diff --git "a/deduped/dedup_0001.jsonl" "b/deduped/dedup_0001.jsonl"
deleted file mode 100644--- "a/deduped/dedup_0001.jsonl"
+++ /dev/null
@@ -1,40 +0,0 @@
-{"text": "Major histocompatibility class I molecules display tens of thousands of peptides on the cell surface for immune surveillance by T cells. The peptide repertoire represents virtually all cellular translation products, and can thus reveal a foreign presence inside the cell. These peptides are derived from not only conventional but also cryptic translational reading frames, including some without conventional AUG codons. To define the mechanism that generates these cryptic peptides, we used T cells as probes to analyze the peptides generated in transfected cells. We found that when CUG acts as an alternate initiation codon, it can be decoded as leucine rather than the expected methionine residue. The leucine start does not depend on an internal ribosome entry site–like mRNA structure, and its efficiency is enhanced by the Kozak nucleotide context. Furthermore, ribosomes scan 5′ to 3′ specifically for the CUG initiation codon in a eukaryotic translation initiation factor 2–independent manner. Because eukaryotic translation initiation factor 2 is frequently targeted to inhibit protein synthesis, this novel translation mechanism allows stressed cells to display antigenic peptides. This initiation mechanism could also be used at non-AUG initiation codons often found in viral transcripts as well as in a growing list of cellular genes. Proteins have been identified for which a unique translational machinery makes use of unconventional start codons Immune surveillance by cytotoxic T cells (CTLs) is a key mechanism for detecting and eliminating abnormal cells. These include cells infected with viruses or bacteria, and those that have suffered tumorigenic transformations . The antThe antigen-presenting cells (APCs), which include almost all nucleated cells, are also very efficient in generating peptides for display by MHC class I . In factiMet, which is specific for AUG and is always charged with the methionine residue -TFNYRNL peptide (the initiation codon is in parentheses and the remaining amino acids are in single-letter code) . AlthougRNAiMet . In the d by CAA . Becaused by CAA . TherefoTo address this question, we identified the first amino acid of CUG-initiated peptides that were presented by MHC class I molecules and thus detectable by appropriate T cells. In this assay, we cotransfected cells with cDNA constructs encoding the peptide as well as the MHC molecule that binds and presents the peptide on the cell surface. Binding to the MHC protects the initiation residue from being removed by cellular proteases, which can trim antigenic peptides in the cytoplasm or the endoplasmic reticulum . We thenb MHC molecule and the *(CTG)-TFNYRNL* peptide ([CTG]YL8). We refer to this as the xYL8 model. We placed the peptide in three different contexts: first, in the pcDNA1 vector; second, upstream of the IRES in the pIRES2-eGFP vector; and, finally, in the 5′ UTR of green fluorescent protein (GFP) in the pcDNA1 vector. The peptides translated in the transfected cells were extracted and fractionated by HPLC. Each fraction was tested for the presence of the leucine-initiated LTFNYRNL (LYL8) peptide and the methionine-initiated MTFNYRNL (MYL8) peptide using BCZ103 T cells and Kb-expressing L cells (a fibroblast cell line) as APCs. With each construct we found a single peak of antigenic activity that eluted in the same fraction as the synthetic LYL8 peptide (To determine if decoding of the CUG initiation codon as leucine was influenced by 5′ or 3′ untranslated regions (UTRs) of the mRNA, we transfected COS-7 cells with cDNA encoding the K peptide A–1C. In  peptide A and 1D.b MHC class I molecule that satisfied the conditions required for our assay: that an MHC molecule present the peptide, that HPLC allow distinction between the leucine- and methionine-initiated forms, and that a T cell cross-react with the peptides with leucine or methionine residues at the first position. When COS-7 cells were transfected with cDNA constructs encoding the Db MHC molecule and the *(CTG)-SNEN-METM peptide derived from the influenza nucleoprotein, only the leucine-initiated LM9 peptide was detected in the HPLC-fractionated cell extracts  and read through the stop codon before the CTG initiation codon in the LYL8 coding sequence. We showed that increasing the number of stop codons upstream of CTG from one to six had no effect on LYL8 expression, and that substituting the CTG codon with other leucine-encoding triplets essentially ablated peptide expression . We asse complex B and the complex C. T cell complex C. To con complex D. Again,We also considered the possibility that leucine was used as the first amino acid because of an RNA modification that introduced an AUG immediately upstream of the peptide-coding sequence. However, the experiments below show that the 5′ UTR influences the leucine start because it is affected by the Kozak context, by the presence of an upstream hairpin, and by the presence of upstream initiation codons. Together, these findings demonstrate that the mRNA remained intact.GCCACCAUGG is optimal, and that the nucleotides at positions –3 and +4 are the most influential, while the nucleotide at the –6 position exerts a smaller effect. Changing these nucleotides can change protein expression by 20-fold SEL8* into the pcDNAI vector, where N represents the degenerate nucleotides flanking the CTG initiation codon for the SLVELTSL (SEL8) peptide presented by the Kb MHC molecule to bm1BZ19.4 T cells SEL8* stimulated the T cells, demonstrating that initiation activity was restricted to the CTG codon  for the AUG start and extends earlier findings that showed that an A at +5 and U at +6 can also enhance initiation at the CUG codon YL8 model, in which the predominant T cell-stimulating activity is the leucine-initiated LYL8 peptide see A–1C. At b MHC cDNA. After 2 d the transfected cells were assayed for their ability to stimulate the BCZ103 T cell. Cells expressing the LYL8 peptide with its CTG initiation codon in the “Excellent Kozak” context  were superior to those with the CTG codon in a “Poor Kozak” context  in stimulating the T cell response  T cells A and 6B. T cells .3CTG. When the transfected cells were used directly to stimulate T cells, the upstream ATGs had little effect (We then transfected cells with a construct encoding (CTG)YL8 and another encoding (CTG)YL8 with three ATGs upstream of and out of frame with the peptide (ATG)e effect C. Howevee effect D. Thus, 3CTG. When the transfected cells were used directly to stimulate T cells, we saw a small but consistent inhibition YL8 with three CTGs upstream of and out of frame with the peptide (CTG)hibition E. Remarkhibition F. The obNote, however, that the upstream CUGs, despite an “Excellent Kozak” context, inhibited the leucine start weakly. This effect contrasts with the inhibition caused by the upstream AUGs on the AUG/methionine or the CUG/methionine starts and suggests that other features are required for an efficient CUG/leucine start. Interestingly, one form of the ASCT2 amino acid transporter is initiated with multiple CUG and GUG codons in close proximity . This reiMet onto the 40S ribosome. Cells target eIF2 by phosphorylating its α subunit (eIF2α) to inhibit protein synthesis in response to a number of stress signals, including viral infection, starvation, and the accumulation of unfolded proteins. Ribosomes release eIF2-guanosine diphosphate (GDP) after the AUG initiation codon is reached, and GDP is exchanged for guanosine triphosphate (GTP) with the assistance of another protein, eIF2B, before eIF2 can be used for another round of translation initiation. When eIF2α is phosphorylated, it binds eIF2B with unusually high affinity and thus prevents subsequent nucleotide exchange. Because eIF2B is limiting in the cell, phosphorylation of only a fraction of eIF2α can substantially inhibit translation globally , which is responsible for loading the RNAglobally .To approach this question, we transfected HeLa cells with (CTG)YL8 or (ATG)YL8 constructs. We then assayed peptide expression in cells that had or had not been treated to induce phosphorylation of eIF2α. It was a challenge to induce phosphorylation of eIF2α for long enough to see an effect on peptide expression without causing substantial toxicity. Furthermore, we could not disrupt peptide/MHC assembly in the endoplasmic reticulum, a requirement that ruled out standard reagents such as dithiothreitol, thapsigargin, and tunicamycin. We also did not want to inhibit peptide elongation, which ruled out amino acid starvation.The optimal treatment for our purposes was sodium arsenite (NaAs). Arsenite reacts with sulfhydryl groups and causes phosphorylation of eIF2α presumably by inducing an unfolded protein response, although the precise mechanism remains unknown . We tranWe assayed the HeLa cells for peptide expression using the BCZ103 T cell hybridoma B. We fouThe effect of eIF2α phosphorylation on the leucine start strikingly mirrors the effect of eIF2α phosphorylation on proteins whose synthesis is directed by the CPV-IRES, which does not require eIF2 . IntriguThe CPV-IRESs are to date the only known sequences that allow eIF2-independent initiation in eukaryotic cells. Viruses employ a host of creative strategies to prevent phosphorylation of eIF2α . InitiatIn summary, we found that when CUG acts as an alternate initiation codon, it can be decoded as leucine as well as methionine. The leucine start does not depend on mRNA structure or sequence, but its efficiency can be enhanced by the Kozak context. A set of ribosomes is scanning 5′ to 3′ specifically for the CUG initiation codon. While the methionine start is inhibited when cells are treated with NaAs, the leucine start is enhanced, suggesting that leucine initiation is independent of eIF2. This novel translation initiation mechanism provides cells not only antigenic peptides but also a potential tool for translational control.–, COS-7, Kb+B7.2+ L, Db+B7.2+ L, BCZ103, 30NX/B10Z, and DBFZ cells have been described . HeLa cells were obtained from ATCC , and cultured in Eagle's minimal essential medium modified with Earle's balanced salt solution, nonessential amino acids, 2 mM L-glutamine, 1 mM sodium pyruvate, 1500 mg/l sodium bicarbonate (ATCC #30–2003), 10% fetal bovine serum, and 10 μg/ml ciprofloxacin.Lmtkescribed . Cell liSequences for constructs depicted in Sequences for constructs depicted in Sequences for constructs depicted in Sequences for constructs depicted in Sequences for constructs depicted in 3ATG-YL8 in the BstXI/XbaI sites of the pcDNA1 vector,5′-TGTGAACCCAGGGTCGACCCAGGACCCAGGTAGTCGACCATGACCTTCAACTACCGGAATCTCTAG-3′; and ATG3ATG-YL8 in the BstXI/XbaI sites of the pcDNA1 vector,5′-TGTGAACCATGGGTCGACCATGGACCATGGTAGTCGACCATGACCTTCAACTACCGGAATCTCTAG-3′.Sequences for constructs depicted in 3CTG-YL8 in the BstXI/XbaI sites of the pcDNA1 vector,5′-TGTGAACCCAGGGTCGACCCAGGACCCAGGTAGTCGACCCTGACCTTCAACTACCGGAATCTCTAG-3′; and ATG3CTG-YL8 in the BstXI/XbaI sites of the pcDNA1 vector,5′-TGTGAACCATGGGTCGACCATGCACCATGGTAGTCGACCCTGACCTTCAACTACCGGAATCTCTAG-3′.Sequences for constructs depicted in 3CTG-YL8 in the HindIII/XbaI sites of the pcDNA1 vector mutated to alter the two CTGs in the 5′ UTR to CAG,5′-AGCTACAAACAGGATTACAAACAGGATTACAAACAGGATTACAAACAGGATTACAAACAGGATTACAAACAGGATTACAAACAGGATTACAAACAGGATTACAAACAGGATTTAGAAACTGACCTTCAACTACCGGAATCTCTAG-3′; and CTG3CTG-YL8 in the HindIII/XbaI sites of the pcDNA1 vector mutated to alter the two CTGs in the 5′ UTR to CAG,5′-AGCTACAAACAGGATTACAAACAGGATTACAAACAGGATTACAAACAGGATTACAAACAGGATTACAAACAGGATTACAAACTGGATTACAAACTGGATTACAAACTGGATTTAGAAACTGACCTTCAACTACCGGAATCTCTAG-3′Sequences for constructs depicted in 3CTG-YL8 in the HindIII/XbaI sites of the pcDNA1 vector,5′-AGCTACAAACAGGNTTACAAACAGGATTACAAACAGGATTACAAACAGGATTACAAACAGGATTACAAACAGGATTACAAACAGGATTACAAACAGGATTACAAACAGGATTTAGAAACTGACCTTCAACTACCGGAATCTCTAG-3′; and CTG3CTG-YL8 in the HindIII/XbaI sites of the pcDNA1 vector,5′-AGCTACAAACAGGATTACAAACAGGATTACAAACAGGATTACAAACAGGATTACAAACAGGATTACAAACAGGATTACAAACTGGATTACAAACTGGATTACAAACTGGATTTAGAAACTGACCTTCAACTACCGGAATCTCTAG-3′.Sequences for constructs depicted in Sequences for constructs depicted in – or COS-7 cells were transfected in 96-well plates (1 × 104 cells per well) with the indicated concentration of plasmid DNA, 0.1 mg/ml DEAE-dextran, 0.1 mM chloroquine, 10 ng/ml MHC class I cDNA, 5 ng/ml B7.2 cDNA, and 10% NuSerum  in RPMI 1640. After 90 min, the cells were shocked with 10% DMSO in PBS for 2 min. After 2 d incubation in normal medium, T cells (1 × 105 cells per well) were added to assay peptide expression. GeneJuice  transfection reagent was used in The DEAE-dextran transfection method was used in 5 cells) were incubated with APCs in 96-well plates for 6–24 h. The response, accumulation of intracellular β-galactosidase, was measured with the substrate chlorophenol red-β-D-galactopyranoside (CPRG). The product was measured with a 96-well plate reader at 595 nm and 655 nm as the reference wavelength.The T cell assay has been described previously . Briefly4 per well) and T cell hybridomas (1 × 105 cells per well).The HPLC assay has been described previously . BrieflyCells were transfected with GeneJuice (Novagen) as described above, but the transfection medium was left on for only 4 h before the cells were lifted and split into multiple dishes with fresh medium. Cells were allowed to rest for 12 h before sodium arsenite treatment. They were treated with 50 μM NaAs , 1× GolgiPlug containing brefeldin A , or left untreated for 4 h. The cells were then lifted and counted. For the T cell assay, they were titrated in a 96-well plate. The assay was as described above, except that 1× GolgiPlug was added in order to “freeze” the cells in their state at the end of treatment. For the Western blot, they were incubated on ice for 5–10 min in lysis buffer . The lysate was spun for 15 min at 4 °C, and the supernatant was transferred to a tube containing an equal volume of 2× SDS-PAGE sample buffer . The sample was then heated in water just off the boil for 5 min, separated on a 10% SDS-PAGE gel, and transferred to a nitrocellulose membrane. The membrane was blocked for 1 h at room temperature in TBS–0.1% Tween 20–5% bovine serum albumin , incubated for 1 h with primary antibody  in TBS–0.1% Tween 20–5% bovine serum albumin, washed four times for 5 min with TBS–0.1% Tween 20, incubated for 40 min with secondary antibody , washed four times for 5 min with TBS–0.1% Tween 20, incubated for 5 min in substrate , and exposed to film. An antibody to α-tubulin  was used as a loading control."}
-{"text": "In the spirit of good health, cells are constantly subjecting their protein contents to immunological surveillance by cytotoxic (killer) T cells. Tens of thousands of major histocompatibility complex (MHC) class I molecules cradle peptides (bits of proteins) on cell surfaces, and T cells detect any suspicious peptides with extreme sensitivity. If a cell is infected with a virus, peptides created from viral DNA will end up on the cell's surface as antigens, triggering immunological red flags.Most—but not all—of the peptides presented by MHC class I molecules are created by conventional cellular mechanisms: with the help of a ribosome, three mRNA nucleotides (a codon) are decoded into a corresponding amino acid, which is strung as the next link on an elongating peptide. Most peptides begin with the amino acid methionine, coded by the mRNA nucleotide triplet A-U-G (AUG). But some peptides are “cryptic,” arising from normally untranslated regions of mRNA or initiated with codons other than AUG.not begin with methionine.Previous studies suggested that an unconventional translation mechanism creates some cryptic peptides. But how? And why? Only one type of translation initiator, transfer RNA (tRNA), specific for AUG and loaded with a methionine molecule, is known. Protein synthesis beginning at alternate codons has been attributed to imprecise pairing between the methionine translation initiator and mRNA. This, however, does not explain proteins that do Only two mechanisms for building non-methionine-initiated peptides have been discovered. In a new study, Susan R. Schwab et al. characterize one of them, the CUG-initiated translation of a peptide starting with leucine instead of methionine.The authors explored cellular translation by engineering cells to create peptides of interest and present them through matching MHC molecules on the cells' surfaces. Then, by harnessing the exquisite sensitivity of T cells to probe for antigens on MHC molecules, they could identify which peptides were created under different experimental conditions.Their findings point to a unique translation mechanism. In the other known example of a non-methionine-initiated peptide, translation beginning at GCU or CAA is guided by a specific folded structure of mRNA nucleotides called the internal ribosome entry site. Schwab et al. have found that no similar structure is necessary for CUG-initiated translation. However, similar to the standard mechanism of AUG initiation, they found that ribosomes do scan for CUG. Additionally, the presence of a specific ribosome-binding sequence in mRNA (the “Kozak context”) near a CUG site can enhance the efficiency of initiation there.Schwab et al. have also suggested a possible purpose for this translation mechanism. Under stress, cells can down-regulate conventional translation, which curbs the production of viral proteins in the event of an infection but also suppresses the creation of antigens needed to flag down T cells for an immune response. Here, Schwab et al. report that peptides starting with leucine were produced in the absence of the protein eIF2, which normally aids in AUG-initiated peptide synthesis. Cells under stress slow conventional translation by restraining the function of eIF2. Therefore, CUG-initiated translation, which works without eIF2, might provide an out for stressed cells needing to create peptides. This alternative could be a great way to avoid pumping out viral proteins and still create antigens for T cell surveillance—unless, of course, viruses take advantage of the loophole for their own peptide production."}
-{"text": "Tumorigenesis is a multi-step process in which normal cells transform into malignant tumors following the accumulation of genetic mutations that enable them to evade the growth control checkpoints that would normally suppress their growth or result in apoptosis. It is therefore important to identify those combinations of mutations that collaborate in cancer development and progression. DNA copy number alterations (CNAs) are one of the ways in which cancer genes are deregulated in tumor cells. We hypothesized that synergistic interactions between cancer genes might be identified by looking for regions of co-occurring gain and/or loss. To this end we developed a scoring framework to separate truly co-occurring aberrations from passenger mutations and dominant single signals present in the data. The resulting regions of high co-occurrence can be investigated for between-region functional interactions. Analysis of high-resolution DNA copy number data from a panel of 95 hematological tumor cell lines correctly identified co-occurring recombinations at the T-cell receptor and immunoglobulin loci in T- and B-cell malignancies, respectively, showing that we can recover truly co-occurring genomic alterations. In addition, our analysis revealed networks of co-occurring genomic losses and gains that are enriched for cancer genes. These networks are also highly enriched for functional relationships between genes. We further examine sub-networks of these networks, core networks, which contain many known cancer genes. The core network for co-occurring DNA losses we find seems to be independent of the canonical cancer genes within the network. Our findings suggest that large-scale, low-intensity copy number alterations may be an important feature of cancer development or maintenance by affecting gene dosage of a large interconnected network of functionally related genes. It is generally accepted that a normal cell has to acquire multiple mutations in order to become a malignant tumor cell. Considerable effort has been invested in finding single genes involved in tumor initiation and progression, but relatively little is known about the constellations of cancer genes that effectively collaborate in oncogenesis. In this study we focus on the identification of co-occurring DNA copy number alterations  in a series of tumor samples. We describe an analysis method to identify DNA copy number mutations that specifically occur together by examining every possible pair of positions on the genome. We analyze a dataset of hematopoietic tumor cell lines, in which we define a network of specific DNA copy number mutations. The regions in this network contain several well-studied cancer related genes. Upon further investigation we find that the regions of DNA copy number alteration also contain large networks of functionally related genes that have not previously been linked to cancer formation. This might illuminate a novel role for these recurrent DNA copy number mutations in hematopoietic malignancies. PIK3CA and KRAS genes was observed Tumor development is generally thought to be a process in which healthy cells transform into malignant tumor cells through the step-wise acquisition of oncogenic alterations Besides single basepair mutations or retroviral integrations, the activity of genes can also be perturbed by DNA copy number alterations that arise as a result of genomic instability, which is frequently observed in tumor cells n) DNA is performed on oligonucleotide- or Bacterial Artificial Chromosome (BAC) based microarray platforms. For each probe on the microarray, the ratio of signal intensities of tumor versus normal DNA is a measure of the relative DNA copy number of the corresponding genomic region in the tumor sample. Platforms designed to identify single nucleotide polymorphisms (SNPs) can also infer CNAs by comparing the raw probe intensity values measured in a tumor sample with a reference sample.DNA copy number alterations (CNAs) may be measured on microarray platforms In order to extract those DNA copy number aberrations that preferentially occur together, we developed an analysis framework. The basic premise of our analysis is to define a pair-wise score for any given pair of genomic locations present in the dataset. This scoring index will only be high if both genomic locations are recurrently aberrated in multiple independent samples within the tumor panel, and if they co-vary similarly over the different samples . Using aThe raw data consist of non-discrete measurements of the average DNA copy number of the population of cells present in the measured sample. The signal consists of a measurement of a heterogeneous population of tumor cells, which may contain many populations potentially carrying different mutations and copy number alterations, as well as normal (diploid) cells. To reduce heterogeneity as much as possible we choose to analyze a collection of hematopoietic tumor cell lines, which on a per-sample basis can be considered clonal. There were several other reasons for analyzing this particular dataset. First, it is a high resolution dataset of well-characterized, clinically relevant samples. Although these samples are cell lines, they are widely used as a model system for the diseases from which they have been derived. Second, this collection of samples includes cell lines derived from T- and B-cell leukemias carrying rearranged T-cell receptor and immunoglobulin loci, respectively. We therefore should be able to separate these two distinct lymphoid malignancies based on co-occurring DNA copy number losses at the T-cell receptor and immunoglobulin loci. During T- and B-cell development, these loci undergo DNA recombination and gene deletion in a process known as V(D)J-recombination. The human genome contains three specific T-cell receptor loci  on two different chromosomes that determine their variability. B-cells have three different loci  on three different chromosomes that undergo recombination to generate a diverse repertoire of immunoglobulins. Since T- and B-cells only undergo recombination of their respective loci after lineage commitment, it is unlikely that T-cell receptor loci are recombined in B-cells and vice-versa. If our approach is successful at finding co-occurring losses, it should identify the co-occurring rearrangements at the T-cell receptor alpha/delta and beta/gamma loci in T-cell leukemias. Similarly, we should be able to pick up co-occurring losses at the IgG kappa, lambda and heavy chain loci in B-cell malignancies.A classic example of finding associations in a large (binary) dataset is association rule mining. Identification of cooperating events in continuous data requires a different approach than binary association rule mining. First we developed a method to score for co-occurrence between two continuous measurements . We thenDNA copy number measurements at two different genomic loci can be visualized in a 2D space, with each axis representing measurements at a certain genomic locus. A point in this space represents a sample in which both loci were measured. We use the covariance of the two measurements to score for co-occurring loci. This score only rewards a high value to a truly co-occurring and co-varying pairs of measurements .For thisσ parameter of the Gaussian function used to convolve the score matrix  we expected to retrieve these co-occurring losses in the small (2 Mb) scale analyses. Since we disregarded co-occurrences on the same chromosome we expected to find five co-occurring losses. Indeed, four of the five expected co-occurring losses are present in the top 50 peaks of the Scale 2 analyses . Figure While the recovery of the V(D)J-related recombination loci as co-occurring losses serves as a positive control for our analysis approach, we are mainly interested in identifying cooperating genes or regions that might play a role in cancer. To see whether the locations we recover are linked to this disease, we analyzed whether the co-occurring genomic loci are enriched for genes known to play a role in cancer. As a reference gene set we used the Cancer Gene Census list While finding enrichment for cancer genes is an encouraging result, this does not explain the possible cooperation between two loci. We expect that the co-occurring loss of two regions points to a functional relationship between the constituents of the genomic loci. A co-occurrence between two genomic regions can point to many different kinds of interactions between the genes residing in both regions, e.g. biochemical interactions of the protein products or functional collaboration of two cancer genes in tumorigenesis. We therefore decided to employ interaction data to shed further light on the genes present in the co-occurring regions. We translated the co-occurring pairs of genomic loci to pairs of gene sets, and we investigated the functional relationships of their protein products using the STRING database In order to keep control of the complexity, we considered in our co-occurrence analysis only radially symmetric kernels, i.e. Gaussian kernels with diagonal, equal variance covariance matrices. This implies that asymmetric co-occurring regions – where a small locus co-occurs with a large locus – will not be optimally detected. Since an asymmetric co-occurring region typically consists of a series of symmetric co-occurring regions detected on a smaller scale (just like a rectangle can be constructed from a collection of squares), we set out to construct larger co-occurring regions from the results of the smaller scales using a hierarchical clustering approach. For details see Supplemental 8). This resulted in a 1000×1000 distance matrix. On this distance matrix we performed single linkage hierarchical clustering. The resulting dendrogram was cut at 1 * 107 bp (5 kernel widths). The resulting clusters are unique genomic loci and were represented as nodes in a graph. Clusters were then linked if a co-occurrence was found between individual loci of different clusters. These links are represented as edges in a graph. The result of the clustering analysis is shown in Briefly, we collected the loci involved in the top 500 co-occurrences of the Scale 2 analysis. This resulted in 1000 genomic loci. For each pair of loci, we calculated the genomic distance in base pairs. The distance between two loci on different chromosome arms was set to a default high value  , the MAPK pathway suppressor GPS2, the nuclear co-activator (and known tumor-suppressor) p300 and a gene of unknown function, CBFA2T3. All interactions found are based on physical binding and co-occurrence in Pubmed abstracts.We investigated the remaining 113 interactors for any interesting interactions that might be a target of this collection of co-occurring losses. Within the total network of interactors we found a sub-network centered on the nuclear co-repressor  (TRAC1) . This inTrp53 or p19-ARF deficient mice Cbfa2t3 is shown in Cbfa2t3 was not flagged as a common integration site, several viral integrations near this gene were found. Remarkably, two individual tumors harbored a bi-allelic integration near the transcription start site of Cbfa2t3, suggesting functional inactivation of this candidate tumor suppressor gene. Indeed, bi-allelic integration is thought to be a hallmark of tumor suppressor genes in IM screens To see whether we could find more information regarding the putative tumor suppressor function of the different interactors, we tested if we could corroborate our findings with data from a large retroviral insertional mutagenesis (IM) screen where hematopoietic tumors were induced through Murine Leukemia virus (MuLV) infection of wild-type mice or Given that we find this sub-network of interactors in a co-occurring network of DNA copy number losses and the recovery of inactivating insertions in a retroviral IM screen, we conclude that this network might be a putative tumor suppressor network.In this study we present a genome-wide analysis for finding collaborating DNA copy number changes on different chromosomes. Using our 2D kernel convolution framework we can score and find co-occurring DNA copy number changes in a high quality, high resolution aCGH dataset. Using a dataset of hematological cell lines we are able to recover DNA copy number alterations specific to the cell lineage of the samples. Furthermore we uncover cancer-related networks of co-occurring DNA copy number changes.Several studies have investigated concerted copy number changes in aCGH data. In studies on lung cancer n results, residing in the extremes of the results distribution, thus minimizing the chance of including false positives. The top n lists allowed us to generate workable results which we have validated extensively with other sources of evidence.The output of our analysis does not include a measure of significance. Constructing a background distribution based on permutations of the DNA copy number data would mean re-running our analysis thousands of times, a task which remains computationally infeasible at this stage. Furthermore, the multiple-testing problem would have to be properly addressed, given that the number of tests is the square of the number of grid points in the 2D space. Due to the complexity of the analysis procedure (minimum operation and kernel smoothing) the definition of an analytical null distribution has remained elusive. Therefore, we have chosen to work with top While we were able to use a distributed computing solution for our analysis, we were fortunate to have the required computational architecture at our disposal. Since the problem basically consists of repeating the same action many times it could be well-suited to software optimization or a hardware based solution where the most time-consuming actions are handled by a dedicated processing unit.When looking for areas in the 2D pair-wise space highly enriched for co-occurrence scores we convolve this space with a 2D-Gaussian kernel. The sigma parameter of this function is a representation of the size of the aberrations we expect to recover. Currently we make the implicit assumption that the co-occurring aberrations have the same size by using a symmetric kernel for the convolution. This could be relieved by allowing for an asymmetrical (ellipsoid) Gaussian kernel for all combinations of scales used. Clearly, this comes at the cost of increased computational complexity. Here we resolve this issue by concatenation of the results obtained in a small scale. In this way we can recover co-occurring losses of different sizes that give a better enrichment for functional interactions when combined with the single peaks obtained in a higher scale analysis.In our analysis of a set of cell lines derived from hematological malignancies we found enrichment of cancer related genes and functional interactions in co-occurring DNA copy number changes. Our results suggest that tumorigenesis requires elimination of multiple gatekeeper genes and gain of multiple oncogenes as demonstrated by the presence of many functional interactions between the loci in the gain-gain and loss-loss core networks.Haploinsufficiency is a well known characteristic of several tumor suppressor genes, where simple reduction of gene dosage by loss of gene copies at the DNA level can already promote oncogenic transformation TP53 gene, often thought to be the single target of this deletion TP53 is no doubt an important target of the DNA copy number loss, our analysis indicates that the concomitant loss of other genes near TP53, as well as co-occurring losses on the other genomic loci may together account for the full tumorigenic effect.We show that the 17p loss and its co-lost regions are highly enriched for functional relationships, which are not fully explained by the presence of the Loss of the loci on 17p, 9p, 9q, 13q, 16q and 22q has been reported previously for several types of hematological malignancies represented in our dataset TP53, RB1 and CDKN2A (INK4a/ARF). We found one sub-network of genes around NCOR1 which might be an example of other tumor suppressor genes that are affected by the concerted loss of these genomic loci.Not all of the gene-gene interactions defined by the 17p network involve the well-known canonical cancer genes NCOR1, is a well-known transcriptional co-repressor that associates in a ligand-independent manner with nuclear receptors SMRT, for recruitment of HDAC proteins to the DNA to induce transcriptional silencing. Its role in cancer is not well-established. NCOR1 null mice die in early embryogenesis NCOR1 is known to increase proliferation in hepatocytes NCOR1 decreases AKT phosphorylation, thus countering its pro-survival signal NCOR1 - might increase proliferation and promote survival.The hub of this interaction network, NCOR1 and its partner genes  have been based on co-occurrence in PubMed abstract and true physical binding CBFA2T3 is a close relative of ETO, which is a target of the recurrent AML1-ETO translocation that occurs in acute myeloid leukemia. It has been shown that the fusion gene AML1-ETO actually interferes with the CBFA2T3-NCOR1 interaction, and that its oncogenic effect derives from that inhibition Cbfa2t3 is recurrently targeted by bi-allelic retroviral integrations, which are predicted to cause functional inactivation of Cbfa2t3PPARA is a member of the Peroxisome proliferator-activated receptors, and has been implicated in hepatocellular carcinoma development in rodents PPARG, exhibit a tumor suppressor-like phenotype, it is possible that PPARA can act as a tumor suppressor in hematological malignancies. GPS2 is a known suppressor of JNK signaling MAP kinase signaling pathway. Deregulation of this pathway is a well-known phenomenon in cancer NCOR1 and the known tumor suppressor p300, our data suggest a selective advantage for loss of multiple constituents that interact with NCOR1 since they all may have tumor suppressor-like activities.All interactions between BRCA1/2-related breast cancer.Many studies focus on a single hematological malignancy in which a single combination of aberrations might be important NCOR1 that may be a novel network of tumor suppressor genes that are affected by the observed co-occurring losses. The observation that DNA copy number changes may affect gene dosage of larger numbers of cancer-relevant genes deviates from the classical view where mutations in a few (5–7) cancer genes lead to tumor development. Our data support the notion of cancer-related networks or pathways, where multiple collaborating genes are deregulated simultaneously to induce oncogenesis. Such a network view of oncogenesis is an important step towards developing effective drug targets because it increases the number of potential targets. However, this view also implies that multiple molecules need to be targeted simultaneously in order to achieve optimal therapy response and to reduce the risk of therapy resistance.We have developed a method for genome-wide analysis of collaborating DNA copy number changes and their corresponding networks. Using this approach we have identified a loss-loss network centered around a region on human chromosome 17p. This network is highly enriched for functional relationships and hints at a more complex system of tumor suppression in which many different genes are affected simultaneously to induce cancer. We show one example of a sub-network around the nuclear co-repressor Datasets consisting of array-based copy number measurements are continuously increasing in size. If probe level interactions are evaluated, the analysis space is of dimensionality Let the aCGH profile of the Negative and positive log2 values respectively denote loss or gain of DNA in the test sample versus the reference sample. We regard both situations separately, which prevents the negative and positive values cancelling each other through summation later in the algorithm. We separate gains and losses by only retaining grid positions with positive values for the gains or negative values for the losses. The absolute values of the separated matrices are then used in the downstream steps. The remaining grid positions are set to zero. More specifically, the gains matrix, The first component of the co-occurrence score is the continuous variant of the AND Boolean logic function: the minimum operation. For two grid points, Since we believe the co-occurrence score to be a smooth variable, and since neighboring co-occurrence values can therefore be employed to reduce the noise locally, we convolve the co-occurrence score matrix with an isotropic 2D Gaussian kernel function. In practice this implies sampling the 2D Gaussian kernel function on a square grid consisting of With 39 unique chromosome arms in the human genome (disregarding the p-arms of the acrocentric chromosomes and the sex chromosomes), three different scales and 4 triangular pair-wise matrices to evaluate  we compute 8892 different CCMs. To solve this problem computationally we used a large distributed computing cluster. Our choice of resolution of the genomic grid was bounded by the memory present on the nodes. We set th peak represents two co-occurring loci, For each CCM we determine the top N peaks for each combination of gains and losses. The nhttp://www.sanger.ac.uk/genetics/CGP/Census/). The reference list of all genes was retrieved from the Ensembl website, with a filter to keep only genes with bio-type = ‘protein_coding’. This left 18840 genes. All CGC genes that could not be mapped back to the reference gene set were excluded. The CGC genes that were annotated as ‘recessive’ were used as the tumor-suppressor genes and ‘dominant’ as oncogenes. Enrichment for all CGC genes, the tumor-suppressor subgroup and the oncogene subgroup in the gene sets determined by the co-occurrence analysis was calculated using a Fisher's exact test.The list of CGC genes was obtained from the CGC website . Clusters are represented as nodes in a graph. Edges between nodes are drawn if any co-occurrence relationship is found between loci present in the nodes.For all pairs of co-occurring loci, http://www.sanger.ac.uk/genetics/CGP/CellLines/). A list of the cell lines included in this dataset can be found in The case we subjected to analysis was a dataset containing 105 cell-lines derived from hematological origin. The aCGH measurements were done on 1.8 million probe Affymetrix SNP 6.0 arrays. After data pre-processing we were left with 95 samples. These cell lines are a subset of the Cancer Genome Project cancer cell line project Click here for additional data file.Dataset S1This file contains information about the cell lines used in this study.(0.03 MB XLS)Click here for additional data file."}
-{"text": "It is not uncommon for a pharmaceutical company to develop several new drugs simultaneously for the same indication. In a small population it may be infeasible to try all new drugs concurrently. A practical approach is to consider one at a time and if the drug is recommended for a phase III trial to temporarily suspend development of other drugs.We propose a development plan that encompasses phase II and III trials, considering a series of sequential phase II trials with interim decision-making. At each stage of a phase II trial, a decision is made whether to continue with participant recruitment to the current trial, stop the current trial and recommend the drug to be tried in a phase III trial, stop the current trial and initiate a new phase II trial with a different drug or stop the current trial and abandon the development.The unknown treatment effect for each drug is assumed to follow a prior distribution. In addition, as drugs are intended for the same population it is not unrealistic to consider treatment effects to be correlated, so that the prior distribution will reflect this. As data are observed from preceding and current trials, prior densities for subsequent drugs are updated, informing us of the performance of the groups of drugs under evaluation. The application of the design is illustrated in the setting of severe arthritis of the hip trials."}
-{"text": "Salmonella serotypes in the environment.Cats can shed antimicrobial drug−resistant  Salmonella to humans, we evaluated the excretion of Salmonella by pet cats. Rectal-swab specimens were taken from 278 healthy house cats, from 58 cats that died of disease, and from 35 group-housed cats. Group-housed cats were kept in one room with three cat trays and a common water and feed tray. Eighteen (51.4%) of 35 group-housed cats, 5 (8.6%) of 58 diseased cats (5/58), and 1 (0.36%) of 278 healthy house cats excreted Salmonella. Salmonella isolates were of serotypes Typhimurium, Enteritidis, Bovismorbificans and 4:i:-. Acquired antimicrobial resistance was found in serotype Typhimurium  and 4:i:- strains . Cats that excrete Salmonella can pose a public health hazard to people who are highly susceptible to Salmonella, such as children, the elderly, and immunocompromised persons.To determine whether cats were a risk for transmission of  Salmonella infections are still a leading cause of human foodborne infections in the world , which came from one owner. Finally, rectal samples of 35 kittens  were taken at a facility where the animals were group-housed, waiting to be adopted. These animals came from 16 different owners.Bacteriologic analysis was performed by enrichment of the rectal swabs. The samples were first pre-enriched in buffered peptone water (BPW)  overnight at 37°C, after which 1 mL of this suspension was added to 9 mL of tetrathionate brilliant green broth (Oxoid) (enrichment). After incubation overnight at 37°C, a drop of this suspension was spread on brilliant green agar (BGA) (Oxoid). Both the serotype and phage type of positive isolates were determined.Salmonella enterica serovar Typhimurium 8420 (resistance type ACSSuT), 6237 (sensitive), 3520 (resistance type T), 2200 (resistance type ASSuT), and 5833 (sensitive) isolates from human patients in Belgium were used as control strains in antimicrobial susceptibility testing.Resistance to antimicrobial agents was tested by using the disk diffusion assay on Mueller-Hinton agar with commercial antimicrobial susceptibility disks (Oxoid) according to the international standards of the National Council for Clinical Laboratory Standards (NCCLS) , according to the manufacturer's instructions. All the resistant strains were tested for the presence of the genes typical for particular resistance. The genes determined and primers used are listed in S. Typhimurium F98 was used as a negative control in all the amplifications. S. Typhimurium strains 8420, 6237, 3520, 2200, and 5833 were used as positive controls.For PCR, a loop of bacterial culture was resuspended in 50 μL of water, and DNA was released from bacterial cells by boiling for 20 min. After the mixture was spun for 1 min in a microfuge at 14,000 x Salmonella strains were tested for the presence of the SopB gene. The primers were GATAGGAAAGATTGAGCACCTCTG and TACAGAGCTTCTATCACTCAGCTTC, and the PCR cycle consisted of 30 cycles of .All XbaI PFGE patterns were determined for all 21 S. Typhimurium strains by using previously described PFGE methods . The Salmonella isolates and the human S. Typhimurium isolates 8420, 6237, 3520, 2200, and 5833 to invade human intestinal epithelial cells was determined. Cells of the human colon carcinoma cell line T84 were seeded in 96-well cell culture plates  at a density of 5.105 cells/mL culture medium  and grown for 24 h. Bacteria were grown for 20 h in LB-medium, after which the suspension was diluted 1:50 in fresh LB-medium. After 4 h of incubation at 37°C, suspensions were centrifuged and resuspended in DMEM with 10% fetal calf serum (FCS). The number of colony-forming units (CFU)/mL was determined by plating 10-fold dilutions on BGA. The suspensions were stored overnight at 4°C. The next day, 106 CFU in 200 μL were added to the T84 cell cultures, which were then centrifuged for 10 min at 1,500 rpm to make close contact between the bacteria and the colon cells. The plates were incubated for 1 h at 37°C and 5% CO2. The cells were then rinsed three times with Hanks' Balanced Salt Solution . Cell culture medium with gentamicin (50 μg/mL) was added, and plates were incubated for 1 h at 37°C and 5% CO2. Hereafter, the cells were rinsed three times with PBS and analyzed with 1% Triton X-100  in distilled water. From this lysate, 10-fold dilution series were made. From each dilution, 6 x 20 μL was added to BGA, to determine the number of CFU Salmonella per mL. The assays were performed in triplicate. The percentage of intracellular bacteria, relative to the number of Salmonella bacteria, initially incubated with the cells, was calculated. The previously mentioned human isolates of S. Typhimurium were used for comparison between the cat isolates and human isolates. Statistical analysis was performed by analysis of variance methods using the SPSS 11.0 software.The capacity of all cat Salmonella strain was isolated, an S. Enteritidis phage type 21 strain, sensitive to all tested antimicrobial drugs. Five strains were isolated from cats that died from or were euthanized because of incurable disease. Feline AIDS (caused by feline immunodeficiency virus [FIV]) was diagnosed in three cats, one died due to feline panleukopenia parvovirus infection, and one was poisoned. Three isolates were identified as being ampicillin-resistant S. Typhimurium phage type 193, harboring the TEMbla gene. They had the same pulsed-field gel electrophoresis (XbaI) pattern, indicating that the isolates were of clonal origin , harboring the TEMbla, cat, sul2, tet(A), and dfrA1 antimicrobial drug–resistance genes. Eighteen strains were isolated from the group-housed cats. All of these were S.Typhimurium phage type 120/ad. Fourteen of these strains showed acquired resistance to ampicillin, chloramphenicol and tetracycline and harbored the TEMbla, cat, and tet(A) antimicrobial drug-resistance genes, while four isolates were resistant to chloramphenicol only and only harbored the cat gene  and the human isolate S. Typhimurium strain 2200, the most invasive, yielding a percentage of invasion of 8% to 10%. The multidrug-resistant cat isolate Salmonella 4:i:- (strain 11) was the least invasive strain, having an invasion percentage of about 0.5%. Invasion percentages of the different isolates are shown in All isolates invaded T84 cells, with the cat isolates of Salmonella strains, healthy house cats are generally safe. Earlier reports regarding isolation of pathogens from healthy cats showed low percentages (mostly around 1%) of Salmonella-positive rectal swabs  of S. Typhimurium 120/ad was isolated, indicates spread of the Salmonella strain between the cats or a common source. The age of these animals may also play a role, since all animals in this group were <4 months. Young animals are more susceptible to Salmonella infection. Also immunodeficiency can result in Salmonella excretion. One outbreak of fatal salmonellosis in cats has been reported after mild immunosuppression induced by live panleukopenia virus vaccination  were resistant to ampicillin, chloramphenicol, and tetracycline. Resistance genes were found to be TEMbla (ampicillin), cat (chloramphenicol), and tet(A) (tetracycline). The genes in the class 1 integron of the multidrug-resistant genomic island in ACSSuT type S. Typhimurium, required for the resistances to the above three mentioned antimicrobial drugs, are PSE1bla, floR, and tet(G) , encoded by TEMbla (ampicillin), cat (chloramphenicol), sul2 (sulfonamides), tet(A) (tetracycline), and dfrA1 (trimethoprim). Also the resistance shown by this example had no relationship to the typical S. Typhimurium DT104 multidrug-resistant genomic island.Since the 1990s, concerns have arisen about the emergence and spread of multidrug-resistant Typhimurium strains, especially the multidrug-resistant ACSSuT type, which is resistant to ampicillin, chloramphenicol, streptomycin, sulfonamides, and tetracycline (Salmonella in the environment. Cats that are sick or are receiving medication resulting in immune deficiencies can potentially pose a threat to public health. Young children, the elderly, and immunocompromised persons are at risk because of their high sensitivity for the infection. All persons should follow good hygiene practices when keeping cats as pets.In conclusion, healthy house cats are generally safe with regard to excretion of"}
-{"text": "Lactococcus lactis subsp. lactis NCDO 2118 is a nondairy lactic acid bacterium, a xylose fermenter, and a gamma-aminobutyric acid (GABA) producer isolated from frozen peas. Here, we report the complete genome sequence of L. lactis NCDO 2118, a strain with probiotic potential activity. Lactococcus lactis NCDO 2118 is a nondairy strain, a xylose fermenter (a common trait of plant-associated strains), and a GABA producer isolated from frozen peas (Lactic acid bacteria (LAB), in general, acquire energy from the conversion of sugars into lactic acid  and are zen peas , 7.L. lactis NCDO 2118 was sequenced three times, due to assembling complexity. First, the genome was decoded with the SOLiD 5500 platform with mate-paired libraries, generating a total of 5,133,057,360 bp, . The reads were subjected to a Phred 20 quality filter using Quality Assessment software . Then manual curation was performed using Artemis . Genome assembly was performed using Mira 3.9 . Assembly was performed with Mira 4.0.1 and Newbler 2.9  to perfoL. lactis NCDO 2118 consists of a single circular chromosome of 2,554,693 bp, containing 2,386 coding sequences (CDS), which had 52 pseudogenes, 66 tRNA genes, and 6 rRNA operons, with a G+C content of 34.9%. There is one plasmid, pNCDO2118 , with 48 CDS, from which 4 are pseudogenes with a G+C content of 32.33%.The complete genome of Lactococcus lactis NCDO 2118 chromosome and the plasmid were deposited at DDBJ/EMBL/GenBank under the accession numbers CP009054 and CP009055, respectively.The"}
-{"text": "Primary care randomised controlled trial of a tailored interactive website for the selfmanagement of respiratory infections (Internet Doctor). BMJ Open 2016;6:e009769. doi:10.1136/bmjopen-2015-009769Little P, Stuart B, Andreou P, There is a labeling mistake in the analysis of this paper. Although the mistake alters the estimates very slightly it does not alter the inferences.“Results 3044 participants were recruited. 852 in the intervention group and 920 in the control group reported one or more RTIs, among whom there a modest increase in NHS Direct contacts in the intervention group (intervention 44/1734 (2.5%) versus control 24/1842 (1.3%); multivariate Risk Ratio (RR) 2.53 ). Conversely reduced contact with doctors occurred (283/1734 (16.3%) vs 368/1845 (20.0%); risk ratio 0.71, 0.53 to 0.95, p=0.019). Reduction in contacts occurred despite slightly longer illness duration  and more days of illness rated moderately bad or worse illness . The estimate of slower symptom resolution in the intervention group was attenuated when controlling for whether individuals had used webpages which advocated ibuprofen use . There was no evidence of increased hospitalisations .”The misunderstanding was that the 24 week follow-up (the last data point) was thought to be 20 weeks, and the real 20 week data was then not included. The most complete use of the data is therefore to include both the 20 and 24 weeks data. If the complete 24 weeks of data is used throughout this means the following changes to the tables: In the Abstract, the Results section should read: Table 2 is the characteristics of those who reported at least one illness and that does not change. The main impact is on the numbers in Table The title of table The corrected Tables are shown below:"}
-{"text": "High performance, cast aluminum automotive wheels are increasingly being incrementally formed via flow forming/metal spinning at elevated temperatures to improve material properties. With a wide array of processing parameters which can affect both the shape attained and resulting material properties, this type of processing is notoriously difficult to commission. A simplified, light-duty version of the process has been designed and implemented for full-size automotive wheels. The apparatus is intended to assist in understanding the deformation mechanisms and the material response to this type of processing. An experimental protocol has been developed to prepare for, and subsequently perform forming trials and is described for as-cast A356 wheel blanks. The thermal profile attained, along with instrumentation details are provided. Similitude with full-scale forming operations which impart significantly more deformation at faster rates is discussed. One of the more challenging metal forming operations currently being practiced in the aerospace and transportation sectors is metal spinning, including derivatives such as shear forming and flow forming1From a processing standpoint, there are a wide range of parameters which can dictate the shape and properties of the manufactured component. Numerous studies have focused on statistical techniques for optimizing various parameters34Cast aluminum alloys are employed in a wide variety of automotive and aerospace applications, with alloy A356 used in automotive wheels. However, this alloy is not suitable for forming at room temperature69Figure 1). This apparatus has been built primarily from a manual, belt-driven capstan lathe with a total output of 22 kW, and a propane torch heating system with a peak output of 82 kW . A mandrel with embedded thermocouples along with a rigid roller assembly  has been installed, which is capable of forming workpieces up to 330 mm in diameter. The mandrel has a manually activated clamping system which is able to account for large changes in workpiece diameter occurring during processing . A battery operated Data Acquisition (DAQ) system containing a miniature wireless computer capable of monitoring the temperature of the mandrel during forming and the blank for characterizing heating has been installed on the quill of the lathe. While other flow forming processes have been synthesized using adapted lathesin situ heating and thermal data acquisition.In order to support development and optimization of flow forming operations for wheel manufacturing, custom forming equipment has been developed at the Department of Materials Engineering at the University of British Columbia  and main working directions and components labelled on a computer-aided design depiction (bottom). Please click here to view a larger version of this figure.Figure 2: Heating system detail. A propane heating system with four discrete burners (top and bottom right) actuated from a central manifold containing a gas control solenoid (top and bottom left). Gas pressure and a discrete flow rate to each of the burners is possible, along with placement along the blank to conform to different geometries. Please click here to view a larger version of this figure.Figure 3:Roller stand assembly detail. The original tool holder on for the lathe has been adapted to hold a roller at arbitrary angles relative to the turning axis of the mandrel via a jam nut assembly. Please click here to view a larger version of this figure.Figure 4:Instrumented mandrel and clamp system overview. The rotary tooling has been designed to bolt directly to the lathe spindle, which is in turn supported by a live center on the tailstock (top and bottom left). Clamp assembly/operation is also depicted (top and bottom right). Please click here to view a larger version of this figure.Acquire as-cast workpieces machined to the mandrel size such that the inner diameter runout is 0.2 mm, while the outer diameter retains as much cast surface as possible. NOTE: If blanks are drawn from full-size wheel castings, machining operations are required to remove all hub and spoke portions, while providing features which can be employed to clamp the workpiece to the mandrel. This includes removal of the in-board flange.Pre-heat a coffin furnace able to receive the entire workpiece to 135 °C, clean the workpiece with degreaser and place in furnace for an hour to prepare for thermal barrier coating application.Rapidly remove the workpiece from the furnace, and place on a coating jig. Using an automotive-type paint sprayer, apply a thin layer of thermal barrier die coating to the inner diameter. NOTE: This coating will provide lubrication and reduce heat transfer to the mandrel during forming operations.Wipe down the mandrel surface with a damp cloth. Ensure that the mandrel has a total rotational runout of < 0.5 mm using a dial gauge indicator along the forming length. Assess this with a live tooling center engaged on the tailstock plate. Using a torque wrench, ensure that all fasteners aside from those on the clamp assemblies are tightened to specified torque values for Grade 12.9 bolts .Start the pre-heating system by first powering the gas supply solenoid, and then igniting the torches with a flint spark lighter. Run the pre-heating system for 10 min to expel any condensate collected in the torches/hoses. Extinguish by deactivating the gas supply solenoid.Remove any loose/oxidized coating layer on the mandrel with dry 600/P1200 grit silicon carbide paper while turning the mandrel at 20 rotations per minute (rpm).Power the on-board data acquisition module, and run the pre-heating system until the thermocouples embedded in the mandrel surface read 200 °C with the live center engaged.Using an automotive-type paint sprayer, lightly coat the mandrel surface with a water-based forging lubricant and allow the rotary tooling to cool to ambient temperature with the live tooling center engaged.Figure 3) with a wrench. Set the approach or attack angle on the roller assembly using a toolmaker's protractor, and tighten both internal and external nuts (M35 - 750 Nm).Loosen the jam nut assembly on the roller stand  by first engaging the M12 shoulder bolt to connect element 2 to the clamp bracket. Inspect for any thermal distortion which will prevent element 2 in Figure 4 from smoothly running against the clamp bracket. Ensure that they move freely, lightly sanding the contact surfaces with dry 320/P400 grit silicon carbide paper. Apply a thin layer of high temperature molybdenum-based lubricant with a cloth as needed.Assemble the 3 clamp assemblies .Move the roller axially and radially (approx. 2-5 mm from workpiece surface) into position for forming, and perform one last clamp tightening  to capture the distribution of temperature across the surface of the blank during this aspect of the process. This response is shown in Figure 5:Typical temperature profile of mandrel and blank. A representative transient thermal response of the blank and mandrel obtained with the heating system. Vertical dashed lines indicate where clamps were tightened during the preheating steps, and the black arrow depicts forming. The last vertical line shows where the heating system was turned off whilst the system cooled.Figure 6: As-cast and formed result. The as-received, as-cast blank surface and geometry having a minimum inner diameter of 330 mm (top) was deformed in two passes to provide the result shown (middle). The as-cast dendritic microstructure (bottom left) is visibly modified by the forming operation and a subsequent T6 heat treatment (bottom right) as observed with optical microscopy8Please click here to view a larger version of this figure.The representative results shown above highlight that the protocol and equipment employed is capable of forming cast aluminum at elevated temperatures, and has provided a platform to determine a processing window for flow forming of wheels. The technique demonstrated can be used to explore aspects of forming envelopes, including how both formed and unformed material responds to heat treatmentRegarding further instrumentation, which would accelerate process model development, the inclusion of machine-tool dynamometer and tribometers1113As it is largely a manual forming process for a material which is sensitive to time at temperature, some inconsistencies between run to run are to be expected. Aluminum alloys have microstructures that are highly sensitive to temperatures above 100°C due to ageing mechanisms. Therefore, the most critical steps within the protocol are 1.2 and 3.3-3.7, where the blank is at elevated temperatures. Tightening and re-seating the clamps must be conducted as quickly as possible to maintain repeatability between forming operations.in situ workpiece heating employed during the pre-heating step is quite inefficient and could be improved via radiative heating. The overall processing speeds in terms of mandrel and tool movements that can be attained are somewhat limited by the capabilities of the lathe employed. Higher forming speeds require a more rigid frame with a higher load capacity, particularly if the forming of a stronger material were to be attempted. Workpiece clamping and release could be improved with the addition of hydraulic or pneumatic actuation. As heat transfer from the blank to the mandrel is largely a function of the pressure imposed by the workpiece onto the mandrel, this addition could also improve a model-based approach to ascertain the workpiece temperature during forming with the existing system.The The apparatus and procedure described has shown that forming loads for this material under these conditions approaches those for standard turning operations, and remains a very cost effective process by which to perform manufacturing trials. Research into different manufacturing routes and formability can be performed away from commercial forming equipment, which is exceedingly expensive to operate. With the apparatus and protocol described, processing parameters can be investigated prior to constructing larger scale, higher throughput equipment, and to the authors' knowledge, is a unique approach.As the protocol developed has only been applied to one specific variant of cast aluminum alloy, there is a multitude of other aluminum foundry alloys which could be investigated for a variety of applications beyond automotive wheels. As these alloys have approximately similar processing windows from a temperature perspective, the protocol developed can be readily adapted.The authors have nothing to disclose."}
-{"text": "The National Institute for Health Research (NIHR) has identified a gap in the number of people it funds who are on a pathway to become future leaders of clinical trials, compared to how much the NIHR invests in clinical trials. In order to support the clinical trials of tomorrow, it is vital that the right people are supported now to lead these trials. To address this issue, NIHR organised a workshop with key stakeholders to understand the barriers to embarking on a clinical trials career and explore initiatives to increase capacity and capability in clinical trials. The output from the workshop was a set of recommendations which NIHR is now considering to shape future support. The vision of the NIHR is, ‘To improve the health and wealth of the nation through research’, and one of its aims in order to realise this vision is to ‘Attract, develop and retain the best research professionals to conduct people-based research’. One of the main ways in which NIHR does this is through its research training programmes which are designed to create the applied health research leaders of the future (www.nihr.ac.uk/funding/training-programmes.htm). The NIHR does not provide training  through these programmes; rather, it provides funding and support to allow the best people to undertake excellent research and extensive training and development programmes based within high-calibre organisations. There are funding opportunities available for all professions, clinical and non-clinical, from masters to professorial level. These opportunities allow people to undertake research training through doing research across a range of disciplines and research methodologies. Training in clinical trials represents an important area in which people undertake training as part of an NIHR research training award. Throughout this letter where training in clinical trials is mentioned, this refers to the training undertaken as part of a NIHR research training award, not training provided directly by NIHR. Details of the guidance currently given to applicants for NIHR research training awards can be found within the latest application guidance notes (e.g. http://www.nihr.ac.uk/documents/funding/Training-Programmes/TCC-Fellowships-Guidance-Notes-2016.pdf).The National Institute for Health Research (NIHR) is the research arm of the National Health Service (NHS) in England. It is funded by the Department of Health in order to deliver the Government’s strategy for applied health research  where appropriate and must have the right level of trials experience in their supervisory team. Applicants are also encouraged to think about the scope of any trial or feasibility study in relation to their research training award to ensure that it is realistic to complete within the award timescale and whether it represents a good training vehicle. However, analysis of the NIHR training portfolio, by looking at the type of research proposed within research training award applications, has identified a gap in the number of people undertaking trials training, with approximately 20 % of funded fellowships including a trial or feasibility study. This compares to 59 % of completed Research for Patient Benefit (RfPB) grants being feasibility studies or randomised controlled trials (RCTs) as of October 2013. The RfPB programme represents a first opportunity for many NIHR trainees to gain experience of applying for and being awarded a significant research grant, and whilst it is not necessarily expected that the profile of research training awards in terms of research areas  and methodologies  should exactly mirror that of the NIHR research programmes, it is NIHR’s view that they should broadly align. This will ensure that the profile of new researchers who will become the research leaders of tomorrow are able to match the requirements, in terms of skills and expertise, needed to deliver future NIHR research. Considering the amount of investment by NIHR in RCTs (774 active RCTs in May 2014 with a research cost of £880 million), it is very important that NIHR trains the individuals capable of leading trials in the future. To help understand barriers to individuals undertaking trials training and to explore initiatives to increase capacity and capability in clinical trials amongst trainees, NIHR set up a workshop with key stakeholders which was held on 29 June 2015. Details of the participants are given in Table Share the current provision for trainees interested in a career as a clinical trialistUnderstand any barriers to trainees embarking on a career in clinical trialsUnderstand any barriers to institutions supporting trainees involved in clinical trialsExplore initiatives to increase capacity and capability in clinical trials amongst NIHR traineesThe aims of the workshop were to:The workshop heard views from across NIHR about the current provision for clinical trials training and potential ways forward, including the current provision of research training awards and the viewpoints of a CTU director, a current NIHR trainee, from NIHR’s research programmes and the NIHR Clinical Research Network. The discussion then focussed on how a trial fits into a fellowship and whether this represents a good training vehicle for someone interested in becoming a future trials leader. Training awards which do include a clinical trial primarily focus on feasibility studies and less on full trials. A lot of discussion took place focussed on what a fellowship based around clinical trials training should look like; for example, some successful applicants have used a fellowship to undertake a lot of the groundwork and preparatory research before going onto to gain further funding for a feasibility, pilot study or full trial. The benefit of working with a CTU to gain experience in a wide range of trial activities was also discussed.Are training programmes fit for purpose?What does a career pathway look like?How do trainees/researchers move through the NIHR pipeline?The second part of the workshop was structured into breakout groups to discuss the following points:Each of the breakout groups had a facilitator who recorded the key points from each discussion. Each group nominated a spokesperson to feed back to the wider group the key points recorded, which informed a further discussion by the whole group. The meeting Chair facilitated these discussions, and recommendations were agreed by consensus decision-making.In looking at the training programmes, the workshop concluded that work should be done to investigate providing more flexibility for people wanting to apply for a NIHR Clinical Trials Fellowship (CTF). NIHR CTFs are 6-month fellowships open to already funded NIHR trainees who are interested in undertaking an intense period of clinical trials training in partnership with a CTU following the conclusion of their current NIHR research training award. The workshop also concluded that consideration should be given to expanding the scope of the NIHR Transitional Research Fellowship (TRF) to provide a route into clinical trials for post-doctoral trainees with little trials experience. NIHR TRFs are currently targeted at researchers from a basic science background who want to transition into applied health research and at researchers returning from a significant career break. Undertaking a TRF with focus on moving into clinical trials could then put applicants in a strong position to apply for further trials funding or fellowships, to lead on a small feasibility study, for example. To ensure that training takes place within a high-quality environment, encouragement, or a requirement, to link with a CTU could be given. The possibility of providing fellowships with explicit links to already funded trials was also discussed.In thinking about career pathways, the workshop considered only those training to become future Chief Investigators rather than the myriad of other roles involved with clinical trials. It was agreed that a clear career pathway for future Chief Investigators does not currently exist and that career pathways for researchers who undertake trials training is currently based more upon their clinical academic pathway (for clinician researchers). Expanding the scope of the TRF as described above could help with this, as would wider dissemination of case studies showcasing people who have forged out a career in clinical trials.Discussions around moving trainees through the NIHR pathway focussed again on those training to become future Chief Investigators. There was an agreement that training awards should have a focus on feasibility and the wider aspects of clinical trials so that trainees are in a strong position to apply for trials funding in the future from programmes like Health Technology Assessment (HTA). The group also thought that developing some key skills for those training in clinical trials would be helpful. This could help, for example, someone wanting to put together a PhD programme with a focus on trials training.The outcome of the workshop was a set of recommendations that have been developed into a specific set of proposals through a task and finish group which NIHR set up following the workshop. These proposals are now under consideration by NIHR, and any changes to research training programmes as a result of these proposals will be announced during course of 2016.Share the current provision for trainees interested in a career as a clinical trialistUnderstand any barriers to trainees embarking on a career in clinical trialsUnderstand any barriers to institutions supporting trainees involved in clinical trialsExplore initiatives to increase capacity and capability in clinical trials amongst NIHR traineesThe original aims of the workshop had been to:The timescale of a clinical trial does not necessarily fit with that for a personal research training award.The additional staff and funds required to run a large trial do not necessarily fit within the scope of what can be provided by a personal research training award.The additional time constraints associated with registering for a PhD are not always compatible with the timescales of a clinical trial.Undertaking a clinical trial or research on a trials-related topic may not be as attractive to potential PhD students as more traditional lab-based research.Applicants are not necessarily aware of how current NIHR awards can be utilised to further skills and experience in clinical trials.There is not a clear career pathway for researchers looking to become future Chief Investigators.Additional flexibility may be required in some schemes, particularly the CTF, to increase their attractiveness to potential applicants.The workshop represented a good opportunity to present the current provision of research training opportunities provided by NIHR which allow for training in clinical trials, and as a result of the discussions, several potential barriers to people taking up these opportunities emerged. These are summarised below:The identification of potential barriers helped shape the recommendations which came out of the workshop, all of which were agreed upon with the aim of overcoming these barriers and increasing capacity and capability in clinical trials amongst NIHR trainees.Increase flexibility and availability of training programmes for clinical trials trainingIncrease dissemination of opportunities for clinical trials trainingExplore linking trials training into the broader research pathwayConsider key skills for different stages of clinical trials trainingConsider how research training awards can best prepare trainees for a career as a trials leader when developing recommendations into concrete proposalsThese recommendations are broadly summarised below:To develop proposals based upon the recommendations of the NIHR Clinical Trials Training workshop for future clinical trials training within NIHRTo advise on the implementation of these proposals within the current structure of NIHR research training programmesThe task and finish group which developed these recommendations further was made up of a sub-section of the attendees at the workshop reported here and worked to the following terms of reference:Whilst there are no plans to repeat the workshop reported here, any changes that are implemented as a result of this workshop will be reviewed in the future and where appropriate, and if required, further workshops may be organised.CTF, Clinical Trials Fellowship; CTU, Clinical Trials Unit; HTA, Health Technology Assessment; NHS, National Health Service; NIHR, National Institute for Health Research; RCT, randomised controlled trial; RfPB, Research for Patient Benefit; TRF, Transitional Research Fellowship"}
-{"text": "Clostridium perfringens enterotoxin (CPE) can be used to eliminate carcinoma cells that overexpress on their cell surface CPE receptors – a subset of claudins . However, CPE cannot target tumors expressing solely CPE‐insensitive claudins (such as Cldn1 and Cldn5). To overcome this limitation, structure‐guided modifications were used to generate CPE variants that can strongly bind to Cldn1, Cldn2 and/or Cldn5, while maintaining the ability to bind Cldn3 and Cldn4. This enabled (a) targeting of the most frequent endocrine malignancy, namely, Cldn1‐overexpressing thyroid cancer, and (b) improved targeting of the most common cancer type worldwide, non‐small‐cell lung cancer (NSCLC), which is characterized by high expression of several claudins, including Cldn1 and Cldn5. Different CPE variants, including the novel mutant CPE‐Mut3 (S231R/S313H), were applied on thyroid cancer (K1 cells) and NSCLC (PC‐9 cells) models. In vitro, CPE‐Mut3, but not CPEwt, showed Cldn1‐dependent binding and cytotoxicity toward K1 cells. For PC‐9 cells, CPE‐Mut3 improved claudin‐dependent cytotoxic targeting, when compared to CPEwt. In vivo, intratumoral injection of CPE‐Mut3 in xenograft models bearing K1 or PC‐9 tumors induced necrosis and reduced the growth of both tumor types. Thus, directed modification of CPE enables eradication of tumor entities that cannot be targeted by CPEwt, for instance, Cldn1‐overexpressing thyroid cancer by using the novel CPE‐Mut3. Clostridium perfringens enterotoxin (CPE) is used to target carcinomas overexpressing a claudin subset serving as CPE receptors. CPE‐based pores in membrane cause cell death. Structure‐guided CPE modifications (CPE‐S231R/S313H) enabled also claudin‐1 binding and growth reduction of claudin‐1‐expressing papillary thyroid carcinoma (mouse xenotransplants) that could not be targeted by CPEwt. Furthermore, CPE‐S231R/S313H improved targeting of lung cancer (NSCLC) expressing multiple claudins. Papillary thyroid carcinoma (PTC), a differentiated type of thyroid cancer, is the most common histological subtype accounting for approximately 70% of thyroid cancer cases  is the most common cancer  and is the most common cause of death from cancer worldwide. In addition, approximately 50–70% of patients with lung adenocarcinoma, one type of NSCLC, after surgery relapse within one year and their cancer cells acquire a chemoresistant phenotype   and two functional domains with a known structure  to Cldn3, Cldn4, Cldn6, Cldn7, and Cldn9; with medium affinity to Cldn8, Cldn14, and Cldn19; and with low affinity to Cldn1 and Cldn2, but does not bind to Cldn5, Cldn10 to Cldn13, Cldn15 to Cldn18, and Cldn20 to Cldn24  and often deregulated Kwon, , therebyet al., et al., et al., et al., et al., In case of thyroid cancer  for cancer treatment is restricted to carcinomas, which express CPEwt‐binding claudins . In addition, extrajunctional CPE‐sensitive claudin molecules are also present on normal epithelia, at least to a minor extent. This can result in side effects during CPE treatment. To overcome these difficulties, we modified CPE for the first time to adjust its claudin‐binding properties to the claudin expression profile of certain cancer types containing claudin subtypes that are not bound by CPEwt.In vitro and in vivo, tumor growth of PTC (K1 cells), overexpressing mainly Cldn1, but not Cldn3 and Cldn4, was efficiently reduced by Cldn1‐binding CPE‐variant S231R/S313H (CPE‐Mut3), but not by CPEwt. In addition, we show that CPE variants suppress growth of NSCLC tumors in a claudin‐directed manner.Here, we demonstrate expansion of CPE‐based oncoleaking strategy specifically for tumor types overexpressing claudins, which are not CPE receptors such as Cldn1 by design and use of CPE mutants: 22.1et al., et al., Plasmid encoding pGEX‐4T‐CPE194‐319 carrying cCPE with N‐terminal GST‐fusions was described  and purified from lysates using Ni‐NTA‐Agarose , as described earlier . Native HEK293 (HEK) cells and HEK cells, stably transfected with Cldn1‐7, were cultured as described elsewhere  precoated 96‐well plates reached 80% confluency, they were transiently transfected with 0.1 µg DNA of CPE constructs and vector with antisense CPE sequence (as negative control) using ViaFect .When cells seeded on poly‐2.5l‐lysine. On next day, cells were preincubated at 37 °C, 5% CO2 for 1 or 24 h, with variable dilutions of cCPE or CPE preparations or 0.01% (v/v) Triton X‐100 (background correction) before medium was replaced by medium without phenol red containing 1.25 mm MTT. Two hours later, cells were treated with 5% (v/v) Triton X‐100 in 2‐propanol for 20 min and absorption was measured at 560 nm.For MTT ‐2,5‐diphenyltetrazolium bromide; Sigma‐Aldrich, USA) cytotoxicity assay cells were seeded 80% confluent on 96‐well plates  precoated with poly‐2.6et al., −1 GST‐cCPE constructs  in 24‐well plates . Amount of bound cCPE was detected as described elsewhere . After reaching confluency, cells were washed and harvested, and extracted membrane protein fraction was analyzed as described elsewhere . Tumor volume  and body weight were determined at least twice weekly. When tumors reached mean volume of 0.14–0.17 cm3, recombinant CPE was injected intratumorally in anesthetized animals. In total, 20 μg of recombinant CPE was applied by 10 injections (daily dose of 0.04 μg CPE·μL−1 0.9% NaCl). During treatment, TV was measured at days 11, 14, 18, and 21 after injection of PC‐9 cells or at days 18, 21, 25, and 28 after injection of K1 cells. Animals were sacrificed for tumor removal and further analysis. All experiments were performed at EPO GmbH, Berlin, Germany.For cell line‐derived subcutaneous xenotransplant (CDX) tumor models, 5 × 102.10Shock frozen tumor tissues were fixed with Tissue‐Tek Medium  and dissected with cryostat into cryosections each of 10 or 18 μm thickness, which were transferred onto cover slides.2.11et al., qupath software  in triplicates of two samples per group. Necrotic area in % related to the whole tissue area is shown.For morphological evaluation of 18 µm thick tissue sections, hematoxylin and eosin (HE) staining was performed. Staining procedures were performed by standard protocols  using one‐way or two‐way ANOVA and Bonferroni’s adjustment for multiple comparisons.Data are expressed as mean ± SEM. Statistical analyses were performed with 33.1et al., et al., We first aimed to create variants of the nontoxic claudin‐binding domain of CPE (cCPE) with increased Cldn1 binding. Mutation S313H in cCPE, was previously shown to improve Cldn1 binding and enable Cldn5 binding (Protze To further improve Cldn1 and Cldn5 binding of cCPE‐Mut1 (cCPE‐S313H), we generated models of claudin–cCPE‐S313H interaction , previously shown to increase binding of cCPE to Cldn1 and other claudins, similar as S313H  and Nthy‐ori 3‐1 cells , PC‐9 (lung adenocarcinoma), and SK‐Mes‐1 (lung squamous‐cell carcinoma). Expression of Cldn1, as well as of other claudins (Cldn2 to Cldn9), in these cell lines was analyzed by western blot Fig. A. For K1Since Cldn1 expression in PC‐9 cells was higher than that of SK‐Mes‐1 cells, PC‐9 cells were used as model for NSCLC for further experiments. K1 cells were chosen as model for PTC and Nthy‐ori 3‐1 cells as thyroid follicular epithelial cell model.3.4First, we tested binding of nontoxic cCPE variants to K1 and Nthy‐ori 3‐1 cells expressing Cldn1. Similarly as found for HEK‐Cldn1 cells Fig. A, cCPE‐MConsequently, cytotoxicity of full length CPE‐Mut3 was tested on Nthy‐ori 3‐1 and K1 cells using MTT assays. After 24‐h incubation with CPEwt, CPE‐negative control, CPE‐Mut3, and CPE‐Mut4, viability of Nthy‐ori 3‐1 cells was not affected Fig. A. In conTo further verify that CPE‐mediated cytotoxicity depends on presence of claudins on surface of K1 cells, K1 cells were incubated simultaneously with both noncytotoxic cCPE (wt or Mut3) and cytotoxic full length CPE‐Mut3 in same molar concentrations. cCPE‐Mut3 bound to Cldn1 on the surface of K1 cells and thereby protected them completely from cytotoxic effect of full length CPE‐Mut3 Fig. B, blue. in vitro PTC model). The insensitivity of Nthy‐ori 3‐1 cells to CPE‐Mut3 is likely due to their low Cldn1 expression and suggests that CPE‐Mut3‐mediated cytotoxicity could potentially be restricted to Cldn1‐overexpressing malignant PTC.Thus, unlike CPEwt and the broad specificity binder CPE‐Mut4, the designed CPE‐Mut3 strongly reduced cell viability selectively in K1 cells overexpressing Cldn1  demonstrated for PC‐9 cells (a) claudin‐dependent cytotoxicity of CPE and (b) that all claudin‐sensitive CPE variants  reduced cell viability. The latter can be explained by the fact that PC‐9 cells do not only express Cldn1, but also Cldn3, Cldn4, and Cldn7  or of vector control preparations were administrated within 10 days (single 2 µg injection daily).Finally, we tested 3 and to 1.0 ± 0.21 cm3, respectively. In contrast, for CPE‐Mut3‐treated animals, only minor tumor growth (to 0.28 ± 0.04 cm3) was observed. The study revealed no significant effect of CPEwt treatment, but a very efficient anti‐tumoral activity of CPE‐Mut3, reflected by reduced tumor growth (14% compared to control)  Fig. A. Hence,In the PC‐9 xenograft model, measurements of TV on days 11, 14, 18, and 21 after beginning of CPE‐administration in different treatment groups revealed anti‐tumoral activity of both CPEwt and of CPE‐Mut3, reflected by respective TVs of 43% and 29%  to expand use of CPE to targeting of Cldn1‐expressing thyroid tumors and (b) to potentially reduce CPE side effects by matching the binding properties of CPE to the claudin expression profile of particular carcinoma types.In this study, we used structure‐guided mutagenesis of CPE to enable for the first time cytotoxic targeting of tumors expressing Cldn1 or Cldn5 to which CPEwt does not bind considerably. As a proof of principle, we showed et al., et al., et al., et al., et al., et al., et al., et al., et al., et al., et al., This study aimed to overcome the restriction of the promising CPE treatment to tumors expressing only receptors for CPEwt  and of NSCLC (PC‐9 cells). For the first time, CPE was used to successfully reduce growth of lung tumors (PC‐9 cells) and its Mut3 enabled efficient Cldn1‐directed reduction of PTC (K1 cells) growth.Furthermore, in contrast to CPEwt, CPE‐Mut3 was cytotoxic for K1 thyroid cancer cells expressing endogenous Cldn1. For PC‐9 lung cancer cells that express multiple claudins, apart from CPE‐Mut3 also CPEwt and CPE‐Mut4 mediated cytotoxicity. Finally, claudin‐specific cytotoxicity was confirmed Using the same approach of structure‐guided mutagenesis, we also generated CPE‐Mut9 and CPE‐Mut10 which enabled efficient Cldn5‐ and Cldn4‐directed cytotoxicity, respectively Fig. . Thus, Cet al., et al., et al., et al., In several studies, high claudin specificity of anti‐claudin antibodies  as the recombinant protein  by subsequent use of cytotoxic cCPE‐PSIF (protein synthesis inhibitory factor) fusion proteins .All animal experimental procedures are performed in accordance with the in‐house guidelines of the Institutional Animal Care and in accordance with the German Animal Protection Law and approved by the local responsible and official authorities, State Office of Health and Social Affairs .Fig. S1. Shift of claudin‐subtype‐directed cytotoxicity of CPE by structure‐guided mutation of CPE.Fig. S2. Claudin‐subtype‐directed cytotoxicity of CPE variants is mediated by induction of Ca2+ influx.Fig. S3. Visualization of CPE and claudins in thyroid and lung xenograft models after recombinant CPE treatment.Table S1. cCPE or CPE variants and claudin‐binding characteristics.Click here for additional data file."}
-{"text": "Understanding the characteristics of commenters on mental health–related online forums is vital for the development of effective psychological interventions in these communities. The way in which commenters interact can enhance our understanding of their characteristics.Using eating disorder–related (EDR) forums as an example, this study detailed a methodology that aimed to determine subtypes of mental health–related forums and profile their commenters based on the other forums to which they contributed.Reddit). A mixed-methods approach comprising network analysis with community detection, text mining, and manual review identified subtypes of EDR forums. For each subtype, another network analysis with community detection was conducted using the EDR forum commenter overlap between 50 forums on which the commenters also commented. The topics of forums in each detected community were then manually reviewed to identify the shared interests of each subtype of EDR forum commenters.The researchers identified all public EDR forums (with ≥500 contributing commenters between March 2017 and February 2018) on a large Web-based discussion platform  of commenters had also commented on pornographic forums and 16.66% (181/1086) had contributed to proeating disorder forums.The article exemplifies a methodology that provides insight into subtypes of mental health–related forums and the characteristics of their commenters. The findings have implications for future research and Web-based psychological interventions. With the publicly available data and code provided, researchers can easily reproduce the analyses or utilize the methodology to investigate other mental health–related forums. Compared with clinician-delivered psychological interventions, Web-based interventions targeting mental health conditions offer several benefits, such as cost-effectiveness , and potproeating disorder or prorecovery  were not included in this count and were excluded from all subsequent analyses.A list of search terms was created to identify EDR subreddits, which is provided in dit data . To focuA mixed-methods approach was then used to identify subtypes of the EDR subreddits. This approach comprised 3 techniques that are described below and were conducted in the order presented: (1) network analyses with community detection; (2) text mining; and (3) manual review of EDR subreddits’ focuses.subreddit A compared with subreddit B), the proportion of each subreddit’s commenters who had posted on the other subreddit was calculated, with the result ranging from 0 (no commenters overlap) to 1 . For example, a proportion of 0.4 (40/100) of subreddit A ’s commenters might post on subreddit B, whereas 0.8 (40/50) of subreddit B ’s commenters post on subreddit A. The mean of these 2 proportions  was calculated to account for the differences in the number of commenters on each subreddit. A matrix was then created using all these pairwise comparisons, where each cell within the matrix represented the mean commenter overlap between each pairing of the EDR subreddits.To conduct the network analyses with community detection, a list of commenters was compiled separately for each of the included EDR subreddits. For each pairwise comparison of the subreddits  network analysis was conducted using the  package  for R stsoftware . Many telgorithm  was usedlgorithm  and was lgorithm .VennDiagramR package  commenters). To focus this report on the largest subtypes of EDR subreddits, only subtypes with 1000 or more commenters were included in the analyses. The following analyses were repeated separately for each included subtype of EDR subreddits.For each of the subtypes of EDR subreddits identified through the previously described methods (Objective 1), a list was compiled of all the commenters who had contributed within the 1-year period to at least 1 subreddit within the subtype  in the 1-year period were identified. Any ancillary subreddits to which fewer than 1% of the EDR subtype’s commenters had contributed were excluded at this stage. This exclusion was made as ancillary subreddits with so few EDR commenters would not have been included in the final steps of the analysis (detailed below) and therefore represented unnecessary data to extract.AskReddit). At the same time, this step also avoided the inclusion of very small subreddits that had very high proportions of the EDR subtype’s commenters . As this threshold  was used solely to facilitate a clear interpretation of the results, extensions of this study could set different thresholds to explore the communities at varying levels of detail.The ancillary subreddits were then ranked separately in the descending order of (1) the number of the EDR subtype’s commenters who had contributed to each ancillary subreddit and (2) the proportion of each ancillary subreddit’s total commenters  that had also commented on at least 1 subreddit within the EDR subtype. For each ancillary subreddit, the mean of these 2 ranks was then calculated. Owing to the large number  of ancillary subreddits associated with each EDR subtype and to improve the interpretability of the results, the mean rank was used to identify the most representative ancillary subreddits for inclusion in the following analyses. Specifically, the 50 ancillary subreddits with the highest mean rank were included, resulting in the inclusion of ancillary subreddits that were both large in size  and included a large proportion of the EDR subtype’s commenters. This avoided the inclusion of ancillary subreddits that were very large in terms of the number of commenters but of which the EDR subtype’s commenters comprised a very small proportion  network analyses with community detection and (2) a manual review of the ancillary subreddits’ topics.The network and community detection analyses were conducted in the same way as detailed for Objective 1. The only difference was that the commenter overlaps (relating to both the ancillary subreddits and detected communities) were calculated using only the EDR subtype’s commenters .loseit was described as weight loss. All ancillary subreddits comprising the detected communities were then reviewed, and a label was produced to represent the general content of each community. For example, a community containing ancillary subreddits that related to eating behaviors and weight loss was labelled Eating/Body. To ensure transparency at every stage of this process, the name and labels of all included ancillary subreddits are presented in tables in the Results section, along with a summary of how each label for the detected communities was generated.A manual review of each ancillary subreddit’s name and brief description was undertaken to describe each subreddit’s general topic. For example, the general topic of the subreddit BingeEatingDisorder, bulimia, EatingDisorders, eating_disorders, fuckeatingdisorders, MyProAna, proED, ProEDmeme s, and thinspo. In total, 14,024 commenters posted on these 9 EDR subreddits. Of these commenters, 0.69%  included the term bot within their account name, with these commenters contributing a mean of 9 comments  to the EDR subreddits. The network analysis with community detection corresponding to the 9 EDR subreddits is presented in The search and inclusion strategy led to the identification of 50 EDR subreddits, a list of which is provided in MyProAna , proED , ProEDmemes , and thinspo . In contrast, community 2 (dark-gray circles) comprised the 5 EDR subreddits with the highest percentage of threads mentioning recovery: BingeEatingDisorder , bulimia , eating_disorders , EatingDisorders , and fuckeatingdisorders . These findings supported a conceptualization of community 1 comprising low recovery-focus EDR subreddits and community 2 comprising high recovery-focus EDR subreddits.only posted on subreddits within the low recovery-focus community, whereas 28.69%  only commented on subreddits within the high recovery-focus community. However, 5.34% commenters  posted on subreddits within both communities, indicating relatively little commenter overlap between the communities.Of the 14,024 commenters, 65.97%  EatingDisorders), a specific eating disorder diagnostic category , or online content associated with eating disorders . Each subreddit’s focus was therefore used to categorize the subreddits within each detected community. Consequently, the low recovery-focus community comprised 3 subtypes of EDR subreddits: pro-eating disorder, consisting of proED and ProEDmemes (8166 commenters); thinspiration, consisting of thinspo (1580 commenters); and pro-anorexia nervosa, consisting of MyProAna (731 commenters). As with the low recovery-focus community, the high recovery-focus community comprised 3 subtypes: pro-recovery eating disorder, consisting of EatingDisorders, eating_disorders, and fuckeatingdisorders (1986 commenters); pro-recovery binge eating disorder, consisting of BingeEatingDisorder (2520 commenters); and pro-recovery bulimia nervosa, consisting of bulimia (524 commenters).In addition to the degree of recovery focus, the EDR subreddits also differed in terms of whether they concerned eating disorders in general . Consequently, the analyses regarding Objective 2 were conducted for 4 subtypes of EDR subreddits: 2 that are conceptualized as low recovery focus  and 2 that are conceptualized as high recovery focus . To examine the networks in sufficient detail and owing to the particular importance of the proeating disorder communities [To focus this report on the largest subtypes of EDR subreddits, subtypes with fewer than 1000 commenters were excluded at this stage . 50 ancillary subreddits were identified, on which 61.95% (5059/8166) of the proeating disorder subtype’s commenters also posted. The network analysis with community detection is presented in In total, 974 ancillary subreddits had been contributed to by at least 1% (82) of the 8166 commenters associated with the Eating/Body as the ancillary subreddits were related to restrictive eating , weight loss or body transformations , or eating disorders . Community 2 (dark gray circles) was labelled Mental health as the subreddits mainly related to mental health conditions  or related issues . Community 3 (light-gray circles) was labelled Women/Appearance/Mixed as the subreddits related to women , appearance , or mixed topics .As shown in Of the 5059 proeating disorder commenters, 67.56% (3418) also posted on ancillary subreddits within the Women/Appearance/Mixed community, compared with 61.24% (3098) and 35.90% (1816) in the Eating/Body and Mental health communities, respectively. thinspiration subtype . A total of 50 ancillary subreddits were identified on which 68.73% (1086/1580) thinspiration subtype’s commenters also posted. The network analysis with community detection is presented in In total, 3932 ancillary subreddits had been contributed to by at least 1.01% (16) of the 1580 commenters associated with the Pornography: 1 as the ancillary subreddits were all pornographic in nature. Community 2 (dark-gray circles) was labelled Pornography: young/small as it mainly comprised pornographic subreddits that explicitly referred to women being young  or small . Community 3 (mid-gray circles) was labelled Pornography: 2 as all the subreddits were pornographic. Community 4 (light-gray circle) was labelled ProEDmemes as it comprised only 1 subreddit, ProEDmemes. Similarly, community 5 (white circle) was labelled proED, as it consisted of proED only.As shown in proED, and ProEDmemes communities, respectively. Of the 1086 thinspiration commenters, 67.59% (734) also posted on ancillary subreddits within the Pornography: 1 community, compared with 59.85% (650), 46.13% (501), 20.99% (228), and 10.87% (118) in the Pornography: young/small, Pornography: 2, ProEDmemes and proED). As such, the overlap between these 2 groups of communities was calculated. Of the 1086 commenters in the thinspiration commenter network, 78.18% (849/1086) only posted on ancillary subreddits within the pornography communities, whereas 16.67% (181/1086) only commented on subreddits within the proeating disorder communities. However, 5.16% (56/1086) of the commenters posted on subreddits within both groups of communities, indicating a small commenter overlap between these groups.As shown in Using the example of EDR subreddits, this study demonstrated a methodology that addressed 2 objectives: (1) determine subtypes of forums related to a similar mental health issue and (2) elucidate the characteristics  of the subtypes’ commenters by identifying other forums to which they contribute  and investigating the commenter overlap between these subreddits. These 2 objectives were achieved using mixed-methods approaches, comprising techniques that included a network analysis with community detection, text mining, and a manual review of the forums’ topics. Following the identification of 6 subtypes of EDR subreddits, the report focused on 2 specific subtypes—proeating disorder and thinspiration. The proeating disorder commenters also contributed to subreddits relating to the body and eating, mental health, and women, appearance, and mixed topics. Regarding the thinspiration subtype, 78% (849/1086) of the commenters also contributed to pornographic subreddits, whereas 17% (181/1086) also commented on proeating disorder subreddits.Twitter [MyProAna, proED, ProEDmemes, and thinspo) than more recovery-focused subreddits . Although the text-mining approach used textual data to assess the frequency of words’ occurrence in comment threads, the network analyses with community detection utilized behavioral data . As the results of the text-mining approach  clearly align with the detected communities , a strength of this mixed-methods approach is that the 2 distinct techniques appear to provide a degree of convergent validity to each other.Concerning the first objective, through the use of network analyses with community detection and a previously detailed text-mining technique , 2 commuTwitter . FurtherTwitter . The finfemalefashionadvice and TheGirlSurvivalGuide), the results also supported previous findings that suggest women are more likely to engage with pro-EDR online content [With regard to the second objective, the topics in which commenters on proeating disorder subreddits were interested are in line with other research ,11,16. S content ,9,30.legal or 18) or small . This finding is in line with previous research, which concluded that thinspiration images were typically sexually suggestive [In contrast to the proeating disorder results, the findings concerning thinspiration commenters were of great surprise. Namely, a clear majority of thinspiration commenters (78%) had also contributed to pornographic subreddits. Furthermore, a specific group of commenters contributed to pornographic subreddits that had names suggesting that women were young  to the current mixed-methods approach, its techniques can compensate for the methodological limitations of the previous studies. For example, survey-based studies concerning users of online forums are unlikely to have representative samples. As the current approach used data concerning all the commenters on public forums, it is not subject to this limitation. As a result, by consolidating the findings generated from these distinct methodological approaches, there can be greater confidence that results do not simply represent an artefact of one particular technique .Reddit data are unsolicited. Although this represents a strength of the data , this also results in a significant amount of noise in the data. Steps were taken to reduce this noise, such as only including 50 ancillary subreddits with a large number and proportion of EDR commenters in the network analyses. This approach identified the most representative subreddits by excluding very small subreddits  and very large subreddits (many of which had a large number but low proportion of EDR commenters). However, the effects of other sources of noise in the data are more difficult to mitigate. For example, the same person might have more than one Reddit username, which might lead to an underestimation of commenter overlap. Additionally, bots  exist that comment widely on subreddits and which might contribute to an overestimation of commenter overlap. Although strategies exist to identify bots [AutoModerator, a generic Reddit bot) were not excluded, to adopt a conservative approach to our analyses. To minimize the effects of these sources of noise, the conclusions are based on communities of subreddits, rather than individual subreddits. Although not necessarily a limitation of this study, caution should be exercised in generalizing these findings to people who have read, but not commented on, the online content. Exploring communities based on the content that users read would be important but ethically problematic, as this would likely require access to data that are not publicly available. Despite not being able to generalize to the readers of forums, Aardoom et al [The findings in this study must be considered in relation to the limitations of the data and methodology. First, it is important to note that the ify bots ,36, thesom et al  found thom et al . TherefoproED, fuckeatingdisorders, and EatingDisorders) [With regard to the approach used for the first objective, the findings in this study have implications for how mental health–related online communities should be conceptualized and investigated in future research. Specifically, when comparing multiple communities, the degree of user overlap between these should be acknowledged. For example, a previous study compared the frequency of fitness tracker mentions between 3 EDR subreddits  . By cons1200isplenty, loseit, and progresspics. As some mental health–related communities  might be unlikely to promote psychological interventions, the current approach could be utilized to identify the communities in which these users also tend to post. As a result, these communities could be approached to provide an alternative way in which to reach these people and to target prevention-focused interventions.Concerning the second objective’s methodological approach, the findings have implications for future research and the design of Web-based psychological interventions for mental health issues. With regard to future research, the approach presented here is entirely reproducible and can be used to explore similar questions in other groups of commenters of particular theoretical interest . The methodology could also be easily extended to explore longitudinal—and, therefore, causal—patterns of commenting. The approach is also useful for hypothesis generation and identifying new avenues of research. As detailed above, this study generated a surprising finding, in that over 3 quarters of thinspiration commenters also commented on pornography. As this relationship had not been identified before, it is a clear indicator of how this approach can be used to identify areas that require greater research attention. Concerning implications for psychological interventions, the current approach can identify other topics that are of interest to people commenting on mental health–related online discussion forums. For example, proeating disorder commenters were observed to be also interested in topics such as body, eating, mental health, and appearance. Consequently, these topics confirm the importance of existing EDR intervention focuses  . These fIn summary, this study has presented a reproducible and primarily data-driven methodology that can be used to (1) identify subtypes of mental health–related forums and (2) identify the interests of the commenters who post on the forums comprising these subtypes. This offers a powerful technique for hypothesis-generation and informing strategies for psychological intervention. Employing different methodologies to explore the same research question is vital to ensure that findings are not solely a result of a particular methodological design . This ap"}
-{"text": "Application of a coating on a mold surface is widely used in the foundry industry. Changes in coating change the heat transfer at the mold–melt interface, which influences the microstructure of the casting. In this study, the effect of boron nitride coating thickness on the interfacial heat transfer and slug microstructure in the Swirled Enthalpy Equilibration Device (SEED) process was investigated. The temperatures of the semi-solid slug and mold were measured, and the interfacial heat transfer coefficient and heat flux of the mold–slug interface was estimated based on these data. Microstructures of the quenched slugs were also examined. The results indicated that the interfacial heat transfer coefficient decreased with an increase in coating thickness and was sensitive to a coating thickness of less than 0.1 mm. The interfacial heat flux decreased sharply at the early stage, and then slowed down as the swirling time increased and the coating thickened. The coating thickness affected the temperature evolution of the slug at the early stage of the SEED process. As the coating thickness increased from near zero to 1.0 mm, the grain size of the slug increased by ~20 µm and the globular structure of the slug transformed into a dendritic structure. Aluminum parts, produced by efficient and low-cost casting processes, are widely used in transportation applications. Well-known casting processes include sand casting, permanent casting, and high-pressure die casting. All of these manufacturing routes have certain drawbacks, including porosity, air holes, and misruns of the casting. Semi-solid die casting, in which a semi-solid slug or slurry with fine and globular primary α-Al particles is pushed into the die cavity, was developed to eliminate these casting defects. For semi-solid die casting, preparation of the semi-solid slug is a key step. Dozens of processes have been developed to prepare such slugs with fine and globular primary α-Al particles. These processes can be classified into two categories: rheo routes and thixo routes. The rheo route has been widely adopted due to its low operating cost and high efficiency.The Swirled Enthalpy Equilibration Device (SEED) process is one such rheo route. The original version was developed by Doutre et al. from Alcan , and theInterfacial heat transfer at the melt–mold interface has been well researched in sand and permanent casting. Published research has shown that many factors affect the interfacial heat transfer coefficient (IHTC). Bouchard et al.  found thIn the present study, the temperatures of the slug and mold were measured for different coating thicknesses on the internal surface of the mold. The IHTC and heat flux on the slug–mold interface were estimated according to the temperature data. The temperature fields and microstructures of slugs produced with different thicknesses of coatings were characterized and analyzed.Commercial aluminum alloy 357  was melted in an electric resistance furnace and held at a temperature of 720 °C. Approximately 1.55 kg of melt at a temperature of 630 °C was poured into a cool tilted cylindrical steel mold of 78 mm inside diameter, 2.3 mm wall thickness, and 210 mm height. Eccentric rotation was then applied at a frequency of 180 rpm. ® Co., Ltd., Spokane, WA, USA) were applied. The thickness of the coating was controlled by adjusting the spray time. The detailed parameters are summarized in In the present study, four thicknesses of BN coating (provided by PyrotekA temperature acquisition system see  was desi4 + 200 mL H2O) under 20 V direct current for 90 s at room temperature. The anodized samples were observed using an Axiovert 200 MAT microscope  using polarized light. Five micrographs  were randomly selected from each sample for quantitative analysis. Particle size  is defined asP is the perimeter of the particle. For F = 1, the particle is a perfect circle; a particle with a more complex shape will correspond to a smaller value of F.The shape factor ) was used to describe the average shape factor of the particles:−2) on the mold–slug interface can be calculated by−3); −1·°C−1); −2·K−1); In the SEED process, the heat released by the melt is absorbed by the mold and ambient air, so the heat flux (h) (W·m−2·K−1) can be calculated by, location 4) (°C) and According to Newton’s law of cooling, the IHTC of the mold–slug interface . According to the heat transfer literature of Lienhard IV and Lienhard v [In this study, the temperature gradient within the mold could be ignored, so Tme) see a. The reenhard v , the tem, the parameters in According to Equations (4) and (5)−2 was reached. As the coating thickness increased, the largest heat flux decreased and its rate of reduction slowed down. The largest heat flux decreased from 800,000 W·m−2 to 180,000 W·m−2 when the coating thickness increased from 0.0 mm to 1.0 mm.−2·K−1 to ~800 W·m−2·K−1 during squeeze casting; Lau et al. [−2·K−1 to ~500 W·m−2·K−1 during permanent mold casting; Zhi-peng et al. [u et al.  showed tg et al.  found th−1  increased as the coating thickened  usually impede the growth of a dendritic microstructure and result in fine structure. This conclusion has been recognized by most researchers in this area. Zhu et al.  investigIn the present study, the observation that a thick coating resulted in a large dendritic structure can be explained by nucleation and grain growth. The analysis in −2·K−1 to ~1100 W·m−2·K−1, 800 W·m−2·K−1, and 500 W·m−2·K−1 when the coating increased in thickness from 0.0 mm to 0.1 mm, 0.5 mm, and 1.0 mm, respectively. The IHTC was sensitive to the BN coating thickness when this was less than 0.1 mm.The IHTC of the mold–slug interface in the SEED process was estimated. The IHTC fluctuated within a small range and decreased with an increase in coating thickness. The IHTC reduced from ~2700 W·m−2 to ~180,000 W·m−2 when the coating increased from 0.0 mm to 1.0 mm.The heat flux of the mold–slug interface decreased sharply from its highest value to a nearly constant low value during the SEED process. The reduction rate decreased as the BN coating thickness and swirling time increased. The highest value decreased from ~800,000 W·mThe temperature difference in the slug dropped off to a constant low value as the swirling time rose. According to this characteristic, the temperature evolution was divided into two stages: unstable and quasi-stable stages. As the coating thickened, the duration of the unstable stage increased and the highest temperature gradient in the slug decreased. The coating thickness had no obvious effect on the quasi-stable stage.The microstructures strongly depended on the BN coating thickness. When the coating thickened, the grain size enlarged and the grain morphology transformed from a globular shape to a dendritic structure. The grain size enlarged from 78 µm to 106 µm at the edge, from 80 µm to 98 µm at the middle, and from 83 µm to 100 µm at the center when the BN coating thickness increased from 0.0 mm to 1.0 mm.The present study showed that the coating thickness on the internal surface of a mold is very important for control of the microstructure of the semi-solid slug in the SEED process. The spray coating process should be well controlled during production to produce a thin and stable coating. In other semi-solid slug preparation methods, especially those based on extensive nucleation caused by cooling of the mold (such as the New Rheocasting (NRC) process patented by Adachi et al.  and the"}
-{"text": "Staphylococcus, Pseudomonas, and Escherichia coli) favors intestinal translocations with Gram negative bacteria or their endotoxins and could trigger sepsis, septic shock, secondary peritonitis, or various intestinal infections. Intestinal infections also induce epithelial lesions and perpetuate the risk of bacterial translocation and dysbiosis through epithelial ischemia and pro-inflammatory cytokines. Furthermore, the decline of protective anaerobic bacteria (Bifidobacterium and Lactobacillus) and inadequate release of immune modulators (such as butyrate) affects the release of antimicrobial peptides, de-represses microbial virulence factors and alters the innate immune response. As a result, intestinal germs modulate liver pathology and represent a common etiology of infections in HIV immunosuppressed patients. Antibiotic and antiretroviral treatments also promote intestinal dysbiosis, followed by the selection of resistant germs which could later become a source of infections. The current article addresses the strong correlations between the intestinal barrier and the microbiota and discusses the role of dysbiosis in destabilizing the intestinal barrier and promoting infectious diseases.The ecosystem of the gut microbiota consists of diverse intestinal species with multiple metabolic and immunologic activities and it is closely connected with the intestinal epithelia and mucosal immune response, with which it builds a complex barrier against intestinal pathogenic bacteria. The microbiota ensures the integrity of the gut barrier through multiple mechanisms, either by releasing antibacterial molecules (bacteriocins) and anti-inflammatory short-chain fatty acids or by activating essential cell receptors for the immune response. Experimental studies have confirmed the role of the intestinal microbiota in the epigenetic modulation of the gut barrier through posttranslational histone modifications and regulatory mechanisms induced by epithelial miRNA in the epithelial lumen. Any quantitative or functional changes of the intestinal microbiota, referred to as dysbiosis, alter the immune response, decrease epithelial permeability and destabilize intestinal homeostasis. Consequently, the overgrowth of pathobionts ( The intestinal barrier defines the morpho-functional unit responsible for the defense of the intestinal mucosa and consists of the intestinal microbiota, intestinal epithelial cells (IECs) and mucosal immunity tightly linked through a complex network of cytokines, antimicrobial peptides (AMPs), metabolic products, and numerous regulatory molecules . Given tThe intestinal microbiota represents the first defense line of the intestinal barrier. The microbiota entails millions of microogranisms colonizing the gastrointestinal tract most of which are bacteria. This large number of microorganisms withstand the unfavorable intestinal habitat thanks to their symbiotic relationships with the human organism. These symbiotic host-commensal relationships develop after birth and enable the metabolic, immune and antiinfectious processes through which the microbiota contributes to gut homeostasis . The strThe article discusses gut barrier defense mechanisms, the key anti-infectious role of microbiota inside of the gut barrier and the impact of dysbiosis in the life-threatening infections.Firmicutes, Bacteroidetes, Actinobacteria, and Proteobacteria  for pre-existent intestinal niches (“niche competition”) as well as for intestinal nutrients (“nutritive competition”). This competition ensures the structural stability of the microbiota and is referred to as “colonization resistance.” Colonization resistance employs a network of specific molecules with a critical anti-infectious roles  with a broad spectrum of activity  such as Nod-like receptors (NLRs), toll-like receptors (TLRs) and other PRR families located on the cell membrane or in the cytoplasm which recognize specific microbial-associated molecular patterns (MAMP). Once the activation of these receptors induces cytoplasmic signal transduction cascades and further promotes the NF-kappaB (NF-kB) pathway along with other cellular transcription factors, inflammasome activation and pro-inflammatory cytokines  . The IECShort chain fatty acids and GPR43/109A stimulation also protects epithelial integrity via inflammasome activation and epigenetic immunomodulation of FoxP3+ regulatory T cells (Treg) proliferation as shown below .Dysbiosis induced by infectious or non-infectious causes  favors the distruption of the intestinal epitelium . The injThe intestinal epithelium represents the largest epithelial surface in the human body. It connects with the intestinal ecosystem containing commensal and pathogenic species. Commensal germs need to be immunologically accepted, whereas intestinal pathogens must be eliminated. This differentiation requires the activation of an extremely well-coordinated and efficient immune system. Considering that intestinal commensals are present in the human body ever since birth they represent, in fact, the first contact between the immune system and the exterior environment. As such, this large and diverse microbiota will serve as one of the body’s defense mechanisms against the invasion of pathogenic germs. At the same time, the microbiota develops mutually beneficial relationships with the organism and together with the intestinal epithelium and gut-associated lymphoid tissue (GALT) the microbiota forms a complex intestinal barrier against infectious threats.These symbiotic relationships are facilitated by the presence of PRRs and by the immunomodulatory capacity of the intestinal microbiota against the antigenic structures exposed by the intestinal microbiota.The intestinal epithelium expresses numerous types of receptors able to recognize different MAMPs expressed by microbial species and to convert them into gut signals for inflammatory cascades . Thus TL+Th1 response in mice and human experiments (Antigen-presenting cells (APC) belonging to GALT such as macrophages and dendritic cells (DCs) also exhibit cell receptors which regulate numerous genes and modulate the release of NF-κB transcription factor, immunomodulatory cytokines and AMP. Depending on the type of activated receptor DCs may generate a Th1/Th17 pro-inflammatory response. Thus, to exemplify, the NLR2 induced by commensal bacteria appears to play a central role in the downregulation of the GALT inflammatory activity and the ability of DCs to induce a polarized CD4eriments .+Th2 phenotype in the periphery , promotion of Treg cells and of CD4eriphery . The inderiphery . ConsequE. coli-derived LPS activates inflammatory mechanisms  whereas the stimulation with LPS derived from Poprhyromonas gingivalis induces IL-4 production and a Th2 response , intra-epithelial lymphocytes, macrophages, DCs, mesenteric ganglia, secretory IgA (sIgA) cells and lymphatics.Peyer’s patches localized in the mucosa and submucosa of the small intestine are covered by a “follicle-associated epithelium” containing specialized “M cells”. These cells engulf and transport antigens from the intestinal lumen to intestinal DCs where T cell lymphocytes (LT) are primed . LT subs+DCs involved in Foxp3 expression and intestinal conversion of naïve CD4+T cells into Treg cells. Commensal flora stimulates CD103+ DCs through the activation of specific receptors or through its own metabolic products such as SCFAs  inducing histone acetylation, and histone deacetylases (HDACs) inducing histone deacetylation. During acetylation, the chromatin structure loosens and can be accessed by transcription factors. HDAC inhibitors increase histone acetylation and subsequently regulate gene expression in numerous immune cells such as epithelial cells, neutrophils, APCs and T cells. On the contrary, deacetylation of histones by HDACs prevents gene transcription. Thus studies performed or HSP90 . The NF-or HSP90 , septic or HSP90 , or inflor HSP90 . Likewisor HSP90 . P53-medor HSP90 , while Hor HSP90 . Severalor HSP90  while otor HSP90 . It has or HSP90 .By inhibiting HDAC, SCFAs could therefore control numerous infectious and immune processes . AlthougE. coli (MicroRNAs (miRNAs) are small, evolutionary conserved non-coding RNAs of approximately 19-23 nucleotides involved in the post-transcriptional regulation of cellular mRNAs. The biogenesis of mature miRNA includes a two-step cleavage process from primary miRNAs (pri-miRNA). The mature miRNA is then loaded into the effector complex RNA-induced complex (RISC). RISC interacts with target mRNA and induce mRNA cleavage or translational repression hence controlling diverse metabolic or cellular pathways including cell cycle progression, differentiation, apoptosis, immune regulation or oncogenesis . miRNAs E. coli  act as pE. coli  and viruE. coli . The rolIntestinal miRNAs are released by IECs  and are Helicobacter pylori, Citrobacter rodentium, Listeria monocytogenes, Francisella tularensis, and Salmonella enterica) induce a different miRNA panel mainly represented by miR-155 and miR-146  , epithelH. pylori or Salmonella Typhimurium  , 2014, whimurium .Pathogenic bacteria also release membrane or outer-membrane vesicles containing sRNAs that modulate the host miRNA profile and gene expression . Some stVarious miRNAs have been correlated with intestinal oncogenesis according to human studies. In this respect miR-182,-503 and miR-17∼92 clusters modulate glycan production and correlate with the growth of certain bacteria which could potentially initiate the microenvironmental changes in colorectal cancer . Gut miREnteric pathogens alter the intestinal barrier, antagonize the intestinal microbiota, and trigger enteral infections through various mechanisms including increased intestinal inflammation, the release of bacteriocins and upregulation of AMPs and toxin delivery secretory systems  as well as the exploitation of nutrients or intestinal niches  and allow the overgrowth of species belonging to the Proteobacteria phylum   . Antibioamilies) .Bacteroides thuringiensis and the Lachnospiraceae and Ruminococcaceae families  from a healthy donor. The effectiveness of FMT in the management of t health .E. coli, a common gut resident  accompanied by a detrimental increase of intestinal pathobionts such as E. coli or Staphylococcus and Pseudomonas species (E. coli and Pseudomonas aeruginosa) acquire additional virulence genes during colonization or even change their morphotype after translocation to express virulence genes and to avoid host defense mechanisms giving rise to gut-derived sepsis  decreases epithelial apoptosis as well as the release of cytokines and bacterial translocations in experimental mice models  and further releases its own antibacterial products  involved in the intestinal homeostasis  and the dramatic decline of commensals such as Roseburia, Bifidobacterium, and Lactobacillales (Clostridia species (the clusters XI and XIVab), the Bacteroidales-Prevotella group and butyrate-producing Roseburia genus , antibiotics (Rifaximine), gut-derived hormones and even FMT for the manipulation of the gut-liver axis  initially arise due to the imbalance of the epithelial barrier turnover . In times circle . Thus dyBacteroides in favor of Proteobacteria  and the significant reduction of symbionts throughout the entire intestinal tract  could reactivate both unintegrated HIV-1 genomes and latent HIV proviruses through HDAC inhibition along with other transcription factors and concurrently explains HIV immunosuppression during ART (Intestinal dysbiosis occurs early during HIV and is aggravated by ART itself . Hence, activity . Otherwiring ART . The rolring ART . Consequring ART .Cl. perfringens expressing HIV-1 Gag protein (In conclusion, HIV pathogenesis involves the loss of the immunomodulatory gastrointestinal activity, bacterial translocations and intestinal dysbiosis, independent of ART. Current therapeutic strategies are modest and based on few studies in humans or macaques: the administration of probiotics , anti-in protein .The microbiota, the intestinal epithelia and mucosal immunity form an anti-infectious barrier rigorously regulated through complex mechanisms. The host-microbiota-pathogen interactions employ numerous cell receptors and molecules with antibacterial and anti-inflammatory roles, which also modulate the epigenetic and immune response. Together with epithelial and immune cells, these signaling molecules form a network that is essential for intestinal homeostasis and anti-infectious defense. Dysbiosis renders these defense mechanisms non-functional. It consequently aggravates gastrointestinal infections, favors bacterial and LPS translocations in sepsis, unbalances the immune defense in hepatitis viruses and HIV replications and controls the progression of infectious diseases to an unknown extent. A better knowledge on the interactions driving the antimicrobial response of the intestinal barrier is therefore crucial to improve the current anti-infectious armamentarium.Both authors contributed equally to the acquisition, analysis, and critical revision of the manuscript, gave their consent for the publication, and agreed to be responsible for the accuracy and integrity of the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
-{"text": "In vitro, astragalin inhibited the expression of matrix metalloproteinases  dose-dependently in TNF-α-induced MH7A cells, with no apparent cytotoxicity. Furthermore, astragalin suppressed the phosphorylation of p38, JNK, and the activation of c-Jun/AP-1 in TNF-α-induced MH7A cells. In conclusion, it has proven that astragalin could attenuate synovial inflammation and joint destruction in RA at least partially by restraining the phosphorylation of MAPKs and the activating of c-Jun/AP-1. Therefore, astragalin can be a potential therapeutic agent for RA.Astragalin, as a bioactive flavonoid with anti-inflammatory, antioxidant, and protective properties, provides a potential agent for rheumatoid arthritis (RA). In this study, its therapeutic efficacy and the underlying mechanisms were explored using DBA/1J mice with collagen-induced arthritis (CIA). It was demonstrated that astragalin could significantly attenuate inflammation of CIA mice. The effects were associated with decreased severity of arthritis (based on the arthritis index), joint swelling and reduced bone erosion and destruction. Furthermore, astragalin treatment suppressed the production of pro-inflammatory cytokines , and inhibited the expression of matrix metalloproteinases  in chondrocytes and synovial cells of CIA mice. Fibroblast-like synoviocytes derived from RA patients (MH7A cells) were applied to verify these effects.  Rheumatoid arthritis (RA) is a chronic autoimmune joint disease, which is characterized by inflammation of synovial tissue and the destruction of bone and cartilage in multiple peripheral joints . RA is eAstragalin, also known as kaempferol-3-O-glucoside, is a newly found flavonoid from leaves of persimmon and green tea seeds and has been used for treating many diseases for a long time . Severalin vivo and its underlying mechanisms in MH7A RA-derived FLSs in vitro.In this study, we investigated the role of astragalin in the regulation of synovial inflammation and joint destruction in a collagen-induced arthritis (CIA) mouse model ® 488) ; Actinomycin D (cat. # A1410), 4′,6-diamidino-2-phenylindole (cat. #D9564) from Sigma ; cell culture medium, fetal bovine serum and trypsin from Gibco .Astragalin  were provided by the Vital River company . Ten of these mice were assigned to the negative control group and thirty to the experimental group. This study was approved by the Medical Ethics Committee of Shanghai University of Traditional Chinese Medicine. The methods applied in this study were carried out in accordance with the approved guidelines and regulations.Collagen-induced arthritis model was established according to a previous protocol . BrieflyDBA/1J mice were randomly divided into four groups (10 mice/group). Group 1 was used the non-immunized mice (Control), whereas mice in group 2–4 were used the CIA mice. Group 2: mice treated with PBS, 0.2 ml/day/intraperitoneally (CIA-Veh); Group 3: mice treated with MTX, 0.1 mg/kg/3 day/intraperitoneally (CIA-MTX); Group 4: mice treated with astragalin, 5 mg/kg/day/intragastrically (CIA-Ast). All the mice from these groups received additional treatments between day 22 and day 50. The time diagram of the process of CIA induction and treatment is shown in Collagen-induced arthritis was considered to have successfully developed when swelling was observed in at least one digit or paw. The global assessment, arthritis index, swollen joints count, and hind paw thickness were scored and recorded every 5 days in a blinded manner as reported before. The severity of arthritis in each of the four paws was scored with a 0–4 scale by visual evaluation of each paw as follows: 0, no evidence of erythema and swelling; 1, erythema and mild swelling confined to the tarsals or ankle joint; 2, erythema and mild swelling extending from the ankle to the tarsals; 3, erythema and moderate swelling extending from ankle to metatarsal joints; 4, erythema and severe swelling encompass the ankle, foot, and digits, or ankylosis of the limb. The final score for each mouse was the sum of the four paws. Thickness of the ankle was measured with digital calipers placed across the ankle joint at the widest point.After 7 weeks of treatment, the knee and ankle joints of these mice were examined using the Vevo 2100 imaging system . Both B mode and color Doppler were scanned with the 550 scan head, 40–50 MHz probes, wall filter = 3 mm/s, scan speed = 2 mm/s, dynamic range = 65.0 dB, the pulses to radiofrequency cycle number = 2, the pulse repetition frequency = 6 kHz, after the 2-dimensional (2D) images were obtained in real time, the images were analyzed and measurements manually determined and calculated using the Vevo LAB software studio measurement package. The Vevo LAB software was then used to construct the scans into a 3-dimensional (3D) image, which allowed for accurate volume measurement and image sculpting creating a visual representation of the knee and ankle joints.On day 50, mice were sacrificed, the left knee and ankle joint tissues were collected and fixed in 4% paraformaldehyde, then decalcified in 10% EDTA for 20 days. Thereafter, the tissues were embedded in paraffin and sectioned using routine methods, and stained with hematoxylin and eosin (H&E). The joint sections were measured using a scale of 0–3 for grading the synovial inflammation, pannus formation, and destruction of bone and cartilage.On day 50, the mice were sacrificed, and their right legs were excised and fixed in 4% formalin for 1 day. A micro-CT (SCANCO μCT80) was used to estimate the structural status in the right knee and ankle joints. The X-ray tube voltage was 55 kV and, the current was 72 μA, with a voxel size of 10 μm. The segmented images were 3D-reconstructed using the SCANCO proprietary software. Joint bone radiological destruction was scored on a scale from 0 to 3: 0, no damage; 1, minor; 2, moderate; 3, severe.2O2) for 10 min. Next, the tissues were incubated with primary antibodies against MMP-1, MMP-3, MMP-13 at 4°C overnight. After washing the tissues with PBS for three times, secondary antibodies were added and incubated for another 1 h; then the signal was amplified with HRP-conjugated streptavidin using a Vectastain Elite ABC kit .The above-described paraffin-embedded knee and ankle joint tissues were deparaffinized with ethanol and xylene. After being hydrated in PBS, tissues were blocked with 0.3% hydrogen peroxide  was added to each well of the plate and incubated at 37°C for 1.5 h. The resulting optical density was detected at 450 nm by a microplate reader.Cell viability was determined using the CCK-8 assay as described previously . BrieflyΔΔCt method. The primer sequences (forward and reverse) were as follows: for MMP-1, 5′-CTCAATTTCACTTCTGTTTTCTG-3′ and 5′-CATCTCTGTCGGCAAATTCGT-3′; for MMP-3, 5′-GGCTTCAGTACCTTCCCAGG-3′ and 5′-GCAGCAACCAGGAATAGGTT-3′; for MMP-13, 5′-CAAGATGCGGGGTTCCTGAT-3′, 5′-AATGCCATCGTGAAGTCTGGT-3′.MH7A cells were pretreated with astragalin  for 2 h and then incubated for another 24 h in the presence or absence of TNF-α (10 ng/mL). Total RNA was extracted using Trizol reagent according to the manufacturer’s instructions and each sample was reverse transcribed using the cDNA synthesis kit according to the manufacturer’s protocol. Real-time PCR analysis was performed using SYBR Green PCR Premix Ex Taq II reagents on a CFX96 real-time system . Relative gene expression was calculated by the ∗106 cells/well) for 24 h, then pretreated with astragalin  for 2 h, then incubated for another 24 h in the presence or absence of TNF-α (10 ng/ml). Cell culture supernatants were collected and stored at -80°C until analysis. The concentrations of the cytokines in serum and culture supernatants were determined by ELISA using a commercial kit according to the manufacturer’s instructions.On day 50, the mice were sacrificed, serum samples were extracted from peripheral blood and stored at -80°C until analysis. MH7A cells were seeded into 6-well plates , and then exposure to TNF-α (10 ng/ml) for 0.5 h. The protein was collected, 30 μg of protein from each sample was separated by 15% SDS-PAGE and transferred to polyvinylidene fluoride membrane. After blocking with 5% bovine serum albumin in TBST at room temperature for 2 h, the membranes were incubated with the corresponding primary antibodies overnight at 4°C. After washing with TBST for three times, the membranes were incubated with the secondary antibodies. Proteins were scanned using the ECL detection system. The gray values of protein bands were analyzed using ImageJ software.MH7A cells were seeded on a round coverslips in 24-well plates for 24 h, and then pretreated with astragalin (200 μM) for 2 h, stimulated with TNF-α for 0.5 h, fixed with 4% paraformaldehyde for 15 min and then permeated with 0.2% Triton X for 20 min. After blocking with 5% bovine serum albumin at room temperature for 0.5 h, cells were incubated with the anti-phospho-c-Jun antibody overnight at 4°C and then incubated with the goat anti-rabbit IgG H&L secondary antibody for 1 h at room temperature. The nuclei were visualized using 4′,6-diamidino-2-phenylindole (DAP). The coverslips were mounted onto glass slides and images were recorded by an Olympus BX-51 microscope.t-test were used to determine differences between groups. As to three groups treated at different times points, two-way ANOVA comparison was performed. p < 0.05 was considered statistically significant.The data were reported as mean ± standard error of the mean (SEM). Significant differences were assessed using GraphPad Prism 7.0 software . One-way ANOVA followed by Dunnett’s in vivo, we established CIA mouse model. Treating mice with astragalin initiated at 22 days after the first immunization. Assessment of the severity of the arthritis was observed every 5 days after the booster injection. Compared with the negative control group, the CIA model mice showed a slight body weight loss  in combination with the Doppler technique has already been used to quantify synovial inflammation by measuring the increased joint space volume and blood flow in CIA mice . The volA histopathological evaluation of the knee and ankle joints was performed to examine the degrees of arthritic damage. Severe synovial hyperplasia, infiltration of inflammatory cells into synovial tissues, pannus formation, and cartilage and bone destruction were observed in the CIA mice. As expected, MTX significantly attenuated the pathological symptom of CIA in the knee and ankle joints. Consistently, astragalin also alleviated the histopathological arthritic damage in the CIA joints . The 3D Various cytokines regulate the pathogenesis of RA. The production of pro-inflammatory cytokines, particularly TNF-α, IL-1β, IL-6, and IL-8, may cause synovial inflammation and pain. MMP-1, MMP-3, and MMP-13 are essential factors for the degradation of joint cartilages. In the present experiment, the production of pro-inflammatory cytokines in the serum of CIA mice was determined using the ELISA kit, and the expression of MMPs in knee and ankle joint tissues were measured by immune-histochemical staining. As shown in in vitro increases MMPs production. To assess the potential cytotoxicity of astragalin, cell viability was evaluated by the CCK-8 assay. As shown in MMPs are mainly secreted by FLSs, which play a critical role in the destruction of joint cartilage . StimulaIn addition, the expression of MMPs is affected by transcriptional regulation and mRNA stability. To clarify the effect of astragalin on the mRNA stability of MMPs, we performed mRNA stability assays. MH7A cells were pretreated with astragalin (200 μM) or not for 2 h, then stimulated with TNF-α for 6 h. Actinomycin D (4 μg/mL) was added to the cells and then mRNA was isolated at time point 0, 2, 4, 6, and 8 h. The levels of MMPs mRNA stability were detected by RT-PCR. We found that astragalin did not alter the mRNA stability of MMPs –G.Previous studies have shown that the MAPK and AP-1 mediated pathways can regulate the expression of MMPs synthesis and inflammatory cytokines . To furtAstragalin is an extract separated from leaves of persimmon and green tea seeds, which possess potent biological effects including anti-inflammatory, antioxidant and anticarcinogenic activities . It showin vitro and in vivo experiments. In the present study, we found that CIA mice treated with astragalin had lower histopathology scores, inflammation, synovial hyperplasia, articular cartilage, and bone destruction. At the same time, astragalin significantly down-regulated the expression levels of MMP-1, MMP-3, and MMP-13 in cartilages and synovial tissues in CIA mice. Consistent with our in vivo findings, astragalin also profoundly inhibited TNFα-induced production of MMP-1, MMP-3, and MMP-13 in cultured MH7A cells. Taken together, these findings suggested that the joint-protective properties of astragalin may be mainly attributed to the down-regulation of MMPs expression.Destruction in articular cartilage and bone hallmarks the presence of RA . Osteoclin vitro increases MMPs production via transcriptional activation (Stimulation of RA-FLSs with TNF-α or IL-1 tivation . AP-1 bitivation . c-Jun ativation . Recent tivation , thus vaAP-1 belongs to the class of basic leucine zipper transcription factors. Its activity can be markedly increased in synoviocytes as a response to the stimulation of cytokines, such as IL-1β and TNF-α, through MAPK, AKT, and other signaling pathways . ActivatThe MAPK pathway is central to many host responses and is one of the major signaling pathway-transmitting signals to immediate early genes implicated in the regulation of cytokine responses . RegulatIn summary, our study demonstrated that astragalin markedly ameliorated synovial inflammation and joint destruction in CIA mice. The joint-protective properties of astragalin could be mainly attributed to the down-regulation of MMPs expression by inhibiting the JNK/p38/AP-1 pathways. Taken together, astragalin may serve as an effective therapeutic drug for RA.QL, QS, and YW conceived and designed the experiments. QJ and TW performed the research. HX analyzed the result. XW and YL wrote the manuscript draft. All authors have read and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
-{"text": "GreenPhylDB is available since 2007, after the release of the Arabidopsis thaliana and Oryza sativa genomes and has undergone multiple releases. With the number of plant genomes currently available, it becomes challenging to select a single reference for comparative genomics studies but there is still a lack of databases taking advantage several genomes by species for orthology detection. GreenPhylDBv5 introduces the concept of comparative pangenomics by harnessing multiple genome sequences by species. We created 19 pangenes and processed them with other species still relying on one genome. In total, 46 plant species were considered to build gene families and predict their homologous relationships through phylogenetic-based analyses. In addition, since the previous publication, we rejuvenated the website and included a new set of original tools including protein-domain combination, tree topologies searches and a section for users to store their own results in order to support community curation efforts.Comparative genomics is the analysis of genomic relationships among different species and serves as a significant base for evolutionary and functional genomic studies. GreenPhylDB ( Plant comparative genomics resources usually compare reference genomes to compute homology sequences and enable functional annotation transfer ,2,3,4,5.Until now, comparative genomics databases have not fully taken advantage of these new datasets. Here, we present an updated version of the GreenPhylDB, a database that features multiple genomes for 19 species  as well as 27 other species with single reference genomes, for a total of 46 genomes. Publicly available genomes were processed to generate representative pangenes (i.e. a set of representative or consensus sequences) for species that were used in multi-species sequence clustering. Resulting gene families were functionally annotated and analysed with orthology detection methods.We retrieved 132 publicly available datasets (coding DNA sequence and protein-coding genes) for 46  and asseBrachypodium distachyon dataset , protein sequences were aligned using MAFFT v7.313  paramet. For eacFor multi-copy clusters (multiple sequences per genome), we applied the same procedure as for single-gene copy clusters but added a preliminary step to select a representative sequence by cluster. Multiple sequence alignments were used to generate a distance matrix using distmat (Jukes-Cantor correction method) from EMBOSS v6.6 Figure . The matFor genotype-specific clusters , we generated a distance matrix between all sequences and the sequence with the lowest average distance (min(d/sum(d))) of all sequences was putatively considered as the most representative sequence. Those sequences were added to the pangene.e-value on the protein-coding genes of all other species genomes to predict their putative prediction accuracy. Sequences with a minimum of one hit in at least two species were added to the pangene; otherwise sequences were excluded.Finally, singletons (cluster of one sequence) were searched for similarity using DIAMOND  with a dMusa acuminata).As a unique identifier was required for each pangene, we defined a nomenclature with a prefix composed of the [5-letter UniProt taxonomy database code]_pan, followed by p (for protein) and an auto-increment of 6-digits , defining 4 levels of stringency (from 1 to 4) to take into account potential sub-classification and we obtained 9419, 18 805, 23 409 and 29 345 clusters, respectively.Pangenes and protein-coding genes of reference genomes (without pangenes) were searched all against all using DIAMOND. We then performed a clustering using TribeMCL   which enabled us to predict ∼17.8 million of orthologs and ∼1.8 million of in-paralogs  relationships. The pipeline was complemented by a Reciprocal Best Hits (RBH) method—computed between all pairs of genomes—that resulted in more than ∼12.1 million orthologous relationships.The previous phylogenetic-based methodology that we applied in the previous version has been conserved but uses a larger set of genomes to update our automated pipeline. The pipeline uses MAFFT for the multiple alignment step. FastTree 2 (v2.1.11)  was prefWith this updated version, the website has received a face-lift. It now takes advantage of the bootstrap and D3.js frameworks to improve the user experience and to be more responsive. Alternatively, it can also be accessed programmatically using Resource Description Framework (RDF) as implemented in AgroLD, a knowledge-based system relying on semantic web technologies .All cluster (or gene family) pages present the same type of information divided into several tabs :Gene family composition: a bar chart allows users to visualize at a glance the composition of the gene family by species  and PhyD3 . It is possible to filter and select only a subset of species of interest.The new page type for pangene sequences is a central and unique concept in this version as they were used for the clustering and homology predictions instead of all individual sequences that compose it. When browsing these pages, users can quickly see which genes are present or missing by looking at the status: core or dispensable compartments. Then, information related to the sequence composition is reported. Users can access information about pangene classification, the consensus sequence (except for singletons) with the multiple sequence alignments used to create it as well as related homology predictions Figure . In the The database can still be searched via keyword searches or by entering a query sequence for similarity search using DIAMOND (which replaces BLAST for faster processing), enhanced by new tools to further explore those datasets.A new interface has been designed to retrieve in a comprehensive and concise way all the information associated with gene family names, sequence annotation and annotations from InterPro and UniProt mappings.It is now possible to search sequences and associated clusters based on a combination of InterPro domain signatures. This can be particularly helpful when searching for transcription factors for which sequences must contain some domains but not others  as the MA tree search can be done by filtering on gene tree topologies . Users cWhile automatic clustering is a relevant and efficient starting point, sometimes limitations  are present and prevent access to ready-to-use datasets, justifying a deeper characterization that will eventually lead to a refinement of the automatic clustering. As a result, knowledge generated on individual gene families is often available only in publications and their supplementary information as PDFs. To encourage knowledge capture, we developed a section for advanced users to create and share their own gene families. Two methods are possible: users can either start from scratch and upload their data or use existing clusters and take advantage of multiples operations implemented in the ‘MyList’ features: such feature was indeed developed to facilitate intersecting, combining clusters. This new tool can be valuable during the review process by providing a unique identifier to referees—and eventually to users—to explore the structure and composition of the submitted gene family.In this section, we describe three possible uses that are enabled by this new GreenPhylDB version. Concrete examples related to each of them are further documented in Supplementary Data.You want to analyse a gene family with focus on a specific species sampling.search the gene family by keyword(s), locus gene ids or sequences using dedicated search families (toolbox menu).browse the family structure and explore sub clusters at level 2, 3 or 4.browse the family composition of the cluster (or a specific sub cluster) to list all the sequences and pangenes selecting one or several bars in the diagram. Export the selected sequences of interest using proposed file formats. if the gene family sequences are characterized by several protein domains, check possible additional sequences in the database using IPR2genomes (toolbox menu). For individual protein domains, its specificity is indicated in each gene family page . In case of additional analyses (e.g. addition of sequences from a new sequences genomes), you can create a ‘custom family’ by uploading the sequences on the website and share the link in a manuscript, with collaborators or reviewers during the review process for a user-friendly exploration of the dataset.You are interested in finding genes that are linked to a specific evolutionary scenario (e.g. duplicated genes in one species but not in another)retrieve full list of gene trees and related gene families using TreePattern (toolbox menu).browse examples gene families to see patterns (highlighted with dashed lines in the tree).click on the sequence name to access the family.browse the family composition of the cluster (or a specific sub cluster) to list all the sequences and pangenes selecting one or several bars in the diagram. Export the selected sequences of interest using proposed file formatsArabidopsis).You have a candidate gene in rice, maize or banana (or any of the 19 pangenes) and want to retrieve the related sequences in other genomes of the same species and then find orthologs in other species . check the multiple gene alignment to see level of divergence.go to the gene family and explore (or download) the gene tree.retrieve predicted orthologs . Alternatively, use the homologous sequence search directly (toolbox menu).This new version of GreenPhylDB provides a unique way to scale up plant comparative genomics studies across multiple plants species by leveraging pangenomic datasets. This release paves the way to the transition from reference-based genomics to pangenome-based systems and tools. In this context, the website includes new powerful search interfaces to explore the content of the gene family collection. Advanced users can also deposit the results of their expert gene family curation for further use and reference. GreenPhylDB is an important resource to understand the genetic basis of genome diversity among plant species and has the potential to accelerate gene discovery to support crop improvement.https://www.greenphyl.org/cgi-bin/downloads.cgi.All datasets produced by our automatic analyses are accessible via GreenPhylDB user interfaces or can be downloaded at gkaa1068_Supplemental_FileClick here for additional data file."}
-{"text": "There is a need for a quick assessment of severely ill patients presenting to the hospital. The objectives of this study were to identify clinical, laboratory and imaging parameters that could differentiate between influenza and COVID-19 and to assess the frequency and impact of early bacterial co-infection. A prospective observational cohort study was performed between February 2019 and April 2020. A retrospective cohort was studied early in the COVID-19 pandemic. Patients suspected of sepsis with PCR-confirmed influenza or SARS-CoV-2 were included. A multivariable logistic regression model was built to differentiate COVID-19 from influenza. In total, 103 patients tested positive for influenza and 110 patients for SARS-CoV-2, respectively. Hypertension (OR 6.550), both unilateral (OR 4.764) and bilateral (OR 7.916), chest X-ray abnormalities, lower temperature (OR 0.535), lower absolute leukocyte count (OR 0.857), lower AST levels (OR 0.946), higher LDH (OR 1.008), higher ALT (OR 1.044) and higher ferritin (OR 1.001) were predictive of COVID-19. Early bacterial co-infection was more frequent in patients with influenza (10.7% vs. 2.7%). Empiric antibiotic usage was high (76.7% vs. 84.5%). Several factors determined at presentation to the hospital can differentiate between influenza and COVID-19. In the future, this could help in triage, diagnosis and early management. Clinicaltrial.gov Identifier: NCT03841162 Seasonal influenza, caused by the influenza virus, causes 4–50 million symptomatic cases in EU/EEA and approximately 500,000 cases in Belgium per year , 2. MortThe coronavirus disease 2019 (COVID-19) pandemic, caused by the novel coronavirus SARS-CoV-2, resulted in 9,063,320 confirmed cases in the EU/EEA until 8th November 2020. Currently, 1,250,275 patients have died in the EU/EEA . On the The severity of both respiratory virus infections is partly dependent on host factors. The elderly and those with the underlying disease have higher chances for a severe disease course and are more frequently hospitalized , 8. SeveThe primary objective of this study is to compare risk factors and identify clinical, laboratory and imaging characteristics that can differentiate between influenza and COVID-19 at clinical presentation with sepsis and that could aid in the early triage and management of these patients. The secondary objective is to assess the frequency of early bacterial co-infection and its impact on the prognosis of patients with influenza and COVID-19.clinicaltrial.gov identifier NCT03841162). Adult patients presenting at the ED with suspected sepsis, defined as patients with symptoms of systemic infection for whom blood cultures were drawn, were asked to participate in the study. Patients who tested positive for influenza by PCR were included in this analysis.A prospective observational cohort study, as part of the Fast Assay for Pathogen Identification and Characterization (FAPIC) project, was performed between February 2019 and April 2020 at Jessa Hospital, Hasselt  were included for this analysis.In Jessa Hospital, for all patients presenting at the ED with suspected sepsis, blood cultures are performed to exclude bacteraemia. During the yearly influenza season (December–April), nasopharyngeal swabs for the detection of influenza were taken based on clinical suspicion. Since the emergence of COVID-19, SARS-Cov-2 PCR was performed according to the national case definition which was based on the WHO case definition guidance –16. AfteWritten informed consent was obtained from all participants with influenza. No informed consent was needed for the retrospective cohort study of COVID-19 patients, according to Belgian legislation. Documented approval for both studies was obtained from the Ethics committees of Hasselt University and Jessa Hospital.Nasopharyngeal swabs for influenza detection were analysed with real-time PCR, either with the ARIES® Flu A/B & RSV assay on the ARIES instrument (Luminex Corporation) or with an in-house multiplex PCR on Quantstudie 7 flex (ThermoFisher) for the simultaneous detection of 23 respiratory pathogens. If available, lower respiratory tract samples, such as sputum, bronchial aspirates or broncho-alveolar lavage fluid, were preferred.E-gene on the ARIES analyser (Luminex Corporation). In patients with a clinical suspicion based on history, laboratory and/or chest X-ray results, and a negative initial PCR test, a second nasopharyngeal swab or, if possible, a lower respiratory tract sample such as sputum, bronchial aspirates or broncho-alveolar lavage fluid, were collected after 24–48 h ). At a cutoff value of 0.49, the sensitivity was 83.5% and the specificity was 81.6%. The PPV and NPV of the logistic regression model were 82.6% and 82.5% respectively.In Table p = .011). Urinary antigen test for Streptococcus pneumoniae and Legionella pneumophila was performed in 59 patients with COVID-19 (53.6%) and in 81 patients with influenza (78.6%). Legionella pneumophila antigen was negative in all patients. Streptococcus pneumoniae antigen was not detected in any patient with COVID-19 but was positive in six patients with influenza. In Table p = .147).In Table This study shows the clinical, laboratory and imaging differences between patients with influenza and patients with COVID-19 who were suspected of sepsis at clinical presentation to the hospital. More patients with COVID-19 had cardiac comorbidities and hypertension than patients with influenza. Overall, COVID-19 was associated with worse clinical outcomes, a higher risk of ICU admissions, longer hospital stay, higher mortality and more discharge to a rehabilitation centre. Furthermore, abnormalities on chest X-ray were more often found in patients with COVID-19, compared to patients with influenza. Early bacterial co-infections were diagnosed in less than 10% of patients, although more frequently in patients with influenza compared to patients with COVID-19. Empiric antibiotics were prescribed to three-fourths of all patients.Cardiac comorbidities and hypertension were reported as risk factors for mortality in patients with COVID-19  while thUnivariate analyses in our study confirm the findings in the Chinese ARDS patients study, showing higher body temperature in patients with influenza and higher levels of CRP, LDH and AST in patients with COVID-19 .The finding that patients with COVID-19 with abnormalities on chest X-ray had more often bilateral abnormalities is in accordance with previous studies [In the best-fitted multivariable logistic regression model, the presence of hypertension, unilateral and bilateral chest X-ray abnormalities, lower body temperature, absolute leukocyte count and AST, and higher LDH, ALT and ferritin were able to predict COVID-19 and differentiate the infection from influenza. The model could very accurately predict COVID-19 with a sensitivity of 83.5% and a specificity of 81.6%. Luo et al. described a diagnostic model combining 18 routine biochemical tests. The model could distinguish between influenza and COVID-19 with an accuracy of 69.6% . The higLastly, our finding that bacterial co-infections are less frequent in patients with COVID-19 is supported by a meta-analysis performed by Lansbury et al. . The preOne of the strengths of this analysis is the availability of two large datasets. Both patient groups were similarly defined, and this resulted in a high number of severely ill patients included. The prospective data collection resulted in data of high quality and both cohorts had a low number of missing values. This study has some limitations. Patients with influenza were included during two consecutive seasons, while the patients with COVID-19 were included in 1 month. Second, we did not collect data on all features and risk factors that are known to be associated with COVID-19 such as obesity and coagulation abnormalities. Early in the pandemic, coagulation tests were not routinely performed in the absence of symptoms suggesting thrombotic events. Obesity is a risk factor for both severe influenza and severe COVID-19 , 24. ThiIn conclusion, differences in clinical, laboratory and imaging characteristics between patients with influenza and patients with COVID-19 presenting with suspected sepsis were identified. Early bacterial co-infection in COVID-19 seems to be rare. Empirical antibiotics should be reserved for patients in whom a bacterial infection is suspected. A multivariable logistic regression model was used to define factors that can differentiate between influenza and COVID-19 in this population. In the future, these early features could help in rapidly triaging patients during the influenza season. Future studies should validate our results in larger cohorts."}
-{"text": "While several studies have described the clinical course of patients with coronavirus disease 2019 (COVID-19), direct comparisons with patients with seasonal influenza are scarce. We compared 166 patients with COVID-19 diagnosed between February 27 and June 14, 2020, and 255 patients with seasonal influenza diagnosed during the 2017–18 season at the same hospital to describe common features and differences in clinical characteristics and course of disease. Patients with COVID-19 were younger  and had fewer comorbidities at baseline with a lower mean overall age-adjusted Charlson Comorbidity Index  than patients with seasonal influenza. COVID-19 patients had a longer duration of hospitalization , a more frequent need for oxygen therapy  and invasive ventilation  and were more frequently admitted to the intensive care unit  than seasonal influenza patients. Among immunocompromised patients, those in the COVID-19 group had a higher hospital mortality compared to those in the seasonal influenza group . In conclusion, we show that COVID-19 patients were younger and had fewer baseline comorbidities than seasonal influenza patients but were at increased risk for severe illness. The high mortality observed in immunocompromised COVID-19 patients emphasizes the importance of protecting these patient groups from SARS-CoV-2 infection. While the strain that COVID-19 places on healthcare systems, economies, and societies worldwide is unprecedented, comparisons have often been drawn with the 1918 influenza pandemic4. Also, the pandemic preparedness plans currently used in many countries are largely based on the experience of several influenza pandemics during the last decades5. Thus, a detailed understanding of common features and differences of patients with SARS-CoV-2 and influenza virus infections in the hospital setting can help to plan resources in this ongoing outbreak. COVID-19 and seasonal influenza are viral respiratory infections that are primarily transmitted from person-to-person via respiratory droplets or aerosols among close contacts8. The clinical presentation of both infections is highly variable and ranges from only mildly symptomatic cases to acute respiratory distress syndrome (ARDS) and death9. However, there remains substantial uncertainty regarding the differences between COVID-19 and seasonal influenza with respect to high-risk-populations, clinical course, and case-fatality rates. Most previous studies describing the clinical course of COVID-19 lack a control group13, and data comparing patients with SARS-CoV-2 infection to patients with other viral respiratory infections such as seasonal influenza in the hospital setting are limited19. This single-center observational study aimed to systematically compare demographics, clinical characteristics, and disease outcomes of two non-selected cohorts of consecutive patients with SARS-CoV-2 infection and influenza virus infection, respectively, who were all treated at the University Medical Center Hamburg-Eppendorf.On March 11, 2020, the WHO declared the coronavirus disease 2019 (COVID-19), caused by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), a pandemici.all adult patients with SARS-CoV-2 infection confirmed by RT-PCR between February 27 and June 14, 2020, treated at the University Medical Center Hamburg-Eppendorf.ii.21.all adult patients with seasonal influenza virus infections confirmed by RT-PCR treated at the University Medical Center Hamburg-Eppendorf between December 25, 2017, and April 8, 2018, which is the definition of the influenza season by the Robert Koch Institute, Germany's national public health institute22.The study was reviewed and approved by the Ethics Committee of the Medical Council of Hamburg (WF-017/18 and WF-052/20). Informed consent was waived by the same ethics committee since only anonymous data were analyzed and published. All experiments were performed in accordance with relevant guidelines and regulations. We did not include psychiatric patients and patients younger than 18 years in the study. Also, employees who were diagnosed with COVID-19 by our institution’s screening algorithm but did not require hospitalization were not included in the studyWe conducted a retrospective observational study at the University Medical Center Hamburg-Eppendorf to compare two patient cohorts:23 throughout the influenza season. After the first case of COVID-19 was confirmed in Germany in January 202024, all symptomatic patients were additionally screened for SARS-CoV-2 infection by RT-PCR using either a laboratory developed test for the NeuMoDx 96 system 25, a Cobas6800 IVD , a GeneXpert Xpress System  or a Cobas6800-based UCT 26. Only patients with influenza or SARS-CoV-2 infection confirmed by RT-PCR were included in this analysis.According to our hospital standards, all patients admitted with fever or respiratory symptoms were screened for influenza infection by RT-PCR using either the GeneXpert Xpress System  or a laboratory-developed assay21. For the current study, COVID-19 and influenza patients were stratified according to whether they were treated as outpatients in our emergency department, were admitted to regular wards of our hospital, or had to be admitted to the intensive care unit (ICU). The age-adjusted Charlson Comorbidity Index (ACCI) was applied to assess comorbidities28. Patients were classified as immunocompromised if they were allogeneic stem cell transplant recipients, had a hematopoietic malignancy known to cause immune dysfunction or if they received systemic immunosuppressive therapy, chemotherapy, or immunomodulatory agents .Antiviral treatment was defined as administration of a specific antiviral agent against influenza and COVID-19, respectively. Patients who participated in placebo-controlled, double-blind treatment studies were assigned to the treatment group for this analysis. Immunotherapy was defined as administration of convalescent plasma, the anti-IL-6 antibody tocilizumab, or the anti-adrenomedullin antibody adrecizumabContinuous variables were expressed as mean and standard deviation (SD) or median and interquartile range (IQR) and compared with Student’s t-test. Categorical variables were expressed as number (%) and compared by Fisher's exact test. A log-rank test was used to compare the proportion of patients discharged alive during the first 90 days of hospitalization. P values less than 0.05 were considered statistically significant. Figures were designed using GraphPad Prism version 8 for macOS . All other analyses were performed using SPSS, version 21.0 .21. The baseline characteristics of both groups are listed in Table Between February 27 and June 14, 2020, a total of 166 patients with SARS-CoV-2 infection were treated at the University Medical Center Hamburg-Eppendorf. During the 2017–18 influenza season, 255 patients with laboratory-confirmed seasonal influenza were treated at our centerAmong COVID-19 patients, the proportion of men was higher than in influenza patients . Patients with SARS-CoV-2 infection were younger  and had a lower overall ACCI  than patients with seasonal influenza  and renal replacement therapy  than influenza patients. The rate of patients receiving extracorporeal membrane oxygenation (ECMO) did not significantly differ between the two groups. A total of 27 (16.3%) patients with COVID-19 and 62 (24.3%) patients with seasonal influenza received specific antiviral therapy (P = 0.05). In addition, 15 (9.0%) patients in the COVID-19 group received immunotherapy with convalescent plasma, tocilizumab, or adrecizumab. There was no statistically significant difference between the two groups in the rate of patients receiving antibiotic therapy during the hospitalization  , bacterial  and fungal  co-infections was similar in both groups and also the overall spectrum of pathogens did not significantly differ between COVID-19 patients and influenza patients . Among those patients admitted to the ICU, no differences in mortality were observed between the two groups . Among all immunocompromised patients, those in the COVID-19 group had a higher mortality compared to those in the seasonal influenza group . Among patients with SARS-CoV-2 infection, mortality was significantly increased in immunocompromised compared to immunocompetent individuals . In contrast, no significant difference in mortality was observed between immunocompromised and immunocompetent patients with seasonal influenza .Notably, all five allogeneic stem cell transplant recipients in the COVID-19 group and one in the seasonal influenza group (14.3%) died  and 176 were infected with influenza B virus (IBV). While the hospital mortality did not differ between patients with IAV and IBV infections , the rate of patients requiring mechanical ventilation was significantly higher in patients with IAV virus infections  compared to patients with IBV infections .We further compared demographic information, comorbidities, and immune status of patients treated as outpatients, those admitted to regular wards and those admitted to the ICU between the COVID-19 group and the seasonal influenza group (see Supplementary Table In this current study, we directly compared a cohort of 166 consecutive patients with COVID-19 with all 255 patients diagnosed with seasonal influenza during the 2017–18 season treated at the University Medical Center Hamburg-Eppendorf. This comparative approach allowed us to identify common features and differences between those two respiratory infections in the identical hospital setting and provide indications of the strain the COVID-19 pandemic places on hospital resources and capacities.32. Even though currently available data indicate similar overall COVID-19 case numbers in men and women33, male sex has been linked to a generally more severe course of disease with more frequent need for hospitalization and an excess in case fatality rates35. While the detailed mechanisms underlying those observed sex-differences remain to be established, our study contributes to the growing body of evidence suggesting that male sex is a major risk factor for severe COVID-1918.An important finding to emerge from this comparison is that the majority of COVID-19 and influenza patients were men and that this male predominance was even more pronounced in COVID-19 patients. These observations are consistent with previous studies that have demonstrated a higher overall incidence of seasonal influenza and higher disease severity in male compared to female patients37 and with a recent cohort study analyzing electronic healthcare databases of the US Department of Veterans Affairs that observed a mean age of 69 years19. However, our observation that patients with SARS-CoV-2 infection are generally younger than seasonal influenza patients is consistent with previously published data18. Interestingly, among patients that were admitted to the ICU, age did not significantly differ between the two groups. Also, patients requiring ICU admission were significantly older than those treated on regular wards or as outpatients in the COVID-19 group but not in the seasonal influenza group. These findings suggest that age may potentially be a more important driver of disease severity for COVID-19 than for seasonal influenza37.Another remarkable observation is that patients with SARS-CoV-2 infection were significantly younger than those with seasonal influenza. The median age of COVID-19 patients in our study was lower than in recent multi-center cohort studies of patients hospitalized with SARS-CoV-2 infection in Germany that observed a mean age of 68–70 years18. In our study, COVID-19 patients had a significantly lower ACCI than influenza patients, reflecting a lower overall prevalence of comorbidities. Interestingly, among patients admitted to the ICU, mean ACCI did not differ between the two groups, suggesting that comorbidities may be stronger determinants of disease severity in COVID-19 patients than in seasonal influenza patients. This is further supported by the fact that in the seasonal influenza group, patients admitted to the ICU even had a lower mean ACCI than seasonal influenza patients treated on regular wards. These results may imply that COVID-19 more frequently causes severe disease requiring hospitalization in relatively healthy individuals compared to seasonal influenza but that patients at highest risk for critical disease requiring admission to the ICU are primarily older individuals with comorbidities for both respiratory infections. Remarkably, we observed a significantly lower prevalence of chronic respiratory diseases in COVID-19 patients than influenza patients in the subgroups admitted to regular wards as well in those admitted to the ICU. While underlying respiratory diseases are associated with more severe outcomes of both viral respiratory infections39, our observations suggest that chronic respiratory conditions may have an even higher impact on the severity of seasonal influenza than on the severity of COVID-19.Assessing the prevalence of specific comorbidities in COVID-19 patients is paramount to identify and protect patient groups at high risk for severe disease. However, many studies characterizing COVID-19 patients are hampered by the lack of control groups, and the comparability of patient cohorts from different countries or different clinical settings is limited. For example, a large cohort study based on electronic health records and claims data showed that compared to influenza patients, COVID-19 patients had fewer comorbidities in the USA but more comorbidities in South Korea40 and 5–8% for seasonal influenza42. Of note, a number of patients with acute leukemia with SARS-CoV-2 infection experienced a severe clinical course with high hospital mortality and contributed to the relatively high overall mortality in the COVID-19 group. Indeed, while the attributable risk of many immunocompromising conditions and immunosuppressive therapies on severity and outcome of COVID-19 yet needs to be established, there is some evidence that patients with hematological malignancies are at increased risk of severe COVID-1945. Likewise, there is evidence that immunocompromised individuals have a higher risk for influenza-associated complications46. However, no significant effect of immunosuppression and immunodeficiency on overall mortality was observed for influenza patients in our cohort. This might either result from a generally lower severity of immunocompromised state in patients with seasonal influenza compared with COVID-19 patients or reflect a lower impact of immunocompromised state on disease outcome of seasonal influenza compared to COVID-19. Notably, amongst immunocompetent patients, those with COVID-19 had a more severe overall course of disease than those with seasonal influenza, but mortality did not significantly differ between the two groups.Even though COVID-19 patients were generally younger and healthier than influenza patients, the overall course of disease was more severe, with fewer patients treated as outpatients, longer overall duration of hospitalization, more frequent admission to the ICU, more frequent need for oxygen therapy, and invasive ventilation. The overall in-hospital mortality in our cohort was 15.9% in COVID-19 patients and 9.0% in influenza patients. This significantly higher case fatality rate among patients hospitalized with SARS-CoV-2 infection is generally in line with large multi-center observational studies, which have shown an overall in-hospital mortality of 15–22% for COVID-1947, HFNC has been suggested to benefit COVID-19 patients with acute hypoxemic respiratory failure without this increased risk of SARS-CoV-2 transmission to patients and healthcare workers49.Remarkably, eight patients with SARS-CoV-2 infection were successfully treated with HFNC and did, therefore, not require tracheal intubation. While NIV is associated with an increased risk of aerosolization and nosocomial transmission50. More recently, several studies have reported a high prevalence of invasive pulmonary aspergillosis in COVID-19 patients admitted to the ICU54, suggesting that those patients might be at equally high risk to develop co-infections with Aspergillus. Our observations emphasize that clinicians need to be aware of this complication in order to conduct prompt and comprehensive analysis in high-risk patients55.In our cohort, the prevalence of invasive pulmonary aspergillosis was similar among critically ill influenza and COVID-19 patients, even in the absence of underlying immunocompromising conditions and was associated with significant mortality. While invasive pulmonary aspergillosis typically occurs in severely immunocompromised hosts, it has also been shown to be a frequent complication in immunocompetent but critically ill patients with influenza infectionsWhile bacterial co-infections in general and the different causative bacterial pathogens, in particular, were equally common in seasonal influenza patients and COVID-19 patients, the latter were significantly less frequently treated with carbapenems and glycopeptides. The reason for this less frequent use of these broad-spectrum antibiotic classes may be a more established antibiotic stewardship program at our hospital in the 2020 outbreak versus the 2017–2018 season.21. Notably, the rate of patients requiring mechanical ventilation was significantly higher in patients with IAV infections compared to patients with IBV infections. These findings demonstrate that extrapolation of disease outcomes related to other influenza seasons should be performed with caution. Fourthly, the screening and treatment algorithm at our center was different for seasonal influenza and COVID-19. While generally only symptomatic patients are tested for influenza infections, all patients admitted to our hospital were screened for SARS-CoV-2 infection from April 20 onwards, which may contribute to sampling bias and result in a higher number of COVID-19 patients with mild or subclinical infections. COVID-19 patients were treated strictly according to a hospital-wide algorithm and, therefore, may, for example, have received low-flow oxygen at higher blood oxygen saturation levels than seasonal influenza patients. Lastly, it is important to note that the significantly lower age and fewer comorbidities in COVID-19 patients compared with influenza patients admitted to regular wards may also, to some extent, reflect a lower threshold for admitting patients with SARS-CoV-2 infection to the hospital due to the challenges of self-quarantine from household members and less data on reliable predictors for disease severity. Likewise, duration of hospitalization in COVID-19 patients may be prolonged due to PCR positivity and not due to clinical necessity, which may place additional strain on healthcare systems.Our study is subject to a number of limitations. Firstly, patients diagnosed at and referred to our tertiary care center may have generally more baseline comorbidities and a more severe course of disease than patients in different clinical settings, so our results may not apply to all other patient cohorts. Secondly, while COVID-19 and seasonal influenza are both viral respiratory infections that share a common transmission route and cause similar symptoms, they are subject to several important differences that considerably limit the comparability of our cohorts. While most humans have pre-existing immunity to seasonal influenza virus strains and vaccines are available for high-risk populations, the COVID-19 pandemic has demonstrated the potential impact of a novel pathogen on an immunologically naive population. Remarkably, only four of the 23 deceased seasonal influenza patients in our study cohort were vaccinated against seasonal influenza. Thirdly, given relatively low influenza case numbers throughout the 2019–2020 season, we compared COVID-19 patients to patients diagnosed with seasonal influenza throughout the 2017–18 season, when most laboratory-confirmed influenza cases were attributed to influenza B virus, and mismatch between the trivalent vaccine and the circulating strains occurredDespite those limitations, our study can provide some relevant insights into common features and differences in clinical characteristics and required hospital resources between patients with COVID-19 during the early phase of the pandemic and those with seasonal influenza. Prospective multi-center studies using standardized admission, treatment, and outcome protocols are needed to confirm the current findings and to assess the changes in morbidity and mortality of COVID-19 as well as of seasonal influenza throughout this evolving pandemic.In conclusion, we demonstrate that patients treated with SARS-CoV-2 infection during the early phase of the pandemic were younger and healthier than those with seasonal influenza infections. However, patients with SARS-CoV-2 infection had a generally more severe course of disease. These results suggest that this phase of the COVID-19 epidemic was associated with a higher demand for both critical care and regular care hospital beds than seasonal influenza epidemics with similar patient numbers. Importantly, the high mortality in COVID-19 patients with hematological malignancies and older patients emphasizes the importance of protecting these patient groups from SARS-CoV-2 infection. While patients hospitalized with SARS-CoV-2 infection in the future will likely differ from those in our cohort in clinical characteristics and disease outcome due to changes in disease epidemiology and novel therapeutic agents and strategies, our observations provide important insights for the future course of the COVID-19 pandemic.Supplementary Information."}
-{"text": "This work contains data on the computational, structural, and electronic characterization of supported ionic liquids phases anchored to copper nanoparticles using Density Functional theory calculations. The data supplement the paper “Interaction of supported ionic liquids phases onto copper nanoparticles: A Density Functional Theory study”  XPS and computational analysis gave mechanistic insights into the Cu NP stabilization pathways, where the anion adsorption onto Cu NP is favored compared to the cation adsorption. The stronger adsorption is observed for Cu@(I)SILP1 complex, which presents the more electron-rich triazole and the higher adsorption value of SILP onto Cu surface (5.18 eV). Computational studies of the adsorption of SILP onto Cu NPs allow evaluating the chemical and physical properties that govern these complexes stability. The schematic representation of Cu@(X)SILPs complexes is displayed in For this work, we designed a series of new triazolium-based supported ionic liquids (SILPs), decorated with Cu NP (Cu@SILPs). The triazoles moieties were functionalized using copper-catalyzed azide-alkyne cycloaddition. Three triazolium cations (T1adsE)  The Cu@SILPs complexes stability was characterized by the adsorption energy (Eads) , where tPREPE) and interaction energy (ΔINTE). The energy decomposition analysis based on absolutely localized molecular orbital (ALMO-EDA), implemented in Q-Chem 5.2 computational package  (0.05 mol%) was added and dissolved in water (5 mL). The reaction was stirred for 4 h at room temperature, and the progress of the reaction was monitored using thin-layer chromatography (TLC). After its completion, the reaction mixture was filtered, and the residue was dissolved in DCM. The combined organic layer was later concentrated in a vacuum to yield the corresponding triazoles.Alkyne , alkyl halide (1.0 eq.), and NaN2.32–I (5 g) was suspended in dry acetonitrile (30 mL), with stoichiometric amounts of triazoles1–3 and refluxed during 24 h. Then, the particles were collected by filtration and repeatedly washed with petroleum ether, and then dried off under vacuum at 110 °C for 4 h to obtain SILP1–3 powder. Based on the amount of IL on the SILP(I)1–3 supports, an excess (1.2 eq.) of NaBF4, KPF6, and LiNTf2 salts were dissolved in deionized water (25 mL) and added to the SILP(I)1–3 (1.0 g) in order to exchange the anions. The suspensions were vigorously stirred for 48 h. The mixtures were washed, centrifuged, and dried to yield the supports SILP(BF4)1–3, SILP(PF6)1–3, and SILP(NTf2)1–3.SiO2.42–I).Initially, 200 g mesh silica gel was soaked in 30% HCl overnight to hydrolyze its surface. Next, activated silica gel (100 g) was suspended in dry toluene (30 mL) in a round-bottom flask equipped with a reflux condenser under nitrogen. While being stirred, 3-iodopropyltrimethoxysilane (0.05 M) was added dropwise. The suspension was refluxed for 72 h. After cooling, the solid was collected by filtration and exhaustively washed by Soxhlet extraction with ethanol and water, and then dried under reduced pressure to yield iodopropyl–silica gel (SiO2.52×2H2O (0.25 mmol) and MeOH (20 mL) was added to SILP(X)1–3 (100 mg) under constant stirring at room temperature for 30 min. A solution of NaBH4 (5 mmol) dissolved in MeOH (3 mL) was added to the reaction mixture dropwise. The reaction mixture turned black due to the formation of Cu NPs that were washed with MeOH (3 × 10 mL) and Et2O (3 × 10 mL). Subsequently, the samples were isolated by centrifugation (4500 rpm) and dried under reduced pressure.A solution of CuCl2.6−9 Torr. Wide energy range survey scans were collected at pass energy of 80 eV in hybrid slot lens mode and a step size of 0.5 eV. High-resolution data on the C 1 s, N 1 s, and F 1 s photoelectron peaks were collected at pass energy 20 eV over energy ranges suitable for each peak, and collection times of 5 min, step sizes of 0.1 eV. The charge neutralizer filament was used to prevent the sample from charging over the irradiated area. The X-ray source was a monochromated Al Kα emission, run at 10 mA and 12 kV (120 W). The energy range for each ‘pass energy’ (resolution) was calibrated using the Kratos Cu 2p3/2, Ag 3d5/2, and Au 4f7/2 three-point calibration method. The data were charge corrected to the reference carbon adventitious signal at 284.8 eV. The transmission function was calibrated using a clean gold sample method for all lens modes and the Kratos transmission generator software within Vision II. The data were processed with CASAXPS (Version 2.3.17).XPS Experiment was collected by powder sample that was mounted on double-sided tape (Sellotape) and pressed to ensure proper coverage of the tape with the powder. X-ray Photoelectron Spectroscopy (XPS) measurements were performed using a Kratos AXIS Ultra DLD instrument. The chamber pressure during the measurements was 5 × 102.7−6 Hartree with no symmetry restriction. Stoll Fragmentation method employing Roothaan-step and exact SCF correction methods after the locally-projected equations. The basis set superposition error (BSSE) and dispersion D3BJ corrections were included.Calculations were calculated using Q-Chem 5.2 computational package ,4. For e2.8−6; criteria for displacement convergence: 1.0 × 10−7; minimal distance between Critical Points of 0.03 Bohr. Skip search if the distance between atoms is longer than the sum of their van der Waals radius multiplied by 1.80; and the criteria for determining if the Hessian matrix is singular of 1.0 × 10−50.The atom in molecules studies (AIM) were developed using the Multiwfn3.6 program 2.9Fragmental charges were calculated using the Charge Model 5 population analysis Kerry Wrighton-Araneda: Conceptualization, Formal analysis, Investigation, Methodology, Software, Validation, Visualization, Writing - original draft, Writing - review & editing. Cristián Valdebenito: Investigation, Writing - original draft, Visualization, Validation. Gabriel Abarca: Investigation, Conceptualization, Funding acquisition, Investigation, Methodology, Project administration, Resources, Software, Supervision, Writing - review & editing, Data curation. Diego Cortés-Arriagada: Investigation, Conceptualization, Funding acquisition, Investigation, Methodology, Project administration, Resources, Software, Supervision, Writing - review & editing, Data curation.The authors declare that they have no known competing for financial interests or personal relationships which have, or could be perceived to have, influenced the work reported in this article."}
-{"text": "Difference of perspective between patients and physicians over integrative medicine (IM) research and service provision remains unclear despite significant use worldwide. We observed an exceptionally low utilisation of IM and potential underreporting in diabetes. We aimed to explore the barriers and recommendations regarding service delivery and research of IM service among diabetes patients and physicians.A 10-group, 50-participant semi-structured focus group interview series was conducted. Twenty-one patients with diverse severity of disease, comorbidities and education levels; and 29 physicians  and 15 Chinese medicine (CM)) with diverse clinical experience, academic background and affiliation were purposively sampled from private and public clinics. Their perspectives were qualitatively analysed by constant comparative method.Seven subthemes regarding barriers towards IM service were identified including finance, service access, advice from medical professionals, uncertainty of service quality, uncertainty of CM effect, difficulty in understanding CM epistemology and access to medical records. Patients underreported the use of CM due to the concern over neutrality of medical advice among physicians. Inconvenience of service access, frequent follow-up, use of decoction and long-term financial burden were identified as key obstacles among patients. Regarding research design, ConM physicians emphasised standardisation and reproducibility while CM physicians emphasised personalisation. Some CM-related outcome measurements were suggested as non-communicable. Both physicians acknowledged the discordance in epistemology should be addressed by pragmatic approach.Key obstacles of CAM clinical utilisation are different between patients. Further assessment on IM should be pragmatic to balance between standardisation, reproducibility and real-world practice. Evidence-based IM programs and research should merge with existing infrastructure. Controversies on incorporating complementary and alternative medicine (CAM) into integrative medical (IM) care continue amid increasing utilisation and volume of evidence worldwide –5. It waHong Kong has a developed health system and the introduction of CM faces challenges similar to the western world , 11. WhiDiabetes is an alarming pandemic affecting 9.5% world adult population, accounting for 9.9% of global all-cause mortality , 21. DiaNevertheless, a service programme in Hong Kong revealed that only 20% of diabetes patients have ever considered CM as an option and only less than 2% have ever used CM as a treatment for diabetes or DKD which was way below the utilisation in other conditions (e.g. around 50% for cancer patients) . InteresWe aimed to explore the barriers and recommendations regarding IM service delivery among patients and physicians of conventional medicine and CAM, and subsequently identify key areas for research, education and service provision.We conducted a 10-group semi-structured focus group interview series on patients and physicians with constant comparative method. Participants were recruited from public and private clinics and teaching hospitals in Hong Kong.Sixty-one invitations were sent out. One patient rejected due to family issues and another 2 rejected due to difficulties in allocating time for the study. Five CM physicians rejected due to work engagement and 3 did not respond to email invitations.Fifty subjects were recruited  from October 2015 to June 2018. Patients aged 18 or above, diagnosed with diabetes / DKD and having follow-up at public outpatient clinics were included and sampled purposively from the consultations of general, renal and family medicine outpatient clinics of Queen Mary Hospital and Tang Shiu Kin Hospital to form 3 groups of 6–8 with diverse age groups, CKD stages, diabetes duration, co-morbidities and education levels to enrich data coverage.ConM physicians formed 3 groups of 3–6, and CM physicians formed 4 groups of 3–4. Physicians with experience in managing diabetes / DKD and were included and purposively sampled with diverse age groups, practicing duration, qualification and experience of ConM and CM, affiliating institutions, service sector (private / public) and involvement in research, administration and teaching.Participants were recruited face-to-face, though telephone or by email. The purpose of interview was explained to the participants by the research coordinator (K.W.C.). The process of recruitment, interview and analysis were iterative until data saturation was observed.The focus group interviews lasted 60–120 min  and were conducted privately in meeting places near participants’ workplace or residence.The interviews were facilitated by a moderator (P.W.L.) with 1) undergraduate public health training, 2) 2 years of in-depth interviews and focus group interviews moderation experience and 3) basic knowledge on CM, ConM and diabetes to ensure adequate skills and knowledge for conducting the interviews. The moderator was not involved in the conceptual design of the study, did not have prior contact with the study subjects, did not have conflict of interests with subjects and the research topic, and was informed about the group composition until 1 week before the interview. The identity of moderator was not disclosed to participants before interviews. He was working in public health administration sector but not involved in integrative medicine or diabetes issues in daily work during the period of study to avoid any potential conflict of interests. One to two clerical staffs were present at different interview sites for administrative support. The moderator recorded participants’ demographics with simple questionnaire and mediated the interviews.The discussion was built around consultation experience, concerns and expectations based on a semi-structured interview guide . The intInterviews were audiotaped and transcribed verbatim. Interviewees’ identity was preserved by using individual codes. Brief notes on interview content and behaviour of interviewees were made real-time during interviews and subsequently combined with the transcripts. The transcripts were cross-checked between 2 independent researchers .The transcripts were analysed using the constant comparative method  aided byCore coding was confirmed for the dataset after observing no new themes at the last round of interview. The finalised coding scheme was applied to index and chart the whole dataset. Charted result was translated by a bilingual investigator (K.W.C.) when used as illustrative quotations to best preserve original meaning. Analysis was completed in October 2018. The analysis process is summarised in Fig. n = 15) had formal credit-bearing ConM education in anatomy, physiology, immunology, pathology and internal medicine as CM undergraduate programmes contained substantial portion of ConM elements in Hong Kong. Table Demographics of subjects are presented in Tables Seven high-level themes  were identified with 25 subthemes. Data on barriers towards IM service and preferred model of integrative service delivery are summarised in Fig. Seven subthemes were identified regarding barriers towards IM service, including finance, inconvenience of access, advice from medical professionals, uncertainty of service quality, uncertainty of CM effect, difficulty in understanding CM epistemology and access to medical records.Finance was identified as a major practical issue against the use of CM / IM by patients. CM service in Hong Kong is financed through insurance and out-of-pocket payment. Government subsidised over 90% for ConM service  and compThe inconvenience of access to CM service, including frequent consultation and the use of raw herbs was also frequently mentioned among patients, although majority of them (61.9%) were unemployed / retired. Patients had a longer follow-up period of 3–6 months for ConM services when compared to 1–2 weeks for CM. Although CM physicians anticipated that inconvenience would affect compliance, they believed it was inevitable due to the personalised nature of CM.“CM is very troublesome. We need to treat the  medicine and attend consultation frequently. ConM doctors give you 3-month medication.” (Patient 5)While some patients were advised against CM by ConM physicians, they hesitated to comply as they believed ConM physicians could not decide the effect of CM. We sought to delineate the underlying mechanism of discouragement and the lack of understanding of CM effect  emerged as the key reason and is further dissected.“They (ConM physicians) do not know which CM physician you consulted and do not know what CM you have taken. How can they give an answer?” (Patient 10)“I advise them (patients) not to take CM as I do not know the interaction between CM and ConM.” (ConM 2)Uncertainty of service quality was a common concern among patients, ConM and CM physicians. Patients doubted CM physicians’ academic qualification and questioned the experience-based consultation of some CM physicians.“They  prescribe medicine based on experience. I do not know the effect after taking their medication.” (Patient 18)“If they (CM physicians) can prove CM does not adversely interact with ConM and they are registered, I do not disagree.” (ConM 12)“I advised them (patients) not to approach CM physicians who are not affiliated with hospitals or NGOs as I am not sure about their understanding on kidney disease or replacement therapy.” (ConM 14)ConM physicians were concerned about the standardisation of CM, interaction between CM and ConM and the background nephrology knowledge among CM physicians.All parties were uncertain about the efficacy of CM. A patient who experienced suspected CM nephrotoxicity suggested that the response to CM was personalised, as he experienced toxicity despite others’ positive feedback. CM physicians also acknowledged that there may not be adequate evidence to inform specific management. However, there were ambivalent opinions on the study design for further research, especially on clinical trials.“For CM, there is limited information on who is more responsive to treatment. You said you (another patient participant) got better after taking CM but I got worse. ConM is different.” (Patient 18)“As CM takes into account many factors including geographical and climatic effect … CM may not be reproducible and may not need to be reproducible.” (CM 15)ConM physicians well-noted that CM has different theory basis and clinical practice when compared to ConM. All parties agreed to emphasise more on the clinical effectiveness.“I studied a short course of CM … the fundamental concept of CM and ConM is very different. For example, when CM refers to heart, lung, liver, spleen and kidney, it is not the organ we understand, they link to five elements and ying yang which is hard to directly translate to ConM.” (ConM 3)“I am not concerned about the principles and methods behind (CM) but we have to be communicable and work on the same  outcomes.” (ConM 6)“(CM theory) is difficult to me. Even if they (CM physicians) wrote consultation notes, I could not understand … I do not understand how they monitor disease progress.” (ConM 1)However, ConM physicians suggested that it is hard to understand and translate CM-related clinical outcomes to their practice.ConM physicians raised concern that the CM medical record, especially hand-written prescription, was often unreadable. This imposed a risk of mishandling of patients under CM service. Also, ConM physicians were worried that the restricted access of investigations among CM physicians may affect clinical management. However, CM physicians who advocated traditional practice were less relied on investigation while other CM physicians suggested that investigations would help alert them critical conditions that require prompt management.“I am worried that CM does not have investigations.” (ConM 14)“I do not want so many consultations. Can you (CM and ConM physicians) both come to offer IM service so that I do not have to separate the consultations?...... I do not mind paying extra if it (IM) really works.” (Patient 1)Four subthemes including organisational management, consultation mode, CM-ConM communication and choice of CM service were identified under the theme ‘Preferred model of IM service delivery’. Data on consultation mode is presented below.vice versa.Majority of participants suggested that there was a need of physically combined service, preferably at the same institution. This would improve the confidence of patients and communication between physicians, leading to more efficient patient management. Patient also expected physicians to offer compromised IM treatment protocol as clinical solutions. Both ConM and CM physicians acknowledged that the combined treatment should be formulated according to the appropriate theory basis, i.e., CM treatment directed by CM theory and “If you reverse the role, you ask all ConM physicians to feel the pulse before prescribing ConM medicine, they will also feel uneasy. … ... We all do not want to follow a protocol that does not match our practice.” (CM 9)“I think collaborative service has a great potential but theory integration almost looks impossible. Even if we have a pharmacy offering both ConM and CM, it does not mean that CM physicians would accept us (ConM physicians) to prescribe CM based on ConM theory. Vice versa, it would be hard for us to accept CM physicians prescribing mycophenolic acid because the patient is having ‘qi deficiency’.” (ConM 7)This is the first focus group study comparing the expectation of patients and physicians regarding the use of IM service for diabetes, with the participation of family medicine, internal medicine and CAM physicians in addition to patients. We demonstrated that there was an expectation mismatch between patients (prefer physicians to design integrative treatment protocol and prefer biomarkers for disease monitoring), CAM physicians  and physicians of conventional medicine (prefer patients to make the choice of treatment).We investigated with a qualitative approach to explore unknown mechanism in the underutilisation and underreporting of CAM among diabetes patients and physicians and conducted focus group interviews to enhance interactions between participants with different experience. The interview guide was designed to explore more practical concerns and actual consultation experience from implementation perspective as existing literature is limited in this aspect. The guide was slightly tilted towards exploring how to integrate CM service into existing ConM system as majority of diabetes patients were receiving ConM as background treatment locally and internationally. The bias of interviewing skills and contents was minimised with an independent experienced moderator. Patients and physicians with different background hypothesised to offer divergent perspectives  were purposively sampled to enrich the content and coverage. As possible underreporting of IM utilisation was previously reported , we sepaData saturation, defined by having no emerged new key themes, was reached in the third round of interview among patients and ConM physicians, and the fourth round of CM physician interview. This reconciled with previous review and empirical studies that 80% of themes could be captured in 2 to 3 rounds of interview and data saturation usually occurred in the 3 to 4 rounds , 43. OnlExisting literature regarding the obstacles of IM emphasised cultural believe and research-related capacity. Our study echoed as uncertainty of service quality and effect of CM were identified as shared concerns among all stakeholders as summarised in Fig. Our findings further highlighted the importance of mutual understanding between physicians of different streams as any advices regarded unreasonable and unexplainable by patients would result in non-compliance and underreporting. In addition to the existing understanding, practical issues including inconvenience of access, frequent follow-up and financial burden were stressed among patients in this series, which were less documented and is likely related to the chronic nature of diabetes. Besides, we found that ConM with exposure to CM knowledge preferred more pragmatic and clinical evaluation of IM service as they recognise there is a fundamental difference in epistemology between ConM and CM. We also documented more practical concerns from the medical community for the consideration of further IM study designs.Convenience of access was frequently quoted by patients as a key barrier while it was not concerned by CM physicians. IM would lead to increased number of clinical visits. While frequent follow-up may provide patients with the best-tailored management, the required effort would compromise patients’ quality of life and increase the economic loss. Combined IM consultation under the same organisational structure was generally preferred by our subjects (both patient and physicians) as it enhances quality control, reduces time cost for consultation and facilitates sharing of medical records among physicians. Integrated clinics are increasingly common globally and provide a platform for physicians from different streams to design and evaluate IM protocols . High quIn contrast to many existing IM models globally that the decision and liability of IM use was shifted to the patients, requiring patients to actively search and critique the evidence themselves, our data suggested that patients expected physicians of different streams to optimise the IM protocol and offer integrated evidence-based recommendations for their informed decision making. This will require centralised and concerted effort in evaluating IM efficacy with parallel mechanism of existing statutory bodies, for instance NICE (UK), FDA (US) and NMPA (China), if not integrating IM procedures into these existing infrastructures.Interestingly, CM physicians from private sector believed the access cost of CM has driven patients to demand extra efficacy and quantifiable evidence when evaluating CM, which amplified the effect of lack of evidence, a well-known barrier. Patients reconciled that cost was one of the key barriers of using IM service. In Hong Kong, CM service is mainly financed through out-of-pocket payment and private insurance whereas ConM service is over 90% publicly subsidised. Comparable CM service of diabetes operated by NGOs is around 100 times more expensive in long run. Government policy on CAM service financing emerged as a decisive factor of implementation.Physicians from both sides called for more basic IM knowledge from their counterparts for better communication. In China, most physicians are double qualified and practise ConM and CM simultaneously. While dual training may provide a comprehensive foundation for IM practice, there are criticisms on the ungrounded integration between ConM and CM on physician level as suggested by the interviewees. As many ConM and CM interventions have been shown to have interactions, IM service requires specifically designed IM-oriented research and evidence instead of simple integration of disaggregated evidence from either side. Also, dual training is difficult to propagate to health systems of other countries and requires substantial resources. The effectiveness and optimal ratio of one physician – dual medical practice model and one administrative system – dual streams of physician model in health systems also require further implementation studies.Regarding research, both ConM and CM physicians acknowledged that research design should formulate according to the corresponding school of theory of ConM and CM to reflect actual practice. Nevertheless, ConM physicians emphasised more on standardisation and reproducibility while CM physicians focused more on personalisation on study design which highlighted the different epistemology between CM and ConM. Both CM and ConM physicians of different specialties proposed pragmatic trial as an agreeable solution which aligned with the trend of establishing real-world comparisons lately , 43, 50.This study has several limitations. Since the aim of this series was to identify detailed barriers, concerns and expectations on IM diabetes management, the findings are context specific, similar to other qualitative studies. However, we believe the major findings could be carefully generalised to the IM management of chronic conditions in places where CAM is not part of the public health system, including most of the developed countries. Also, this series only identified possible mechanisms of social behaviour and further quantitative studies including survey are needed to better determine the magnitude of and prioritisation of the concerns. Lastly, the study period was long due to the availability of funding and difficulties in organising focus groups, especially for physicians, which is a commonly known challenge.Inadequate explanation of CAM effect to patient may lead to underreporting. Practical issues on the access and finance of medical service emerged as major barriers to the delivery of IM service from the patients’ perspective. Inadequacy in evidence of clinical effectiveness and the difficulties in interpreting CM theory remained as the major obstacles in the consideration of CM among ConM physicians. Pragmatic clinical evaluation is mutually accepted by both ConM and CM physicians. Research design should focus on the add-on effect of CAM and consider standardisation, reproducibility and the real-world practice. To enhance the utilisation, IM programmes that are evidence-based should merge with existing infrastructure.Additional file 1."}
-{"text": "The aim of this trial was to investigate whether a digital device that provides real-time visualized brushing instructions would contribute to the removal of dental plaque over usual brushing instructions.t-test was used to compare the two groups in accordance with intention-to-treat principles.We conducted a single-center, parallel-group, stratified permuted block randomized control trial with 1:1 allocation ratio. Eligibility criteria included people aged ≥ 18 years, and exclude people who met the following criteria: severely crowded teeth; using interdental cleaning implement; having external injury in the oral cavity, or stomatitis; having less than 20 teeth; using orthodontic apparatus; visited to a dental clinic; having the possibility of consulting a dental clinic; having a dental license; not owning a smartphone or tablet device; smoker; taken antibiotics; pregnant; an allergy to the staining fluid; and employee of Sunstar Inc. All participants received tooth brushing instructions using video materials and were randomly assigned to one of two groups for four weeks: (1) an intervention group who used the digital device, providing real-time visualized instructions by connection with a mobile application; and (2) a control group that used a digital device which only collected their brushing logs. The primary outcome was the change in 6-point method plaque control record (PCR) score of all teeth between baseline and week 4. The p = 0.088, 95% confidence interval −0.70–10.07).Among 118 enrolled individuals, 112 participants were eligible for our analyses. The mean of PCR score at week 4 was 45.05% in the intervention group and 49.65% in the control group, and the change of PCR score from baseline was −20.46% in the intervention group and −15.77% in the control group (A digital device providing real-time visualized brushing instructions may be effective for the removal of dental plaque. Periodontal disease is an inflammatory condition caused by infection with bacteria and is one of the main diseases seen in dentistry . DecayedOnce a tooth is lost from periodontal disease, it causes oral dysfunction and influences the whole body . Many prRemoving dental plaque is important for the prevention and treatment of periodontal disease . The easAppropriate brushing instructions are required to master effective brushing. However, not many people visit the dentist regularly, which is of note as people can get brushing instructions from dentists or dental hygienists. Moreover, one of the tooth brushing methods which is often used in the clinical setting is the Bass method, which requires one to move their toothbrush in small steps ,13. PrevIn addition, although toothbrushing for more than two minutes is recommended to remove dental plaque , a studySunstar Inc.  has developed a digital device that provides visible brushing instructions, linked to a mobile application, to facilitate learning appropriate teeth brushing habits. Many similar applications and devices, which improve oral hygiene or promote oral health behavior, have been developed and there have been reported their effect of only mobile applications or especially with electric toothbrush –21. HoweWe conducted a single-center, parallel-group, randomized control trial (RCT). Randomization was done by stratified permuted block with a 1:1 allocation ratio.th, 2018 to November 30th, 2018. We placed an advertisement about this trial in Kyoto University’s bulletin board from October 3rd, 2018 and recruited participants from October 29th to November 2nd. At the first day of follow-up period, after explaining this trial and gave written informed consents, we registered the participant officially, and followed each participant for one month.The trial was conducted at Kyoto University Health Service from October 29This trial included people aged ≥ 18 years, and we excluded people who met one or more of the following criteria: severely crowded teeth ; using interdental cleaning implement every day; the presence of an external injury in the oral cavity, or stomatitis, that can affect teeth brushing; having less than 20 remaining teeth; using orthodontic apparatus; visit to a dental clinic within the past month; having the possibility of consulting a dental clinic during the study period; having a dental license; not owning a smartphone or tablet device; current smoker; taken antibiotics within the past week; the possibility of being pregnant; an allergy to the staining fluid used for dental plaques; and being an employee of Sunstar Inc.th, 2018, and registered University hospital Medical Information Network (UMIN) Clinical Trial Registry (CTR) (UMIN000034503).The trial was approved by the ethics committee of Kyoto University (C1390) on June 27Before the trial, participants were measured plaque control record (PCR) score and underwent brushing for dental plaque removal by a dental hygienist. The PCR score was measured by O’Leary’s method , where t® device, which had three functions linked with a mobile application: (1) to visualize the toothbrush position and provide a guide for the brushing sequence; (2) to ensure the brushing time lasted more than 3 minutes; and (3) to visualize whether the user is moving the toothbrush in small steps or not  during the trial and were restricted from using other dental materials for plaque removal, such as dental floss and mouthwash. The PCR score was measured 2 and 4 weeks after the baseline measurement by the dental hygienist. The participants were prohibited from eating, drinking and tooth brushing two hours before the oral examination, so that the time and the oral conditions at the three examinations were as similar as possible.All participants used a standard toothbrush  and toothpaste  followed by brushing instructions from a dental hygienist. A week later, PCR was re-measured (B). On the same day, the digital device provided visualized brushing instructions was supplied to the participants, and after receiving instructions on how to use it, they performed teeth brushing with use of the application and digital device for a week, prior to a further set of PCR measurements being performed (C). The PCR score (A–B) of the control group in this study decreased by 9.4% from baseline, while in the intervention group, the score (A–C) decreased by 16%. Thus, assuming that the use of the brushing-instruction digital device results in a 6% decrease in the PCR score, with the level of significance (α) set at 5% (two-sided level) and the detection power (1–β) at 80%, the required participants’ number in one group was 63. Moreover, we estimated a drop-out rate of 10%, a power calculation indicated that a sample of 70 participants in each group was required to detect intergroup differences.For the randomization process, the stratified block randomization method  was used, where participants were randomly assigned to either of the two groups in a 1:1 ratio using stratification methods according to gender  and baseline PCR score (≥ 60%/< 60%) with a computer-generated randomization list, by a trial staff who only took charge of randomization. Randomization code was prepared in advance by the trial statistician. When an eligible participant was identified, the trial staff checked his/her teeth report and allocated using the randomization list.Both the assignment process and the explanation of the digital devices were conducted in a protected area, and randomization concealment for the group was maintained for the dental hygienists who measured PCR score and for the analysts of the data. On the other hand, we could not blind for the participants.t-test for continuous variables and the Chi-square test for categorical variables. In evaluating the primary and secondary outcome, changes in PCR score between baseline and week 4 were assessed using the t-test. In addition, we divided the whole tooth into three surfaces parts  and two teeth parts (anterior teeth and posterior teeth), and calculated the mean PCR score at baseline and week 4, and the presence of changes in each part. The differences in the consciousness of brushing and the time spent brushing between the two groups were evaluated using the Mann-Whitney U test.Participants characteristics were compared between the two groups using the We also calculated the number of participants with plaque on each tooth surface at baseline, and the number of participants who still had plaque after 4 weeks, as well as the decrease ratio, which was classified into 10% groups. Moreover, we calculated the number of the tooth surfaces of each group of the decrease ratio and the proportion of tooth surfaces relative to all 192 teeth surfaces.All statistical analyses were performed on an intention-to-treat basis. All p values were two-sided, and p values < 0.05 were considered statistically significant. We used R statistical software  .th, 2018 to November 30, 2018 (the last day of the follow-up for the participants). The trial was conducted from October 29p = 0.088, 95% confidence interval [95%CI] −0.70–10.07). The change of mean PCR score from baseline using the 4-point method as the secondary outcome was significantly greater in the intervention group (−18.09%) compared to the control group . The change of mean PCR score from baseline to week 2 was −13.53% in the intervention group and −10.26% in the control group. Moreover, the mean PCR score at week 4 decreased from baseline to a larger extent in the intervention group compared to the control group across all three surfaces parts  and two teeth locations . Furthermore, the distribution of each consciousness and brushing time were different in the two groups at week 4. Some participants in the intervention group reported that, \"I could learn the appropriate brushing methods.\" and that \" The digital device gave me an opportunity to review my brushing\" at week 4.During this trial, adverse events and serious harms were not observed.In this RCT, we evaluated the effects of the digital device, which offers real-time visualized brushing instructions. We found that the 6-point method PCR score decreased 4.69% more after four weeks by using the digital device with visualized brushing instructions compared to usual brushing instructions alone, although the difference was not statistically significant. The PCR score calculated using the 4-point method as the secondary outcome measure was 4.98% lower through the use of the digital device with visualized brushing instructions compared to usual brushing instructions alone, and this difference was statistically significant. In buccal center surfaces, lingual center surfaces and the anterior teeth, the PCR score at week 4 had a tendency to show a greater decrease in the intervention group compared to the control group. Our questionnaire survey data indicated behavioral change more in the intervention group participants compared to the control group participants. These results have important implications for the removal of dental plaque and habituation of appropriate brushing techniques.Several previous studies have investigated the effect of plaque removal by brushing, providing instructions about brushing methods, and also the association between brushing time and plaque removal –11. SchlWe used the same video material for all participants receiving tooth brushing instructions in this trial, therefore we were unable to personalized instructions based on each participant’s oral condition. It may be more effective, even in difficult parts of the mouth, to learn an individual’s oral condition and provide suitable brushing methods under professional instruction.Plaque control is recognized as an effective approach to prevent periodontal disease, and the prevention of periodontal disease can result in the prevention of many lifestyle-related diseases –6. RecenThe PCR score tended to decrease more from baseline in the intervention group compared to the control group. The decrease ratio of PCR score on each tooth surface part tended to be greater in the intervention group than the control group. However, in several parts most participants could not remove the plaque and it was difficult to achieve the appropriate PCR score regardless of the use of the brushing-instruction digital device. Guidelines recommend keeping the PCR score between 10% and 20% in order to prevent periodontal disease , howeverIn the questionnaire survey at week 4, most participants in the intervention group stated that they are “always conscious” of the procedure of teeth brushing, of brushing each surface of the tooth, and moving the toothbrush in small steps. This suggests that participants may have an increased awareness of appropriate brushing techniques due to instructions from the digital device. It is important to continue appropriate teeth brushing every day to enable plaque control, and motivation as well as repeated brushing instructions are required for this. As can be seen from our results of decreasing the mean of the PCR score at week 4 from week 2, the use of the digital device, which provides repeated real-time visualized brushing instructions, may be effective for people to get habituation of continuous brushing their teeth properly. However, it remains to be seen whether participants can maintain the consciousness of appropriate teeth brushing after this trial, and further investigations are needed to evaluate this.This trial has several inherent limitations. First, the number of participants did not satisfy the sample size we calculated beforehand, because of the difficulties in recruitment. Second, masking participants was impossible in our trial because of the different brushing approaches in the intervention and control groups. Third, the Hawthorne effect may have influenced our trial results, with participants performing better with teeth brushing because of awareness that they are being monitored in a trial setting. Fourth, the follow-up period of this trial was restricted. It is assumed that people lose interest for the digital device as they use it for long time. Therefore, we cannot discuss whether the effect of this digital device continues, if people use it for a long time. Finally, the generalizability of our results is limited by the fact that this was a single-center trial with several inclusion criteria. This shows that we only investigate the restricted population, moreover, the most participants were university students and the mean of their age was 20s. Generally, the proportion of the people who have periodontal disease is said to be high in elderly persons compared to that of young persons. Therefore, the findings of this trial may not apply to elder population.We observed a non-significant reduction in the 6-point method PCR score after 4 weeks of using the digital device with visualized brushing instructions, when compared to usual brushing alone. However, the consciousness of teeth brushing at week 4 improved more in the intervention than control group. The use of a digital device providing real-time visualized brushing instructions may be somewhat effective for the removal of dental plaque and habituation of appropriate brushing, and may be useful as a trigger for self-care.S1 Fig(XLSX)Click here for additional data file.S1 Table(XLSX)Click here for additional data file.S1 Checklist(DOC)Click here for additional data file.S1 Protocol(DOCX)Click here for additional data file.S2 Protocol(DOCX)Click here for additional data file."}
-{"text": "Correction of calcium (Ca), phosphorus (P), and parathyroid hormone (PTH) disorders is the standard of treatment in non-dialysis patients with chronic kidney disease-mineral and bone disorder (CKD-MBD), but the side effects and adverse reactions brought by western medicine (WM) are still the main problems. More importantly, the lack of protection of kidney function in the treatment greatly affects the health of patients. Although traditional Chinese medicine (TCM), specifically tonifying kidney and strengthen bone (TKSB) therapy is wildly applied for patients with CKD-MBD in China, the evidence of TKSB therapy in the treatment of CKD-MBD is limited. Thus, we pretent to conduct this protocol to evaluate the efficacy and safety of TKSB therapy combined with WM for non-dialysis patients with CKD-MBD.A system research of randomized controlled trials (RCTs) of TKSB therapy for CKD-MBD will be conducted by 2 investigators from 7 electronic databases. Methodological quality evaluations will be performed by using the Cochrane collaboration tool and data analysis will be conducted by RevMan V5.3 software and STATA v15.0.The results of this paper will be submitted to a peer-reviewed journal for publication.This research will determine the safety and efficacy of TKSB therapy in treating non-dialysis patients with CKD-MBD.INPLASY2020120086 Such a high incidence and prevalence have brought a great burden to society. Chronic kidney disease-mineral and bone disorder (CKD-MBD) is one of the most common complications of chronic kidney disease. With the progression of CKD, the incidence of CKD-MBD is increasing. When it progresses to end-stage renal disease, almost all patients have renal bone disease (RBD). As early as CKD stage 3, due to the decline of renal function and the decrease of glomerular filtration rate, the renal phosphate excretion is impaired and the phosphate in the blood is retained. Such high phosphorus in the blood can directly inhibit the secretion of 1α-hydroxylase by the kidneys, leading to obstacles in the production of renal active vitamin D3. However, active vitamin D3 is an important component of intestinal absorption of calcium into the blood, so lack of it will cause hypocalcemia. The reduction of activated vitamin D3 can make bones have varying degrees of resistance to parathyroid hormone (PTH), which will increase the compensatory secretion of PTH in the blood. At this time, the increased PTH will mobilize a large amount of bone calcium into the blood to maintain the balance of Ca and P, but it will cause bone calcium loss in bone tissue, leading to osteoporosis, fractures, bone pain, and other bone diseases, which is the so-called CKD-MBD. These diseases have severely affected the quality of the patients’ life and shortened their survival time.Chronic kidney disease (CKD) is a major disease threatening human health. In the past 3 decades, the global incidence and prevalence of CKD have increased by 89% and 87%, respectively.: reduce phosphorus intake and promote phosphorus clearance to control hyperphosphatemia; supplement calcium and active vitamin D3, adjust blood calcium to maintain a safe level and avoid the occurrence of hypercalcemia; prevention and treatment of secondary hyperparathyroidism; if the effect of drug therapy is not good, parathyroid surgery can be considered. These therapies listed above are effective in controlling calcium, phosphorus, and parathyroid hormone in the blood, but there are many adverse reactions. For example, the oral administration of aluminum hydroxide can easily cause the accumulation of aluminum in the body, and the improper grasp of the dosage and treatment course of calcium can easily cause hypercalcemia. Once in end-stage of CKD-MBD, parathyroidectomy for the treatment of tertiary hyperparathyroidism not only brings irreversible damage to the body, but also causes a heavy economic burden on the patient. More importantly, western medicine (WM) ignores the improvement of renal function, as well as the lack of early prevention of CKD-MBD. Patients often take treatment measures only when they have severe bone pain, bone deformity, and other clinical symptoms, but it is very difficult to reverse the course of the disease at this time. Therefore, it is essential to seek treatments which can both improve renal function and regulate Ca, P, and PTH levels.At present, the main clinical treatment methods for CKD-MBD are as follows The combination of TKSB therapy with WM can not only improve renal function, but also regulate the levels of Ca, P, and PTH. For example, Zheng et al found that Yishen Jiangzhuo Granule, an effective TCM for TKSB, combined with WM treatment, could significantly improve renal function by increasing CCr and decreasing SCr when compared with WM alone. Zhou showed that the combination of WM with TKSB therapy could improve the symptoms of renal function and reduce bone loss by increasing Ca levels in blood, reducing P and PTH levels in the blood, increasing bone density, and reducing ALP content. The therapeutic effect of combining treatment group was superior to the WM treatment group. All the above studies have shown that TKSB therapy pays more attention to improving renal function in the treatment of CKD-MBD, that is, it uses herbal drugs to match the kidney bias to improve the vitality of the kidney to help the body restore the normal metabolic function of the kidney, which is the essence of TCM in the treatment of CKD-MBD. It does not only focus on regulating the abnormal trace elements in the blood as doing like this will ignore the analysis of pathogeny, leading to the gradual decline of renal function and ultimately resulting in an irreversible situation of dialysis treatment. Inspired by these findings, we wonder if the treatment is focused on improving renal function, perhaps the trace elements in the blood will return to normal, which is what TCM is good at and pursues. At present, a large number of literature have reported the clinical efficacy and drug safety evaluation of TKSB therapy in the treatment of CKD-MBD, including dialysis patients and non-dialysis patients. Since metabolism is not carried out through the kidney in dialysis patients, the effect of TCM on renal function improvement cannot be reflected in the body of dialysis patients. Based on this point, we believe that the therapeutic effect of TKSB therapy on non-dialysis patients is more significant. However, there has been no meta-analysis to evaluate the clinical efficacy of TKSB therapy in the treatment of CKD-MBD in non-dialysis patients. Consequently, our study is to lay a foundation for promoting the clinical application of TKSB in the treatment of CKD-MBD in non-dialysis patients.Traditional Chinese medicine (TCM) is widely used in the prevention and treatment of kidney diseases and bone metabolism diseases. According to the theory of TCM, renal bone disease belongs to the category of “bone impotence” in TCM. Bone is closely related to kidney. Bone loss is the main characteristic of kidney deficiency. Kidney deficiency and bone atrophy are the basic pathological features of RBD. Therefore, the classic therapy of TCM for RBD is tonifying kidney and strengthen bone (Bushen Jiangu).2This protocol is registered in INPLASY (INPLASY2020120086). This protocol was performed in accordance with the preferred reporting items for systematic reviews and meta-analysis protocol. Ethical approval is unnecessary because this is a literature-based study.2.1http://www.chictr.org.cn/), and international clinical trial registry . We will contact the original investigators for more complete details of the study to solve questions about eligibility if necessary.We will comprehensively search the following 7 databases: PubMed, EMBASE, Cochrane Library, Wanfang database, Chinese National Knowledge Infrastructure (CNKI), China Biological Medicine (CBM), and VIP Journals Database. The basic terms were performed as follows: (bushen OR yishen OR tonifyingkidney OR bugu OR jiangu OR zhuanggu OR strengthen bone) AND . Ambiguous literature will be manually searched to avoid missing eligible trials. Ongoing registered clinical trials will be searched on the websites of the Chinese clinical trial registry  combined with one type of WM .2.2.3The control group should receive WM treatment alone. If the control group contains other TCM therapy or dialysis treatment, it will be excluded.2.2.4Included studies should contain at least 4 of the following evaluated outcomes: clinical effective rate; serum Ca level; serum P level; parathyroid hormone (PTH); blood urea nitrogen (BUN) level; serum creatinine (SCr) level; adverse events from TKSB therapy or WM.2.2.5Randomized controlled trial and quasi- randomized controlled trials (RCT) including combination therapy of TKSB will be included. Articles will be excluded if they are case reports, letters, editorials, and nonhuman studies. The flow diagram of the study selection is shown in Fig. 2.3For eligible studies, the following data will be independently extracted by 2 authors (GLW and LL) according to predefined criteria: first author, publication year, region, sample size, detail of intervention, treatment courses, and outcome parameters. For any disagreement between the 2 authors, it would be settled through discussion with a third author (YQX). The reasons for exclusion were recorded. The data were extracted from the included RCTs to a predefined Excel table  and cross-checked by the 2 reviewers . In the event of missing data, we will attempt to contact the corresponding authors for details.2.4 Disagreements, if any, were resolved by discussion and reached consensus through a third reviewer (JL). The assessed items included 6 domains: random sequence generation; allocation concealment; blinding method; integrity of data; selective reporting; other bias. Selective reporting bias was judged according to the published protocols for the registered clinical trials that were contained on the Chinese clinical trial registry (http://www.chictr.org) and international clinical trial registry of the US National Institutes of Health  websites. We compared the outcome measures between the study protocol and the final published trial.Two authors  independently assessed the methodological quality of each trial according to the standards advised by the Cochrane Handbook.2.5I2 test. The result of I2 test above 50% will be considered to indicate significant heterogeneity, and the meta-regression model will be applied to find out the sources of the heterogeneity. Additionally, if necessary, a sensitivity analysis will be carried out to evaluate the stability and reliability of the results by removing individual studies at a time.Review Manager 5.3 , compiled by the Cochrane Collaboration, will be employed to pool and analyze data. Dichotomous variables will summarize as risk ratios (RR) with 95% confidence intervals (CI), while continuous variables will summarize as mean difference (MD) with 95% CI. Heterogeneity will be examined by the 2.6The funnel plot to evaluate the potential publication bias will be used when there are >10 studies included in the meta-analysis. And quantitative analysis of publication bias will measured by the method of Egger test or Begg test.3 However, the optimal strategy for the treatment of CKD-MBD remains controversial. For example, Gross et al believe that there is still no convincing RCT evidence to confirm whether reducing the level of P in the blood can improve the clinical prognosis and reduce the mortality of patients with CKD-MBD. Block et al believed that the use of calcium-phosphorus binder or non-calcium-phosphorus binder in patients with CKD stage 3–4 could accelerate the rate of vascular calcification, and it was difficult to obtain satisfactory clinical efficacy. In this context, the current treatment of CKD-MBD only focuses on regulating the metabolic levels of Ca, P, and PTH in the blood, while ignoring the improvement of renal function and considering its adverse effects. At present, TCM is widely used to improve the symptoms and signs of patients with CKD-MBD, and it is especially good at improving patients’ physical conditions and improving their quality of life. According to the theory of TCM, the incidence of CKD-MBD is usually in the kidney and bone, and its pathogenesis is closely related to kidney deficiency and bone impotence, which mostly belong to deficiency syndrome. Thus, TKSB therapy is the main method for TCM treatment of CKD-MBD. In recent years, increasingly RCTs have been reported on the treatment of CKD-MBD with TKSB therapy, which provides an opportunity for the objective and comprehensive evaluation of this method. In order to clarify the efficacy and safety of this treatment strategy in a scientific and reasonable way so as to promote its clinical application, we pretent to conduct a meta-analysis in the future. Through the forthcoming meta-analysis, we will conduct a statistical analysis of the herbs used at a high frequency to provide a better therapy.RBD is one of the most common and serious complications of CKD. Metabolic disorders such as Ca, P, and PTH in vivo caused by chronic renal impairment will lead to cardiovascular diseases and fractures, posing a great threat to human life and health.As the systematic review is based on the secondary research of published literature, there are undeniable methodological defects. In addition, the quality of the included studies determines the quality level and reliability of the final results. We will begin to conduct the review when the necessary trials are met, and all operating procedures will be performed in accordance of Cochrane Handbook to ensure that the provided information is helpful for clinicians and patients.The authors would like to thank Professor Youping Li, Director of Cochrane Center in China; Professor Rui Peng, Director of College of Acupuncture and Orthopedics of Hubei University of Chinese Medicine in China; Professor Jia Li, Director of Hubei Provincial Collaborative Innovation Center of Preventive Treatment by Acupuncture and Moxibustion in China for their training on Cochrane system evaluation and knowledge of statistical analysis.Data curation: Liang Li.Formal analysis: Guiling Wu.Methodology: Jia Li.Software: Youqiong Xie.Supervision: Rui Peng.Writing – original draft: Zi Jian Wu."}
-{"text": "Mesenchymal stem cell therapy (MSCT) has been shown to be a new therapeutic option for treating alopecia areata (AA). Outer root sheath cells (ORSCs) play key roles in maintaining the hair follicle structure and supporting the bulge area. In human ORSCs (hORSCs), the mechanism for this process has not been extensively studied. In this study, we aimed to examine the influence of human hematopoietic mesenchymal stem cells (hHMSCs) in the hORSCs in vitro model of AA and determine the mechanisms controlling efficacy. Interferon-gamma (IFN-γ) pretreatment was used to induce an in vitro model of AA in hORSCs. The effect of MSCT on the viability and migration of hORSCs was examined using co-cultures, the MTT assay, and migration assays. We investigated the expression of molecules related to the Wnt/β-catenin pathway, JAK/STAT pathway, and growth factors in hHMSC-treated hORSCs by reverse transcription-polymerase chain reaction (RT-PCR) and Western blot analyses. hHMSCs increased hORSC viability and migration when they were co-cultured. hHMSCs reverted IFN-γ-induced expression—including NLRP3, ASC, caspase-1, CXCL-9 through 11, IL-1β, and IL-15—and upregulated several growth factors and hair stem cell markers. hHMSCs activated several molecules in the Wnt/β-catenin signaling pathway, such as in the Wnt families, β-catenin, phosphorylated GSK-3β and cyclin D1, and suppressed the expression of DKK1 induced by IFN-γ in hORSCs. hHMSCs suppressed the phosphorylation of JAK1 to 3, STAT1, and STAT3 compared to the controls and IFN-γ-pretreated hORSCs. These results demonstrate that hHMSCs increased hORSC viability and migration in the in vitro AA model. Additionally, MSCT definitely stimulated anagen survival and hair growth in an HF organ culture model. MSCT appeared to be associated with the Wnt/β-catenin and JAK/STAT pathways in hORSCs. Alopecia areata (AA) is an autoimmune disease that targets hair follicles (HFs) during the anagen stage and is primarily caused by the disruption of immune privilege. ,2. AA isAccording to the concept of pathology, the prevention or recovery of immune privilege disruption of HFs can ultimately lead to the more effective management of AA. Recently, research studies have reported that treatments using mesenchymal stem cells (MSCs) can be useful for treating AA. Mesenchymal stem cell therapy (MSCT) or stem cell therapy using umbilical cord blood-derived cells for AA has been reported in several refractory cases ,7. A recThe mechanism by which MSCT is associated with improvement of hair growth and the immune environment is not yet well known. According to our previous study, MSCT reverted an AA-like environment in human dermal papillar cells (hDPCs) via the Wnt/β-catenin and Janus kinase (JAK)/signal transducers and activators of transcription protein (STAT) signaling pathways. In addition, various growth factors and cytokines associated with anagen re-entry induction were found to be enhanced by MSCT . ActivatHFs are composed of cells of multiple origins, are single independent mini-organs, and have a characteristic periodic hair cycle . The haiThe hORSCs of HFs are multilayered tissues predominantly made up of undifferentiated keratinocytes . hORSCs The effects of MSCT on hORSCs have not yet been studied. To study the therapeutic mechanism of MSCT in AA, we investigated the effect of MSCT on hORSCs, with or without pretreatment with IFN-γ. We examined the effect of MSCT on the viability and migration ability of hORSCs. We focused on the activation of the Wnt/β-catenin and JAK/STAT signaling pathways and changes associated with the expression of several cytokines and chemokines, inflammasomes, growth factors, hair stem cell markers, and migration in response to MSCT.4 cells/well, according to a previous study [First, we examined whether MSCT could increase the cell viability of hORSCs. The concentration of hHMSCs used was 5 × 10us study . To deteNLRP3, Apoptosis-associated speck-like protein containing a CARD (ASC), caspase-1, and IL-1β at the mRNA levels. As shown in NLRP3, ASC, caspase-1, and IL-1β were significantly increased in the IFN-γ-treated group compared to the controls. There was no significant difference in the expression levels in the MSCT group compared to the controls, whereas the expression of inflammasome components was upregulated in the IFN-γ-treated group, and downregulated by additional MSCT.To investigate whether NLRP3 inflammasome activation was related to MSCT in hORSCs, we examined the expression of of CXCL9, CXCL10, CXCL11, TNF-α, IL-10, IL-15, IL-18, IFN-γR, and Major histocompatibility complex (MHC) class I chain-related protein A (MICA) at the mRNA level  and AXIN2 compared to the controls. Additionally, IFN-γ-hHMSC-treated group increased the mRNA expression levels of WNT3, WNT5, WNT10, GSK-3β, β-catenin, Cyclin D1, LEF1 and AXIN2, which was decreased by IFN-γ. The mRNA levels of WNT7 were significantly increased only in the MSCT group.We measured the expression of Wnt/β-catenin genes by real-time PCR to investigate the roles of MSCT . The resDKK1 in the MSCT group with and without IFN-γ treatment compared to the controls. The change in TGF-β2 expression was not significant in the MSCT group compared to the controls. The expression levels of DKK1 and TGF-β2 were increased in the IFN-γ-treated group and were suppressed by MSCT.As shown in We also investigated the effects of MSCT on the WNT/β-catenin pathway at the protein level by Western blotting . The levKeratin15 genes by qPCR , fibroblast growth factor 2(FGF2), fibroblast growth factor 7(FGF7), vascular endothelial growth factor (VEGF), platelet-derived growth factor (PDGF), sonic hedgehog (SHH), bone morphogenetic protein 2 (BMP2), and BMP4 are representative growth factors associated with hair growth.IGF1, FGF2, FGF7, VEGF, PDGF, SHH, BMP2 and BMP4 in response to MSCT were significantly upregulated compared to the control or IFN-γ-treated groups in this study.As shown in We examined the effects of MSCT on the JAK/STAT signaling pathway at the protein level using Western blotting . OverallThe level of phosphorylation of JAK1-3 was significantly increased in IFN-γ-treated cells compared to the controls. Phosphorylation was significantly suppressed by MSCT compared to the IFN-γ-treated controls B. The leNext, we also investigated the effect of MSCT on IFN-γR and IL-15, which are the key cytokines in JAK/ STAT pathway activation. The level of IFN-γR was increased in the IFN-γ-treated group compared to the control and was suppressed by MSCT. IL-15 was only expressed in the IFN-γ-treated group and MSCT blocked the expression of IL-15 .Next, the effect of MSCT on hORSC migration was examined by the crystal violet assay using six-well polycarbonate Transwell inserts. As shown in To examine the effect of MSCT at the organ level, we performed an ex vivo culture of mouse vibrissae HFs. In this study, 20 HFs were cultured individually with control, IFN-γ, IFN-γ plus MSCT, or MSCT. Each hair shaft was measured every third day.As shown in IL-10, which contributes to the immunomodulatory effects of MSCT, was increased by MSCT. Hair growth factors were upregulated by MSCT  attack MICA positive HFs, which results in apoptosis and hair loss . AccordiThe Wnt/β-catenin signaling pathway is important for hair morphogenesis and anagen re-entry . β-catenTGF-β2 mRNA was only increased by IFN-γ treatment and not by MSCT in this study. Most of the Wnt/β-catenin-related molecules were increased by MSCT conditions in vitro. This suggests that MSCT could help induce anagen re-entry by stimulating the Wnt/β-catenin signal pathway.In this study, MSCT significantly induced Wnt family proteins, β-catenin, GSK-3β and cyclin D1 expression. Among the Wnt family proteins, Wnt3a and 10b are related to the hair cycle and regeneration, and increase anagen gene expression. Kishimoto et al. generated Wnt3a-overexpressing keratinocyte feeder cells and co-cultured the cells with freshly isolated murine DPCs. In this experiment, Wnt3a was found to increase β-catenin expression and increase hair growth in nude mice that underwent skin remodeling composed of DPCs and keratinocytes . Wnt5a iSOX9 is characteristically expressed in CD34-positive hORSCs in the bulge area and is involved in the regulation of bulge formation and stem cell transcription ,34,35. CIn AA, dystrophic HFs are often observed instead of normal HFs because hORSCs are attacked by inflammatory cells around the HFs and the immune privilege of the HFs is disrupted. The main role of hORSCs is to secrete and react to inflammatory substances. hORSCs are important immunocompetent cells that express NLRP3 inflammasomes constitutively in the HFs . TherefoIL-10 is an anti-inflammatory cytokine that has the opposite effect. These results can be the outcome of JAK/STAT pathway activation. Recent studies have shown that increased JAK-STAT signaling suppressed HF stem cell function in vitro and that STAT5 signaling regulated HF stem cell quiescence [We also found that the IFN-γ-induced proinflammatory cytokines and chemokines of AA  were supiescence ,40. EvenIn this study, the phosphorylation of JAK1-3 and STAT1 was significantly decreased in hORSCs by MSCT, which reverted the IFN-γ-induced proinflammatory changes. Although the downregulation of STAT3 in the IFN-γ-hHMSCs treated group was not significant compared to the IFN-γ-treated groups, the changes were significant compared to the controls in Western blotting analysis. We suggest that MSCT suppress IFN-γ signaling through downregulation of the JAK/STAT pathway. This result suggests that the MSCT-suppressed activation of JAK1/2 reversed catagen induction and induced a potential mechanism involved in the new hair cycle. TGF-β is well known as an inducer of regression . In accoIGF1, FGF2, FGF7, PDGF, VEGF, SHH, BMP2 and BMP4 mRNA expression was suppressed by IFN-γ, and MSCT had a stimulatory effect on the transcription of growth factors. Our results indicate that MSCT increased hair growth factors to facilitate the viability and migration of hORSCs  were seeded into six-well culture plates in Dulbecco’s Modified Eagle Medium  containing 10% fetal bovine serum  and 1% penicillin/streptomycin  for 24 h. hORSCs at passage three to five were used for the experiments. Then, hORSCs were seeded on culture dish plates with serum-free DMEM, and the plates were co-cultured with upper chamber containing hHMSCs.We obtained human bone marrow-derived mesenchymal stem cells . We purchased human outer root sheath cells (hORSCs) from ScienCell  and cultured them, as previously described . hORSCs 5 cells per well. hHMSCs were added to the upper chamber of the Transwell in separate plates at a density of 5 × 104 cells per well. The upper chambers were coated with polyethylene terephthalate . After 24 h, the media was changed to serum-free DMEM and the upper chamber containing hHMSCs was transferred to the wells where the hORSCs were cultured to produce the co-culture. The IFN-γ group was treated with recombinant human IFN-gamma at 100 ng/mL, obtained from Peprotech . After different times , the upper chamber was removed and washed with Dulbecco’s phosphate-buffered saline . Next, the hORSCs were harvested and used for analysis. The experiment was repeated three times.The co-culture of hORSCs and hHMSCs was performed as previously described . hORSCs Cell viability was measured via the 3--2,5-diphenyltetrazolium bromide (MTT) assay. After co-culturing for different times, the MTT reagent was added and reacted for 2 h. The reagent was removed, and the resulting formazan crystals were dissolved in dimethylsulfoxide (DMSO) . Then, tTotal RNA was isolated from the hORSCs using TRIzol reagent , and cDNA was synthesized with the MG cDNA Synthesis Kit  according to the manufacturer’s instructions. Total RNA (1 μg) was reverse transcribed with primers and Moloney-murine leukemia virus (M-MLV) reverse transcriptase (RTase) . Real-time PCR was performed using the SYBR Green Master mix . The gene expression levels were quantified using analysis software . The primer sequences are listed in hORSCs were harvested with RIPA lysis buffer supplemented with Protease and Phosphatase Inhibitor Cocktail . The amount of protein was measured using the BCA protein assay kit  and compared to bovine serum albumin (ThermoFisher) standards. Cell lysates containing the same quantity of total protein were separated by electrophoresis on sodium dodecyl sulfate (SDS)-polyacrylamide gels and transferred to polyvinylidene fluoride (PVDF) membranes. The membranes were blocked with 5% skim milk in TBST for an hour at room temperature and incubated with primary antibodies in 5% BSA at 4 °C overnight. Primary antibodies against phospho-JAK1-3, total-JAK1-3, phospho-STAT1-3 total-STAT1-3, DKK1, IL-15, phospho-GSK-3β, GSK-3β, β-catenin, SOX9, CD34, CD200, and GAPDH were purchased from Santa Cruz Biotechnology  and Cell Signaling Technology, Inc. . On the following day, the membranes were washed with TBST several times and incubated in peroxidase-conjugated secondary antibody  for 2 h at room temperature. The immunoreactive bands were visualized by the enhanced chemiluminescence (ECL) detection system (ThermoFisher) and were obtained using a chemiluminescence imaging system  after incubation with horseradish peroxidase.5 hORSCs that were already treated with IFN-γ or hHMSCs. The number of hHMSCs and density of IFN-γ were the same as those used in the co-culture procedure. DMEM containing 10% FBS was added to the lower chambers. After incubation for 15 h at room temperature, the cells in the upper chamber were carefully removed using a cotton swab and the membranes were fixed with 4% paraformaldehyde for 20 min. The cells that had migrated under the filter were stained with 0.5% crystal violet for 20 min and then observed under a light microscope [The migration of hORSCs was measured using Transwell plates that were 6.5 mm in diameter with 8 μm pore filters. The Transwell system was separated from the lower segment by a permeable membrane coated with polyethylene terephthalate. The upper chambers were loaded with 1 × 10croscope . The cel4 cells per well as described in the co-culture method. At least 20 HFs were cultured individually with control, IFN-γ, IFN-γ plus MSCT, or MSCT. The culture medium was changed every three days, and images of individual follicles were filmed before and after hHMSCs treatment. All procedures were carried out under the Institutional Animal Care and Use Committee—approved protocols .Six-week-old female C57BL/6 mouse vibrissae follicles were micro-dissected under sterile conditions, as previously described . IndividThe length of vibrissae HFs from the top of hair to the bottom of the hair bulb in organ culture was measured with a microscope every third day for 10 days. Changes in hair length were calculated from the photographs and expressed as mean ± SEM of 20 vibrissae HFs.t-test were used for the statistical analyses with SPSS (v.7.0) software . All tests were one-sided, and a p-value of less than 0.05 was considered statistically significant.All data are expressed as the mean ± SEM. An ANOVA test and paired Student’s"}
-{"text": "Peptide receptor radionuclide therapy (PRRT) is a systemic treatment consisting of the administration of a tumor-targeting radiopharmaceutical into the circulation of a patient. The radiopharmaceutical will bind to a specific peptide receptor leading to tumor-specific binding and retention. This will subsequently cause lethal DNA damage to the tumor cell. The only target that is currently used in widespread clinical practice is the somatostatin receptor, which is overexpressed on a range of tumor cells, including neuroendocrine tumors and neural-crest derived tumors. Academia played an important role in the development of PRRT, which has led to heterogeneous literature over the last two decades, as no standard radiopharmaceutical or regimen has been available for a long time. This review focuses on the basic principles and clinical applications of PRRT, and discusses several PRRT-optimization strategies.Peptide receptor radionuclide therapy (PRRT) consists of the administration of a tumor-targeting radiopharmaceutical into the circulation of a patient. The radiopharmaceutical will bind to a specific peptide receptor leading to tumor-specific binding and retention. The only target that is currently used in clinical practice is the somatostatin receptor (SSTR), which is overexpressed on a range of tumor cells, including neuroendocrine tumors and neural-crest derived tumors. Academia played an important role in the development of PRRT, which has led to heterogeneous literature over the last two decades, as no standard radiopharmaceutical or regimen has been available for a long time. This review provides a summary of the treatment efficacy , impact on patient outcome and toxicity profile of PRRT performed with different generations of SSTR-targeting radiopharmaceuticals, including the landmark randomized-controlled trial NETTER-1. In addition, multiple optimization strategies for PRRT are discussed, i.e., the dose–effect concept, dosimetry, combination therapies , new radiopharmaceuticals , administration route  and response prediction via molecular testing or imaging. The evolution and continuous refinement of PRRT resulted in many lessons for the future development of radionuclide therapy aimed at other targets and tumor types. Peptide receptor radionuclide therapy (PRRT) is a systemic treatment consisting of the administration of a tumor-targeting radiopharmaceutical into the circulation of a patient. The radiopharmaceutical will bind to a specific peptide receptor leading to tumor-specific binding and retention. Examples of receptors that have been studied include the somatostatin receptor (SSTR), glucagon-like peptide-1 receptor (GLP-1R), bombesin receptor, cholecystokinin type 2 (CCK2R) and melanocortin receptor -polymerase 1 (PARP-1) activity is required for the DNA damage repair of single strand breaks that can be caused by PRRT. When single-strand breaks are not repaired, they will lead to replication fork arrest and double-strand break formation during replication, and ultimately to cell death. PARP inhibitors are currently used in the treatment of several solid tumors . As such, an increase in preclinical research using PARP inhibitors as a radiosensitizer has emerged over the last few years. Several preclinical studies have shown that the combination of PARP inhibitors with ll death ,135,136.177Lu-OPS201  to 177Lu-DOTATATE, have shown that 177Lu-OPS201 exhibits a higher tumor uptake, higher number of double-strand breaks, longer tumor residence time and improved tumor-to-kidney dose ratio [177Lu-OPS201 was performed in four patients with advanced neuroendocrine neoplasms (NENs) and chronic grade 2 or 3 kidney disease [177Lu-DOTATATE, 177Lu-OPS201 showed a longer tumoral residence time and higher tumor uptake resulting in 1.7–10.6 times higher tumor doses. Toxicity was minor and reversible. Moreover, a phase-I trial including 20 patients with progressive well-differentiated NETs using 177Lu-OPS201 led to a high ORR of 45% and SD in 40% of patients [177Lu-DOTA-LM3 in 51 patients with advanced NENs [177Lu-DOTATOC or -TATE. Promising results were achieved with a high DCR of 85%. The occurrence of hematological toxicity was low, contrary to the previously described phase-I trial with 177Lu-OPS201 [68Ga-DOTATOC or -TATE PET/CT (insufficient for agonist PRRT) [Over the last few decades, the PRRT-paradigm for effective tumor targeting consisted of using receptor agonists which internalize after receptor binding, hereby causing tracer accumulation in the tumor cells. However, SSTR-antagonists are slowly emerging in the SSTR imaging and PRRT scene, with several preclinical studies showing their superiority over SSTR-agonists, despite the very slight amount of internalization . It is pse ratio ,140. A p disease . Comparepatients . Nephrotced NENs . Sixty-nu-OPS201 . This isst PRRT) . Several177Lu-DOTA-EB-TATE was conducted in five patients with advanced metastatic NETs [177Lu-DOTATATE (n = 3 patients), 177Lu-DOTA-EB-TATE achieved an extended blood-circulation and a 7.9-fold increase in tumor dose delivery. No adverse effects were noticed which was excepted as the administered activity was subtherapeutic, however, the dose delivery to the kidneys and bone marrow was significantly higher in patients receiving 177Lu-DOTA-EB-TATE compared to 177Lu-DOTATATE  [max) after treatment in the 177Lu-DOTA-EB-TATE group was achieved compared to the 177Lu-DOTATATE group , in a selection of lesions with a comparable baseline SUVmax (range 15–40). Furthermore, the safety and efficacy of administering up to three cycles 177Lu-DOTA-EB-TATE has been evaluated in 32 NET patients  [177Lu-DOTA-EB-TATE and 177Lu-DOTATOC was conducted in 5 patients with progressive SSTR positive disease [177Lu-DOTA-EB-TATE compared to 177Lu-DOTATOC. Therefore, all 5 patients were eventually treated with 177Lu-DOTATOC. The higher tumor dose delivered with this agent comes at the price of an even higher increase of the bone marrow dose, and thus it remains uncertain if using this compound is superior to higher activity/more cycles of established radiopharmaceuticals. More prospective studies are needed to evaluate the toxicity/treatment efficacy balance of this new compound.An attempt to improve the pharmacokinetics of the known radiolabeled SSAs was made by conjugating an Evans blue analog onto octreotate (EB-TATE). This results in a reversible binding of EB-TATE to serum albumin through the EB moiety, hereby extending its biological half-life in blood . The firtic NETs . In compctively) . These fctively) . A signi0.5 GBq) . Hematot disease . The ratThe use of alpha-emitters  in PRRT is an emerging strategy, however, the availability of these alpha-emitters is still limited world-wide. To date, preclinical and clinical research studies with actinium-225 or bismuth-213 were predominantly conducted by the extraction of actinium-225 from thorium-229 sources, arising from the decay of fissile uranium-233. However, these thorium-229/uranium-233 stocks are limited due to legal requirements related to fissile materials. This led to the investigation of several accelerator-based production routes over the last years, which will increase the availability of these alpha-emitters in the future . 213Bi-DOTATOC to eight patients with progressive NETs refractory to nonradioactive octreotide and tandem therapy with 90Y/177Lu-DOTATOC  [213Bi-DOTATOC was able to overcome resistance against beta radiation and induce long-term tumor remission. Nephrotoxicity and acute hematotoxicity were in the acceptable range. A prospective study was performed with 225Ac-DOTATATE in 32 patients with metastatic GEP-NENs who had SD after completing 177Lu-DOTATATE (n = 14) or PD on 177Lu-DOTATATE therapy (n = 18) [177Lu-DOTATATE, revealed PR (n = 8) or MR (n = 4) in the 12 patients who were assessed. In addition, in the patient group that had PD on 177Lu-DOTATATE, no PD was seen during the response assessment after two cycles of 225Ac-DOTATATE. No grade III/IV hematotoxicity, nephrotoxicity or hepatotoxicity occurred [212Pb-DOTAMTATE in 20 patients are promising [212Pb-DOTAMTATE at the highest dose level of 2.50 kBq/kg/cycle, have completed all four cycles of treatment. A high ORR of 83.3% (5/6 patients) via RECIST 1.1 was achieved and toxicity was low. In conclusion, these preliminary clinical results provide proof-of-principle evidence that α-PRRT can overcome resistance to β-PRRT.A first-in-human study was conducted by administering tration) . 213Bi-D(n = 18) . The meaoccurred . Furtherromising . At pres68Ga-DOTATOC compared with intravenous (IV) administration in 15 patients with GEP-NETs. IA administration of 68Ga-DOTATOC resulted in an average increase in SUV of 3.75-fold higher in liver metastases and 1.44- to 7.8-fold higher (dependent on the catheter placement) in the primary tumor, all compared with IV administration [Given the fact that NETs often metastasize to the liver, it can be hypothesized that intra-arterial (IA) administration of the radiopharmaceutical in the hepatic artery can lead to higher radiopharmaceutical concentrations and hence and improvement in treatment response, with a potential reduction in treatment toxicity . A high stration .90Y-DOTATOC and/or 177Lu-DOTATOC in 15 patients with liver metastases from GEP-NETs [111In-DOTATOC was also performed in this study. The time-activity curve of the intra-arterial administration of 111In-DOTATOC revealed a 3.5-fold higher uptake ratio just after termination of the infusion compared with IV administration. However, the time-activity curve of the IA administration also showed a saturation phase followed by a washout phase; this washout phase was not visible in the IV administration. This can be explained by receptor saturation, which depends on the total amount of administered peptide and the route of administration of the radiopharmaceutical (IA versus IV). Despite the washout effect, a higher tumor uptake was visible at 4 h (2-fold increase in uptake ratio) and 72 h post-injection (1.3-fold increase in uptake ratio) with the IA method, compared with the IV administration [Kratochwil et al. performed a pilot study investigating the efficacy of hepatic IA GEP-NETs . An ORR stration . FurtherAnother way of PRRT optimization can be achieved by pretreatment patient stratification. This strategy is gaining popularity over the last few years, given the fact that 15–30% of the patients show progression during PRRT and 10–20% of patients progress within the year after termination of PRRT ,64,152. The PRRT predictive quotient (PPQ) allows pre-PRRT patient stratification into PRRT-responders (PPQ positive) and PRRT-non-responders (PPQ negative). PPQ is based on serum-circulating gene clusters combined with tissue-tumor grading . The cirmax of more than 17.9, derived from 68Ga-DOTATOC PET, can predict responders from non-responders after PRRT with 90Y-DOTATOC, with a sensitivity of 100% and specificity of 95% [max of more than 16.4, derived from liver metastases on 68Ga-DOTATOC PET, can predict treatment response after PRRT with 90Y/177Lu-DOTATOC with a sensitivity of 95% and specificity of 60% [max of a single lesion and the average of up to five lesions (maximum two target lesions per organ) on 68Ga-DOTATATE PET/CT predicted response after 177Lu-DOTATATE [max cut-off of 13.0 was most optimal . This cut-off value was also associated with longer PFS (median 45.1 months if >13.0 compared to 19.9 if <13.0) with HR 2.5 (95%CI: 1.06–6.09). Ortega et al. investigated the relationship between multiple quantitative parameters, derived from 68Ga-DOTATATE PET/CT at baseline and after 1 cycle of PRRT, and treatment response in 91 patients with progressive metastatic NETs [max of malignant lesions on baseline and interim PET and mean higher SUVmax tumor-to-liver ratio of malignant lesions on baseline PET were predictive of therapy response . Higher values of kurtosis, a first-order heterogeneity parameter, derived from the malignant lesions on baseline PET, were observed in non-responders compared to responders . Further, Haug et al. investigated the role of 68Ga-DOTATATE PET/CT in early response prediction after PRRT (90Y/177Lu-DOTATATE), by evaluating changes in SUVmax and tumor-to-spleen SUV ratio (SUVT/S) between baseline and interim 68Ga-DOTATATE PET 3 months after the first cycle [T/S after the first cycle of PRRT was a significant predictor of time-to-progression in multivariate analysis. To the contrary, several studies did not find a predictive relationship between SUV and treatment response [max, the total tumor burden should also be assessed via SUVmean or total lesion activity [Several attempts have been made to discover a predictive relationship between quantitative PET-derived parameters on SSTR-imaging and treatment response after PRRT. Öksuz et al. found that a pretherapeutic SUVy of 95% . Moreovey of 60% . Sharma DOTATATE . A baseltic NETs . A highest cycle . Only a response ,161. Theactivity . Further177Lu-DOTATATE results in a pronounced longer PFS and a significantly higher response rate compared to high-dose octreotide long-acting-release [The phase-III NETTER-1 RCT has proven that PRRT with -release . In addi-release ,73. The"}
-{"text": "Progression-free survival (PFS) and overall survival (OS) of these patients are favorably comparable with standard therapies. The protagonist in this type of therapy is a somatostatin-modified peptide fragment ([Tyr3] octreotide), equipped with a specific chelating system (DOTA) capable of creating a stable bond with β-emitting radionuclides, such as yttrium-90 and lutetium-177. In this review, covering twenty five years of literature, we describe the characteristics and performances of the two most used therapeutic radiopharmaceuticals for the NETs radio-treatment: [ There are several combinations of molecular targeting vectors and radionuclides suitable for theranostic use. Multi-element radiopharmaceuticals, consisting of two radioisotopes possessing similar chemical properties but having different physical emission properties, for example, Tc/188Re ,3,4, 68G68Ga/90Y , used foThe nuclear medicine research, in this particular therapeutic field, is constantly evolving thanks to the strong multidisciplinary synergy. In particular, the close collaboration of specialists from different disciplines such as physics, chemistry, radiochemistry, biochemistry, pharmacology, and nuclear medicine has determined the possibility to offer targeted therapies against solid neoplasms, such as NETs.NETs include a heterogeneous group of neoplasms, exhibiting a variable biological behavior, that can originate from various organs with an estimated incidence of about 5 new cases per 100,000 individuals per year .Overall, the highest incidence of these neoplasms is affecting the organs of the digestive system, in particular ileum and pancreas and, less frequently, stomach, duodenum, colon and appendix, constituting the gastro-entero-pancreatic NET (GEP) and representing 60–70% of all NETs. In addition to GEP NETs, other histotypes, affecting, in particular, the respiratory system and bronchi (20–30%) or other organs (10%) such as skin, thyroid, parathyroid, thymus, paraganglia and adrenal glands, can be classified as non-GEP NETs ,9.111In]In-pentetreotide or PET-CT with [68Ga]Ga-SST-As) Y-DOTATOC, [90Y]Y-DOTATATE, [177Lu]Lu-DOTATATE, [177Lu]Lu-DOTATOC. However, the greatest clinical experience (and the most abundant scientific literature) refers to the use of [90Y]Y-DOTATOC, which represented the first generation radiopharmaceutical for NETs. More recently, the [177Lu]Lu-DOTATATE was used in the phase 3 Netter-1 study Y-DOTATATE while the interest and use of [177Lu]Lu-DOTATOC is still growing Ga-DOTATOC), we proposed both [90Y]Y-DOTATOC and [177Lu]Lu-DOTATOC as therapeutic radiopharmaceuticals octreotide (TOC), octreotide (TATE) and [1-Nal3] octreotide (NOC), with peculiar SST receptors affinity. Focusing the attention on the chemical characteristics of these ligands, it was found that the replacement of Phe3 in octreotide by Tyr3 leads to an improved SST-R2 affinity, but the SST-R3 and SST-R5 affinity is reduced; the C-terminal introduction of Thr for Thr(ol) in TATE results in a SST-2- selective ligand with a 7-fold improvement of SST affinity. The NOC derivative  leads to a peptide with affinity to SST2,3,5. -octreotide or SMT487 or Edotreotide), somatostatin analogue, functionalized with an amide bonded to a chelating bifunctional macrocycle DOTA -Tyr3-octreotide -Tyr3-octreotide , representing the “VECTOR” component, is responsible for the pharmacokinetics and pharmacodynamics of the final radiopharmaceuticals Y-DOTATOC and [177Lu]Lu-DOTATOC radiopharmaceuticals respectively.The 90Y and 177Lu are responsible for the selective irradiation of the target and collateral irradiation of critical organs . It follows that the pharmacological characteristics of [111In] In-DOTATOC, [68Ga-]Ga-DOTATOC, [86Y]Y-DOTATOC, [90Y] Y-DOTATOC and [177Lu]Lu-DOTATOC can be considered almost superimposable, especially for the last two radiopharmaceuticals Y- or [111In]In-DOTATOC were used to predict the in vivo behavior of radiopharmaceuticals based on the use of DOTATOC radiolabelled with β- isotopes with higher energy emitters such as 90Y and 177Lu Y-DOTATOC was the first of the two radiopharmaceuticals to be produced as described in the review by Otte and collegues (1998) showing that, when administered systemically, [90Y]YDOTATOC stably binds to neoplastic lesions expressing SST-Rs  Lu-DOTATATE was the first radiopharmaceutical of 177Lu used in PRRT and subjected, starting from the 2000s, to phase II clinical studies. Consequently, the greatest pharmacological knowledge refers to this radiopharmaceutical, so much so that today it is the only radiopharmaceutical approved by the competent authorities for [177Lu] Lu-DOTATATE. DOTATATE, as mentioned above, has a different affinity (compared to DOTATOC) for SST-R2 Y-DOTATOC or [177Lu]Lu-DOTATOC is still mainly performed using manual procedures although the radioactivity managed during the synthesis and fractionation of these radiopharmaceuticals is very high. Normally, the radiopharmaceutical product is a 0.9% NaCl/buffer solution  containing an activity between 16.65 and 24.05 GBq in a total volume approximately 18 to 26 mL. The radioactive concentration of the solution is on average about 0.92 GBq/mL. However, regardless of the production method adopted, the synthesis and quality control procedure is the same and is described hereafter in accordance with European Pharmacopoeia. According to the revised procedure [177Lu]Lu-DOTA-TOC and [90Y]Y-DOTATOC were obtained conjugating the [177Lu]LuCl3 or [90Y]YCl3 with the DOTATOC peptide in the acetate form. The radiopharmaceutical synthesis must be carried out in a classified isolator. Both radiopharmaceuticals can be prepared by adding into the reactor, containing the radioisotope [177Lu]LuCl3 (or [90Y]YCl3), the solubilized peptide in ascorbate buffer , sterilized (0.2 mm sterile filter)  b and fin filter) c. The ad177Lu makes the radiopharmaceutical more suitable for the treatment of small lesions (≤20 mm) while the 90Y makes it more suitable for the treatment of large lesions (>20 mm) Lu-DOTATOC and [90Y]Y-DOTATOC.Since many researchers have produced and collected pharmacokinetic and pharmacodynamic data, comparing the different radiopharmaceuticals belonging to this radiopeptides category, these data will be presented in the following paragraphs with particular reference to MK-678 to evaluate the expression of surface membrane receptors and found that the binding of somatostatin peptides with high SSTR2 affinity and antiproliferative properties were powerful inhibitors of [125I]MK-678 binding to various tumor species, indicating that they can practice antitumor effects via the SSTR2 receptor.In a study conducted in 1994 by Taylor et al.  the pres111In]In-DTPA] octreotide, OctreoScan®; London, UK), was the ideal chelator for the radiosynthesis of radiolabeled somatostatin analogues. Moreover, a new modified octreotide Tyr3-octreotide (TOC), conjugated with the DOTA chelator (DOTATOC) and radiolabeled with indium-111 or yttrium-90 showed greater affinity for tumor cells expressing receptors for somatostatin with respect to [111In-DTPA0]-octreotide] and, therefore, a high diagnostic and therapeutic potential, respectively.De Jong et al. , in one 90Y]Y-DOTATOC has decreased by 65% intravenous administrated D-lysine, while the radioactivity of the blood, the pancreas and the adrenal glands were not affected. The D-lysine may be preferred to the L-lysine for reducing renal absorption of radioactivity during scintigraphy and PRRT due to lower toxicity and its disturbing with the metabolic equilibrium of natural amino acids.The potential nephrotoxicity following therapeutic use of radiolabeled somatostatin analogues was already known after the first pharmacological and scintigraphic studies with radiopeptides. In an animal study conducted by Bernard et al. , it was In a study published the following year, de Jong et al.  confirme90Y]Y-DOTATOC binds rapidly to the tumor of rats; (2) 24 h after administration, the ratio of radiopharmaceutical concentration in the tumor to blood is equal to 49.14; (3) a single administration of 10 mCi/kg of [90Y]Y-DOTATOC is able to determine a complete response in 5/7 experimental animals, with no signs of recurrence disease in the following eight months.In the same year, Stolz et al.  publishe0-(D) Phe1-octreotide (DOTAOc), DOTA0-(D) Phe1 Tyr3-octreotide (DOTATOC), DOTA0-(D)®Nal1-lanreotide (DOTALan) and DOTA0-(D) Phe1-vapreotide (DOTAVap) were tested, compared and better defined from a pharmacological point of view radiolabeled with indium-111, iodine-125 and yttrium-90 and tested in mouse models carriers of AR4-2J tumor with high SST-R2 receptor expression. For all DOTA-peptides included in the study, regardless of the incorporated isotope type, favorable biodistribution profiles were observed in animals with: (1) high receptor affinity for SST-R2 membrane receptors located on AR4-2J tumor cells; (2) a rapid clearance of radiopeptides from all tissues not expressing SST-R2 with the exception of the renal parenchyma and a specific uptake of radiopeptides in tissues expressing SST-R2 and in particular in tumor lesions; (3) excellent intra-tumor penetration of DOTA-peptides, and of DOTATOC in particular, which correlates with a high diagnostic and therapeutic efficacy.In a fundamental study by Froidevaux et al.  in 1999,50) of TOC, DOTATOC and Y-DOTATOC  for SSR-T2 has the highest values compared to the other analogs and that the bond with DOTA influences the binding affinity between the TOC peptide and the SST-R2, while the further incorporation of the metal inside the DOTA does not involve changes in receptor affinity.To get these results, chelator-free peptides [Oc and TyrOc (or TOC)], DOTA-chelated peptides (DOTATOC) and peptides conjugated with non-radioactive yttrium were tested, taking into account that the incorporation of the metal, radioactive or not, could influence the receptor affinity of the complex. The results obtained showed that the affinity  and, therefore, the highest tumor retention value in the 48-h observation period. Renal distribution was maximal at 4 h after administration and for DOTATOC was relatively low compared to the other peptides.A valid indicator of efficacy and safety for the therapeutic use of radiopeptides has been identified in the ratio between the surface area (under the distribution curve in the period 4–48 h after administration) relative to the tumor and the surface of the tumor area (under the distribution curve in the period 4–48 h after administration) relative to the renal parenchyma. The tumor/kidney ratio of DOTATOC was, once again, more advantageous than the other radioligands .This study has therefore shown that, among the DOTA-peptides examined in animals, DOTATOC has the best pharmacological profile, and it is probably the most suitable and promising radioligand for nuclear medical oncological clinical applications.90Y]Y-DOTATOC in CA20948 pancreatic tumors, of various sizes, transplanted into Lewis rats. The study showed the ability of ([90Y]Y-DOTA(0),Tyr(3))octreotide to control tumor growth, especially in medium-sized tumors and included in a volumetric range ≥1 cm2 and ≤14 cm2. The effect of radionuclide therapy appeared to be dependent on tumor size at the onset of therapy. They confirmed the therapeutic effect of [90Y]Y-DOTATOC previously demonstrated by studies Stoltz et al. Y-DOTATOC and [177Lu]Lu-DOTATATE in rats with tumor lesions (CA20948 or AR42J) expressing somatostatin receptors ranging in size from 0.1 to 15 cm2. The animals were treated with 1–2 intravenous administrations (one week apart) of 277.5–555 MBq of [177Lu]Lu-DOTATATE or 379 MBq of [90Y]Y-DOTATOC and followed for at least 150 days after therapy. They observed that the antitumor response obtained depended on the size of the lesions and, in particular, that 177Lu was more suitable for small lesions while 90Y showed greater efficacy on large lesions. These studies subsequently paved the way for clinical trials reaching conclusions still valid and applied in the most modern clinical protocols of PRRT Y-DOTATOC at doses of 120, 240, 360 mCi/m2 have documented a no-observed-effect-level (NOEL) value in monkeys at 120 mCi/m2. The NOEL values in rats treated daily for 4 weeks were: 1 mg/kg/day (6 mg/m2/day) and 0.3 mg/kg/day (1.8 mg/m2/day) in males and females, respectively. The NOEL values in monkeys, treated intravenously daily, for 4 weeks, were: 0.3 mg/kg/day (3.6 mg/m2/day) and 1 mg/kg/day (12 mg/m2/day) in males and females, respectively [The toxicity profile of DOTATOC was assessed—as such and after radiolabeling with ectively .86Y [111In [90Y and 177Lu allowed one to obtain accurate predictions in terms of absorbed dose to tumor lesions and healthy/critical organs and efficacy and safety profile. The evaluation of the kinetics of the system is carried out using a multi-compartmental developed by Cremonesi et al. [111In]In-DOTATOC [111In]In-DOTATOC from the blood compartment is very rapid and the circulating rate decreases to less than 9 ± 5% within the first hour and to less than 0.9 ± 0.4% within 10–12 h of intravenous administration.The DOTATOC pharmacokinetics and biodistribution have been studied in humans after labeling with 86Y  and withY Y-DOTATOC, obtained superimposable pharmacokinetic data and demonstrated that: (i) there is a rapid disappearance of the radiopeptide from the bloodstream with a plasma residue of the injected activity of approximately 5% after 5 h and ≤1% at 24 h; (ii) the circulating activity is entirely confined to plasma with a share linked to red blood cells of less than 1%; (iii) the fraction of stable radiopeptide circulating in the plasma is high (95.3 ± 4.7%) and that this value remains constant over time (with observations up to 3 h after administration) confirming the effectiveness of the chelating molecule DOTA; (iv) intravenous co-infusion of amino acids (L-Lysine and or L-Arginine) for the protection of the renal parenchyma did not significantly modify the plasma clearance curve of [89Y]Y-DOTATOC.Jamar et al.  with [89177Lu]Lu-DOTATATE is comparable to that of [111In]In-DTPA-octreotide, with rapid scintigraphic visualization of the renal parenchyma after administration and of the liver, spleen, kidneys, (and in some patients pituitary and thyroid) and tumor lesions 4 h after administration. The authors also reported in their study that the distribution patterns of the two radiopeptides at 24 h after administration are similar, with corresponding uptake on the liver, kidney and spleen; on the other hand, tumor lesions are more intensely (up to 3–4 times) and longer uplifting after administration of [177Lu]Lu-DOTATATE. From the percentage biostribution data obtained, the absorbed dose values for critical organs and tumor lesions were extrapolated. For the latter, it was demonstrated, by theoretical model, that the absorbed dose was 4 times higher for [177Lu]Lu-DOTATATE compared to [111In]In-DTPA-octreotide and 2 times higher for [177Lu]Lu-DOTATATE compared to [90Y]Y-DOTATOC [Kwekkeboom et al.  document-DOTATOC .177Lu]Lu-DOTATATE with [177Lu]Lu-DOTATOC. For both, the clearance in the blood is very rapid and the plasma concentration is less than 10% of the activity administered after 3 h. During the first 24 h the clearance of [177Lu]Lu-DOTATOC is slightly faster than that of [177Lu]Lu-DOTATATE but this difference is not statically significant and, therefore, the clearance is evaluated as overlapping for the two radiopeptides.Esser et al.  compared177Lu]Lu-DOTATATE, with a mean ratio of 2.1:1 compared to [177Lu]Lu-DOTATOC. Similarly, the value of τ is in the ratio of 1.4:1 and 1.5:1 for the renal and splenic parenchyma, respectively. The authors conclude that, based on residence times, a higher dose absorbed to the tumor but also a higher absorbed dose to the renal parenchyma is foreseeable in the case of [177Lu]Lu-DOTATOC, in the case of [177Lu]Lu-DOTATOC a lower absorbed dose to the tumor, but also a lower dose absorbed to the kidney which, however, remains the critical and limiting organ in PRRT.As regards the residence time τ in tumor lesions and in healthy/critical organs, however, a significant difference has been documented which, with the same clearance times and in the presence of the same isotope and the same chelating molecule, is imputable—as expected—to the different receptor affinity that the two distinct somatostatin analogues (TOC and TATE) have for SST-R2. In particular, the tumor τ value is significantly longer for patients treated with [177Lu]Lu-DOTATOC delivers the lowest doses to healthy organs and has a more advantageous ratio—in terms of absorbed dose—between tumor and kidney, compared to [177Lu]Lu-DOTATATE and [177Lu]Lu-DOTANOC  which deserves extensive consideration in the dosimetric evaluation, in order to limit renal damage. The deposit of radioactive urine at the level of the bladder cavity is a source of irradiation of the wall of this organ : this situation must also be taken into consideration, especially for when it concerns the aids to stimulate and facilitate diuresis.The elimination of the unbound portion of radiolabeled peptide occurs mainly through the renal emunctorium and, to a lesser extent, through the intestinal emuntorium. The amount of radiopetide present in the pre-urine undergoes reabsorption (mediated by an active transport mechanism) at the level of the proximal convoluted tubule cells. This reabsorption—if a somatostatin analogue radiolabelled with 111In]In-DOTATOC it was estimated that the cumulative activity of radiopeptide eliminated in urine was 52% ± 12% of the amount administered 4 h after administration and 73 ± 11% after 24 h from administration. Although the radioexposure of the renal parenchyma in the case of [177Lu]Lu-DOTA-SST-As is lower than the values reported in PRRT with [90Y]Y-DOTA-SST-As, it is still essential to consider the kidney as a critical organ and apply all available aids  in order to limit the damage.From the studies carried out, it has been shown that the amount of radiopetide eliminated through the intestinal emuntorium is reduced to the limits of significance and therefore determines a negligible dosimetric load. With [86Y]Y-DOTATOC Lu-DOTATOC compared to [177Lu]Lu-DOTATATE with percentages equal to 81% and 71%, respectively.Esser et al.  showed tIn two decades of follow-up, relating to numerous clinical studies, a lot of information was extracted about the safety and efficacy of PRRT. In terms of safety, PRRT is a well-tolerated treatment, with absent or mild-moderate toxicity in most cases, if performed with the correct prescribing methods and adopting all measures aimed at limiting the absorbed dose to the renal parenchyma and to the hematopoietic marrow, which represent the critical dose-limiting organs. In terms of efficacy, PRRT is able to determine an objective response with a reduction in size of lesions and tumor-specific markers, a reduction in symptoms and therefore an improvement in the quality of life and, overall, an increase in survival times.177Lu in PRRT was introduced in 2000, with the somatostatin analogue DOTATATE peptide. The use of [177Lu]Lu-DOTATATE has spread rapidly and—especially due to its potential better profile of renal toxicity due to the physical characteristics of the isotope used—has relegated the use of 90Y radiolabeled peptides to the background. The first studies with [177Lu]Lu-DOTATATE were carried out at the Erasmus University of Rotterdam. The key work regarding PRRT with [177Lu]Lu-DOTATATE is that of Kweekeboom et al. [177Lu]Lu-DOTATATE, for 4 consecutive administrations, with intervals of 8 weeks. As regards the objective response—measured with the SWOG criteria—the following results were obtained: CR: 2%, PR: 28%, MR: 16%, SD: 35%. In the same population, the median OS was found to be greater than 48 months and the PFS equal to 33 months. Direct comparison with a series of published data from a similar population estimated that patients undergoing PRRT with [177Lu]Lu-DOTATATE achieved an estimated survival benefit of 40–72 months. Although these data are not derived from a randomized study, the difference in survival reflects the real therapeutic impact that PRRT can have in the care of NET patients. The authors state that the data relating to the response obtainable from PRRT can compare well with those relating to other treatments, such as chemotherapy. In this study, it was also observed that the best therapeutic responses were obtained in those patients who showed high lesional uptake at baseline scintigraph with OctreoScan® and limited liver disease. In contrast, disease progression was more frequent in patients with low performance status and extensive liver disease. An attempt to categorize the objective response on the basis of histology allowed us to understand that NETs of pancreatic origin had a tendency to respond better than other GEP NETs and that functioning forms (pancreatic gastronomy) had a tendency to relapse earlier than to the remaining histotypes included in the study. In this study, the authors evaluated toxicity in 504 patients. Acute side effects that appeared within 24 h of radiopharmaceutical administration included nausea, vomiting and abdominal pain (10–25% of administrations). Grade 3–4 hematological toxicity (WHO), although transient, affected 9.5% of patients. Episodes of severe late toxicity  involved 13 patients (2%).The use of m et al. , which i177Lu]Lu-DOTATATE: these studies  of bronchial NETs (B -NETs) and other histotypes (some not strictly NETs but still expressing SST-R2). In particular, the following are summarized: the sample of treated patients, the histological variant, the objective response, the survival times, the toxicity profile and the most relevant clinical conclusions.On the experience of the Dutch group, other European Centers have carried out PRRT studies with [ studies  althoughR1 study  is the f177Lu]Lu-DOTATOC is another radiopeptide used in PRRT [1LuLu-DOTA in PRRT .177Lu]Lu-DOTATOC used in patients with advanced NETs. 56 patients with metastatic and progressive disease were studied  and treated with various cycles (1-4) of [177Lu]Lu-DOTATOC, with a median activity per cycle of 7.0 GBq and with intervals of 3 months between one cycle and the next. The results of this study confirmed that [177Lu]Lu-DOTATOC determines an objective response and survival times comparable to those obtained using [177Lu]Lu-DOTATATE. The most interesting thing that emerges from the results is the absence of significant side effects, especially affecting the renal parenchyma. 20% of the patients included in the study and treated presented (even before the PRRT) moderate renal insufficiency: in these patients, an objective lesion response was obtained, and no worsening related to the pre-existing renal deficit was manifested. 177Lu]Lu-DOTATOC was used, as the only radiopharmaceutical or in association with [90Y]Y-DOTATOC, for the treatment of NETs and other histotypes (some not strictly NETs but still expressing SST-R2). In particular, the following are summarized: the sample of treated patients, the histological variant, the objective response, the survival times, the toxicity profile and the most relevant clinical conclusions.Among the various studies in the literature, the phase 2 study by Baum et al.  is relev177Lu]Lu-DOTATOC , shows a high percentage of objective responses and high survival times. Furthermore, the safety profile is also favorable, with bone marrow toxicity percentages comparable (and in some cases lower) to those reported in the PRRT studies with [177Lu]Lu-DOTATATE.The analysis of the reported studies concerning the use of Y-DOTATOC and 3.8% per year after [177Lu]Lu-DOTATATE In-pentetreotide and mostly [68Ga]Ga-SS-As guarantee high accuracy to obtain this type of information. Numerous recent studies have confirmed that the lesion level uptake index  is potentially correlated with the magnitude of the objective response (OR) and the efficacy of the treatment in terms of overall survival (OS) and progression-free survival (PFS), reductions in symptoms and, therefore, improved quality of life (QoL).(a2)Histology positive for NET.In fact, a high receptor expression is essential to ensure adequate accumulation of radiopharmaceuticals and a consequent adequate radiation dose to tumor lesions. Positive imaging with [(a3)Well-differentiated low graded shapes (WHO) .NETs include the neoplasms that most frequently and most abundantly express SST-R2. Among these, the histological variants that statistically best respond to PRRT include those of the gastro-entero-pancreatic tract and the forms of broncho-pulmonary origin. NETs that originate in the remaining organs of the respiratory system and in other locations , as well as other histotypes with neuroendocrine phenotypes, generally have less responsiveness and efficacy to the treatment.(a4)Limited spread of disease.The histotypes with a high degree of differentiation, i.e., G1 (Ki67 ≤ 3%) and G2 (Ki67 ≤ 10%), provide the best profiles of objective response and efficacy in terms of survival at PRRT. Some histotypes with G2 (Ki67 > 10%) and especially the well-differentiated G3 (Ki67 > 20%) forms may respond to treatment but have lower PFS and OS values.(a5)Hepatic and pancreatic localization.The extent of disease spread is inversely proportional to the degree of objective response and therapeutic efficacy in terms of PFS and OS. Very often the NETs are indolent and slowly progressive, and their diagnosis occurs frequently when the disease is already systemic due to the presence of diffuse metastases or in any case not surgically attacked. Where technically possible and the patient’s general condition permits, surgical or interventional procedures aimed at eradicating or reducing the disease are recommended. Adjuvant post-surgical therapies, including PRRT, may be more successful after tumor debulking.(a6)Good performance status.Secondary hepatic lesions from NET are those that most frequently respond to PRRT, but primary NETs of the pancreas also show good responses to treatment. More resistant to treatment are secondary lymph node lesions and, above all, skeletal ones. PRRT with intra-arterial administration of the radiopharmaceutical through the hepatic artery represents—in patients with localized liver disease—an alternative modality (compared to the classic systemic intravenous administration) capable of expanding the therapeutic response and outcome of patients.(a7)Favorable genotype.A good general clinical status of the patient, a good life expectancy and the absence of comorbidities are potential factors directly related to the success of the treatment. In particular, the absence of risk factors for bone marrow toxicity  and for renal toxicity  allows, in a context of greater tolerability by of these two critical organs, the administration of the highest levels of administrable radiopharmaceutical activity, which results in a higher absorbed dose to the tumor lesions.It is known, in clinical practice, how similar clinical presentations of NETs can respond differently or even opposite to the various types of treatment, including PRRT. The evaluation of the cellular genome, which can be performed with specific tests still in the experimental phase (NeTest), will, in the near future, describe the state of the disease and predict its prognosis and possible response to therapeutic treatments ,106.(b)(b1)Multidisciplinary evaluation.Factors related to the therapeutic management of the patient to be treated:(b2)Adherence to PRRT protocols (and guidelines).The preliminary discussion of each single clinical case, the collegial choice of treatment, the timing and sequencing between the different treatments that make up the patient’s therapeutic plan, as well as the participatory evaluation of the follow-up, represent the ideal prerequisites for an efficient and effective management of the patient affected by NETs. Various studies correlate patient outcomes with how they are managed within structured specialized clinical paths and/or specialized and highly equipped Centers to respond to this type of patient.PRRT benefit predictors are ,62,71:Reduced bone marrow function.PRRT risk predictors are ,62,71:, especially if performed in the weeks preceding the PRRT, increase the risk of bone marrow toxicity after PRRT. In cases of suspected haematological compromise, it could be useful to perform a biopsy of the haematopoietic marrow to verify the pre-PRRT situation, in order to evaluate the possible risks that the PRRT itself could bring and therefore implement the precautions aimed at reducing potential risks . In any case, the overall bone marrow dose should always be ≤2 Gy. In relation to the activities (90Y or 177Lu) administered, the persistence of low platelet values, after the first courses of treatment, could affect the ability to recycle within the scheduled time and administer the planned activities at the start of treatment. Severe acute toxicity, albeit reversible, was reported in less than 10–13% of patients treated with 90Y and in 2–3% of those treated with 177Lu. In addition, sporadic cases of acute myelodysplasia and leukemia have been described.(b)Reduced kidney function.Adequate bone marrow reserve should be present in PRRT candidates. Reference values recommend: WBC > 3000/μL, with absolute neutrophil value >1000/μL, PLT > 75,000/μL for [90Y is recommended in situations in which renal function  is preserved. Treatments with 177Lu can also be admitted to patients with mild renal function impairment but, in any case, with creatinemia values ≤1.7 mg/dL. Renal parenchyma protection based on the administration of amino acids (L-Lysine and/or L-Arginine) before, during and after PRRT treatment is always recommended in all patients, regardless of starting renal function. For this concomitant treatment, attention should be paid to the possible hyperkalemia [The kidney represents the dose-limiting organ for radiopharmaceutical activities normally used in PRRT. Therapy with rkalemia ,108.90Y labeled peptides are used compared to those based on the use of analogues conjugated with 177Lu.Some chronic diseases such as uncompensated diabetes, uncontrolled hypertension, obstructive nephropathies, as well as any previous nephrotoxic chemotherapeutic treatments (based on platinum) represent risk factors for the development of a potential toxicity induced by PRRT. On the basis of these observations, the absorbed dose to the kidney, in terms of BED , was set at a threshold value of ≤40 Gy for the standard population and ≤28 Gy for subjects with a positive history of aforementioned pathologies favoring the onset of renal toxicity. Although the clinical experience accumulated in the last twenty years by the main PRRT centers has considerably reduced the occurrence of side effects, the most recent summary data confirm the possibility of a deterioration of renal function, more accentuated in the PRRT protocols in where Absolute contraindications to PRRT : pregnanAccording to what emerges from the literature and clinical experience, it can be said that PRRT constitutes an essential tool for the treatment of numerous patients with neuroendocrine neoplasia. In particular, taking into consideration the data concerning the potential toxicity and the documented therapeutic efficacy, the balance between the risks and the benefits clearly leans in favor of PRRT."}
-{"text": "Adjuvant temozolomide (TMZ) chemotherapy with standard regimen remarkably improves survival in patients with high-grade glioma (HGG). However, the influence of long-term TMZ chemotherapy on serum ions concentration is unclear.One hundred and thirty-eight patients with HGG were included. Their blood samples were collected for blood biochemistry and routine test. The alteration in serum ions concentration, total protein, albumin, globin, and blood cells counts were used to identify the impact of long-term TMZ chemotherapy.p < 0.001; 1st vs. 12th, p < 0.001). Additionally, the correlation analysis showed that platelets was negatively correlated with chemotherapy cycles . The hematological adverse events mainly centered on grade 1 to 2.Through the comparation of quantitative value of diverse parameters among different chemotherapy cycles, we identified that serum potassium concentration had a downward trend after TMZ administration (1st vs. 6th, Long-term administration of TMZ may lead to serum ions disturbance. Besides the myelosuppression, we should pay attention to the alteration in serum ions concentration, and give patients proper symptomatic treatment when necessary.The online version contains supplementary material available at 10.1186/s41016-022-00271-7. As the most common intracranial primary malignant tumor in adult, glioma is characterized by high invasiveness and recurrence rate, especially for high-grade glioma  , 2. MediPostoperative radiotherapy with concurrent and adjuvant TMZ chemotherapy is universally recognized in clinical practice . In receBesides the effect on survival, there were studies assessing the influence of cisplatin on serum ion concentration and trace elements , 22. Howhttp://www.cgga.org.cn).There were two cohorts in this study. The first cohort included 73 recurrent HGG samples with postoperative chemotherapy information and RNA sequencing data available (48 with postoperative chemotherapy and 25 without) Table . The dat2/day for days 1–5 every 28 days) in our hospital. Seventy-three patients received at least 12 cycles of TMZ chemotherapy while 28 patients received at least 18 cycles. The range of chemotherapy cycles was from two to thirty-seven. After 6-cycle standard adjuvant chemotherapy, extended chemotherapy was performed according to the tumor residual and patients’ tolerance. The blood samples were collected before the next cycle of chemotherapy. Testing items included blood biochemistry  and blood routine   grade III and IV primary gliomas from Beijing Tiantan Hospital during May 2011 to March 2018 were enrolled in this study. Considering the large variation of time interval between two chemotherapy cycles in patients, patients with interval time more than 56 days were excluded. One hundred and thirty-eight postoperative patients were included finally. All patients received adjuvant TMZ  . The chaThe Common Terminology Criteria for Adverse Events (CTCAE) version 5.0 established by the National Cancer Institute was applied to assess the severity of the hematologic toxicity for patients in the second cohort. In CTCAE system, grade 1 to 5 indicates mild adverse effects, moderate adverse effects, severe or medically significant adverse effects, life-threatening adverse effects and death related to adverse effects, respectively. Here, the degree of thrombocytopenia, leukopenia, anemia, and erythropenia were evaluated by using CTCAE criteria .https://www.r-project.org/). Public packages “ggplot2,” “fgsea,” “qusage,” and “pheatmap” were used to perform statistical computation. Gene set enrichment analysis (GSEA) was applied to annotate the function of genes that were highly expressed in the chemotherapy group in the first cohort. In the second cohort, Spearman rank correlation analysis was applied to detect the correlation between chemotherapy cycles and the change of parameters. In patients with the same chemotherapeutic cycles, analysis of paired t test or paired Wilcoxon symbolic rank test was used to compare the change of ions concentration between different periods of chemotherapy. Chi-square test was used to compare the difference between hematological adverse events and chemotherapy cycles. In all statistical analysis, a p < 0.05 was considered significant.R language was used for statistical analysis and generating figures  > 1) were enriched in ion channels and ion transmembrane transport, including calcium, potassium, sodium, and chloride channels .To investigate the effect of TMZ chemotherapy on the expression profiles of HGG samples, we downloaded the RNA sequencing data of 73 recurrent HGGs with postoperative chemotherapy information available from CGGA database Table . Patientr = − 0.762, p = 0.004; Fig. r = 0.747, p = 0.005; p > 0.05). To detect the difference more directly, we compared the quantitative value of the ions in different chemotherapy cycles . The serum sodium concentration diminished slightly between the sixth cycles and the twelfth cycle (p = 0.029). While, an elevated serum concentration was observed in certain ions, such as iron  and chlorine . Therefore, we observed definite correlations between TMZ chemotherapy and ion concentrations in HGG patients.To validate the effect of TMZ chemotherapy on the concentration of serum ions, we collected the blood test results (blood biochemistry and blood routine test) from 138 patients in the second cohort before every cycle of TMZ chemotherapy. To reduce the variation of the baseline levels in each individual, we used their first blood test value as a baseline, and focused on the relative level  of the ions. With the increase of TMZ chemotherapy cycles, serum ions concentration showed slight fluctuations Fig. A–F. The p = 0.043) and potassium (p = 0.049) significantly declined after 18 cycles chemotherapy    Fig. . The num= 0.047) . With inThe toxicity of TMZ has been widely investigated. Fatigue, gastrointestinal side effects, leukopenia and thrombocytopenia were recognized as common adverse events , 23. To T test and Wilcoxon signed-rank test were applied for analyzing the differences among the first cycle, the sixth cycle and the eighteenth cycle chemotherapy. The results showed that the disorder of serum ions concentration was associated with long-term chemotherapy. However, except for some extremums, most indicators could maintain within normal range. Benefiting from the oral administration, patients did not need to stay in the hospital for a long time, which, on the other hand, affected the results to a certain extent. There were great differences in their dietary habit, digestive side effect as well as taking Chinese traditional medicine, which led to the inevitable biases. We attempted to enlarge the sample size to minimize such biases. Whereas, individual differences among patients could not be eliminated. Therefore, we performed data analysis to remind the clinicians paying attention to the risk of serum ions metabolism disorder after prolonged cycles of TMZ chemotherapy.According to the result of GSEA analysis, the function of differentially expressed genes was mainly involved in ion channels, such as potassium ion, calcium ion and sodium ion, etc. Compared with those without chemotherapy, patients received TMZ chemotherapy presented an up-regulation of genes associated with potassium, calcium and sodium ion transport, which reminded us that TMZ chemotherapy might change the serum ions concentration via regulating certain ion channels. To verify our findings, we included eligible patients with HGG and collected their blood samples to further analysis. For those patients who received at least 12 cycles chemotherapy, their serum ions concentration and the hematological parameters tended to fluctuate. The correlation analysis revealed that serum potassium concentration and PLT were decreased visibly with the increase of chemotherapy cycles. It has been reported that TMZ-induced cell death and apoptosis was mediated by O6-methylguanine (O6-meG) production and its reactive oxygen species production. TMZ-induced O6-meG production, involved in AMP-activated protein kinase (AMPK) activation, and contributed to cell apoptosis by promoting p53 activation and inhibiting mTORC1 signaling , 27. BasIn addition, the interaction among ions metabolism should be concerned with. Some studies suggested that the maintenance of serum potassium concentration resulted in sustained improvement in calcium balance . ApproxiLong-term TMZ chemotherapy may lead to the disturbance of ions concentration by influencing the specific ion channels. In addition to the focus on myelosuppression, we should pay attention to the alteration in serum ions concentration, and give patients proper symptomatic treatment when necessary. However, the dietary supplement, treatment before chemotherapy, anti-emetics and individual difference are unavoidable factors that may influence the results. Thus, well-designed large clinical trials and rigorous experiments are needed in the future.Additional file 1: Figure S1. The correlation analysis between serum parameters and chemotherapy cycles (with iron).Additional file 2: Figure S2. Chi-square analysis between hematological adverse events and chemotherapy cycles. (A) Leukopenia; (B) Thrombocytopenia.Additional file 3: Table S1. The normal ranges of blood routine and blood biochemistry test.Additional file 4: Table S2. Hematological adverse event assessment in TMZ administration according to the CTCAE criteria.Additional file 5: Table S3. The grade of adverse events according to CTCAE criteria."}
-{"text": "Accumulating evidence also suggests that ER stress may play an important part in the pathogenesis of inflammatory myopathies and genetic muscle disorders. Among the different known proteins regulating ER structure and function, we focused on RTN-1C, a member of the reticulon proteins family localized on the ER membrane. We previously demonstrated that RTN-1C expression modulates cytosolic calcium concentration and ER stress pathway. Moreover, we recently reported a role for the reticulon protein in autophagy regulation. In this study, we found that muscle differentiation process positively correlates with RTN-1C expression and UPR pathway up-regulation during myogenesis. To better characterize the role of the reticulon protein alongside myogenic and muscle regenerative processes, we performed in vivo experiments using either a model of muscle injury or a photogenic model for Duchenne muscular dystrophy. The obtained results revealed RTN-1C up-regulation in mice undergoing active regeneration and localization in the injured myofibers. The presented results strongly suggested that RTN-1C, as a protein involved in key aspects of muscle metabolism, may represent a new target to promote muscle regeneration and repair upon injury.Skeletal muscle is a very dynamic and plastic tissue, being essential for posture, locomotion and respiratory movement. Muscle atrophy or genetic muscle disorders, such as muscular dystrophies, are characterized by myofiber degeneration and replacement with fibrotic tissue. Recent studies suggest that changes in muscle metabolism such as mitochondrial dysfunction and dysregulation of intracellular Ca Myogenic differentiation is an essential process of muscle development depending on the activity of different specific cells and environmental signals ,2. WhileLoss of skeletal muscle mass is associated with a wide array of disease states such as aging, cancer, HIV, chronic heart failure, burn injury, etc. . In addiER stress and the UPR pathways may regulate not only skeletal muscle adaptation in response to physiological stimuli, but also their formation during embryonic development and regeneration upon damage. Indeed, recent studies suggest that a physiological mild ER stress, which occurs during muscle cell differentiation, improves myogenic differentiation efficiency ,9. On thExisting evidence also links muscular dystrophies with mitochondrial and metabolic dysfunction. Indeed, it is now clear that energetics and mitochondrial dynamics are severely affected in muscle disorders and multiple metabolic adaptations are induced to maintain energy homeostasis in dystrophic muscle .2+ homeostasis, thus providing a possible mechanism by which this structural ER protein modulates the cellular metabolism. Recently, we also demonstrated that RTN-1C is involved in the regulation of autophagy [In this regard, the reticulon 1 protein (RTN-1C) has been demonstrated to be a key component of the ER compartment and a functional molecule in the induction of ER stress. RTN-1C is a member of the reticulon family, ER-associated proteins that play important role in bending and shaping the ER membrane, in trafficking of material from the ER to the Golgi apparatus, and in apoptosis . Our preutophagy . Specifiutophagy ,18,19. IBased on these findings, we here studied the role of RTN-1C in myogenic and muscle regenerative processes. We provided evidence that RTN-1C expression correlates with UPR pathway up-regulation and myogenic differentiation. Moreover, by using an in vivo model of Duchenne muscular dystrophy, we observed that RTN-1C modulation is also associated with myogenic and muscle regenerative processes in a pathogenic context.To investigate RTN-1C’s role in skeletal muscle differentiation, we used C2C12 myoblasts, a well-established cellular model, to study myogenesis. C2C12 can be cultivated in proliferative conditions when cultured in growth medium (GM) and undergo myogenic differentiation once shifted in differentiation medium (DM), forming multinucleated differentiated myotubes as shown in To study the effect of RTN-1C modulation along the differentiation process, we either over-expressed or silenced the protein in C2C12 cells and analyzed by western blotting the expression of different myogenic markers. Considering skeletal muscle’s ability to regenerate in response to injury, we investigated on the role of RTN-1C during the regenerative processes in vivo. Muscle regeneration was induced by muscle freezing of anterior tibialis in wild type (WT) mice and analysed for the expression of RTN-1C after 3 and 7 days post injury (d.p.i.). RTN-1C expression in injured anterior tibialis significantly increased at transcriptional A and traPrompted by this evidence, we investigated whether RTN-1C was involved not only in physiological regeneration, but also in disease-associated regenerative processes occurring in Duchenne Muscular Dystrophy (DMD). To this aim, we used mdx mice, the most common mouse model for DMD, characterized by the presence of a premature stop codon in exon 23 of the dystrophin gene. In mdx mice, muscle fibers became necrotic, initiated inflammatory processes, and progressed through cycles of degeneration and regeneration, starting at 2 weeks of age, peaking at 12 months, and continuing for the remaining lifetime of the mouse. Remarkably, the analysis of RTN-1C levels underlined a higher amount of the protein in both tibialis anterior and diaphragms of mdx mice with respect to the age-matched WT mice C,D. AccoDuring muscle regeneration, different cell types take part of the repair process. Among those, we can include muscle satellite cells, macrophages, and fibro-adipogenic precursors . In partTo trace RTC-1C expression in satellite cells in vivo, we analyzed its expression in freshly-isolated cells at different time points after muscle injury and analyzed right after isolation. Upon muscle injury, satellite cells exited from the quiescent state and became activated. After a proliferative expansion, they eventually underwent myogenic differentiation to repair damaged muscle ,22,23. WWe previously demonstrated that RTN-1C plays an important role in endoplasmic reticulum (ER) stress induction and the UPR pathway ,14; inteIn line with these findings, we observed an increase of ER stress-related genes such as GRP78 and the phosphorylated form of eIF2α that parallels RTN-1C upregulation in C2C12 D. These According to this evidence, we investigated whether RTN-1C could affect ER stress response during DMD pathogenesis. We unveiled a positive correlation among RTN-1C-increased expression in dystrophic tibialis and diaphragm and enhanced GRP78 and phosphorylated eIF2α protein levels E.In this study, we investigated the involvement of the reticulon protein 1C (RTN-1C) in skeletal muscle differentiation. We previously demonstrated that RTN-1C has a key role in different cellular processes associated to changes in ER homeostasis and function . SkeletaAnother important aspect of skeletal muscle metabolism and physiology is mitochondrial dynamics, which affect the signaling pathways regulating muscle mass. In this regard, we demonstrated that RTN-1C induces morphological and functional changes of mitochondria through the modulation of ER–mitochondria cross-talk .Moreover, we recently highlighted a new role for RTN-1C protein as a novel emerging regulator of autophagic processes . Taken tTo further support this notion, we decided to explore the involvement of the reticulon protein in myogenic and muscle regenerative processes in vivo. We investigated RTN-1C modulation after muscle freeze injury, a widely used model system to study the events involved in muscle regeneration. The increased expression of RTN-1C in the damaged tissue possibly suggests that the induction of the protein after muscle injury advances the muscle regeneration processes.To determine the contribution of RTN-1C, we analyzed RTN-1C levels in a mouse model of Duchenne muscular dystrophy (mdx), which is characterized by degeneration and regeneration of myofibers upon satellite cells activation. We demonstrated that mRNA and protein levels of the reticulon protein are up-regulated in mdx mice with respect to wild-type mice.The skeletal muscle has an intrinsic capacity to regenerate tissue damage deriving from physiological or pathological injuries. This ability is widely accomplished by undifferentiated skeletal muscle precursor cells, namely satellite cells, located in the niche between the muscle fiber plasmalemma and the basement membrane . SatelliThus, we investigated the expression of RTN-1C in primary satellite cells, isolated from mouse hind limbs muscles, and which underwent muscle differentiation. Here, again, we observed the up-regulation of the reticulon protein along with the early and late myogenic markers, while the specific silencing of RTN-1C showed an opposite effect, further supporting the involvement of the protein in the muscle differentiation process.The results obtained so far are not surprising considering the fact that among the different roles of reticulon proteins they have been originally indicated as markers of different cellular differentiations . MoreoveAs mentioned above, the RTN-1C protein is able to induce ER stress and UPR pathways ,14 that Taken together, these results suggested that the RTN-1C induction could be functional to generate ER stress during myogenesis favoring skeletal muscle differentiation.As previously mentioned, the preservation of a normal structure and function of skeletal muscle fibers depends on several factors such as cell-cell communication, vesicles-based delivery system, and the maintaining of calcium homeostasis. Considering the involvement of reticulons in ER- vesicle trafficking and the ability of RTN-1C to modulate intracellular calcium concentration and mitochondrial dymanics ,15, we r2 in a humidified atmosphere (GM). To induce differentiation, cells were cultured in Dulbecco’s modified Eagle’s medium (Lonza) supplemented with 2% horse serum (DM).C2C12 cells (less than 10 passage) were cultured in Dulbecco’s modified Eagle’s medium  supplemented with 10% fetal bovine serum, 100 μg/mL streptomycin, and 100 units/mL penicillin, at 37 °C and 5% COTo silence RTN-1C, cells were transfected with 10-nM siRNA specific for mouse RTN-1C  for 72 h. Scramble siRNA, which does not target any known genes from any species, was used as negative control.To over-express RTN-1C, human RTN-1C cloned in pCDNA 3.1 Zeo(þ) vector was used .Transfections were performed using Lipofectamine 2000  according to the manufacturer’s instructions.Three-month-old male wild-type C57BL/6 (WT) mice or C57BL/6ScSn-Dmdmdx/J (mdx) mice purchased from Jackson Laboratories were used. Mice were maintained under regular housing conditions with standard access to food and drink in a pathogen-free facility. All the procedures in mice were approved by the local Ethics Committee for Animal Welfare  and complied with the NIH Guide for the Care and Use of Laboratory Animals.Muscle acute injury was performed in WT C57BL/6 mice, anesthetized by 1–4% L/min O2 isofluorane  inhalation, by inserting a 30-gauge 5/16” needle previously cooled in liquid nitrogen into tibialis muscle for 10 min.Tibialis anterior of mice were subjected to homogenization and enzymatic dissociation according to Marinkovic et al., 2019 ,29. The ® Western .Tissues were lysed in 50 mM Tris HCl pH 7.5, 50 mM NaCl, 320 mM sucrose, 1% Triton X-100, 10% glycerol supplemented with protease, and a phosphatase inhibitor cocktail. Cells were rinsed in ice-cold PBS and collected in lysis buffer containing 20 mM Tris–HCl pH 7.4, 150 mM NaCl, and 1% Triton X-100 with a protease inhibitor cocktail. Nuclear and cytosolic extracts were obtained using the NE-PER Nuclear and Cytoplasmic Extraction Kit . Protein concentrations were determined by the Bradford assay, using bovine serum albumin as a standard. Aliquots of total protein extracts from cells after different treatments were resolved on SDS–polyacrylamide gel and transferred to a nitrocellulose membrane. Blots were blocked in 5% non-fat dry milk in T-PBS (PBS + 0.05% Tween-20) for 1 h at room temperature and then incubated overnight with the described antibodies. The membranes were incubated with HRP-conjugated secondary antibody for 1 h at room temperature, and the signal was detected by ImmobilonAnti-tubulin , anti actin , anti GAPDH , anti RTN-1C , anti MyHC (DSHB), anti myogenin (DSHB), anti GRP78 , and anti p-eIF2a  were used.w/v (permeabilization solution) for one hour at RT and then incubated with a blocking solution composed of PBS plus Triton™ X-100 0.1% w/v, glycine 1% w/v and goat serum NGS  10% w/v for one hour at RT. Subsequently, the sections were incubated with a primary antibody appropriately diluted in blocking solution for one hour at RT. Two washes were performed, respectively at 15 and 5 min each, with PBS plus Triton™ X-100 0.2% w/v BSA (Bovine Serum Albumin) 1% w/v (washing solution), and then the sections were incubated for one hour at RT with a secondary antibody conjugated with a fluorophore appropriately diluted in blocking solution. After a 10 min rinse with the washing solution, DAPI was added , 0.1 mg/mL, in PBS for 10 min at RT. Finally, the sections were mounted with Aqua Poly/Mount .C2C12 cells were fixed in 2% PFA over night at 4 °C, and then were permeabilized with PBS plus Triton™ X-100  0.3% Mouse anti-MyHC (produced in our laboratory by hybridoma cells) diluted 1:2.Primary antibody used:Anti-mouse Alexa555 (Molecular Probes) diluted 1:100.The secondary antibody used:® software .The sections were photographed with the microscope Nikon Eclipse TE 2000, supported by MetaMorphTissues were lysed in Trizol reagent  and total RNA was extracted using Direct-Zol™ RNA MiniPrep Plus according to the manufacturer’s instructions. One μg of RNA was retro-transcribed using SensiFAST™ cDNA Synthesis Kit  and used in the quantitative RT-PCR (qPCR) experiment, using SensiFAST™ SYBR Hi-ROX Kit  following the manufacturer’s instructions. Thermocycling consisted of an initial polymerase activation step at 98 °C for 5 min, and amplification was performed with 35 cycles of 95 °C for 15 s, 68 °C for 10 s, and 72 °C for 20 s with data acquisition at this stage, and the reaction finished by the built-in melt curve. The relative amounts of mRNA were calculated by using the comparative Ct method.RTN-1C: 5′-TACCCGTCTCCAGGGTAGC-3′, 5′-TTGGTCAATCTGTGCCTGGT -3′GAPDH: 5′-AACTTTGGCATTGTGGAAGG-3′, 5′-CACATTGGGGGTAGGAACAC-3′t-test or one-way ANOVA test. p-value smaller than 0.05 (p < 0.05) was considered to be significant.Graph Pad was used for statistical analysis. ImageJ64 software was used for densitometric analysis. Statistical significance was determined using the Student’s"}
-{"text": "This study investigated the effects of transglutaminase (TG) concentrations  on the physicochemical properties of whole wheat dough (WWD) and noodles (WWN) during refrigerated storage . The yield, ferulic acid (FA) content, molecular weight (Mw), and apparent viscosity (AV) of water extractable arabinoxylan (WEAX) from refrigerated WWDs were analysed. The WEAX yield and FA tended to increase with refrigerated storage, while the Mw decreased. WEAX FA of from WWD with TG tended to be smaller than the control during refrigeration. The AV for all WEAXs gradually decreased during refrigeration. The TG concentration effects on WWD resistance to extension and extensibility and the WWN cooking properties and texture profile analysis (TPA) were studied. The water absorption and swelling index tended to decrease in WWNs with TG depending on refrigeration time compared to the control samples. The TPA results showed that WWNs with TG were significantly harder than the control after two days of refrigeration. This study demonstrated that TG affected not only WWD composition but also WWN physical properties during refrigerated storage. Triticum aestivum L.) is one of the major food sources consumed globally. Whole wheat grain includes endosperm, germ, and bran. Bran is removed when refining flour, while whole wheat grain provides many dietary fibres and phytochemicals [Wheat  is known to form isopeptide bonds within the gluten network. Since one of the problems in refrigerated refined flour dough is the loss of dough strength , informaThe wheat samples used in this study were the Keumkang cultivar , which is a typical medium wheat in Korea. Whole wheat flour was obtained by grinding with an Ultra Fine Particle Mill DSCH 550S . The moisture content and mean (d50) particle size of the WWF were 6.17% and 44.78 μm, respectively. TG (ACTIVA TG-B) was purchased from Ajinomoto . Alpha-amylase (Termamyl 120 L) and amyloglucosidase (AMG 300 L) were purchased from Novozymes . All reagents were analytical grade.w/w flour weight basis (fwb), distilled water—37.5% (based on 14% flour moisture content), and TG—0.1%/1% w/w (fwb). The TG concentrations used in this study were determined based on the minimum and maximum concentrations for foods recommended by the supplier. The solution (water + enzyme + NaCl) was mixed for 1 min at 60 rpm using a mixer . Then, flour was added to the bowl in solution by mixing it at 135 rpm for 3 min. The resulting dough was rounded and wrapped in plastic film. WWD samples were used for WWN preparation initially and after 1, 2, and 3 days of storage at 3 + 1 °C.The dough preparation procedure followed the AACC method 66-60.01 . EnzymesWWN samples were made by method AACC 66-60.01  with somg for 10 min. The supernatant pH was set to 6.5, and 0.3 mL amyloglucosidase was added. Then, the supernatant was kept at 55 °C for 16 h for degradation of liquefied starch by amyloglucosidase. After the reaction ended, the enzymes were inactivated by boiling in a water bath for 30 min. After passing the resulting solution through filter paper , 10% (v/v) bentonite solution (0.2% mass) was added to remove proteins and stirred for 30 min at room temperature (RT). The pellet was removed again by centrifugation .The water extractable arabinoxylan (WEAX) was extracted according to the methods described by Mansberger et al.  with somv/v), and the solution was stirred for 30 min at RT. The isolated pellet was washed with 200 mL of 65% (v/v) ethanol and twice with 50 mL of acetone. The final material was air-dried for 16 h. The dried pellet was resolved in 200 mL of deionized water, and the supernatant induced by centrifugation was freeze dried.To isolate arabinoxylan from the supernatant, ethanol  was added until the solution alcohol concentration reached 65% (3 and filtered with a 0.45 μm nylon filter. The solutions (200 μL) obtained were separated on TSKgel GMPWxl and TSKgel G2500PWxl  columns by isocratic elution with 0.1 M NaNO3 monitored with an RI detector. The flow rate was 1 mL/min, and the temperature was set at 40 °C. Pullulans (P50 to P800) were used for estimating Mw as a standard calibration.The molecular weight (Mw) of WEAX was determined with a Tosoh EcoSEC HLC-8320GPC  using EcoSEC software. WEAX sample aliquots were solubilized in 0.1 M NaNOw/v) was measured using an MCR 102 rheometer  at 25 °C according to Simsek et al. [−1.The apparent viscosity (AV) of WEAX aqueous solution  and acidified to pH 2 using 6 M HCl. The FA was extracted three times with 3 mL ethyl acetate. The combined extractions were dried under nitrogen followed by dissolution in 500 μL of H2O/MeOH solution at a 1:1 ratio. Twenty microliters of sample was injected for HPLC  with a Capcell Pak C18 UG120 column . The solvent system was composed of solvent A—0.1% (v/v) trifluoracetic acid (TFA) in water and solvent B—0.1% (v/v) TFA in methanol. The flow rate was 0.8 mL/min, and detection was performed on the absorbance at 320 nm. Elution was started isocratically at 35% solvent B, and then a linear gradient from 35% to 95% solvent B for 25 min was applied.The content of ferulic acid (FA) in WEAX was measured with a modified method by Wang et al. . WEAX (5w/v) CHAPS, 1% (w/v) DTTT, 2% pharmalyte, and 1 mM benzamidine). Protein was extracted for 1 h with vortexing followed by centrifugation . The upper layer was used for two-dimensional electric motion, and the protein concentration was determined by the Bradford method [Two DE WWD protein analyses were performed by the methods from Kim et al. . WWD prod method . The sold method , but theDough resistance to extension and extensibility were measured using a texture analyser  by the method from Barros et al. . The resDynamic rheological properties were measured using a MCR 102 rheometer  according to the method from Kaur et al. . The plaEach 30 g of noodles was cooked for 15 min in 500 mL of distilled water. After cooking, the noodles were removed from the water and drained for 15 s using noodle baskets. Cooking parameters were calculated by the method from Tudorica et al. . The remThe texture profile analysis (TPA) of cooked noodles was performed using a TA-XT plus texture analyser  using the method described by Niu et al.  with somp < 0.05. Two-way analysis of variance (ANOVA) was performed to investigate the effect of enzyme concentrations and refrigerated storage time.Three replications of Kieffer extensibility, dynamic rheological measurement, cooking parameters, and TPA as well as duplicate WEAX physicochemical property measurements were performed. Resulting data were represented as the mean ± standard deviation. Analysis of variance (ANOVA) was carried out using XLSTAT  to determine the differences among samples. When significant differences were detected, the Student–Newman–Keuls (SNK) multiple comparison test was performed to separate the means at The WEAX yield (%) from WWDs is represented in The content of ferulic acid (FA) in WEAX from WWD depended on TG concentration, ranging from 636 to 3007 μg/kg, and storage time at low temperature, as shown in The WWD WEAX Mw is presented in w/v) depending on the shear rate. The AV of the WEAX solution  in WWD showed Newtonian flow characteristics at a high shear rate (600–1200/s) after 3 days of refrigerated storage. Regardless of storage time, shear thinning behavior was observed as the shear rate was increased. At the state of rest, the un-crosslinked molecule polysaccharide solution contracts to shape balls, causing high viscosity. However, when shear is applied to a polymer solution, the ball unfolds and becomes an ellipsoid [llipsoid . The challipsoid . Therefollipsoid , which sProtein extractions of each of the groups with 0 and 3 day WWDs were separated by 2-DE, as shown in p < 0.001) in WWD resistance to extension and extensibility were observed by refrigerated storage time  and TG concentration , as shown in r = −0.809) between the WWD elastic modulus at 1 rad/s and extensibility in this study, TG, which prevents an elastic modulus decrease and gluten degradation during refrigeration, might prevent a dough strength decrease. However, to validate the TG function, which inhibits the gluten degradation induced by refrigeration storage, further study on the interaction between TG behavior and gluten is needed.p < 0.001) depending on the WWD TG concentration. The tan δ ranges for the control, 0.1% TG, and 1% TG groups were as follows: 0.37–0.40, 0.36, and 0.31–0.32, respectively. A decreasing trend in loss factor was shown by TG. These study results imply that TG could influence gluten degradation, affecting dough strength during refrigerated storage. The average loss factor (tan δ) at all frequency points, equal to G″/G′, was in the range of 0.31–0.40 in TG addition influenced both the WWD physicochemical properties and its product during refrigerated storage. During refrigeration, TG played an important role in modifying the WEAX structural properties by affecting its yield and Mw and prevented FA release from the gluten-WEAX structure. The WEAX yield (%) from WWD with 0.1% TG or the control was affected by storage time, while that with 1% TG was not affected by storage time. WEAX Mw ranges on day 0 and after 3 days of refrigerated storage were 105,406 to 109,692 and 93,209 to 96,971, respectively, which implied WWD WEAX decomposition during refrigeration. However, after 3 days of refrigerated storage, a significantly higher Mw was found in WEAX from WWD with TG than in the control implying inhibition of WWD WEAX decomposition by TG during refrigeration. The content of FA in WEAX from WWD depended on TG concentration, ranging from 636 to 3007 μg/kg, and storage time at low temperature. Overall, WEAX FA increased with time when stored at low temperatures. TG influenced FA in WEAX, which is positioned on O-5 of the arabinose residue, and the WEAX AV was altered, implying the modified WEAX branching degree. During refrigeration, the viscosity of the shear rate dependence for the control group continued to decline gradually, while the difference between the overall apparent viscosities depending on storage time was reduced when TG was incorporated in the WWD. Thus, WWD property improvement might be expected by the use of TG due to inhibited WEAX decomposition during refrigeration. However, when 1% TG was applied to the WWD, both resistance to extension and extensibility simultaneously decreased during refrigerated storage. This could be explained by the stiff WWD when 1% TG was added. The elastic modulus (G′) of WWD was decreased with refrigerated storage, while that of WWD with TG 1% was increased. Considering that gluten structure degradation reduces elastic modulus (G′), the reason for the increased G′ could be explained by TG which formulates disulfide bonds within gluten. In addition, after two days of refrigerated storage, 1% TG showed significantly higher cooking loss than the control and 0.1% TG. Consequently, even if TG ameliorates the WWD gluten structure or diminishes WEAX decomposition during refrigeration, the modified properties induced by TG do not always improve product quality. Significant decrease in hardness and chewiness was found in control WWN during refrigerated storage, while hardness and chewiness of WWN with TG 0.1% or 1% were not changed. Even though WWD with TG significantly maintained the WWN hardness during refrigerated storage, the TG concentration should be adjusted according to the target WWN properties since the WWN adhesiveness or cohesiveness differs with TG concentrations. This is the first report on the TG behaviour in refrigerated WWDs. However, further research on TG reaction in low-temperature storage is needed to confirm these findings."}
-{"text": "Brewer’s spent grain (BSG) is the main side-stream of brewing. BSG is a potential source for nutritionally enriched cereal products due to its high content of fibre and protein. Two novel ingredients originating from BSG, EverVita FIBRA (EVF) and EverVita PRO (EVP), were incorporated into bread in two addition levels to achieve a ‘source of fibre’ (3 g/100 g) and a ‘high in fibre’ (6 g/100 g) nutrition claim for the breads. The impact of those two ingredients on dough and bread quality as well as on nutritional value was investigated and compared to baker’s flour (C1) and wholemeal flour (C2) breads. The addition of EVF performed outstandingly well in the bread system achieving high specific volumes (3.72–4.66 mL/g), a soft crumb texture (4.77–9.03 N) and a crumb structure comparable with C1. Furthermore, EVF barely restricted gluten network development and did not influence dough rheology. EVP increased the dough resistance (+150%) compared to C1 which led to a lower specific volume (2.17–4.38 mL/g) and a harder crumb (6.25–36.36 N). However, EVP increased the nutritional value of the breads by increasing protein content (+36%) and protein quality by elevating the amount of indispensable amino acids. Furthermore, a decrease in predicted glycaemic index by 26% was achieved and microbial shelf life was extended by up to 3 days. Although both ingredients originated from the same BSG, their impact on bread characteristics and nutritional value varied. EVF and EVP can be considered as game-changers in the development of bread fortified with BSG, increasing nutritional value, and promoting sustainability. Due to increased environmental awareness, the sustainable use of side-streams generated within the food industry has become increasingly important, focused on eliminating waste and the continual use of resources. Various studies have been conducted to valorise food waste by recycling these materials into biofuels, enzymes and bioactive compounds . From a w/w) and protein (19–30% w/w). The fibre is constituted of hemicellulose including arabinoxylans, cellulose and lignin [BSG has huge potential to enhance the nutritional value of food due to its high content of fibre  processed BSG and launched two ingredients, EverVita FIBRA and EverVita PRO, which differ in their protein and fibre content and particle size. A recent study characterised those ingredients and investigated their effect on pasta, resulting in outstanding product quality and increased nutritional value . The curBaker’s flour and stoneground wholemeal flour supplied by Odlums , sunflower oil , salt , sugar , baker’s instant active dried yeast  and tap water were used in the bread production. The two ingredients, EverVita FIBRA (EVF) and EverVita PRO (EVP), rejuvenated brewer’s spent grain, were supplied by EverGrain, LLC . Chemicals used for analysis were purchased from Sigma-Aldrich , unless stated otherwise.The compositional analysis of EVF and EVP were previously reported by Sahin et al., (2021) . Baker’sAmino acid analysis was conducted by Mérieux NutriScience CHELAB S.r.l., Resana, Italy. After protein extraction and hydrolysis , amino acids were quantified using ionic chromatography with post-column ninhydrin derivatisation coupled with a fluorescence and an ultraviolet (UV) detector. The concentration of the amino acids is given as % based on protein.Bread doughs were produced using the ingredients according to the recipes illustrated in Dry ingredients were pre-mixed for 1 min at minimum speed using a Kenwood Titanium Major KM020 mixer equipped with a hook attachment  to ensure a homogeneous distribution, and instant active dried yeast was activated by its addition to water (25 °C) for 10 min. Yeast solution and sunflower oil were added to the dry ingredients and mixed at speed 1 for 1 min first, followed by a second mixing step at speed 2 for 7 min. This procedure was used for the baking process as well as for the evaluation of the fermentation quality of the bread doughs.EverVita ingredients originate from BSG, which has been reported to impact bread dough quality negatively. Hence the effect of reinvented BSG-based ingredients on gluten network development, starch pasting properties as well as on dough rheology, extensibility and fermentability was investigated. Therefore, blends of baker’s flour and EVF/EVP according to the ratios given in The impact of EverVita ingredients on both gluten network and starch pasting was determined by the GlutoPeak and the Rapid Visco Analyser (RVA). For both measurements the solid part represents a mixing of baker’s flour and EverVita ingredient (EVF or EVP) in the proportion used for the bread baking process .®  was used to measure the gluten aggregation properties represented by the time of full aggregation (peak maximum time (PMT) in seconds (s)) and gluten network strength (torque maximum (TM) in Brabender units (BU)). 9 g of solids, based on 14% moisture, was added to 9 g of distilled water (36 °C) and the test was started using a rotation speed of 2750 rpm of the paddle.The GlutoPeakStarch pasting properties during heating and cooking were determined using a Rapid Visco Analyser ; 3 g of solids, based on 14% moisture, was added to 25 g distilled water in the metal sample cup and premixed briefly with the paddle to remove lumps. A constant shear rate of 160 rpm was applied during the measurement. The temperature profile used was equilibration at 50 °C for 1 min, followed by an increase to 95 °C with a heating rate of 0.2 °C/s, held at 95 °C for 162 s, cooled to 50 °C with a cooling rate of 0.2 °C/s, and held at 50 °C for 60 s. During the measurement the viscosity in centipoise (cP) was monitored resulting in a viscosity curve over time and peak viscosity (cP), breakdown viscosity (cP), trough viscosity (cP) and final viscosity (cP) were evaluated.® equipped with an automatic water dosing unit . Therefore, flour and EverVita ingredients were used in the ratio illustrated in The water content of the different formulations was adjusted using Farinograph-TS® . The dough was prepared following the bread dough preparation process omitting yeast. 150 ± 0.5 g of dough (without addition of yeast) was moulded and placed into the proofing chamber. Analysis was performed after 90 min of proofing (time used for proofing during the baking process).The dough extensibility (E) in mm, resistance to extension (RE) in extensograph units (EU) and the ratio of resistance over extensibility (RE/E) in (EU/mm) were determined using ExtensographA rheofermentometer  was used to measure gaseous release and dough rise during the proofing process. We prepared 300 g dough following the bread dough preparation process procedure mentioned before and transferred into the fermentation chamber (30 °C). A cylindrical weight of 1500 g was placed on the dough and the dough was fermented for 180 min. The maximum height of the dough (Hm) in mm, the time required to achieve maximum height (T1) in minutes, the total volume of carbon dioxide released by the dough (Vtot) in mL and the height of maximum gas formation (H’m) in mm were evaluated.Dough was separated into 450 g pieces, moulded, transferred into a bread pan (dimensions: 15 × 9.5 × 9.7 cm) and placed into the proofing chamber  for 90 min set to 30 °C and 85% relative humidity. After proofing, the tins with the leavened doughs were transferred into a deck oven  (220 °C top temperature and 230 °C bottom temperature). 400 mL of steam was injected prior to loading. The breads were baked for 35 min, removed from the baking tins and left to cool for 120 min on a rack before analysis. Two breads per batch were analysed after baking and two loaves were packed in plastic bags and stored at 20 °C for five days to determine the staling rate. Three batches per bread type were evaluated.The specific volume was measured with a 3D laser scan using a Volscan Profiler 300  and expressed as mL/g.The bread crumb texture was analysed using a TA-XT2i texture analyser  equipped with a 25 kg load cell. For analysis, the breads were sliced with a thickness of 25 mm. To imitate chewing activity, a two-compression test was carried out using a cylindric probe with a diameter of 35 mm, a test speed of 5 mm/s, a trigger force of 0.05 N and a compression of 40%. The crumb hardness in Newton (N) and chewiness (N) were evaluated 120 min after baking. Gumminess (N) showed the same values as chewiness and was not further considered in the manuscript. In addition, the hardness (N) was measured 120 h after baking to evaluate bread staling. Staling was expressed as staling rate as defined by Sahin, Axel, Zannini, and Arendt (2018) .2), number of cells and average cell diameter (mm) were evaluated. The crumb area for the evaluation of the number of cells and the cell diameter was the slice area. Furthermore, the microstructure of the crumb was visualised using a scanning electron microscope (SEM). Therefore, bread crumb was freeze-dried, immobilised, and coated with a layer of 25 mm of sputtered palladium-gold. The microstructure was observed using a working distance of 8 mm and micrographs were taken at an accelerating voltage of 5 kV. SEM Control User Interface software, Version 5.21  was used. For the evaluation of crumb structure, a C-cell Imaging System  was used and slice area  was used to determine the bread colour. To evaluate the influence of EverVita ingredients on the colour and the differences in colour compared to both controls, baker’s flour and wholemeal flour, the ΔL*2 = lightness value of the bread including EverVita ingredients; L*1 = lightness value of the control .a*2 = redness value of the bread including EverVita ingredients; a*1 = redness value of the control .b*2 = yellowness value of the bread including EverVita ingredients; b*1 = yellowness value of the control .The water activity was determined using a water activity metre . The microbial shelf life analysis of the breads were performed using the environmental challenge method as reported by Dal Bello et al. (2007) . BrieflyStarch can be present in different forms, digestible and resistant towards digestion. The digestible starch and resistant starch content of freeze-dried bread samples were determined by an enzymatic method using the K-RAPRS kit . The digestible and resistance starch content in fresh bread was calculated considering the moisture content. The sum of both starch components represents the total starch content. The predicted protein and fibre content were calculated based on nutritional information of the ingredients considering the bake loss. The expected indispensable amino acid , aromatic amino acids (AAA), threonine, tryptophan, valine) in the breads were calculated and are presented relative to the requirement pattern bread on an average intake of 0.66 g protein per kg composition in breads . TherefoAn in vitro digestion method, specific to fibre-enriched food, was carried out to determine the predicted glycaemic index (pGI) of the breads. The procedure was performed as described by Brennan and Tudorica (2008)  and 4 g sample refers to the absorbance at 546 nm of the sample treated with enzymes; 500 refers to the total volume of buffer; 0.95 is the conversion factor of starch to maltose by amylase; Amaltose refers to the absorbance of a 1 mg/mL maltose standard; digestible carbohydrates in 4 g sample expressed in mg.Reducing sugars released (RSR) is calculated as:The reducing sugar release index (RSRI) at 150 min is defined as:The ‘control’ refers to the baker’s flour control.maltose is the diffusion of the maltose blank . The percentage of maltose able to diffuse through the tube in the presence of sample (DIFF):blank +maltose refers to the absorbance of the sample blank with maltose addition; Ablank refers to the absorbance of the sample blank; 500 is the total volume of buffer; Amaltose refers to the absorbance of the maltose blank; 200 is the weight of maltose in ‘blank + maltose’-sample in mg.Sugar diffusion index: All tests were carried out in triplicate, unless stated otherwise. A variance analysis  was performed using Minitab 17. In addition, a two-way ANOVA was conducted to evaluate the influence of the type of ingredients and the addition level. Correlation analysis was performed using Microsoft Excel.The nutritional composition of the raw ingredients is an influencing factor of the final nutritional profile of the food product. The differences between baker’s flour (C1), wholemeal flour (C2) and EverVita ingredients regarding moisture, protein, fat, total carbohydrates, ash and sodium are illustrated in The total carbohydrate concentration in the EverVita ingredients is 6–19% lower compared to the flours, yet their dietary fibre content, illustrated in Apart from the macronutrients, such as protein, fat, and carbohydrates, the protein profile plays a key role in the final nutritional value of food products. The total amino acid composition of the protein fraction after hydrolysis of the raw ingredients based on their protein content is displayed in p < 0.05) influenced the PMT (63.3 ± 2.3 s (SF); 29.0 ± 1.0 s (HF)).The effect of EverVita ingredients on gluten network development compared to the controls baker’s flour (C1) and wholemeal flour (C2) is illustrated in C1 showed the highest trough viscosity (740 ± 6 cP), followed by formulations including EVF (SF) (655 ± 2 cP) and EVP (SF) (645 ± 1 cP). The incorporation of EVP (HF) showed a significant lower trough viscosity (465 ± 4 cP). The trough viscosity of C2 (516 ± 15 cP) was lower compared to C1 and did not significantly differ from samples including EVF (HF) (530 ± 10 cP). During cooling amylose and amylopectin reassociate, which is called retrogradation, and leads to an increase in viscosity. The highest final viscosity was determined in the C1 (1758 ± 9 cP), followed by the formulations with EverVita ingredients at a SF level (EVF (SF): 1603 ± 8 cP; EVP (SF): 1606 ± 1 cP). The addition of EVF at a higher level (HF) led to a significant lower value (1315 ± 8 cP) which is comparable to the final viscosity detected in C2 (1318 ± 28 cP). The incorporation of EVP at HF level resulted in the lowest final viscosity (1222 ± 11 cP).Rheological characteristics of dough include consistency changes during mixing (Farinograph) as well as elasticity and resistance to extension during stretching of the dough (Extensograph).The farinograph was not only used to adjust the water content (WA) of each dough reaching a final consistency of 500 ± 20 FU, rheological parameters such as dough development time (DDT), arrival of dough stability (S1) and the mixing tolerance index (MTI) were investigated. p < 0.04; r = 0.95). C2 resulted in a longer DDT (10.12 ± 0.28 min) and a delay in S1 (6.93 ± 0.32 min) compared to C1 . Both EverVita ingredients caused a quicker DDT  and S1 is reached earlier when added in ‘source of fibre’ levels (EVF (SF): 1.33 ± 0.12 min; EVP (SF): 1.27 ± 0.12 min). While the addition level of EVF did not have any impact on the dough rheology during mixing, the longest overall DDT (17.84 ± 0.65 min) and the highest S1 (8.07 ± 0.98 min) occurred in doughs with EVP (HF). The MTI showed the highest value for C1 (34.33 ± 1.53) while all other doughs had a significantly lower MTI (between 13.00 to 19.67).C1 showed the lowest water absorption resulting in a water addition level of 60.47% to achieve 500 FU, while C2 required 63.30% water. The addition of EVF (SF) and EVP (SF) caused an increased water addition level by 1.80% and 3.50% compared to C1, respectively. While the incorporation of EVF (HF) only affected the water absorption of the system to a relatively small extent (+3.83%) compared to C1, EVP (HF) caused an increase by 10.26% and showed the highest water content overall. DDT and S1 revealed a strong positive correlation (The Farinograph measurement of EVP (HF) did not give any MTI value which indicates no changes in peak consistency five minutes after the peak is reached. Furthermore, the curve showed fluctuations in the first 7.5 min of mixing.Extensograph measurements revealed the extensibility (E) and the resistance to extension (RE) during stretching of the dough and the results are demonstrated in 2 production by yeast, while in dough including EVP (HF) the lowest CO2 formation occurred (2426 ± 48 mL).The rheofermentometer was used to measure dough rise and CO2 formation during 180 min of fermentation. The results for maximum height of the dough (Hm), time required to achieve maximum height (T1), the total volume of carbon dioxide released by the dough (Vtot) and the height of maximum gas formation (H’m) are displayed in The specific volume, crumb texture, crumb macro- and microstructure as well as the crust and crumb colour, water activity and microbial shelf life of the breads were determined to evaluate bread quality. The results are illustrated in The addition of EverVita ingredients in a concentration to achieve a ‘source of fibre’ claim did not significantly impact the specific volume (EVF (SF): 4.66 ± 0.23 mL/g; EVP (SF): 4.38 ± 0.31 mL/g) compared to C1 (4.46 ± 0.26 mL/g). However, a higher addition level decreased the specific volume of the breads significantly resulting in 3.72 ± 0.37 mL/g and 2.17 ± 0.05 mL/g for EVF (HF) and EVP (HF) breads, respectively. EVP (HF) showed the same specific volume as C2 (2.28 ± 0.07 mL/g). In The texture of the bread crumb was evaluated considering crumb hardness (N) and chewiness (N), and the degree of staling over time was determined and expressed as the staling rate. The softest crumb was determined in C1 (4.76 ± 1.20 N) and EVF (SF) (4.77 ± 0.65 N), followed by EVP (SF) (6.25 ± 1.49 N) and EVF (HF) (9.03 ± 1.23 N). C2 showed a significant harder crumb (24.54 ± 3.68 N) and the highest crumb hardness was measured in bread containing EVP (HF) (36.36 ± 1.99 N). EVF (SF) resulted in the least chewy crumb (3.25 ± 0.56 N), while EVP (HF) had the highest chewiness value (20.32 ± 1.20 N). The staling rate was the highest in EVF (SF), EVP (SF) and EVF (HF) with values between 2.55 and 2.70. The lowest staling rates were detected in C2 (1.32 ± 0.45) and EVP (HF) (1.24 ± 0.15). 2), number of cells and average cell diameter (mm). A strong positive correlation between slice area and specific volume  occurred and thus the biggest slice area was measured in C1  and EVF (SF)  breads, while the smallest slice area was determined in C2 (4990 ± 388 mm2) and EVP (HF) (5701 ± 369 mm2). The highest number of cells in the bread crumb was determined in EVP (SF) (5997 ± 268). These cells were relatively small (diameter of 1.88 ± 0.10 mm) compared to those of the other samples. C2 showed the lowest number of cells (2794 ± 144) and also the smallest average cell diameter (1.25 ± 0.20 mm). C1 and EVF (SF) had the biggest cell diameter among all samples with 2.43 ± 0.20 mm and 2.32 ± 0.12 mm for C1 and EVF (SF), respectively. Differences in crumb structure were visualised using a SEM and are illustrated in Changes in crumb structure were evaluated considering slice area  and crumb colour (17.66 ± 2.86). The most similar crust colour to C1 was determined in breads including EVP (HF) (8.21 ± 4.47), while EVF (SF) (5.28 ± 3.39) and EVP (SF) (8.92 ± 2.80) showed the most similar crumb colour to C1. Compared to C2, breads containing EverVita ingredients with source of fibre addition level (EVF (SF): 15.08 ± 2.42; EVP (SF): 16.54 ± 2.55) had the highest ΔE-value, while EVP (HF) showed the most similar crust colour (8.93 ± 2.30). Regarding the colour difference in crumbs, EVP (HF) had the most similar crumb colour to C2 (5.69 ± 2.20), whereas C1 showed the highest difference. The microbial shelf life of the breads revealed the shortest shelf life in C1 and EVF (SF) breads. Compared to C1 which showed the first microbial growth after 6.00 ± 1.00 days, the growth started after 9.00 ± 1.00 days and 9.33 ± 0.58 days in breads including EVP (SF) and EVP (HF), respectively. Hence, an extension of microbial shelf life occurred, even though no significant differences in water activity was determined.The nutritional value of breads was evaluated considering the composition of the breads  as well as the amino acids composition and the predicted glycaemic index (pGI) and predicted glycaemic load (pGL).The predicted composition of the breads based on ingredient characteristics and the addition level of EverVita ingredients is illustrated in The main compound of the breads is moisture, which ranges between 42.04 ± 0.04% in EVF (SF) breads to 46.68 ± 0.26% in EVP (HF) breads. The second main compound in the breads is starch. The highest total starch content was determined in C1 (40.56 ± 0.42 g/100 g), whereas high fibre breads and C2 showed the lowest total starch concentrations. The same trend occurred in the digestible starch content. C1 had the lowest dietary fibre content (2.1 g/100 g) and C2 included 4.8 g/100 g dietary fibre based on calculation. EverVita ingredients were added in amounts needed to achieve either 3 g/100 g of dietary fibre (‘source of fibre’ claim) or 6 g/100 g (‘high in fibre’ claim). The inclusion of EverVita ingredients increased the protein content in the breads, which ranged between 8.4 g/100 g (C2) and 11.5 g/100 g (EVP (HF)). No major differences occurred in the fat content of the breads. C1 had the lowest fat content (3.18 g/100 g) and EVP (HF) breads included the highest fat content (3.47 g/100 g).The amount of indispensable amino acids was calculated and expressed relative to the requirement pattern established by the World Health Organisation (WHO) . Since tBy contrast, the fortification of wheat bread with EVP increased the concentration of some indispensable amino acids, in particular lysine (+24.5%) an amino acid that is known to be limiting in cereal based products. Moreover, the incorporation of EVP increased the concentration of aromatic amino acids (AAA) by 4% compared to C1, and valine (+1%). A significant difference occurred in the predicted tryptophan content in both high in fibre breads (EVF and EVP), which made 0.215% and 0.561% based on the total protein content in the breads, respectively, while no tryptophan was expected in both controls.The pGI and pGL values represent the in vitro starch digestibility of the breads during digestion. The pGI and pGL of the different bread samples are illustrated in The impact of BSG on bread dough characteristics and final bread quality has been extensively studied. Rejuvenated BSG in the form of two ingredients, EverVita FIBRA and EverVita PRO, was used to fortify bread in two inclusion levels, 3 g/100 g and 6 g/100 g bread. The type of EverVita ingredient significantly impacted on dough and bread quality and final bread characteristics.p < 0.001), the type of EverVita ingredient also influenced the network strength (p < 0.005) and development time (p < 0.001). As previously reported, the EverVita ingredients contain low molecular weight peptides, which promote intramolecular connections, such as disulphide-, hydrogen- and ionic bonds resulting in a faster network development [EVF contains 23.4% protein and 67.6% dietary fibre, mainly insoluble fibre, while EVP has a protein content of 36.8% and a dietary fibre content of 46.8% [elopment . Since Eelopment ,36. Secoelopment . Also, aelopment ,39. p < 0.036; r = 0.84) and dough rise during proving . This indicates the primary role of the gluten network on dough quality and the weakening effect caused by fibre ingredients [The gluten network strength influenced the dough rheology resulting in a positive correlation with extensibility  and the type of EverVita ingredient (p < 0.0001) and showed a strong positive correlation with the gluten network strength . Baker’s flour is rich in intact gluten proteins and starch, which participate in dough structure formation [p < 0.04; r = −0.84). Furthermore, the curves of the gluten network development (The dough rise during fermentation (Hm) is influenced by both, addition level .Vtot is the total volume of CO% starch , resultep < 0.003; r = 0.96), crumb hardness , chewiness  and slice area . The specific volume correlated negatively with the dough development time during mixing . To achieve the highest specific volume the formulation can reach, the dough needs to be fully developed, meaning all compounds need to be fully hydrated to form a network [p < 0.01; r = 0.92).It is known that dough extensibility and dough expansion during proofing influence the final bread quality. Hm and RE/E correlated with several bread quality parameters, such as specific volume , meaning a high degree of starch swelling during heating results in a high viscosity which enhances the stability of the system during the baking process [Besides the dough rheology, starch pasting during baking and the related changes in viscosity of the system impacts the final product quality. In general, the replacement of baker’s flour caused lower viscosity values which may be related to the reduced amount of total starch. The peak viscosity showed a strong positive correlation with the specific volume of the bread  caused a significant decrease in the specific volume of the breads, which affected the crumb structure. Food structure affects the starch digestibility of products making starch less accessible for digestive enzymes to bind on the substrate, in this case, starch . In part3 ,63. In a3 . Even thIn addition, the structural differences could explain the differences in microbial shelf life. The protein matrix, putatively, also acts as a barrier for microbial attack on starch, prolonging the shelf life by two to three days. Apart from the structural influence, the increased water binding capacity of fibre and especially proteins restrict the accessibility to water and hinder the growth of mould . BSG is a nutritious side-stream of the brewing industry that is used primarily for animal feed. Previously, using BSG as a food ingredient to enrich products, particularly cereal products, with highly nutritious dietary fibre and protein has been very challenging, more often than not leading to a significant decrease in final bread quality. The present study used two unique BSG-derived ingredients, EverVita FIBRA (EVF) and EverVita PRO (EVP), which differ in protein and dietary fibre content as well as particle size. These two ingredients performed very similarly in small inclusion levels but differently in bread systems with a ‘high in fibre’ addition level. The inclusion of EVF in high amounts resulted in outstanding bread characteristics such as high specific volume, soft crumb texture and a crumb structure comparable to a baker’s flour control. While the impact of EVP on the techno-functional properties was less desired, it significantly increased the nutritional value of the bread by increasing protein content by 36% and fibre content by 3-fold, lowering pGI-values by up to 25%, elevating the amount of indispensable amino acids and hence the protein quality, and prolonging microbial shelf life. Notwithstanding this, correlation analysis revealed the influence of dough characteristics on bread quality which can help make controlled changes in the baking process or even the formulation for further optimisation using functional ingredients. In the past, several studies have addressed the impact of the most abundant dietary fibre in BSG, arabinoxylans, on bread quality and the interaction between fibre and gluten network. However, the impact of the protein fraction present in BSG has been neglected in the literature. This study provided a deep insight into the impact of several BSG-derived fractions, including protein, on bread quality. This work demonstrated the potential game-changing impact of brewing side-streams to sustainably enhance the nutritional value of food products."}
-{"text": "Glioblastoma (GBM) is an incurable form of primary astrocytic brain tumor driven by glioma stem cell (GSC) compartment closely associated with the vascular niche. GSC phenotypes are heterogeneous and range from proneural to mesenchymal-like, the latter characterised by greater invasiveness. Here we document the secretory (angiocrine) role of endothelial cells and their derived extracellular vesicles (EVs) as drivers of proneural-to-mesenchymal reprogramming of GSCs. These changes involve activation of matrix metalloproteinases (MMPs) and NFκB, and inactivation of NOTCH, while altering responsiveness to chemotherapy and driving infiltrative growth in the brain. Our findings suggest that EV-mediated angiocrine interactions impact the nature of cellular stemness in GBM with implications for disease biology and therapy. Glioma stem-like cells (GSCs) exhibit plasticity during proneural-to-mesenchymal transition. Here the authors show that extracellular vesicles from endothelial cells can promote this transition of GSCs through activation of MMPs and NFkB, and inactivation of NOTCH. The gene expression profiles of GSCs are reminiscent of the corresponding GBM subgroups7 and imply numerical preponderance8. Notably, patients with mesenchymal GBM tend to have a poorer prognosis relative to patients with proneural GBM7  is an aggressive and incurable brain tumor with pronounced vascularity. GBM is thought to arise from glioma stem-like cells (GSCs) of which at least two subtypes have been identified and described as either proneural (PN) or mesenchymal (MES)18. Interrelationships between GSCs and endothelial cells have also emerged in the context of angiogenesis20 and other processes driving tumor neovascularization23, with ongoing identification of their respective mediators17. On the other hand, endothelium is regarded as a secretory tissue, the paracrine (angiocrine) effects of which are thought to be mediated by either soluble proteins, or multimolecular carriers, such as extracellular vesicles (EVs) including exosomes24. Indeed, the endothelial secretome has recently emerged as a potent regulatory mechanism for cancer cells, their niches, and across tumor microenvironment27. However, the present understanding of the nature and scope of angiocrine influences on different subsets of cancer cells25, stem cells28 and GSCs remains relatively limited16.Interactions with the brain vasculature represent a hallmark of both neural stem cells and GSCs, epitomized by formation of endothelial stem cell nichesHere, we show that endothelial cell derived EVs (EEVs) not only harbor the ability to modify GSC behavior, but also potentiate a switch in GSC subtype. Specifically, the conditioned medium derived from endothelial cells prevents sphere formation, reduces proneural hallmarks, induces mesenchymal hallmarks, causes increased migration of proneural GSCs, and facilitates increased tumorigenicity in mice xenografted with proneural GSCs pre-treated with endothelial cell derived conditioned media relative to the controls. These findings are in harmony with the results obtained when proneural GSCs were treated with endothelial cell derived EVs (EEVs). We have identified MMPs as a key cargo component of EEVs, which when taken up by proneural cells inaugurates the mesenchymal signaling pathway, NFκB. This study sheds new light on the alteration of proneural GSCs not after an intervention, such as surgical resection, radiation or chemotherapy, but during the development of a naïve primary GBM. This change entails EEV uptake by GSCs which leads to the downregulation of the NOTCH pathway and an upregulation of NFκB.16. Indeed, co-staining of human GBM sections for NES  and CD31  enforces such a spatial association  and mesenchymal-GSCs (loose spheres) in culture. Thus, sphere cultures of several mesenchymal-GSCs (GSC83 and GSC1005) and proneural-GSCs (GSC157 and GSC1079) were incubated in the presence of endothelial cells, including brain endothelial cell line . The ability to form tumor spheres in serum free media represents a defining feature of GSCs, which is often used to interrogate their clonogenic and tumor initiating potentials24  is contact-dependent or paracrine in nature. To address this question proneural-GSC1079 spheres were incubated in conditioned media derived either from endothelial cells (CME) or their own sphere culture (CMO) for 7 days, while their responses were continuously monitored using Incucyte imaging Fig. . While C28. However, in our hands, components of the endothelial cell secretome (CME) disrupted GSC sphere formation suggesting a possibility of a paradoxical (negative) impact on cellular clonogenicity. To explore this further, we conducted time-dependent ELDA screens of clonogenic proficiency in a series of proneural GSCs  and mesenchymal GSCs , which revealed considerable subtype-dependent differences. In line with their sphere disrupting effects, CME preparations markedly suppressed and delayed clonogenicity of proneural GSCs with a considerably less pronounced impact on their mesenchymal GSC counterparts . Cancer cell stemness is often enhanced by their interactions with endothelial cellsrts Fig. . Apart frts Fig.  and 9a. 31 is largely guided by their resemblance of gene expression pattern described in TCGA and subsequent GBM classifications32  and supernatant (Sup) using optimized ultracentrifugation protocol36 . Proteomic analysis of EEVs identified several highly enriched proteins including FN1 and HSPG2, which are involved in the EV uptake and induction of cell motility38  play important roles in bidirectional tumor-stromal communicationl36 Fig. . The EEVl36 Fig.  along wiy38 Fig. .Fig. 4Ex36. To ascertain whether this is the case, we adopted the previously developed Cre–loxP reporter system where EV mediated transfer of Cre recombinase triggers the expression of fluorescent proteins in recipient cells40. In this case, ECs were transduced with Cre-mCherry expressing lentivirus, while recipient GSC157 were transduced with a DsRed/loxP/eGFP dual Cre-sensitive reporter. Indeed, 4 days after exposure to Cre-EEVs the recipient GSC157 cells turned on eGFP expression (signifying Cre-EV uptake), which was not observed in the presence of control OEVs, or Cre-EC Supernatant  and their responses were recorded using Incucyte in real time for up to 4 days  chemotherapy, with mesenchymal GSCs being more sensitive relative to their proneural counterparts15 Fig. . Therefo15 Fig. . This is41, we blocked NOTCH pathway in proneural GSC157 cells using γ-secretase inhibitor, DAPT  is an important part of their effect on proneural GSCs  on recipient cell surface18. It is therefore plausible that the homotypic cell-cell interactions of GSC157 cells, or abundance of GSC EVs (OEVs) facilitate the juxtacrine NOTCH signaling and maintenance of the proneural phenotype (with high hNICD levels). This process could be disrupted by excess of competing EEVs when cancer cells infiltrate the surrounding brain  may lead to their homing to tumor core, edge, and distant brain parenchyma, including perivascular regions, each with considerable consequences to tumor-tumor and tumor-vascular interactionsain Fig. , especiaain Fig. . To testain Fig. . To undeain Fig. . This su+) in the case of inoculates pre-treated with CME, relative to CMO  and immortalized human brain endothelial cell line (HBEC-5i) were purchased from American Type Culture Collection . Human primary brain microvascular endothelial cells (BMECs) were purchased from Cell Biologics# H-6023. HUVECs and BMECs were cultured in bullet kit media and supplements (Lonza#CC-3162). HBEC-5i were cultured in DMEM-F12 media supplemented with 10% FBS, 1% P/S and 40 μg/mL endothelial growth supplement (ECGS) (Sigma E2759). All the endothelial cells were grown as monolayers on 0.1% Gelatin (Sigma#G9391). HEK-293  and NHA  were cultured in DMEM media supplemented with 10% FBS and 1% Penicillin-streptomycin. All the cell lines purchased from ATCC or Cell Biologics were tested and validated by the respective company. Depleted media used to condition the cells and isolate their secretomes comprised DMEM-F12 and 0.125% EV-depleted FBS. GSCs, HUVECs, HBEC-5i and BMECs were cultured in depleted media for 3 days in vitro to obtain GSC specific conditioned media  and HUVEC/HBEC5i/BMEC specific conditioned media . All the conditioned media (CM) were subjected to a 2000 X g centrifugation for 20 min to sediment cell debris prior to use. For all CM experiments, GSCs were cultured in either OCM or ECM at a 1:1 ratio with FM. Most of the CM experiments were 7 days long, unless mentioned otherwise. All cells were cultured in a 37 oC incubator with 5% CO2. For co-culture assay, monolayered HUVECs were labeled with carboxyfluorescein succinimidyl ester (CFSE) (ThermoFisher#C34554) and GSCs labeled with PKH26 dye (Sigma# PKH26GL-1KT) were added in a 1:1 ratio and cells were cultured for 7 days.Patient derived GSC lines, namely, (GSC) 83, 1123, 1005, 528, 157, 84 and 1079 were isolated from GBM surgical samples, obtained in the laboratory of Dr. Ichiro Nakano. All the cell lines were grown in serum free media in suspension. The GSC culture media  comprised of DMEM-F12 basal media (GIBCO#11320033), EGF (GIBCO#PHG0311L), FGF (GIBCO#PHG0261), Heparin 0.2% (STEMCELL#07980), B27 (GIBCO#17504044), Glutamax (GIBCO#35050061) and 1% Penicillin-streptomycin (GIBCO#15070063). The gene and protein expression studies are periodically performed in houseg for 19 h to pellet EVs. Supernatant FBS was filtered through a 0.2 µm filter. This FBS was considered EV depleted. It was used to prepare starvation media for CM experiments.FBS was centrifuged at 100,000 × The following inhibitors were used, as indicated: MMP inhibitors - BB94 , AG3340 , NFkB inhibitor—Bay11-7082 , NOTCH inhibitor—DAPT . Images were obtained at 10 X every 30 min for 7 days. Cell sharpness (cell adherence) and eccentricity (change in cellular morphology) were analyzed using the standard Incucyte analysis software. Images were acquired using bright field, red and green fluorescence.The xCelligence RTCA MP instrument (ACEA Biosciences) was used to measure cell impedance (cell adherence). The E-plate VIEW 16 (ACEA Biosciences# 6324738001) was used to plate cells at a clonal density in OCM or ECM cultured for 7 days.http://bioinf.wehi.edu.au/software/elda/. Endpoint was reached once all wells contained a tumor sphere, or if no additional tumor spheres formed after 3-7 additional days of incubation post endpoint.Cells were seeded at different densities (1–40 cells/well) in 96 well plates. Up to 12 wells for 1 cell and 6 wells per 5-, 10-, 15-, 20-, 25-, 30-, 35-, and 40-cells were seeded using FACS. Cells were cultured in 100 μL of either CME , CMO , or FM for 1–6 weeks as indicated. Cells were fed every 15 days with 100 μL of respective CM/FM media. At each timepoint, the number of wells with at least one tumor sphere (clusters/spheres comprising of >20 cells) were counted. The frequency of cluster-initiating cells was calculated by an ELDA online program at n = 5). Cells were left to incubate for 3, 5, or 7 days as indicated. MTS reagent corresponding to 1/10th the total volume present in a given well was used to measure cell growth/survival in presence/absence of endothelial-cell (HUVEC) conditioned media. After 2 h of treatment, the absorbance at 490 nm was read using a plate-reader. The readings were normalized to the MTS readings obtained using CMO alone and CME alone without the presence of cells. MTS for temozolomide  was done after 24 h incubation with TMZ.500 cells/well of a given cell-line were seeded in 96 well plates with 100 μL of either CME  or CMO  media to afford 5 technical replicates  was injected i.v. 30 m prior to euthanizing the mouse. Brains from mice were harvested and put in cold PBS. The brains were sectioned at 200 μm using a vibratome (Leica VT 1200 s). The tissues were placed in a µ-Dish 35 mm, high Glass Bottom dish  and taken for high resolution confocal microscopy . An end point of a mouse with intracranial injection was established based on the first sign of neurological symptoms such as circling or dehydration. No decline in well being was allowed. All mice were maintained at MUHC RI and McGill University animal care facility, monitored daily, under 12 h of light/12 h of dark cycle. All procedures comprising animals were conducted in accordance with the guidelines of the Canadian Council of Animal Care and the Animal Utilization Protocols, approved by the Institutional Animal Care Committee at the Research Institute of the McGill University Health Center and McGill University.Orthotopic injections were carried out by injecting 2 μl of 25,000 GSCs stereotactically into the brains of 3 month old NOD.Cg-PrkdcSCID Il2rgtm1Wjl/SzJ (NSG) mice (Charles River Labs). For staining blood vessels, 54. Briefly, aortas of 2 month old C57bl/6 (Charles River Labs) mice were collected and ~1 mm rings were cut and placed in the BME matrix  in a 12-well dish. After the ring solidified in the BME, aortic ring media containing DMEM/F12 , 1X Penstrep , 2% FBS  and ECGS  were added to cultures. After 3d, when the endothelial cell sprouts developed, GFP labeled GSCs were incorporated in BME and placed at the edge of the well containing aortic rings. Images were taken 3 days after co-culture initiation.Aortic ring sprouts were prepared as described previouslyGSCs were grown as monolayers in 12-well dishes coated with poly-l-ornithine  and laminin . A scratch was generated by running a P1000 sterile pipette tip across the confluent GSC culture. Respective media was added in each well and images were recorded over time using Incucyte S3 live analysis system (EssenBio).3. Briefly, the respective conditioned media were cleared of cells at 300 × g for 5 min, and dead cells/debris was further eliminated by centrifugation at 2000 × g for 20 min, after which the supernatant was concentrated by spinning at 3500 × g for 20 min using Amicon Ultra-15 Centrifugal Filter Units −100 KDa-  to a final volume of 1 ml. The 1 ml Concentrate was subjected to ultracentrifugation at 110,000 × g for 1 h using a tabletop ultracentrifuge (Beckman TLA100.2 rotor). The pelleted EVs were washed with sterile PBS  at 110,000 × g for 1 h in the ultracentrifuge suspended in sterile PBS or RIPA buffer and analysed.EVs were purified as previously describedParticle number and size were investigated using NS500 nanoparticle tracking analysis system . 1:1000 aliquots were loaded into the chamber. Three recordings of 30 s each were obtained under automatic detection and processing settings at 37 °C with camera level at 15, detection threshold of 5 and blur size set by auto by NTA software (version 3.0).g for 1 h 30 m. After overnight incubation, respective media was changed. Three days following spinoculation, cells were washed three times in sterile PBS and cells exhibiting red fluorescence were sorted by FACS in the case of both, GSCs and HUVECs.pLV-CMV-LoxP-DsRed-LoxP-eGFP  lentiviral vector was transduced into the PN-GSC157 cells. pLM-CMV-R-Cre  lentiviral vector was transduced into HUVECs. Briefly, cells were plated at 10,000 cells per well in a 24 well dish. Based on titration, 10μl of the prepared virus was added to the cells and subjected to spinoculation at 800 × oC. Protein concentrations were assessed using the Pierce Micro BCATM Protein Assay . Using 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE), lysates were resolved. Transfer of the resolved proteins onto polyvinylidene difluoride membranes  was performed at 30 V overnight. Membranes were blocked for 1 h in 5% milk or 5% BSA and probed with primary antibodies and respective horseradish peroxidise (HRP)-conjugated secondary anti-mouse , anti-rabbit  or anti-goat  antibodies. Chemiluminescence  was visualized using ChemiDoc MP system (Biorad). Primary antibodies used included: rabbit anti-CD63 , rabbit anti-CD9 , rabbit anti-CD81 , rabbit anti-BIP , rabbit anti-NOTCH1 , rabbit anti-SOX2 , rabbit anti-NES , rabbit anti-TGM2 , rabbit anti-NICD , goat anti-VIM , rabbit anti-P65 , rabbit anti-pP65  and mouse anti-βactin .Total cell proteins and EV proteins were isolated using RIPA buffer  containing protease inhibitor . After incubation on ice for 30 m, the lysates were centrifuged at 15,000 x g for 5 m at 4oC for 15 min in unmasking solution  for antigen retrieval. Primary antibodies: rabbit anti-CD31  and mouse anti-NES  were incubated overnight at 4oC. The tissues were washed for 5 min three times in PBS. The respective fluorescent secondary antibodies, purchased from Invitrogen, were incubated with tissues for 1 h at 37 oC. Secondary antibodies: goat anti-rabbit IgG Alexa Fluor 488  and donkey anti-goat IgG Alexa Fluor Plus 594 . Tissues were washed for 10 min three times, then the slides were cover slipped using DAPI mounting reagent .All brain tissues were preserved in 4% PFA after dissections. Tissues were passed through the tissue processor (Leica TP 1050) and embedded in paraffin blocks from which 5 μm thick sections were cut using a microtome . Tissues were de-waxed and re-hydrated in a series of 5 min steps involving Xylene and 95%- >50% ethanol. Tissues were further processed by heating at 95GSC157 cultures were treated with CMO, CME, OEVs and EEVs for 7 days, then stained for CD44  and IgG control. For the CFSE experiment, purified EVs were stained with CFSE  prior to incubation with cells. Cells were treated with CFSE labeled EVs for 24 h followed by FACS analysis. The cells were subjected to flow cytometry (BD LSR Fortessa) and data was analysed using the FlowJo software 10.7.1. For ImageStream, GSC157 cells were incubated with OEVs pre-stained with PKH26  and EEVs pre-stained with DiD . 24 h later, NucBlue  was added and GSCs were subjected to Image Stream analysis (Amnis ImageStream Mark II).3. Briefly, data was collected using the Thermo Orbitrap Fusion mass spectrometer operating at 120,000 resolution (FWHM in MS1) with HCD sequencing . Data was analyzed using Prism 9. The raw data were converted into *.mgf format (Mascot generic format) for searching using the Mascot 2.6.2 search engine (Matrix Science) against Human Uniprot sequences (2020). The database search results were loaded onto Scaffold Q + Scaffold_4.9.0 (Proteome Sciences) for statistical treatment and data visualization. Analysis for biological pathways found in highly enriched proteins was performed using DAVID: https://david.ncifcrf.gov platform.Proteomics was done as previously describedProtein lysates (10-15 μg) were processed using the MMP analysis kit  as per the manufacturer’s instructions.oC with agitation. Preparations were then subjected to ultracentrifugation, 110,000 × g for 1 h to pellet the treated EEVs. GSC157 was then incubated with the KCl treated EEVs and analysed as indicated.EEVs were prevented from internalization by exposing the proneural-GSC157 cells to heparin (10 μg/ml) for 1 h prior to EEV treatment. EEVs were stripped off the outer proteins by treating 1.5 ml of EEVs with 1.5 ml of 2 M KCl solution for 30 min at 4 t test analysis was used to compare two groups while one way ANOVA was used for comparison of more than two groups of data sets using GraphPad Prism v9. XCelligence data are plotted as average and standard deviation of well replicates. Every experiment was independently repeated > /= 3 times  and each experiment had > /= 5 technical repeats. The results were considered not significant (NS) when P > 0.05, or significant when P < 0.05 (*); P < 0.01 (**); P < 0.001 (***) and P < 0.0001 (****). All graphs were plotted to show the standard deviation of replicates.Standard unbiased Student’s Further information on research design is available in the Supplementary InformationDescription of Additional Supplementary FilesSupplementary Movie 1Supplementary Movie 2Supplementary Movie 3Supplementary Movie 4Reporting Summary"}
-{"text": "The association between out-of-hospital cardiac arrest patient survival and advanced life support response time remained controversial. We aimed to test the hypothesis that for adult, non-traumatic, out-of-hospital cardiac arrest patients, a shorter advanced life support response time is associated with a better chance of survival. We analyzed Utstein-based registry data on adult, non-traumatic, out-of-hospital cardiac arrest patients in Taipei from 2011 to 2015.Patients without complete data, witnessed by emergency medical technicians, or with response times of ≥ 15 minutes, were excluded. We used logistic regression with an exposure of advanced life support response time. Primary and secondary outcomes were survival to hospital discharge and favorable neurological outcomes , respectively. Subgroup analyses were based on presenting rhythms of out-of-hospital cardiac arrest, bystander cardiopulmonary resuscitation, and witness status.A total of 4,278 cases were included in the final analysis. The median advanced life support response time was 9 minutes. For every minute delayed in advanced life support response time, the chance of survival to hospital discharge would reduce by 7% and chance of favorable neurological outcome by 9%. Subgroup analysis showed that a longer advanced life support response time was negatively associated with the chance of survival to hospital discharge among out-of-hospital cardiac arrest patients with shockable rhythm and pulse electrical activity groups.In non-traumatic, adult, out-of-hospital cardiac arrest patients in Taipei, a longer advanced life support response time was associated with declining odds of survival to hospital discharge and favorable neurologic outcomes, especially in patients presenting with shockable rhythm and pulse electrical activity. Out-of-hospital cardiac arrest (OHCA) is a major disease worldwide, with a high mortality rate. Taiwan has approximately 9,815 cases of OHCA annually, with a survival rate of approximately 9.8% . SeveralThe effect of advanced life support (ALS) treatments in prehospital settings remains controversial. Several studies reported that earlier ALS intervention is associated with increasing survival rate –16, whilRegarding the EMS system in Taipei, previous studies showed that the intervention of ALS and the number of ALS personnel are associated with better outcomes in OHCA patients , 23–27; We conducted a 5-year retrospective cohort study using prospectively collected Utstein-based registry data from the Taipei EMS to investigate the association between the response time of ALS care and OHCA patient outcomes. All methods were performed in accordance with the study protocol which was approved by the Institutional Review Board (IRB) of the National Taiwan University Hospital (201606007RIND). Informed consent was waived due to the anonymized database and retrospective nature of the study, which was also approved by IRB of the National Taiwan University Hospital. The preliminary version of the abstract had been published at the European Resuscitation Council annual conference 2019 in Slovenia before we develop it into a full-length article.The Utstein-based OHCA registry system from the Taipei EMS was initially developed for OHCA quality control . The reg2, with 2.6 million registered residents. The majority of the population is Taiwanese. Taipei City has an EMS system based on the fire service with a two-tiered response team, including a basic life support (BLS) team and an ALS team. Taipei City has 45 prehospital BLS stations with 1,279 emergency medical technician (EMT) intermediate staff, who have completed at least 320 hours of training; and four ALS stations with 141 EMT paramedics, who have completed at least 1280 hours of training and need to conduct OHCA re-training every year  Q1–Q3). We performed chi-squared or Fisher’s exact tests to assess the associations between the categorical variables and outcomes. For continuous variables, we conducted non-parametric Mann–Whitney rank sum tests for analyses. All variables previously determined to be associated with the outcomes were included in the multivariable logistic regression analysis to prevent overfitting. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated, and two-tailed p-values < 0.05 were considered statistically significant.We conducted a subgroup analysis using the new Utstein template, with methods suggested by the International Liaison Committee on Resuscitation (ILCOR) in 2014, to explore the effect of ALS response time among different subgroups of patients with OHCA. For this analysis, we stratified the data based on presenting rhythms of OHCA, including shockable rhythm (pVT/Vf), pulseless electrical activity (PEA), and asystole . We alsoOf the 16,062 OHCA cases treated between 2010 and 2015, 7,571 cases were adult, non-trauma OHCA without EMT witness with resuscitation attempted and 4,278 cases with ALS dispatch were included in the final analysis.  The propThe restricted cubic spline curve in In this large observational study in Taipei, we found that every minute of delay in ALS response time was associated with a 7% reduction in survival to hospital discharge and a 9% reduction in favorable neurological outcome in adult, non-traumatic, OHCA patients. A swift response by ALS not only benefited all OHCA patients, but also significantly benefited the subgroups of patients initially presenting shockable rhythms or PEA. An ALS response time of less than 8 minutes was associated with better outcomes in OHCA patients, while over 11 minutes was associated with a diminished chance of survival. We previously announced the preliminary results of this study [Our findings are similar to those of Grunau et al. , with neThere are several reasonable explanations for early ALS team response time improving the rate of survival to hospital discharge and neurological outcome among OHCA patients. ALS treatment includes airway management and drug administration. Network meta-analysis of randomized control trials reveal that ET tube placement and supraglottic airway (SGA) do increase the rate of ROSC compared to BVM ; the sucSome studies have opposed ALS treatment. The OPALS study compared the before and after of implementation of ALS paramedics into EMS in Canada. The results revealed no improvement in the rate of survival to hospital discharge and functional outcome in OHCA patients after ALS intervention . AlthougOur study had several limitations. First, this was a retrospective observational study. While selection bias inherent to our study design cannot be eliminated, we believe it was mitigated by our population-based approach. While we adjusted for common OHCA confounders, additional unmeasured or unmeasurable confounders may have been present, such as in-hospital care, which may have influenced OHCA survival , 57. SecIn non-traumatic, adult, OHCA patients in Taipei, a longer ALS response time was associated with worse odds of survival to hospital discharge and favorable neurological outcomes, especially in patients presenting with shockable rhythm and PEA.Our study further suggests the optimal ALS response time for the EMS system.S1 TableALS: advanced life support. BLS: basic life support. CPR: cardiopulmonary resuscitation. EMS: emergency medical service. EMT: emergency medical technician. OHCA: out-of-hospital cardiac arrest. OR: odds ratio. pVT: pulseless ventricular tachycardia. PEA: pulseless electrical activity. STHD: survival to hospital discharge. VF: ventricular fibrillation.(DOCX)Click here for additional data file.S2 Tablea: cannot performed due to N = 1 in group CPC1-2.ALS: advanced life support. BLS: basic life support. CPC: cerebral performance category. CPR: cardiopulmonary resuscitation. EMS: emergency medical service. EMT: emergency medical technician. OHCA: out-of-hospital cardiac arrest. OR: odds ratio. pVT: pulseless ventricular tachycardia. PEA: pulseless electrical activity. VF: ventricular fibrillation. (DOCX)Click here for additional data file."}
-{"text": "SC was measured at four timepoints under three noise interference conditions each : after screening , HA- fitting (t1), additional auditory training (t2), and at 70-day follow-up (t3). Repeated-measure analyses of covariance investigated the effects of HAs (t0–t1), auditory training (t1–t2), and the stability of the combined effect (t2–t3) on SC per noise interference level and HL subgroup. Correlational analyses examined associations between SC, age, and psychological indices. Results: Patients showed mildly elevated tinnitus-related distress, which was negatively associated with SC in patients with mild but not moderate HL. At 0 dB, the intervention lastingly improved SC for patients with mild and moderate HL; at 55 dB, for patients with mild HL only. These effects were mainly driven by HAs. Conclusions: The here-investigated treatment demonstrates some SC-benefit under conditions of no or little noise interference. The auditory training component warrants further investigation regarding non-audiological treatment outcomes.Background: Patients with chronic tinnitus and mild-to-moderate hearing loss (HL) can experience difficulties with speech comprehension (SC). The present study investigated SC benefits of a two-component hearing therapy. Methods: One-hundred-seventy-seven gender-stratified patients underwent binaural DSL Tinnitus has been defined as “the conscious awareness of a tonal or composite noise for which there is no identifiable corresponding external acoustic source” . PrevaleSimilarly, research investigating the effects of auditory training on HL or SC suggests only small improvements across outcome domains such as speech intelligibility, cognition , or selfN = 177 patients with chronic tinnitus and mild-to-moderate HL  = 3.25, p < 0.05, p²η = 0.03, small effect) and moderate HL , both of which appeared to be driven by the time × age interaction effects of the HAs .At 0 dB noise interference, the intervention yielded significant time × age interaction effects for patients with mild  but not moderate HL. Post hoc analyses revealed no significant change but a weak trend (p = 0.06) for the t0–t1 effect of HAs.At 55 dB noise interference, the intervention yielded a significant main effect of time for patients with mild  and moderate HL .To further investigate the time × age interaction effect on patients’ SC in silence, correlational analyses revealed an association between higher age and higher HA-related improvement in patients with mild .We further conducted two (patients with mild vs. moderate HL) × two  vs. old) additional rmANCOVAs which found that, for patients with both mild and moderate HL, significant medium- and large-sized main effects of time emerged for older but not younger individuals. Post hoc analyses revealed significant improvements between t1: Ftime  = 8.05, 1: Ftime  = 14.32,r = −0.29, p < 0.05) but not younger patients  showed an association between higher HA-related improvement and higher TFI-measured TRD.Moreover, correlational analyses for younger vs. older patients with mild vs. moderate HL showed that in patients with mild, but not moderate HL, older (© hearing therapy for patients with mild (n = 124) and moderate (n = 53) HL on SC at four timepoints: after screening , after HA fitting (t1), after additional auditory training (t2), and at 70-day follow-up (t3) for three noise interference conditions . The intervention comprised binaural DSLchild-algorithm-based HA fitting and 14 days of daily, CD-enhanced auditory training exercises.The present study investigated the effects of TerzoCompared to patients with mild HL, patients with moderate HL were significantly older and had higher SC difficulties in silence and under noise interference—yet comparable, mildly elevated, levels of TRD. These findings are in agreement with previous studies that reported positive associations between age and HL  as well In patients with mild HL, lower SC was associated with (a) higher TFI-measured TRD at 0 dB noise interference; (b) higher anxiety and psychological distress, as well as higher TQ-THI- and TFI-measured TRD at 55 dB noise interference in this subgroup only; and (c) higher TFI-measured TRD at 65 dB noise interference in this subgroup only.Against the backdrop of overall mildly elevated TRD levels , the herInterestingly, an association between TRD and SC emerged only in patients with mild but not moderate hearing loss. This finding elucidates the importance of conjointly considering the degree of HL and psychological distress when operationalising SC success or planning HA fittings . Future Higher HA-related improvements of SC were associated with (a) older age and lower perceived stress at 0 dB noise interference, and (b), in this subgroup only, higher TFI-measured TRD at 55 dB noise interference.In line with existing recommendations , this fiDespite the overall low levels of psychological distress, the association between the beneficial effects of HAs on SC and lower perceived stress suggests the influence of psychological factors on the effectiveness of audiological interventions ,59 and vIn patients with mild HL, higher auditory training-related improvements were associated with higher TRD and perceived stress.© HA fitting (cf. below), its effect was associated with higher levels of psychological distress at baseline. Against the backdrop of our predecessor paper, which reported overall psychological benefits following hearing therapy [Although the auditory training did not significantly improve patients’ SC beyond the effects of the Terzo therapy , the pre therapy ,63, the Moreover, higher stability of the combined effect was associated with lower TRD, perceived stress, anxiety, depressivity, and psychological distress at the baseline, again highlighting the potential importance of psychological contributors to the effects of the here-investigated hearing therapy on SC .© hearing therapy yielded a medium-sized, significant time × age interaction effect at 0 dB noise interference. This effect was driven by an age-dependent effect of HAs.Terzo© hearing therapy resulted in a small-sized, significant main effect of time at 55 dB noise interference that was driven by a trend effect of HAs.Exploratory additional analyses suggested a main effect of HAs for older but not younger patients with mild HL. Moreover, TerzoThis finding is in agreement with the literature emphasizing age in the process of HA fitting  and suggIn patients with moderate HL, higher SC was associated with higher TQ-measured TRD at 0 dB noise interference.Although preliminary, the tinnitus-related or broader emotional distress might modulate executive control towards heightened processing of external stimuli in the context of moderate hearing loss, for example by means of altered executive control or allocation of attentional resources ,66,67. IHigher HA-related improvements were associated with (a) lower TQ-measured TRD at 0 dB noise interference, and (b) lower THI-measured TRD at 55 dB noise interference.In line with previous studies investigating psychological influences on successful HA use ,69, psyc© hearing therapy yielded a large-sized, significant time × age interaction effect at 0 dB noise interference, which was driven by an age-dependent effect of HAs. Additional exploratory analyses again suggested the main effect of HAs for older but not younger patients at 0 dB noise interference.TerzoThe current study has important limitations, most notably the absence of control group analyses and the non-stratification of included patients by psychological distress. Importantly, owing to the study’s inclusion and exclusion criteria, the current results cannot be generalised to individuals with severe hearing loss.© HA fitting on SC for patients with chronic tinnitus and mild or moderate HL under conditions of little or no noise interference. At medium-level noise interference, HAs benefit patients’ SC in context of mild but not moderate HL. Psychological variables appear to interact with the degree of peripherally mediated HL in influencing both patients’ SC and HA-related benefits, however inconclusively so. Overall, low psychological distress rates prohibited further examination of affective–cognitive influences; thus, interactions of emotional distress and intervention benefits (including the duration of HA-use) remain to be investigated in future studies.In summary, the results of the present study revealed benefits of Terzo"}
-{"text": "The intestinal microbiota is essential in absorbing nutrients and defending against pathogens and is associated with various diseases, including obesity, type 2 diabetes, and hypertension. As an alternative medicine, Traditional Chinese Medicine (TCM) has long been used in disease treatment and healthcare, partly because it may mediate gut microbiota. However, the specific effects of TCM on the abundance and interactions of microbiota remain unknown. Moreover, using TCM ingredients and data detailing changes in the abundance of gut microorganisms, we developed bioinformatic methods that decipher the impact of TCM on microorganism interactions.The dynamics of gut microorganisms affected by TCM treatments is explored using a mouse model, which provided the abundance of 70 microorganisms over time. The Granger causality analysis was used to measure microorganism interactions. Novel “serial connection” and “diverging connection” models were used to identify molecular mechanisms underlying the impact of TCM on gut microorganism interactions, based on microorganism proteins, TCM chemical ingredients, and KEGG reaction equations.Codonopsis pilosula (Dangshen), Cassia twig (Gui Zhi), Radices saussureae (Mu Xiang), and Sijunzi Decoction did not cause an increase in the abundance of harmful microorganisms. Most TCMs decreased the abundance of Bifidobacterium pseudolongum, suggesting a Bifidobacterium pseudolongum supplement should be used during TCM treatment. The Granger causality analysis indicated that TCM treatment changes more than half the interactions between the 70 microorganisms, and “serial connection” and “diverging connection” models suggested that changes in interactions may be related to the reaction number connecting species proteins and TCM ingredients. From a species diversity perspective, a TCM decoction is better than a single herb for healthcare. The Sijunzi Decoction only significantly increased the abundance of Bifidobacterium pseudolongum and did not cause a decrease in the abundance of other species but was found to improve the alpha diversity with the lowest replacement rate.Because most of the nine TCMs are medicinal and edible plants, we expect the methods and results presented can be used to optimize and integrate microbiota and TCMs into healthcare processes. Moreover, as a control study, these results can be combined with future disease mouse models to link variations in species abundance with particular diseases. TCM medp < 0.01 and accept the hypothesis when x2 causes x1 at the level of p < 0.01. For the python function “grangercausalitytests,” there are four kinds of tests for the null hypothesis: two tests are based on the F distribution, “params_ftest” and “ssr_ftest,” and two are based on the χ2 distribution, “ssr_chi2test” and “lrtest.”The interactions of microorganisms contribute to the stability of the microbiome. The strength of this interaction can be measured by the Granger causality approach, which identifies causality between different time series Granger, , can be To benefit healthcare and intestinal disease TCM treatment, we used the bio-statistic and Granger causality methods to explore the impact of TCM on gut microorganism abundance and interactions using nine TCMs and standard mouse gut microorganism sequencing data. Moreover, by novel serial and diverging connection models, we also deduced possible reaction pathways underlying the impact of the interactions.Codonopsis pilosula , Poria cocos , Rhizoma dioscoreae , Radices saussureae , Rhizoma Zingiberis , Cassia twig , Magnolia officinalis , White Atractylodes rhizome , Poria cocos , Liquiritiae glycyrrhizae , Astragalus mongholicus , and Chinese angelica .The TCMs were obtained from Kangmei Pharmaceutical Industry Co., Ltd, with batch numbers (BN) as follows: Codonopsis pilosula may affect small intestinal propulsion movement , Poria cocos (Fuling), Rhizoma dioscoreae (Shan Yao), Rhizoma zingiberis (Ganjiang), Liquiritiae glycyrrhizae (Gan Cao), Astragalus mongholicus (Huangqi), and Chinese angelica (Dang Gui), are medicinal and edible plants. TCM samples listed in Initially, we weighed seven single dried Chinese herbs and two compounds used in intestinal treatment  C57BL/6J mice aged 6 weeks. The mice were housed in the SPF animal breeding room of KMHD under License No. SYXK (Yue) 2019-0205, at a temperature of 23–25°C, moisture 54–57% and a 12-h light/dark cycle. This experimental study was approved by the Ethics Committee of KMHD under Approval No. IACUC-0210831-1.After feeding for a week, 198 mice were randomly grouped into 11 groups, with each group consisting of 18 mice. Among the 11 groups, nine groups were treated with different TCMs by gastric infusion , and theFecal collection process: after alcohol disinfection of each cage, three mice in each cage acted freely and defecated freely. Using sterile forceps, fresh feces were collected, placed into 2EP tubes, and quickly placed at −80°C. The fecal collection was performed before intragastric administration. The intragastric administration was suspended during the 3rd week (days 15 to 21) of the experiment.merged_abundance_table_species70.csv, we list the relative abundance of 70 species at 0, 3, 14, 21, and 28-day time points under the 11 different treatments, where the sum of each column is 100.High-quality genomic DNA was extracted from the mouse feces. The DNA that passed quality control was then used to construct a library using the TruSeq DNA HT Sample Prep Kit. Paired-end sequencing (2 × 150 bp) was carried out using the Illumina HiSeq X10 platform. After removing the host (mouse) and low-quality sequences, the relative abundance was calculated using MetaPhlAn 3.0  includes 11,075 reactions and represents a primary source to relate TCM with microorganisms. Chemical compositions and keywords of chemical reactions related to Cassia twig (Gui Zhi) and Sijunzi Decoction are listed in KEGG (Kyoto Encyclopedia of Genes and Genomes)  normalizing each column of merged_abundance_table_species70.csv, from the 11 TCM-free samples, we estimated the mean abundance values and variances for all 70 microorganisms. Then, we calculated the mean relative abundance for each microorganism species under each TCM treatment on days 3, 14, 21, and 28. If the mean is in the 95% confidence interval, treatment does not significantly change the abundance of the species at the p1 < 0.05 level according to the two-tail test. A mean located on the left side of the 95% confidence interval indicates that treatment significantly decreases the abundance of a species, whereas a mean on the right side of the confidence interval indicates that treatment increases the abundance of a species, with p2 < 0.025 using the one-tail test.Most microorganisms with increasing abundance following treatment with the nine TCMs have positive health functions for humans. There were 11 TCM-free samples on day 0. After p2 < 0.005 with the one-tail test, no microorganisms treated with the nine TCMs showed a decrease; however, setting p2 < 0.05 with the one-tail test revealed that Dang Gui Bu Xue Decoction, Cassia twig (Gui Zhi), and Sijunzi Decoction did not cause a significant decrease in the abundance of all microorganisms, whereas the other TCMs caused a reduction in the abundance of Bifidobacterium pseudolongum. This observation suggests that people taking TCM for healthcare should also take probiotics (including Bifidobacterium pseudolongum) to neutralize the mild adverse effects because this species is enriched with specific enzymes that degrade complex plant carbohydrates and host glycans  benefits to human health, including Lactobacillus_johnsonii  content in the caecum, Enterorhabdus_caecimuris , and the results are presented in Rhizoma dioscoreae (Shan Yao) was found to have five biomarkers: Bacteroides_caccae, Blautia_coccoides, Ruthenibacterium_lactatiformans, Clostridium_innocuum, and Lactobacillus_intestinalis. Rhizoma zingiberis (Ganjiang) was found to have Intestinimonas_butyriciproducens and Escherichia_coli as biomarkers. Codonopsis pilosula (Dangshen), Sijunzi, and Magnolia officinalis (Houpo) were found to have only one biomarker. Compared with Rhizoma zingiberis (Ganjiang), where the abundance of the two biomarkers increased.The LDA Effect Size (LEfSe) , a χ2 distribution test, to calculate the p-values of the Granger causality. We found many possible causality relationships under the 11 treatments when p < 10−4. For example, we showed that the Granger causality network for mouse gut microorganisms treated by Sijunzi Decoction has a p < 10−4 (Codonopsis pilosula (Dangshen), Poria cocos (Fuling), Rhizoma zingiberis (Ganjiang), Cassia twig (Gui Zhi), Magnolia officinalis (Houpo), Radices saussureae (Mu Xiang), saline control, Rhizoma dioscoreae (Shan Yao), and the Sijunzi Decoction have 372, 414, 426, 428, 467, 588, 443, 543, 431, 410 and 392 pairs of significantly correlated species, respectively.Taking the python package statsmodels.tsa.stattools, importing the grangercausalitytests function and using gc_res = grangercausalitytests , the Granger causality p < 10−4 . Supplemp < 10−4. Thus, correlations between the 70 species were found to change considerably by TCMs.Compared with the blank control group, the newly added causality pairs included 374, 383, 400, 454, 552, 423, 513, 410, 371, and 347 for the last 10 treatments, and 332, 329, 344, 359, 336, 352, 351, 351, 333, and 327 causality pairs vanished. In p < 0.00000001, a stricter cutoff, for blank control, Dang Gui Bu Xue Decoction, Codonopsis pilosula (Dangshen), Poria cocos (Fuling), Rhizoma zingiberis (Ganjiang), Cassia twig (Gui Zhi), Magnolia officinalis (Houpo), Radices saussureae (Mu Xiang), saline control, Rhizoma dioscoreae (Shan Yao), and Sijunzi Decoction, there remained 36, 30, 44, 45, 73, 22, 58, 61, 31, 64, and 45 pairs of significantly correlated species, respectively. Compared with the blank group, the number of newly added causality pairs was 29, 44, 45, 73, 22, 57, 61, 31, 63, and 45 for the last 10 treatments, and 35, 36, 36, 36, 36, 35, 36, 36, 35, and 36 causality pairs vanished, respectively. These results further confirmed that TCMs greatly changed the species correlations.After setting lrtest to Moreover, the biomarkers shown in Poria cocos (Fuling) and Cassia twig (Gui Zhi), a decrease in the alpha diversity values were observed because their diversity at point “5” was significantly lower than that at point “1”. The remaining TCMs showed no significant change in their alpha diversity. From the perspective of species diversity, TCM decoctions were found to have a greater effect when compared with single herbs.A diversity index for a dataset is a quantity reflecting how many different species exist and how evenly individuals are distributed among those species. The diversity index increases with increasing species number and increasing evenness. Alpha diversity measures, in one sample, the number of different species and their different abundance, whereas beta diversity focuses on a group of samples and compares species compositions between different samples. For each sample of each treatment in our study, an alpha diversity index was calculated . Here, wAs shown in Codonopsis pilosula (Dangshen) treatment group was 0.2443439. A value of 0.2672811 was determined for Poria cocos (Fuling) treatment, 0.3333333 for Rhizoma zingiberis (Ganjiang) treatment, 0.2918660 for Cassia twig (Gui Zhi) treatment, 0.3302752 for Magnolia officinalis (Houpo) treatment, 0.3594470 for Radices saussureae (Mu Xiang) treatment, 0.2127660 for the saline control treatment, 0.4285714 for Rhizoma dioscoreae (Shan Yao) treatment and 0.1842105 for Sijunzi Decoction treatment. The Sijunzi Decoction, saline, and blank treatments have the lowest replacement rates, whereas Ganjiang, Houpo, Mu Xiang and Shan Yao have the highest replacement rates. Interestingly, the Sijunzi Decoction was found to only increase the abundance of Bifidobacterium_pseudolongum significantly, with no decrease in any other species abundance. Thus, this treatment improved the alpha diversity with the lowest replacement rate.Beta diversity measures differences between the species composition of samples, with larger beta diversity values indicating a larger replacement rate  and two microorganisms (Adlercreutzia equolifaciens and Bifidobacterium pseudolongum) were used as examples to clarify the novel mechanism exploration method as follows. First, the two microorganisms present very different correlation strengths under the two TCM treatments. Second, specific reactions involving the chemical compositions of the two TCMs and metabolisms of the two microorganisms were retrieved. Finally, by using novel serial and diverging connection reaction path models, contrast analysis was performed to deduce the possible mechanism of TCM that changes the microorganism correlation strength.Two TCMs (Adlercreutzia equolifaciens and Bifidobacterium pseudolongum presents very different correlations: treatment with Cassia twig (Gui Zhi) gave a Granger causality lrtest p-value of 0.000064934, whereas treatment with the Sijunzi Decoction yielded a Granger causality lrtest p-value of 0.93943. We typically study three models to explore the relationship among the three objects (a TCM and two microorganisms): serial connection, diverging connection, and converging connection. Here, the “converging connection” is not applicable because microorganisms cannot have an impact on the TCM.The interaction between Cassia twig (Gui Zhi) and Sijunzi Decoction, respectively, and the metabolites of Adlercreutzia_equolifaciens and Bifidobacterium_pseudolongum are available from KEGG (data not shown due to size). “Serial connection” means three equations are involved in Adlercreutzia_equolifaciens → Bifidobacterium_pseudolongum → chemical composition of TCM, or Bifidobacterium_pseudolongum → Adlercreutzia_equolifaciens → chemical composition of TCM, where the TCM may increase the inter-species correlation by driving the chemical reaction based on Le Chatelier's principle/the equilibrium law.For convenience, in the following study, in Cassia twig, taking the following as an example: {rn:R00237} acetyl-CoA + pyruvate ↔ (3S)-citramalyl-CoA (A. equolifaciens) → {rn:R02955} acetate + (3S)-citramalyl-CoA (A. equolifaciens) ↔ Acetyl-CoA (B. pseudolongum) + Citramalate → {rn:R10474} Acetyl-CoA (B. pseudolongum) + cinnamyl alcohol (Cassia twig) ↔ CoA + Cinnamyl acetate. Clearly, there are three equations involved in A. equolifaciens → B. pseudolongum → Cassia twig. Here, the metabolite “(3S)-citramalyl-CoA” of A. equolifaciens helps to produce the metabolite “acetyl-CoA” of B. pseudolongum, and the chemical composition of “cinnamyl alcohol” from Cassia twig can consume “acetyl-CoA” of B. pseudolongum. Hence, this serial connection may increase the correlation between A. equolifaciens and B. pseudolongum.For A. equolifaciens → B. pseudolongum → Cassia twig. In B. pseudolongum → A. equolifaciens → Cassia twig. In A. equolifaciens → B. pseudolongum → Sijunzi Decoction, and in B. pseudolongum → A. equolifaciens → Sijunzi Decoction. Clearly, for Adlercreutzia_equolifaciens and Bifidobacterium_pseudolongum, the number of serial connections driven by Cassia twig  is much larger than that driven by the Sijunzi Decoction . This observation may partially explain the stronger Granger causality of A. equolifaciens and B. pseudolongum under Cassia twig than that under the Sijunzi Decoction.In A. equolifaciens and B. pseudolongum through the same or different reaction equations. As shown in Cassia twig (Gui Zhi) connects with both A. equolifaciens and B. pseudolongum through 75 shared chemical reactions, whereas Cassia twig (Gui Zhi) has five specific equations with A. equolifaciens and 15 specific equations with B. pseudolongum. Data in A. equolifaciens and B. pseudolongum through 11 shared chemical reactions, without any specific reactions. The more shared chemical reactions may explain, in part, the higher correlation between A. equolifaciens and B. pseudolongum under Cassia twig treatment than that found under Sijunzi Decoction treatment.The “diverging connection” indicated that the compositions of TCM may react with both metabolites of assia twig (Gui Zhi) and Sijunzi Decoction. Moreover, among the 70 microorganisms annotated in our mice model, only 28 microorganisms were annotated in KEGG. Given more detailed data, the novel serial and diverging connection models should provide additional insights into how TCM affects microorganism abundance and inter-species correlations.Mouse gut experiments and sequencing technology afforded a systematic analysis of the abundance of gut microorganisms over time with and without TCM treatments. The study also provided an opportunity to explore how TCM affects microorganism abundance and their inter-species correlations. Ingredient and reaction pathway analysis was used to explain the impact of TCM on gut microorganisms, and we focused our analysis on two TCMs, CCNP0002573.The datasets presented in this study can be found in the Fecal Metagenomic sequencing reads from CNGB Nucleotide Sequence Archive under accession number The animal study was reviewed and approved by the Ethics Committee of KMHD on the use of animal subjects under Approval No. IACUC-0210831-1. Written informed consent was obtained from the owners for the participation of their animals in this study.LH, XF, HY, and YZ designed the project. YC, XS, YD, QQ, and DZ conducted the experiments. DZ, YZ, and XB analyzed the data. DZ and XB developed the algorithm and software. YZ, DZ, and LH wrote and revised the paper. All authors contributed to the article and approved the submitted version.This paper was supported by Science Technology and Innovation Committee of Shenzhen Municipality under Grant No. JCYJ20160331190123578 and the Natural Science Foundation of Hebei Province of China under Grant No. A2019208336.Authors YZ, DZ, XB, and XF were employed by Kangmeihuada GeneTech Co., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
-{"text": "This article provides the context for the ambition outlined in the the National Institute for Health and Care Excellence (NICE) 2021–2026 strategy to ‘lead globally on the potential to include environmental impact data in its guidance to reduce the carbon footprint of health and care’. Anthropogenic environmental changes pose a catastrophic risk to human health, with potential to widen national and global health inequalities. Recognising the fact that NICE guidance influences the way health and care is delivered and its consequent environmental impact, NICE has included environmental sustainability among its strategic priorities. This article outlines the work underway to meet this sustainability agenda at NICE. In recent years, the National Institute for Health and Care Excellence (NICE) has continued to expand its engagement with environmental sustainability and work to promote environmental sustainability in the health system.NICE is identifying and supporting implementation of measures to assess and reduce the environmental impacts of NICE guidance and advice. A number of NICE products reference information on the environmental impact of health interventions to support more sustainable healthcare, including a medicine optimisation sustainability report, a patient decision aid for asthma inhalers and a medical technologies guideline.Upcoming work will include formalising how environmental sustainability considerations are integrated into health technology evaluation and other NICE processes, developing the inhaler decision aid to enhance its accessibility and usefulness and running a programme of deliberative public engagement on sustainability.NICE is also working to reduce its own organisational footprint. In 2022, NICE has been working to meet and surpass the ‘Greening Government Commitments’.Anthropogenic environmental changes, including air and water pollution, climate change and biodiversity loss, pose potentially catastrophic risks to human health.The scale of the existential threat of climate change led the Intergovernmental Panel on Climate Change in 2018 to recommend that greenhouse gas emissions (GHGs) must reach net zero by 2050 to prevent a catastrophic temperature rise of 1.5°C.,Recognising that NICE guidance affects how the NHS operates and consequently its environmental impact, NICE laid out ambitions to support environmental sustainability in the NICE strategy 2021–2026.In the 2021–2026 NICE strategy, NICE outlines its ambition to ‘lead globally on the potential to include environmental impact data in its guidance to reduce the carbon footprint of health and care’.Since this recent strategic commitment to support a sustainable health system, NICE has been working to identify and implement actions that it can take to support environmental sustainability across the health and care system. This requires collaboration to ensure coherence across different areas of NICE’s work, including overseeing methodological development work, and to share progress on NICE’s work to support sustainability.NICE has previously demonstrated how implementation of its medicines optimisation guidelines on the safe and effective use of medicines in health and social care settings can also produce benefits from an environmental point of view.The responsibility to raise wider system awareness of environmental impacts of medication use extends to work NICE has been undertaking around use of inhalers for respiratory conditions. Inhalers are responsible for 3% of the NHS’s carbon footprint. A NICE patient decision aid included a question to enable patients to consider environmental impact when making a choice about which asthma inhaler they use.In guidance published in January 2022 (MTG65), ‘Sedaconda ACD-S for sedation with volatile anaesthetics in intensive care’, the medical technologies advisory committee considered environmental impact (based on data provided by the manufacturer), alongside clinical and cost effectiveness evidence. Sedaconda ACD-S is a system to capture and reduce the release of anaesthetic gases, which is important because volatile anaesthetic drugs are potent GHGs.In addition to supporting system sustainability across health and care, NICE is also working to reduce the environmental impact of its own activities given its reputational and leadership role globally. NICE adheres to the ‘Greening Government Commitments’ to:reduce carbon emissionsminimise wastereduce water usemake sustainable choices about procurementsupport biodiversity and nature recoveryadapt to climate change andreduce the environmental impacts of digital workingNICE has an internal action-focused group engaging staff and working to reduce NICE’s environmental footprint in line with these commitments.In line with its strategic commitment, NICE has commissioned an academic centre to explore possible approaches to incorporating environmental sustainability considerations in NICE’s methods and processes, including health technology evaluation. The academic centre has identified data sources and methods that can be used. This exploration has provided insights which may inform development of a framework for presenting and quantifying environmental impact information. Work is also underway to prepare for the implementation of such a framework, including deliberative public engagement to gain insights into public perceptions and preferences.In response to the consultation at the scoping stage for the BTS/SIGN/NICE asthma guideline, which is due for publication in November 2022, stakeholders requested that NICE address environmental sustainability considerations. The importance of selecting the right inhaler device for each patient will be included in the guideline, and where devices are equally acceptable, environmental factors will be taken into account. The developers intend to recruit an expert on environmental issues related to respiratory care to support the committee.During 2022, NICE is also undertaking focused projects to incorporate environmental considerations within specific activities. An important piece is a programme of deliberative public engagement, NICE Listens, which NICE will use to explore views on NICE’s role and priorities in the environmental sustainability space.In its 2021–2026 strategy, NICE has acknowledged the importance of assessing environmental impact in its guidance and the responsibility it has as a health leader to promote environmental sustainability. This article has highlighted how NICE is engaging with this agenda and contributing to the positive changes that are underway in the UK health system.S.W. is an unpaid Associate of the Centre for Sustainable Healthcare.K.S. and S.W. are employed by the National Institute for Health and Care Excellence.In his previous employments, K.S.' employers have received funding from a variety of sources, including pharmaceutical companies and the Association of the British Pharmaceutical Industry.M.S. has nothing to declare."}
-{"text": "Cancer cells exhibit unique metabolic properties, including a high requirement for methionine. However, the mechanism that explains how cancer cells suffer from the absence of methionine more significantly than healthy cells remains elusive. Methionine is essential for epigenetic reprogramming of cells, both at the DNA level and for post-translation histone code modification. The post-translational modifications of histone variants (hPTMs) in normal and cancer cells were characterized by mass-spectrometry in the absence and presence of methionine gamma-lyase (MGL), a bacterial enzyme that degrades methionine and inhibits the growth of cancer cells. Results indicate a complex pattern of PTMs on histone variants and striking differences between normal and cancer cells that might help in the understanding of the molecular mechanisms triggered by methionine depletion and in the fine-tuning of MGL-based cancer therapy.Methionine is an essential amino acid involved in the formation of polyamines and a precursor metabolite for DNA and protein methylation. The dependence of cancer cells on methionine has triggered extensive investigations aimed at its targeting for cancer therapy, including the exploitation as a therapeutic tool of methionine γ-lyase (MGL), a bacterial enzyme that degrades methionine, capable of inhibiting cancer cells growth due to methionine starvation. We have exploited the high-resolution power of mass spectrometry to compare the effects of reduced availability of the methyl donor SAM, induced by MGL treatment, on the post-translational modifications of the histone tails in normal Hs27 and cancer HT-29 cells. In the absence of MGL, our analysis detected a three-fold higher relative abundance of trimethylated K25 of H1.4 in HT-29 than Hs27 cells, and a complex pattern of methylated, unmethylated and acetylated peptides in H2 and H3.3. In the presence of MGL, in HT-29, the peptide H2A1_4_11 is predominantly unmodified with mono-methylated K5 increasing upon treatment, whereas in Hs27 cells, H2A1_4_11 is monomethylated at K5 and K9 with these marks decreasing upon treatment. The time dependence of the effects of MGL-mediated methionine depletion on PTMs of histone variants in HT-29 cancer cells was also monitored. Overall, our present data on histone variants H1, H2A, H2B as well as H3.3 integrated with our previous studies on histones H3 and H4, shed light on the epigenetic modifications associated with methionine starvation and associated cancer cell death. Malignant cells exhibit proliferative advantages when compared to non-malignant cells due to an altered metabolism that supports their rapid growth. The Warburg effect that describes the preference of cancer cells to metabolize glucose anaerobically rather than aerobically, even under normoxia, is a typical example. In addition, cancer cells often present an increased demand for selected amino acids (AAs), resulting in a dependency on exogenous sources or upregulation of their de novo synthesis . The expA notable example of metabolic vulnerability in cancer cells is the elevated requirement for methionine ,4. The hMethionine is involved in many relevant biological processes, such as protein synthesis, glutathione formation, polyamine synthesis and methyl group donation in methylation reactions. Thus, low methionine availability widely perturbs cellular mechanisms . In partIn yeast cells, the imbalance in SAM/SAH (S-adenosylhomocysteine) ratio alters histone methylation, increasing or reducing viability . Yeast cSensing methionine availability is thus crucial for cellular, epigenetic, and genomic integrity, but the mechanisms for methionine perception are different throughout different organisms, despite a conserved role of methionine as a growth signal.In mammalian, the molecular mechanisms are still elusive. It was reported that methionine is sensed indirectly through SAM , which bA few recent studies have started to address the epigenetic changes occurring in cancer cells exposed to methionine restriction ,29,30,31Our laboratory carried out an extensive characterization of the differential histone methylome, acetylome and proteome of normal and cancer cells upon MGL-induced methionine deprivation by mass spectrometry-based proteomics . MGL treThe chromatin of individual eukaryotic cells is wrapped around histone octamers to form the nucleosome core particles. An octamer contains two of each core histone  with 145–147 base pairs of DNA wound around it. A histone known as linker histone H1 is bound to the outside of the nucleosome core particle, forming a full nucleosome, and stabilizing higher-order chromatin structures.Histone variants diverge in sequence and impart effects on many DNA-templated processes and are deposited throughout the cell cycle often by variant-specific histone chaperones. Replacement of canonical histones by variants affects nucleosome structure and accessibility of the histone tail. Variants of histones H2A, H2B, H3, and H1 are well-described in literature, while there is little evolutionary divergence in H4.Distinct amino-terminal modifications of the histone tails characterize a specific “histone code” that determines dynamic transitions between transcriptionally active or transcriptionally silent chromatin states.Histone amino-terminal modifications include acetylation, methylation, phosphorylation, ubiquitinylation, sumoylation, ADP ribosylation, and deamination . In partThis process increases the information potential of the genetic code and provides the cell with a rapid response to solicitations/stresses that require modulation of transcription. However, the histone code and its role together with the relevance of PTMs on histone variants are still not completely deciphered.To our knowledge, our present study describes for the first time how MGL-mediated methionine depletion affects post-translational modifications deposited on histone variants (hPTMs) in normal and cancer cells. Our effort was to help better understand the complex epigenetic cell alterations due to methionine restriction but also to define new biomarkers to better calibrate anticancer therapy based on enzymes able to cause methionine deprivation.E. coli BL21(DE3) cells containing the plasmid with MGL gene from C. freundii were grown. Enzyme was purified, and protein concentration was determined according to the protocol previously described [escribed ,40,41. P2O → methanethiol + NH3 + α-ketobutyrateL-methionine + H−1 cm−1) at 37 °C. The rate of α-ketobutyric acid production was measured in a coupled assay at 30 °C. The reaction mixture contained 100 mM potassium phosphate, 100 mM pyridoxal 5′ phosphate (PLP), 5 mM DTT, 0.2 mM NADH, pH 7.2. The amount of the enzyme that catalyzes the formation of 1.0 μmol min−1 of α-ketobutyrate at pH 8.0, 37 °C, was defined as one unit of enzyme activity. Kinetic parameters of MGL mutants in the α,γ-elimination reaction with L-methionine were previously reported to be kcat = 7.9 s−1 ± 0.3; KM = 0.8 mM ± 0.1; kcat/KM = 9.7 × 103 M−1s−1 [MGL catalytic activity was determined using L-methionine as a substrate and measuring the rate of α-ketobutyrate production in the coupled reaction with D-2-hydroxyisocaproate dehydrogenase (HO-HxoDH) by monitoring the decrease of NADH absorption at 340 nm , pH 7.4, and sterilized through Millipore GV 0.22 µm filters and stored at −80 °C. The methionine concentration in the medium for cell growth was quantified to be 400 μM by the afore mentioned coupled activity assay with HO-HxoDH. This concentration corresponds to half of the Knditions . The confter 1 h .v/v) fetal bovine serum, in a humidified CO2 (5%) incubator at 37 °C.The effects of methionine depletion caused by MGL treatment were tested on two human cell lines provided by ATCC: the human colon adenocarcinoma cell line HT-29  and the human skin fibroblast cell line Hs27 . Cell culture conditions have been previously reported [5 cells were seeded in 12-well plates, with 2 mL of DMEM complete medium and, after treatment, cell nuclei were isolated, and histones were extracted with 0.2 M H2SO4 for 2 h and precipitated with 33% trichloroacetic acid (TCA) overnight. The histone protein pellets were dissolved in 30 μL of 50 mM ammonium bicarbonate, pH 8.0. To ensure complete derivatization, two rounds of propionylation were performed mixing propionic anhydride with acetonitrile in a ratio of 1:3 (v/v) and adding to histone solutions in the ratio of 1:4 (v/v) for 20 min, at room temperature. After digestion, to derivatize peptide N-termini, the derivatization procedure was repeated twice.Histone acid extraction and analysis by mass spectrometry were performed following our previously detailed protocol ,42. 2.5 Samples were desalted prior to LC-MS analysis by using C18 Stage-tips. They were then resuspended in 10 µL of 0.1% TFA and loaded onto a Dionex RSLC Ultimate 300 , coupled online with an Orbitrap Fusion Lumos (Thermo Scientific). Chromatographic separation was performed with a two-column system, consisting of a C-18 trap cartridge  and a picofrit analytical column  packed in-house with reversed-phase Repro-Sil Pur C18-AQ 3 µm resin.5 and an HCD collision energy of 30.To analyze the histones, peptides were separated using a 60 min gradient from 4%-30% buffer B  at a flow rate of 300 nl/min. Data were acquired using a data-independent acquisition (DIA) method. In particular, the full MS scan (300–1100 m/z) was acquired in the Orbitrap with a resolution of 120,000. MS/MS was performed by setting consecutive isolation windows of 50 m/z with an AGC target of 2 × 10t-test heteroscedastic with two-tails (significant if p < 0.05).Histone peptide data were analyzed using EpiProfile 2.0 software . The rawT-test. Significance was assumed if the obtained p-value was < 0.05. Prior to T-test calculation, protein abundances were log2 transformed, normalized by the average value of each sample and missing values were imputed using a normal distribution 2 standard deviations lower than the mean. The distribution of data points of replicates was assumed to be normal, but this was not formally tested.To assess statistical significance, we used a two-tails heteroscedastic parametric https://chorusproject.org/) at the project number 1712, accessed on 4 March 2021.Histone raw files are available for download at the repository Chorus  . On the In cancer cells the mono-methylation at K33 in H1.2 decreases after treatment, while the unmodified peptide increases. In addition, acetylation at K31 in H1.4 increases in treated cancer cells .The abundance of the peptide corresponding to the N-terminal portion (1–35) of H1.4 versus H1.5 seems to be unaffected by the treatment in normal cells with H1.4 predominant over H1.5. On the contrary, in cancer cells H1.4 is predominant in untreated cells with respect to H1.5 but becomes equal upon treatment .In normal cells, upon MGL50 treatment, the peptide corresponding to the 54–84 fragment of H1.1 increases with a decrease in the peptide characteristic of H1.5. In cancer cells, the increase in H1.5 is at the expense of H1.4 with no changes in H1.1 abundance .H2 histone variants—In cancer cells, H2A1_4_11 is predominantly unmodified with the mono-methylation at K5 that increases upon treatment. On the contrary, in normal cells, H2A1_4_11 is monomethylated at K5 and K9 with these marks that consistently decrease upon treatment. The abundance of the unmodified peptide is similar in both normal and cancer cells with a change in the opposite direction: in Hs27 increases upon treatment, while in HT-29 decreases .For the H2AJ_4_11 peptide, in cancer cells, K5me1 is the most abundant mark and increases upon treatment whereas K9 mono-methylation and acetylation marks decrease. In Hs27 cells, the most abundant marks in the untreated cells are K5me1 > K9ac > K9me1 > unmodified. Upon treatment K5me is the dominant mark associated with K9ac and the unmodified peptide and K9me1 almost disappears .In H2AX_4_11 after treatment, K5me1 increases in normal and cancer cells, while K9me1 decreases .In HT-29 cells, H2A1_1_11 peptide K5 is acetylated, and treatment causes a 10% decrease. In normal cells, the unmodified peptide is as abundant as the acetylated one and the treatment increases acetylation on K5 .H2A1_12_17 K15ac is a dominant mark in cancer cells and almost absent in normal cells .H2A3_12_17 K15me1 is significantly dominating in untreated cancer cells with a significant fraction of unmodified peptide. K13me1 abundance increases upon treatment. In normal cells, the dominant mark is K13me1 when untreated and K15me1 when treated.H2A_1_88 H2AY.SAKAGVIFPVGR (macroH2A) skyrockets in normal cells upon treatment , while tIn H2B1A, K86ac is the predominant mark in cancer cells independently of treatment, while in normal cells a consistent fraction is unmodified, and acetylation is strongly affected by treatment. However, statistical significance is not reached by these data .Abundance of the variants affecting the N-terminal peptide of H2B is different in untreated normal and cancer cells and changes in response to MGL-mediated methionine depletion. H2B_1_29 1C.PEPAKSAPAPKKGSKKAVTKAQKKDGKKR and H2B_1_29 1H.PDPAKSAPAPKKGSKKAVTKAQKKDGKKR are more abundant in normal than in cancer cells upon treatment .H3.3 histone variants—MGL-mediated methionine depletion does not induce statistically significant alterations on hPTMs in H3.3 histone variants .H1 histone variants—24 and 48 h MGL treatments were applied to HT-29 cells in order to investigate how the deposition of marks on variants changed during progressive and sustained enzyme-mediated methionine starvation . InteresH2 histone variants—Variation in abundance of methylation at K5 and K15 of H2A1 displays opposite direction after 48 h treatment: the first one decreases and the second one increases. Little but significant variations were observed for H2A1K13ac and H2AZK7ac upon 24 h of methionine starvation, and for H2A3K15ac after 48 h . H2AJ unIn HT-29 cells upon treatment, the double acetylation at H2AZK4acK7ac and the triple acetylation at H2AZK4acK7acK11ac decrease after 48 h; on the contrary, the double acetylation at H2AZK7acK15ac decreases after 24 h .We evaluated also the time course of alterations induced by MGL50 on hPTMs in H2B variants, upon 24 h of MGL-mediated methionine depletion. In this case, H2B1A unmod increases and H2B1AK86ac decreases compared to control. After 48 h, the relative abundance of H2B1B unmodified peptide decreases and the acetylation at Y83 increases .H3 histone variants—hPTMs on the H3.3 histone variants when HT-29 cells were treated for 24 and 48 h are shown in MGL50 treatment caused a higher acetylation at K27 and a lower one at S28 already after 24 h than the control. Subsequently, the S28ac is reduced, but not significantly .The treatment for 48 h induced a reduction of K27me1K36me2, K27me1K36me1 and K27me3S28acK36me1 relative abundance .The K27me3K36me1 and K27me1K36me3 increase already upon 24 h methionine depletion, but only the second one decreases significantly upon 48 h .In the last years, significant effort has been exerted to decipher the histone code and to establish a relationship between hPTMs and stress exposition. Histone code could be employed to manage genome/epigenome alterations and to establish a genetic/epigenetic crosstalk beyond DNA sequences. hPTMs play a pivotal role in many biological processes and represent the crucial mechanism by which histones exert regulatory control over different processes and therefore determine cellular identity and metabolism ,49,50. HThis study deepens and integrates our knowledge of hPTMs in HT-29 and Hs27 cells in absence and in presence of methionine depletion. In our previous work, we focused on histone 3 and 4 specific marks . In thisIn HT-29 and Hs27cells epigenetic modification occurs mainly at lysine residues. Literature studies suggest that lysine acetylation is usually related to DNA damage response, cell-cycle control, chromatin architecture, RNA splicing, and transcription ,52. IndeIn particular, in untreated cancer cells we observed several mono-, di- and tri-methylation  on H1.4, H2A1, H2A3 and H3.3 histone variants, and a different pattern of mono-acetylation . Non-malignant cells show mono-methylation on H2A  and tri- or double-methylation on H3.3 histone variants. Nowadays, the relevance of PTMs modifications is well understood, but the complexity of the epigenetic signature and its impact on cellular context are unknown.We carried out a detailed analysis of the histone PTMs induced by methionine starvation. Methionine is an essential amino acid and is involved in many biological processes, such as glutathione formation, polyamine synthesis, and methyl group donation. Our previous results highlighted that malignant cell growth was significantly impaired in methionine-depleted conditions, while normal cells growth was unaffected . These eOur findings suggest that the changes of significant hPTM marks are different after MGL50 treatment in comparison with normal cells. These marks are abundant in cancer cells only after MGL50 administration. The most important alterations occur on H2A and H3.3 variants. The precise role of the histone modifications remains largely unclear and there is little information about the specific cellular mechanisms influenced by the deposition of such marks either in normal and cancer cells.Using information deriving from in-silico tools such as the “HISTome2: The HISTone Infobase”  we triedAmong the changes highlighted during methionine starvation induced by MGL treatment on the HT29 tumor cell line , changesAs described in previous studies , our masThe analytical power of mass spectrometry was applied to the characterization of the PTMs of histone tails, the region more affected by epigenetic changes, including those caused by methionine depletion in cell cultures. Significant differences were observed between normal and cancer cells in the PTM pattern both in the absence and presence of MGL, an enzyme that is able to decrease the available methionine, suggesting diversified metabolic adaptations. Future studies are needed to examine the consequences of these profile changes in normal and cancer cells at the proteomic level."}
-{"text": "The challenges of treating central nervous system (CNS) tumors in young children are many. These include age-specific tumor characteristics, limited treatment options, and susceptibility of the developing CNS to cytotoxic therapy. The aim of this study was to analyze the long-term survival, health-related, and educational/occupational outcomes of this vulnerable patient population.Retrospective study of 128 children diagnosed with a CNS tumor under 5 years of age at a single center in Switzerland between 1990 and 2019.Median age at diagnosis was 1.81 years . Median follow-up time of surviving patients was 8.39 years . The main tumor subtypes were pediatric low-grade glioma (36%), pediatric high-grade glioma (11%), ependymoma (16%), medulloblastoma (11%), other embryonal tumors (7%), germ cell tumors (3%), choroid plexus tumors (6%), and others (9%). The 5-year overall survival (OS) was 78.8%  for the whole cohort. Eighty-seven percent of survivors > 5 years had any tumor- or treatment-related sequelae with 61% neurological complications, 30% endocrine sequelae, 17% hearing impairment, and 56% visual impairment at last follow-up. Most patients (72%) attended regular school or worked in a skilled job at last follow-up.Young children diagnosed with a CNS tumor experience a range of complications after treatment, many of which are long-lasting and potentially debilitating. Our findings highlight the vulnerabilities of this population, the need for long-term support and strategies for rehabilitation, specifically tailored for young children.The online version contains supplementary material available at 10.1007/s11060-022-03963-3. CNS tumors are the most common pediatric solid cancers. The average annual incidence rate is 6.18 per 100,000 in 0–4-year-olds in the U.S. –4. DevelYoung children (< 5 years of age) are particularly prone to long-term sequelae of cytotoxic therapies . Due to Health care professionals often face the dilemma between augmenting treatment intensity for optimal disease control and minimizing acute toxicity as well as the risk of long-term sequelae . ClinicaIn this retrospective study, young children aged 0–5 years with a newly diagnosed primary CNS tumor and treated at the University Children’s Hospital of Zurich between January 1990 and December 2019 were identified. Date of diagnosis was defined as either date of histological confirmation of tissue sample or, if not available, date of diagnostic imaging.The design of the study was approved by the Ethics Committee of the Canton of Zurich. A general research consent was implemented at our institution in 2015. The need for informed consent was waived for deceased patients, patients diagnosed prior to 2015 and lost to follow-up. Patients with documented refusal to participate in research were excluded.The baseline clinical characteristics included age at diagnosis, sex, tumor characteristics , hydrocephalus at diagnosis, underlying genetic predisposition and treatment details. Extent of resection was determined based on neurosurgical reports and postsurgical MRI when available; if a residual tumor was described in the neurosurgical report and/or postsurgical MRI, the tumor was considered partially resected. Progression-free survival (PFS) was calculated from date of diagnosis to disease progression leading to change in treatment or death in patients without such a progression, and overall survival (OS) from date of diagnosis to death. In the absence of progression and for patients alive at last follow-up, PFS and OS were censored at the last documented date that the patient was seen by a physician (last follow-up).The long-term health-related outcome information was extracted from the medical charts of all patients and included neurologic status, endocrine function, hearing loss, visual acuity, secondary malignancies, and cerebral vasculopathy. Ototoxicity was graded according to Chang after review of available audiograms . NeuroloAt our pediatric institution, patients are followed up until 20 years of age and information on schooling and employment is regularly documented at long-term follow-up clinic visits. Academic achievement was categorized into two groups. The first group contains patients who attend regular school or work in a skilled job and the second group includes patients who attend an assisted or modified school program e.g. with smaller student numbers per class and additional assistance or who work in an unskilled or assisted job. A skilled job was defined as student with graduation after vocational training with a Federal Diploma . An unskilled job includes only training on-site without graduation. Preschool-aged children were excluded from this analysis.Descriptive analyses were used to summarize the study population. Kaplan–Meier survival curves were generated to estimate OS probability and progression-free survival probability. Log-rank test was performed for comparison between different subgroups.To quantify the association between different treatment modalities and long-term outcomes fisher’s exact test was used.R version 4.0.3 and RStudio (v1.3) were used for statistical analysis. The following additional packages were used: Beeswarm, ggplot2, ggpubr, openxlsx, plotly, plotrix, plyr, survival, survminer, tableone, tidyverse, viridis.We identified 164 children under 5 years of age and diagnosed with a primary CNS tumor between 1990 and 2019 at the University Children’s Hospital of Zurich, the largest pediatric oncology center in Switzerland. Thirty-six patients were excluded: 28 patients due to lack of sufficient information and 8 patients due to refusal to participate in research. Thus, 128 patients were included in the final analysis (Table S1).The main tumor subtypes were pediatric low-grade glioma (pLGG) , pediatric high-grade glioma (pHGG) n = 14, 10.9%) including five diffuse intrinsic pontine gliomas (DIPG), ependymoma , medulloblastoma , other embryonal tumors , germ cell tumors , choroid plexus tumors , and others   and choroid plexus tumors (n = 8) were diagnosed in children of younger age with the eldest child being 1.09 years and 1.98 years old, respectively. The other tumor subtypes showed a more balanced distribution from 0 to 5 years of age , followed by the cerebral hemispheres (26%). Most tumors found in the optic pathway and hypothalamus/midline region were pediatric low-grade gliomas n = 15, 71%), 3 of those patients were diagnosed with neurofibromatosis 1 (NF1). Tumors located in the thalamus and brainstem were mostly pediatric low-grade  or high-grade gliomas   underwent surgery, in 41% gross total resection (GTR) was achieved (Table S1). Fifty percent of patients had an uneventful postoperative course, for 9% there was no detailed information available. Seven patients (6.3%) had an ischemic event perioperatively, 5 (4.5%) presented with hemorrhages in the perisurgical period, with one being hemodynamically relevant. Ten patients (8.9%) developed hygroma or craniospinal fluid (CSF) leakage, 11 (9.8%) had nerve lesions with subsequent (transient) paresis in the corresponding area and 18 (16%) had other postoperative complications such as epilepsy, hemisyndromes, and endocrine deficiencies. Some patients suffered multiple complications.Sixty-three percent of patients received chemotherapy, most of them enrolled on or treated as per tumor-specific protocols  , 15.Radiotherapy was performed in 39.8% of patients (n = 51), either upfront (n = 27) or at progression (n = 24), two of those 24 were re-irradiated after further progression. The majority (56.9%) underwent proton radiation (introduced in Switzerland in 1996), 37.3% photon radiation, and 5.9% both modalities. Almost 30% underwent craniospinal radiation.Median follow-up time of surviving patients was 8.39 years [range 0.74–23.65 years]. Median progression-free survival (PFS) of the whole cohort was 3.3 years . The 5- and 10-year OS probability was 78.8% resp. 76.1% for the whole cohort  Fig. A with a Most of the deceased patients died within the first 5 years after diagnosis. Of those patients who died, the majority  died of tumor progression/relapse. One patient initially diagnosed with medulloblastoma died after diagnosis of radiation-induced high-grade glioma. The cause of death was undocumented or unclear for two patients.Twenty-six patients (20.3%) presented with endocrine deficiencies at last follow-up, where 21 (81%) received hormonal replacement therapy. Most (85%) presented with hypopituitarism. Hypopituitarism was associated with radiotherapy  and chemotherapy  (Table S3). Other endocrine alterations included obesity or precocious puberty.Fourteen patients were over 18 years of age at last follow-up. As far as documented none of them conceived a child. Four patients  had ovarian insufficiency and two required estradiol replacement. For the male patients (n = 6), spermiograms were not available.Visual impairment is multifactorial and prevalent also in the general population. Focusing on the subset of patients with optic pathway glioma and tumor-associated visual impairment, all patients  with optic pathway glioma showed some degree of visual impairment at last follow-up and four patients were blind in at least one eye.Sixteen patients 12.5%) had hearing impairment at last follow-up (≧ Chang Grade 2b)  presented with a moyamoya vasculopathy during follow-up. Both had been diagnosed with posterior fossa ependymoma and had received focal proton radiation at below 4 years of age, with a dose to the tumor bed of 54 Gy and 59.4 Gy, respectively.Nine patients (7%) experienced a stroke during follow-up time, in four patients after surgical resection of the tumor and in 2 patients stroke was deemed related to radiation-induced cerebrovascular disease (2.5 years and 13 years post completion of radiation).In summary, among survivors followed for more than 5 years (n = 77), 87% present with any tumor- or treatment-related sequelae, 61% had any neurological deficit, 30% presented with endocrine sequelae and 81% of them with need for hormone replacement, 17% with hearing impairment, and 56% with visual impairment at last follow-up.Thirty-seven patients had not yet reached school age at time of last follow-up. Information on schooling was not available for 6 patients. Of the remaining 85 patients, 71.8% were able to attend regular school and/or work in a skilled job, whereas 28.2% were schooled in a modified program or working in an unskilled or assisted job Fig. . Of the Among survivors of childhood cancer, the cumulative burden of chronic health conditions is highest in patients diagnosed with CNS malignancies . ProvidiWith a 5-year OS of 78.8%, the survival outcome of our cohort is comparable to previous studies, albeit differences regarding patient characteristics and therapy between studies , 22–24. Other studies reported a higher mortality rate in children diagnosed under 1 year of age when compared to older children , 26, 27.Survival rates of children diagnosed with a CNS tumor seem to have increased over the last years , 24, whiA study summarizing the outcomes of a cohort of 20 survivors, previously diagnosed with a brain tumor in the first year of life, reported 70% with neurological dysfunction, 25% with endocrine dysfunction, 15% with hearing impairment, and 45% with visual impairment . HearingHypopituitarism was associated with radiotherapy, as previously described –35. A reWe found that most (71.8%) of our school-aged patients or older at the time of analysis attended regular school or were employed in a skilled job. This is higher than what a previous study reported including children diagnosed with a CNS tumor in the first year of life . A recenThe size and heterogeneity of our study population, as well as limitations associated with the retrospective nature of the study, need to be considered when interpreting our findings. Assessment of long-term outcome has not followed a standard procedure in terms of frequency and tools used, limiting interpatient comparisons. The classification of CNS tumors has undergone several important revisions over the decades covered in this study. The main tumor entities have been reclassified and subdivided into new subgroups, reflecting the heterogeneity in tumor biology, especially in pediatric brain tumors in young children , 43. ThoYoung children are at a high risk for long-term morbidity after diagnosis of a CNS tumor. Encouragingly, though a vast proportion of survivors experience health-related sequelae, most were integrated in regular schools. Our study highlights the importance of long-term support strategies, tailored to young children. These include early screening for visual and hearing impairment, as well as endocrinopathy and neuropsychology assessments, to offer appropriate support. Advances in treatment modalities, including targeted anti-tumor therapies and improvement in high-precision radiation techniques, will hopefully lead to a further reduction in treatment burden and better long-term outcomes in these children.Supplementary file1 (DOCX 607 KB)Below is the link to the electronic supplementary material."}
-{"text": "Improving arm-hand skill performance is a major therapeutic target in stroke rehabilitation. Arm-hand rehabilitation may be enriched in content and variation by using technology-assisted training. Especially for people with a severely affected arm, technology-assisted training offers more challenging training possibilities. The aim of this study was to explore the feasibility of ReHab-TOAT, a “Remote Handling Based Task-Oriented Arm Training” approach featuring enriched haptic feedback aimed at improving daily activities and participation.motivation’, ‘individualization of training’, ‘potential training effects’, and ‘implementation in rehabilitation’ of patients and therapists. Five subacute or chronic stroke patients suffering moderate to severe arm-hand impairments and five rehabilitation therapists participated. All participants received 2 ReHab-TOAT sessions. Outcome measure was a bespoke feasibility questionnaire on user experiences and satisfaction regarding ‘ Both patients and therapists experienced ReHab-TOAT as being feasible. They found ReHab-TOAT very motivating and challenging. All patients perceived an added value of ReHab-TOAT and would continue the training. Small improvements regarding exercise variability were suggested. ReHab-TOAT seems to be a feasible and very promising training approach for arm-hand rehabilitation of stroke patients with a moderately or severely affected arm. Further research is necessary to investigate potential training effects of ReHab-TOAT. In addiIt has been shown that task-oriented training, i.e. repetitive training of meaningful activities in a functional context, induces changes in the cerebral cortex, supporting motor recovery based on brain plasticity , 11 and A number of systematic reviews about the effectiveness of robot-assisted therapy for upper extremities have been published in the last decade , 17. AltGiven the afore mentioned, we developed a new task-oriented arm training approach using a so-called ‘remote handling concept’ device featuring haptic feedback, to manipulate proprioception, i.e. the sense of movement, in patients with a severely affected arm-hand (UAT 1–3). This approach is called “Remote Handling concept based, Task-Oriented Arm Training” (acronym: ReHab-TOAT). The intervention consists of task-oriented training, incorporating the principles of motor learning, and is based on the training approach of two previously described and evaluated training concepts, i.e. “CARAS”  and “TOA to date , 26, 27. to date . Another to date .Therefore, the aim of the present study was to assess the feasibility of the ReHab-TOAT approach featuring enriched haptic feedback aimed at improving activities of daily living and participation in chronic and in subacute stroke patients with either a moderately or severely affected arm-hand. This was done from both the patients’ perspective and the therapists’ perspective. Special emphasis was put on motivation, individualization of training, training effects, and implementation in a rehabilitation context.2.This feasibility study was approved by the Medical Ethics Committee of Maxima Medisch Centrum in Veldhoven, the Netherlands (study code: NL70014.015.19). The study was also registered in the ISRCTN registry (ISRCTN50551089).2.1Five patients in either the subacute or chronic phase after a stroke participated. Patients were identified from the database of the department of brain injury rehabilitation of Adelante rehabilitation centre in Hoensbroek, the Netherlands. They all met the following inclusion criteria: unilateral stroke; post-stroke time between 6 and 12 weeks (subacute) or post-stroke time larger than 12 months (chronic); arm-hand motor impairment, i.e. an Utrechtse Arm/hand Test (UAT) score of 1–3 ; age > 1ore > 1+ ; non-strAlso, five therapists participated in the study. They all met the following inclusion criteria: working at a specialized rehabilitation centre, i.e. Adelante Zorggroep, Hoensbroek in the Netherlands; holding a degree in physiotherapy or occupational therapy; having at least 6 years of experience in the treatment of patients with central nervous system deficits.2.2ReHab-TOAT is a task-oriented arm training approach for stroke patients with a moderately to severely affected arm-hand  . One of The general content and time planning of each training session of the ReHab-TOAT approach is depicted in Fig. A comprehensive description of the ReHab-TOAT approach, including training session timing, training content & training build-up, and the potential for generalization of training effects, are presented in Appendix 1, 2 and 3 respectively.ReHab-TOAT was originally developed to be provided in three sessions per week, each session lasting 1.5 hours, over a training period of four weeks, based on previous research , 23. How2.3Outcome measures were user satisfaction and experiences from both patients and therapists regarding different aspects of feasibility . The out2.4The data of the quantitative part of the questionnaires from therapists and patients are reported descriptively. The answers to the open-ended questions were analysed using directed content analysis . The ini3.3.1The characteristics of the 5 stroke patients and the 5 therapists who participated in this study are shown in Table 3.2The individual results of the quantitative part of the feasibility questionnaire of the patients are presented in Table a bit boring” and “not exhausting”. In general, the patients were positive about the motivational aspect of ReHab-TOAT. They used terms like “nice” . Another patient stated the importance of the presence of a therapist during a training session “to make sure that there is therapeutic added value of the training”  of the movement possibilities of the patient during one exercise, “The individual results of the quantitative part of the feasibility questionnaire from the therapists can be found in Table Challenging and inviting to push your own limits” . However, one added value of using technology-assisted force feedback in ReHab-TOAT is that the training is made accessible to a broader group of patients. It creates the possibility to train meaningful movements even in patients with a severely affected arm-hand function or in patients with cognitive impairments.4.4In our study, both patients and therapists agreed that ReHab-TOAT has an added value for arm-hand rehabilitation of stroke patients, because of a) force feedback making therapy possible for a broader range of patients; b) the self-perceived training effects in daily life; c) the fun element; d) the challenging and motivating way of training; and e) the incorporation of self-efficacy principles and the stimulation of autonomy of the patient during training. And as therapists and patients, besides other experts, were involved in the development process of ReHab-TOAT right from the start of the project conception, their ideas and thoughts on the use of rehabilitation technology, and more specifically the use of the Dexternageable , 15.Also, in order to further optimise ReHab-TOAT, during the execution of the project several of the participants suggested to add more games and exercises, which enhances practice variability and training motivation. This, in turn, may increase generalization and transfer of training effects towards novel situations and other arm-hand skills . Therapi4.5The purpose of the present study was to assess the feasibility of ReHab-TOAT. Feasibility can be sub-classified in several key areas of interest, as described by Bowen and co-workers . We focuThe strength of this study is that ReHab-TOAT was tested by a defined group of therapists  and patients (stroke patients in chronic and subacute stage after stroke with a severely or moderately impaired arm-hand function and from different ages), in order to obtain a comprehensive set of information on the feasibility. This variety in participants was of added value, as it provided us with relevant and broad information on potential future end-users. ReHab-TOAT was tested under realistic circumstances, i.e. in regular rehabilitation conditions, in which it will also be used in the future. Furthermore, ReHab-TOAT has been developed for a wide group of patients, and contains all necessary and evidence-based training principles of current arm-hand rehabilitation regimes.During this study participants gave insights into their self-perceived performance and self-perceived training effects after only two sessions of ReHab-TOAT. Consequently, potential experienced effects that might occur after a longer use of the approach were not investigated. The same applies to aspects of the feasibility which might change during a more long-term use of the approach, especially regarding the motivation of patients. Furthermore, as none of the existing questionnaires gauging  technology was specific enough for our queries regarding ReHab-TOAT, two bespoke questionnaires were constructed, based on expert opinion from different domain experts (see Appendix 4 and 5). These questionnaires were not validated against any existing criterion or existing questionnaires.Our study did not focus on feasibility items like ‘Adaptation’, ‘Expansion’ or ‘Limited efficacy’. The latter would have necessitated a far larger number of participants in larger (and homogeneous) strata or subgroups, and a different methodological study set-up contrasting conditions and/or subgroups. No objective measures on any potential physical improvements and training effects were gauged.5.ReHab-TOAT seems to be a feasible training approach for arm rehabilitation of stroke patients with a moderately or severely affected arm. Both patients and therapists identified several benefits of ReHab-TOAT, e.g. the haptic feedback, increased motivation, enhancing self-efficacy and autonomy of the patient during the rehabilitation process, the possibility of individualizing the training (based on the patients’ needs), and the possible training effects at different levels of the ICF model. All participants wanted to continue the use of ReHab-TOAT, because they saw the high potential of gaining improvements, not only at arm-hand function level, but particularly at activity and participation level. Further research is necessary to investigate any potential training effect of ReHab-TOAT on patients’ performance at the different levels of the ICF model.This study, as part of the i2-CoRT project (www.i2-CoRT.eu), has been co-funded by the Interreg V-A Euregio Meuse-Rhine (EMR) programme under Grant EMR1. The Interreg EMR program has invested almost EUR 100 million in the development of the Interreg-region until 2020. With the investment of EU funds in Interreg projects, the European Union directly invests in the economic development, innovation, territorial development, social inclusion and education of this region.Coded data will be made available to the scientific community upon reasonable request.The supplementary files are available to download from http://dx.doi.org/10.3233/THC-220465.Click here for additional data file."}
-{"text": "SCD5A expression was found compared with SCD5B. This unequal splicing is attributed to a weaker recognition of the SCD5B-specific splicing acceptor site, based on predictions confirmed by an optimized minigene assay. The pronounced dominance of SCD5A was largely modified  or even inverted (rs1011850309_C) by natural SNVs at the TV-specific splice sites. Our results provide long missing data on the proportion of SCD5 TVs in human tissues and reveal mutation-driven changes in SCD5 AS, potentially affecting tumor-associated reprogramming of lipid metabolism, thus having prognostic significance, which may be utilized for novel and personalized therapeutic approaches.Alternative splicing (AS) is a major means of post-transcriptional control of gene expression, and provides a dynamic versatility of protein isoforms. Cancer-related AS disorders have diagnostic, prognostic and therapeutic values. Changes in the expression and AS of human stearoyl-CoA desaturase-5 (SCD5) are promising specific tumor markers, although the transcript variants (TVs) of the gene have not yet been confirmed. Our in silico, in vitro and in vivo study focuses on the distribution of SCD5 TVs (A and B) in human tissues, the functionality of the relevant splice sites, and their modulation by certain single-nucleotide variations (SNVs). An order of magnitude higher  The balance of lipid metabolism in the human body depends on an adequate supply of various saturated (SFA), monounsaturated (MUFA) and polyunsaturated (PUFA) fatty acids (FAs) of different carbon chain lengths, adjusted to the dynamically changing requirements. The MUFA-producing stearoyl-CoA desaturases (SCDs) are endoplasmic reticulum membrane-bound enzymes, which introduce the first double bond at cis-delta9 position into saturated fatty acyl-CoA molecules, mainly palmitoyl-CoA and stearoyl-CoA, to produce palmitoleyl-CoA and oleyl-CoA, respectively . Two isoSCD1 is mainly expressed in the major organs of lipid metabolism [SCD5 is highly represented in the embryonic and mature brain, pancreas and gonads instead [SCD5 gene expression may be less dependent on lipid factors compared to other mammalian desaturases. In contrast to SCD1, the promoter activity of SCD5 has been shown to be insensitive to several FAs in vitro [α, NF1, NFY) in the 5′ regulatory sequence of SCD5 [SCD5 mRNA levels. However, certain promoter polymorphisms of SCD5 have been proven to significantly reduce the promoter activity in vitro, modify TF binding sites in silico and were associated to metabolic disorders [The two human isoforms show markedly different gene expression patterns. While tabolism , SCD5 is instead ,5,6,7. I of SCD5 ,9, neith of SCD5 , changes of SCD5 , nor the of SCD5  affectedSCD5 [In recent years, the results of high-throughput whole genome, transcriptome and microRNA sequencing data have directed attention to tumor-related changes in the expression level of SCD5 ,17,18,19SCD5 . SCD5-drSCD5  and melaSCD5 ,23. FurtSCD5 , and a rSCD5 splicing event was identified as strong prognostic biomarker in a study analyzing the AS profile of kidney renal clear-cell carcinoma [Alternative splicing (AS) is a fundamental modulator of human gene expression, and it plays a significant role in expanding the diversity of functional proteins. There is increasing evidence that AS has a profound effect on cancer development. The tumor type-specific changes of the splicing process in cancer cells have significant prognostic value, can contribute to the prediction of cancer progression rate, and may be of therapeutic relevance . Along warcinoma , howeverarcinoma ,25,26.Minigene assay is a reliable in vitro tool for investigating the effect of human variations in AS . After cSCD5A and SCD5B forms and assessed their relative mRNA expression and distribution in different human cell lines and tissues. We proved the biased, SCD5A dominant acceptor site recognition of the two TVs in silico by prediction, and in vitro by generating and expressing a modified SCD5 minigene construct. Human variations affecting SCD5A- and SCD5B-specific donor and acceptor splice sites were also tested by the newly developed SCD5 minigene system.Although there are two TVs (A and B) of SCD5 in the NCBI, Ensemble and UniProt databases, they are not distinguished, examined, or even mentioned in scientific publications, with only one exception to our knowledge . TherefoSCD5 gene is located on the longer arm of chromosome 4. Its average-length exons are separated by rather long intron sequences of tens of thousands of base pairs. The first three of its six exons are identical for the two TVs, but SCD5A contains two more exons    B, wherea4B, E4B) B, which 4B, E4B) A. Accord4B, E4B) B,C.SCD5A and B TVs was tested by RT-PCR using primers specific for the common exon 2 and E5A and E4B, respectively, , thus the method proved to be suitable for quantitative comparisons .Since the two SCD5 TVs are produced from the same gene with extensively identical 5′ segments  A, their SCD5 may be due to differential recognition of A and B acceptor sites by the splicing machinery. To test this hypothesis in silico, we analyzed approximately 500-base-pair-long sequences harboring the AB donor and the A and B acceptor sites by NetGene2-2.42 online prediction program package [SCD5 pre-mRNA -based minigene system, in which the two acceptor sites can be compared simultaneously in the same cell. The schematic structure and exact sequence of the SCD5 minigene are shown in SCD5 gene, as well as the exons E4A and E5A without introns, were cloned into the expression vector. E4B was cloned together with the adjacent intron sequences. Due to their length, the entire introns 3 and 4 cannot be cloned into a vector, thus, only segments important for splicing were placed in the positions corresponding to the SCD5 gene. In the case of intron 3, a section with a length of 242 nucleotides from the 3′ end and 334 nucleotides from the 5′ end were inserted, while in the case of intron 4, the fragments were 242 and 344 nucleotides long  affecting the We examined a total of eight sequence variations of six SNVs, of which the position and main characteristics are summarized in A single missense variation  were seen to reduce the amount of SCD5A protein in the transiently transfected HEK293T cells compared with the wildtype A,C. Howe5 to 37% , and tha5 to 37% B. It is 5 to 37% C, withou5 to 37% D. The ef5 to 37% B, althousplicing C,D.SCD5B variant  or low extent  varies widely. Liver, lung, small intestine and spleen mainly express SCD1, and the pancreas, kidney and ovary are dominated by SCD5, while the two genes show balanced expression in brain, skeletal muscle and testis. Even though the SCDs catalyze the same reaction, their tissue-specific distribution and varying proportion suggest different functions, the nature of which requires further investigation.Although the characteristic gene expression of both  tissues ,5,6,7,33 results . Althoug, [The amino acid sequence of human SCD5A indicates four transmembrane domains, similarly to other SCD isoforms. The three histidine clusters considered important to fatty-acyl desaturase activity are also identified in SCD5A . It is ny 2023), ).SCD5A- and SCD5B-specific donor and acceptor splice sites, but also the effect of their SNVs on variant proportions. Our in silico and in vitro results were in very good agreement in both cases, i.e., the B acceptor site of lower-predicted probability indeed resulted in a lower level of SCD5B mRNA . Bovine serum albumin, HepG2 and HEK293T cells were purchased from Sigma-Aldrich . Polyclonal primary antibody against SCD5 was obtained from Invitrogen . Actin-specific polyclonal antibody and secondary antibodies were obtained from Cell Signaling . Human tissue RNAs were purchased from Thermo Fisher Scientific  and Zyagen Laboratories . All chemicals used in this study were of analytical grade. All experiments and measurements were carried out by using Millipore ultrapure water.SCD5 gene were included in the present study if they were identified in at least two different populations. The in silico impact of the selected sequence variants was predicted using the Variant Effect Predictor  and Netly 2022, ) online SCD5A and SCD5B were amplified from human ovary cDNA by iProof™ High-Fidelity DNA Polymerase , according to the manufacturer’s protocol. The purified DNA fragments were cloned into the pcDNA3.1(−) expression vector between the XhoI and KpnI restriction sites. The SCD5 minigene expression plasmid was generated in the pcDNA3.1(−) vector. The construct was designed to include the possible donor and acceptor sites of the third and fourth introns relevant for the alternative splicing of SCD5A and SCD5B TVs, the branch points, and their flanking sequences. A detailed description of the cloning procedure is presented in SCD5A plasmid or genomic DNA as a template. Then, the first two and the last two overlapping PCR products were combined by overlapped extension PCR. The three DNA fragments containing the three common and the three different exons, as well as the 5′ end, 3′ end and branch point regions, were successively cloned into the pcDNA3.1(−) expression plasmid using XhoI, NotI, Eco32I and KpnI restriction sites. The sequence of the cloning primers is shown in ® Site-Directed Mutagenesis Kit . The mutagenic primers are listed in The coding regions of 6 cells per well) in Dulbecco’s modified eagle medium (DMEM), supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin solution, at 37 °C in a humidified atmosphere containing 5% CO2. Cells were transfected with 1 μg SCD5 minigene plasmids using 3 μL Lipofectamine 3000, supplemented with 2 µL P3000  in 1 mL DMEM, respectively. Cells were harvested and processed 24 h after transfection.Human embryonic kidney (HEK293T) and hepatocellular carcinoma (HepG2) cells were cultured in 12-well plates  was added to each well, and the cells were scraped and briefly vortexed. After 45 min incubation on ice, the lysates were centrifuged for 15 min at maximum speed in a benchtop centrifuge at 4 °C, to remove cell debris. The protein concentration of the supernatant was measured with Pierce® BCA Protein Assay Kit , and the samples were stored at −20 °C until downstream analysis.Cell lysates were prepared for immunoblot analysis by removing the medium and washing the cells twice with PBS. The RIPA lysis buffer (100 µL)  using the SuperSignal West Pico Chemiluminescent Substrate .Aliquots of cell lysates (5 μg protein per lane) were analyzed by SDS-PAGE on 15% Tris-glycine minigels, and transferred onto Immobilon-P membranes . Primary and secondary antibodies were applied overnight at 4 °C and for 1 h at room temperature, respectively. Horseradish peroxidase (HRP)-conjugated goat polyclonal anti-actin  antibodies were used at 1:1000 dilution. SCD5 was detected with a rabbit polyclonal antibody , used at a dilution of 1:2000, followed by HRP-conjugated goat polyclonal anti-rabbit IgG  at a dilution of 1:2000. HRP was detected by C-DiGit®-4PCR Kit . cDNA samples were produced by reverse transcription of 0.5 µg DNA-free RNA, using the SensiFASTTM cDNA Synthesis Kit . Reverse-transcription PCR was performed in 10 µL final volume containing 1 µL cDNA template, 0.2 mM dNTPs, 1× PCR Buffer, 1× Q-Solution, 0.025 U/µL HotStarTaq DNA Polymerase , 1 µM forward and reverse primers. SCD5A and SCD5B sequences were amplified by a commonsense primer (5′-CGC TCT GGG TGT GAC A-3′), together with SCD5A (5′-CCC CAG CCA GCA CAT GAA AT-3′)- or SCD5B (5′-CCT CCA GGG ACA CAG AAA GAG-3′)-specific antisense primer. GAPDH cDNA was also amplified as an endogenous control using 5′-GTC CAC TGG CGT CTT CAC CA-3′ and 5′-GTG GCA GTG ATG GCA TGG AC-3′ primers. The first step of the thermocycle was an initial denaturation and enzyme activation at 95 °C for 15 min. It was followed by 20 cycles of 94 °C for 30 s, 60 °C for 30 s and 72 °C for 1 min. After final extension (72 °C for 10 min), the samples were separated on 1.5% agarose gel and visualized by ethidium bromide staining.Total RNA was purified from transfected HEK293T and HepG2 cells by using RNeasy Plus Mini Kit  following the manufacturer’s instruction. Possible DNA contamination was removed by DNase I treatment using RNAqueousTM SYBRTM Green Master Mix, 0.5 µM forward and reverse primers, using the QuantStudio 12K Flex Real-Time PCR System . SCD5A, SCD5B and SCD1 sequences were amplified by 5′-ATG GAA ACC GGC CCT ATG AC-3′/5′-CCC CAG CCA GCA CAT GAA AT-3′, 5′-GTG AGA TGC TTC GTG AAT GGC-3′/5′-CCT CCA GGG ACA CAG AAA GAG-3′ and 5′-CTG GCC TAT GAC CGG AAG AAA-3′, 5′-GAC CCC AAA CTC ATT CCA TAG G-3′ primer pairs, respectively. GAPDH, Actin and Tubulin cDNAs were also amplified as endogenous controls using 5′-GTC CAC TGG CGT CTT CAC CA-3′/5′-GTG GCA GTG ATG GCA TGG AC-3′, 5′-CTG GTG CCT GGG GCG-3′/5′-AGC CTC GCC TTT GCC GA-3′ and 5′-AAG TTC GCA CTG GCA CCT AC-3′/5′-AAC CAA GAA GCC CTG GAG AC-3′ primer pairs, respectively. For increased reliability, an RT negative control of each sample was also analyzed in addition to DNase I digestion. The first step of the thermocycle was an initial denaturation and enzyme activation at 95 °C for 2 min. It was followed by 40 cycles of 95 °C for 15 s, 55 °C for 15 s and 72 °C for 1 min, measurement of the fluorescent signal was carried out during annealing. Reactions were performed in triplicates, a reaction mixture with RNase-free water instead of template cDNA was employed as a non-template control. Relative expression levels were calculated as 2CT−Δ, where ΔCT values corresponded to the difference of the CT-values of the endogenous control and target genes.Quantitative qPCR assay was performed in 20 µL final volume containing 5 µL 20× diluted cDNA, 1× PowerUp® 5.2 software , and are shown as relative band densities normalized to actin as a reference or on a percentage scale. Data are presented in the diagrams as the mean values ± S.D. and were compared by ANOVA with the Tukey’s multiple comparison post hoc test, using the GraphPad Prism 6.0 software . Differences with a p < 0.05 value were considered to be statistically significant.Immunoblots were evaluated by densitometry using the Image StudioSCD5. We have demonstrated the expression of both SCD5A and SCD5B forms and the general dominance of the former in several human tissues, provided evidence for the markedly different binding probabilities of the alternative splice acceptor sites underlying the phenomenon, and revealed the impact of various human gene variants on SCD5 AS causing remarkable changes in the relative expression levels of the TVs, even in the dominance of SCD5B, in one case. We believe that our findings will facilitate further studies on tumor-related metabolic reprogramming of diagnostic, prognostic and therapeutic significance.Due to the limited expression of a few tissue types, it is possible that research on SCD5 has lagged significantly behind that of the more ubiquitous other human desaturase isoform. The existence of the two TVs of SCD5 has long been known, but remained largely disregarded in most studies. However, recent findings shed light on the importance of SCD5 expression and AS in tumor progression and metastasis, and their potential as prognostic factors and predictive biomarkers for tumor therapy. This is why we felt the need to compare the distribution of SCD5A and SCD5B in human tissues, and to elucidate the molecular background of the disproportionate AS of the primary transcript. This gap-filling research was also complemented by the investigation of certain SNVs potentially affecting the AS of"}
-{"text": "Venous stenting could alleviate exercise intolerance associated with chronic inferior vena cava (IVC) obstruction. We describe a 36-year-old male patient with an unknown IVC-obstruction. The obstruction was discovered after a bi-iliac deep vein thrombosis (DVT). The thrombus was resolved using thrombolysis. In the chronic phase, the patient developed exercise intolerance without any leg-specific symptoms or signs. Venous stenting was performed to open the IVC-obstruction, 1 year after the acute DVT. His physical condition improved, but cardiac magnetic resonance imaging at rest did not reveal hemodynamical changes after stenting. The Short Form Health Survey (SF-36) physical and mental component summaries were increased from 40.3 to 46.1 and 42.2 to 53.7, respectively. In patients with iliocaval obstruction, improved venous flow without changes in resting hemodynamics can enhance exercise intolerance and quality of life, even in the absence of leg symptoms. Diagnostic tools performed only at rest may miss abnormalities. It is often referred to as a congenital disorder, but may also result from thrombotic events in early childhood. Assessment of IVC-anomalies, including hypoplasia or aplasia is needed in DVT patients, especially those with iliofemoral DVT. Young patients with chronic IVC-obstruction may present asymptomatic, but are at risk for acute deep vein thrombosis (DVT), presenting at a mean age of twenty-five. Patients tend to develop post-thrombotic syndrome (PTS) later in life, which may cause pain, swelling, and/or ulceration of the leg. Exercise intolerance including dyspnea, exhaustion and turning pale during physical activities, is also observed.Partial or complete inferior vena cava (IVC) obstruction has a prevalence around 0.15%. but evidence is limited supporting its use for exercise intolerance. Endovenous recanalization, followed by venous stenting, could relieve exercise intolerance in IVC-obstruction. Cardiorespiratory functioning tests can be used to evaluate exercise intolerance in IVC-obstruction and its response to treatment. However, the impact of treatment on hemodynamics and quality of life (QoL) is unclear. Venous blood return is altered in IVC-obstruction, with the azygos vein, ascending lumbar veins, and abundant communicating veins becoming more prominent. Venous recanalization presumably resolves exercise intolerance by enhanced venous blood return.Deep venous stenting is an accepted treatment for symptomatic iliofemoral obstruction,This case-report presents a patient with exercise intolerance due to IVC-obstruction, which was accidentally discovered at presentation with an acute iliofemoral DVT. One year following acute DVT, the patient underwent venous stenting. Hemodynamics, clinical features, and quality of life (QoL) were evaluated pre- and post-procedure. Informed consent was obtained from the individual described in this case-report.A 36-year-old male patient was referred to our academic hospital for endovenous treatment of acute bi-iliac DVT with coincidental finding of IVC-obstruction. One week earlier, he was admitted for iliocaval DVT and treated conservatively with a heparin pump elsewhere, subsequently replaced with a direct-oral-anticoagulant. He experienced minimal back pain and bilateral inguinal pain at discharge. However, he was readmitted after 3 days due to worsening of complaints.Upon arrival at our institution, the patient had a fever, malaise, back pain, severe bilateral groin pain, and impaired mobility. Notably, leg symptoms and/or signs were absent. Duplex ultrasound (DUS) and Computed tomography venography (CTV) revealed an extensive DVT from the femoral veins above the knee until the IVC, including a thrombosed collateral vein . From thThrombolysis successfully restored patency of both iliac veins and the most distal segment of the IVC, but was stopped due to bleeding complications before the collateral opened . RecanalDuring the 6-month-control, the patient reported exercise intolerance. His complaints consisted of reduced physical condition, dyspnea, exhaustion and paleness during physical activities such as walking and cycling, without any leg-specific symptoms or signs. These complaints were absent prior to his acute DVT. Duplex ultrasound and CTV revealed a re-occlusion of the common iliac veins and distal IVC, with patent external iliac, femoral, and popliteal veins.Venous stenting was planned to improve cardiac preload and to resolve complaints. Cardiac magnetic resonance imaging (MRI) and the Short Form Health Survey (SF-36) questionnaire were used to evaluate the effect, both pre- and post-procedure.The first attempt of recanalization failed, but in a second attempt, the IVC was successfully stented. Both femoral veins and the right jugular vein were punctured for access. The IVC was recanalized after a snaring procedure creating a through and through wire. Intravascular ultrasound (IVUS) determined stent position and length after percutaneous transluminal angioplasty . The IVC was stented right below the hepatic veins with 3 SinusXL  overlapping stents (80 × 24 mm + 80 × 24 mm + 16 × 24 mm), in which two BeYond  stents (16 × 150 mm) were placed in a kissing fashion extending into the external iliac veins, with one additional stent (16 × 120 mm) on the right side. The SF-36 is divided in physical functioning, role limitations due to physical health , bodily pain, general health, vitality, social functioning, role limitation due to emotional problems , and mental health. Each domain scores between 0 and 100, with higher scores indicating a better QoL. Domains are summarized in a mental and physical component summary.All SF-36 domains remained stable or increased after venous stenting. Disabilities before the procedure were common in the role-physical, general health, and role-emotional domains with increased mean differences between 27.0 and 76.7 post-procedure. Physical and mental component summary also increased with 5.8 and 11.5 points, respectively.We presented a young male patient with exercise intolerance due to iliocaval obstruction. Endovenous recanalization followed by venous stenting led to complete resolution of his symptoms 1 year after the initial DVT. His SF-36 scores increased and were comparable to those of an age-matched Dutch cohort. However, there were no changes in heart volumes at rest before and after venous stenting. It is not regularly evaluated in venous outflow obstruction. Currently, exercise intolerance also is not included in any PTS score. Inadequate return of venous blood to the heart may cause exercise intolerance. Reduced venous return from the lower limbs during exercise reduces stroke volume and cardiac output in iliocaval outflow obstruction. Venous stenting presumably resolves exercise intolerance, by enhancing venous return and increasing cardiac output.Exercise intolerance is often underestimated as a consequence of chronic (ilio)caval obstruction. Despite unchanged pre- and post-venous stenting heart volumes, that were within the normal range, our patient experienced an improvement, as evidenced by SF-36 scores. Cardiac volumes were also normal at rest in patients with exercise intolerance after IVC-ligation, while lower volumes were measured during exercise. Therefore, diagnostic tools may miss abnormalities if only performed at rest.Evaluating cardiac hemodynamics at rest may fail to detect venous abnormalities, as resting venous capacitance may not reveal the increased demands of venous volume during exercise.Another lesson learned is that in acute DVT resulting from chronic IVC-obstruction, the IVC may be left untreated, with only fresh clot removal followed by lifelong treatment with anticoagulants. However, if collateral vessels remain occluded, persisting symptoms and signs may necessitate invasive treatment during follow-up.This case increases awareness for symptoms and signs related to physical exercise in venous iliocaval obstruction. Future studies are needed to reveal how venous stenting affects hemodynamics during exercise in IVC-obstruction. Understanding the impact of venous stents on cardiac hemodynamics and exercise-related complaints, may improve treatment selection for IVC-obstruction."}
-{"text": "Dysregulated fear reactions can result from maladaptive processing of trauma-related memories. In post-traumatic stress disorder (PTSD) and other psychiatric disorders, dysfunctional extinction learning prevents discretization of trauma-related memory engrams and generalizes fear responses. Although PTSD may be viewed as a memory-based disorder, no approved treatments target pathological fear memory processing. Hippocampal sharp wave-ripples (SWRs) and concurrent neocortical oscillations are scaffolds to consolidate contextual memory, but their role during fear processing remains poorly understood. Here, we show that closed-loop, SWR triggered neuromodulation of the medial forebrain bundle (MFB) can enhance fear extinction consolidation in male rats. The modified fear memories became resistant to induced recall  and did not reemerge spontaneously. These effects were mediated by D2 receptor signaling-induced synaptic remodeling in the basolateral amygdala. Our results demonstrate that SWR-triggered closed-loop stimulation of the MFB reward system enhances extinction of fearful memories and reducing fear expression across different contexts and preventing excessive and persistent fear responses. These findings highlight the potential of neuromodulation to augment extinction learning and provide a new avenue to develop treatments for anxiety disorders. Whether fear memories can be attenuated through on demand electrical stimulation remains unclear. Here, the authors demonstrate that fear extinction can be augmented through closed-loop stimulation of the reward system, guided by hippocampal SWRs. Extinction learning, the process of reducing the expression of learned fear responses, is essential for adaptive behavior in response to traumatic experiences.Learning unpleasant things and remembering them is advantageous for the organism for avoiding future reoccurrences. Memories that are irrelevant to survival or adaptation tend to fade away either by graceful degradation5. For example, post-traumatic stress disorder (PTSD) is a debilitating psychiatric disorder resulting from direct or indirect exposure to stressful events, threats, or life-threatening events perceived to compromise personal physical or mental safety8. Symptoms include intense feelings of unprovoked fear, panic attacks, anxiety; intrusive fear memories during wakefulness or in nightmares, fear generalization, and avoiding similar but neutral stimuli10. PTSD is highly resistant to psycho- and pharmacotherapy13.However, in some pathological scenarios, extinction learning is often impaired, leading to persistent and maladaptive fear responses14, and that closed-loop stimulation of the reward system can enhance memory consolidation15. Exposure-based extinction procedures have been found to reduce fear in a context-dependent manner, suggesting that the hippocampal representation of the extinction context drives fear attenuation16. The activity in the basolateral amygdala decreases when conditioning stimuli (CS+) are presented in the same context used for extinction but increases following non-extinction exposure to the CS+17. Furthermore, inactivation of the hippocampus has been found to enhance extinction to the CS+ and promote low fear expression in environments different from the extinction context19.Previous studies have demonstrated that hippocampal sharp-wave ripples (SWRs) play a critical role in the consolidation of fear memories20. Additionally, these neurons participate in a mutual inhibition process21. Based on these findings, we hypothesize that manipulating internal reward signals during extinction learning could facilitate the extinction of memories, thereby reducing excessive fear reactions in inappropriate contexts.Excitatory neurons in the basolateral amygdala have been shown to respond to both reward and punishment and have been proposed to be involved in mediating reward signaling induced by the omission of an unconditioned stimulus during extinctionHere, we explore whether SWR-triggered stimulation of the reward system through medial-forebrain bundle (MFB) can augment extinction learning. Our findings suggest that SWRs are crucial for mediating fear extinction, and that closed-loop neuromodulation targeting oscillatory activity related to memory processing could be a promising intervention for reducing excessive fear reactions in inappropriate contexts. Specifically, our experiments demonstrate that selective suppression of SWRs after extinction delayed fear attenuation, indicating that intact SWRs are necessary for extinction learning. Furthermore, our results show that SWR-triggered closed-loop stimulation of the reward system through MFB enhances the extinction of fearful memories, resulting in reduced fear expression across different contexts and preventing excessive and persistent fear responses. Overall, our study suggests that rewarding brain stimulation may be a promising approach to augment extinction learning, potentially beneficial to alleviate PTSD symptoms.Rats were subjected to a single session of fear conditioning  to develop PTSD-like phenotypes  to reveal the overall effect of the interventions , animals received SWR-triggered closed-loop stimulation during sleep for three consecutive days but were not exposed to the extinction paradigm Fig. .Fig. 2CoTo match the mean number of extinction sessions required for closed-loop animals to achieve the remission criterion Fig. , the numWe next tested if the SWR-triggered closed-loop stimulation interferes with already consolidated non-fear-related memories as a non-specific detrimental effect. For this purpose, the animals were trained in a spatial memory task, in which a randomly alternated visual cue indicated the correct choice in a T-maze to receive a reward (froot-loops pellet). They underwent a total of 20 trials per day until achieving 80% of correct choice. After completing the spatial memory task, the animals underwent fear conditioning, extinction, and stimulation sessions in the same way as in the previous experiment until achieving remission Fig. . During 16, required SWRs as they play a crucial role in contextual memory consolidation through cortico-hippocampal circuits23. To test this, we suppressed SWRs by ventral hippocampal commissural electrical stimulation that induces phasic silencing of hippocampal pyramidal cells and interneurons26. Since animals trained with high-intensity foot-shocks tend to resist extinction, we reduced the training intensity (5 pairings CS+US at 0.7 mA) to ensure that the extinction criterion was achieved within seven sessions in control conditions. During stimulation following each extinction, online detected SWRs triggered a single-pulse (0.5 ms) ventral hippocampal commissural stimulation ), animals received bilateral microinfusions of the Rac1 inhibitor NSC2376, D1R antagonist SCH23390, or D2R antagonist sulpiride immediately after each extinction session and before the closed-loop stimulation  introduces preset electrical stimulation in an open-loop manner, without being aligned to the internal oscillatory activity. Although DBS has been used to control fear expression in animal models36. SWRs rely on synchronous CA1 principal neuron activation mainly controlled by PV+ interneurons37. Boosting the activity of hippocampal PV+ interneurons results in selective extinction of contextual fear memory and increased SWR incidence38. However, suppression of hippocampal PV+ interneurons alters principal neuronal phase coupling to SWRs, decreasing ripple-spindle coupling and consolidation of contextual fear memory40. Our findings indicate that SWRs are necessary for the extinction of cued fear conditioning and can update the memory trace with rewarding information. Closed-loop disruption of SWRs delayed but did not block extinction since 80% of animals still achieved the remission criterion, consistent with the contextual dependence of fear extinction19, although cued fear conditioning is amygdala- dependent43. Our initial hypothesis that SWRs encode contextual features of ‘safety’ during the extinction is supported by the decreased time to achieve remission but does not explain the fear reduction to CS+.SWRs encode and consolidate spatial memory and are involved in fear memory processing. Selective pre or post-training inactivation of CA3 disrupts the acquisition and consolidation of contextual fear memory by reducing the number and dominant frequency of CA1 ripples and shifting underlying CA1 ensemble activity44 indicating that during SWRs, replay, and information integration involve the contextual features of an engram and the corresponding emotional memory traces. The multiple roles of SWRs and hippocampal place cells in processing contingencies beyond spatial localization support this idea46. Thus, the SWR-triggered closed-loop MFB stimulation and the resulting reward signal coincide with the widespread ongoing brain network activity orchestrating the consolidation of fear extinction47 during SWR events. Neuronal activity in the BLA increases during SWRs49 and coordinated reactivation between the dorsal hippocampus and BLA during offline aversive memory processing peaks around the SWRs50. Therefore, the SWR-triggered closed-loop neuromodulation may provide a reward safety signal to a consolidating aversive memory51 and/or enhance the network activity that encodes fear extinction52. Since SWRs are also important in encoding context, it cannot be excluded that the enhancement shown in this study might also influence spatial or contextual learning. While we demonstrated that the closed-loop SWR-triggered MFB stimulation does not interfere with already consolidated spatial memories, revealing any effects on their acquisition or extinction may require further studies.SWRs play a critical role in establishing temporally precise ‘windows’ for integrating information across neocortical and subcortical structures. A widespread increase in neocortical activity precedes SWRs56 characterized by high temporal and neurochemical precision. This hypothesis is supported by the absence of closed-loop effect when animals are not exposed to the extinction learning. In such cases, the reward signal triggered by MFB stimulation does not coincide with extinction-contingent SWRs, which prevent the enhancement of fear attenuation.The potential mechanism underlying the closed-loop neuromodulation of SWRs and reward signaling resembles a counterconditioning process by memory updating with contrasting emotional valence57. This increase in activity has a positive correlation with extinction learning. In addition, optogenetic excitation of VTA dopaminergic neurons at the time of the US omission accelerates fear extinction58. These results suggest that dopaminergic activity during extinction encodes prediction error or mismatch between expectancies59. This system is more active during the initial phase (unexpected omission) compared to late phase (expected omission) of extinction learning58. Together our results from MFB closed-loop neuromodulation, combined with the assumption that US omission may be rewarding itself60, suggest that dopaminergic signaling plays a crucial role in the consolidation of extinction during offline states, particularly during SWRs.Interestingly, when the US is unexpectedly omitted during extinction, there is an increase in the activity of dopaminergic neurons in the VTA61. A cluster of dopaminergic neurons in the anterior VTA/SNc directly connect with CA162. A global manipulation of the reward system through MFB deep brain stimulation can ameliorate depression-like behaviors in animal models and depression symptoms in human patients63. We found that temporally precise electrical stimulation in these circuits during SWRs may scaffold the extinction enhancement. We argue for a dopamine-dependent mechanism, since previous studies have shown that MFB stimulation leads to an increase in dopamine release in BLA66 and the effects of closed-loop neuromodulation were prevented by a selective local antagonism of D2 but not D1 receptors. Moreover, our stimulation protocol was able to induce conditioned place preference.The idea that dopaminergic signaling is essential for extinction consolidation is supported by the fact that MFB fibers, which connect nodes involved in reward and emotional processing, play a critical role in this process. The VTA sends dopaminergic axons to the NAc, amygdala and PFC via the MFB67 and fear extinction can revert the enhanced activity of these neurons and decrease AMPAR expression induced by fear conditioning68. Dopamine enhances the excitability of BLA projection neurons, and D1 and D2 receptor activation increase excitability and input resistance, respectively69.Multiple lines of evidence supports that fear conditioning induces long-term potentiation of amygdala principal neurons70. Fear memories and extinction are encoded by different BLA neuronal populations. Rather than overwriting the original fear learning engrams, extinction engrams can suppress the activity of neurons that were initially engaged in fear learning. Furthermore, since neurons that mediate extinction learning also overlap with those involved in reward processing, the activation of these neurons could also signal reward20.Indeed, dopamine release in the BLA during fear learning is controlling the saliency of the footshock and the extinction through prediction error signaling of non-reinforced CS+ presentation71, supporting the idea that dopamine release is modulated by SWRs. Dopaminergic projections from VTA innervate PV+ interneurons expressing D2 receptors, contributing to the suppression of BLA principal neurons72. The suppression of feed-forward inhibition can induce LTP at excitatory afferent synapses in the BLA, an effect also mediated by D2 receptors73. Although the initial fear generalization phenotype was not evaluated after our closed-loop intervention, there is evidence that cue fear generalization is promoted by high-intensity training74 and is a limiting factor for extinction75. Generalization may be mediated by the temporal proximity between CS+ and CS-, linking memory traces by neuronal co-allocation to overlapping engrams76. Given this scenario, it is expected that closed-loop MFB stimulation would impact not only the CS+ trace but also the overlapping CS-trace. This hypothesis should be addressed in future studies.Our experimental design cannot differentiate whether post-extinction SWRs are related to the reactivation of the original fear memory or represent the consolidation of the extinction. However, increased dopamine release during SWRs could change the emotional valence of an engram replay or directly suppress neurons engaged in fear learning. Reward-responsive VTA neuronal activity is coupled to SWRs during quiet wakefulness2. Inhibition of Rac1 activity in the dHPC impairs extinction of contextual fear memories77 and photoactivation of Rac1 in the motor cortex suppresses motor learning29.Dopamine stimulation of engram cells may enhance forgetting by activating Rac1/Cofilin, which modulates actin cytoskeleton and cellular morphology77 and RAC1 activation is required for plasticity-related mechanism during fear extinction78. Since the disruption in fear attenuation was more pronounced under closed-loop stimulation, the synaptic plasticity may differ between normal and enhanced extinction. Additional work is required to determine the mechanisms of interaction between dopamine receptors and Rac1 modulation during fear extinction.Our findings suggest three sequential mechanisms underpinning closed-loop extinction enhancement: (1) SWRs reactivate the memory trace in BLA. (2) Closed-loop MFB stimulation promotes concurrent dopamine release in BLA. (3) BLA dopamine release can induce D2 receptor-mediated plasticity processes culminating in Rac1 activation. Blocking Rac1 signaling prevents spontaneous or closed-loop neuromodulation-induced fear reduction during renewal. However, Rac1 inhibition without closed-loop neuromodulation did not extend the number of sessions required for successful fear extinction using the remission criterion. This partial disruption without electrical stimulation is expected since previous studies have shown that RAC1 inhibition impairs the extinction of contextual fear memories79. It should be noted that in addition to the MFB, other components of the reward system, as the nucleus accumbens (NAc), may also be viable targets for closed-loop neuromodulation. This is supported by evidence demonstrating that NAc-DBS can elicit striatal dopamine release in humans80. Although in our experiments the detection of SWRs was invasive, alternatively, cortical slow-waves and spindles concurring with SWRs in animals82 may be detected non-invasively to align stimulation. Thus, closed-loop stimulation triggered by cortical EEG activity could replace SWRs detection. Further, non-invasive techniques  could stimulate reward-associated cortical areas instead of penetrating electrodes. Importantly, our experiments were performed in male animals only. Considering sex differences in the renewal and the context-dependence of extinction in rodents83 as well as the higher risk of women to develop anxiety-related disorder compared to men85, future experiments are needed to assess if the closed-loop neuromodulation approach can be extended to females.Our results suggest a novel translational treatment of fear-related disorders. The US Food and Drug Administration (FDA) approved MFB stimulation for treatment-resistant depression in clinical trials, with promising efficacy87, our intervention avoids the side effects of systemic treatments . Coupling between SWRs, cortical slow-waves, and spindles may offer a potential way to translate our approach towards a non-invasive therapy in the future.Our framework to study and attenuate fear-related memories relies on closed-loop stimulation guided by classical biomarkers of memory consolidation. Closed-loop stimulation can reduce the side effects from chronic and excessive stimulation of DBS approaches. Temporally precise manipulation of the reward system during SWRs overcomes the resistance to extinction in an animal model with key features of PTSD. Moreover, SWRs are critical for extinction learning. Although dopaminergic agonists can enhance fear extinctionRats  were kept in a 12-hour light/ dark cycle. All experiments were performed in accordance with the European Union guidelines (2003/65/CE) and the National Institutes of Health Guidelines for the Care and Use of Animals for Experimental Procedures. The experimental protocols were approved by the Ethical Committee for Animal Research at the Albert Szent-Györgyi Medical and Pharmaceutical Center of the University of Szeged (XIV/218/2016 and XIV/824/2021).88 targeting the anterior cingulate cortex (ACC) , bilateral BLA  and the bilateral CA1 subfield of the dorsal hippocampus . To improve DH- SWRs detection, a custom-built microdrive89 was used in some experiments, allowing the vertical adjustment over the CA1 subfield. A custom-built bipolar electrode consisting of two insulated (except 200 µm at the tip) Tungsten wires  was implanted in the left medial-forebrain bundle . LFP electrodes and the base of the microdrive were secured to the skull with dental acrylic . Two stainless-steel screws above the cerebellum served as ground and reference for the recordings, respectively. A Faraday cage was built using copper mesh and dental acrylic on the skull around the implanted electrodes.The animals were anesthetized with 2% isoflurane and craniotomies were performed according to stereotaxic coordinates. Intracortical electrode triplets In experiments involving concomitant electrophysiological recording and local pharmacological infusion, in addition to electrodes, rats were bilaterally implanted with 25-gauge guide cannulas above the BLA . Cannulae were fixed to the skull with dental acrylic (Unifast Trad). Caps were used to cover cannulae to avoid any accidental occlusion.ad libitum. All recording sessions took place in the same room using 12/12 h light/dark cycle with light onset/offset at 7 h/19 h The multiplexed signals were acquired at 500 Hz per channel for closed-loop neuromodulation experiments88. The neuronal signals were preamplified , multiplexed on head, and stored after digitalization at 20 kHz sampling rate per channel . During home cage stimulation, preamplified signals were analyzed online by a programmable digital signal processor  using a custom-made sharp-wave ripple detection algorithm, as follows.Rats were housed individually in Plexiglass home cages . LFP recordings were performed in the home cage and the fear conditioning box (see below). Recording and stimulation sessions for closed-loop or open-loop interventions were performed during the first hour following the extinction protocol. To avoid any twisting and over-tension of the recording cables, a bore-through electrical commutator  was used. Food and water were available Two LFP signals were used for real-time SWRs detection. For ripple detection, a channel from the tripolar electrodes from CA1 pyramidal layer with the largest ripple amplitude was selected and band-pass filtered (150–250 Hz), and root-mean-square (RMS) power was calculated in real-time for ripple detection. For noise detection, manual inspection from channels of the ACC, VHC, or AMY was performed to select the signal with no ripple-like activity and lower noise incidence to enhance signal-to-noise ratio during detection. In case of the ACC, signal was filtered between 80 and 500 Hz. SWRs were defined as events crossing the ripple thresholds in the absence of the noise signal. Amplitude threshold for ripple was adjusted for each animal before fear conditioning training. SWRs were defined as events crossing ripple thresholds in the absence of the noise signal in the neocortical site. Threshold crossings triggered a stimulation train lasting 100 ms and composed of fourteen 1-ms long, 100 µA square-wave pulses at 140 Hz) in the MFB or single pulse   depending on the experiment performed. MFB stimulation was performed under current mode and VHC stimulation in voltage-controlled mode. The threshold of the detection algorithm was set for each rat separately. Behavioral  effect of MFB stimulation was confirmed with a place preference task (see below).https://github.com/buzsakilab/buzcode) was employed combined with post manually corrections. Time-frequency spectrum was calculated in MATLAB using Multitaper Spectral Estimation from the Chronux Toolbox (http://chronux.org/). A 2 s sliding window with a 50% overlap, a time-bandwidth product of 5 and tapers of 3 were chosen.The offline ripples were analyzed using custom-made MATLAB  routines. Raw signals were down sampled from 20 kHz to 500 Hz and bandpass filtered in the ripple band (150–250 Hz) of hippocampal channels. Normalized squared signal was calculated. Putative SWRs events were defined as those where the beginning/end cutoffs exceeded 2 SDs and the peak power 3 SDs. The detection window was set in 150 ms. SWR duration limits were set to be between 20 and 200 ms, otherwise the events were excluded to minimize artifacts. All ripple events were drawn out for manually speculations after offline detection. The closest stimulation onset from the digital channel was selected for further analysis. Then calculated the time delay between the successfully detected ripples events and the stimulation time. For the brain states classifications (SWS/REM), SleepScoreMaster toolbox from Buzcode (The Rac1 inhibitor NSC2376 (10 µg/µl), D1 dopamine receptor antagonist SCH23390 (0.50 µg/µl), and D2 dopamine receptor antagonist sulpiride (1 µg/µl) were dissolved in sterile physiological saline (0.9% NaCl). NSC2376, SCH23390, and sulpiride were infused bilaterally into the BLA using a 33 G gauge injectors connected to Hamilton syringes via 20-gauge plastic tubes. The infusion injectors tip protruding 2.0 mm below the tip of the cannula and aimed the BLA center. A total volume of 0.5 μl per side was infused by a microinfusion pump at a rate of 0.125 μl/min. Injectors were left in place for an additional minute to ensure proper drug diffusion. All drugs were infused after the extinction sessions.The experiments were carried out in a fear conditioning apparatus comprising three contextual Plexiglas boxes  placed within a soundproof chamber. Four different contextual configurations were used (Habituation and Test Context (A): square configuration, white walls with black vertical horizontal lines, white smooth floor, washed with 70% ethanol; Training Context (B): square configuration, gray walls, metal grid on black floor, washed 30% ethanol; Extinction Context (C): rectangular configuration, white walls with black dots, white smooth floor; and Renewal and Remote/Reinstatement context (D): hybrid context comprising a square configuration, gray walls from training context, white smooth floor, washed with 70% ethanol. All sessions were controlled using a MATLAB custom script.On day 1, animals were exposed to the habituation session in context A. After 2 min of contextual habituation, they were exposed to 5 alternating presentations of two different tones . Tone time intervals were randomized (30–40 s) during the session. No behavioral differences were detected under exposition to the two frequencies.On day 2, cue fear conditioning was performed in context B. After 2 min of contextual habituation, animals received 5 trials of one tone (CS+: 7.5 kHz) immediately followed by a 2 s long footshock as unconditioned stimulus . The other tone (CS−: 2.5 kHz) was presented 5 times intermittently but never followed by the US.On day 3, animals underwent fear retrieval in context A. After 2 min of contextual habituation, rats were exposed to presentations of the CS+ or CS- in two different sessions. Each session consisted of a block of five tones. The order of the CS+ and the CS− in each session was randomized. Sessions were repeated every 4–6 h.In context C, from day 5 until reaching the remission criterion (see below), rats received extinction training consisting of twenty CS+ presentations without the US (unreinforced tones). Tones were repeated with randomized intervals (30–40 s) during the session.90. The block of the first five tones during each extinction session was assessed to determine fear reduction level of the given day. Considering individual differences under fear conditioning92 fear reduction during extinction was expressed as a fraction of the percentage of freezing expressed during the CS+ test (Day 3) (% Freezing Reduction = Freezing extinction × 100/Freezing test CS+). Fear remission was considered achieved when animals expressed <20% of the initial freezing during the first block of the day . Extinction training was repeated for maximum 7 days.We used an extinction threshold criterion to assess the efficacy of fear reduction after extinction sessions similar toTwenty-four hours or 25 days after achieving the remission, animals were exposed to context D (Hybrid context) as a renewal or remote test, respectively. In each test, rats were exposed to a block of five CS+ presentations after 2 min of contextual habituation. Time intervals between tones were randomized (30–40 s) during the session.To promote fear recovery, animals were placed in a neutral environment outside the conditioning box and received an unconditioned footshock after 30 s contextual exposition, with the same intensity used during fear conditioning. The animals were returned to their home cage 30 s following the footshock.Animals were submitted to a reinstatement test in context D 24 hours after the immediate footshock. Rats were exposed to a block of 5 CS+ presentations after 2 min of contextual habituation. Time intervals between tones were randomized during the session.Freezing behavior was used as a memory index in the fear conditioning task. Freezing was analyzed offline using Solomon software , for behavioral coding by an experienced observer that was blinded to the experimental group. Freezing was defined as the absence of all movements, except those related to breathing, while the animal was alert and awake.The conditioning box consisted of three chambers, two for the conditioning session having the same dimensions (24 × 40 × 50 cm), and the other serving as a central/start chamber (10 × 40 × 50 cm). Each chamber was employed with contextual cues and floor texture to distinguish them.Conditioned place preference test consisted of three phases: pre-conditioning (day 1), conditioning (days 2–6), and test (day 7). The pre-conditioning session (15-min) was intended to reduce novelty and determine initial preferences for any of the two chambers by assessing the time spent in each compartment. Conditioning always took place in the initially less preferred chamber. Conditioning sessions were performed during the following five days. Animals underwent two conditioning sessions each day with 6–8 h intervals between sessions. In one session, animals were placed in the initially less preferred compartment and received MFB stimulation . During the other session, the animals were placed in the opposite compartment without stimulation. The order of the sessions was randomized between animals and days. A 15 min place preference test was conducted in the absence of stimulation 24 h after the last conditioning day. The video of the animal behavior was recorded and analyzed offline using the ANY-Maze  video tracking software.Animals on food restriction (no less than 85% of their baseline weight) were habituated to the T-maze during 5 days before the training. The T-maze was constructed from black acrylic, with 80 cm long and 30 cm wide alleys and 40 cm high walls. Two removable doors closed the side alleys. During training, a light cue indicated the correct arm to receive a reward (froot-loops pellet). A total of 20 trials per day were performed until achieving 80% of correct choice. A removable door in the central arm was used to confine the animal at the starting point during cue presentation. After 3 min, the alley was removed, and the animal allowed to run in the maze. After arm selection, the alley was closed and the animal remains additional 3 min in the maze before next trial. Afterwards, fear conditioning, extinction, and stimulation sessions started. Animals were tested in the T-maze after the extinction sessions to verify any disruption of the consolidated spatial memory. Extinction and stimulation sessions and T-maze tests were separated by five hours and the order of the behavioral tasks were randomized each day.Following the termination of the experiments, animals were deeply anesthetized with 1.5 g/kg urethane (i.p.), and the recording sites of each electrode were lesioned with 100 µA anodal direct current for 10 s (Supplemental Fig. p < 0.05. Data were analyzed using two-tailed Mann–Whitney U test, Kruskal–Wallis test, or Mixed ANOVA followed by Dunn’s post hoc or Bonferroni’s multiple comparisons test. Data are expressed and visualized as median ± IQR, individual data points are also shown where applicable. Detailed statistics are shown in Supplementary Data Statistical analyses were performed using GraphPad Prism 8 software. Significance was set at Further information on research design is available in the Supplementary InformationPeer Review FileDescription of Additional Supplementary FilesSupplementary Data 1Reporting Summary"}
-{"text": "P = .0364). The score of satisfaction from residents in the RRT teaching group was significantly higher than that of the TR group . Compared with the TR teaching group, more residents thought their clinical skills have been improved  and willing to recommend their training method to others  in the RRT teaching group. However, no significant differences were observed in the incidence of postpartum hemorrhage between the 2 groups. RRT teaching is beneficial in the standardized training and teaching of residents in the delivery room. It improves the DDI of category 1 emergency cesarean section and the degree of satisfaction.Category 1 cesarean section (CS) can be a life-saving procedure when there is immediate threat to the life of the woman or fetus. However, category 1 CS is a challenge for obstetrics and gynecology residents, and it is necessary to establish an effective and straightforward teaching strategy. This study aimed to evaluate the efficiency of rapid response team (RRT) on category 1 CS teaching for obstetrics and gynecology residents in the delivery room. A total of 142 residents who underwent standardized residency training programs in the delivery room were divided into a RRT teaching group and a traditional response (TR) teaching group. In the RRT teaching group, Category 1 emergency CS teaching was started and explored by rapid response team. The training included both theoretical and practical components. After the training, decision-to-delivery interval (DDI), neonatal Apgar score, operation time and rate of postpartum hemorrhage were compared. A questionnaire on the subjective assessment of various aspects of the program was conducted at the end of the training period. The DDI in minutes in the RRT teaching group (n = 72) was significantly shorter than that of the TR teaching group (n = 70) (11.83 ± 4.16 vs 13.56 ± 5.47,  Category 1 CS is when there is immediate threat to the life of the woman or fetus, for example, suspected uterine rupture, major placental abruption, cord prolapse, fetal hypoxia or persistent fetal bradycardia. Team performance, rapid response, effective communication, critical thinking, and leadership are recommended during Category 1 CS to improve perinatal outcomes. Rapid response team (RRT) is a multidisciplinary team staffed by healthcare professionals with expertise in critical care. RRT was established and applied in Category 1 CS in Fujian Maternity and Child Health Hospital since 2015. Not surprisingly, the application of RRT improved perinatal outcomes as reported in other studies.Maternal and fetal morbidity and mortality are significant public health concerns in worldwide.Resident training is a crucial stage of progressing for a obstetrics and gynecology doctor. During this procedure, resident doctors need to preview and accept a large amount of theoretical knowledge, practice and command basic clinical skills and learn to handle kinds of severe emergency situation. Residents are important members of the delivery team and should be prepared and trained against all risks including Category 1 CS in the delivery room.However, whether RRT can be quickly mastered by residents and improve the perinatal outcomes remains to be elucidated. Therefore, this study aimed to study the perinatal outcomes of patients and explore the self-evaluation and satisfaction of residents after receiving RRT training.All residents who underwent resident standardizing training from January 2020 to January 2021 in the delivery room of Fujian Maternity and Child Health Hospital accepted traditional response (TR) teaching (n = 70) and all residents who underwent resident standardizing training from January 2021 to January 2022 in the delivery room of Fujian Maternity and Child Health Hospital accepted RRT teaching (n = 72). The theory and program of emergency CS especially Category 1 were introduced to all residents in the first week of training. Residents in TR teaching group practiced response to category 1 CS in traditional response mode that category 1 CS was launched and responded by resident-self and managed by teacher. Residents in RRT teaching group practiced response to category 1 CS in RRT mode. The composition and schematic diagram of RRT was showed in Figure Category 1 emergency CS was launched once immediate threat to the life of the woman or fetus . RRT was applied in category 1 CS in Fujian Maternity and Child Health Hospital since 2015. The policy and process of RRT had been established and refined.Baseline characteristics of all residents enrolled in the study was analyzed and compared and achieved satisfactory teaching results, which can provide a basis for promoting the clinical training teaching method of category 1 CS in the future, which is reported as follows. The outcomes of all patients who underwent category 1 CS from January 2020 to January 2021 in the delivery room of Fujian Maternity and Child Health Hospital was compared with that of all patients who underwent category 1 CS from January 2021 to January 2022.U test was used. Categorical variables were analyzed with the Chi-square test or Fisher exact probability method. All statistical analyses were performed using the Statistical Package for the Social Sciences for Windows v22.0 . Differences were considered statistically significant if P < .05.The normality of data was assessed by the Kolmogorov–Smirnov test. The categorical variables are expressed in percentages, the continuous variables with normal distribution are expressed as mean ± SD, and the nonnormally distributed continuous variables are expressed as median (quartile spacing) values. For 2 groups with continuous variables, the 2-sample independent t-test was used when each set of data was normally distributed with homogeneous variance; otherwise, the Mann–Whitney There were 70 residents in the TR group and 72 residents in the RRT group. There were no significant differences in age, gender, education and entrance examination scores between the 2 groups Table .P = .0364). However, no significant differences were observed in the neonatal Apgar score, weight of newborn and incidence of postpartum hemorrhage (PPH) between the 2 groups.After the training, there were no apparent differences in the baseline characteristics of the patients  that we included between the 2 groups  and willing to recommend their training method to others  in the RRT teaching group. However, no significant differences were observed in the incidence of PPH between the 2 groups.A total of 142 questionnaires were distributed in 2 groups and 142 were recovered, representing a 100% return rate. Before data entry, all questionnaires were checked for logic and integrity. As shown in Table Urgent situation including suspected uterine rupture, major placental abruption, cord prolapse, fetal hypoxia or persistent fetal bradycardia sometimes occurs in the delivery room. Category 1 CS can be a life-saving procedure for ABOVED life-threaten emergencies. RRT was applied in category 1 CS in Fujian Maternity and Child Health Hospital since 2015. Residents are important members of the delivery team and should be prepared against Category 1 CS in the delivery room. However, resident routine training in delivery room was in traditional response mode. Whether RRT teaching mode can be quickly mastered by residents and improve the perinatal outcomes remains unclear. Therefore, this study aimed to study the perinatal outcomes of patients and explore the self-evaluation and satisfaction of residents after application of RRT teaching in residents about Category 1 CS. The primary finding was that DDI in minutes in the RRT teaching group was shorter than that of the TR teaching group and no increase in complications. We also found that more residents thought their clinical skills had been improved, satisfy and willing to recommend RRT training method to others. However, no significant differences were observed in the incidence of PPH between the 2 groups. Take into account the condition of the woman and the unborn baby, emergency CS is categorized into 4-category. Category 1- Immediate threat to the life of the woman or fetus. Category 2 - Maternal or fetal compromise which is not immediately life-threatening. Category 3 - No maternal or fetal compromise but needs early birth. Category 4 -Birth timed to suit woman or healthcare provider. To improve maternal and neonatal outcomes, it is recommended that the time from decision of category 1 emergency CS to the birth of the baby  should be within 30 minutes.,14,15 In order to achieve the 30 minutes goal, the whole process of category 1 CS that should be performed perfectly as far as possible. Accordingly, a rapid response multidisciplinary team, including, obstetricians, anesthesiologist, pediatricians, and other related personnel was established in order to shorten the DDI for category 1 emergency CS. As some studies reported, 30 minutes goal can be achieved in this study after application of RRT.CS is the commonest major obstetric surgery and a life-saving intervention sometimes. It is divided into planed CS and emergency CS.–18However, It should be noted that category 1 emergency CS is launched against with immediate threat to life of the woman or fetus. Some studies demonstrated that short DDI could improves perinatal outcomes. Our hypothesis was that resident trainees act as front-line caregivers in delivery room and an important member during category 1 emergency CS, accept RRT teaching may short DDI. The DDI in the RRT teaching group indeed shorter. The results reflect that strengthen collaboration of residents with all related staff can short DDI. However, the incidence of PPH did not increase. This was similar to other previous studies which demonstrated that various quality improvement programs including continuous education and team training course for obstetric and related staff with emphasis on the importance of achieving the standard of 30 minutes goal, can significantly shorten DDI and other processes.This study has some limitations. First, to ensure the homogeneity of educational interventions, these data were obtained at a single teaching hospital, and validation from other institutions is needed. Second, RRT need practice again and again. So RRT teaching is time-consuming. Most resident trained in the delivery room for 2 months. Undoubtedly, this may reduce the effect of RRT training. Third, this is a case control study and if a randomized controlled trial can be performed will be better.The application of RRT teaching in the standardized teaching of residents improves the DDI of category 1 emergency cesarean section and the degree of satisfaction. We therefore recommend this teaching method.Conceptualization: Xia Xu, Ying Lin, Ling Weng, Yanni Guo, Lin Lin, Jianying Yan.Data curation: Xia Xu, Ying Lin, Ling Weng, Yanni Guo, Lin Lin, Jianying Yan.Formal analysis: Xia Xu, Ying Lin, Ling Weng, Yanni Guo, Lin Lin, Jianying Yan.Funding acquisition: Jianying Yan.Investigation: Xia Xu, Ying Lin, Ling Weng, Yanni Guo, Lin Lin, Jianying Yan.Methodology: Xia Xu, Ying Lin, Ling Weng, Yanni Guo, Lin Lin, Jianying Yan.Project administration: Xia Xu, Ying Lin, Ling Weng, Yanni Guo, Lin Lin, Jianying Yan.Resources: Xia Xu, Ying Lin, Ling Weng, Yanni Guo, Lin Lin, Jianying Yan.Software: Xia Xu, Ying Lin, Ling Weng, Yanni Guo, Lin Lin, Jianying Yan.Supervision: Xia Xu, Ying Lin, Ling Weng, Yanni Guo, Lin Lin, Jianying Yan.Validation: Xia Xu, Ying Lin, Ling Weng, Yanni Guo, Lin Lin, Jianying Yan.Visualization: Xia Xu, Ying Lin, Ling Weng, Yanni Guo, Lin Lin, Jianying Yan.Writing – original draft: Xia Xu, Ying Lin, Ling Weng, Yanni Guo, Lin Lin, Jianying Yan.Writing – review & editing: Xia Xu, Ying Lin, Ling Weng, Yanni Guo, Lin Lin, Jianying Yan."}