diff --git "a/deduped/dedup_0366.jsonl" "b/deduped/dedup_0366.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0366.jsonl"
@@ -0,0 +1,41 @@
+{"text": "Public health practitioners and researchers for many years have been attempting to understand more clearly the links between social conditions and the health of populations. Until recently, most public health professionals in English-speaking countries were unaware that their colleagues in Latin America had developed an entire field of inquiry and practice devoted to making these links more clearly understood. The Latin American Social Medicine (LASM) database finally bridges this previous gap. brings important information, originally known mostly within professional networks located in Latin American countries to public health professionals worldwide via the Internet. The LASM database uses Spanish, Portuguese, and English language trilingual, structured abstracts to summarize classic and contemporary works.This public health informatics case study describes the key features of a unique information resource intended to improve access to LASM literature and to augment understanding about the social determinants of health. This case study includes both quantitative and qualitative evaluation data. Currently the LASM database at The University of New Mexico This database provides helpful information for public health professionals on the social determinants of health and expands access to LASM. Public health practitioners have long recognized the connections between patients' socioeconomic conditions and their health -8. Yet tAmerican Journal of Public Health that focused on LASM [Until recently, however, most of the knowledge base in this discipline has remained largely unknown outside Latin America. Language barriers and disincentives to distribute this information more widely are two major reasons for this lack of awareness. Some readers might have first learned about Latin American social medicine (LASM) through recent critical reviews  or throu on LASM ,11.LASM traces its historic origins to European researchers such as Rudolf Virchow and the belief systems of indigenous cultures. Both the European and indigenous sources of current social medicine practices emphasized the importance of linking social conditions to health status. Contemporary social medicine in Latin America continues to emphasize these linkages between social conditions and the health of populations. Social medicine professionals participate in a wide array of settings in Latin America and represent diverse specialties. Their integration into healthcare systems has varied by era and country .Innovative approaches to disseminating work in LASM have become increasingly available due to Internet technology. The project \"Enhanced Access for Latin American Social Medicine\" at The University of New Mexico with funding from the U.S. National Library of Medicine seeks to make information on the connections between social conditions and health problems available to a wide audience. The project has sought to bridge the prior information gap primarily through delivering structured abstracts of social medicine publications in Spanish, English, and Portuguese via the Internet on the LASM database beginning in 2001. Other goals of this project include: publishing full text social medicine electronic journals on behalf of medical societies in Latin America; and, maintaining a repository for key classic and contemporary social medicine publications.Structured abstracts are posted in three languages in the LASM database at The University of New Mexico for both the classic and contemporary social medicine literatures. The first phase of this project involved preparing and posting the structured abstracts of 25 landmark books, 50 book chapters, and 100 journal articles from the classic social medicine literature in Spanish, Portuguese, and English.A peer selection committee identified and agreed upon the specific selections of classic books, book chapters, and journal articles to be abstracted for this project. Table The contemporary literature summarized in the LASM database has been drawn primarily from the 12 journals currently or previously published in Latin America. Table Sa\u00fade em Debate (Brazil) and SaluCo Bulletin (Cuba), are available from the host website. The host website also posts structured abstracts of important articles from these full text journals.As a pilot, the project has made two social medicine journals available in electronic full text format. Several issues of these journals, The LASM database encompasses several broad themes within LASM. Subject areas include the history, theories, methodologies, and organizational dimensions of social medicine. Other subjects pertain to institutional analysis, social/critical epidemiology, and strategic planning. Table The LASM database is a web application developed using the Cold Fusion application server. The data are stored in a Microsoft SQLServer relational database. The data sources are the original Latin American publications, which are summarized in Spanish, Portuguese, and English languages in structured abstract format. The English-language structured abstracts are quality checked by the principal investigator, who reviews the abstracts for substantive content, and then by the librarian investigator who reviews the structured abstracts for final quality assurance purposes. Each record contains fields for author, title , place of publication, publisher and structured abstracts in each language. Records contain volume, number, and pagination when applicable. All records contain terms the from Medical Subject Headings (MeSH) system, a controlled vocabulary developed and maintained by the National Library of Medicine. Users can search the database on controlled fields of author, title, and MeSH terms in any of the three available languages. Full text abstract searching is also available. In addition to the abstract searching facilities, the LASM database can be browsed alphabetically by title. The browsing interface offers a convenient way to become familiar with the extent and diversity of the LASM literature.From January 2002 through December 2003, a total of 17, 853 visits were made to the website hosting the LASM database. The largest numbers of visits in descending rank order originated from Brazil, Mexico, Argentina, Spain, and Colombia. A preliminary, qualitative evaluation has been favorable. Following completion of this project, we will conduct and publish a comprehensive summative evaluation. A total of 250 structured abstracts in Spanish, Portuguese, and English had been posted to the LASM database as of June 30, 2004. The host website presents more detailed information about this project, as well as the structured abstracts themselves.The LASM database comprises a dynamic and searchable web application containing structured abstracts in English, Portuguese, and Spanish. It is designed using industry standard web application design principles, but its content is unique to the LASM domain.A database searching design and utility problem unique to the LASM database, and other web applications like it, relates to the problem of web-based multilingual searching. Widely available search engines cannot preprocess a multilingual language translation of search terms (e.g. retrieving results containing the Spanish word \"p\u00fablica\" for the English search term \"public\"). Additionally, search engines do not recognize that the unaccented \"publica\" (as it might be entered by an English speaker as a search string) might be the same word as the Spanish accented \"p\u00fablica\" and therefore will not return the user's expected search result. Key combinations and modifiers that are used to create special and accented characters in word processing programs like Microsoft Word often do not work in browser based search and form fields. Our primary instruction to users for constructing search terms containing special and accented characters  suggests that they use a separate text editor that accepts keyboard modifiers to construct special and accented characters to build the search term and then copy and paste the completed search string into the field. On our search pages we also list common special and accented characters in Spanish and Portuguese that users can copy and paste into browser based search fields.Although there are no other alternatives for entering special and accented characters into browser form fields, both methodologies are somewhat cumbersome. Therefore, to improve the searching utility of the LASM database we also preprocess entered search strings to allow the search engine to perform selected character substitution on the entered search string and attempt to solve the accented character problem from the search engine side. All search strings are first passed through a regular expression routine, which substitutes single character search engine wildcards for the following characters: A, E, I, O, U, a, e, i, o, u, N, C, n, c. This effectively removes potential special and accented character misspellings. To return to the previous example, a user might enter the search string \"publica\" (\"public\" in English) in a search field as an attempt to find article titles that contain the Spanish or Portuguese word \"p\u00fablica\". Properly spelled, \"P\u00fablica\" uses the accented character \"\u00fa\" rather than \"u\" (ASCII 163 rather than ASCII 117). Unfortunately, current search engines are not intelligent enough to infer that \"p\u00fablica\" is a match for the search string \"publica\". Therefore, the literal search for publica (unaccented) will not return any search results that contain \"p\u00fablica\" although there are hundreds of instances of the word \"p\u00fablica\" in the LASM database.In the case of \"publica\", the preprocessed search string that is finally submitted to the search engine is \"p*bl***\". The search engine will return all seven-letter word matches that contain the letters p, b, and l in the first, third, and fourth positions respectively. The net effect of this technique is to under-specify the search result. That is, the search engine may possibly return records that contain other words that happen coincidentally to match the submitted search string. On the other hand, the returned result set can be guaranteed to contain the desired search result.Problems created from under-specifying the search are limited based on experience gained from using this technique. The positional constraints of submitted characters within the search string generally are restrictive enough to prevent most problems. Specifically, within a limited domain search surface like the LASM database, the likelihood of the occurrence of most alternative word matches is very low.The character substitution methodology described here is not perfect, and many other alternative strategies for addressing the multilingual search problem have been explored by LASM technical staff. Most of the alternative strategies considered, however, involved much higher costs in terms of acquiring or developing specialized search engine capabilities or much higher abstract preparation costs. Therefore, we chose the character substitution strategy as a compromise between implementation cost and search utility.Internet technology via websites and web browsers has created numerous opportunities for public health colleagues to inform one another and to collaborate across wide geographic space. The LASM database clearly demonstrates the efficacy of the Internet for communicating its informative structured abstracts posted in the Spanish, Portuguese, and English languages. This database provides useful information that would otherwise be unavailable for public health professionals on the social determinants of health. Furthermore, it expands access to LASM through its inclusion of both the classic and contemporary literature.. As the data reported above indicate, the LASM database already has been accessed steadily since its initial small-scale publicity began in 2002. We hope that public health readers will utilize the LASM database to improve their research, teaching, and practice.Anyone with access to the World Wide Web and a web browser can access all structured abstracts in the LASM database Neither the authors nor any support personnel possess competing interests related to the LASM database or to this article's publication.JE conceived of and wrote the initial version of this article, served as an early collaborator on and helped design the project, was responsible as an investigator for acquiring journals for the Latin American social medicine collection, provided quality assurance editing on structured abstracts, played a major role in the formative evaluation of the project, and coordinated all revisions to this article. HW initiated and designed the project, served as principal investigator, obtained funding, translated and edited abstracts in the English-language, and edited this manuscript. HSB served as co-principal Investigator, helped design this project, obtained funding, and led the effort for the formative evaluation of this project. JT helped administer the project and edited this manuscript. CI coordinated the project, wrote Spanish-language structured abstracts, and provided reference materials for this article. KW and JT developed all programming aspects of the website including the search strategies, managed the web interface and underlying database and contributed the text for portions of this article.The pre-publication history for this paper can be accessed here:"}
+{"text": "Web-based searching is the accepted contemporary mode of retrieving relevant literature, and retrieving as many full text articles as possible is a typical prerequisite for research success. In most cases only a proportion of references will be directly accessible as digital reprints through displayed links. A large number of references, however, have to be verified in library catalogues and, depending on their availability, are accessible as print holdings or by interlibrary loan request.The problem of verifying local print holdings from an initial retrieval set of citations can be solved using Z39.50, an ANSI protocol for interactively querying library information systems. Numerous systems include Z39.50 interfaces and therefore can process Z39.50 interactive requests. However, the programmed query interaction command structure is non-intuitive and inaccessible to the average biomedical researcher. For the typical user, it is necessary to implement the protocol within a tool that hides and handles Z39.50 syntax, presenting a comfortable user interface.PMD2HD is a web tool implementing Z39.50 to provide an appropriately functional and usable interface to integrate into the typical workflow that follows an initial PubMed literature search, providing users with an immediate asset to assist in the most tedious step in literature retrieval, checking for subscription holdings against a local online catalogue.PMD2HD can facilitate literature access considerably with respect to the time and cost of manual comparisons of search results with local catalogue holdings. The example presented in this article is related to the library system and collections of the German Cancer Research Centre. However, the PMD2HD software architecture and use of common Z39.50 protocol commands allow for transfer to a broad range of scientific libraries using Z39.50-compatible library information systems. The mainstream realm of biosciences research is comprised, from the bibliographic point of view, within the accumulated indexing efforts of the United States National Library of Medicine (NLM). The PubMed  databaseA subsequent research working step is acquisition of relevant article full texts that lack direct linking. The individual and institutional subscription situation will provide several common alternatives, such as a local library print or e-journal holding confirmed through the local catalogue. A final resort may be a time-consuming and costly loan request.The web tool PMD2HD  has beenIn the scenario envisioned for the use of PMD2HD, a researcher will can carry out a PubMed search as usual, finishing by marking  the complete results web page with the shortcut command control-a (Windows\u2122) and copying it with control-c into the clipboard Figure . This w. A fundaPMD2HD is written in PHP , a very Z39.50 ,9 is an If the catalogue system finds an entry for a requested ISSN, it returns all information about this entry as a record that is structured according to USMARC. One of the record items is the holding record of the journal subscription. Next, the web tool checks if the publication year of the article is in the Library's journal holding range. If so, the catalogue database is queried again via Z39.50 to get all information for this journal.One drawback in universal applicability of this Z39.50 method is that some ejournals do not conform to an ISSN search, and occasionally a journal name lookup in the online catalogue is necessary. However, a Z39.50 journal name query is not performed by a string matching search. Instead, all names a journal has ever had, including name changes, are returned to the web tool and have to be parsed. Finally, a results page is generated showing all the data that have been collected in the two preceding steps. As PMD2HD prepares a unified list of articles with respect to both electronic and print holdings of local libraries, it can therefore be regarded as efficient tool that reduces the number of manual user actions for list collection and holding verification.The PMD2HD results page Figure  combines1. If the PubMed entry contains a DOI , a direc2. The holding record of the respective print medium provided from the local library system is provided.3. A link to the related ejournal is provided.4. An indication 'Online?' is shown when the web tool cannot fetch an ejournal address from the online catalogue. This advises the user to check the bibliographic data manually when the stored names for the print journal and the ejournal are not exactly the same.5. A link to the loan request web form. If the holding record of a print journal or an ejournal link is found, a link to the loan request page is not necessary.For the link to the loan request page, the article data is filled in automatically from the retrieved data fields, and the users only have to enter their names, email addresses and local account number Figure . The ISSPMD2HD is an easy-to-use web-based tool offering a usable interface and direct integration into the workflow of a typical PubMed search task. PMD2HD has also directed the Z39.50 search protocol for citation verification purposes directly at the library catalogue. PMD2HD unifies two different technical principles of data transmission, the connection-oriented Z39.50 and the non-connection client-server hypertext transmission (HTTP) data exchange. PMD2HD provides data storage that connectionless protocols cannot in terms of storing session parameters or preliminary results. Using the dedicated protocol Z39.50 overcomes the problem of inconsistencies in query languages, data format, and display styles that would ordinarily hinder a web tool's interactivity with a local library management system.PMD2HD, with small modifications, could be further adapted for library systems with support for the Z39.50 interface, particularly focused scientific libraries and collections. In fact, the PMD2HD application could expand beyond local application to perform a cascading sequence of subsequent transactions, scalable either to a formal network of libraries or the individual needs of scientists who have access to several libraries. The common denominator requirement for alternative implementation is Z.39.50 support. Preliminary investigation in Germany demonstrated that there are two large library networks and four important libraries, including 'Die Deutsche Bibliothek', offering access via Z39.50. Examples all over the world include BIBSYS, the Library of Congress and numerous university libraries, and CURL (Consortium of University Research Libraries) in UK . A test How does PMD2HD  compare Optimal benefit from PubMed literature retrieval can only be achieved when as many relevant articles as possible can be acquired in full text form as quickly as possible. PMD2HD has been created as a Web-accessible tool to perform this task on the library collection of the German Cancer Research Centre. PMD2HD helps scientists to obtain literature as fast and effortlessly as possible, and besides it saves time and money for unnecessary interlibrary loan transactions. PMD2HD can be implemented with other integrated library systems or used for retrieval within a network of federated libraries, as its underlying protocol Z39.50 is very widespread among scientific libraries. Use of Z39.50 prevents retrieval failure due to incompatibilities of query syntax and result display forms.ANSI American National Standards InstituteBIBSYS A consortium for all Norwegian University Libraries, the National Library and a number of college and research libraries.CURL Consortium of University Research LibrariesDOI Digital Object IdentifierHTTP Hypertext Transmission ProtocolID IdentificationISSN International Standard Serial NumberIP Internet ProtocolNLM National Library of MedicinePMID PubMed IdentificationUSMARC US Machine-Readable CataloguingXML Extensible Markup LanguageProject name: PMD2HD \u2022 Project home page: \u2022 Operating system(s): Platform independent\u2022 Type of software: Web-service\u2022 Programming language at server side: PHP 4 [\u2022 e: PHP 4 Other requirements at server side: Apache web server [\u2022 b server , PHP-Yazb server Requirements at client side: standard web-browser\u2022 License: free access\u2022 Any restrictions: The access in the presented form is only useful for users of the local library.\u2022 The author(s) declare that they have no competing interests.AL developed the web tool, EL participated in its design, co-ordination and in writing the manuscript, AT programmed the Z39.50 module with a configuration to the local library system."}
+{"text": "VEGF gene and PDR. Moreover, it was hoped to determine whether serum and vitreous levels of VEGF are affected by genetic factors.In proliferative diabetic retinopathy (PDR) and other angiogenesis-associated diseases, increased levels of cytokines, inflammatory cells, growth factors, and angiogenic factors are present. Vascular endothelial growth factor (VEGF) appears to play a central role in mediating microvascular pathology in PDR. The purpose of the present study was to search for the association between the \u2013634 C/G polymorphism of the This cross-sectional case-control study enrolled 349 unrelated Slovene subjects (Caucasians) with type 2 diabetes mellitus. The case group consisted of 206 patients with an advanced form of PDR and for whom vitrectomy was performed, and the control group had 143 patients who had no clinical signs of diabetic retinopathy but did have type 2 diabetes of more than 10 years duration. To analyze the genotype distribution we had to compare the genotype frequencies in diabetics with PDR  and diabetics without diabetic retinopathy . Additionally, to evaluate the effect of diabetes on the VEGF serum levels 2 groups, diabetics and non diabetics, were compared. First group were diabetics , and second group were 29 subjects without diabetes.VEGF polymorphism was not associated with PDR. Mean serum and vitreous levels of VEGF were statistically significantly higher in PDR in comparison to the control group. Moreover, significantly higher serum and vitreous levels of VEGF were demonstrated in diabetics with the CC genotype compared to those with the other (CG + GG) genotypes.The \u2013634 C/G VEGF polymorphism on serum and vitreous levels of VEGF in PDR, it failed to contribute to the genetic susceptibility to PDR.VEGF is an important cytokine in PDR. Despite the effect of the \u2013634 C/G  VEGF 634 C/G (rs2010963) polymorphism in the 5\u2032-untranslated region has been reported to be associated with variations in VEGF serum concentrations and with a susceptibility to disorders, such as diabetic retinopathy, diabetic nephropathy, and cardiovascular diseases [In proliferative diabetic retinopathy (PDR) and other angiogenesis-associated diseases, increased levels of cytokines, inflammatory cells, growth factors, and angiogenic factors are present -5. Vascudiseases ,10-13.VEGF on PDR in a Slovenian population (Caucasians) with type 2 diabetes, we searched for the association between the -634 C/G VEGF polymorphism and PDR in subjects with type 2 diabetes. Moreover, the aim of the study was to determine the serum and vitreous levels of VEGF of patients with PDR, and whether serum and vitreous levels of VEGF are affected by genetic factors.To investigate the impact of genetic polymorphisms of This cross-sectional case-control study enrolled 349  unrelated Slovene subjects (Caucasians) with type 2 diabetes mellitus who had a defined ophthalmologic status. Patients were classified as having type 2 diabetes according to the current American Diabetes Association criteria for the diagnosis and classification of diabetes . PatientThe study group consisted of 206 patients with an advanced form of PDR (new vessel formation as well as fibrous proliferation with or without vitreous hemorrhage) in whom vitrectomy was indicated and performed due to vitreous hemorrhage, macular detachment, or macular threatening detachment. The control group consisted of 143 patients who had type 2 diabetes of more than 10 years duration but had no clinical signs of diabetic retinopathy.In 68 out of 206 patients with PDR (71 eyes) 0.3 ml vitreous fluid samples were obtained by vitreoretinal surgery. The study excluded patients who had previous vitrectomy, neovascularization of no diabetic etiology, recent vitreous hemorrhage (less than two months), or a history of ocular inflammation and photocoagulation in the preceding three months.Macular edema was defined as being clinically significant based on observations rendered by the Early Treatment Diabetic Retinopathy Study . PDR wasFasting serum VEGF levels were analyzed in 104 out 206 of patients with PDR and in 29 patients without diabetes. Vitreous fluid samples (0.3\u00a0ml) were obtained by vitreoretinal surgery  from 71 eyes of 68 consecutive patients with PDR, and from 17 eyes of 17 consecutive nondiabetic patients in whom vitrectomy was performed because of idiopatic macular hole [20, 1 \u03bcl 5% DMSO, 0,5 unit of AmliTaq Gold DNA-polymerase (Applied Biosystems). Cycling parameters were as follows: 3 min 94 \u00b0C for primary denaturation, followed by 30 cycles of 1 minute 94 \u00b0C and 1 minute 59 \u00b0C, 1 minute 72 \u00b0C. After digestion for 16 hours at 65 \u00b0C by 1 unit of the restriction enzyme BsmFI, the restriction products were electrophoresed on a 2.0% agarose gel and then visualized using ethidium bromide staining. The -634G allele result in the gain of a BsmFI site. Two investigators , blinded for case or control status of the DNA sample, performed the genotype classification.The \u2013634 C/G VEGF polymorphism was evaluated as described previously . GenotypFor the determination of fasting serum VEGF concentration (isoform VEGF 165), we used a solid phase sandwich ELISA, which involved two kinds of highly specific antibodies . In our study the respective coefficient of variation  were between 3 and 5.5 for interassay measurements, and between 2.6 and 5.3 for intraassay measurements.The vitreous VEGF concentration was determined with the cytometric bead array method . The samples were collected in sterile tubes, rapidly frozen and then stored at \u201380 C until analyzed. VEGF concentrations were measured using CBA (BD Biosciences). The VEGF capture beads were mixed with phycoerythrin \u2013 conjugated detection antibodies. These capture beads were incubated with recombinant standards or test samples (vitreous) to form sandwich complexes. Two-color flow cytometric analysis was performed using a FACSCalibur flow cytometer (BD Biosciences). Data were acquired and analyzed using Becton Dickinson Cytometric Bead Array CBA software, and concentrations were determined from the standard curves, plotting recombinant calibrator concentration versus FL-2 mean fluorescence intensity.The use of this method made it possible to detect two of the four VEGF isoforms (VEGF 121 and VEGF 165).t-test as appropriate. The \u03c72 test was used to compare discrete variables and to compare genotype distributions. In addition, all variables that showed significant differences by univariate methods  were analyzed together in a logistic regression analysis. Statistical analysis was performed using the SPSS program for Windows version 14 .We used a nonparametric Mann\u2013Whitney test and Kruskal\u2013Wallis test for multiple group comparison or the Student The characteristics of the cases and control subjects are listed in 2=1.21, p=0.27; \u2013634 C/G: controls \u03c72=0.29, p=0.59). The \u2013634 C/G VEGF polymorphism was not associated with PDR in a group of Caucasian subjects with type 2 diabetes  plus the VEGF polymorphism were analyzed together in a logistic regression analysis. In the logistic regression model  the CC genotype of the VEGF polymorphism was not an independent risk factor for PDR (The variables that showed significant differences by \u03c7 for PDR .Fasting serum VEGF levels in 104 PDR patients (55.3\u00b125.1 ng/l) were significantly higher from those of 29 controls without diabetes . To analyze the genotype distribution we had to compare the genotype frequencies in diabetics with PDR  and diabetics without diabetic retinopathy . However, to evaluate the effect of diabetes on the VEGF serum levels 2 groups, diabetics and non-diabetics, were compared. First group were diabetics , and second group were 29 subjects without diabetes.Moreover, we found significantly higher VEGF serum levels in 24 PDR patients with the CC genotype (60.4\u00b132.1 ng/l) compared to 80 PDR patients with the other (CG + GG) genotypes ; 24 PDR patients with the CC genotype did not differ in clinical parameters  from 80 PDR patients with the other genotypes (data not shown).We failed, however, to demonstrate statistically significant differences in fasting serum VEGF levels between patients with macular edema (62.1\u00b139.1 ng/l ) and patients without macular edema . Moreover, we failed to demonstrate statistically significant differences in fasting serum VEGF levels between patients with active neovascularization (56.3\u00b141.8 ng/l ) and patients without active neovascularization Vitreous VEGF levels were analyzed in 71 eyes of 68 patients with PDR, and from 17 eyes of 17 patients without diabetes in whom vitrectomy was performed due to idiopatic macular hole [Vitreous VEGF levels were significantly higher in 12 eyes from 12 patients with the CC genotype (6061.52\u00b15341.69 pg/ml ) compared to 59 eyes from 56 subjects with the other (CG + GG) genotypes ; 12 PDR eyes from 12 PDR patients with the CC genotype did not differ in clinical parameters  from 59 PDR eyes from 56 patients with the other genotypes (data not shown).Macular edema was present in 37 out of 71 eyes with PDR. Significantly higher vitreous VEGF levels were demonstrated in the eyes with macular edema (6567.96\u00b15780.66 pg/ml) compared to 34 eyes without macular edema .Additionally, we wanted to compare vitreous VEGF levels between active stage of PDR (54 eyes out of 71 in whom vitrectomy was performed) and inactive stage of PDR (17 eyes out of 71 in whom vitrectomy was performed). Statistically significant differences between active (n=54) and inactive stages (n=17) of PDR were demonstrated in vitreous levels of VEGF .The extent of laser photocoagulation was related to the vitreous level of VEGF. In the group of 13 eyes with no laser photocoagulation (7541.46\u00b16323.89 pg/ml), the VEGF level was significantly higher compared to the group of 32 eyes with incomplete photocoagulation (6631.64\u00b15543.10 pg/ml) or the group of 26 eyes with photocoagulation in all four quadrants .VEGF \u2013634 C/G polymorphism as a potential genetic marker of PDR. The VEGF \u2013634 C/G polymorphism was not associated with PDR in a group of Caucasians with type 2 diabetes. In accordance with our study, Awata and coworkers [VEGF \u2013634 C/G polymorphism and PDR, but they reported an association with diabetic retinopathy. They compared 70 Japanese patients with PDR (22.9% ) to 118 Japanese diabetics without diabetic retinopathy (10.3%), and they failed to demonstrate a statistically significant difference (p=0.081) in the frequency of the CC genotype [VEGF C-634G polymorphism is a genetic risk factor for diabetic macular edema as well as diabetic retinopathy.In our study we analyzed the oworkers  failed tgenotype  comparedgenotype  have recVEGF \u2013634 C/G polymorphism). We analyzed fasting serum VEGF levels in 104 PDR patients and found significantly higher VEGF serum levels in 24 patietns with the CC genotype compared to 80 patients with the other (CG + GG) genotypes. The VEGF \u2013634 C/G polymorphism is most probably a functional polymorphism, since significantly higher VEGF serum levels have also been reported in healthy subjects with the CC genotype of the C(\u2013634)G polymorphism compared to those with the other genotypes [VEGF expression at both transcriptional and translational levels [VEGF gene polymorphism) influence serum VEGF levels [Serum VEGF levels were found to be affected by genetic factors (the l levels . AdditioF levels .VEGF \u2013634 C/G polymorphism) and by local factors in the eyes (extent of laser photocoagulation). Vitreous VEGF levels were affected by the VEGF \u2013634 C/G polymorphism. Vitreous VEGF levels were significantly higher in 12 PDR patients with the CC genotype compared to 56 PDR patients with the other (CG + GG) genotypes. In our study as well as in other studies it was demonstrated that in PDR the extent of laser photocoagulation significantly affects VEGF level [In our study, vitreous VEGF levels were found to be affected by genetic factors .VEGF is an important mediator in pathogenesis of diabetic retinopathy ,13,18,22VEGF \u2013634 C/G polymorphism on serum and vitreous levels of VEGF in PDR, we found the VEGF \u2013634 C/G polymorphism failed to contribute to the genetic susceptibility to PDR.In conclusion, VEGF is an important cytokine in PDR. The serum and vitreous VEGF levels were statistically higher in PDR eyes in comparison to the control group. Despite the effect of the"}
+{"text": "Grain yield is a key economic driver of successful wheat production. Due to its complex nature, little is known regarding its genetic control. The goal of this study was to identify important quantitative trait loci (QTL) directly and indirectly affecting grain yield using doubled haploid lines derived from a cross between Hanxuan 10 and Lumai 14.a), epistatic main effects (aa) and their environment interaction effects (ae and aae) by using composite interval mapping in a mixed linear model.Ten yield-associated traits, including yield per plant (YP), number of spikes per plant (NSP), number of grains per spike (NGS), one-thousand grain weight (TGW), total number of spikelets per spike (TNSS), number of sterile spikelets per spike (NSSS), proportion of fertile spikelets per spike (PFSS), spike length (SL), density of spikelets per spike (DSS) and plant height (PH), were assessed across 14 (for YP) to 23 (for TGW) year \u00d7 location \u00d7 water regime environments in China. Then, the genetic effects were partitioned into additive main effects (Twelve (YP) to 33 (PH) QTLs were identified on all 21 chromosomes except 6D. QTLs were more frequently observed on chromosomes 1B, 2B, 2D, 5A and 6B, and were concentrated in a few regions on individual chromosomes, exemplified by three striking yield-related QTL clusters on chromosomes 2B, 1B and 4B that explained the correlations between YP and other traits. The additive main-effect QTLs contributed more phenotypic variation than the epistasis and environmental interaction. Consistent with agronomic analyses, a group of progeny derived by selecting TGW and NGS, with higher grain yield, had an increased frequency of QTL for high YP, NGS, TGW, TNSS, PFSS, SL, PH and fewer NSSS, when compared to low yielding progeny. This indicated that it is feasible by marker-assisted selection to facilitate wheat production. Triticum aestivum L.) is one of the most important crops in the world. Grain yield is the most important economic trait in wheat improvement. Being the final product of many processes, it is directly and multilaterally determined by yield-component traits, such as number of spikes per plant (NSP), number of grains per spike (NGS), one-thousand grain weight (TGW), and indirectly affected by other yield-related traits, e.g. plant architecture. Yield and yield associated traits are complex quantitative traits controlled by multiple genes and are highly influenced by environmental conditions Wheat (Quantitative trait locus (QTL) analysis has provided an effective way to dissect complicated quantitative traits into component loci and to study their individual effects on a specific trait Drought is one of the most severe constraints to wheat production. Owing to increasing water shortages and uneven distribution of rainfall, it has become an increasingly important problem a), epistatic main effects (aa) and their environment interaction effects , the purpose of this study was to utilize the Hanxuan 10\u00d7 Lumai 14 doubled haploid population to examine the genetic control of yield and yield-associated traits under different water-related conditions.Based on the mixed linear model In the majority of environments Hanxuan 10 was significantly taller (PH 77.00\u2013132.75 cm) and had more spikes (NSP 5.01\u201311.27), shorter spikes (SL 5.77\u20138.98 cm), denser spikelets (DSS 1.93\u20132.43), and fewer grains (NGS 23.94\u201338.65) than Lumai 14 , File S1*\u20130.52****), whereas there were negative correlations of YP with NSSS (\u22120.22**) and DSS (\u22120.19*) . There were also significant negative correlations among NSP, NGS and TGW, between NSP and PFSS and PH, between NGS and NSSS, and between TGW and DSS, TNSS and PFSS.For most environments, YP was significantly correlated with all traits, for example, positive correlations were observed between YP and NSP, NGS, TGW, TNSS, PFSS, SL, and PH (0.16(\u22120.19*) . A positP<0.0001) (YP) to 123.49 (P<0.0001) (PH) and for environments 245.66 (P<0.0001) (DSS) to 910.44 (P<0.0001) (TNSS). When ANOVA analysis for all traits was performed to determine the significances of differences between genotypes, between year \u00d7 location (YL) combinations, between water regimes, and between two-factor combinations of genotypes, YL combinations and water regimes, it was clear that water regimes had a large effect on PH and NSP, but did not significantly affect NSSS and DSS. YL had large effects on YP, NGS, TGW, NSSS, PFSS, SL and DSS. The role of water regimes on TNSS was in line with YL  whereas the 4B cluster involved six traits   on chromosomes other than 3D and 6D . QTLs co and SL) .a effects, and 50.0% (YP) to 97.0% (PH) of QTLs were involved in significant aa effects  was involved in epistatic interactions with background loci, whereas the majority (51.9% for TNSS - 100.0% for NSP) of loci involved in epistatic interactions did not appear to have significant additive effects  to 66.7% (YP) of QTLs were identified with significant  effects . Of the  effects . The a e of loci . Of the ut 50.0% . This sua effect of a single QTL for an individual trait was equal to or more than the aa effect of a single epistasis, and the mean phenotypic variation explained due to the a effect exceeded that of aa effect ), cp05T  and cp06C ), and for YP, NP, NGS, TGW, NSSS and PFSS, 11.8% (TGW) - 83.3% (NSP) of epistatic pairs were subjected to aae effects in one to three of the 11 environments  - 76.9% (TGW) of additive QTLs were involved in ronments .ae effects, even the absolute value of the ae effect of a single QTL for NSP, NGS, TGW, TNSS, SL and PH appeared less than the a effect, but for YP, PFSS and NSSS the ae effects were greater than the a effects  and fp99C , indicating it was induced by the environment. Thus, the additive effects for YP, PFSS and NSSS were readily affected by environments. In addition, owing to ae effects, Hanxuan 10 possessed alleles increasing YP, NSP, NGS, TGW, TNSS, PFSS, SL, and PH, and decreasing NSSS at one to six QTLs in one to three drought stressed environments, suggesting that these QTLs might adapt well to drought conditions , QTNSS.cgb-2D.1 in ly99T , fp99T  and fy01T, QPH.cgb-6B.6 in fp00T and fy01T, and QTGW.cgb-6B in ly99T, fp99T and fy01T. However, some QTLs controlling NSP, NGS, TGW, TNSS, SL and PH with a effects contributed far more phenotypic variation than ae effects (a effects (3.1%\u201338.0%) of all traits contributed more than ae effect (0.2%\u20134.1%) (Among additive QTLs involved in  effects . QNSSS.cnditions . For exa effects . They we2%\u20134.1%) .aae effects, generally the averaged absolute value of the aae effects detected for epistatic QTL pairs were larger than their aa effects, indicating that these epistatic pairs of YP, NSP, NGS, TGW, NSSS and PFSS were highly sensitive to environments  accounted for more phenotypic variation than aae effects (0.4%\u20132.1%) for all traits except YP (For epistatic QTLs involved in ronments . Epistaty little . In addixcept YP .P<0.05) - 28.05 (P<0.0001) respectively (Among four categories of progeny lines (high TGW and high NGS group (Hgw_Hgn), high TGW but low NGS group (Hgw_Lgn), low TGW but high NGS group (Lgw_Hgn) and low TGW and low NGS group (Lgw_Lgn)), significant differences occurred for all traits except YP, their F-values were 2.99 , NSP (one QTL), NGS (two of four QTL), TGW (one of six QTL), TNSS (four of six QTL), PFSS (two of four QTL), SL (two of four QTL), DSS (one of three QTL) and PH (one QTL), and reduced NSSS (three QTL from Lumai 14) . Of thesGrain yield is a major goal for the improvement of wheat in drought-prone areas a effects), additive \u00d7 additive epistatic main effects (aa effects) and their environmental interaction effects . To date, the majority of QTL studies in wheat have not examined interactions  a effects, aa effects and environmental interaction effects (ae and/or aae), except for density of spikelets per spike (DSS) where no QTL \u00d7 environment interaction effects (QE effects) were detected  was small relative to that from a effects (3.1%\u201351.5%) for each trait investigated . Several desirable QTLs detected under year \u00d7 location \u00d7 drought stress (DS) combination, such as QNGS.cgb-2B, QTNSS.cgb-2D.1 and QPH.cgb-6B.6, were identified with the consistent effects in the same year \u00d7 location combinations under DS. But no QTL by water regime interactions were detected under the same YL combination, except that one QTL controlling YP on 2D (near Xwmc 453.1) was detected with negative ae effect (\u22120.57***) in hd99 . This indicated that water treatment contributed little to environmental variation in our study. The actual contributions of ae and/or aae interactions were small compared to a effects , vernalization gene (Vrn) and photoperiod sensitivity gene (Ppd) have been the focus of yield breeding for many years as a means to reduce the height of the crop and to better adapt to their environments by flowering at the appropriate time Ppd-B1, 2D with Ppd-D1 and Rht8, and 4B with the green revolution gene Rht1 in our study. Ppd-B1 has been mapped 6.6 cM distal of Xgwm429 on 2B, and Ppd-D1 14.4 cM proximal of Xgwm261 near Rht8 on 2D Rht1 was mapped near marker Xgwm165.1 on 4B It is well-known that the reduced height gene  involving QTLs for NSP, TGW and PH with strong a effects, which appears to be new.Additionally, corresponding with the location of the vernalisation gene per se is a complex trait with low heritability, breeding high yielding wheat cultivars by direct selection for yield has generally been slow Because yield QTL analysis showed that though yield-associated traits were subjected to additive main effects, epistatic main effects and their environmental modifications, the additive main-effect QTLs were the major genetic component. All chromosomes except 6D were observed with QTLs controlling yield-associated traits, but among different chromosomes QTLs were non-randomly distributed. A great number of QTLs were located on chromosome 1B, 2B, 2D, 5A and 6B. QTL cluster was another general characteristic of QTL distribution strikingly delegated by three yield-related QTL clusters on 1B, 2B and 4B which accounted for the correlations between YP and other traits well. Twenty six major QTLs with large phenotypic variation explained (PVE) could be the targets for marker assisted selection in wheat improvement. A small group high-yielding progeny was derived by selecting two major yield components TGW and NGS, which was rich in QTLs for higher YP, NGS, TGW, TNSS, PFSS, SL, PH and fewer NSSS than the low yielding progeny, indicating the potential of marker-assisted selection to facilitate wheat production later.We have obtained the relevant permission for our field studies for growing the DH population and parents in three locations in China over 1 year from the corresponding institutions. They are the Luoyang Academy of Agricultural Sciences in Luoyang (ly) Henan, the Northwest Agriculture & Forest University in Fuping (fp) Shaanxi, and the Institute of Crop Science, Shanxi Academy of Agricultural Sciences in Fenyang (fy) Shanxi.1 hybrid of Hanxuan 10 and Lumai 14, two Chinese common wheat cultivars A doubled haploid population of 150 lines was developed by microspore culture from the FThe DH population and parents were grown in five locations in China over 1, 2 and 7 years providing data for 12 year-location combinations . The fiv3/ha four times: at the pre-overwintering, jointing, flowering and grain filling stages, respectively. All the DH lines, along with the parents were planted in Haidian (Beijing) in two-row plots with a length of 2 m and 30 cm spacing, whereas all lines were grown in four-row plots with a length of 4 m and 30 cm spacing in other locations. The field management followed standard agricultural practices. A total of 24 environments of year \u00d7 location \u00d7 treatments combination were investigated.In each year-location combination (YL), two water regimes were applied as drought stressed (DS) and well-watered (WW). DS treatments were represented by rain-fed conditions. The rainfalls are shown in At maturity, five plants in the middle of each plot were randomly sampled for analysis. Eight traits , includiStatistical analysis was implemented using the SAS V8.0 statistics package . Pearson's correlation coefficients between pairs of traits were determined for each year \u00d7 location \u00d7 water regime environments and mean environment using the \u2018proc corr\u2019 procedure. The ANOVA-general linear model (GLM) analysis was performed to determine the significances of differences between DH line genotypes and between year \u00d7 location \u00d7 water regime environments. The broad sense heritability of each trait was determined as the ratio of genotypic variance to the sum of the genotypic and environmental variances. To further reveal the contribution of water treatment to phenotypic variation, ANOVA-GLM was carried out to determine the significances of differences between the genotypes, between year-location combinations, between water regimes, and between two-factor combinations (two-factor interactions) for genotypes, year-location combinations and water regimes. Year-location combination was considered as a separate factor because the two factors are not orthogonal (some years have only one location and vice versa).k-th DH line in environment h (hky) can be expressed as the following:\u03bc is the population mean; ia and ja are the additive effects (fixed effects) of two putative loci iQ and jQ, respectively; ijaa is the additive \u00d7 additive epistatic effect (fixed effect) between the two loci; h with a coefficient iQ (or jQ); f nested within the h-th environment with a coefficient l-th marker \u00d7 marker interaction nested within the h-th environment with a coefficient The available genetic linkage map, established from the 150 DH lines using MAPMAKER/Exp version 3.0 software under Kosambis mapping function, consisted of 395 marker loci (132 amplified fragment length polymorphisms (AFLP) and 263 simple sequence repeats (SSR)) covering 3,904 cM with an average distance of 9.9 cM between adjacent markers a) and additive \u00d7 additive epistatic genetic effects (aa) and their interactions with environment (ae and aae). In such a model, all possible pairs of markers were tested.Composite interval analysis was carried out using forward-backward stepwise, multiple linear regression with a probability into and out of the model of 0.05 and a window size set at 10 cM. Significant thresholds for QTL detection were calculated for each dataset using 1,000 permutations and a genome-wide error rate of 0.05. The final genetic model incorporated significant main additive (QTL frequency was estimated for different traits in 41 high-yielding lines (25% selection intensity), including having either high TGW and high NGS (Hgw_Hgn) (four lines), high TGW but low NGS (Hgw_Lgn) (thirteen lines), low TGW but high NGS (Lgw_Hgn) (fifteen lines), or low TGW and low NGS (Lgw_Lgn) (nine lines) as described in Rattey et al. (2009) File S1Phenotypic values of yield-associated traits in the wheat parents and DH Lines in different environments.(DOC)Click here for additional data file.File S2QTLs affecting yield-associated traits of wheat in different environments. This is the original QTL mapping results for ten yield-associated traits of wheat in more than 14 year \u00d7 location \u00d7 water regime environments.(DOC)Click here for additional data file."}
+{"text": "Opioids are extremely effective in managing cancer pain, and now are utilized for longer periods of time in cancer patients as the treatment for malignancies has become more successful. The goal2 There is a significant variability in terminology utilized in research and clinical practice; and terms can lead to clinicians confusing pharmacological phenomena with abuse and addiction. MaladaptTolerance is a \u201cpharmacological property defined by the need for increasing doses to maintain the effect of the agent\u201d. In cancePhysical dependence is defined as the occurrence of a withdrawal after abrupt dose reduction or an administration of an agonist.The DSM IV criteria for substance abuse and substance dependence provide definitions for maladaptive patterns of substance abuse, where the defining factor is compulsive drug seeking behavior.252The phenomena of \u201copioid seeking\u201d may be seen when someone is experience unrelenting unrelieved pain and this is not be confused with substance dependence.6The administration of an opioid antagonist or a mixed agonist\u2013antagonist to person who has physical dependence will precipitate a withdrawal syndrome. Opioid wThere have been several studies exploring the prevalence of opioid addiction in medical illness. The most notable was the Boston Collaborative surveillance project, which only identified 4 cases of addiction out of 11,882 inpatients prescribed opioids. The rate12de novo substance abuse or addiction when opioids are used for appropriate medical indications, is extremely low if no personal or family history or abuse or addiction or significant premorbid psychiatric disorder exists.Opioids used to manage cancer pain for patients with no prior history of substance abuse or addiction, is rarely associated with new onset of substance disorder.7\u20139 The cPolicies need to be in place to allow secure storage of opioid medication stock, maintenance of records and stock registers and judicious prescribing by appropriately trained clinicians. There arClinicians need to be adequately trained in pain management, and the prescription and monitoring of opioid therapy; and have a responsibility to provide education to the patient and their family about their safe use, and adverse effect monitoring. A comprehensive history and assessment is needed prior to the commencement of opioid therapy, and attention to specific risks such as family history or significant premorbid psychiatric conditions. Equally People with a history of abuse of opioids may develop cancer and associated pain syndromes; which in some cases may require opioid therapy for adequate relief. In the a1In the setting that an aberrant drug related behavior is identified, a comprehensive assessment and interpretation of these behaviors needs to be undertaken to determine the underlying cause, from a range of differential diagnoses. The requ"}
+{"text": "Testicular morphology and immunohistochemical studies have never been reported in genetically documented adult patients with 5 alpha-reductase type 2 deficiency (5\u03b1-R2 deficiency).SRD5A2 gene.We also performed an immunohistochemical analysis in order to further study the relationship between seminiferous tubules structure, Sertoli cell differentiation and androgenic signaling impairment in this case. We thus evaluated the testicular expression of the anti-M\u00fcllerian hormone (AMH), androgen receptor (AR) and 3\u03b2-hydroxysteroid dehydrogenase (3\u03b2HSD). Histological analysis revealed a heterogeneous aspect with a majority (92%) of seminiferous tubules (ST) presenting a mature aspect but containing only Sertoli cells and devoid of germ cells and spermatogenesis. Focal areas of immature ST (8%) were also found. Testicular AR and 3\u03b2HSD expression were detected in adult male control, 5\u03b1-R2 deficiency and CAIS subjects. However, AMH expression was heterogeneous  in the 5\u03b1-R2 deficiency, conversely to normal adult testis in which AMH was uniformly repressed and to an adult CAIS testis in which AMH was uniformly and strongly expressed.We describe the testicular histopathology of a 17-year-old XY subject with 5\u03b1-R2 deficiency caused by the recurrent homozygous Gly115Asp loss of function mutation of the Intratesticular testosterone can repress AMH by itself, independently of its metabolism into dihydrotestosterone. We also compare our results to the few post pubertal cases of 5\u03b1-R2 deficiency with available histological testicular description, reported in the literature. We will discuss these histological findings, in the more general context of evaluating the fertility potential of these patients if they were raised as males and were azoospermic. LHCGR), 17\u03b2 hydroxysteroid dehydrogenase deficiency type 3, related to mutations of the HSD17B3 gene and loss of function mutations of the SRD5A2 gene, responsible for 5\u03b1-reductase type 2deficiencywhich is one of the three 5\u03b1-reductase isoforms expressed in humans [AR) mutations have been identified in patients with mild, partial or complete androgen insensitivity syndromes (AIS) [The 46, XY disorders of sex development (DSD) are presently classified in three main categories : disordeAIS have variable phenotypic presentations, mainly related to the severity of the deleterious effects of AR mutations. Indeed, subjects with complete androgen insensitivity (CAIS) present as girls and women with feminine aspect of external genitalia but with absent pubic hair, blind ending vagina and uterine agenesis. In partial androgen insensitivity syndrome (PAIS) phenotypes, there are varying degrees of masculinization, ranging from perineoscrotal hypospadias to minor forms of male infertility, more or less associated with gynecomastia, undervirilization, hypotrophic gonads and micropenis .5\u03b1-R2 deficiency phenotype is also variable, ranging from a complete female phenotype at birth to a more or less complete virilization of genitalia . In girlIn both pubertal and adult subjects with CAIS and 5\u03b1-R2 deficiency, very few studies of testicular histology showed severely altered spermatogenesis ,5. The sAn interesting cellular marker of Sertoli cells, used for the evaluation of the androgen signaling within seminiferous tubules is the anti-M\u00fcllerian hormone (AMH). AMH expression is usually recognized as a marker of differentiation of Sertoli cells and considered to be negatively regulated by androgens at puberty and adulthood ,8.The first objective of this work was to evaluate the contribution of testicular testosterone versus its 5\u03b1-reduced metabolite, dihydrotestosterone (DHT), on AMH repression after puberty and its relation with spermatogenesis. We, therefore, compared the testicular morphology, as well as the AR and AMH expression in a postpubertal case of genetically demonstrated 5\u03b1-R2 deficiency with that of a postpubertal case of CAIS. We also compared our findings to published data describing the histological testicular features of post pubertal individuals considered to be 5\u03b1-R2 deficient, but in which the diagnosis was not genetically confirmed. Finally, we discuss the testicular histological findings in the more general context of the fertility potential of these patients in adult life, if they were assigned to a male gender.SRD5A2 gene . The residual 5\u03b1-reductase type 2 activity in cells transfected with this mutant was of less than 0.2% [The testicular samples of the 5\u03b1-R2 deficiency patient were obtained immediately after the bilateral gonadectomy performed when she was 17-years-old. The patient was a post-pubertal XY female with primary amenorrhea, failure of pubertal breast development and virilization, clitoromegaly and bilateral cryptorchidism, with testes located in the inguinal canals. This phenotype was related to a recurrent , homozyghan 0.2%  The detahan 0.2% .AR gene. This recurrent, loss of function mutation , has already been reported in several CAIS patients [We comparatively analyzed the testicular histological aspect of this case with those of a CAIS and in a man with obstructive azoospermia but normal testicular spermatogenesis (see below). The CAIS patient was an 18-year-old, XY female, with primary amenorrhea  and absent axillary and pubic hair and high testosterone (19\u00a0ng/mL) and AMH (170 pmol/L) levels. On clinical and ultrasound examinations were observed a blind ending vagina, absent uterus and bilateral cryptorchidism . In this patient, the diagnosis of CAIS was confirmed by the identification of a missense mutation in the exon 5 of the patients  and its patients .The testicular sample, used as a normal control, was obtained from a 29-year-old patient, with normal testosterone and gonadotropin levels  undergoing testicular biopsy for obstructive azoospermia. Indeed, for ethical reasons, it was not possible to perform testicular biopsies in healthy men. However, as already reported, more than 86% of patients with obstructive azoospermia present normal spermatogenesis on testicular biopsies . For thiAll subjects gave their informed written consent to allow the study of testicular samples. This study was approved by the corresponding local ethics committees and was in accordance with the French Bioethics law No.2004-800. All paraffin samples from the three patients were studied by the pathologist (SF), without knowledge of the underlying conditions. For each sample, testicular morphology was assessed on haematoxylin-eosin staining, followed by immunohistochemical analysis for the expression and localization of AR, AMH and 3\u03b2-hydroxysteroid dehydrogenase (3\u03b2HSD). The immunohistochemistry techniques used were previously reported in detail -15. Immu3) and morphology. Macroscopically, both testes of the patient with 5\u03b1-R2 deficiency exhibited a similar hypotrophic aspect. Thus, the left testis had a 6\u00a0cm3 volume and weighted 7\u00a0g while the right testis volume was 7\u00a0cm3 and weighted 7\u00a0g. The testicular samples of the patient with CAIS obtained after bilateral gonadectomy, exhibited similar size (11 and 9\u00a0cm3) and macroscopic aspect than the 5\u03b1-R2 deficiency patient\u2019s testis.The adult testicular samples used as a control, were harvested from testes with intrascrotal localization, presenting normal volume . The deleterious character of this recurrent mutation was clearly demonstrated by Wigley et al. [SRD5A2 gene analysis [Herein, we report the histological and immunohistochemical testicular analysis of a posptubertal patient with 5\u03b1-R2 deficiency; the diagnostic was considered in front of the clinical presentation, associated with a high T/DHT ratio, and confirmed by the genetic analysis, which revealed a homozyguous missense mutation in the y et al.  who showanalysis -25.Overall, histological features in those postpubertal patients with 5\u03b1-R2 deficiency seem to be rather heterogeneous, varying from complete lack of spermatogenesis to apparently normal spermatogenesis Table\u00a0.The histological analysis of the testicular samples obtained from our patient revealed a heterogeneous aspect with a wide majority of seminiferous tubules presenting a mature aspect but a severely altered spermatogenesis, and containing only Sertoli cells. In a minority of seminiferous tubules of prepubertal appearance, where Sertoli cells exhibited a pseudostratified distribution, few germ cells were identified. Overall, the histological aspect of our patient\u2019s testicular samples was similar to that described by Steger et al. , in threHistological analysis of the testicular samples of the 5\u03b1-R2 deficiency patient reported here also revealed an oncocytic transformation of Sertoli cell cytoplasm in very few seminiferous tubules. This minoritary peculiar histological feature is similar to that described in several infertile subjects .The pathSimilarly, Leydig cell hyperplasia has been already reported in CAIS postpubertal patients , or in mThe immunohistochemical analysis also revealed that in our patient, the androgen receptor (AR) was expressed in all three testicular compartments , suggesting the possibility of a global cellular response to the intratesticular testosterone in this case of 5\u03b1-R2 deficiency. Most notably, AR was expressed in 92% of the seminiferous tubules, namely in those with a mature aspect. However, AR expression was below detectable levels in 8% of the seminiferous tubules, specifically those with an immature aspect. Along this line, it is worth noting that AMH immunodetection was rather heterogeneous, as previously reported in a case of 5\u03b1-R2 deficiency with \u201cSertoli cell only\u201d histology ,8, suppoIn our patient with 5 alpha-Reductase type 2 Deficiency, serum AMH level was within normal range for postpubertal male as reported in few cases with this condition . This coSRD5A2 gene mutation severity and the presence of spermatozoa still remains an unsolved question, opening further studies with regards to the prognostic and risk stratification in relation with the severity of the enzymatic defect.Identification of various spermatogenesis stages in patients with 5\u03b1-R2 deficiency is of importance in the context of sex assignment and fertility preservation. Indeed, due to recent progress in the assisted reproduction techniques, successful results with testicular sperm extraction (TESE) and intracytoplasmic sperm injection (ICSI) are now reported in azoospermic patients, either with androgen insensitivity  or with Written informed consent was obtained from the patient with 5\u03b1-R2 deficiency, as well as from both the CAIS patient and the individual with obstructive azoospermia, for genetic and histological analyses and for publication of this case report and the accompanying images. Copies of written consents are available upon request for review by the Journal Editor.5\u03b1-R2 deficiency: 5\u03b1-reductase type 2 deficiency; AIS: Androgen insensitivity syndromes; AMH: Anti-M\u00fcllerian hormone; AR: Androgen receptor; 3\u03b2HSD: 3\u03b2-hydroxysteroid dehydrogenase; TESE: Testicular sperm extraction; ICSI: Intracytoplasmic sperm injection.The authors declare that they have no competing interests.LV, ML and JY led the conception and design, acquisition of data, review of literature, and drafted the manuscript. HBG and DP critically reviewed the manuscript. SF, IAA and GB provided the paraffin embedded samples and advised on the pathology pictures. All authors read and approved the manuscript.LV is PhD student at INSERM-Paris Sud Research Unit U693 and assistant at Department of Biophysics and Nuclear Medecine at Bic\u00eatre Hospital, France. ML is head of the INSERM-Paris Sud Research Unit U693, France. JY is Professor of Endocrinology at Universit\u00e9 Paris-Sud and Medical practitioner at the Department of Reproductive Endocrinology, Bic\u00eatre Hospital, France.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1472-6823/14/43/prepub"}
+{"text": "Toward the end of his career, Zewail developed strong interest in fast electron spectroscopy and imaging, a field to which he made important contributions toward his aim of making molecular movies free of radiation damage. We therefore compare here the atomistic mechanisms leading to destruction of protein samples in diffract-and-destroy experiments for the cases of high-energy electron beam irradiation and X-ray laser pulses. The damage processes and their time-scales are compared and relevant elastic, inelastic, and photoelectron cross sections are given. Inelastic mean-free paths for ejected electrons at very low energies in insulators are compared with the bioparticle size. The dose rate and structural damage rate for electrons are found to be much lower, allowing longer pulses, reduced beam current, and Coulomb interactions for the formation of smaller probes. High-angle electron scattering from the nucleus, which has no parallel in the X-ray case, tracks the slowly moving nuclei during the explosion, just as the gain of the XFEL (X-ray free-electron laser) has no parallel in the electron case. Despite reduced damage and much larger elastic scattering cross sections in the electron case, leading to not dissimilar elastic scattering rates (when account is taken of the greatly increased incident XFEL fluence), progress for single-particle electron diffraction is seen to depend on the effort to reduce emittance growth due to Coulomb interactions, and so allow formation of intense sub-micron beams no larger than a virus. I.Zewail's remarkable career, establishing the field of femtochemistry, is described elsewhere in this volume. I first encountered his work in the late 1990s when his interests turned to pump-probe fast electron diffraction experiments, motivated, as he told me, by the strength of the electron interaction with matter. This resulted in a series of visits to his labs and much stimulating discussion with him and his excellent group working on fast electron diffraction. And it was a stimulating experience to edit an early draft of his book with Thomas on fast electron microscopy . After tin the correct thermal bath in which molecular machines must operate. They are made possible by the ability of femtosecond pulses to out-run the effects of radiation damage, using pulses as brief as 10 fs or less, as discussed below. A few provisos are needed, however, to clarify the widely used jargon in this field for a wider audience. \u201cMolecular movies\u201d in this context are mainly obtained from time-resolved diffraction data, which, when obtained from microcrystals (in order to provide atomic resolution), require ensemble-averaging effects to be disentangled.  \u201cOutrunning damage\u201d usually refers to the elimination of secondary \u201cimpact ionization,\u201d not the immediate \u201celectronic damage\u201d due to the ionization of a small fraction of the atoms in a microcrystal in the first ten femtoseconds, while \u201cnear-physiological\u201d conditions recognizes that the volatile buffer used for crystallization is not identical to the cytoplasm in which many proteins function within a cell.Recently, we have seen the first publication of \u201cmolecular movies\u201d from hydrated proteins with atomic resolution and femtosecond time resolution. The reaction is triggered by light , together with his use of few-electron pulses (and very high repetition rate) in order to minimize Coulomb interactions, has produced a growing body of research. A major advance also occurred with the development of the dynamic transmission electron microscope instrument at Lawrence Livermore Laboratories around 2006 see , where tThe second group works with MeV electron linear accelerator (LINAC)  for electron diffraction (II.A.fX(q) (the Fourier Transform of the atomic charge density) as  making it extremely sensitive to the form of the chemical bonds between atoms . The electron-nuclear scattering is the basis of the high-angle annular-detector dark field (HAADF) imaging method in scanning transmission electron microscopy (STEM), where only these electrons, due to the first term on the right-hand side of Eq. Because of the orthogonality of initial and final atomic electron states in the Bethe scattering theory , inelastsity) as d\u03c3d\u03a9=4\u03b322\u27e9 is a temperature factor, with\u2009\u27e8u2\u27e9\u2009the mean-squared atomic vibration amplitude. This diffuse scattering is seen in individual XFEL snapshots, via the ergodic theorem, and is also present in crystals consisting of molecules with displacive disorder, as discussed below (The multiphonon diffuse scattering due to atomic vibration (in an Einstein model) which develops initially during fast intense electron irradiation is given by d\u03c3d\u03a9=4\u03b32At large scattering angles, the electronic X-ray scattering term in Eq. Since the electron velocity rapidly approaches a limit, neither this cross section, nor that for inelastic scattering from atomic electrons (with similar beam energy dependence) vary much with beam energy above 1\u2009MeV. Increased beam energy cannot therefore be used to discriminate against unwanted background due to inelastic electron scattering and the resulting radiation damage; however, it does allow the use of thicker samples, since it delays the onset of multiple elastic scattering perturbations.B.The electron charge and mass produce fundamentally distinct interactions from the X-ray beam case. As with X-rays, however, strong electric fields and resulting forces from the tube of charge surrounding the electron beam are known to displace atoms in insulators, unlike metals where rapid screening occurs, minimizing damage . ElectroK (measured from the vacuum level) and the electron affinity \u03d5\u0391 is less than the band gap cannot lose any energy to electronic processes, and so can be expected to have a long IMFP. [This is because the maximum amount of energy (EK\u2009+\u2009\u03a6A) which the electron can lose is insufficient to promote an electron across the gap.] This situation may obtain for some phases of ice, which has a large bandgap and small affinity.The measurement and theoretical treatment of IMFP for electrons at these very low energies involves many complexities and becomes highly dependent on the electronic structure of the sample. Not all inelastic scattering events result in damage in the sense of an irreversible displacement of the nucleus, which, unlike X-rays, scatters an electron beam. [At higher energies the well-established \u201cuniversal curve\u201d used in surface science can be used (The radiology community has recently devoted considerable effort to the measurement of the electron IMFP at few-eV energies by the LEET (low energy electron transmission) method, in which an organic layer is added to a metal substrate in which electrons are photoexcited by X-ray photo-electron spectroscopy and ultraviolet photoelectron spectroscopy. The electron transmission through the film is measured as a function of film thickness using an electron spectrometer. (The films are evidently not hydrated.) The aim is to understand the damage mechanisms of low energy electrons, since it has been discovered , where the fading of outer Bragg spots can be timed for a given dose. Since insulating solids retain charge, making them unsuitable as LEED samples, few results have been published for organic films; however, work on thin coronene and ethane films on a conductive substrate at 50\u2009eV indicates that the results are highly materials specific . Aromatid\u2009=\u2009j \u03c3d/|e| for current density j. The cross section \u03c3d \u223c 133b for carbon at 0.5\u2009MeV  \u0394E, giving the amount of energy deposited in the sample by inelastic processes (such as the photoelectric effect) per unit elastic scattering, was found to strongly favor electrons  over X-rays  . The cross sections are given for 0.1\u2009MeV electrons  and for 8\u2009kV photons. Re is approximately independent of beam energy, while RX varies strongly with beam energy as processes other than the photoelectric effect (Compton and Auger) become important. This result (Re \u226a RX) reflects the very large photoelectric cross section for X-rays relative to that for coherent X-ray scattering, and the large average amount of energy \u0394E dumped as a result. For XFEL diffraction from submicron protein nanocrystals , however, most photoelectrons escape from the sample rather than depositing their energy in it, whereas the much shorter inelastic mean free path for the few-eV electrons excited by an electron beam is less likely to escape. Thus, the fraction of energy deposited in the sample by ejected electrons can provide an important point of comparison, in addition to the Bragg boost discussed below, both of which depend on the microcrystal size. The value of Rx should be compared to an elastic-to-inelastic scattering ratio for electrons nearer unity, a much larger elastic scattering cross section, and more modest amount of energy deposited per inelastic event. In protein crystallography, over 98% of 12\u2009kV photons pass through a typical crystal without interaction. Of the remaining 2%, 84% are annihilated in production of photoelectrons, 8% are scattered by the Compton process, and 8% are Bragg scattered. By comparison, in rough qualitative terms, for 0.5\u2009MeV electrons, a low atomic number sample thickness of a micron may see the direct beam reduced to negligible intensity by elastic and inelastic scattering processes of comparable strength in the sample. Cryo-em samples for \u201csingle-particle\u201d full-field imaging typically consist of large macromolecules, perhaps 4\u201320\u2009nm in size, embedded within a slab of vitreous ice about 60\u2009nm thick, illuminated by a collimated coherent beam of 0.4\u2009MeV electrons.From the beginning, radiation damage has limited resolution in practically all forms of microscopy and diffractive imaging. Historically, the assumption has always been made that the radiation dose needed to image one isolated molecule using any form of long-lived radiation  would destroy it . In an iThree factors, however, favor X-rays: (i) The source properties must be considered, and, despite the high brightness and coherence of field-emission electron sources, the new free-electron X-ray lasers (EXFEL) have gain (perhaps five or six orders of magnitude), not present in electron accelerators. (ii) X-rays which have excited photoelectrons are annihilated, unlike fast electrons, which can lose any amount of energy in the sample, after which they continue to the detector to create a large background, not seen in X-ray work.  The X-ray diffraction patterns therefore generally show much less background than unfiltered electron diffraction patterns. (iii) The onset of multiple elastic scattering, requiring the use of samples tens of nanometers thick in TEM (thinner than a cell), is not limiting in hard X-ray studies.Favoring TEM are the existence of high-resolution electron lenses for direct imaging (avoiding the phase problem) and the evident recent dramatic successes of the Cryo-em method with new detectors [see 6 electrons in a 100 fs pulse into a 500 \u03bcm diameter spot with 5\u2009\u00d7\u200910\u22125 radian beam divergence . This is similar performance to the SLAC ultrafast electron diffraction machine , if background is not limiting. The use of much higher beam energies, where electric and magnetic forces within the beam tend to cancel, is a field of active research. Simulations  and unwanted additional energy spread  in the beam. While these effects are negligible at the current densities used in conventional TEM  with its continuous (CW) coherent electron beam, they become limiting when attempting to pack large numbers of electrons into sub-ps electron pulses focussed to micron or smaller dimensions in a linear accelerator (LINAC). The transverse emittance (loosely the product of source size and emission angle) and time resolution of X-rays, and the electron beams which generate them, are linked through the resonance condition required for X-ray \u201clasing\u201d or gain, in the Self-Amplified Spontaneous Emission (SASE) mode .  time as they pass through focus at higher energy. This provides the incentive for the use of higher energy beams in order to form smaller focused probes. Research into methods for emittance control is an active field of research .The issues involved in formation of nanometer-diameter coherent hard X-ray beams, using various forms of X-ray optics, are extensively covered in the literature  when using pulses which terminate before the onset of significant damage.In protein crystallography, a \u201ccritical dose\u201d of 30 MGy (1 Gy\u2009=\u20091 J/kg) is defined as the maximum tolerable for cryo-cooled samples. A dose of 1 MGy heats water from RT to a final temperature of 208\u2009K, while the typical 1 GGy dose from an XFEL pulse eventually generates a plasma at 2\u2009\u00d7\u200910pe I per atom for incident photon flux I. The subsequent electronic relaxation generates, in most cases, a second Auger electron  from each ionization event. The carbon K hole lifetime, which controls the Auger line-widths and Auger electron emission rate per atom, is 11 fs. These electrons generate further ionization as they leave the particle, or may thermalize before doing so. For a 6\u2009kV beam energy, the photoelectron has a mean-free path of 15\u2009nm and thermalizes in 10 fs, producing about 240 additional ionizations, 19 of which are inner-shell. If they leave the particle, photoelectrons may return to the increasingly positively charged particle at later times. The photoelectron cascade has been analyzed in detail using both plasma and molecular dynamics algorithms, in which atoms change to ions with a given ionization probability and lifetime as time progresses, and the photoelectron cascade is tracked in Monte-Carlo simulation. For a 40 fs pulse at 1.8\u2009keV, 10% of carbon atoms are ionized if the incident beam has irradiance 1017\u2009W/cm\u22122, corresponding to about 1\u2009\u00d7\u20091012 photons/pulse in a 7 \u03bcm spot. Figure \u22122) is about 0.9 (using 2\u2009kV X-rays incident on protein). The RMS displacement of an atom is less than 0.1\u2009nm at the end of a 50 fs pulse, as simulated using the modified Gromax molecular dynamics code  flux, \u0394E the energy deposited per interaction with cross section \u03c3in, particle density \u03c1, thickness T, and particle mass M. For our 3\u2009MeV accelerator example above (with same beam and virus size) compared to 8\u2009kV X-rays, find that the electron dose rate  is 10\u22124 times that for X-rays.The X-ray and electron methods may also be compared by estimating the time until a certain critical amount of energy has been deposited in the sample. The dose rate  is D\u2009=\u2009IV.This discussion has assumed particle-counting detectors, which have only very recently become a possibility for XFEL work\u2014for the more common integrating detector the detected signal depends on the product of particle number and energy deposited in the detector, with different efficiencies for high-energy electrons and photons. Our analysis is also not accurate for the analysis of coherent phase-contrast imaging, where contrast depends on scattering amplitudes, not cross-sections, and increases steadily at least up to 5\u2009MeV see .12 incident hard X-rays per pulse (compared with about 1\u2009\u00d7\u2009106 electrons from a 3\u2009MeV electron gun), the gain of the XFEL laser then compensates for the reduced amount of elastic X-ray scattering relative to that from an electron beam. Yet the dose rate is far lower for electrons, allowing longer pulses prior to damage, which thereby reduces beam current and Coulomb interactions. If the time-scale for damage is set by the critical dose, then a much longer pulse at lower beam current could be used in the example given above  secondary electrons than high energy (8\u2009kV) photoelectrons generated by the X-ray beam, while, in the absence of energy-filtering, the electron beam generates a larger background than the X-rays, due mainly to beam electrons which have lost energy exciting secondary  electrons. For a SASE-mode XFEL supplying 1\u2009\u00d7\u200910\u03bcm in diameter). Such a small beam (with zero impact parameter for each shot!) will be required to provide sufficient elastic scattering for 3D image-formation.Success with electron beams is seen to lie mainly with the accelerator physics community, in the battle against the emittance growth which prevents the formation of intense submicron electron beams of comparable size to a biological target, such as a virus (perhaps 0.1"}
+{"text": "After multi-pass rolling and intermittent annealing at 550\u2009\u00b0C for 300\u2009s, the obtained UFG-1 steel showed an average ferrite grain size of ~430\u2009nm, containing nanoscale spheroidized cementite (Fe3C) particles with an average size of ~70\u2009nm. On annealing at 600\u2009\u00b0C for 300\u2009s, the average size of ferritic grains was increased to ~680\u2009nm and the average size of spheroidized Fe3C particles increased to ~90\u2009nm, referred as UFG-2 steel. Tensile tests indicated that UFG-1 steel had high yield strength (\u03c3y) of 1260\u2009MPa, and ultimate tensile strength (\u03c3UTS) of 1400\u2009MPa. These values are higher than that of UFG-2 steel (\u03c3y\u2009=\u20091080\u2009MPa and \u03c3UTS\u2009=\u20091200\u2009MPa), suggesting that the strengthening contribution is a cumulative effect of decrease in ferrite grain size and nanoscale cementite. The incoherent interfaces between nanosized particles and the matrix acted as a strong barrier to dislocation motion. The study underscores that nanosized precipitates not only provide strength but also contribute to ductility, which is very encouraging for improving the ductility of medium-carbon steels.We describe here innovative processing of low alloy medium-carbon steel with a duplex microstructure composed of nanoscale spheroidized cementite (Fe Materials processed by these methods are characterized by a microstructure mainly consisting of ultrafine grains (UFG) that increases hardness and strength. Grain refinement of steels results in a decrease of ductile-to-brittle transition temperature9.Metals and alloys produced by severe plastic deformation (SPD) techniques such as equal channel angular pressing (ECAP)10. The spheroidized microstructure consisting of plate-type lamellar cementite and ferrite matrix provides lower hardness but higher ductility than the pearlite microstructure11. On the other hand, spheroidized carbide particles embedded in ferrite matrix contribute to high ductility13. The superior ductility and low hardness of the spheroidized microstructure play an important role in the subsequent cold forming of low-carbon steels.Grain refinement may not improve the ductility of UFG materials, but inherently poor ductility can be improved by second phase particles, through accumulation of geometrically necessary dislocations around the particles16. However, the application of these steels is limited by their poor ductility at high strength level18. Several studies on the fracture of D6AC steel have been conducted20. Mechanical properties of D6AC may change considerably when the impact of the subsequent annealing treatment is reduced23. To improve the ductility and formability of steels, a typical heat-treatment process for D6AC steel that has been suggested is quenching from a high austenitic temperature to room temperature, followed by conventional tempering11. This process can be referred as spheroidization treatment, because spheroidized carbide particles  are expected to be uniformly distributed in the ferrite matrix. These spheroidized Fe3C particles have a potential to improve the ductility of this class of steels. The spheroidized microstructure is formed at an appropriate temperature when the time for carbon diffusion reaction is adequate. However, the spheroidization of cementite can influence the mechanical properties of steels, such as leading to a reduction in hardness with slightly improved ductility. This is because the spherical cementite is softer than the lamellar counterpart25. The microstructure consisting of spheroidized cementite particles in an ultrafine ferrite matrix can be obtained through conventional cold or warm rolling plus subsequent annealing in low-carbon steels26. While the processing route and mechanical properties of ultrafine-grained steels have been previously reported, corresponding studies on medium-carbon steels have rarely been conducted because of difficulties experienced in controlling the microstructure during spheroidization annealing. First, the rate of spheroidization is influenced by carbon diffusion in ferrite. Second, the addition of a strong carbide forming element such as Ti, V, and Nb decreases the diffusivity of carbon in ferrite, such that the spheroidization reaction becomes slow. Third, the small cementite particles grow or coalesce to minimize the total interfacial surface area at a given temperature, resulting in coarse particles11. Lastly, the spheroidization process is related to the matrix and phase composition that are determined by hot rolling parameters including rolling temperature, number of passes, strain rate, etc.The D6AC steel belongs to medium-carbon steels with low alloying content. The carbon content is in the range of 0.42\u20130.48\u2009wt.% together with other alloying elements in accordance to ASTM standard 6431 . This group of steels has high strength and large yield-to-tensile strength ratio, and consequently is widely used as pressure vessels, aerospace and defense components3C particles on the mechanical properties of low-alloyed steel. To accomplish the objectives and to elucidate the relationship between structure and mechanical properties, uniaxial tensile tests together with post-mortem transmission electron microscopy (TEM) was carried out. The study provides new insights into the micromechanisms contributing to work hardening of HSLA steels. It is expected that the present study is beneficial in the design of medium- and high-carbon steels with nanosized composite structures.The objective of the study described here is threefold: (i) To spheroidize cementite to nanoscale in a high strength low-alloy (HSLA) steel of chemical composition, Fe-1.05Cr-1.01Mo-0.73Mn-0.61Ni-0.17Si-0.09V-0.43C (wt.%) through an innovative process. (ii) To refine the ferrite matrix to ultrafine-grained regime. (iii) To quantify the effect of nanoscale Fe3 was cast. The chemical composition of the alloy, measured by inductively coupled plasma mass spectroscopy was as follows: 1.05Cr, 1.01Mo, 0.73Mn, 0.61Ni, 0.17Si, 0.09\u2009V, 0.43\u2009C (in wt.%), and balance Fe. A plate was cut from the ingot, homogenized in an air furnace at 1200\u2009\u00b0C for 2\u2009hours to remove the inhomogeneous microstructure evolved during solidification, hot rolled at 1000\u2009\u00b0C  via 9 passes to thickness of 6.5\u2009mm (\u03b5\u2009=\u200985%), and then quenched to room temperature in water (at a cooling rate of ~50\u2009\u00b0C/s) to obtain a fully martensitic microstructure. Subsequently, the plate was divided into two parts and annealed at 750\u2009\u00b0C for 300\u2009s (martensite transformed to ferrite). Following warm rolling at 750\u2009\u00b0C for 6 passes with ~12% reduction per pass, a final thickness of 1.5\u2009mm was obtained. Two intermittent annealing treatments, i.e., annealing at 550\u2009\u00b0C and 600\u2009\u00b0C for 300\u2009s after each pass, were performed for the two parts, respectively. Our aim was to obtain ultrafine-grained (UFG) microstructure. Based on the applied annealing temperature, the steel annealed at 550\u2009\u00b0C and 600\u2009\u00b0C are referred as UFG-1 and UFG-2, respectively.The alloy was melted in a vacuum induction furnace, and an ingot of dimension 300\u2009\u00d7\u2009200\u2009\u00d7\u200920\u2009mmk\u2009=\u20090.1789 nm) and an X-Celebrator detector was used. The penetration depth of X-rays (Co radiation) into steels was a few micrometers.To determine phases, X-ray diffraction measurements were performed on the surface of the rolled plates, i.e., the RD-TD planes . The Rigaku Smart-Lab diffractometer equipped with a sample stage in which a Co anode  in conjunction with electron backscatter diffraction (EBSD), the grain morphology of the as-processed steels was characterized. The RD-TD planes of the specimens were mechanically polished and finally electropolished to remove the surface damage induced by grinding and mechanical polishing. The electrolyte consisted of 10\u2009vol. % perchloric acid and 90\u2009vol. % ethanol. The EBSD data were collected using a SU-70 Hitachi field-emission SEM at an accelerated voltage of 20\u2009kV and a sample tilt angle of 70\u00b0. The selected scanning step was 0.1\u2009\u00b5m, and the analyzed area was 1.5\u2009\u00d7\u20091.0\u2009mmSpecimens for TEM studies were cut from the homogeneously deformed regions (uniform elongated zone) of the tensile specimens. The specimens were mechanically polished from both sides to a thickness of ~60\u2009\u00b5m. Then, the foils were thinned using a double-jet electrolytic polisher at a voltage of 32\u2009V and temperature in the range of \u221210 and \u22125\u2009\u00b0C. TEM studies on the strained samples were performed in a Tecnai G2 20 microscope, operated at an accelerated voltage of 200\u2009kV.3. The uniaxial tensile tests were conducted using a CMT 5105 pc-controlled mechanical testing system  at a constant strain rate of 5\u2009\u00d7\u200910\u22123\u2009s\u22121 at room temperature. During loading, an extensometer was used to calibrate and measure the strain.The dog-bone shaped specimens were cut from the middle of the as-annealed steel along RD using electron discharge machining, and mechanically polished using silica paper to dimensions of 15 (gauge length)\u2009\u00d7\u20093 (gauge width)\u2009\u00d7\u20091.5 (gauge thickness) mmFigure\u00a027. For as-annealed UFG-2 steel, the dominant orientation is <101>//ND  of 10.5% and 7.9%  to diameter (d) of the precipitates, i.e., Fv/d, is 1.5\u2009\u00d7\u200910\u22123 nm\u22121 and 8.8\u2009\u00d7\u200910\u22124\u2009nm\u22121 for the UFG-1 and UFG-2 steels. Detailed TEM characterization for UFG-2 specimens reveals that the diffraction pattern of Fe3C particles overlaps with the surrounding ferrite matrix (the Pitsch-Petch orientation relationship30 is fulfilled between the cementite and the ferrite). Clearly, cementite is incoherent with the ferrite matrix because the spacing of the neighboring Based on TEM observations, the size of Fe\u22121. Mechanical properties vary with grain size and phase composition. The ultrafine-grained samples exhibit high 0.2% off-set yield stress (\u03c3y), ultimate-tensile stress (\u03c3UTS) and elongation-to-failure (\u025bf). For the UFG-1 steel, \u03c3y is 1260\u2009MPa, and \u03c3UTS is 1400\u2009MPa. These values are significantly higher than UFG-2 steel (\u03c3y\u2009=\u20091080\u2009MPa and \u03c3UTS\u2009=\u20091200\u2009MPa). The UFG-1 steel shows an elongation of 15%. This gives the product of strength and elongation value of 21000\u2009MPa%. The product of strength and elongation is an important indicator to assert if a metallic material has good formability. Furthermore, \u025bf of UFG-2 steel is 17%, resulting in the product of strength and elongation of 20400\u2009MPa%. In a medium-carbon steel composed of cementite (d\u2009~\u2009610\u2009nm) in fine-grained ferrite (d\u2009~\u20093.3\u2009\u03bcm), \u03c3y and \u03c3UTS are only 425\u2009MPa and 645\u2009MPa, respectively31, which are significantly lower than our UFG steels. In the reported spheroidized D6AC steel of similar chemical composition, even though the ductility is marginally greater at 21%, the \u03c3y and \u03c3UTS values are only 870\u2009MPa and 930\u2009MPa, respectively11. To clearly see work hardening for both UFG steels over a wide strain range, especially at large strains and high stresses. The high strain hardening capacity of the UFG-1 and UFG-2 steels is essential for achieving large uniform elongation without pronounced strain localization such as necking32. The remarkable difference in mechanical properties between the currently studied steels and those in literatures should be associated with the significantly different microstructures of the steels. As far as the medium-carbon steel32 is concerned, the sizes of both spherical Fe3C and ferritic grains are about one order of magnitude larger than that in the UFG-1 steel, i.e., 610\u2009nm vs. 70\u2009nm for cementite and 3300\u2009nm vs. 430\u2009nm for ferrite, respectively. On the other hand, the large elongation and low strength in the spheroidized D6AC steel11 must be resulted from the coarse ferritic grains or bainitic laths , despite of the existence of nanosized cementite particles.Figure\u00a03C particles. The decrease in ferrite grain size and nanoscale particles are responsible for high \u03c3y and \u03c3UTS of UFG-1 steel. The coarsening of spheroidized carbide particles also leads to reduction of \u03c3y and \u03c3UTS. On the other hand, the elongation can be compensated by increasing ferrite grain size and coarsening of Fe3C particles.The results can be explained by the different strain hardening behavior of the constituent phases as well as the differences in grain size in the two studied steels. The good combination of strength and ductility in the both UFG steels is associated with different contribution from the duplex microstructure consisting of soft ferrite matrix and hard Fe35. Humphreys et al.36 noted that the effect of precipitates on grain refinement during SPD depends on the ratio of volume fraction (Fv) to diameter (d) of the precipitates, i.e., Fv/d. As mentioned above, in our case, nanosized Fe3C precipitates with an average diameter of 70\u2009nm and 90\u2009nm correspond to a Fv/d of 1.5\u2009\u00d7\u200910\u22123\u2009nm\u22121 and 8.8\u2009\u00d7\u200910\u22124\u2009nm\u22121. The effect of precipitates on recrystallization can be described in terms of the dislocation-related driving force acting at the grain boundaries and Zener particle-related drag force, as follows36:Fc is the mean-field driving force acting at an interface, Fr is the Zener drag force induced by precipitate, Fv is the volume fraction of precipitate, \u03b3 is grain boundary energy, d is the diameter of precipitate, G is the shear modulus, b is Burgers vector, and \u03c1 is the stored dislocation density. Fv/d represents the dispersion ratio of nanosized particles. According to equation  to Fv/d\u2009=\u20098.8\u2009\u00d7\u200910\u22124\u2009nm\u22121 (UFG-2 steel). During warm rolling processing, numerous dislocations tangles appear around the Fe3C precipitates, indicating that the particles are effective obstacles to dislocation motion and thereby contribute to dislocation storage. Hence, Fe3C precipitates can significantly facilitate recrystallization and grain refinement through the following two possible mechanisms: (i) The precipitates facilitate retention of high density of dislocations by promoting generation of dislocations and hinder the dislocations from cutting through the precipitates during deformation, which enhances the driving force for recrystallization. (ii) Nanosized Fe3C particles modify plastic deformation in their vicinity and thus promote the formation of deformation bands. These regions may act as potential sites for nucleation of new grains.Several studies suggested that nanosized precipitates in an Al alloy may promote multiplication of dislocations, limit the slip distance, i.e., the mean free path between obstacles, and thus accelerate grain refinement during SPD processingentclass1pt{minima\u03c1, can be estimated using the following equation30:\u03c1s is the deformation-driven dislocation density of matrix, \u0394\u03c1 is the increment of dislocation density associated with hard particles, and 3C particles appear to be extremely blurred because of significant pile-up of dislocations. In both UFG-1 . The elongation of UFG-1 steel is 15%, while that of UFG-2 steel is 17%. Both the UFG steels show high product of strength and elongation, i.e., the good strength-ductility balance. The good ductility of UFG steels is attributed to the existence of the nanosized Fe3C particles. The cementite particles act as strong obstacles for dislocation slip in ferrite. Subsequently, dislocations pile-up at the cementite/ferrite interface, which effectively promotes strain hardening and ductility. The study underscores that the nanosized precipitates not only provide high strength but also contribute to desirable ductility, which is encouraging for improving the ductility of medium-carbon steels.Duplex microstructure composed of ultrafine-grained ferritic matrix and nanosized Fe"}
+{"text": "Hedgehog (HH) pathway plays an important role in embryonic development, but is largely inactive in adult except for tissue repair. Aberrant activation of HH pathway has been found in a variety of cancer types. In non-small cell lung cancer, however, the role and importance of HH pathway remain controversial. In the current study, we found that HH pathway was maintained in low activity in lung adenocarcinoma (LAC) cells under normal culture condition, but was highly induced in response to stress conditions. Activation of HH pathway promoted cell survival, growth, and invasion partially through HGF and MET signaling. Hedgehog-Interacting Protein (HHIP), a cell-surface negative regulator of HH pathway, was epigenetically silenced in LAC. Overexpression of HHIP blocked the activation of HH and HGF/MET pathways, and made cells significantly more susceptible to stress conditions. In LAC cells with acquired resistance to Epidermal Growth Factor Receptor Tyrosin Kinase Inhibitor (EGFR-TKI), we found that a part of tumor cells were much more sensitive to HH or HGF/MET inhibitors, suggesting an oncogenic addiction shift from EGFR to HH and HGF/MET pathways. In conclusion, this study showed that HH pathway is a survival signaling that drives LAC cell growth under stress conditions, and HHIP is a key regulator to block the induction of HH pathway. Targeting the HH pathway through inhibitors or HHIP thus holds promise to address EGFR-TKI resistance in LAC in clinic. Lung cancer is the leading cause of cancer mortality worldwide. Non-small cell lung cancer (NSCLC) accounts for about 75% of lung cancers, among which the lung adenocarcinoma (LAC) is the most common histological subtype about 40%). LAC is frequently associated with activating epidermal growth factor receptor (EGFR) mutations, and chemotherapy has limited efficacy \u20133. Altho0%. LAC iTumor cells are continually subjected to diverse stress conditions from microenvironment, such as hypoxia, nutrient deprivation, and oxidative, genotoxic, and replicative stresses , 10. StePTCH is the cell surface receptor of HH pathway, which positively regulates the downstream HH signaling through SMO. Hedgehog-interacting protein (HHIP) is a membrane glycoprotein that binds to all three mammalian HH ligands with an affinity comparable to PTCH , 23. HHIWe first investigated whether HH pathway is abnormally activated in LAC. Three microarray data sets from public domain Gene Expression Omnibus (GEO) containing the gene expression information of both tumor and adjacent normal parts in LAC patients  were analyzed. Comparing the relative gene expressions between tumor and normal parts (the T/N ratio), only HHIP was significantly reduced, while other HH pathway components largely unchanged (T/N closed to 1) Figure . One micIt has been reported that HHIP was epigenetically silenced by promoter hypermethylation in different types of cancer \u201328. We tWe then investigated the role of HHIP silencing in LAC. HHIP or Red-Fluorescent Protein  was overexpressed in 3 different LAC cell lines. Unexpectedly, HHIP overexpression only slightly reduced cell proliferation and clonogenicity in LAC cells under normal culture condition (10% FBS) Figure . Howeverin vivo tumor formation and the growth of LAC cells, we implanted LAC cells overexpressing HHIP or RFP subcutaneously in nude mice. The tumor growth was followed for 1 month. The result showed that tumors overexpressing HHIP had a 70% reduced average volume and 63% reduced average weight as compared to control tumors  were detected as indication for the pathway activity. The results showed that expressions of both genes were significantly induced within 2 days after serum-starvation Figure . ImportaWe then tried to verify whether HGF/MET plays an important role downstream of HH pathway. The recombinant HGF was added into cells cultured in mediums containing 10% or 1% FBS. The results showed that HGF recovered the invasion activity that was reduced in serum-starvation state in cells overexpressing HHIP, but showed minimal effect in control cells Figure . HGF alsSince HH pathway can be activated in serum-starvation state to improve cell survival, we asked whether it can be also activated in response to drug treatment. LAC cells were treated with EGFR-TKI (Gefitinib), and the result showed that within 48 hr, the surviving cells showed enhanced GLI1 expression Figure . Once moFinally, we investigated the role of HH pathway in LAC cells with acquired resistance to EGFR-TKI. Primary lung tumor cells isolated from patients relapsed from EGFR-TKI treatment  were anaIn previous studies, controversial conclusions have been made concerning the role of HH pathway in NSCLC. It was initially identified in 2003 that ligand-dependent HH pathway maintained the malignant phenotype of a subset of SCLC, but was low or inactive in NSCLC . A recenIn vitro analysis showed that most LAC cell lines did not express significantly enhanced SHH or GLI1 than non-tumor lung epithelial cells, but had a remarkably reduced HHIP expression  showed that all HH components, except for HHIP, had an average T/N ratio close to 1 Figure . In vitrn Figure . These rWe then found that HHIP promoter was epigenetically silenced in LAC, like previous reports in other cancer types \u201329, The in vivo, an avascular environment short of serum support. We found that cells overexpressing HHIP exhibited defective tumor initiation and growth activity in nude mice , H1975 (ATCC CRL-5908), HCC827 (ATCC CRL-2868), and H358 (ATCC CRL-5807) were cultured in RPMI medium containing 10% fetal bovine serum as previously described . Growth 5 cells/well) at 37\u00b0C in a humidified atmosphere containing 20% O2 and 5%CO2. Serum-free culture medium was used to prevent fibroblast overgrowth. After 12~24 hours, suspension cells in the wells were collected and cultured in a new plate with RPMI medium containing 10% FBS.EGFR-TKI resistant LAC cells were harvested from malignant pleural effusion of patients who were refractory to EGFR-TKI at the National Taiwan University Hospital (NTUH) . All celLentiviral vectors pLAS3w.RFP-C.Ppuro and pLAS3w.Ppuro were purchased from National RNAi Core Facility Platform (Academia Sinica). HHIP and GLI1 cDNA (library NIH_MGC_17) were obtained from VYM Genome Research Center . HHIP and GLI1 cDNAs were amplified by PCR and ligated into pLAS3w.Ppuro via NheI, EcoRV, and PstI sites downstream of CAG promoter to generate pLAS3w.HHIP.Ppuro and pLAS3w.GLI1. Ppuro expression vectors, respectively. pLKO.1-shGLI1 (clone ID: TRCN0000020485) that expresses the shRNA against GLI1 was obtained from the National RNAi Core Facility, Academia Sinica , with the target sequence: CCTGATTATCTTCCTTCAGAA.http://biq-analyzer.bioinf.mpi-inf.mpg.de, Max Planck Institut Informatik, Germany). MSP was performed according to a previous report [BS-specific primers (HHIP-BS-F and HHIP-BS-R) and BS process were performed according a previous publication  Supplem. Sequencs report   or H358 (5000 cells/well) cells were seeded in 6-well plates in RPMI medium containing 10%, or 1% FBS as indicated on the figures, for 20\u201324 days without replenishing medium. HCC827 cells cultured in medium containing 10% FBS were cultured for only 10\u201314 days, preventing the overgrowth of colonies . For theBefore experiment, 96-well plates were coated with 0.7% agarose (50 \u03bcl/well) and incubated at room temperature for more than 1 hr. HCC827 HHIP/Ctrl cells were suspended in Matrigel (BD Biosciences) and loaded on the top of agarose layer (2000 cells/30 \u03bcl/well), incubated at room temperature for more than 30 min. To avoid pipetting error, mixtures for 6 replicates were prepared in one tube, and loaded to 5 wells. DMEM/F12 medium containing 1 \u00d7 N-2 Supplement (Thermo Fisher Scientific Inc.), 50 ng/ml of EGF, and 20 ng/ml of FGF was added to wells (200 \u03bcl/well), and refreshed every 3 or 4 days. Cells were cultured for 14 days. The spheroids were examined and imaged with a ZEISS Observer A1 microscopy under 2.5X and 10X object lens.4 cells were suspended in 200 \u03bcl of RPMI containing 10% FBS, 1% FBS or 1% Nu-serum , and seeded on matrigel. Eighteen hr later, cells were fixed with methanol and stained with Hoechst (Invitrogen). The invasion cells were imaged using fluorescent microscopy and quantified with ImageJ software.Non-transparent trans-wells (BD Biosciences) were coated with 7 \u03bcl of matrigel (BD Biosciences). 2 \u00d7 106 cells/mouse). Tumor sizes were measured weekly with a dial caliper. All mice were sacrificed 5 weeks after injection, and the tumors were resected, weighed, and photographed.Five-week-old nude mice (BALB/cAnN.Cg-Foxn1 nu/CrlNarl) were purchased from National Laboratory Animal Center , and maintained in Taiwan Mouse Clinic . HCC827 cells overexpressing HHIP or RFP (as control protein) were subcutaneously injected into the flank region of mice . The expression levels of HH pathway component genes between each tumor and the paired normal tissue were compared and presented as T/N ratios  on the figures.For primary culture of LAC tumor cells, the samples were procured and utilized according to approved IRB protocols for research on human subjects . Animal experiment protocols are approved by Institutional Animal Care and Utilization Committee .T-Test (Two-tailed) or Paired T-Test  using SigmaPlot v.12 (Systat Software Inc.). P < 0.05 is considered significant.The statistic significances of the experimental results were assessed by Independent-Samples"}
+{"text": "Of the MDROs strains, vancomycin-resistant enterococcus and carbapenem-resistant acinetobacter baumannii increased annually . Three factors of age (over 60 years), treatment in an intensive care unit (ICU), and specimen category were statistically significant  and indicated that elderly patients in an ICU have a higher risk of being infected by MDROs. The outpatients infected by methicillin-resistant staphylococcus aureus (MRSA) were more frequent than inpatients, implying the existence of community-acquired MRSA strains. The results of this study could provide valuable information for the detection and colonization of multidrug-resistant organisms in hospital infection control systems.This study evaluated the prevalence of clinical multidrug-resistant organisms (MDROs) and analyzed correlations between MDROs and patient characteristics in a regional teaching hospital of Taiwan. A retrospective comparative case-control study was conducted from January 2016 to August 2018 by collecting data from 486 hospitalized and non-hospitalized patients , including patient gender and age, microbial species, and antibiotic susceptibility. The results indicated that at least one MDRO was isolated from 5.3\u20136.3% of patients ( Common i (CRAB) , carbapea (CRPA) , methicis (MRSA) , and van (VREfm) . In 1997 (VREfm)  indicateS. aureus isolates in 1999 and 2003, respectively. VREs from ICUs accounted for almost 25% of Enterococcus isolates in 1999, and 28.5% in 2003. Similarly, from 1999 to 2003, P. aeruginosa resistant to fluoroquinolone antibiotics increased from 23% to 29.5% in ICUs. A survey of 15 Brooklyn hospitals in 1999 found that 53% of A. baumannii strains exhibited resistance to carbapenems [During the past several decades, the prevalence of MDROs in hospitals and medical centers of the world has increased steadily. According to statistics from the National Nosocomial Infection Surveillance (NNIS) system, MRSAs originating in intensive care units (ICUs) accounted for 50% and 59.5% of bapenems . Accordip < 0.001) between anti-pseudomonal carbapenems usage and the prevalence of imipenem- and meropenem-resistant P. aeruginosa to several classes, rather than to all antimicrobial agents in the hospital. On the other hand, Dermota et. al. [In 2013, Xu  suggeste et. al.  highligh et. al.  indicate et. al.  adopted Implementing nosocomial infection surveillance is of vital importance ,14 for cIn Taiwan, most research focused on the analysis of specific MDROs but not comprehensive epidemiological studies of MDROs in regional teaching hospitals. Therefore, this study investigates the prevalence of MDROs in a regional teaching hospital and explores the correlation between characteristics of patients and isolates of MDROs to discuss current MDRO epidemiology in Taiwan. These results can be an important indicator of nosocomial infection control, provide relevant data to supplement medical care-related infection data, help flag abnormal warnings for suitable interventions and generally support public health in Taiwan.This retrospective case-control study was conducted in a regional teaching hospital with 486 patient beds that is an important emergency medical institution in Kaohsiung, Taiwan (R.O.C.). A total of 486 strains were collected from pus , urine , sputum  and other specimens  of clinical patients from January 1, 2016 to August 31, 2018. Patients who were identified as having the first infection of an MDROs strain were included and the average age of MDRO-infected patients was 61.08 \u00b1 23.8 years. The positive rates of MDROs-infected patients from different years were analyzed by WHONET.6\u2013107 CFU/mL, then the diluted suspension was distributed into each well of the detection plate (100 \u03bcL) and incubated at 37 \u00b0C for 18 to 24 h. The plate was scanned with an illuminometer (Merlin) at a wavelength of 620 nm. Optical density > 0.1 was interpreted as an indication of growth. The MIC of antibiotic susceptibility was according to the expert system MCN-6 (Merlin) and CLSI  specifications. E. coli ATCC 25922, E. coli ATCC 35218 and K. pneumoniae ATCC 700603 were used as positive and negative control groups.Antibiotic susceptibility testing of all isolates was determined by MICRONAUT susceptibility testing (AST)  according to the manufacturer\u2019s recommendations to determine the minimum inhibitory concentration (MIC) of 14 antimicrobial agents in serial dilutions of antibiotics. An overnight culture of bacteria was suspended in NaCl solution (0.9%) to obtain turbidity corresponding to 0.5 McFarland Standard . The bacterial suspension was diluted to a final concentration of about 10Clinical specimens were inoculated on proper or selective medium to isolate the harboring bacteria. Bacterial isolates needed to be confirmed for antibiotic susceptibility and to identify the species. VITEK\u00ae 2 Compact  is a commonly used commercial kit that was adopted by clinical standard examination to determine susceptibility to the antibiotics and to identify the species of the bacterial isolates. After the bacteria were pre-treated with the VITEK kit, they were analyzed by the VITEK\u00ae 2 Compact . All identification stages from reading to the recording of results are automated, thereby optimizing workflow. As the system operates with bar-coded cards, full traceability is ensured and the risk of transcription errors is minimized. VITEK\u00ae 2 Compact GN  was used for identifying CRE, CRAB and CRPA, and Compact GP  was used for identifying VREfm and MRSA. Antibiotic susceptibility was based on those defined by the Clinical and Laboratory Standards Institute (CLSI) guidelines 2014 (M100-S21). The MIC of antibiotic susceptibility was determined according to the expert system MCN-6  and CLSI  specification.p < 0.05. SPSS software statistical version 24  was used for statistical analysis.The variation of each MDRO strain within different years was evaluated by the chi-square test to obtain trends. Multivariate analysis was performed to evaluate the epidemiological association between MDRO strains and characteristics of infected patients. All tests were two-tailed with a significance level of p < 0.001) and CRAB (p < 0.012) were significantly increased, but there was no significant difference in MRSA (p = 0.821), CRE (p = 0.210) and CRPA (p = 0.830).p < 0.05) in gender was only seen in total MDRO, but there was no significant difference in the separate analysis of each drug-resistant bacterial species. On the factor of age, MRSA infection was significantly different in the age group of 40\u201359 but not in the group over 60 years of age. All MDRO, VER, CRE, CRAB and CRE infections showed a significant difference over the age of 60 years. In the analysis of the sample and ward categories, MDRO and MRSA infections showed significant differences in samples of pus and sputum; CRAB and CRPA were also significantly different in pus samples. Ward and station also influenced bacterial infection. Total MDRO, VER, MRSA, CRE, CRAB and CRE infections were significantly different among the stations of ICU, RCW and CNU; MRSA, CRE, and CRPA infections were also significant different in the general ward.Using multivariate analysis, the MDRO-infection risk based on gender, age, sample and ward category and station is shown on p < 0.05). In the ICU, NICU and respiratory care wards, a total of 60 patients were analyzed. There were 36 males (60.0%) and 24 females (40.0%) in the gender group, eight patients (13.3%) in the age group >40 years old, 21 patients in the 40\u201359 age group (20.0%) and 40 patients (66.7%) >60 years old; 31 (51.7%) with sputum, 10 (16.6%) with urine and 19 others (31.7%). Of the MDROs, there were three strains (5.0%) of VRE, 27 strains (45.0%) of MRSA, five strains (8.3%) of CRE, 16 strains (26.7%) of CRAB, and nine strains (15.0%) of CRPA. MDROs had the largest number of MRSA infections in the same place in ICUs, general wards and emergency department; 16 cases of CRAB  and three strains of VRE  were found in different ICUs. Using the Stepwise method of multivariate analysis, there were significant differences in samples of the ICU and sputum  and 4343 patients without MDRO infections (94.7%), and in 2017, there were 122 MDRO-infected patients (5.6%) and 2059 patients without MDRO infections (94.4%). From January to August in 2018, there were 122 MDRO-infected patients (6.3%) and 1813 patients without MDRO infections (93.7%). The increase in the proportion of MDRO-infected patients between 2017 and 2018 was due to the decline in the total number of people. Analyzed by GPC (Gram-positive cocci), there were 617 inpatients and 382 outpatients with 179 (29%) and 128 (33.5%) cases of VRE and MRSA, respectively. Analyzed by GNB (Gram-negative bacteria), there were 1845 inpatients and 2135 outpatients, with 38 (2.1%) and seven (0.3%) CRE-infected cases, respectively. Analyzed by GNF (glucose-nonfermenter bacteria), there were 395 inpatients and 123 outpatients, with 111 (28.1%) and 23 (18.7%) CRAB-infected and CRPA-infected cases, respectively. These results indicated that inpatients are more infected with MDROs than MRSA.A. baumannii is substantially higher than that reported in other regions, especially carbapenem-resistant A. baumannii (CRAB) (64.91%) and multidrug-resistant A. baumannii (MDR-AB) (58.51%). This review found a dose-response relationship between different degrees of resistant mechanisms of A. baumannii and the infection-caused mortality rate [p < 0.012) and VRE (p < 0.001) are increasing; however, those for CRE and CRPA are not increasing  IV gene. Due to rapid genetic adaptation, CA-MRSA is emerging as a global public health threat. In sharp contrast to HA-MRSA, the propagation control of CA-MRSA is complex, forcing clinicians to use advanced antibiotic management skills [S. aureus strains from bloodstream infection (BSI) have considerable genetic diversity in children, identifying major genotypes of CA-MRSA and CA-MSSA (community-acquired methicillin-sensitive S. aureus), and finding a high prevalence of CA-MRSA [S. aureus in children in Chinese communities [Our data show that the proportion of MRSA-infected cases in GPC (33.0%) is higher in outpatients than inpatients (26.4%) , which it skills ,24. Othe CA-MRSA . Moreovemunities . Therefomunities .A. baumannii to carbapenem [In summary, first, the results of this study showed that isolation rates of CRAB and VRE are on the rise. Second, the risk of MDROs infection in patients who are admitted to ICUs, elderly or immunocompromised is higher. Thirdly, the proportion of MRSA-infected cases in GPC is higher in outpatients than inpatients. Infection control continues to be involved, and strategies to actively monitor laboratory resistant strains need to be strengthened. This study describes the epidemiological distribution of MDROs in a regional teaching hospital in Taiwan, indicating the importance of monitoring the long-term prevalence of MDROs. Further experimental study design is also needed, such as the analysis of MDRO homology by pulse-field gel electrophoresis (PFGE)  or the erbapenem . Thereforbapenem . The res"}
+{"text": "Zip4), with the perspective of finding an alternative to zinc supplementation. In this study we have assessed the utility of a different class of zinc ionophore compound (zinc diethyl bis(N4-methylthiosemicarbazone), Zn-DTSM; Collaborative Medicinal Development, Sausalito, CA, USA) to the one we have previously described (clioquinol), to determine whether it is effective at preventing the stereotypical weight loss present in the animal model of disease. We first utilised an in vitro assay to assess the ionophore capacity of the compound, and then assessed the effect of the compound in three in vivo animal studies . Our data demonstrate that Zn-DTSM has a pronounced effect on preventing weight loss when administered daily at 30 mg/kg/day; this was apparent in the absence of any added exogenous zinc. This compound had little overall effect on zinc content in various tissues that were assessed, although further characterisation is required to more fully explore the cellular changes underlying the physiological benefit of this compound. These data suggest that Zn-DTSM, or similar compounds, should be further explored as potential therapeutic options for the long-term treatment of AE.Acrodermatitis enteropathica (AE) is a rare disease characterised by a failure in intestinal zinc absorption, which results in a host of symptoms that can ultimately lead to death if left untreated. Current clinical treatment involves life-long high-dose zinc supplements, which can introduce complications for overall nutrient balance in the body. Previous studies have therefore explored the pharmacological treatment of AE utilising metal ionophore/transport compounds in an animal model of the disease  of the zinc transporter,  ZIP4) gene , which has been shown to play a role in zinc homeostasis and to be regulated by zinc levels in vivo [ZIP4 gene in mice resulted in decreased cellular uptake of zinc [The identification of acrodermatitis enteropathica (AE) as a distinct disease entity was first made by Danbolt and Closs in 1942, who postulated that AE was a \u201cprimary affection of the intestinal tract\u201d , have l of zinc . Whilst  of zinc ,13,14,15Zip4-enterocyte knockout model recently developed by Geiser and colleagues [Zip4 knockout (KO), resulting from a switch from an anabolic to catabolic state in these mice, with the animals experiencing significant loss of muscle and bone mass prior to death within a matter of weeks. This model has been utilised to demonstrate that the Zip4 gene controls animal growth and viability, impacts upon metal ion homeostasis, and results in a host of other biochemical, pathway, and anatomical changes that can drive the AE phenotype. Furthermore, it has also been used to assess therapeutic options. In this regard, we examined the utility of the 8-hydroxy quinoline compound, clioquinol (CQ), and found that when administered in concert with zinc it was highly effective at improving the phenotype in this model, in contrast to zinc and CQ alone which were ineffective [In order to further understand disease mechanisms and explore potential therapeutic options, a number of mouse models of AE have been proposed. Amongst these is a tamoxifen-inducible lleagues . The priffective . This stffective ,29,30,31The compound, Zn-DTSM, was a kind gift from Collaborative Medicinal Development. The chemical structure of this compound (Mw 351.8) is shown in The ionophore assay, which we have previously published on , utiliseWe have previously published the ICPMS methods. Briefly, tissue samples were lyophilised and then digested with nitric acid  overnight, followed by heating at 90 \u00b0C for 20 min using a heat block. Samples were then removed from the heat block and an equivalent volume of hydrogen peroxide  added to each sample. Once samples had finished digesting, they were heated for a further 15 min at 70 \u00b0C. Samples were then diluted with 1% nitric acid diluent. Measurements were made using an Agilent 7700 series ICPMS instrument under routine multi-element operating conditions using a helium reaction gas cell. The instrument was calibrated using 0, 5, 10, 50, 100 and 500 ppb of certified multi-element ICPMS standard calibration solutions  for a range of elements, and we also utilised a certified internal standard solution containing 200 ppb of Yttrium (Y89) as a control .All animal experiments were approved by the Howard Florey Animal Ethics Committee (AEC#14-055) and were conducted in accordance with the Australian Code of Practice for the Care and Use of Animals for Scientific Purposes as described by the National Health and Medical Research Council of Australia. All animals had free access to food and water and were group-housed in individually ventilated cages in The Florey Institute Animal Facility under controlled temperature (22 \u00b1 2 \u00b0C) and lighting (14:10 h light/dark cycle) conditions.Zip4 (Slc39a4) KO mouse model of AE, which we have previously described [Zip4 KO and which will ultimately result in the death of the animal if left untreated. In all the experiments described herein animals  were weighed daily  and were culled prior to reaching a terminal endpoint. For the induction of the KO, a tamoxifen stock solution was prepared by the addition of 100 \u00b5L of ethanol to 10 mg of tamoxifen  and heating to 37 \u00b0C briefly to dissolve the tamoxifen. This solution was then diluted to 1 ml with autoclaved canola oil and heated briefly to 37 \u00b0C. The stock solution (10 mg tamoxifen/mL) was stored at 4 \u00b0C for up to two weeks or at \u221280 \u00b0C for longer-term storage. Before injection, the tamoxifen stock solution was heated to 37 \u00b0C. Mice were injected with 100 \u00b5L  of the tamoxifen stock solution daily for 3 consecutive days. The weight taken on the first day prior to the initial tamoxifen injection was used as the reference weight for each animal, and the subsequent weight change in response to the KO and/or the various treatments was calculated as a % weight change from this reference weight for each animal. The average % weight change was then calculated across the different groups and presented in the Figures. Following three days of rest, animals were then randomly assigned to specific experimental groups. Within this body of work there were three separate studies performed\u2014Study#1, Study#2, and Study#3. Across these we did not examine the impact of Zn-DTSM in \u201dnormal\u201d animals , as the compound is designed to restore a zinc deficit, and thus, in the absence of a zinc deficiency it is unlikely that we would see any compound effect. However, the effect of the compound in na\u00efve animals would need to be assessed prior to any clinical advancement.We utilised the conditional escribed  and whicStudy#1\u2014following the post-tamoxifen rest period, AE animals (aged ~1.5 months) were given access to either water alone , water supplemented with zinc sulphate (250 mg/L) , or were orally gavaged with either Zn-DTSM (30 mg/kg/day made up in standard suspension vehicle (SSV), comprising 0.9% NaCl, 0.5% Na-carboxymethylcellulose, 0.5% benzyl alcohol, 0.4% Tween-80) and given access to water alone , or gavaged with Zn-DTSM and given water similarly supplemented with 250 mg/L zinc sulphate  . Following a week of treatment, animals were deeply anaesthetised using sodium pentobarbitone , perfused with 25\u201330 mL of cold PBS  and then tissue harvested for metal analysis. The brain was micro-dissected into hippocampus, cortex, cerebellum and \u201cremainder\u201d of the brain; the proximal small intestine was flushed with cold PBS, cut into small 1-cm pieces; and the liver was similarly collected. All tissues were then frozen at \u221280 \u00b0C for biochemical analysis.Study#2\u2014This study was similar to Study#1, except the animals were ~5 months of age at the time of cull, and there were \u201cControl\u201d and \u201cZn-DTSM\u201d groups . We also included a group of na\u00efve animals that were not treated with tamoxifen or in any other way manipulated, and these animals also had access to normal food and water .Study#3\u2014This study was similar to that outlined in Study#1, with the following exceptions. The animals were all aged ~5 months in this study and the dose of Zn-DTSM was 3 mg/kg/day. The groups included were \u201cNormal\u201d, \u201cControl\u201d, \u201cZinc\u201d, \u201cZn-DTSM\u201d and \u201cZn-DTSM+Zinc\u201d . In the case of the groups receiving zinc supplementation, this was the same as shown above, with zinc sulphate spiked into the drinking water at 250 mg/L.All statistical analyses were carried out using GraphPad Prism . All statistical comparisons made are stated in the respective Figure Legends. For p < 0.0001), with Zn-DTSM significantly increasing cellular zinc content  and also a significant interaction effect (p < 0.0001) across the study (p = 0.006), Day 3 (p = 0.0002), Day 4 (p = 0.006), and Day 5 (p < 0.0001). In the AE \u201cControl\u201d group there were also two deaths, whereas in the AE \u201cZinc\u201d and AE \u201cZn-DTSM\u201d group there were no deaths. Significantly, there was no statistical difference between the AE mice treated with either Zn-DTSM alone, or Zn-DTSM plus exogenous zinc. This demonstrates that Zn-DTSM at this dose does not require additional dietary zinc supplementation.The \u201chigh\u201d dose of Zn-DTSM was tested in mice in which the ablation of Zip4 was induced in young mice (~1.5 months of age). These data demonstrate that there was an overall significant effect of treatment group . We have, however, not assessed any specific endpoints that would address the mechanisms underlying this weight gain. Further studies would be required to address this, and to definitively show whether or not this compound had any effect on weight gain independent of Zip4 ablation to assess whether or not the loss of Zip4 had a similar effect on weight in the older adult animals (Study#2). In this study we only assessed the effect of Zn-DTSM alone. As shown in p = 0.0003; treatment effect p < 0.0001; \u201cNormal\u201d vs. \u201cControl\u201d significantly different on days 4 and 5, p = 0.005 and p = 0.003 respectively), and similarly to Study#1, Zn-DTSM was effective at preventing this weight loss on Days 3, 4, and 5 . In this study there were no dietary zinc supplements provided, and the compound alone was again effective at preventing the Zip4-induced weight loss that characterises these AE mice. Whilst the \u201cNormal\u201d mice did not gain weight over this acute time course, in contrast to the \u201cAE+(Zn-DTSM)\u201d mice that gained ~5%, there was not a significant difference in gross weight between these groups at the end of the study . Longer studies would be required to determine whether or not the AE mice treated with compound continued to gain weight or stabilised around wildtype control levels. Similarly, to definitively establish whether or not the compound itself could have a specific effect on weight, independent of the effects of the ablation of Zip4, additional experiments would be required.We also aged mice to 5 months prior to the induction of the p = 0.039) and treatment group (p < 0.0001) across the study. The control-treated mice all lost weight across the trial, and this was only altered by zinc treatment on days 7 and 8 (p = 0.01 and p = 0.01 respectively). The Zn-DTSM treatment alone appears to have reduced the severity of the weight loss, but this did not reach statistical significance. In contrast, the animals treated with the combination of Zn-DTSM and exogenous zinc all gained weight, and were significantly different to the controls on Days 2\u20138 , but were no different to zinc-alone treated mice.Given the data from the first two studies, we assessed the effect of Zn-DTSM in a final set of experiments Study#3; . In thesp = 0.01), with the AE+(Zn-DTSM+Zinc) group significantly (p < 0.05) different to the AE control group; the AE+(Zn-DTSM+Zinc) group was also different to the AE+Zinc group (p < 0.05) and the AE+(Zn-DTSM+Zinc) group was different to the AE+Zn-DTSM group (p < 0.05). Also in the young group, there was a significant effect  in the intestine, with the AE+(Zn-DTSM+Zinc) group significantly different to the AE control group (p < 0.05).As shown in Zip4 gene was ablated in both young (1.5-month) and older (5-month) mice. Significantly, and unlike CQ that we have published on previously [In this study we have demonstrated that the novel metal ionophore, Zn-DTSM, is effective at preventing weight loss in the animal model of AE. This effect was observed when the eviously , this efThe Zn-DTSM compound utilised in this study belongs to the bis thiosemicarbazone family of compounds. We have previously utilised compounds from this chemical class in other disease models, including Cu(GTSM) that was utilised in the APP/PS1 mouse model of AD . In thatZip4 KO mouse model and shown that it is ineffective in preventing the phenotype present in this model when given in isolation. However, in the presence of exogenous zinc, then the compound was highly effective in preventing the rapid weight loss that leads to eventual death in this model. In that study we also interrogated potential mechanisms of action of CQ and demonstrated significant effects on intestinal cells. Given the marginal zinc ionophore capacity of CQ [In the case of AE, we have previously tested the efficacy of CQ  in the Zty of CQ  it is pety of CQ .Consistent with its capacity for zinc delivery, Zn-DTSM (30 mg/kg/day) was shown to be far more effective in preventing the primary weight loss phenotype in the AE model than CQ. Importantly, the effect of Zn-DTSM was achieved in the absence of any exogenous zinc and it was also beneficial in both young and older AE animals, suggesting that it may be of potential benefit to both juvenile and adult-onset AE. However, our studies were acute in nature , and so more chronic studies are required to investigate the longer-term benefit of Zn-DTSM and to also understand the mechanism of action of this compound in this disease. Such studies will also be valuable to tease apart the dose\u2013response for the compound, as we also assessed a lower dose of compound (3 mg/kg/day) in older mice and found that it was only effective at preventing significant weight loss when given in the presence of exogenous zinc, and even then it was no more beneficial than zinc alone. Thus, understanding the limiting dose of compound, from the perspective of the requirement for exogenous zinc supplementation, will be important from a clinical and drug development perspective. This will also allow us to further interrogate the effect of these compounds on the metalloproteomic profile of the mice.Zip4. Longer-term studies will allow us to assess whether the AE-associated zinc insufficiency translates to CNS deficits that then impact/translate to impairments in higher order functions such as learning and memory, or contribute to other metal-associated psychiatric manifestations.Specifically, ZN-DTSM had no apparent effect on either copper or iron levels in the cell (in the ionophore assay), whereas other 8-hydroxy quinoline compounds (such as PBT2) can have a significant ionophore capacity for other metals such as copper . This apThese studies demonstrate that Zn-DTSM is a potent zinc ionophore that may have utility in the treatment of zinc deficiency disorders, such as AE. This, or similar compounds, may eliminate the need for the daily high-dose zinc supplementation that is used clinically, and which may contribute to a long-term disruption in normal nutrient balance in the body that can potentiate other undesirable clinical symptoms. Additional studies are required, however, to address the long-term consequences of treatment with this compound in both na\u00efve and disease animals. Furthermore, understanding the impact of chronic zinc deficiency  on other physiological parameters, such as learning and memory, is critical given the known role of zinc in these higher order cognitive processes. Whether zinc ionophores may also have some role in such situations also remains an open question that should be investigated."}
+{"text": "Allium cepa root tip, respectively. Several plasma proteins displayed strong affinity towards NPs and produced multi-layered corona of 13\u2009nm to 600\u2009nm size. The coronated-NPs often attracted each other via non-specific protein-protein attraction which subsequently induced protein-induced coalescence in NPs. In the protein point of view, the interaction caused conformational changes and denaturation of protein thereby turned it as bio-incompatible. The coronated-NPs with increased protein confirmation changes caused higher genotoxic and cytotoxic effect in human blood cells than the virgin-NPs. On the other hand, virgin-NPs and the NPs isolated from facial scrubs hindered the root growth and caused chromosome aberration  in root of Allium cepa. At the outset, the present study highlights the urgent need of scrutinization and regulation of NPs use in medical applications and pre-requisition of additional studies for assessing the bio-accumulation and bio-magnification of NPs.Recently, the concerns about micro- and nano-plastics (NPs) toxicity have been increasing constantly, however the investigations are quiet meager. The present study provides evidences on the toxicological prospectives of virgin-, coronated- and isolated-NPs on human blood cells and  Owing to the sustainability, flexibility, durability, stability, long-lasting ability, viscosity and bioavailability, the cosmetics, personal care, textile and food packaging industries incorporates plastic materials in wide range of products4. For instance, facial masks, lipstick, mascara, eye shadow, anti-wrinkle creams, soap, shampoo, conditioner, moisturizers, shower gel, hair spray, hair coloring, scrubs, toothpaste, deodorant, shaving cream, sunscreen, insect repellent, yoga pants, t-shirts, jeans, fleece, socks, running shorts, acrylic onesies, microfiber cleaning cloths, unbending plate and holders, expendable eating utensils, frothed mugs, plates, bowls6 and many other products ubiquitously composed of 1 to 90% of plastic. From these products as well as from indiscriminately discharged plastic polymer debris, including polyvinylchloride, polylactic acid, nylon, polypropylene, polyethylene and polystyrene, small plastic fragments called micro-plastics (cannot be decomposed or collected for recycling) are derived, enters water ways through drains and reaches aquatic environment. As a result, micro-plastics (MPs) are now pervasive in the environment and found worldwide7. In the environment these MPs are progressively broken into nano-plastics (NPs) due to physical, chemical and biological processes8.Because of modern consumption culture, plastic usage has deep routed in our daily life, thereby the global virgin plastic production escalated to a total of 8300 million metric tons (Mt) in 2015, of which around 4977 Mt waste had been generated and accumulated in natural environment9, macro pinocytosis10 and phagocytosis2 and interacts with various bio-molecules due to their expansive surface to mass proportion and smaller size. Particularly, the interaction with proteins produce polystyrene-protein complex and upon complexation, a protein coat is formed commonly alludes as corona11. Formation of biomolecular corona on MPs/NPs subsequently provides them a new biological identity; to escape from immune system, prolonged persistence in circulation and interfere cellular and molecular processes. Studies reported that protein corona reduces the RBC agglutination compare to the virgin-NPs12, successively translocate the NPs to all organs and accumulates/aggregates in liver, kidney and gut14. This uninterrupted entry of coronated-NPs in biological system could pave the way to unanticipated effects and eventually promotes them as a potential health hazard.Over the past few decades, polystyrenes a prevalent MPs and NPs being used in various day-to-day life products. These plastics can easily enter in to the cells through clathrin-coated vesiclesBrachionus koreanus (rotifer)15 and the crustaceans Tigriopus japonicas (copepod)16 showed significant reduction in growth rate and retardation, respectively upon exposure to MPs. Further, MPs displayed significant histological changes in the tissue and cellular level of blue mussel (Mytilus edulis L.)17, sea bass (Dicentrarchus labrax)18 and reduction in feeding activity in lugworm Arenicola marina19. In Eisenia andrei (earthworms), fibrosis, congestion and inflammatory infiltrates were observed20, and in microalgae namely, Chlorella sp. and Scenedesmus sp., the physical adsorption of polystyrene micro-beads inhibited the photosynthesis process21. Though there are indisputable evidences on the significant deformity at the cellular level and accumulation of NPs in the vital organs, the effect magnitude and the fate of micro-plastics is still uncertain. Therefore, the present study intended to assess (i) the physical changes in virgin-NPs during protein interaction, (ii) adverse effects of plasma coronated-NPs on human blood cells, (iii) toxicological impacts of virgin-NPs and the NPs isolated from cosmetics against human blood cells and Allium cepa root cells.Recently, studies on MPs and NPs have grown exponentially revealing the discharges from the cosmetics and personal care products have potential harmful consequences towards wide range of animals and environment. For instance, the pseudocoelomate animal 24. Therefore, in the present study, we first investigated the interactive prospectives of virgin-NPs with HSA and with human plasma followed by physical changes in NPs and proteins, secondly, tested the adverse effects of plasma coronated- and virgin-NPs on human blood cells, and finally, evaluated the cytotoxic and genotoxic effect of NPs isolated from commercial face scrubs on the human blood cells as well as A. cepa root tips.Though MPs and NPs have constantly been released and persisted in the environment for more than 50 years, only very recently they were identified and acquainted. Since then few studies have demonstrated their adverse effects in human and environmental health. Privation of fundamental knowledge that links the physical changes of MP/NP\u2019s to the biological macro-molecular interactions, thus triggered molecular alterations and cell toxicity is the break down to understand and evaluate the harmfulness of plastics to humans25. This process can be repeated until the entire surface filled with HSA, resulted as protein corona  via protein \u2013 protein interaction. Layer by layer association of secondary binders produces multi-layered corona with the size ranging from 13\u2009nm , side chains of phenylalanine (Phe) and tyrosine (Tyr), pyrrole ring proline (Pro) and isopropyl group of valine  could possibly establish strong interaction with the benzene ring of polystyrene NPs28. Apart from these residues, aspartic acid (Asp), arginine (Arg), histidine (His), tryptophan (Trp) and glutamine (Gln) may institute the electrostatic adsorption with polystyrene NPs29. Considering HSA, the most abundant protein in serum composed of 18 Tyr, 31 Phe and 1 Trp, and 34 disulfide bonds that could provide rapid binding (within seconds to minutes) towards NPs and therefore, found as the major proportion of corona in the serum interaction studies31.Although, the binding mechanism of protein with NPs is not fully understood, it is believed that the biomolecules can binds on the NPs surfaces via non-specific attraction forces especially, Van der Waals forces or by the electric polarity alteration of approaching molecules leads to the establishment of strong bond (hydrophobic) between them or by simple dipole against dipole bonding particularly, hydrogen bond via hydrophilic chemical groups 32. So far, many phenomenon namely, Brownian coalescence wherein collision occurs between particulates due to Brownian motion, Ostwald ripening where the particulates turns in to large ones through molecular diffusion across the intervening continuous phase, hydrodynamic coarsening via particulates interfacial velocity, coalescence-induced coalescence and diffusion-induced coalescence have been proposed for particulate coarsening effect33. Herein, we observed the protein-induced coalescence of NPs, where the NPs possibly dissolves during strong surface pressure produced by corona while approaching to larger coronated-NPs, diffuses across the neck like protein-bridge and coalesces with the other NPs. The TEM observations of coalescence effect revealed that three to four coronated-NPs coalesced to produce 500\u2009nm size particles  or by the complex formation between the quencher and fluorophore at the ground state (static quenching)38. Apart from the excited or ground state reaction, the spectral variations can also be produced by the molecular rearrangements, energy transfer, protein conformational changes, substrate binding, subunit association and denaturation39. Herein, the hyper-chromatic and quenching effect of HSA upon interaction with NPs reveals the existence of static quenching as well as conformational changes in the HSA40. The binding parameters for HSA and NPs were assessed by Stern\u2013Volmer (F0/F vs. [NP]) and double logarithmic plot (log (F0 \u2212 F/F) vs. log[NP]) at 290, 300, & 310\u2009K.0 and F are the fluorescence intensity of HSA of pre- and post-NP interaction, Ksv is Stern-Volmer constant, Kq is dynamic quenching rate constant, \u03c40 is the life time of HSA without quencher, K is binding constant of HSA, n is number of binding sites and NP is nano-plastics in different concentration. The Stern-Volmer quenching plot presented in Fig.\u00a013, 0.0096\u2009\u00d7\u20091013, and 0.0055\u2009\u00d7\u20091013 (L mol\u22121) for 290, 300, and 310\u2009K, respectively. From the double logarithmic eq., the K values for respective temperature were determined as 3.801, 5.726 and 1.341\u2009L\u2009mol\u22121 and the n value was found close to be 1 denoting single binding site.On the other hand, conformational change in the protein structure was elucidated by spectroscopic and electrophoretic studies. Upon stable and continuous interaction with NPs, HSA produce hyper-chromatic effect reflecting the ground state complex formation in the micro-environment. Under UV spectrophotometry, HSA exhibited absorbance maxima ~280\u2009nm due to \u03c0\u2009\u2192\u2009\u03c0* transition of the tryptophan or tyrosine residues\u2009nm Fig.\u00a0 while at\u2009nm Fig.\u00a0. General41. Figure\u00a042 induced by NPs. Further, the reduction in \u03b2 sheet percentage suggests the amino acid residues of polypeptide chain binding with NPs, which cause partial unfolding. Since the protein structure controls its function and drives them either as beneficial or harmful, the conformational changes in the HSA structure could eventually change their function. In order to compare the secondary structure of native and adsorbed HSA, FT-IR spectroscopy was employed. The infrared spectra  was observed during plasma interaction as well Fig.\u00a0. Such grnds Fig.\u00a0. It appends Fig.\u00a0 suggesti50. Numerous controlled laboratory studies on MPs/NPs displayed size dependent milder to chronic conditions in various ecological targets ranging from planktonic species to filter-feeders and bottom grazers and from earthworms (Lumbricus terrestris) to terrestrial birds. The conditions includes, compromised immune responses in fathead minnows 32, induced liver lesions in zebrafish (Danio rerio)51, reduced reproduction, feeding, growth rate in rotifers50 and Lumbricus terrestris52, embryotoxicity in sea urchin53 and mortality and multiple molting in brine shrimp54 and blockage of intestinal tract and compromised the feeding and digestion in Mediterranean seabirds55. Although several studies demonstrated, the accumulation and persistence of NPs in terrestrial birds, earthworms, rotifers and other organisms58, the exact damage caused by NPs or its mechanism of action were not identified, however negative effects are inevitable due to the carcinogenic plastics additives especially, phthalates, bisphenol A, brominated flame retardants, triclosan, bisphenone and organotins59 and sorbed pollutants60 that leach into cells. At the outset, it is assumed that in any organism, ingested nano-plastics will typically reach the intestine via peristaltic action, where it can be (i) incorporated with fecal matter and excreted61; (ii) adsorbed and entrapped across gut lining and block the intestine; or (iii) uptaken by gut enterocytes and accumulated in villi then pass through the blood stream and reaches other organs/tissues50 prior entering liver for recirculation into small intestine via bile62. It is noteworthy to mention that it has been speculated that increase in wildlife cancer might be reflected from global plastic contamination63 however, evidence to support or refute this claim as well as fate of NPs post-ingestion are scanty.Physico-chemical properties such as, size, shape and surface properties, and additives as well as sorbed material can influence NPs/MPs biological ramifications. Studies on fluorescence polystyrene NPs revealed that\u00a0the toxicity, persistence and excretion of NPs in organisms are size dependent process. For example, in rotifers, larger NPs (>100\u2009nm) were accumulated in gut and excreted simultaneously, whereas small NPs (<50\u2009nm) apparently pass through the intestinal wall, entered tissues and organs through circulation, and reached extruded eggsin vitro condition. Wherein, the cytotoxic effect was investigated via MTT assay65 and the erythrocytes lysis was determined by hemoglobin release via spectrophotometric analysis. The percentage of cytotoxicity and hemolysis caused by coronated-NPs is presented in Fig.\u00a066 were presented in Fig.\u00a066. In the present study, an extensive DNA damage in lymphocytes was observed at 5\u2009\u03bcg/mL concentration of coronated-NPs when compare to virgin-NPs. The observed genotoxic in lymphocytes treated with coronated- and virgin-NPs were in good correlation with the cytotoxic and hemolytic effect. The increased effect of coronated-NPs at the tested concentrations signifies the effect magnitude can be influenced by plasma protein confirmation i.e. after interaction with NPs the plasma protein turns into bio-incompatible and delivering an altered biological activity. It is noteworthy to mention that isolated-NPs showed significant genotoxic effect than virgin-NPs, however the effect is lesser than the coronated-NPs.To substantiate the toxic effects in blood stream, human lymphocytes and erythrocytes were exposed to coronated-NPs under 2-Polystyrene (50\u2009nm)67. Similarly, DNA strand breaks in haemocytes and neurotoxic effects was observed in mussels  treated with polyethylene and polystyrene MPs68. Whereas in some studies, upregulation of stress regulator proteins at low concentration of polystyrene NPs was observed evidencing the oxidative stress induction, while at high concentration, gene expression was downregulated, this could be due to the damage in the antioxidative system or DNA69. MPs/NPs mediated oxidative damage has been reported in wide range of organisms such as lugworm Arenicola marina70, algae Chlorella and Scenedesmus21, Crab Eriocheir sinensis71 and zebrafish Danio rerio72. Although, there is no direct evidence portraying nano-plastics mediated genotoxicity in human, chromosomal aberrations73, mutations in glycophorin A74, sister chromatid exchange75, micronuclei formation75 and DNA single strand breaks76 were reported in numerous works exposed to styrene. From the present study, it is assumed that the physical damage caused by the virigin- and coronated-NPs leads to increased reactive oxygen species production and oxidative stress which ultimately cause DNA damage in blood cells similar to that of metallic nanoparticles77. Further, the increase in genotoxicity of coronated-NPs may be either due to the stress induced by denatured protein molecules or by coronated NPs or by the migrated styrene molecules78 during dissolution and coalescence effect.Studies on polystyrene NPs mediated genotoxicity (DNA damage) and chromosome aberrations in human are limited. Previously, delayed G1 phase and decreased cyclin  expression was observed in cancer HeLa cells as well as normal NIH 3T3 cells exposed to NHA. cepa. About, 10\u2009\u03bcg/mL NPs caused 50% reduction in mitotic index and 25\u201330% chromosome aberration (CA) in 3\u2009h treatment whereas 25\u2009\u03bcg/mL NPs declined MI below 25% and caused 35\u201350% CA. Therefore, the concentrations 10 and 25\u2009\u03bcg/mL are anticipated as sublethal79 and lethal80, respectively to A. cepa root cells for 3\u2009h treatment. At these concentrations, 35% and 80% increase in oxidative stress was observed, respectively (data not presented). Further, the degree of decrease in MI and increase in CA displayed a positive correlation with increasing NPs concentration and treatment time. Additionally, we observed that depending on the treatment time the sublethal concentration can produce lethal effect to the cells. Both virgin- and isolated-NPs caused clastogenic  and non-clastogenic  abnormalities in A. cepa  and increase in chromosome alterations Fig.\u00a0. Both NPepa Fig.\u00a0. Where t87. Recently, there has been increasing research interest in the potential application of NPs various medical applications, especially as drug delivery system89. In this circumstance, the present study highlights the urgent need for studying the adverse effects of NPs of different polymer type against human, plant and other animal systems using systematic as well as meticulous approaches, in addition to assessing the impacts of coronated-NPs on the immune system, vital organs and tissue cells and related defense response.At the outset, the present study provides direct evidences on; (i) multilayered corona formation on NPs during protein interaction and corona mediated protein-induced coalescence of NPs, while, from the protein point of view, the interaction caused conformational changes and denaturation of protein thereby turning it as bio-incompatible, (ii) the plasma coronated-NPs with increased protein structural alterations could cause extended cytotoxic and genotoxic effects on blood cells in compare to the virgin-NPs Fig.\u00a0, (iii) N8 and used for further studies. Detailed isolation procedure is presented in the Supplementary Information.Polystyrene nano-plastics  (NPs) with the size range of 100\u2009nm were purchased from Corpuscular Inc., NY, USA. On the other hand, NPs (~100\u2009nm) Fig.\u00a0 was isol\u22121. All the experiments and analysis preformed in this study were triplicated.In the neutral buffer system, 0.1% of human serum albumin  was allowed to interact with variable concentrations  of virgin-NPs for 4\u2009h at 110\u2009rpm in an incubator shaker. After incubation, HSA-NPs complex was separated and subjected to spectral property analysis where the changes during interaction was monitored between 200\u2013500\u2009nm under double beam spectrophotometer . Similarly, the intrinsic emission spectra of protein after interaction with NPs at different temperatures 283\u2009K, 300\u2009K, & 310\u2009K were recorded with excitation and emission wavelengths of 280\u2009nm and 340\u2009nm, respectively using a spectrofluorimeter  equipped with thermostatically peltier compartment operating with the scan speed of 200\u2009nm/min. Further, the modifications in the secondary structure of protein after NPs interaction was measured at far UV CD spectral range (200 to 260\u2009nm) using Circular Dichorism Spectropolarimeter  and the element of secondary structure protein were analyzed using an in build software provided by the JASCO manufacture . Finally, the HSA-NPs interaction was analyzed in IRAffinity-1 FT-IR spectrophotometer  between the wavenumber 4000 to 500\u2009cmHuman blood was collected from five healthy male volunteers  through venipuncture into heparinized vacutainers followed by plasma, erythrocytes and lymphocytes were separated and used for further experiments. All the experiments were performed in accordance with relevant bioethics guidelines and regulations and approved by Institutional Ethical Committee for Studies on Human Subjects (VIT/IECH/014/01.2015). The healthy male volunteers gave informed consent. Similar to HSA studies, five different concentrations of NPs  were allowed to interact with 3 volumes of blood plasma of each individual at room temperature for 4\u2009h, respectively. After incubation, the samples were subjected to HR-TEM, SDS-PAGE and toxicity analysis.90.HSA and plasma samples of post-NPs interaction were subjected to SDS-PAGE analysis using a 5% stacking gel and 10% separating gel under Mini-PROTEAN tetra cell system . Electrophoresis was performed according to the manufacturer\u2019s instructions and the protein was visualized by Coomassie blue stainingPhysical changes in the virgin-NPs interacted with HSA and plasma was examined under HR-TEM  as well as HR-SEM  by fixing a thin film of HSA/plasma-NP complex on copper grid. Prior to SEM analysis, the sample was coated with gold using sputter coater.6 cells/mL) were seeded in flat bottom 96-well plate containing serum free RPMI-1640 medium. Later, cells were treated with 100\u2009\u03bcL of plasma-NPs complex containing 1, 2.5, 5, 7.5 and 10\u2009\u03bcg of NPs derived respectively from 10, 25, 50, 75 and 100\u2009\u03bcg/mL of NPs-plasma interaction. In similar fashion, virgin-NPs dissolved in PBS were also used for the treatment. On the other hand, the toxicity of isolated-NPs was tested using 2.5, 5 and 25\u2009\u03bcg/mL concentrations. After 24\u2009h incubation at 37\u2009\u00b0C, 20\u2009\u03bcL of MTT (5\u2009mg/mL) was added and incubated for 4\u2009h, then 10% of DMSO was added to the wells and kept for 20\u2009min. Optical density at 590\u2009nm was measured on ELISA plate reader .Lymphocytotoxic effect of NPs was assessed by evaluating metabolic activity of cells via MTT -2, 5-diphenyl tetrazolium bromide) assay. Briefly, 100\u2009\u03bcL of freshly isolated lymphocytes  containing 1, 2.5, 5, 7.5 and 10\u2009\u03bcg of NPs and incubated overnight at 37\u2009\u00b0C. After incubation, the samples were centrifuged at 10000\u2009g for 5\u2009min and the supernatants were transferred to 96 well plate. The absorbance values at 570\u2009nm were recorded using a ELISA plate reader . Percentage of hemolysis was calculated by following formula;A. cepa were allowed to grow in ultrapure water for 2\u20133 days at room temperature for achieving 2\u20134\u2009cm root growth. The bulbs were transferred to ultrapure water containing 5, 10, 15, 20 and 25\u2009\u03bcg/mL of virgin-NPs. Similar set of treatment was performed with isolated-NPs. For control, separate set of bulbs were maintained in ultrapure water. At 3, 6, 12 and 24\u2009h interval, root tips were washed (ultrapure water), hydrolyzed (1\u2009N HCl) at 60\u201370\u2009\u00b0C for 15\u2009min. Thin sections of root tips were made and stained with aceto-orcein92, prior to microscopic examination (Detailed procedure is presented in Supplementary Information).Bulbs of Since the knowledge about biomolecule mediated transformation of NPs are scanty, it is very much required to understand the NPs behavior with biomolecules and its toxicity using a controlled reference system. Therefore, application of polystyrene beads to capture the critical causes at controlled biological system could pave the way to understand the effects of real world NPs. In this work, we have preliminarily showed the protein corona could possible cause coalescence effect in the NPs apart from the protein confirmation changes. Since the prominent proteins in blood are responsible for protein-induced coalescence of NPs, we believe such grain growth in NPs entered in blood stream could possibly block the in- and out-flow of body fluids. On the other hand, the NPs can interrupt mitotic activity and cause cytotoxicity to human and animal cells. This knowledgebase could be useful for acquiring/retrieving the perceptive toxicity information and health risk from real world NPs.Dataset 1"}
+{"text": "N,N-dimethylformamide (DMF), N-methylpyrrolidone (NMP) and dimethyl sulfoxide (DMSO) as well as in low polar/non-polar solvents like tetrahydrofuran (THF), chloroform and toluene; further, the dispersibility improved upon increasing FD. Thermogravimetric analysis (TGA) confirmed that the covalent attachment of HDI greatly improves the thermal stability of GO, ascribed to the crosslinking between adjacent sheets, which is interesting for long-term electronics and electrothermal device applications. The HDI-GO samples can further react with organic molecules or polymers via the remaining oxygen groups, hence are ideal candidates as nanofillers for high-performance GO-based polymer nanocomposites.Graphene oxide (GO), the oxidized form of graphene, shows unique properties including high mechanical strength, optical transparency, amphiphilicity and surface functionalization capability that make it attractive in fields ranging from medicine to optoelectronic devices and solar cells. However, its insolubility in non-polar and polar aprotic solvents hinders some applications. To solve this issue, novel functionalization strategies are pursued. In this regard, this study deals with the preparation and characterization of hexamethylene diisocyanate (HDI)-functionalized GO. Different reaction conditions were tested to optimize the functionalization degree (FD), and detailed characterizations were conducted via elemental analysis, Fourier-transformed infrared (FT-IR) and Raman spectroscopies to confirm the success of the functionalization reaction. The morphology of HDI-GO was investigated by transmission electron microscopy (TEM), which revealed an increase in the flake thickness with increasing FD. The HDI-GO showed a more hydrophobic nature than pristine GO and could be suspended in polar aprotic solvents such as  It presents superior electronic, thermal and mechanical properties, very large surface area and the highest electrical conductivity known at room temperature , OCNCH2CH2  and OCNCH2CH2CH2 ; these chemical shifts are in perfect agreement with those of the initial HDI, which confirms the lack of byproducts in the synthesis of HDI-GO.To corroborate the absence of urea and carbodiimide byproducts, the toluene removed during the filtration stage was analyzed by gas chromatography/mass spectrometry and RMN techniques. The chromatogram showed only one compound and the mass spectra revealed that this peak corresponded to the initial product. The Regarding the reaction carried out for 48 h (HDI-GO 3), a slight fall in FD is found , entry 4\u22121 and N=C=O stretching of the isocyanate groups at 2260 cm\u22121. These peaks gradually drop in intensity with increasing FD, indicative of a lower extent of the reverse reaction.On the other hand, the rise in the reaction temperature (HDI-GO 4) also resulted in a lower FD , entry 5Another factor that could influence the reaction yield is the solvent volume. Given that the functionalization reaction should take place on the surface groups of GO, the HDI and TEA have to diffuse from the bulk solution to the GO surface, and the diffusion is typically the slowest stage that controls the overall reaction rate. The solvent facilitates the diffusion of the reactant and catalyst towards the nanomaterial surface; if the solvent volume is too low, these cannot effectively diffuse, and the reaction becomes saturated. Therefore, low solvent volumes likely limit the reaction yield. Further, the solvent molecules arrange around the reactants forming solvent cages. This \u201ccage effect\u201d hinders the separation of the reactant molecules and easily absorbs the excess energy of products, thus favouring product formation . The incTo test this hypothesis, further experiments were carried out with double volume of solvent (HDI-GO 5 and HDI-GO 6). Besides, to enlarge the surface area of GO available for the reaction, it was subjected to sonication with an ultrasonic probe, a process that effectively induces the exfoliation of the nanomaterial into thinner sheets. However, this procedure generates defects in the GO flakes: Point defects on the basal plane and edge defects, which may have detrimental effects on the nanomaterial properties, and the number of defects rises with increasing ultrasonication time . Therefo\u22121 corresponding to the O\u2013H stretching vibrations, the peaks at around 2925 and 2845 cm\u22121 attributed to sp2 and sp3 C\u2013H stretching bands produced at defects sites of the graphene network, the peak at ~1730 cm\u22121 arising from the C=O stretching of the carboxylic acid groups, the band at 1620 cm\u22121 assigned to the aromatic C\u2013C stretching, that at ~1400 cm\u22121 corresponding to the O\u2013H deformation [\u22121 [The chemical changes that occurred upon treatment of GO with HDI were monitored by FT-IR spectroscopy, since both GO and the derivatives display characteristic IR spectra . As mentormation  and the \u22121 originating from symmetrical and asymmetrical stretching vibrations of \u2013CH2\u2013 became more intense upon raising FD, due to an increased number of methylene chains arising from the HDI. A new band appeared in the samples with low FD at 2280 cm\u22121 ascribed to unreacted N=C=O group [\u22121 in pristine GO is hidden by a new peak at ~1710 cm\u22121 ascribed to the C=O stretching of the carbamate ester groups [Upon treatment with HDI, the intensity of the O\u2013H stretching band was reduced, decreasing gradually with increasing FD, and also shifted towards lower wavenumbers, due to the overlapping with the N\u2013H stretching vibrations of the carbamate groups. Further, the peaks at 2845 and 2925 cm=O group , suggestr groups . This pe\u22121; the first can be assigned to the coupling of the C=O stretching with in-phase N\u2013H bending and the second to the coupling of the N\u2013H bending with the C\u2013N stretching vibration [\u22121, whilst for carbamate esters the bands are closer together due to the stronger \u03c0-\u03c0 interaction between the carbonyl group and the nitrogen lone pair electrons, and the amide II band appears at higher frequency [\u22121, likely related to \u2013C(=O)\u2013O and C\u2013N stretching vibrations of the carbamate groups, at 885 cm\u22121 attributed to C\u2013H out-of-plane bending vibrations of substituted aromatic rings and at around 720 cm\u22121, ascribed to the rocking of the methylene groups of HDI. On the basis of all the aforementioned observations, it can be concluded that GO was successfully functionalized with the organic HDI reactant and that the functionalization route via carbamate ester formation predominates.Besides, new intense bands can be observed at ~1648 and 1580 cmibration . These brequency . These trequency . Other bWater contact angle (CA) measurements were performed to evaluate the hydrophobic or hydrophilic character of the synthesized HDI-GO. In general, surfaces with contact angles \u226590\u00b0 are regarded as hydrophobic, or in other words water-repellent. As detailed in the introduction, the stability of HDI-GO in a range of solvents is a critical point for the preparation of dispersions to be applied in various fields. In this context, the solubility/dispersibility of the functionalized samples was investigated in water and organic solvents of different nature, and directly compared with that of pristine GO. The following organic solvents were tested: Acetone, methanol, ethanol, 2-propanol, THF, DMF, NMP, DMSO, chloroform, toluene, n-hexane and n-pentane. For solubility tests, a small quantity of GO or HDI-GO (~0.5 mg) was added to a given volume of solvent (~1 mL) in a test tube and gently stirred with a glass stirring rod for a few min. To check the dispersibility, the samples were sonicated in an ultrasound bath for 10 min. The results obtained from the solubility tests are summarized in Pristine GO is completely soluble in water, propanol, THF and NMP , entry 1In contrast to neat GO, the HDI-GO samples were hardly soluble in water and polar protic solvents, and the solubility decreased with increasing FD. However, upon a short ultrasonication treatment, they swelled and formed colloidal dispersions in polar aprotic solvents such as DMF, NMP and DMSO, and the dispersibility improved with increasing FD. The HDI-GO samples with higher FD showed better dispersibility in DMF and DMSO than the parent GO, and were stable for a few weeks. Owed to their higher hydrophobic character, they could also be more easily suspended in low polar solvents like THF or non-polar ones such as chloroform and toluene d. The reThe surface morphology of neat GO and the different functionalized samples was examined by TEM, and typical images at different magnifications of GO, HDI-GO 2, HDI-GO 5 and HDI-GO 6 are compared in The thickness of a single monolayer graphene nanosheet has been reported to be about 0.34 nm , and a GConversely, the HDI-GO samples seem more heterogeneous, and present a relatively fuzzy morphology due to the grafting of the HDI chains onto the nanomaterial surface. Apparently, the darker areas in the images correspond to the alkyl chains of the organic diisocyanate, since the number of dark areas increases with increasing FD. This is consistent with the results reported previously by other authors who grafted alkyl segments onto G via reaction with surfactant molecules ,49 or poIn the samples with higher FD, a morphology of fluffy and smooth surfaces in a stack state can be observed c, ascribIt should be noted that GO is non-homogeneously covered by the HDI chains in the derivatives with low FD b, wherea\u22121 that indicates the level of structural disorder and the tangential G band at ~1595 cm\u22121 arising from in-plane displacements in the graphene sheets.Raman spectroscopy was carried out to verify the structural changes in GO upon reaction with HDI, and the spectra of the different samples are compared in D/IG) is widely used to obtain quantitative information about the amount of defects in graphene materials: The higher the ratio, the higher the disorder [D/IG data for raw GO and the HDI-GO samples are summarized in 2 domains, owed to the covalent grafting of the HDI chains onto the GO surface. An analogous trend of ID/IG increase has been reported upon covalent functionalization of GO with other organic molecules such as 4-aminobenzenesulfonic acid [The D to G band intensity ratio  at 124 \u00b0C and exhibits the maximum rate of weight loss (Tmax) at ~235 \u00b0C , grow steadily as the extent of functionalization increases (i increased by about 80 \u00b0C from neat GO (Besides, the characteristic degradation temperatures, namely Tncreases , which c neat GO , entry 1 neat GO , entry 7HDI-GO derivatives with different functionalization degrees have been synthesized following a two-step approach: Firstly, GO was prepared using a modified Hummers\u00b4 method from graphite, and secondly GO was treated with HDI in the presence of a TEA catalyst to yield the modified nanomaterial. The FT-IR and Raman spectra corroborated the success of the reaction and that the functionalization route via carbamate ester formation predominated. The increase in the amount of HDI reactant and TEA catalyst, as well as the increase in the reaction time or temperature resulted in a drop in the extent of functionalization, whilst the combination of probe and bath sonication with higher solvent volumes led to the highest functionalization degrees. The HDI-GO displayed a more hydrophobic character than raw GO and could be dispersed in polar aprotic solvents such as DMF, NMP and DMSO as well as in some low polar/non-polar solvents like THF, chloroform and toluene. Further, the dispersibility in these solvents improved as the functionalization degree increased. The surface morphology of the samples was analyzed by TEM, and the images showed a raise in layer thickness with increasing extent of functionalization. TGA study revealed that the covalent grafting of HDI enhances the thermal stability of GO, ascribed to the crosslinking between neighbouring sheets. This thermal stability improvement is highly attractive for applications such as long-term electronics and electrothermal devices. Future work will focus on the reaction of HDI-GO with other organic molecules or polymers via the remaining oxygen groups, in order to develop high-performance GO-based nanocomposites."}
+{"text": "Providing culturally safe health care can contribute to improved health among Aboriginal people. However, little is known about how to make hospitals culturally safe for Aboriginal people. This study assessed the impact of an emergency department (ED)-based continuous quality improvement program on: the accuracy of recording of Aboriginal status in ED information systems; incomplete ED visits among Aboriginal patients; and the cultural appropriateness of ED systems and environments.Between 2012 and 2014, the Aboriginal Identification in Hospitals Quality Improvement Program (AIHQIP) was implemented in eight EDs in NSW, Australia. A multiple baseline design and analysis of linked administrative data were used to assess program impact on the proportion of Aboriginal patients correctly identified as Aboriginal in ED information systems and incomplete ED visits in Aboriginal patients. Key informant interviews and document review were used to explore organisational changes.p\u00a0<\u20090.001 in ED 4 and OR 1.15, p\u00a0=\u20090.020 in ED 5). In other words, the accuracy of recording of Aboriginality increased from 61.4 to 70% in ED 4 and from 72.6 to 73.9% in ED 5. If the program were not implemented, only a marginal increase would have occurred in ED 4 (from 61.4 to 64%) and, in ED 5, the accuracy of reporting would have decreased (from 72.6 to 71.1%). Organisational changes were achieved across EDs, including modifications to waiting areas and improved processes for identifying Aboriginal patients and managing incomplete visits.In all EDs combined, the AIHQIP was not associated with a reduction in incomplete ED visits in Aboriginal people, nor did it influence the proportion of ED visits made by Aboriginal people that had an accurate recording of Aboriginal status. However, in two EDs it was associated with an increase in the trend of accurate recording of Aboriginality from baseline to the intervention period (odds ratio (OR) 1.31, The AIHQIP did not have an overall effect on the accuracy of recording of Aboriginal status or on levels of incomplete ED visits in Aboriginal patients. However, important organisational changes were achieved. Further research investigating the effectiveness of interventions to improve Aboriginal cultural safety is warranted.The online version of this article (10.1186/s12913-019-4049-6) contains supplementary material, which is available to authorized users. In Australia, Aboriginal peopleAboriginal peoples\u2019 engagement with health care is influenced by the physical accessibility, affordability and cultural safety of health service provision . CulturaAboriginal people are overrepresented among ED patients, relative to population size . AdditioImproving the cultural safety of health services can contribute to improved health among Aboriginal people and is a health priority in Australia , 21. HowWe evaluated the Aboriginal Identification in Hospitals Quality Improvement Program (AIHQIP), a CQI initiative aiming to improve the cultural safety of Aboriginal patients in eight EDs in New South Wales (NSW), Australia. The study aimed to investigate whether the program: increased the proportion of Aboriginal patients correctly identified as Aboriginal in ED information systems; reduced the proportion of Aboriginal patients who had an incomplete ED visit; and improved the cultural appropriateness of ED systems and environments.Each participating ED implemented a CQI project with a focus on working with Aboriginal people to improve the cultural safety of ED services for Aboriginal patients. Each ED employed a project officer and established a working group to lead and guide project implementation. Working group membership typically included key hospital staff, staff of Aboriginal community-controlled organisations and local Aboriginal community members.Provision of a nine-step \u201cPlan, Do, Study, Act\u201d CQI framework with a unique emphasis on genuine partnership with Aboriginal communities. The framework included an implementation toolkit with supportive resources, such as an action plan template and examples of activities to aid each framework step. The nine steps of the framework are shown in Fig.\u00a0Provision of a 1.5\u2009day face-to-face training session for project officers and other interested working group members on how to implement the nine-step CQI framework and use the implementation toolkit. Key topics covered included: problem identification and solution generation; data collection and synthesis; action planning; guiding principles for collaborating with Aboriginal organisations; examples of best practice in the application of CQI; and the Aboriginal health policy context in NSW.Provision of between four and six site visits during which project officers were provided with tailored CQI and cultural competency advice, mentoring and resources, with additional support provided via email and telephone.Establishment of a network of project officers and other working group members from participating EDs to: share and discuss their CQI experiences; identify key facilitators and barriers to effective implementation; and share CQI resources. Two face-to-face meetings of the network were facilitated by the research team.The research team supported EDs to implement their CQI projects in the following ways:Each ED selected objectives for their CQI project from a predetermined list of objectives aligning with the overarching aims of the AIHQIP. Common project objectives included to: encourage Aboriginal patients to identify as Aboriginal in the ED; improve the Aboriginal cultural competence of ED staff and other hospital staff; improve collaboration between the ED and Aboriginal community-controlled organisations; and reduce incomplete ED visits among Aboriginal patients. Tailored strategies were developed, implemented and refined to meet these objectives.The AIHQIP was implemented in eight public EDs in NSW, one of eight States and Territories in Australia. About 7.5 million people live in NSW, of whom about 3%  are Aboriginal people . There aIn NSW, public EDs are operated by autonomous, geography-based health corporations called Local Health Districts, while the NSW Ministry of Health monitors and manages ED performance \u2013 for example, levels of re-presentation to the same ED within 48\u2009h among Aboriginal patients. Several policies and procedures are in place to improve Aboriginal peoples\u2019 experiences of emergency care in NSW, including mandatory Aboriginal cultural competency training for all hospital staff, mandatory recording of the Aboriginal status of hospital patients in information systems and a strategy for increasing and building the capacity of the Aboriginal health workforce in public hospitals, including EDs. Additionally, some EDs employ Aboriginal Liaison Officers (ALO) to provide emotional, social and cultural support to Aboriginal patients and their families when in hospital.Site selection was non-random. EDs were chosen to include a mix of rural and metropolitan EDs across multiple Local Health Districts. Additionally, executive support for implementing the AIHQIP and employment of an ALO were essential criterion for study participation, as these characteristics were considered fundamental to implementing the program as intended. The characteristics of participating EDs are included in Table\u00a0A multiple baseline design, qualitative interviews with program stakeholders and document review were used to evaluate the AIHQIP.A multiple baseline design  and secoNSW Public Health Act 2010 to support, among other things, evaluations of public health interventions. It includes linked records of the following datasets:NSW Admitted Patient Data Collection includes records of all separations in NSW private and public hospitals.NSW Register of Births, Deaths and Marriages includes records of all births, deaths and marriages registered in NSW.Cause of Death Unit Record File provides cause(s) of death for all deaths registered in NSW.NSW Emergency Department Data Collection includes records of all visits to public EDs in NSW. Data are obtained from patient information systems in local EDs.Data were obtained from the NSW Admitted Patient, Emergency Department Attendance and Deaths Register (APEDDR). The APEDDR is a statutory public health and disease register established under the These data sources were linked by the Centre for Health Record Linkage using probabilistic record linkage methods.The study population included Aboriginal people who attended one of the eight participating EDs between 1st January 2010 and 31st March 2015.The two outcomes investigated were the proportion of Aboriginal patients correctly identified as Aboriginal in ED information systems and rates of incomplete ED visits. Both are considered indirect indicators of the cultural safety of ED service provision .In NSW, staff in public EDs are required to ask every ED patient if they are AboriginalNSW Perinatal Data CollectionThe proportion of Aboriginal patients correctly identified as Aboriginal in ED information systems was assessed using the Enhanced Reporting of Aboriginality (ERA) variable in the APEDDR. The different datasets in the APEDDR and records of the Incomplete ED visits included visits for which the patient either left the ED before receiving a medical assessment or left the ED after a medical assessment but before completion of care or ED discharge. Feeling culturally unsafe is a main reason why Aboriginal people leave the ED early , 32. IncThe eight EDs were allocated to three clusters. The clustering of EDs was non-random and informed by practical considerations, such as readiness to start implementing the AIHQIP. Clusters were then randomly assigned an implementation order of first, second or third. It was intended that program implementation in each cluster would be separated by three months. However, some EDs experienced delays in implementing the AIHQIP such that the period separating program commencement in EDs ranged from one month to four months. The first cluster of EDs started implementation in August 2012, with the implementation period at each site ranging in duration from 10\u2009months to 15\u2009months , increases the likelihood that any detected improvement in outcomes is due to the intervention, rather than external factors .In determining program effectiveness, the main consideration was whether the trend in each outcome changed significantly, and in the desired direction, following program implementation. Change in intercept  was considered less relevant given the organisational changes the AIHQIP aimed to achieve can take a long time to establish.p-values. Data management and aggregations were performed in SAS version 9.3. Modelling was conducted in R version 3.2.1. An additional file provides a complete description of the statistical analysis [see Additional\u00a0file\u00a0Data were aggregated by month of ED presentation, hospital and patient sex, age group and Aboriginal status. Baseline patient characteristics were calculated for each site. Two modelling phases were undertaken for each outcome. First, preliminary logistic regression models were prepared for each study ED to investigate facility-level intervention effects. Following this, generalised linear mixed models were prepared to investigate the average intervention effect among all study EDs. Preliminary analyses identified a need to adjust for varying intercepts, trends and intervention effects between study sites. In all models, the key parameter of interest was the change in the linear trend from the control period to the intervention period. Parameter estimates were calculated, along with odds ratios, 95% confidence intervals and corresponding n\u00a0=\u200923) exploring factors influencing project implementation and perceived achievements. Interviewees were AIHQIP project officers (n\u00a0=\u20098), hospital managerial staff (n\u2009=\u20098), a hospital executive, an LHD Deputy Director of Aboriginal Health, and ALOs (n\u00a0=\u20095). Six of the 23 interviewees were Aboriginal people.Following implementation of the AIHQIP, qualitative interviews of 15\u201360\u2009min duration were conducted with participating ED staff and other hospital staff (Interviews were conducted in a quiet room in participating EDs (three were done by phone) by a non-Aboriginal researcher with experience conducting qualitative interviews with Aboriginal people. Detailed notes were taken during the interviews and circulated to interviewees for comment and verification. The notes were analysed using qualitative thematic analysis and a data mining approach. Responses were grouped under the questions that were asked during interviews. Following this, responses were repeatedly read to identify common themes and key achievements, both within individual EDs and across all sites.n\u00a0=\u200950) were also reviewed to describe changes to participating ED systems and environments relating to the cultural safety of Aboriginal patients. The main documents reviewed were site visit reports. Following each site visit, the research team and local working groups compiled a report using a standardised template. Reports described: the hospital context; the CQI support provided; implementation progress and challenges; and organisational changes perceived to be related to the AIHQIP. Documents were analysed using qualitative thematic analysis and a data mining approach (as described above), and findings triangulated with key informant interview findings. Several other methods were used as part of a comprehensive process evaluation of the AIHQIP. However, these are not the focus of this paper.Documents relating to the AIHQIP  and the Aboriginal Health and Medical Research Council of NSW Ethics Committee (Reference no. 856/12).During the control period, the average number of ED visits per month in the eight study EDs combined was 27,096 . The proportion of ED visits made by Aboriginal people that were incomplete also differed between study sites  . In other words, if the AIHQIP was not implemented the accuracy of recording would have increased from 61.4% in the control period to 64% 12\u2009months after the program was first implemented. However, program implementation was associated with a larger increase in the accuracy of recording during this period \u2013 from 61.4 to 70%.In ED 4, during the control period the odds of an ED visit made by an Aboriginal person having an accurate recording of Aboriginal status were increasing by a factor of 1.12 per year. During the intervention period, the odds were increasing by a factor of 1.47 per year (p\u00a0=\u20090.020) Additional file 2:Factors influencing implementation. Description of data: A detailed description of the factors influencing implementation, as reported by key informant interviewees. (DOCX 19 kb)"}
+{"text": "Brain-derived neurotrophic factor (BDNF), a member of the neurotrophin family, is involved in multiple and fundamental functions of the central and peripheral nervous systems including sensory organs. Despite recent advances in knowledge on the functional significance of BDNF and TrkB in the regulation of the acoustic system of mammals, the localization of BDNF/TrkB system in the inner ear of zebrafish during development, is not well known. Therefore, the goal of the present study is to analyze the age-dependent changes using RT-PCR, Western Blot and single and double immunofluorescence of the BDNF and its specific receptor in the zebrafish inner ear. The results showed the mRNA expression and the cell localization of BDNF and TrkB in the hair cells of the crista ampullaris and in the neuroepithelium of the utricle, saccule and macula lagena, analyzed at different ages. Our results demonstrate that the BDNF/TrkB system is present in the sensory cells of the inner ear, during whole life. Therefore, this system might play a key role in the development and maintenance of the hair cells in adults, suggesting that the zebrafish inner ear represents an interesting model to study the involvement of the neurotrophins in the biology of sensory cells  According to the World Health Organization, around 466 million people (5% of the populations) worldwide have disabling hearing loss. The onset of the hearing disorders originate from genetic problems to pharmacological treatments, through infectious diseases and exposure to strong noise. Particularly, the non-sensorineural hearing loss represents the most common hearing disorder, caused by a serious morphofunctional alterations of cochlear hair cells. Brain-derived neurotrophic factor (BDNF) belongs to the neurotrophin family and is involved in the development, maintenance and neuronal plasticity of the different neuronal subpopulations of the central and peripheral nervous systems . BDNF acThe inner ear in zebrafish is located in a bone capsule in the cranial cavity, posterolaterally to the optic tectum, just behind the eyes a,b. It iAt the end of each semicircular canals a dilated sac is present, called ampulla ossea, containing a cluster of sensory cells called crista ampullaris and a thick gelatinous cap called cupula a. The crEach otolith organ, containing an oval thickening called maculae of supporting cells, interdigitates among hair sensory cells . Dense calcareous structures are present in close proximity to sensory epithelium, the utricular otolith (lapillus), saccular otolith (arrow) and lagenar otolith (asterisk) located in a small cavity in the temporal bone d\u2013f. In tAlthough its dimensions have increased, the 15, 30 and 50 dpf ear is characterized by the semicircular canals and utricle, and the anatomical spatial organization and the histological features of the neuroepithelium are very similar to the adult zebrafish (data not shown). Bdnf and ntrk2b mRNA was assayed in the homogenates of zebrafish inner ear using reverse transcriptase PCR. Our observations demonstrated that Bdnf and ntrk2b are expressed at 8, 15, 30, 50 dpf and adult stage. B-actin controls for each condition were also conducted (The expression of onducted . The negative (not shown) and positive controls were performed to validate the obtained results. Moreover, in order to test the specificity of the antibodies utilized, we performed western blot analysis at the same age. Two specific protein bands with a molecular weight of 14 and 145 kDa, corresponding to the mammalian isoform of BDNF and TrkB respectively, were observed. \u03b2-Actin protein was used as an endogenous control to allow the normalization of BDNF and TrKB proteins .An immunohistochemical analysis was carried out in serial sections using single and double immunofluorescence. Cellular localization was performed in zebrafish larvae using double immunofluorescence with a monoclonal antibody against pro-BDNF and a polyclonal antibody against TrkB. Moreover, in order to identify the positive cells, we used a morpho-topographical approach based on the observation of the cellular histological features. The results, using confocal laser microscopy, demonstrated that pro-BDNF and TrkB were found only in the hair cells of the macule and cristae lateralis with an identical pattern of expression a\u2013f. To mRegarding the adult zebrafish, an intense and strong immunostaining for BDNF, and its specific receptor TrkB, was observed in the maculae of the utricle, saccule and lagena and more specifically in the hair bundle of the sensory cells a,b.Moreover, the immunohistochemical detection performed in serial sections, also using S100 protein as specific marker for hair cells in order to identify the cells displaying BDNF and TrkB, demonstrated a similar pattern of distribution . Both BDIn addition, BDNF, TrkB and S100 proteins were detected in the cristae ampullaris of the semicircular canals. Specific staining was found in a subpopulation of hair cells localized in the central and peripheral part of the sensory cells cluster respectively .This study demonstrates the expression and cell localization of the BDNF, and its specific receptor TrkB in the inner ear of zebrafish from larval to adult stages. Moreover, the S100 protein was also found in the sensory cells of the zebrafish inner ear. This finding is in complete agreement with previous results, demonstrating the presence and specificity of the S100 protein used as a specific marker for the identification of hair cells in the inner ear and lateral line system of zebrafish at different stages of development ,28,29,30In this study, we used eighty (80) zebrafish from larval to adult stage. Particularly, we utilized samples at 8 days post-fertilization (dpf), 15 dpf, 30 dpf, 50 dpf and adulthood. The fish were obtained from CISS  and kept on a 14 h day, 10 h night cycle at a constant temperature of 28.5 \u00b0C and were fed twice a day. All embryos were collected after natural spawning and staged according to Kimmel et al. . The fisBrachidanio rerio bdnf (GenBank accession number NM_131595) Brachidanio rerio ntrk2b (GenBank accession number NM_001197161.2) and Brachidanio rerio \u03b2-actin (GenBank accession number NM_131031) and were: bdnf forward: 5\u2032AACTCCAAAGGATCCGCTCA3\u2032, reverse: 5\u2032GCAGCTCTCATGCAACTGA3\u2032, for ntrk2b forward: 5\u2032ACGAGG-ACCACATGAAGTTC3\u2032, reverse: 5\u2032GCAGAACGTCTCTTTCACTG3\u2032 and for \u03b2-actin forward: 5\u2032 CACAGATCATGTTCGAGACC3\u2032, reverse 5\u2032GGTCAGGATCTTCATCAGGT3\u2032. The conditions of amplification were as follows: 2 U Taq DNA Polymerase , 1 \u00b5M primers, 10 ng zebrafish brain cDNA, 0.2 mM each dNTP in 15 \u00b5LTaq DNA Polymerase buffer. The reaction was performed in a thermal cycler (Hyband Th. Cycler) with the following program: 1 min at 94 \u00b0C initial denaturation, then 10 cycles of 94 \u00b0C for 1 min, 65 \u00b0C for 30 s and 72 \u00b0C for 45 s, followed by 20 cycles of 94 \u00b0C for 1 min, 61 \u00b0C for 30 s, 72 \u00b0C for 45 s and a 5 min final extension at 72 \u00b0C. The PCR products were visualized by ethidium bromide staining under UV light following electrophoresis on a 2% agarose gel.For the isolation of RNA and Reverse Transcription PCR, total RNAs were extracted using Trizol reagent . The integrity of RNA was checked using agarose gel electrophoresis. RNA extracted was reverse-transcribed in a final volume of 20 \u00b5L using 20 U of Superscript RNA-ase H2 Reverse Transcriptase  in the manufacturer\u2019s buffer containing 2 \u00b5g RNA, 5 \u00b5M oligo (dT), 12\u201318 mM dNTPs 40 U RNA-ase inhibitor , 0.1 \u00b5g/\u00b5L BSA and 10 mM DTT. The reaction took place at 42 \u00b0C for 90 min. The sequences of the oligonucleotide primers were based upon the published sequences for, w/v) with a Potter homogenizer in Tris\u2013HCl buffered saline  containing 1 \u00b5M leupeptin, 10 \u00b5M pepstatin and 2 mM phenylmethylsulfonyl fluoride. The homogenates were then centrifuged at 25,000\u00d7 g for 15 min at 4 \u00b0C, and the resulting pellet dissolved in 10 mM Tris\u2013HCl, pH = 6.8, 2% SDS, 100 mM DTT, and 10% glycerol at 4 \u00b0C. The pellets were thawed and analyzed by electrophoresis in 10% (for Trks) or 15% (for NTs) polyacrylamide SDS gels. After electrophoresis, proteins were transferred to a nitrocellulose membrane and unspecific binding was blocked by incubation for 3 h in phosphate-buffered saline containing 5% dry milk, and 0.1% Tween 20. The membranes were then incubated at 4 \u00b0C for 2 h with primary antibodies against BDNF and TrkB proteins. We used rabbit polyclonal antibodies against an amino-terminal sequence of mouse BDNF  and TrkB . These antibodies have been characterized elsewhere for use in zebrafish and are suitable for use in Western blot and immunohistochemistry [Frozen material was processed for Western blot. Experiments were performed in triplicate as follows: they were rinsed in cold saline, then pooled and homogenized  0.1 M pH = 7.4 and incubated for 30 min in a PBS solution of fetal bovine serum to avoid non-specific binding, followed by incubation with the primary antibodies. Incubation was carried out overnight at 4 \u00b0C in a humid chamber. We used mouse monoclonal antibody pro-BDNF, also designated preproprotein BDNF antibody  and rabbit polyclonal antibodies against a sequence of amino-terminal mouse BDNF , TrkB  and S100 protein directed against bovine S100 protein  and it detects both S100A and S100B proteins (manufacturer\u2019s notice) ,28,48. ATwo heads of adult zebrafish utilized for the anatomical study before being fixed, were put in a tank containing tap water for one month in order to accelerate the tissues maceration process ,50. Duri"}
+{"text": "Ti alloys have attracted continuing research attention as promising biomaterials due to their superior corrosion resistance and biocompatibility and excellent mechanical properties. Metastable \u03b2-type Ti alloys also provide several unique properties such as low Young\u2019s modulus, shape memory effect, and superelasticity. Such unique properties are predominantly attributed to the phase stability and reversible martensitic transformation. In this study, the effects of the Nb and Zr contents on phase constitution, transformation temperature, deformation behavior, and Young\u2019s modulus were investigated. Ti\u2013Nb and Ti\u2013Nb\u2013Zr alloys over a wide composition range, i.e., Ti\u2013(18\u201340)Nb, Ti\u2013(15\u201340)Nb\u20134Zr, Ti\u2013(16\u201340)Nb\u20138Zr, Ti\u2013(15\u201340)Nb\u201312Zr, Ti\u2013(12\u201317)Nb\u201318Zr, were fabricated and their properties were characterized. The phase boundary between the \u03b2 phase and the \u03b1\u2032\u2032 martensite phase was clarified. The lower limit content of Nb to suppress the martensitic transformation and to obtain a single \u03b2 phase at room temperature decreased with increasing Zr content. The Ti\u201325Nb, Ti\u201322Nb\u20134Zr, Ti\u201319Nb\u20138Zr, Ti\u201317Nb\u201312Zr and Ti\u201314Nb\u201318Zr alloys exhibit the lowest Young\u2019s modulus among Ti\u2013Nb\u2013Zr alloys with Zr content of 0, 4, 8, 12, and 18 at.%, respectively. Particularly, the Ti\u201314Nb\u201318Zr alloy exhibits a very low Young\u2019s modulus less than 40 GPa. Correlation among alloy composition, phase stability, and Young\u2019s modulus was discussed. Metallic materials such as Ti alloys, cobalt-chromium based alloys and stainless steels have been extensively used as structural biomaterial. One of the critical issues associated with metallic biomaterials is their high Young\u2019s modulus because the large difference of the elastic modulus between metallic implants and adjacent bone tissues can lead to stress shielding, causing bone resorption and osteoporosis ,2. AmongOver the last decades, there have been extensive studies to reduce Young\u2019s modulus of Ti alloys as much closer to those of bone tissues ,15,16,17Mo equivalent (eqMo), electron to atom ratio (e/a), and d-electron alloy design theory. The Mo equivalent is an empirical parameter representing the contribution of alloying elements on the stability of \u03b2 phase in comparison to that of Mo. Although eqMo has been widely used as a guideline to design \u03b2-type Ti alloys, there have been some controversial issues concerning the effect of alloying elements on the stability of \u03b2 phase and modification has been continued [e/a) is also a representative measure of the elastic constants of bcc crystals. It has been reported that as a decrease in the value of e/a, the shear modulus c\u2032 = (c11 \u2212 c12)/2 and bulk modulus B of a bcc crystal decrease, causing the \u03b2 phase to become unstable [d-electron alloy design theory is based on molecular orbital calculations. Two key parameters of this theory are the bond order (Bo) and the d-orbital energy level (Md) which are calculated for each alloying element. Bo is parameter to show the overlapping of the electron clouds of adjacent two atoms, which is a measure of the covalent bond strength between Ti and alloying element. Md is found to be closely related with electronegativity and atomic radius of each alloying element. The average values of Bo and Md, calculated by taking the compositional averages, have been utilized to predict phase boundaries and the stability of the \u03b2 phase. Experimental results have validated that the \u03b2 phase becomes unstable with decreasing Bo or with increasing Md [Bo-Md map shifts as the change of constituent alloying elements [It has been confirmed that the Young\u2019s modulus of \u03b2-type Ti alloys is strongly dependent on the stability of the \u03b2 phase ,36,37,38ontinued . The aveunstable ,36,37,38asing Md ,41,42,43elements .Bo-Md map for Ti alloys is useful to predict the martensitic transformation temperature and deformation mechanism [e/a, Bo, and Md, and the experimental data are still insufficient to understand the mechanisms involved. This study focuses on the effect of the Zr addition on the phase stability and Young\u2019s modulus in Ti\u2013Nb alloys because Zr has been used as a major alloying element in \u03b2-type Ti alloys for biomedical applications due to its superior biocompatibility [Bo and Md without changing e/a. Ti\u2013Nb\u2013Zr alloys with various Nb and Zr contents were fabricated and the composition dependence of phase constitution and deformation behavior was investigated. The phase boundary between the \u03b2 phase and the \u03b1\u2032\u2032 martensite phase in Ti\u2013Nb\u2013Zr alloys was clarified. The relations among phase stability, martensitic transformation behavior, and Young\u2019s modulus were analyzed. Finally, a novel guideline to design \u03b2-type Ti alloys with low Young\u2019s modulus was proposed.\u03b2-type Ti alloys have also attracted attention as biomedical shape memory alloys ,50,51,52echanism ,55,56,57tibility ,30,32,33tibility ,58. FurtA total of 44 alloys were investigated in this study. The alloys are named in their Nb content and Zr content. For binary Ti\u2013Nb alloys, ten compositions with different Nb content from 18 to 40 at.%, which are denoted as Ti\u2013(18\u201340)Nb, were investigated. For Ti\u2013Nb\u2013Zr ternary alloys, 4 different series of alloys containing 4 at.% Zr, 8 at.% Zr, 12 at.% Zr or 18 at.% Zr were investigated where the range of Nb content is indicated in parenthesis. All the alloy compositions investigated in this study are indicated in the isothermal sections of the Ti\u2013Nb\u2013Zr phase diagram at 1173 K . Ti\u2013 with Cu K\u03b1 radiation . Microstructural characterization was performed using a scanning electron microscope . Tensile tests were carried out along the rolling direction using dog-bone specimens with a 20-mm gauge length and 1.5-mm width at a strain rate of 0.005 mm/s at room temperature. The strain of the specimens was measured using a non-contacting video extensometer  with two targets. Transformation temperatures were evaluated from differential scanning calorimetry (DSC) curves. The DSC measurements were performed at heating rate of 10 K/min in the Shimadzu DSC-60 .Ms) decreases with increasing Nb content and becomes below room temperature when the Nb content is 26 at.%. In consequence, it is clear that the lower limit content of Nb to suppress the martensitic transformation and to obtain a single \u03b2 phase is 26 at.% in the Ti\u2013Nb binary alloys, which is consistent with previous reports [Ms below room temperature, i.e., to obtain a single \u03b2 phase at room temperature, further decreased from 22 at.% to 19 at.%, 17 at.% and 14 at.%, respectively. Ms and plays a role to stabilize the \u03b2 phase [Ms of Ti\u2013Nb alloys, which is equivalent to about two thirds of Nb.Phase constitutions of Ti\u2013Nb\u2013Zr alloys annealed at 1173 K for 0.3 ks were investigated by XRD at room temperature.  reports ,60. For  \u03b2 phase ,48,59. WMechanical properties and deformation behavior are also strongly dependent on Nb and Zr contents. The stress\u2013strain curves of Ti\u201340Nb and Ti\u201340Nb\u2013 Zr alloys which have fully stabilized \u03b2 phase are compared in As) for the Ti\u2013Nb\u2013Zr alloys with various Zr content is plotted as a function of the Nb content in As temperature decreases with increasing Nb content with a slope of \u221228 K/1 at.% Nb for the binary Ti\u2013Nb alloys. The slope became steeper with increasing Zr content, namely from \u221243 K/1 at.% Nb for the Ti\u2013Nb\u20134Zr alloys to \u221266 K/1 at.% Nb for the Ti\u2013Nb\u201318Zr alloys. It is also noted that the Ti\u201324Nb, Ti\u201318Nb\u20138Zr, Ti\u201316Nb\u201312Zr, and Ti\u201313Nb\u201318Zr alloys have almost similar values of 400 K, indicating that the impact of Zr on decreasing As temperature is equivalent to about two thirds times that of Nb. This result is in good agreement with microstructural observation and the composition dependence of deformation behavior.In order to clarify the effect of Nb and Zr content on the reverse transformation temperature, DSC measurements were performed by heating samples taken from the specimens that had been loading\u2013unloading tested, and the results are shown in Young\u2019s moduli of the Ti\u2013Nb and Ti\u2013Nb\u2013Zr alloys were evaluated using the stress-strain curves and they are plotted as a function of Nb content in e/a is a dominant factor governing the elastic constants and Young\u2019s modulus of bcc transition metals including \u03b2-type Ti alloys [e/a. For comparison purposes, the results of some \u03b2-type Ti alloys [e/a of the alloys investigated in this study decreased with increasing Zr content as follows: Ti\u201325Nb, 4.25; Ti\u201322Nb\u20134Zr, 4.22; Ti\u201319Nb\u20138Zr, 4.19; Ti\u201317Nb\u201312Zr, 4.17; and Ti\u201314Nb\u201318Zr, 4.14. The decrease is attributed to the fact that Zr decreases Ms of the alloys, and the addition of Zr shifts the phase boundary of (\u03b2 + \u03b1\u2032\u2032)/\u03b2 toward lower Nb content. Although the data were somewhat scattered, there is a clear tendency of decreasing Young\u2019s modulus with decreasing e/a in accordance with the previous reports [e/a to maintain the \u03b2 phase. Similarly, Sn is considered as a useful alloying element because it also decreases the Ms of the alloys while keeping e/a. These results may have important implications for developing useful guidelines for alloy design.Previous studies have demonstrated that i alloys ,33,35. Ii alloys ,63,64,65 reports ,33,35,66c\u2032 and c44 [c\u2032 and c44 and lower limit of Young\u2019s of Ti\u2013Nb based alloys are dependent on electronic hybridization of electronic structures. They also proposed that the addition of a second transition metallic element can be useful for reducing Young\u2019s modulus by tuning atomic bonding structure and elastic constants. It is suggested that Zr is a promising alloying element to control atomic bonding structure without increasing e/a. Further studies are required to evaluate the impact of Zr on the electronic structure of multicomponent \u03b2-Ti alloys and its effect on the elastic constants and Young\u2019s modulus.It has been demonstrated that Young\u2019s modulus of the \u03b2 phase is governed by elastic constants of  and c44 . Very re and c44  reportedBo-Md maps have been used successfully as guideline for alloy design of Ti alloys. Bo-Md map representing phase boundaries, where Ms = RT line corresponds to the phase boundary of (\u03b2 + \u03b1\u2032\u2032)/\u03b2. The alloys investigated in this study, i.e., Ti\u2013(24\u201327)Nb, Ti\u2013(20\u201323)Nb\u20134Zr, Ti\u2013(16\u201320)Nb\u20138Zr, Ti\u2013(14\u201319)Nb\u201312Zr, and Ti\u2013(13\u201316)Nb\u201318Zr alloys, are represented in Md region from the line suggested by Morinaga et al. [Bo-Md map [Md increased.As was mentioned in the introduction, a et al.  and Abdea et al. . These r, Ti\u201314\u20131Nb\u201312Zr, o-Md map ,42. It i(1)The addition of Zr decreases the martensitic and reverse transformation temperatures of Ti\u2013Nb alloys. The influence of Zr on decreasing the transformation temperatures is weaker, i.e., about two thirds that of Nb. The minimum Nb content to maintain the \u03b2 phase at room temperature continuously decreases with increasing Zr content.(2)Mechanical properties and deformation behavior strongly depend on Nb and Zr contents. Deformation behavior changes from double yielding to single yielding with increasing Nb or Zr content. The critical stress for the first yielding takes a minimum value at the composition locating near the phase boundary of (\u03b2 + \u03b1\u2032\u2032)/\u03b2. For Ti\u2013Nb\u2013Zr alloys with fully stabilized \u03b2 phase, the yield stress increased with increasing Zr content.(3)Young\u2019s modulus gradually decreases with decreasing Nb content, reaching a minimum value, and then increases again with further decreasing Nb content. The Nb content taking the minimum value of Young\u2019s modulus was shifted to lower values as the increase in the Zr content. The Ti\u201325Nb, Ti\u201322Nb\u20134Zr, Ti\u201319Nb\u20138Zr, Ti\u201317Nb\u201312Zr and Ti\u201314Nb\u201318Zr alloys exhibit the lowest Young\u2019s moduli among Ti\u2013Nb\u2013Zr alloys with Zr contents of 0, 4, 8, 12, and 18 at.%, respectively. The minimum Young\u2019s modulus decreases with increasing Zr content. Particularly, the Ti\u201314Nb\u201318Zr alloy exhibits a very low value of 39 GPa.(4)e/a to maintain the \u03b2 phase. The addition of Zr shifts the phase boundary of (\u03b2 + \u03b1\u2032\u2032)/\u03b2 downward in the Bo-Md map. Young\u2019s modulus of Ti\u2013Nb\u2013Zr alloys located on the phase boundary of (\u03b2 + \u03b1\u2032\u2032)/\u03b2 decreases as the Md increases.The addition of Zr in Ti\u2013Nb alloys reduces the lower limit of In this study, the effects of the Nb and Zr contents on phase constitution, transformation temperature, deformation behavior, and Young\u2019s modulus in Ti\u2013(12\u201340)Nb\u2013(0\u201318)Zr alloys were investigated. The main conclusions are as follows:"}
+{"text": "Kawasaki disease (KD) is the leading cause of acquired pediatric heart disease in the developed world as 25\u201330% of untreated patients and at least 5% of treated patients will develop irreversible coronary artery lesions (CAL). Pentraxin-3 (PTX-3) has been well-studied in inflammatory diseases, particularly in cardiovascular diseases associated with vascular endothelial dysfunction. We hypothesized that PTX-3 plays an important role in the development of KD-associated CAL and investigated the circulating levels of PTX-3 in the serum of KD patients. Children with acute KD were followed from diagnosis through normalization of the clinical parameters of inflammation . Serum samples were obtained and echocardiograms were conducted at several phases of the illness: acute [prior to intravenous immunoglobulin (IVIG) treatment], sub-acute (5\u201310 days after IVIG treatment), and convalescent (1\u20134 months after KD diagnosis). Seventy children were included in the final cohort of the study, of whom 26 (37%) presented with CAL and 18 (26%) developed IVIG resistance. The patients included in this study came from diverse ethnic backgrounds, mostly with mixed ancestry/ ethnicity. Significantly increased PTX-3 levels were observed during the acute phase of KD compared to the sub-acute and the convalescent phases. The PTX-3 levels during acute KD were significantly higher among KD patients with CAL compared to patients with normal coronary arteries (NCA). Also, the PTX-3 levels were significantly higher in patients with IVIG resistance. Furthermore, the PTX-3 levels were significantly higher in IVIG-resistant KD patients with CAL as compared to the NCA group. Moreover, the PTX-3 levels were significantly correlated to coronary artery z-score during acute KD and to neutrophil counts throughout KD progression regardless of coronary artery z-score. Elevated PTX-3 levels correlated to elevated neutrophil counts, a known source of PTX-3 in acute inflammation and an important player in the development of KD vasculitis. We, therefore, suggest PTX-3 as a novel factor in the development of KD-associated CAL and propose neutrophil-derived PTX-3 as contributing to KD vascular dysfunction. Kawasaki disease (KD) is the leading cause of acquired pediatric heart disease in the developed world, presenting in young children as acute, febrile, self-limiting, systemic vasculitis , 2. The A specific diagnostic test for timely and accurate identification of KD would be a boon to clinicians, facilitating early treatment and reduction of the risk for development of coronary involvement. Previous studies have demonstrated the risk for CAL in KD patients who present with higher baseline coronary artery dimensions, exhibit IVIG resistance , or have a delay in diagnosis causing a delay in treatment \u201315. SeveCurrent theories of KD pathogenesis include (i) infection with classic immune responses to an as-yet identified pathogen(s), (ii) an autoantibody or T-cell driven autoimmune response triggered by an antigen, i.e., molecular mimicry, and (iii) an autoinflammatory response, which includes innate immune responses that cause systemic inflammation as well as damage to the coronary arterial wall . PreviouPTX-3 is a member of the pentraxin protein family, a class of soluble pattern recognition receptors (PRR), which includes C-reactive protein (CRP), a widely used laboratory parameter of clinical inflammation, and serum amyloid P component . This faAll children recruited in this study were admitted to the KMCWC in Honolulu, Hawai\u2018i, between October 2013 and November 2018. The children were evaluated by experienced clinicians at KMCWC and fulfilled the diagnostic criteria for KD as endorsed by the American Heart Association (AHA). All patients were treated, per AHA guidelines, with IVIG and high-dose acetylsalicylic acid as primary treatment. IVIG resistance was defined as patients having a persistent or recurrent fever for more than 36 h after completion of the initial IVIG treatment. Serum was separated within 24 h of blood collection and stored at \u221280\u00b0C until further analysis. The serum samples for research were collected from a total of 70 patients at three phases: 62 patients at the time of KD diagnosis/disease onset and prior to IVIG treatment (acute phase), 65 patients at 1 to 2 weeks following IVIG treatment (sub-acute phase), and 64 patients at 3 weeks to 4 months following disease onset . There were 53 patients whose samples were obtained at all three phases. Convalescence was defined by the normalization of the clinical laboratory features of KD such as elevated erythrocyte sedimentation rate (ESR), C-reactive protein (CRP) levels, and white blood cell (WBC) counts. In addition to these parameters, echocardiogram measurements and additional clinical laboratory data  were evaluated at each phase of the disease. The echocardiogram measurements were collected for all patients at each phase of the disease. However, not all clinical laboratory parameters were captured at each phase of the disease in all patients.A complete echocardiogram was conducted as part of the standard diagnostic evaluation of KD for all patients at each phase of the disease. The inner diameter of the right coronary artery (RCA) and the left anterior descending coronary artery (LAD) was measured in the modified parasternal views, and the z-score of the coronary artery diameters was calculated based on the patient's body surface area using the Boston dataset for standards . CAL wasCirculating levels of PTX-3 were measured in the patient's serum samples by MILLIPLEX MAP Human Cardiovascular Disease Multiplex Assay  following the manufacturer's instructions. The patient's samples were tested in duplicate. Plates were analyzed on a Luminex 200 system  and data were analyzed using xPONENT 3.1 (Luminex Corp.) and Milliplex Analyst 5.1 Software (MilliporeSigma).Q\u2013Q plot and residual plots) and the outcome variables were transformed by natural logarithm to satisfy the model assumption . With the final model, Tukey's post-hoc test was conducted to compare the different phases. Spearman's correlation was computed to assess bivariate associations between PTX-3 and coronary artery z-score or clinical laboratory variables at each phase of KD. Fisher's exact test was used to evaluate the IVIG response group effect and computed odds ratio. Repeated-measures ANOVA, Spearman's correlations, and Fisher's exact test were conducted using GraphPad Prism version 8.4.0 . To assess the association between immune factors and laboratory variables over the clinical course of KD, repeated-measures correlations were calculated using the package  for continuous variables and frequency and percentage for categorical variables. Repeated-measures analysis of variance (ANOVA) was used to characterize how clinical laboratory parameters and PTX-3 levels change over the course of KD pathogenesis  (within-factor) and CAL (between-factor), accounting for within-subject dependence. Model diagnostics were explored  and girls , with 86% (n =60) under 5 years of age , and half of the patients reported two or more ethnicities (up to five)   received primary treatment within the first 10 days of onset of fever; IVIG resistance was observed in 18 patients (26%)  . Most pats (26%) .n = 15; 3.96 (3.27\u20134.35)], with fewer during the sub-acute phase , and none at the convalescent phase. Clinicoepidemiological characteristics were reported among patients with normal coronary arteries (NCA) and CAL. We did not observe any significant differences in clinicoepidemiological characteristics among the NCA and the CAL groups, with the exception of IVIG resistance placing children at a higher risk for CAL . However, in our study population, males accounted for more of the CAL patients  as compared to females , and White children were less susceptible to CAL  as compared to non-White children .This study included 26 (37%) patients who presented with CAL . Among pThe KD patients were evaluated for circulating levels of PTX-3 throughout the clinical course of the disease. This analysis revealed a significant increase in PTX-3 levels in the acute  as compared to the sub-acute  and the convalescent  KD phases , Table 2n = 26), and all other KD patients were included in the NCA group (n = 44). During the acute phase, the PTX-3 levels  in the CAL group were significantly higher as compared to the NCA group  . However, this relationship was lost at the sub-acute and the convalescent KD phases  . There w8\u201316.01) , Table 3D phases .vs. NCA groups. None of the parameters evaluated revealed any significant differences between these two patient groups  demonstrated a significant, strong positive correlation between PTX-3 and ESR, CRP, WBC, and ANC and significant, strong negative correlations with Hct, ALC, and PLT (rs) between PTX-3 and the clinical laboratory parameters  and Spearman's correlation (rs) analyses between the two groups. Overall, the rrm and rs correlations were stronger in the CAL group. Similar to the un-stratified analysis, the rrm analysis in both the NCA and the CAL groups showed a significant, strong positive correlation between PTX-3 and ESR, CRP, WBC, and ANC and significant, strong negative correlations with ALC and PLT  in this study. Comparisons of the coronary artery z-scores between IVIG-responsive and IVIG-resistant patients demonstrated significantly larger coronary artery z-scores throughout KD progression among IVIG-resistant patients as compared to IVIG-responsive patients (IVIG resistance is a well-known risk factor for CAL. Our study population included 18 (26%) IVIG-resistant patients , of whompatients , Table 4patients , Table 4p = 0.99)  , Table 4 = 0.99) , Table 4PTX-3 is produced in response to proinflammatory signals and microbial stimulation and by a wide variety of immune and endothelial cells with roles in the regulation of inflammation and complement activation as well as in vascular inflammation and endothelial cell dysfunction , 32. EleConsistent with previous studies of clinical laboratory data in KD progression \u201348, in oThe positive repeated-measures correlation and Spearman's correlation in the acute phase between WBC, specifically neutrophils and PTX-3, suggest neutrophils as a possible source for PTX-3. Neutrophils have been shown to release PTX-3 when activated in cardiovascular disease and sepsis , 34, 39.It has been suggested that PTX-3 plays dual roles, both protective and harmful, in the development and the progression of a cardiovascular disease , 28, 61.There have been several studies investigating PTX-3 in the context of coronary artery disease, with conflicting results. In nine studies, published between 2004 and 2017, among adult study populations conducted in Asia, Europe, and North America, there seems to be a consensus that patients with coronary disease and higher circulating PTX-3 levels had an increased risk of all-cause mortality, cardiac death, and cardiac events . In our Stratification of KD patients by coronary artery z-scores in the CAL and the NCA groups revealed a stronger repeated-measures correlation between PTX-3 and the clinical assessments of inflammation in the CAL group. Previous studies have observed elevated sub-acute and convalescent WBC and ESR levels  and highIVIG resistance is a risk factor for the development of CAL in KD . Fever sResearchers in Japan who evaluated the transcriptional regulation of infliximab therapy in IVIG-resistant KD patients identified high levels of PTX-3 transcript levels in IVIG-resistant KD patients . TherefoStudies of clinical laboratory markers have described elevated CRP, liver enzyme level, WBC, and neutrophil counts to be associated with KD patients resistant to IVIG treatment . Our datIn this study, we demonstrate the potential role of PTX-3 in KD pathogenesis and particularly in coronary dilation that is the most significant outcome of the disease. A strength of these findings is that they have been obtained in a population of mixed ethnicity. Ethnicity is a well-known risk factor for KD and KD-associated CAL. Much KD research has been conducted in ethnically homogenous study populations . Our study's geographic setting in Hawai\u2018i has resulted in a heterogeneous study population, including a majority of mixed-race patients. Perhaps this allows the associations that we detect to have more robust disease implication rather than geographic or ethnic specificity.The limitations of this study include limited sample size, particularly within the CAL group, and some incomplete sampling of patients at a few time points. Convalescent phase samples were used as individual patient controls; however, the diagnosis of KD requires distinguishing KD patients from other febrile children admitted to the emergency room who present with similar symptoms . Thus, additional studies investigating the specific role of PTX-3 in KD patients as compared to febrile and afebrile controls are warranted to evaluate the diagnostic potential of PTX-3. During normal physiological conditions, PTX-3 has been demonstrated as a non-specific systemic inflammatory protein known to have very low to undetectable levels in the circulation. The serum PTX-3 levels dramatically increase within 6\u20138 h of infection and inflammation . Thus, tCurrently, KD diagnosis relies on the identification of specific symptoms by an experienced clinician. Without prompt diagnosis and administration of treatment, KD patients are at an increased risk for severe complications such as CAL and aneurysm formation, which may result in permanent coronary vasculopathy and life-long risk for cardiovascular diseases . TherefoThe raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.This study was approved by the Kapi'olani Medical Center for Women and Children (KMCWC) Institutional Research and Ethics Committee (Western Consortium IRB Study No. 1140512). Informed consent was obtained from the parents or guardians of all patients prior to enrollment and specimen collection.AB, MM, VN, and RS conceptualized and designed the study and interpreted the data. LC and VN conceptualized and designed the PTX-3 study. LC acquired the data, conducted an initial statistical analysis of the data, interpreted the data, and drafted the initial manuscript. VN supervised the data collection, interpreted the data, and drafted the initial manuscript. EL conducted a formal statistical analysis of the data. All authors reviewed and edited the final manuscript and have read and agreed to the published version of the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Background: Kawasaki disease (KD) is a common cardiovascular disease in infants and young children, with fever, rash, and conjunctivitis as the main clinical manifestations, which can lead to the occurrence of coronary aneurysms. Intravenous immunoglobulin (IVIG) is the preferred treatment for KD patients, but 10\u201320% of patients are resistant to IVIG. Lipoprotein-associated phospholipase A 2 (Lp-PLA2) is a potential therapeutic target for coronary atherosclerotic heart disease, and the polymorphism of Phospholipase A2 Group VII (PLA2G7) is closely related to the activity of Lp-PLA2, of which rs1051931 is the strongest. Therefore, the rs1051931 polymorphism may be a predictor of IVIG resistance in KD patients.Methods: A total of 760 KD cases, including 148 IVIG-resistant patients and 612 IVIG-responsive patients, were genotyped for rs1051931 in PLA2G7, we compared the effects of rs1051931 on IVIG treatment in KD patients by odds ratios (OR) and 95% confidence interval (CI).Results: The homozygous mutation AA may be a protective factor for IVIG resistance in KD patients  and is more evident in patients with KD aged <60 months .Conclusions: The PLA2G7 rs1051931 G>A polymorphism may be suitable as a biomarker for the diagnosis or prognosis of IVIG resistance in KD in a southern Chinese population. Kawasaki disease (KD), known also as Kawasaki syndrome or mucocutaneous lymph node syndrome, is an acute systemic vasculitis that primarily affects infants and young children , 2. The PLA2G7 encodes plasma PAF acetylhydrolase (PAF-AH), an extracellular Lp-PLA2, whose activity is related to large-artery atherosclerotic etiology and recurrent stroke in transient ischaemic attack patients , which has been associated with circulating Lp-PLA2 and atherosclerotic disease . Additionally, in order to ensure the quality and accuracy of the genotyping results, we randomly selected 10% of the samples for repeated analysis, and the results were completely consistent.Genomic DNA was extracted from anticoagulant-containing peripheral blood collected from patients using the TIANamp Blood DNA Kit  according to the manufacturer's instructions. The procedures can be found in our previous paper . The PLA2 test to evaluate the significant differences between IVIG-resistant cases and IVIG-responsive cases in the frequency distributions and genotypes. Odds ratios (OR) and 95% confidence intervals (CI) were used to quantify the association between the PLA2G7 rs1051931 G>A polymorphism and the susceptibility of IVIG treatment in KD patients with adjustments for age and gender. The association between the PLA2G7 rs1051931 G>A polymorphism and resistance to IVIG treatment in KD cases was evaluated by age and gender stratification analysis. Statistical analyses were performed by SAS software .We first examined the Hardy-Weinberg equilibrium (HWE) of the samples. Next, we use \u03c7P = 0.656) or gender (P = 0.5462) between the IVIG-resistant and IVIG-responsive KD patients.A total of 148 IVIG-resistant cases and 612 IVIG-responsive cases were analyzed in this study. The demographics of participants are all shown in PLA2G7 rs1051931 G>A polymorphism in the IVIG-resistant and IVIG-responsive KD patients are shown in PLA2G7 rs1051931 polymorphisms were 79.73% (GG), 16.22% (GA), and 4.05% (AA) in the IVIG-resistant group and 79.90% (GG), 18.95% (GA), and 1.14% (AA) in the IVIG-responsive group. In comparison with IVIG-resistant and IVIG-responsive KD subjects, there were significant differences in the AA genotype of PLA2G7 rs1051931 , which means KD patients with AA mutation were more resistant to IVIG (P = 0.0281).The genotype distributions of the PLA2G7 rs1051931 polymorphism with IVIG resistance in KD in the stratified analysis by age and gender. For KD strikes predominantly children younger than 5 years of age (P = 0.0399) (We further explored the association of the  0.0399) . HoweverPLA2G7 rs1051931 AA genotype was associated with a protective effect against IVIG resistance for KD and that the effect was more evident in children \u226460 months of age. To the best of my knowledge, this is the first study in which PLA2G7 rs1051931 G>A polymorphisms were found to be related to IVIG response in KD patients.KD is the most common cause of acquired heart disease in infants and children, especially in developed countries. High-dose IVIG treatment significantly reduced the risk of CAL, but some children with KD failed to respond to initial IVIG therapy. Therefore, early identification of the risk factors of IVIG resistance is important. Our research showed that the The mechanism of action of IVIG in KD is unclear. Potential explanations include immunologic blockade of the Fc receptor , interacPLA2G7 may be an effective therapeutic target in humans and animals, assuming that this enzyme is related to oxidative modification of LDL and the development of arterial inflammation  and consequent enzymatic deficiency is one of the factor for IVIG resistance in Japanese patients with acute KD , and minor(s)' legal guardian/next of kin, for the publication of any potentially identifiable images or data included in this article.All authors contributed significantly to this work. XuG, ZJ, and XiG were primarily responsible for the overall project design and paper writing. WL and YX were responsible for performing the experiments. Data analysis was carried out by YX and DC. DC and XiG modified and polished the manuscript. The others give suggestion for this article. All authors have reviewed and approved the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The paper addresses the dynamics of education by using Markov chains, a powerful probabilistic model able to make predictions on how sources of knowledge either change or stabilize over adulthood. To this end, each student filled in a survey that rated, on a scale from 1 to 5, the utility of five different sources of knowledge. They completed this survey twice, once for their previous and once for their current education. The authors then fitted a Markov chain to these data\u2014essentially, calculating transition probabilities from one ranking of sources of knowledge to another\u2014and inferred the final maximum utility sources of knowledge via the stationary distribution. The overall conclusion is the following: even if the professor used to play a crucial role in early development, students have the tendency to become independent in their learning process, relying more on online materials and less on printed books and libraries. Education is a long debated topic and is perceived through positive, negative and neutral lenses. In order to alleviate the gloominess that has been surrounding education, the authors have decided to embark on a research meant to show how the sources of knowledge used by students change or remain unaltered once the subject transits from high school to university, advocating for the efficiency of education in the vein of knowledge management thought.Some researchers in their study related to metacognition identified two categories of students: (a) those with lower level of metacognition whom were associated with a uni-dimensional measure and exhibited lower levels of deep learning strategies and performance and (b) those with higher levels of metacognition associated with a bi-dimensional measure of regulation and knowledge, whom manifested significantly higher utilization of deep learning strategies .The education literature convincingly argues that students have different learning styles and use different tools. Most frequently reported, in business education at least, are the following: Professor\u2019s lectures, books and libraries, case studies, success stories of business people, projects and seminars, online sources, interactions with colleagues ,3. ThougAfter carefully evaluating the theoretical framework, we decided to categorize Interaction with colleagues also as a source of knowledge, since we do not refer to a mere physical interaction/communication, but to the actual exchange of information and transfer of knowledge.As the preference is influenced by the cognitive development of the subjects (which is obviously dependent on time), one can simplify the dynamics of the process down to a two-iteration conditioning, leading to a Markov chain model. The stationary distribution of this Markov chain is translated into a preference vector over the sources of knowledge in our study.Using a 10-item questionnaire addressed to a large group of bachelor students from a Business and Economics university, the utility of five sources of knowledge\u2014previously identified and confirmed by literature\u2014was rated on a five-point Likert scale. Actually, the survey consisted of five different questions that have been answered twice: once for their previous and once for their current education approach.To our knowledge there is no similar research in the education literature, assuming a Markov dependency among the students\u2019 preferences towards various sources of knowledge. There is no guarantee that education preferences are described by such stochastic models, and no guarantee either that all students share the same Markov chain. Yet, this is always the trade-off between mathematical modeling and practice, especially within the realm of social sciences.The current research does not resemble any of the Markov models presented in the literature for academic dynamics. Previous research employs data from the administrative level within university, referring to inbound and outbound mobility of students. By contrast, we gather primary data directly from students, by means of a questionnaire. Subjects rate their preference with respect to sources of knowledge and support actions, at two different moments in time.the two static distributions corresponding to high school and universitythe five limit/stationary distributions corresponding to the individual source of knowledgethe stationary distribution among the five sources of knowledge.By firstly treating each source of knowledge separately, and then by looking at all five together\u2014which required an original, carefully constructed dichotomization algorithm for the Likert scale\u2014we fitted six different Markov chains to the survey data. As a result, several probability distributions were computed and analyzed:We consider the last distribution of paramount interest, as rendering the adult\u2019s preference towards the five sources of knowledge, providing a clear indication on how long-life-learning programs should be designed. Unsurprisingly, results show that professors, printed books and libraries do not play a crucial role anymore, as students become more and more independent and online learning becomes predominant.As portability of psychometric instruments between different cultures, economies and continents is usually limited, see e.g., ,7, the aEducation has evolved at the same pace with the technological advancements. If, at the beginning it simply consisted in a mere dyad of the professor and the student, nowadays we are talking about an intricate ecosystem that embodies both parties alongside different sources of knowledge, topped by the computer-assisted learning, perceived as a reliable and effective tool for helping people learn in an orderly and customized manner . AlthougMarkov chains and learning theory have a long history together, going back in time as far as the 1950s ,13. For Apparently, the topic of the present paper\u2014how students shift from one source of knowledge to another\u2014could also be read as change of opinion paradigm. We think this is not the case, because learning works on a deeper, more intrinsic psychological level than a simple change of opinion. That is the reason for building our Markov chain from empirical data, instead of considering an established theoretical model. This also corresponds to the more recent trend in literature, where accent shifts onto practical oriented studies, ranging from modeling faculty movement inbound and outbound higher education institutions , to descOne paper analyzes how students\u2019 achievements during the semester affect the final outcome of the exam . This isAs already stated, the present study does not resemble any of the previously discussed Markov models for student movement inbound and outbound of the university. Instead of sampling data from faculty (administrative) level, our analysis is based on a questionnaire, asking each student to rate their preferences towards a set of sources of knowledge at two distinct moments in their scholarly life. The sampling method is different and the results are different as well: instead of reducible Markov models exhibiting one or more absorbing states, the Markov chain we obtain is ergodic, with a proper stationary distribution, able to predict the subject\u2019s preference towards the sources of knowledge during adulthood.Another fast growing direction in education literature taking into account the temporal and sequential nature of the learning process is the socially- and self-regulation learning (S-SRL) . DevelopWe cannot simply conclude based on a bird\u2019s eye view on Markov chains and learning without pointing out a spectacular literature which completely reverses the research paradigm. Instead of imposing an external stochastic model on students behaviour, some authors build their Markov model on the idea that the human brain itself works by recovering a probabilistic process from a sample of empirical data . AccordiWe designed a questionnaire which was physically distributed to 436 undergraduates affiliated to a business administration faculty. After a thorough pre-analysis data screening of the returned questionnaires, a remainder of 269 questionnaires were evaluated as valid. Under these circumstances, the obtained response rate was 61.69%. For a confidence level of 95% and a confidence interval of 4%, for a population of 485, the recommended sample size was 269. The average age of the sample is 20, the gender distribution is 60% female, 40% male and the year distribution is 47% second year and 53% third year since we figured that for first year students it would be rather difficult to assess the impact of specific sources of knowledge.The questionnaire attempted to decrypt the dynamics regarding their sources of knowledge preference. The answers to each question are registered on a typical 1 to 5 Likert scale, then translated into an Excel database in order to build the Markov models.We applied a filtering procedure to the database of 269 respondents, by excluding subjects that responded 1 (never) to all five questions of a set\u2014either with respect to current or previous use of sources of knowledge. The motivation is straightforward: a response of all 1\u2019s means either that (a) the subject has no propensity for academia, or (b) the factorization of the education process as provided by i to state j by P does not change over time, the Markov chain is called homogeneous. Considering a fixed row i, probabilities i, transition from state i to the next one defines a random variable. A matrix P with this property is called stochastic. As the sequential movement of the chain inside the set S continues for infinitely many steps, P governs the short and long term dynamics of the process. What makes Markov chains so attractive, both to theoreticians and practitioners, is the limit property of the powers P positive, e.g.,\u2014the power sequence converges to a matrix with identical rows, the generic row being the so-called stationary distribution, often seen as a predictor for the long-term behaviour of the process . For a rigorous introduction of the concepts and main results on Markov chains the reader is referred to some important monographs [A stochastic process is a sequence of random variables with an intrinsic relationship among the variables. The finite homogeneous Markov chain is the classical example, defined on a finite set of states nographs ,37,38.N observed transitions among the states in S, represented by positive integers P, describing the short term behaviour of the process in study. Second, depending on the particular transition matrix obtained, information on the long term behaviour of the process can be obtained by multiplying P by itself and looking at the asymptotics of the powers In case the Markov chain matrix is not provided by the theory, it is built from empirical data. One starts with requency ,40(1)pin method .We considered five sources of knowledge, designed to synthesize, from a knowledge management perspective, the main factors that contribute to the education process, at an academic level, as depicted in current/previous education program (bachelor studies/high school). This makes the process associated to each particular source of knowledge ideal for the application of Markov chain theory, by defining the states as the ordinal Likert values ranging from 1 to 5.With respect to each of the five sources, students were required to rate, on a scale from 1 to 5, the degree  to which they use/have used the respective source of knowledge in their We counted how many transitions we have from 1 to 1, from 1 to 2, and so on, gathered all these values in a At a first glance, the five Markov chains seem to fulfill the aim of our quantitative analysis, which was inferring long-term behaviour from short-term transitions. Yet, one should notice the hidden assumption in the previous modeling: the rankings for each source of knowledge are evolving independently. However, it is more likely that the evolution of one source of knowledge was coupled with the evolution of another source of knowledge.As a consequence, we opted for designing a more elaborate Markov chain, that accommodates transitions among different sources of knowledge. To this end, the 5-point Likert scale had to first be dichotomized, as we needed to extract, for each respondent, the source(s) of knowledge that was (were) dominant for either high school or university. We claimed that this new Markov model has the potential of revealing the true cognitive development during adolescence, as students move from one education program to another.In order to build transition probabilities among sources of knowledge, one should define the state space as the set of all possible rankings occurring in the survey, then infer transition probabilities. However, the computational complexity is too large for that to work: the state space would be yes/no replies. Although the methodological literature in psychology and social science argues strongly against dichotomization, we believe this is a rare occasion when such a procedure is justified [Such a procedure is known in literature as dichotomization, and is usually applied to transform the ordinal Likert scale into a binary one - that is, to transform the original 1\u20135 answers of the subjects into nominal ustified . Notice C and D. The actual value of the maximum, which in our case equalled 3, was discarded. So, instead of looking at all the possible numerical combinations of the 1-5 rankings, we only looked at the subsets of Instead, we compressed the state of all five Likert rankings into a list of top-ranked sources. For instance, if a student scored Step 1F with We initialized a Step 2F, for each respondent i  i and to maximal response value in the current use (column index) j. For example, if one student responded To fill in the positions in Step 3F into a stochastic matrix P of the same size: on each row, we divided each component by the overall sum of the row.We transformed frequency matrix Step 4P by itself until it stabilized  in The paper presents a stochastic model of the way in which learning transitions among different sources of knowledge while subjects move from high school to university. Education is a complex ecosystem relying on dedicated means. Literature on this matter is extensive and has filtered as most important sources the following: Professor, case studies, online sources, student projects, practical activities and peer-to-peer teaching and learning.The previous Markov models within the academic spectrum were devoted only to inbound-outbound student flows, as measured by data collected at faculty level. To the extent of our research, we could not find studies addressing the dynamics of students\u2019 cognitive development, which is an ever changing process that can be expressed by the preference of the subject towards one or other source of knowledge, in accordance to their brain dominance. Inspired by the knowledge management paradigm, we identified five sources of knowledge that we consider common for most education programs: Professor\u2019s lectures, books and library, case studies and seminars, online sources, and interactions with colleagues.A questionnaire addressed to students from Business and Economics bachelor studies required them to rate their preference with respect to each of the five sources of knowledge, at two different points in time: high-school and university. Responses were measured on a five-point ordinal Likert scale. Based on the two-stage time conditioning, five probability transition matrices were constructed (one for each source of knowledge). Performing de-coupled Markov analyses for each source can be a flawed endeavor, since it is more reasonable to assume that the learning process is a whole, with all five sources of knowledge evolving together as a mechanism.The new model required first a dichotomization of the Likert scale, leading to a different, extended Markov matrix, aggregating transition probabilities among the sources of knowledge themselves. The latter transition matrix is primitive and characterized by a stationary distribution which captures the limit behaviour of the entire cognitive process. In a straightforward reading, the stationary distribution is a predictor for the individual preference among the sources of knowledge during adult life.From the stationary distribution of this transition matrix, one may infer which mode of learning is the most useful in the long run. This approach can help customize the long-life learning programs designed by different institutions or policy makers. According to our results, the extreme points on the utility scale are: online sources being awarded a maximum, with The contribution of the current paper is twofold: the first one is represented by the proved dependency among the five sources of knowledge which are the subject of study; the second one refers to the particular sources of knowledge that would be favored during adulthood.Since there are no similar Markov models of source of knowledge dynamics in literature, likewise comparison cannot be delivered or assessed. In this vein, an important line of future research consists in validating the stationary distribution obtained in the present work by compiling a similar questionnaire to either master or PhD students.In this scenario, we could consider more than two moments in time for the construction of the Markov model\u2014e.g., should the respondents be PhD students, the reference moments would be the following, in an ascending order: high school, bachelor, master, and PhD. This would imply either of the following two paths: (a) a similar two-stage Markov chain, but with the corresponding matrix averaged along all the three consecutive transitions: high school\u2013bachelor, bachelor\u2013master, and master\u2013PhD; (b) an extended, four-step Markov chain, accounting for a higher degree of dependency .We acknowledge the limitation of the current study with respect to evaluating a previous moment in time, based on subjective recollection. This limitation could be addressed by conducting a more elaborated longitudinal study, over several years, and tracking the same subjects throughout a couple of academic years. Consequently, though a limitation, this also constitutes a pertinent line of future research.One limitation, to the common 1 to 5 Likert scale used in the paper, is that different students have different definitions of what a particular numerical label means. To test the reliability of the results, a possible research avenue consists in undertaking a similar Markov research, however using different scales, such as: Saaty scale, Ma-Zheng scale and even the linguistic scale, and perform a comparison between the results. In such case, this will give rise to a new dichotomization algorithm, particularly tailored to the specificities of the newly defined scale.According to constructivism theory pertaining to social sciences, we cannot claim generality for the results. Still, our deduction is consistent with the new globalization and virtual era paradigm characterizing the 21st century. Alongside the principles of fair-play in research, other authors can replicate the same questionnaire with students from other countries, and perform the same Markov analysis. The stationary distribution may look differently. On the other hand, since the respondents of the present survey belonged to an Economics and Business university, it would be interesting to test whether results change dramatically if considering a sample from a different academic domain."}
+{"text": "Saccharomyces carlsbergensis was investigated by monitoring the autofluorescence of the coenzyme NADH. In populations of intermediate cell densities the individual cells remained oscillatory, whereas on the level of the cell population both a partially synchronized and an asynchronous state were accessible for experimental studies. In the partially synchronized state, the mean oscillatory frequency was larger than that of the cells in the asynchronous state. This suggests that synchronisation occurred due to entrainment by the cells that oscillated more rapidly. This is typical for synchronisation due to phase advancement. Furthermore, the synchronisation of the frequency of the glycolytic oscillations preceded the synchronisation of their phases. However, the cells did not synchronize completely, as the distribution of the oscillatory frequencies only narrowed but did not collapse to a unique frequency. Cells belonging to spatially denser clusters showed a slightly enhanced local synchronisation during the episode of partial synchronisation. Neither the clusters nor a transition from partially synchronized glycolytic oscillations to travelling glycolytic waves did substantially affect the degree of partial synchronisation. Chimera states, i.e., the coexistence of a synchronized and an asynchronous part of the population, could not be found.The transition between synchronized and asynchronous behaviour of immobilized yeast cells of the strain  Among the abundant biological systems that show sustained oscillations6, glycolytic oscillations play a prominent role because glycolysis is the fundamental pathway in the energy metabolism, which is conserved from bacteria to humans. For instance, glycolytic oscillations have been observed in the bacterium Escherichia coli7, the yeasts Saccharomyces carlsbergensis13 and Saccharomyces cerevisiae21, in murine fat cells22 and 23, ventricular myocytes of rabbits24, as well as in cancer cells in humans25. Despite its ubiquity, the physiological function of glycolytic oscillations remains unknown, however, these oscillations are reported to emerge due to a trade-off between efficiency and robustness of the glycolytic pathway26. One possible role of glycolytic oscillations is to act as pacemakers for other physiological oscillators23. On the other hand, life in a community is considered to be a strategy of long-term survival for unicellular organisms such as yeast27. Hence, metabolic oscillations may provide an efficient mechanism for communication among individual cells of a population.Synchronisation is a frequent manifestation of individual entities showing oscillatory or excitable dynamics where they adhere to a collective, common rhythm. Thus, synchronisation is a phenomenon that leads to the emergence of collective, macroscopic dynamics15 as shown in experiments where two yeast populations initially oscillated at opposite phases but the same frequency. When they were mixed, the cells synchronized their metabolism to a common rhythm after a few oscillations15. Individual cells are coupled to each other through acetaldehyde28, which is produced and released by the yeast cells. This messenger molecule then diffuses through the extracellular medium and it is taken up by other cells. When a sufficiently high concentration of this messenger is reached locally, the cells synchronize their rhythm to that of the messenger-rich extracellular medium in the immediate environment of the cell. Synchronisation of the metabolism of yeast is not only observed in stirred cell media but also in spatially-extended arrangements, for instance, in sedimented29 or gel-entrapped cells31.In dense populations, yeast cells synchronize their metabolic oscillations32. The transition between these two types of macroscopic dynamics may follow two distinct pathways. First, the transition may occur through a \u2019Kuramoto transition\u201934, where, at high cell densities, all cells oscillate with common phase and frequency, whereas in sparse populations, the individual cells continue to oscillate, however, they lose their phase (and possibly frequency) coherence. The second pathway is either called \u2019oscillation death\u2019 in the field of Dynamical Systems35 or \u2019dynamical quorum sensing\u2019 in more biological literature37. Here, the transition between collective oscillations and quiescence is caused by a simultaneous cessation (or onset) of the oscillations at the level of individual cells. In other words, here, the dynamics of the individuals is the same as that of the population.Already early on, the collective dynamics of yeast was found to depend on cell density. At high cell densities, the individuals synchronize their metabolic oscillations, whereas collective oscillations are no longer displayed when the cell density falls below a critical threshold38. Both types of transitions, i.e., oscillation death and the Kuramoto transition, have been reported to occur in yeast cell populations. Whereas oscillation death was found in stirred yeast cell suspensions36, in suspended and stirred beads of an oscillatory reaction37, or even in immobilized cells18, early reports that individual cells remain oscillatory in unstirred cell suspensions at low cell densities14 have recently been confirmed in experiments using either S. carlsbergensis cells immobilized on coverslips13 or S. cerevisiae in microfluidic devices39.The character of the transition between synchronous collective oscillations and quiescence on the macroscopic level depends on both, cell density and the strength of the coupling between oscillators (or cells). In fact, the phase space domains supporting Kuramoto transition and oscillation death are separated by a common phase boundary40. For small numbers of oscillators (or cells), however, this transition persists but becomes blurry41. In the case of yeast cell populations this implies that for suitable cell densities , partial synchronisation of the cells occurs, i.e., the population is neither completely synchronized to a unique frequency and phase, nor does it oscillate in an asynchronous manner. An investigation of such partially synchronized states may shed some light into the route through which immobilized yeast cells achieve synchronisation. On the other hand, partial synchronisation may involve so-called chimera states. In a chimera, the coupling of originally identical oscillators leads to a symmetry breaking, such that (at least) a subpopulation of the oscillators is synchronized to each other, whereas the other subpopulation remains desynchronized44. In fact, chimera states have also been intensively studied in a variety of coupled oscillatory systems48, both in theory and experiments. In the latter, the individual oscillators were no longer identical, but similar to each other, due to the inevitable presence of noise.For systems with a unimodal frequency distribution, the Kuramoto transition between synchronous and asynchronous dynamics is a second order phase transitionS. carlsbergensis cells achieve synchronisation by monitoring the autofluorescence of the coenzyme NADH. To this purpose, we profit from the relative longevity of both the asynchronous and the partially synchronized states in populations of intermediate density. In addition to the temporal dynamics, we study the changes in the spatial aspects of the immobilized cells during the transition between the asynchronous and the partially synchronized state. Furthermore, we investigate the evolution of the spatial coherence of the oscillations during the partially synchronized state. Finally, we tested whether the partially synchronized state supports the generation of chimera states.In the present study, we investigate how populations of immobilized S.\u00a0carlsbergensis depended on the cell density. While at cell densities The dynamics of glycolytic oscillations of yeast cells of the strain thm Fig.\u00a0, synchro08% Fig.\u00a0. As the Although experiments were run at several cell densities . A similar situation was found for data obtained at all intermediate cell densities  a subpopulation of oscillators that are synchronized among each other with another subpopulation that is neither synchronized with the first one nor within itself. In particular, in chimeras, the synchronized oscillators remain synchronized as long as the chimera exists.R was high  state where all cells oscillate with individual frequencies and a state of partial synchronisation. In the latter, the cells entrain their glycolytic oscillations, however, their oscillations fail to collapse on a unique frequency and a unique phase that is common to all cells. These two states are available for experimental studies, since the transition from desynchronisation to partial synchronisation takes a sufficiently long time. Thus, the pathway by which yeast cells synchronize can be addressed.Shortly after addition of an aliquot of glucose, the yeast cells started intracellular glycolytic oscillations, however each cell did so at its individual frequency and phase. After a narrowing of the frequency distribution, a regime of asynchronous oscillations developed which eventually gave way to a partially synchronized state. From the evolution of the distributions of the oscillation frequencies and (relative) phases Figs.\u00a0d,e, 2d,eT. Thus, the partial synchronisation was achieved by entraining the individual cells to an oscillatory cycle whose period is shorter than that of their free-running oscillations  were close to that of the synchronized cells. However, a minority of cells still oscillated at frequencies 13, and it is more pronounced at decreasing cell densities At intermediate yeast cell densities the cells may have achieved partial synchronisation as reflected by an order parameter lls Fig.\u00a0. This fe28, which diffuses through the extracellular medium. In denser clusters, the free distance between adjacent cells is smaller, and so is the decrease in acetaldehyde concentration due to diffusion (and dilution) in the extracellular matrix. Hence, clusters behave as domains where the cell area density is enhanced above that of the entire population.A closer inspection of the cells immobilized on the coverslip reveals the formation of spatial clusters, which are characterized by a locally enhanced cell density  studied in spatially extended reactors51. The main factor leading to this transition from synchronous oscillations to waves was identified as being the energy charge of the yeast extract52. Such a mechanism is most probably also at the origin of the transition from glycolytic oscillations to travelling waves in our yeast cell populations.During partial synchronisation, we have observed that synchronized glycolytic oscillations may give way to travelling glycolytic waves Fig.\u00a0. In factDuring the events of partial synchronisation of glycolytic oscillations, the cells presented a continuous distribution of oscillatory frequencies and phases. In fact, we could not distinguish between two dynamic subpopulations, where one oscillated synchronously whereas the other oscillated at different phases. Thus, we conclude that yeast cell populations performing glycolytic oscillations were unable to form chimera states.Partial synchronisation is achieved in yeast cell populations of intermediate cell densities. The route leading to such a partial synchronisation involves a time delay between the synchronisation in the frequencies and that in the phases of the glycolytic oscillations. In fact, the synchronisation of the frequencies of oscillations precedes that of their phases. Furthermore, the cells are entrained to oscillate at slightly higher frequencies, i.e., the cells are entrained by phase advancement. Even in the partially synchronized regime, the glycolytic oscillations fail to collapse on a unique frequency and a unique phase that is common to all cells. This means that in the field of view, most of the cells oscillate synchronously, while a few of them still keep oscillating with their own, different phase and possibly frequency. Although spatial domains of more densely packed cells were found in the batch chamber, these clusters only contributed to transient synchronisation of their member cells; the persistence times of episodes of high synchronisation in a cluster were always significantly shorter than the duration of partial synchronisation of the cell population.Last but not least, we rule out the formation of chimera states in populations of partially synchronized yeast cells.Saccharomyces\u00a0carlsbergensis were cultivated, harvested, washed and stored as described by Weber et al.13 Cell suspensions of different densities were prepared, where the density Cells of the yeast 100 In the batch chamber, the cells were allowed to sediment for at least 20 min, where they were immobilized on the coverslip coated with poly-D-lysine. Then the experiment was started by adding 3\u00a0mmol l12. The NADH autofluorescence from single yeast cells was measured in a low-light wide-field fluorescence lifetime imaging microscopy setup, which allows for both a minimum exposure of the yeast cells to light and a pulsating illumination, thus avoiding exposure of the cells to light stress or damage54. In our studies, the setup is used as a fluorescence microscope, where information stored in the fluorescence intensity is monitored. The batch chamber is mounted in an inverted microscope  that is equipped with a 100The intracellular dynamics were monitored by following the autofluorescence of endogenous\u00a0reduced nicotinamide adenine dinucleotide (NADH), which serves as an indicator for glycolytic activity55, we have analysed the NADH fluorescence signal originating from each of the cells as well as the collective population signal in the field of view. The fluorescence signal from each immobilized cell was monitored in time. At any instant, the fluorescence i is the mean value of the intensity of the fluorescence signal detected in the area occupied by the individual cell, i. The temporal sequence The immobilized yeast cells were randomly distributed on the coverslip. Following the protocols established in our previous work55.The time-series of the fluorescence of each cell  was obtained by averaging over all baseline subtracted time series The collective signal (collective fluorescence) of the entire cell population The amplitudes of the oscillations were measured using the baseline-subtracted fluorescence time-series. For a more convenient scaling, we present the amplitude data as normalized amplitudes iThe phase entclass1pt{minimaThe instantaneous frequencies R56The order parameter iThe macroscopic oscillation phase R(t) was calculated asR  to its neighbours j did not exceed a certain threshold. We chose cells whose area density N is the number of cells in the field of view.Spatial clusters of cells were detected by preselecting the cells, either by detecting the narrow spatial domains of closely packed cells, i.e., cells that possess a large relative cell area density R (Eq.\u00a0M cells that belong to a spatial cluster. In our analyses, we considered that cells of a cluster are synchronized, once To assess whether and to which extent cells that belong to a spatial cluster also synchronized their dynamics which each other during the events of partial synchronisation, we introduce the cluster order parameter er R Eq.\u00a0. The cluIn order to test whether chimera states were formed during partial synchronisation of yeast cells, we monitored the development of the distributions of the relative phase Supplementary information.Supplementary Video S1.Supplementary Video S2.Supplementary Video S4.Supplementary Video S5."}
+{"text": "Older individuals  constitute a growing proportion of the forensic mental health patient population. As a group, they are vulnerable to health outcomes similar to other individuals with serious mental disorders of the same age; however, these concerns can be compounded by complex forensic-related care backgrounds and clinical presentations, lengthy periods of time spent in prison or psychiatric hospitals, substance use histories, and crime perpetration or victimisation. The healthcare needs and strengths of this group are not well understood.The aim of this study was to identify and describe the demographic, physical health, mental wellbeing, cognitive ability, and quality of life profiles of older forensic patients in community, low, medium, and high security settings in England.A cross-sectional quantitative study design was used. N=37 forensic patients aged 55 years and over completed six questionnaires. Data were also collected from patient records.Most patients were male and were diagnosed with psychosis. The most frequently committed index offence types were violent offences. Patients were prescribed 7.6 medications on average and had average anticholinergic effect on cognition scores of 2.4. Nearly half the sample had diabetes, with an average BMI score of 31.7 (indicating obesity). Possible cognitive impairment was identified in 65% of the sample. Patients\u2019 assessments of their recovery-related quality of life and mental wellbeing were comparable to published UK general population values. Assessments of quality of life were positively correlated with the ability to undertake everyday activities and cognitive performance.We suggest that forensic services are well-placed to provide holistic mental and physical care to this group but that they should co-develop with patients a greater range of age-appropriate meaningful activities that are mindful of mobility issues and consider implementing more cognition-based and physical health interventions. Forensic mental health services provide care for people who have committed a crime or are at risk of harm to themselves or others. This care takes many forms, including mental health support, physical health care, and assistance to re-enter the community after spending time in secure mental health hospitals. Due to changes in the general population, there is a growing number of patients over the age of 55 in care. Despite this, we do not know enough about the healthcare needs of this older patient group and how these needs differ from younger patients. This study aimed to find out more about this patient group.In the current study, thirty-seven forensic patients aged 55 years and older were recruited from low, medium and high security hospitals and community care. These patients completed six questionnaires. Patients were asked about their physical health, mental wellbeing, cognitive ability, and quality of life. Information about medical diagnoses and socio-demographic backgrounds were collected from hospital records.The study found that these patients had complex health needs. Most patients were diagnosed with psychosis , were men, and had committed a violent criminal offence. On average patients were prescribed 7.6 medications, many of which carry significant side effects. Nearly half of the patients had diabetes, and most patients were obese or overweight. Quality of life scores were lower for patients who also reported having problems undertaking everyday activities and patients with cognitive impairment. Patients subjectively rated their mental wellbeing and quality of life similarly to the general population\u2019s ratings as reported in other studies. We suggest that services should work with patients to develop a greater number of age-appropriate activities and interventions aimed at improving cognitive and physical health. RecogniForensic mental healthcare patients aged 50 and over constitute about 20% of the UK forensic mental healthcare inpatient population ; indeed,Compared to younger adult mental healthcare patients, older individuals are more likely to have a higher number of unmet health needs and to experience fewer improvements in their health over time  . These aims were to investigate whether physical health, health-related quality of life, and recovery-related quality of life were correlated with each other in this population, and whether these constructs were associated with: mild cognitive impairment, age, length of stay in secure care, amount of leave (for inpatients), experiences of secure hospital restrictiveness, and treatment setting . A stratified cluster sampling frame was planned for community, low and medium secure units, taking into account gender mix and specialisation . This was disrupted due to COVID-19; however, we were able to recruit participants from a variety of settings across a geographically diverse range of sites. NHS Trusts were recruited through the Clinical Research Network (CRN). No specialist facilities were recruited, sites provided low, medium, and or high secure facilities and community care. Of the 12 community patients recruited, 11 were living independently, with one living in supported accommodation. Local investigators liaised with members of the study team to identify patients aged over 55 years. These patients were then approached by local investigators to ascertain interest in participation, provide information sheets, and answer any questions about the study. Inclusion criteria for patients was those: aged 55 or over; under the care of forensic mental health services; able to complete self-report questionnaires and semi-structured interviews; who understood written and oral English; and who had capacity to consent. The CRN and PIs at different sites undertook recruitment and initial consenting for participation and as a result it was unknown how patients were approached and how many refused. The number of participants recruited from each trust is depicted in55 years was chosen as the cut-off as this reflects the expedited ageing experienced by forensic patients, suggested by some to be around 10 years . Funding was provided by the National Institute for Health Research [PB-PG-1217-20028].n=10), via video call (n=26), or over the phone (n=1). All patients gave informed consent, with written consent taken from those met face-to-face, and verbal recorded consent from those met via video call or phone. Both methods of recording consent were approved by the relevant ethics committee.Data collection took place between March 2020 and September 2021 across eight National Health Service (NHS) trusts. In total, 38 patients were recruited and completed all study questionnaires. However, it transpired one patient was 53 years old, so their data are excluded from the analysis. Meetings between the researcher responsible for data collection and participants took place in person  prescriptions were not counted as it would not be possible to ascertain how much of the drug had actually been administered.Clinical data included ICD-10 diagnoses, body mass index (BMI), lists of physical health conditions and medication data , and the researcher undertook the two  other questionnaires with the participants (Q5 and Q6 both require the researcher to actively administer them). The rest of the questionnaires were collected over video-call. For this, the researcher administered Q5 and Q6 to the participants, but Q1\u2013Q4 were filled in by the participants independently to the call. Q1\u2013Q4 were distributed to the participants by principal investigators on each site and were posted/emailed back to the research team once completed.n =36, and FRQn =27). G*Power . This suggests that whilst most correlations conducted in this study are sufficiently powered, our findings involving the FRQ should be seen as exploratory.Post-hoc power analyses were conducted as the number of completed questionnaires varied  software v.27 was used. The distribution of questionnaire response data was assessed with the Shapiro-Wilk statistic and most variables were non-normally distributed. To account for this, non-parametric methods were used.n=36; EQ-5D-5L, \u03b1= .871,n=36; ReQoL, \u03b1= .859,n=36; FRQ, \u03b1= .945,n=27; and MoCA, \u03b1= .660,n=34. The alpha value (\u03b1) for the MoCA was lower than for the other measures and much of the literature (\u03c1) was used to assess correlations. Effect sizes (r) were judges as follows: 0.1, 0.3, and 0.5 as small, medium and large , and \u2018health today\u2019 (\u03c1= .486) as assessed by the EQ-5D-5L, both considered at or above large effect sizes. It was negatively correlated with the depression and anxiety domain (\u03c1= -.348) of the EQ-5D-5L and was trending towards a significant relationship with the \u2018usual activities\u2019 domain of the same measure . A negative correlation was also observed for inpatient perceptions of restrictiveness in care (\u03c1= -.481)), a large effect but the small sample size must be borne in mind here. The association between mental wellbeing and mild cognitive impairment was trending towards significance in a negative direction .Mental wellbeing (SWEMWBS) was significantly positively associated with recovery-related quality of life (ReQoL) (\u03c1= .627), an above large effect size, and its overall index value (\u03c1= .362). Recovery-related quality of life was negatively correlated with \u2018mobility\u2019 (\u03c1= -.340), \u2018usual activities\u2019 (\u03c1= -.551), \u2018depression and anxiety\u2019 domains on the EQ-5D-5L (\u03c1= -.408) implying fewer problems on these domains, and (for inpatients) experiences of restrictiveness (\u03c1= -.608), a large effect but the small sample size must be borne in mind here. The association between recovery-related quality of life and mild cognitive impairment was also significant in a negative direction (\u03c1= -.377).Recovery-related quality of life positively correlated with the EQ-5D-5L \u2018health today\u2019 domain  our sample were diagnosed with diabetes, 38% had a disease of the cardiovascular system, and one-fifth (19%) had high cholesterol . Around 16% had COPD and 14% had some form of visual impairment. BMI data were available for 30 patients; the mean score for our sample was 31.7, classified as \u2018obesity class one\u2019 by the World Health Organisation (WHO). Nine patients met the threshold for \u2018pre-obesity\u2019, and 19 patients for obesity classes one, two or three. Only two patients were in the \u2018normal weight\u2019 range. On average, patients were prescribed 2.1 psychotropic medications for regular use, with an average anticholinergic effect on cognition score of 2.4, according to the scoring system described in (\u03c1= -.432) whilst their overall health index score on the same questionnaire was not.The EQ-5D-5L domains mobility, self-care, usual activities, pain and discomfort, anxiety and depression were all significantly positively correlated with each other. They were all also negatively correlated with the broader EQ-5D-5L indicators of \u2018health today\u2019 and the overall \u2018index value\u2019 . Patients' assessment of their health on that specific day was linked with cognitive impairment scores (\u03c1= .440) and anxiety and depression (\u03c1= .384) indicating a greater number of problems in these domains, and negatively associated with EQ-5D-5L index value suggesting poorer health (\u03c1= -.374). Despite the correlation with the index value, there was no significant relationship with patients' assessments of their health on that specific day.Age was not significantly linked to any of the outcomes measured. Length of stay in current setting was positively associated with usual activities (\u03c1= -.377) and positively with higher restrictiveness ratings . Premorbid IQ was negatively correlated with the EQ-5D-5L \u2018health today\u2019 domain (\u03c1= -.432). As our sample was too small to conduct analyses of difference between more than two groups , we present median recovery-related quality of life, overall wellbeing , mental wellbeing, and experiences of restrictiveness scores across treatment settings and levels of leave inMild cognitive impairment scores were negatively correlated with recovery-related quality of life scores ; five studies of which reported a weighted pooled prevalence of BMI scores >25 at 72.4% (n= 840) , we foun. This relationship had a large effect size. This finding underscores the importance of meaningful and accessible activities in the recovery process. Secure inpatient settings have a limited range of activities and community patients can face age-, physical health- or forensic-related barriers to participation  our sample (mean= 25.7) has higher mean recovery-related quality of life scores on the ReQoL and lower scores to a representative sample of the UK general population (mean= 28.5) . Nevertheless, given this and the link between mobility and recovery-related quality of life, the associations between physical health and general mental health should be investigated further and services should ensure barriers to mobility are removed.feeling young , offering little variance for the statistical analysis. One possible explanation for this null finding is that several qualitative investigations have found age to be a subjective construct for many forensic mental health patients; some reject the \u2018older\u2019 label and expressIn relation to medication, the mean number of psychotropic drugs prescribed (2.1 per patient) does not seem excessive given the range and number of diagnoses. The higher total number of drugs (mean = 7.6 per patient) doubtless reflects the burden of physical morbidity, especially diabetes and cardiovascular conditions, in the sample. Of concern is that the mean anticholinergic effect score was 2.4, which suggests that there is scope for review of these medications as they are known to contribute to the future risk of dementia  and mobility highlights the importance of seeking to address these issues to enhance quality of life. To reduce levels of obesity and diabetes, more consideration should be given to improving patient physical activity levels, diet, and sleep quality. Acknowledging that many patients will be experiencing cognitive impairment, services should make allowances for this in provision of services, needs assessment, risk assessment, interventions, and treatment, as well as providing relevant staff training.Further research should address participation in meaningful activities in more detail. Tools that measure aspects of engagement in occupational activities such as the Model of Human Occupation Screening Tool , precluding the use of multivariate analysis (e.g. regression) or comparisons of mean differences across multiple groups (e.g. ANOVA). It is possible that given the small sample size, factors not included in this study or not controlled for played a role in shaping patient experiences of for example, quality of life and wellbeing. Having acknowledged this, post-hoc power analyses indicate that most of the analyses included in the study attain the generally accepted power of 0.8 and our sample size is comparable to other studies of this population . Perceptions of physical health were largely though not entirely uncorrelated to either of these constructs . Age was not correlated with health-related quality of life, recovery-related quality of life or mental wellbeing. There were high levels of possible mild cognitive impairment. Diabetes, vitamin D deficiency, and musculoskeletal and cardiovascular conditions were prevalent. We suggest services co-develop with patients age-appropriate meaningful activities that are mindful of mobility issues and consider implementing cognitive stimulation therapies. This study adds to the growing and much needed literature on older forensic mental health patients and further promotes the importance of studying different marginalised patient groups.In consultation with a lived experience advisory panel to identify our most important research foci, we investigated correlates of patients\u2019 health-related quality of life, recovery-related quality of life and mental wellbeing. We found that recovery-related quality of life was significantly associated with a measure of mild cognitive impairment and problems engaging in usual activities. Mental wellbeing was trending towards a significant relationship with problems engaging in usual activities .Data are available under the terms of the I am happy with the answers of the authors and the amendments they have made. In my opinion this manuscript is ready for indexing now.Is the work clearly and accurately presented and does it cite the current literature?YesIf applicable, is the statistical analysis and its interpretation appropriate?I cannot comment. A qualified statistician is required.Are all the source data underlying the results available to ensure full reproducibility?YesIs the study design appropriate and is the work technically sound?YesAre the conclusions drawn adequately supported by the results?YesAre sufficient details of methods and analysis provided to allow replication by others?PartlyReviewer Expertise:NAI confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. The authors have considered my comments made in relation to version 1 and addressed these in a thoughtful and constructive manner. As noted in my previous comments, I think this is an important topic area. The revisions made result in a greater focus on the data collected from the 37 participants. This has resulted in the paper reporting interesting and valuable findings which help to develop our understanding of the issues surrounding caring for this group of service users.Is the work clearly and accurately presented and does it cite the current literature?YesIf applicable, is the statistical analysis and its interpretation appropriate?NoAre all the source data underlying the results available to ensure full reproducibility?YesIs the study design appropriate and is the work technically sound?PartlyAre the conclusions drawn adequately supported by the results?PartlyAre sufficient details of methods and analysis provided to allow replication by others?PartlyReviewer Expertise:Mental Health and particularly forensic psychiatry, stigma, social networks, co-production and working with families and carersI confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Can you explain in the text why the patient number is so low, since you recruited them from a range of forensic mental health settings in England? I think this needs some clarification.Seven of them had no offences. Can you explain this lack of offences? All of them are forensic psychiatric patients?In my opinion there is an overload of figures in the manuscript (figures 1 and 2). Maybe you could select some of them and explain more in the body of the paper (without figures).This paper shows interesting research that is well written and structured. The patient number is low, all of them are forensic psychiatric patients.Is the work clearly and accurately presented and does it cite the current literature?YesIf applicable, is the statistical analysis and its interpretation appropriate?I cannot comment. A qualified statistician is required.Are all the source data underlying the results available to ensure full reproducibility?YesIs the study design appropriate and is the work technically sound?YesAre the conclusions drawn adequately supported by the results?YesAre sufficient details of methods and analysis provided to allow replication by others?PartlyReviewer Expertise:NAI confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. This paper shows interesting research that is well written and structured. The patient number is low, all of them are forensic psychiatric patients.\u00a0 Can you explain in the text why the patient number is so low, since you recruited them from a range of forensic mental health settings in England? I think this needs some clarification.\u00a0We would like to thank the reviewer for your time and comments. \u00a0\u00a0 The sample is small as the number of older forensic patients (>55) is generally low; it is quite resources intensive to involve new sites or \u2018NHS Trusts\u2019 within a single study, so we had to cap the number of participating sites due to this; patients were recruited only where giving consent, so we could not use hospital records to ascertain information of all eligible patients; and finally, the quantitative data were collected in the same meeting as a qualitative interview was undertaken, with the quantitative questionnaires seen as a complementary to the qualitative interviews. Only collecting quantitative data might have increased the willingness of patients to participate and reduced the resource intensiveness of the study, allowing more time to recruit participants. To make this clearer in the manuscript, we have added to the section \u2018Sampling and recruitment\u201d:\u00a0 \u201cThe study aimed to recruit N=36 participants so as to reach saturation of themes in the concurrent qualitative analysis and this was deemed sufficient for basic statistical analysis of association between variables in the quantitative analysis presented in this paper; post-hoc power calculations are presented below.\u201d\u00a0 Seven of them had no offences. Can you explain this lack of offences? All of them are forensic psychiatric patients?\u00a0This is an important point to clarify, thank you. We have added the following to the \u2018Data collection\u2019 section:\u00a0 \u201cIt should be noted that in England and Wales, patients do not need to have committed an index offence to receive treatment in forensic services. They might receive treatment in these services under a civil, non-forensic legal section where they are at risk of harm to themselves or others, which cannot be safely managed in general psychiatric settings.\u201d\u00a0 \u00a0\u00a0 In my opinion there is an overload of figures in the manuscript (figures 1 and 2). Maybe you could select some of them and explain more in the body of the paper (without figures).\u00a0\u00a0 This is helpful observation; a similar point was made by Reviewer 1. Accordingly, we have removed these figures and replaced them with Table 4. Also following comments from Reviewer 1, we have added some more information on the information include in Table 4. We have sought to explain in more detail these findings in the \u2018Results\u2019 section:\u00a0 \u201cAs our sample was too small to conduct analyses of difference between more than two groups , we present median recovery-related quality of life, overall wellbeing , mental wellbeing, and experiences of restrictiveness scores across treatment settings and levels of leave in Table 4. Though it is not possible to draw firm conclusions from these findings, at face value there appears to be a trend indicating that scores become preferable as levels of security decrease from high to low and as levels of leave increase. The exception to this is that community patients appear to have equivalent or poorer outcomes on the SWEMWBS and EQ-5D-5L than inpatients, and ReQoL scores at a level between patients in medium and low security.\u201d The paper looks at an important topic; older people in forensic mental health settings, with the number of older adults increasing in number in secure settings. It is primarily an exploratory paper reporting descriptive demographic, clinical and forensic data concerning the 37 patients in the study. The paper then examines the strengths of relationships between some of these variables with a set of 6 outcome measures. There is then an attempt to broaden out the paper with inferential analysis used to compare the data from this study with data from populations norms and published samples\u00a0which I think is not warranted (and will discuss this further below). It would be better as a more focused paper acknowledging it is a small-scale descriptive study with an examination of associations between variables. I would suggest the paper should focus on the data obtained from these 37 participants and the findings. This would lead to some tentative conclusions being able to be made but not any broad generalisations about the wider older patient population in forensic settings. I have made a number of comments that I think would be helpful for the authors to address. I hope they are useful.Abstract It notes the research design is a mixed methods approach. Although the authors note that qualitative work was undertaken as part of the larger study, this paper does not include any of this and so either the research design noted needs to be changed or the other element(s) of the mixed methods approach needs to be included.Defining an older patient in forensic settings In the introduction, there is some mention of previous studies where 50+ mentioned as the cut-off age for examining older adults in these settings. However, none seem to have 55+ as a cut-off. It would be helpful to detail why 55+ was chosen as the age to decide who should be viewed as an older patient as well as acknowledging alternative definitions and the implications of using 55 as a cut-off.Recruitment Further information is needed about the recruitment process. How was the recruitment managed? 8 separate trusts were included and it would be helpful to be given some information about these 8 sites. How many older patients were recruited from these different sites? Were any specialist facilities i.e. ? What were the community facilities? Were there differences in recruitment rates between the sites? How many were approached? How many refused to take part? What was the inclusion/exclusion criteria for participants? How many were excluded through this? Were there any differences noted in the between those recruited and those older patients in these sites. How did the demographic and clinical and forensic characteristics compare to the 1500 or so older patients in secure mental health facilities in England and Wales? These questions also relate to the representativeness of the study sample and how generalisable the study findings are to this wider group of older forensic patients. Some discussions about this would be beneficial.Interview data The use of interviews to gather qualitative data was mentioned on a number of occasions as well as noting this was not part of the study. It is probably best to mention this once  and then remove any other comments about interviews.Data Collection The six self-report measures were noted on pg4. It would be useful to ensure that the scoring range of these measures are detailed. It is also noted that a score of <26 on the MoCA indicates possible cognitive impairment. Could you state whether any of the other measures have cut-off points? Are there any other cut-off points for determining level of wellness and, if possible, record these in your results? It would also be useful to describe how the data were collected particularly as different approaches were used  and document whether there were any differences in the approach used .Sample size calculation On pg5 it is noted that Power Calculations were undertaken using G*Power. I presume this was through calculating the sample size needed for a Pearsons R correlation. It would be helpful if you could give further details about the procedures used when determining that a minimum sample size of 36 was required . In addition, three of the measures  reported smaller numbers of participants\u2019 answering the measure than the proposed minimum sample size of 36. Could you give a rationale for including these measures in the analysis? Will this have reduced the likelihood of important associations being found?Aims It was a little confusing to note the specific aims and objectives of the study. It is stated on pg3 the aim was \u201cto better understand the profiles of this patient group and investigate factors associated with quality of life, recovery and well-being\u201d. However, a revised set of aims is detailed on pg4. To help the reader, one coherent set of aims and objectives should be noted.Results Correlations \u2013 It would be helpful to give some indication of the criteria you used to determine the strength of relationship between the variables (I presume you used Cohen\u2019s conventions). There are a number of interesting findings. A number of these reported are moderate associations. Would it be worth focusing more on the stronger relationships reported? This would be supported by the likelihood that a small number of outlier scores could influence the rho scores due to the small sample size. In addition, the estimated effect size of 0.5 noted as a parameter in the power calculation suggested that the predicted relationship effect would be large. A small point; some Spearmans rho scores are reported with associated probability values whilst others were. It would be better to adopt one consistent approach.\u00a0Figures I am unsure about the figures 1 and 2 and what they bring to the paper. The small numbers in each category make it extremely unlikely that any significant differences would be recorded and the boxplots, visually, don\u2019t show any meaningful differences in scores. As an example, in Fig1 (pg9), the differences in scores between those with no leave allowed and those on unescorted leave appears to be 10 points. This is a significant clinical difference even if it is not statistically significant as is a ReQoL score <24 recorded by the \u201cno leave allowed\u201d group. I think a table reporting the median and inter-quartile range would give much clearer information. Part of the discussion about the use of also looked at the potential use of ANOVA. It was noted that the data set would not allow ANOVA to be used but on a wider level the use of statistical analysis to examine differences in in scores is at odds with the analysis undertaken in the paper which focused on examining at the strength of the relationships between variables. Focusing on ether the relationship or difference is preferable.Comparison with populations norms and published samples I think it is very difficult to use the findings in this study and compare them with populations norms and published samples apart from noting the scores of this study sample and scores recorded by by other samples. Even then, any comparisons should be tentative as there are many extraneous variables that may have impacted on this study\u2019s findings. As an example, I think it would be impossible to make any relevant comparisons between the cognitive abilities of this group of participants and the educational attainment of students in Ireland without additional data about the educational attainment achieved by the 37 participants. I would also strongly suggest that carrying out inferential analysis is wrong and misleading and should be removed from the findings as it can induce misleading findings.Discussion It may be helpful to focus on the main findings reported by the 37 participants and, in particular, where there were large strength of associations recorded. The issues with regards to limited sample size should included in the discussions (i.e. relationship of age to outcomes reported). The samples are being reported as a homogenous group but the limited sample size means that the scores may be majorly influenced by other factors . Pg 10 - When discussing cardiovascular health, it is mentioned that direct comparisons are not possible due to different methods of diagnosis and recording practice. If this is the case, any comparative discussions should be removed. Pg 12 - It is noted that that a men number of 2.1 psychotropic medications does not seem excessive and also that \u201cof concern is the mean anticholinergic effect of 2.4. Some supportive reference for viewing these scores as such would be helpful.\u00a0 Pg 12 - It was proposed that a larger sample with patients aged over 18 may have led to different findings. I wasn\u2019t sure about what point was being made by this sentence. Some clarification would be helpful.\u00a0 Pg 12 - It was reported that some patients may have felt younger and rated a number of outcomes in line with this. If this is the case, how valid are the measures used?Implications On pg12, it is stated that our data suggest that older patients could benefit from interventions to improve cognition or ameliorate cognitive decline. This needs to be clearly detailed from the data as, at present, this doesn\u2019t seem to be the case \u2013 the data only states there is cognitive decline in these participants and it is in the discussion where ways of dealing with this are suggested.Limitations These need to be clearly noted. There are issues reading sample size and it is questionable whether the study was sufficiently powered for some of the correlational analysis. The representativeness of the sample and how generalisability of the findings should also be consideredConclusions It is suggested on pg13 services co-develop with patients\u2019 meaningful activities. I agree with this statement but if it is to be a concluding point, it should be explicitly mentioned in the discussion (or elsewhere in the paper).Is the work clearly and accurately presented and does it cite the current literature?YesIf applicable, is the statistical analysis and its interpretation appropriate?NoAre all the source data underlying the results available to ensure full reproducibility?YesIs the study design appropriate and is the work technically sound?PartlyAre the conclusions drawn adequately supported by the results?PartlyAre sufficient details of methods and analysis provided to allow replication by others?PartlyReviewer Expertise:Mental Health and particularly forensic psychiatry, stigma, social networks, co-production and working with families and carersI confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above. The paper looks at an important topic; older people in forensic mental health settings, with the number of older adults increasing in number in secure settings. It is primarily an exploratory paper reporting descriptive demographic, clinical and forensic data concerning the 37 patients in the study. The paper then examines the strengths of relationships between some of these variables with a set of 6 outcome measures. There is then an attempt to broaden out the paper with inferential analysis used to compare the data from this study with data from populations norms and published samples which I think is not warranted (and will discuss this further below). It would be better as a more focused paper acknowledging it is a small-scale descriptive study with an examination of associations between variables. I would suggest the paper should focus on the data obtained from these 37 participants and the findings. This would lead to some tentative conclusions being able to be made but not any broad generalisations about the wider older patient population in forensic settings.\u00a0We thank the reviewer for the time they took to review this manuscript and for their helpful comments. We hope we have addressed the reviewer\u2019s feedback and have revised the manuscript to a satisfactory standard.\u00a0\u00a0 \u00a0 I have made a number of comments that I think would be helpful for the authors to address. I hope they are useful.\u00a0 Abstract\u00a0 It notes the research design is a mixed methods approach. Although the authors note that qualitative work was undertaken as part of the larger study, this paper does not include any of this and so either the research design noted needs to be changed or the other element(s) of the mixed methods approach needs to be included.\u00a0Thank you, this is noted. This now reads: \u2018A cross-sectional quantitative study design was used.\u2019\u00a0 Defining an older patient in forensic settings\u00a0 In the introduction, there is some mention of previous studies where 50+ mentioned as the cut-off age for examining older adults in these settings. However, none seem to have 55+ as a cut-off. It would be helpful to detail why 55+ was chosen as the age to decide who should be viewed as an older patient as well as acknowledging alternative definitions and the implications of using 55 as a cut-off.\u00a0 et al., 2020), which aligns with an often-used older age threshold in non-forensic populations used in research of 65 years.\u2019\u00a0We agree that this needs clarification. We have added the following text: \u201855 years was chosen as this reflects the expedited ageing experienced by forensic patients, suggested by some to be around 10 years ? What were the community facilities? Were there differences in recruitment rates between the sites? How many were approached? How many refused to take part? What was the inclusion/exclusion criteria for participants? How many were excluded through this? Were there any differences noted in the between those recruited and those older patients in these sites. How did the demographic and clinical and forensic characteristics compare to the 1500 or so older patients in secure mental health facilities in England and Wales? These questions also relate to the representativeness of the study sample and how generalisable the study findings are to this wider group of older forensic patients. Some discussions about this would be beneficial.\u00a0Thank you for highlighting these issues. We agree that more information is needed. We have renamed the section \u2018Participants\u2019, to \u2018Sampling and recruitment\u2019, to which we have added:\u00a0 \u201cA stratified cluster sampling frame was planned for community, low and medium secure units, taking into account gender mix and specialisation . This was disrupted due to COVID-19; however, we were able to recruit participants from a variety of settings across a geographically diverse range of sites. NHS Trusts were recruited through the Clinical Research Network. No specialist facilities were recruited, sites provided low, medium, and or high secure facilities and community care. Of the 12 community patients recruited, 11 were living independently, with one living in supported accommodation.\u00a0\u00a0 Local investigators liaised with members of the study team to identify patients aged over 55 years. These patients were then approached by local investigators to ascertain interest in participation, provide information sheets, and answer any questions about the study. Inclusion criteria for patients was those: aged 55 or over; under the care of forensic mental health services; able to complete self-report questionnaires and semi-structured interviews; who understood written and oral English; and who had capacity to consent. The CRN and PIs at different sites undertook recruitment and initial consenting for participation and as a result it was unknown how patients were approached and how many refused. The number of participants recruited from each trust is depicted in Table 1.\u201d\u00a0 Interview data\u00a0 The use of interviews to gather qualitative data was mentioned on a number of occasions as well as noting this was not part of the study. It is probably best to mention this once  and then remove any other comments about interviews.\u00a0This is a good point. We have kept only two mentions of this and removed all others.\u00a0 Data Collection\u00a0 The six self-report measures were noted on pg4. It would be useful to ensure that the scoring range of these measures are detailed. It is also noted that a score of <26 on the MoCA indicates possible cognitive impairment. Could you state whether any of the other measures have cut-off points? Are there any other cut-off points for determining level of wellness and, if possible, record these in your results? It would also be useful to describe how the data were collected particularly as different approaches were used  and document whether there were any differences in the approach used .\u00a0Thank you for these helpful comments. We have added descriptions for the score ranges and cut-offs for all questionnaires where these are available. Please see additional sentences added to the descriptions of the questionnaires in the \u2018Data collection\u2019 section.\u00a0 We describe how many different approaches were used to collect data in the section titled \u2018Data Collection\u2019 in paragraph one. E.g., \u201cMeetings between the researcher responsible for data collection and participants took place in person ( n=10), via video call ( n=26), or over the phone ( n=1).\u201d\u00a0 We have added more information on the data collection process, e.g., how questionnaires were completed by participants:\u00a0 \u201cDue to disruptions due to COVID-19, our data collection methods had to be revised during data collection. Two sets of data were collected in person, where the participants completed the four self-report questionnaires , and the researcher undertook the two  other questionnaires with the participants (Q5 and Q6 both require the researcher to actively administer them). The rest of the questionnaires were collected over video-call. For this, the researcher administered Q5 and Q6 to the participants, but Q1-Q4 were filled in by the participants independently to the call. Q1-Q4 were distributed to the participants by principal investigators on each site and were posted/emailed back to the research team once completed.\u201d\u00a0 Sample size calculation\u00a0 On pg5 it is noted that Power Calculations were undertaken using G*Power. I presume this was through calculating the sample size needed for a Pearsons R correlation. It would be helpful if you could give further details about the procedures used when determining that a minimum sample size of 36 was required . In addition, three of the measures  reported smaller numbers of participants\u2019 answering the measure than the proposed minimum sample size of 36. Could you give a rationale for including these measures in the analysis? Will this have reduced the likelihood of important associations being found?\u00a0This is a great point, and something we have overlooked. As we have different sample sizes as you point out, we conducted post-hoc analyses to investigate the extent to which our findings were sufficiently powered. We have sought to remind readers that our findings should be observed with some degree of caution given the small sample size . We have added the following to the manuscript:\u00a0 \u201cPost-hoc power analyses were conducted as the number of completed questionnaires varied . G*Power  suggested that at r = 0.5, p = 0.05, two-tailed, n = 36, our analysis yielded a sufficient power of 0.89. G*Power also indicated at r = 0.5, p = 0.05, two-tailed, n = 27, that analyses including the FRQ yielded a power of 0.78, just under the usually accepted standard of 0.8 (in this study achieved with a sample of n =28). This suggests that whilst most correlations conducted in this study are sufficiently powered, our findings involving the FRQ should be seen as exploratory.\u201d\u00a0 Aims\u00a0 It was a little confusing to note the specific aims and objectives of the study. It is stated on pg3 the aim was \u201cto better understand the profiles of this patient group and investigate factors associated with quality of life, recovery and well-being\u201d. However, a revised set of aims is detailed on pg4. To help the reader, one coherent set of aims and objectives should be noted.\u00a0Thank you for highlighting this. We have removed the following sentence to provide further clarity: \u2018The aims of this study were to better understand the profiles of this patient group and investigate factors associated with quality of life, recovery, and wellbeing.\u2019.\u00a0 Results\u00a0 Correlations \u2013 It would be helpful to give some indication of the criteria you used to determine the strength of relationship between the variables (I presume you used Cohen\u2019s conventions). There are a number of interesting findings. A number of these reported are moderate associations. Would it be worth focusing more on the stronger relationships reported? This would be supported by the likelihood that a small number of outlier scores could influence the rho scores due to the small sample size. In addition, the estimated effect size of 0.5 noted as a parameter in the power calculation suggested that the predicted relationship effect would be large.\u00a0Good point \u2013 we have now added the effect sizes (Cohen\u2019s r) to our \u2018Data Analysis\u2019 section. Indeed, many of the significant correlations were between .3 and .7 so we have chosen a large effect size of .5 for the power calculation. We have signposted readers to large and moderate effect sizes throughout the findings and discussion where appropriate. We think this help make the important findings of the study clearer.\u00a0\u00a0 A small point; some Spearmans rho scores are reported with associated probability values whilst others were. It would be better to adopt one consistent approach.\u00a0\u00a0Thank you for highlighting this. We only report p values of Spearman RHO analyses where these were not significant or were trending towards significance. All other Spearman RHO coefficients reported without a p value are significant at P=<0.001. To clarify, we added the following to the \u2018Data analysis\u2019 section: \u2018All correlation coefficients reported without a p value are significant at p=<0.001.\u2019\u00a0 Figures\u00a0 I am unsure about the figures 1 and 2 and what they bring to the paper. The small numbers in each category make it extremely unlikely that any significant differences would be recorded and the boxplots, visually, don\u2019t show any meaningful differences in scores. As an example, in Fig1 (pg9), the differences in scores between those with no leave allowed and those on unescorted leave appears to be 10 points. This is a significant clinical difference even if it is not statistically significant as is a ReQoL score <24 recorded by the \u201cno leave allowed\u201d group. I think a table reporting the median and inter-quartile range would give much clearer information. Part of the discussion about the use of also looked at the potential use of ANOVA. It was noted that the data set would not allow ANOVA to be used but on a wider level the use of statistical analysis to examine differences in in scores is at odds with the analysis undertaken in the paper which focused on examining at the strength of the relationships between variables. Focusing on ether the relationship or difference is preferable.\u00a0Thank you for these comments. We have now revised this section of the findings. Instead of discussing the potential findings of an ANOVA in a future study, we now include a table of median and IQR values and the following text:\u00a0 \u201cAs our sample was too small to conduct analyses of difference between more than two groups , we present median recovery-related quality of life, overall wellbeing , mental wellbeing, and experiences of restrictiveness scores across treatment settings and levels of leave in Table 4. Though it is not possible to draw firm conclusions from these findings, at face value there appears to be a trend indicating that scores become preferable as levels of security decrease from high to low and as levels of leave increase. The exception to this is that community patients appear to have equivalent or poorer outcomes on the SWEMWBS and EQ-5D-5L than inpatients, and ReQoL scores at a level between patients in medium and low security.\u201d\u00a0 Comparison with populations norms and published samples\u00a0 I think it is very difficult to use the findings in this study and compare them with populations norms and published samples apart from noting the scores of this study sample and scores recorded by by other samples. Even then, any comparisons should be tentative as there are many extraneous variables that may have impacted on this study\u2019s findings. As an example, I think it would be impossible to make any relevant comparisons between the cognitive abilities of this group of participants and the educational attainment of students in Ireland without additional data about the educational attainment achieved by the 37 participants. I would also strongly suggest that carrying out inferential analysis is wrong and misleading and should be removed from the findings as it can induce misleading findings.\u00a0We note this feedback and have removed the inferential statistics. We now present a face-value comparison in the discussion and have removed the statistical comparison as an aim of the study. This is evident throughout the manuscript, but please note the largest changes to the \u2018Discussion\u2019 section.\u00a0 \u201cTo provide some sense of how our sample compared to other groups, we look to the published literature and population norm values regarding recovery-related quality of life, mental wellbeing, and experiences of restrictiveness. Interestingly, compared to a sample of UK general mental health patients receiving care across different settings (mean= 21.9) our sample (mean= 25.7) has higher mean recovery-related quality of life scores on the ReQoL and lower scores to a representative sample of the UK general population (mean= 28.5) . We can also see that our sample had similar mental wellbeing scores to the general population as measured by the SWEMWS (mean=23.5) . When compared to a sample used to develop the FRQ (mean= 35.6), reported similar scores on the measure of patient experiences of restrictiveness in secure care to the sample in Tomlin et al. (2019). These comparisons should be investigated in further research using random samples and inferential statistics.\u201d\u00a0 Discussion\u00a0 It may be helpful to focus on the main findings reported by the 37 participants and, in particular, where there were large strength of associations recorded.\u00a0We have included mention of effect sizes in the Discussion section, so as to acknowledge the larger associations. We have also scaled back our discussion to keep this closer to the findings of the paper; we have revised heavily the paragraph looking at published population norms or other study data.\u00a0\u00a0\u00a0 The issues with regards to limited sample size should included in the discussions (i.e. relationship of age to outcomes reported). The samples are being reported as a homogenous group but the limited sample size means that the scores may be majorly influenced by other factors .\u00a0We have revised this, so that our limitations section now includes the following amended text:\u00a0 \u201cIt is possible that given the small sample size, factors not included in this study or not controlled for played a role in shaping patient experiences of for example, quality of life and wellbeing. Having acknowledged this, post-hoc power analyses indicate that most of the analyses included in the study attain the generally accepted power of 0.8 and our sample size is comparable to other studies of this population , most of which are retrospective using hospital records and did not involve active participant recruitment.\u201d\u00a0 Pg 10 - When discussing cardiovascular health, it is mentioned that direct comparisons are not possible due to different methods of diagnosis and recording practice. If this is the case, any comparative discussions should be removed.\u00a0We have deleted this and replaced this with:\u00a0 \u201cFurther longitudinal research should investigate cardiovascular health across age ranges using the same measures and diagnostic tools, to explore in what ways cardiovascular health might change in secure settings as patients age.\u201d\u00a0 Pg 12 - It is noted that that a men number of 2.1 psychotropic medications does not seem excessive and also that \u201cof concern is the mean anticholinergic effect of 2.4. Some supportive reference for viewing these scores as such would be helpful.\u00a0\u00a0We hope we have clarified this. We provide information on links between anticholinergic effect on cognition with mental wellbeing later in the referenced paragraph. We state that we use the scoring system described by  in the sections: \u2018Health status and perceptions of physical wellbeing\u2019 and \u2018Data collection\u2019.\u00a0\u00a0 Pg 12 - It was proposed that a larger sample with patients aged over 18 may have led to different findings. I wasn\u2019t sure about what point was being made by this sentence. Some clarification would be helpful.\u00a0 +\u00a0 Pg 12 - It was reported that some patients may have felt younger and rated a number of outcomes in line with this. If this is the case, how valid are the measures used?\u00a0In response to the two points above \u2013 we agree that this is confusingly worded. We have sought to simplify this by deleting the following, and simplifying our main point in this paragraph:\u00a0\u00a0 \u201cAs our outcomes were largely subjectively measured it is possible some respondents felt younger or older than others the same age and rated their mental wellbeing, physical health and recovery-related quality of life in line with this. A larger sample with patients aged 18 and older might have led to different findings.\u201d\u00a0 \u00a0 Implications\u00a0 On pg12, it is stated that our data suggest that older patients could benefit from interventions to improve cognition or ameliorate cognitive decline. This needs to be clearly detailed from the data as, at present, this doesn\u2019t seem to be the case \u2013 the data only states there is cognitive decline in these participants and it is in the discussion where ways of dealing with this are suggested.\u00a0We agree implications should be couched in sufficient evidence. We have reworded this section to reflect our findings and signpost the need for more research:\u00a0 \u201cTo summarise the practical implications of our study, 65% of our sample had possible cognitive impairment according to a validated measure. This suggests that older patients might benefit from interventions to improve cognition or ameliorate cognitive decline, though more evidence is needed to speak to the efficacy of different interventions. Studies suggest improvement might be best achieved through cognition-based interventions, physical exercise and antioxidants .\u201d\u00a0 Limitations\u00a0 These need to be clearly noted. There are issues reading sample size and it is questionable whether the study was sufficiently powered for some of the correlational analysis. The representativeness of the sample and how generalisability of the findings should also be considered\u00a0This is an important point. We have acknowledged this by including the following in the \u2018Limitations\u2019 section:\u00a0 \u201cFinally, we did not compare our sample to a representative or whole population of all older patients in England and Wales or a representative or whole population sample of all patients; nor did we obtain a random sample of participants. This places limitations on the extent to which we can conclude our findings are generalisable to patients outside our sample.\u201d\u00a0 Conclusions\u00a0 It is suggested on pg13 services co-develop with patients\u2019 meaningful activities. I agree with this statement but if it is to be a concluding point, it should be explicitly mentioned in the discussion (or elsewhere in the paper).\u00a0We are glad that the Reviewer agrees that this an important point. As we do not think we can introduce the topic of co-production in detail in this manuscript, we have made a small reference to this in the introduction, as we would like to keep this in:\u00a0\u00a0 \u201cInvestigating and documenting the disparities between younger and older mental healthcare patients can better equip us to shape service provision, co-develop responsive and appropriate interventions with patients, and address structural disparities in health and wellbeing outcomes .\u201d"}
+{"text": "In the past 20 years, myostatin, a negative regulator of muscle mass, has attracted attention as a potential therapeutic target in muscular dystrophies and other conditions. Preclinical studies have shown potential for increasing muscular mass and ameliorating the pathological features of dystrophic muscle by the inhibition of myostatin in various ways. However, hardly any clinical trials have proven to translate the promising results from the animal models into patient populations. We present the background for myostatin regulation, clinical and preclinical results and discuss why translation from animal models to patients is difficult. Based on this, we put the clinical relevance of future antimyostatin treatment into perspective. MSTN) gene have subsequently been identified in the double muscled Belgian Blue and Piedmontese cattle [MSTN in a German boy with a hypermuscular phenotype demonstrated that the effect of myostatin is functionally conserved across different mammalian species [Muscular dystrophies consist of a broad array of inherited conditions characterized by muscular wasting and atrophy. As clinical presentations in patients may vary due to a wide spectrum of phenotype\u2013genotype variants for a particular gene, a common treatment, not depending on correcting a single molecular defect, has emerged as an attractive target for development. For the last 20 years, one of the most promising therapeutic subjects in the field of muscular dystrophies has been myostatin. Identified for the first time in 1997, myostatin knock-out in mice caused increased muscle mass [e cattle ,4 as wele cattle . In 2004 species . Since m species , interes species , this remstn-gene is highly conserved among different vertebrate species [Myostatin, also known as growth and differentiation factor 8 (GDF-8), was identified in 1997 by McPherron and Lee ,12 and h species ,16,17,18 species . During  species ,19,20,21 species . Other t species , follist species , Gasp-1  species  and the  species ,26 typicOnce liberated from inhibitory proteins, myostatin, as well as other members of the TGF-\u03b2-family, binds to activin-receptors and, in the case of myostatin, mainly to the activin-receptor type IIB (ActRIIB) as well as the type IA receptor . The actCompared to healthy young men, there was no reported change in serum myostatin levels in an elderly population with mild or severe sarcopenia (as defined by muscular contractile force) . Burch eThe effect of age on the expression of not only myostatin but also other promyogenic muscle regulatory factors (MRF) following exercise was examined by Raue et al. They found that at rest, there is a relative upregulation of both MRF and myostatin prior to exercise in elderly women compared to younger ones, but that the postexercise downregulation of myostatin is not hampered by age . A studyThe clinical relevance of myostatin in humans was described for the first time in HIV patients, who had increased levels of myostatin compared to healthy subjects. Furthermore, the levels were even higher in the patients who met the definition of AIDS-wasting syndrome . The rolIn terms of cardiovascular disease, the upregulation of myostatin in the cardiomyocytes surrounding an ischemic infarction in sheep was shown in 1999  and myosTreating cancer-associated cachexia by means of myostatin inhibition has been another field of interest. As myostatin was elevated in the gastrocnemius muscle of mice inoculated with the Yoshida AH-130 hepatoma , targetiCOPD has been another target of interest due to the muscle wasting, since 30\u201340% of all people with COPD undergo muscle wasting as a secondary complication to impaired pulmonary function . The linCy/+), with increased activation of atrogenic transcription factors in EDL adding insights to the pathophysiology behind muscle wasting in this condition [In CKD, myostatin is elevated in the serum and skeletal muscle of the rat model of CKD, , the following will focus on the bulk of scientific work that describes the effect of myostatin on muscular tissue. A summarized overview is presented in The pharmacological approaches to inhibiting myostatin activity in vivo have included: (a) systemic administration of antibodies against myostatin; (b) overexpression or administration of the myostatin propeptide; (c) systemic administration of the activin-IIB-receptor itself; (d) administration of antibodies directed against ActRIIB; (e) overexpression or administration of follistatin; (f) liver-mediated overexpression of a soluble receptor (sActRIIB), dominant-negative myostatin (dnMSTN) or the propeptide; (g) RNA interference and antioligonucleotides against myostatin or ActRIIB or; (h) AAV-Cas9 mediated myostatin gene editing. Finally, we have also included works on the effects of transgenic knock-out models and crossbreeding with the preexisting models of muscular dystrophy (i).mdx, with antibodies directed towards myostatin  [mdx reproduces the pathological features seen in muscles of DMD-patients most accurately [\u2212/\u2212Sgcg model of limb-girdle muscular dystrophy (LGMD) 2C in a design of similar age and treatment length to the previously mentioned study [\u2212/\u2212Sgcd mouse model of LGMD2F also treated with JA16 antibodies was not able to improve fibrosis in either young or older \u2212/\u2212Sgcd animals  with older animals even showing signs of worsening of fibrosis [mdx-animals showed positive effects on the diaphragm, as specific force increased while absolute force was unaffected, fiber size increased and connective tissue infiltration of the diaphragm was reduced [mdx mice [Acta1D286G mouse model of nemaline myopathy [Sod1G93A mouse and rat models of amyotrophic lateral sclerosis (ALS) with RK35 improved grip strength compared to placebo controls but did not delay disease onset or extend survival of either model [Smn\u03947 mouse of spinal muscle atrophy (SMA) had increased absolute muscle torque but not specific torque after treatment with the muSRK-015P antibody versus myostatin  [Bogdanovich et al. were the first to successfully treat the commonly used mouse model of Duchenne Muscular Dystrophy (DMD), the s, JA16) . The rescurately , showed ed study . The Sgcfibrosis . Interes reduced , indicatmdx mice  and the myopathy . Treatmeer model . Later, er model . As oppone mRNA) . In a stne mRNA) .mdx [Sgca\u2212/\u2212-mouse models of LGMD2A and 2D, respectively, by local and systemic overexpression of the propeptide but were only able to improve the calpain-3-null mice [As previously mentioned, the myostatin propeptide functions as an inhibitor of myostatin, as it binds myostatin in an inactive complex. Propeptide-based inhibition by intraperitoneal injection for three months resulted in increased body mass, EDL mass, absolute and specific force in EDL. There was no effect on stretch-resistance but the histopathological phenotype of the diaphragm improved compared to untreated mdx . Bartoliull mice .mdx mice [mdx [In order to increase the specific targeting of myostatin and reduce binding of the variety of other ligands that also bind to and activate ActRIIB, another approach based on the systemic administration of a soluble activin type IIB receptor, sActRIIB, has been widely utilized . The commdx mice , a functmdx mice ,93, mdx ice [mdx ,94,99, aice [mdx   and described the receptor-specificity in cell cultures and myoblasts while also showing the effects on body and muscle mass in both SCID-mice and a glucocorticoid atrophy model .mdx ameliorated the dystrophic features in terms of grip strength and pathohistological features [F66-mice) is crossed with the dysferlinopathy LGMD2B model Dysf\u2212/\u2212, the positive effect on muscle weight in \u2212/\u2212F66;Dysf-mice declines with age and the specific force of EDL is reduced, compared to F66-mice, exacerbating the dystrophic phenotype [Dysf\u2212/\u2212-mice ameliorated histopathological changes, but increased creatine kinase  levels. The authors conclude that follistatin overexpression accelerated the degenerative features in the dysferlinopathy model, as the dystrophin-deficient mdx was not exacerbated [Like the myostatin propeptide, follistatin is able to inhibit not only myostatin but also shows affinity for other TGF-\u03b2-family members (such as BMPs and activins) ,136. Trafeatures . When trhenotype . Furthercerbated , and sugmdx [Another approach using a follistatin-based fusion protein ACE-083 by local intramuscular injections increased CSA, weight and absolute, but not specific, force of injected muscle tibialis anterior (TA) in the Trembler-J mouse model of Charcot\u2013Marie\u2013Tooth disease and mdx .mdx-animals [mdx-mice for 12 weeks also undergoing an exhaustion-exercise regime showed increased muscle weight and absolute but not specific force increments [As the systemic clearance of follistatin is rather quick, systemic versus local administration poses a challenge. Thus, the pharmacokinetic properties were edited and a long-acting follistatin-based molecule (FS-EEE-hFc) was engineered by Shen and colleagues  and appl-animals . The subcrements .mdx with AAV-vectors, which brought liver-mediated transcripts of sActRIIB [mdx-mice was predominantly observed in the fast fibers  of both the EDL and soleus, while soleus increased both absolute and specific force and CK decreased [D2.mdx only reported beneficial effects on absolute force in EDL [Using the same approach as mentioned earlier with adeno-associated virus 8 (AAV8)-delivered myostatin inhibitors, Morine and colleagues treated the sActRIIB  or dnMSTsActRIIB  into cirsActRIIB . The dnMecreased . A simile in EDL .mdx, Liu and colleagues treated the C/C mouse model of spinal muscle atrophy (SMA) with AAV8-vectors containing transcripts for dnMSTN and sActRIIB, respectively [Similar to the treatment regimes in the ectively . Both trmdx-mice were treated at the age of three months, which increased body mass, grip strength, muscle mass and fiber radius [Another approach was used in wild-type MF-1 mice, where propeptide coupled to an immunoglobulin Fc molecule was delivered by means of AAV8 vectors to hepatocytes, ensuring an intrinsic production of the inhibitor . In contr radius . The absmdx [Myostatin has also been sought downregulated by means of RNA interference. Dumonceaux et al. combined short hairpin RNA (shRNA) interference of ActRIIB mRNA with AAV mediated exon-skipping of dystrophin. The number of fibers increased in TA, but force production was unchanged in mice that received myostatin interference solely compared to untreated mdx .mdx-mice [mdx mice receiving the myostatin-inhibiting PMO did not benefit from this treatment alone [mdx animals, suggesting that histopathology plays a role in efficiency of the treatment [In contrast to AAV-mediated gene therapy, antisense oligomers (AOs) hold no risk of uncontrolled genome insertion and levels of exon skipping can be regulated or aborted over time. Antisense phosphorodiamidate morpholine oligomers (PMOs) causing exon-skipping of myostatin increased TA weight and CSA locally in mdx-mice . A follont alone . A similreatment ,139.Recently, it was demonstrated that myostatin knock-out by the means of AAV-Sa-Cas9 gene editing delivered by intramuscular injections increased fiber area and number of fibers per area in aged wild-type mice . HoweverMstn\u2212/\u2212, also denominated \u2018the myostatin-null\u2019) described in 1997, has subsequently been further examined and crossed with various mouse models of neuromuscular diseases. The myostatin-null itself has been described numerous times [C/C), which contains a 12-bp deletion in the propeptide domain of promyostatin (MstnCmpt-dl1Abc) but leaves the biologically active growth-factor domain of myostatin unaffected [The murine hypermuscular myostatin knockout , which has an induced loss-of-function mutation leading to a peptide without the ligand, thus a complete lack of myostatin. This model has similarly increased muscularity but has had most of its use in the field of metabolic research [A third mouse model is the lean myostatin mouse . The romdx , myostatLooking at the histopathological changes, both qualitative and quantitative measures have been made when assessing the effect of treatment on fibrosis by visualizing and measuring e.g., hydroxyproline or collagen content. As with the functional studies, histopathological examination has shown both positive and negative findings  while inMstn\u2212/\u2212 mice. Not all dystrophic models have benefitted from myostatin inhibition; indeed, in those disease models where the sarcolemma or extracellular matrix is specifically affected, the treatment may cause further deterioration. The overexpression of follistatin in the dysferlin deficient Dysf\u2212/\u2212 mouse resulted in the exacerbation of muscular degeneration [Sgcd\u2212/\u2212 mice treated with myostatin inhibitors showed signs of increased fibrosis [dyW/dyW mice caused increased mortality in offspring [On a functional level, most studies of postnatal myostatin inhibition present increases in absolute force, but very few studies ,98,116 hneration , older \u03b4fibrosis  and the ffspring . The oveffspring . We specffspring . In contFrom a patient perspective, these limitations to the treatment mean that a large part of human muscle is either not responsive to the effect of myostatin inhibition or only to a minor degree as humans do not express type IIB fibers. Importantly, myostatin inhibition based on the mouse studies is unlikely to have any meaningful effect on the heart to halt or reverse cardiomyopathy and the degeneration of the muscles involved in respiratory function, as these are composed of oxidative fibers ,152  and LGMD, idiopathic inflammatory myopathies , cancer patients, COPD and a geriatric patient population  .The first study in a population of muscular dystrophy patients  receiving myostatin inhibitors was a phase I/II trial with MYO-029  . The cliA phase I study of ACE-031 , a fusion protein of ActRIIB to the Fc-portion of human IgG, showed increased LBM in healthy women  but was A different molecular strategy was pursued by Roche/Greentech with the antimyostatin adnectin RG6206/RO7239361, an engineered molecule based on a fibronectin III domain, which like antibodies binds a target molecule with high affinity. A phase Ib/II study reported increased LBM in treated DMD boys and the compound was found safe and well tolerated , which sAs a treatment for inflammatory myopathies such as spontaneous inclusion body myositis (sIBM), phase II and III trials of BYM-338 , an anti-ActRIIB-antibody in sIBM failed to show positive long-term functional effects ,169,170.In a small phase I/IIa study of six BMD-patients without controls or placebo treatment, local injections of AAV1-delivered vectors harboring follistatin showed no adverse effects . A subseAs inherited muscular dystrophies such as DMD represent the most severe and irreversible conditions , it was considered that myostatin inhibition would show more promising results in milder phenotypes of the muscular disorder and conditions not arising from specific and inherited genetic malfunction. It can be speculated that the physiological adaptations in conditions arising from congenital genetic defects may be much harder to overcome by myostatin inhibition compared to acquired and potentially reversible conditions.LY2495655 , a myostatin antibody, was tested in a population of elderly subjects who had experienced falling at least once before enrollment in the trial. Functional outcomes such as stair climbing time, chair rise with arms and fast gait speed increased, although the increase was not significant from placebo in all measures . LY24956BYM-338 was also examined in an older population suffering from sarcopenia with reduced gait-speed and muscle function. A single infusion of 30 mg/kg confirms a positive functional effect, but only when measuring the 6-min walk test (6MWT) distance 16 weeks after treatment in a subpopulation with low 6MWT performance at baseline . Later, The antimyostatin peptibody AMG-745, developed by Amgen, is a fusion protein with a human Fc at the N-terminus and a myostatin-neutralizing peptide at the C-terminus . Subcutamdx and the more severe D2.mdx [Evidently, not a single clinical trial in muscular dystrophy has succeeded in reaching a clinically significant outcome and most have been withdrawn . Why is e D2.mdx . Hammerse D2.mdx . Since te D2.mdx . In addie D2.mdx ,180,181.e D2.mdx .Ultimately, these are all difficult hurdles to overcome. Some can be amended by improving the specificity of the modus of inhibition, others are less likely to be improved, like the expression of myostatin in fast fibers and the lack of improvement in the integrity of sarcolemma. Obviously, these factors should be taken into consideration if new targets are to be pursued.A different issue is the goal of attempting to develop a treatment for severe diseases. In muscular dystrophies, DMD represents the pinnacle most treatments aim to improve, not only due to the frequency of patients, but also because DMD affects almost all muscles and a treatment or treatment modality for DMD may be applicable to many other muscle diseases. However, the myopic focus on finding a treatment for DMD may hurt efforts at using the very same treatments against other less severe muscle disorders. It can be argued that expecting a significant positive change in the primary outcomes may be a bit too ambitious for severe disorders. In the case of myostatin inhibition, this was tried on patients suffering from cachexia and sarcopenia, where the muscle function is unaffected by a genetic condition, without improving the muscle condition. If no myostatin inhibition treatment has been able to improve severe (DMD), intermediate (sIBM), moderate (LGMD) muscle disorders or muscle wasting related to cancer or age, then this mode of treatment is likely not suited for treating any of these disorders and conditions.Finally, and this is an ongoing discussion throughout the entire field of treating muscle diseases, it can be argued that the primary outcome measures simply do not match the disease. It is always preferable to have a functional primary outcome measure, followed by relevant secondary outcome measures. However, the chosen functional primary outcome measure should perhaps better reflect the severity of the disease. In the absence of more flexibility of choosing the right functional outcome measure, there are usually multiple secondary outcome measures, which may demonstrate a coherent change due to treatment. However, in all clinical trials of muscular dystrophy included in this review the primary outcome measures did not demonstrate any functional improvement and the secondary outcome measures did not demonstrate any coherent improvement that could outweigh the absence of a positive primary outcome due to treatment. A recent example of a clinical trial with no improvement in functional outcome, but with a coherent improvement of secondary outcomes, is the treatment of patients with myasthenia gravis with eculizumab, which resulted in a recommendation of using eculizumab for treating this group of patients . So evenSMN2 gene expression through a splice modulator may have more success in a clinical trial, since it aims at increasing muscle mass and correcting the functional deficit leading to SMA [Over 20 years ago, the discovery of myostatin gave patients, clinicians and caretakers a hope that myostatin would provide a benchmark in treating neuromuscular disorders and that the promising results in preclinical settings would translate into clinical remission in patients. Unfortunately, the disappointing results in almost any clinical trial associated with myostatin inhibition will most likely discourage further research and development into myostatin inhibition. However, applying myostatin inhibitors as an adjuvating therapy to gene therapy restoring e.g., truncated dystrophin as previously shown in animal models ,184 or ig to SMA . If the g to SMA , induce g to SMA ,186 or fg to SMA . However"}
+{"text": "Varroa destructor, is unarguably the leading cause of honeybee (Apis mellifera) mortality worldwide through its role as a vector for lethal viruses, in particular, strains of the Deformed wing virus (DWV) and Acute bee paralysis virus (ABPV) complexes. Several honeybee populations across Europe have well-documented adaptations of mite-resistant traits but little is known about host adaptations towards the virus infections vectored by the mite. The aim of this study was to assess and compare the possible contribution of adapted virus tolerance and/or resistance to the enhanced survival of four well-documented mite-resistant honeybee populations from Norway, Sweden, The Netherlands and France, in relation to unselected mite-susceptible honeybees. Caged adult bees and laboratory reared larvae, from colonies of these four populations, were inoculated with DWV and ABPV in a series of feeding infection experiments, while control groups received virus-free food. Virus infections were monitored using RT-qPCR assays in individuals sampled over a time course. In both adults and larvae the DWV and ABPV infection dynamics were nearly identical in all groups, but all mite-resistant honeybee populations had significantly higher survival rates compared to the mite-susceptible honeybees. These results suggest that adapted virus tolerance is an important component of survival mechanisms.The ectoparasitic mite,  Varroa destructor, is inarguably the leading cause of honeybee (Apis mellifera) mortality world-wide, practically exterminating wild colonies and severely affecting the management and profitability of beekeeping in the wake of its global spread during the 1980\u2019s and 1990\u2019s1. The damage this parasite causes to its new host by feeding on adults and brood is amplified by the multiple viruses it carries and transmits4. Two virus-complexes in particular are transmitted highly efficiently by varroa mites with devastating consequences5: the Deformed wing virus (DWV) complex, including major strains DWV-A, DWV-B and DWV-C6; and the Acute bee paralysis virus (ABPV) complex, including major strains ABPV, Kashmir bee virus (KBV) and Israeli acute paralysis virus (IAPV)7. Both DWV and ABPV are single-stranded RNA viruses that infect all stages of honeybee development8. In the absence of varroa mites, they are maintained in the colony at low levels as innocuous infections through horizontal and vertical transmission routes14. DWV is the most common and wide spread virus2. Symptoms are almost exclusively associated with varroa-mediated transmission when the mite feeds on the bee during the pupal developmental stages15 causing severe wing deformities that result in flightless adult bees that die shortly after emerging8. ABPV symptoms are characterized mostly by severe pupal mortality and by trembling, paralysis and behavioural inadequacies of adult bees at elevated titres7.The ectoparasitic mite, 16. To avoid virus epidemics and thus colony death, mite population control strategies are essential in apiculture in almost all parts of the world where the mite exists16. However, there are several extraordinary honeybee populations in Europe and North America that have been documented to survive for extended periods without mite control measures and without the harmful effects typically associated with varroa mite infestation17. These populations have all been exposed to the selection pressure of long-term uncontrolled mite infestation and in response have adapted a repertoire of mite-resistant traits that limit the mite population growth rate21. These traits subsequently support colony survival likely by reducing the transmission potential for lethal virus epidemics. However, despite having acquired mite-resistant traits, these populations can still experience and survive with occasional high mite infestation levels. Suggesting that perhaps other adapted survival mechanisms are contributing to the long-term survival success of these populations such as host resistance or tolerance to the actual mortality inducing virus infections.A natural mite population in an infested honeybee colony can grow exponentially, rapidly leading to a DWV and/or ABPV epidemic that ultimately precipitates the death of the colony typically within a few years22. Recently, we have shown that individuals from the naturally adapted mite-resistant honeybee population on Gotland, Sweden, survive with higher thresholds of DWV and ABPV infections before bee health is compromised, relative to mite-susceptible unselected honeybees23. This suggests that host tolerance, rather than resistance, to virus infections is an important component of the naturally adapted survival mechanisms of the Gotland mite-resistant population, in addition to their adapted mite-resistant traits. At the colony level, the Gotland honeybee population also appear to have adapted resistance to other virus infection not directly transmitted by varroa mites but nevertheless harm honeybee health and reduce long-term survival25.In host\u2013parasite interactions, host tolerance is defined as the ability to reduce the effect of the parasite, while host resistance is the ability to reduce the fitness of the parasite20, The Netherlands21 and France26, while comparing them with the Gotland population in Sweden23 and a non-selected mite-susceptible local honeybee population. This was done by comparing how experimental APBV and DWV oral infections differentially affect the larvae and adult bees from these honeybee population, through both a virus infection time-course and adult bee mortality rates. Virus susceptibility was determined by comparing the virus titres of virus-inoculated bees relative to both the pre-experiment background virus titres and the natural infection development in uninoculated bees across the time-course. Adult bee mortality over time was also recorded, as well as the virus titres in dead bees.The aim of this study was to assess the possible contribution of adapted virus tolerance and/or resistance to the enhanced survival of three other well-documented mite-resistant honeybee populations from Norway27, and recently summarised in a review17. Briefly, the populations have evolved independently without mite control since 1994 26, 1999 27, 2001 20 and 2005 21. During summer 2016, twelve queens from each of the four mite-resistant populations were produced and mated in their geographic locations of origin and were transported by surface courier to Sweden according to EU-legislation guidelines for animal transport. Twelve queens from a local mite-susceptible population were similarly produced and mated, to be used in this study as a control group. These queens originated from an unselected population near Uppsala that requires regular varroa mite control interventions by beekeepers to avoid colony death. Sixty host colonies, each in a single full-size hive body containing 4 frames brood, 1 frame pollen, 2 frames honey and 3 frames wax foundation, were acquired from four local beekeepers (15 colonies from each beekeeper) and placed in four apiaries (one apiary per beekeeper) at the L\u00f6vsta Research Station at the Swedish University of Agricultural Sciences in Uppsala, Sweden. The four apiaries were between 500 and 1000\u00a0m separated from each other. On July 12, 2016, in each of the four apiaries, three queens from each of the five populations  were introduced in the fifteen colonies. All colonies were fed with a commercial 66% w/w sugar solution with a 2/1/1 ratio of sucrose/fructose/glucose  to encourage queen acceptance. On August 25, 2016 each colony was treated against varroa with two strips of tau-fluvalinate  for six weeks, following the manufacturers recommended procedures. No further varroa treatment was applied until the experiments described here began the following summer in 2017, by which time all individuals in each colony were the offspring of the introduced experimental and control queens. The colonies used in these experiments were selected randomly from all four apiaries. Samples of\u2009~\u2009300 adult bees were taken from each colony at bi-monthly intervals during 2017 to determine the phoretic varroa infestation rates, using soapy water mite washes28, with the rate for August 2017 (when the larvae and adults for the experiments were collected) used in the analyses 13. From these 50 pupae, a clarified crude extract was made by homogenizing the pupae in a blender with 10\u00a0mL 0.5\u00a0M Phosphate Buffer, pH 8.0 (DWV) or 10\u00a0mL 0.01\u00a0M Phosphate Buffer, pH 7.0 (ABPV),and stored in 50\u00a0\u03bcl aliquots at \u2013 80\u00a0\u00b0C13. These crude extracts were used for the virus infection experiments. The virological composition of the propagated virus stocks has been described previously19 and was determined using RT-qPCR assays for seven common bee viruses that can be propagated through injection13: DWV-A, DWV-B, ABPV, IAPV, KBV, sacbrood virus (SBV) and black queen cell virus (BQCV).The DWV and ABPV inocula used in each oral infection experiment was prepared previously23 to identify the optimum dose for experimentation that did not cause larvae or adult bee mortality before 96\u00a0h post inoculation (hpi). This dose selection criteria was used so that early  virus infectivity dynamics could be studied, as well as possible subsequent differential mortality between mite-resistant and mite-susceptible bees. The optimum single inoculation dose for larvae was determined to be\u2009~\u20091.5\u2009\u00d7\u2009108 and\u2009~\u20096.0\u2009\u00d7\u2009108 DWV genome equivalents for larvae and adults respectively, with the corresponding figures for ABPV inoculation\u2009~\u20095.4\u2009\u00d7\u2009107 and\u2009~\u20092.1\u2009\u00d7\u2009108 ABPV genome equivalents, as determined by RT-qPCR analysis of the crude extracts. These levels are consistent with previous estimates of the infectious doses for these viruses30.The infectivity of the crude extracts was tested previously in optimization experimentsThe infection experiments were conducted separately on newly emerged adult bees and on newly hatched larvae. Each infection experiment consisted a single infection time-course for bees from four different colonies from each population. With a few exceptions, the same colonies were used for both the larval and adult experiments. Each infection trial consisted of one cohort of DWV-inoculated bees, one cohort of ABPV-inoculated bees and one cohort of non-inoculated control bees. From each cohort of bees in each infection trial, adult bees and larvae were sampled at 0, 6, 24, 48, and 72\u00a0h post inoculation (hpi) representing the time-course. The inoculation strategy consisted of feeding bees with a single infectious dose for a short period followed by non-contaminated food for the remainder of the time course, in order to ensure that any increase in virus titres through the time course represented a newly established infection rather than a passive accumulation of virus inoculum. The non-inoculated cohorts received food containing crude extract from non-inoculated pupae.Norwegian, Swedish, Dutch, French) and the mite-susceptible Control population. Larvae of similar age were obtained by confining the queens of the experimental colonies to a single frame for 24\u00a0h for egg-laying. First instar larvae (between 24 and 36\u00a0h old) were transferred into individual wells of 48-well tissue culture plates  following standard larval rearing procedures32. The larvae were pre-incubated for 24\u00a0h at 35\u00a0\u00b0C with a relative humidity of 96%, after which all dead and excess larvae were removed, such that 48 living larvae were retained for the infection experiment. The viable larvae were then fed with larval food. For the larvae cohorts to be inoculated with virus, the larval food was mixed with the optimum single infectious dose of DWV or ABPV, as determined above. The larvae were fed daily according to established protocols32. At each hpi-sampling point during the experimental time-course (see above), four live larvae from each infection cohort were collected in microcentrifuge tubes and stored at \u2212 20\u00a0\u00b0C until further analysis33.The larval infection experiments were conducted on newly hatched larvae from 4 colonies from each of the four mite-resistant populations  based on the number of mites encountered in the cage during the emergence of the adults  the same 4 colonies used for the larvae infection experiments from each of the five populations. The bees were hatched on caged frames inside an incubator at a constant 35\u00a0\u00b0C temperature and 96% relative humidity33. Total RNA was extracted from 100\u00a0\u03bcl of this homogenate by a QiaCube robot following the RNAeasy protocol for plants (Qiagen). The RNA was eluted in 50-\u03bcl RNase-free water, the RNA concentration was estimated by NanoDrop and the purified RNA was stored at \u2212 80\u00a0\u00b0C until further processing.Each experimental time-course sample, containing either 4 larvae or 5 adult bees, was placed in a mesh bag and ground to powder using liquid nitrogen and a pestle. A primary homogenate was produced by adding 200\u00a0\u03bcl/bee sterile water to each ground sample and mixing vigorously13) were determined using reverse transcription quantitative PCR (RT-qPCR), using the iScript One Step RT-PCR kit (Bio-Rad) with SYBR Green as the detection chemistry and the Bio-Rad CFX connect thermocycler. The reactions were performed in 20\u00a0\u03bcl volumes containing 0.2\u00a0\u03bcM of the forward and the reverse primers, 3\u00a0\u03bcl RNA, 10\u00a0\u03bcl SYBR Green RTmix and 0.4\u00a0\u03bcl of iScript reverse transcriptase, with the following cycling profile: 10\u00a0min at 50\u00a0\u00b0C for cDNA synthesis, 5\u00a0min at 95\u00a0\u00b0C for inactivation of the reverse transcriptase following 40 cycles of 10\u00a0s. at 95\u00a0\u00b0C for denaturation and 30\u00a0s. at 58\u00a0\u00b0C for annealing/extension and data collection. Amplification was followed immediately by a Melting Curve analysis to confirm the identity of the amplification products, by incubating at 60\u00a0s: 95\u00a0\u00b0C, 60\u00a0s 65\u00a0\u00b0C and fluorescence reading at 0.5\u00a0\u00b0C increments between 65 and 95\u00a0\u00b0C. Included in each qPCR run was a ten-fold dilution series of known amounts of each target, for absolute quantification. All assays were run in duplicate, with the average Cq value retained for analysis. The qPCR data were first screened for the presence of secondary RT-PCR products through visual inspection of the Melting Curve (MC) analyses. After the visual inspection, the average Cq values were converted to Standard Quantity (SQ) values through use of the external calibration curves established by the ten-fold dilution series for each target. These data were then multiplied by the various dilution factors throughout the methodology to estimate the copy number of each target per bee. The DWV and ABPV values for each sample were then normalized using their corresponding RP49 values, to correct for sample-specific differences in the quality and quantity of RNA36.The amounts of DWV and ABPV RNA, as well as RP49 mRNA  as recorded for the infection experiments for either of the two life stages  were used as the response variables, analysed separately. In each of these four separate analyses the models (function lmer within the lmerTest package38) tested the degree to which the virus titres depended on the Population of origin, the Inoculation treatment  or the phoretic Varroa infestation rate of the colonies providing the experimental bees, and their interactions. The apiary location of the colonies and the different post-inoculation sampling time-points during the time-courses were included as Gaussian random effects to account for, respectively, any apiary-specific variability between the colonies used and the repeated measure structure associated with sampling the same group of bees progressively during the time-course. The distribution of the residuals and the homogeneity of variances was checked visually to confirm compliance with the assumptions for linear models using a Gaussian-distributed response variable39. Pairwise comparisons (using the function glht and cld from the mulcomp package40) among all combinations of Population and Inoculation treatment were calculated from these initial models. In order to evaluate the importance of each of these predictors and their interaction, non-significant terms were removed in a backwards model selection (using the step function in the lmerTest package) until the minimal adequate model was obtained.The normalized virus titres per individual bee were log41. Here we estimated the probability that an individual bee died relative to time post-inoculation. These probabilities were compared between the different populations, in particular with pairwise comparisons between the varroa-susceptible Control and each of the Dutch, French, Norwegian and Swedish varroa-resistant populations. The analyses were run separately for DWV-inoculated, ABPV-inoculated and non-inoculated adult bees. For each of these three virus inoculation experiments, we followed the fate of 600 individual bees (30 bees from each colony\u2009\u00d7\u20094 replicate colonies per population\u2009\u00d7\u20095 population) and recorded their survival or mortality at 6, 24, 48, 72, 96 and 144\u00a0h post-inoculation . Because the colonies were located at four different apiaries, with different historical and environmental backgrounds  and the colony-level phoretic varroa infestation rate (mites per adult bee) for each colony during August 2017, when the experiments took place, to control for any confounding effects that different varroa mite loads would contribute to individual bee mortality. The models converged readily  and could explain the data with a very high degree of confidence, as assessed by a Likelihood ratio test  analysis using a Cox proportional hazards regression modelnds see \u201c\u201d, we inc19. A graphical summary of the raw data is shown in Supplementary Fig.\u00a019, making it impossible to demonstrate successful infection either through comparing pre- and post-inoculation samples or through titre increases with time, since such increases were observed equally in all populations for the DWV-inoculated, the ABPV-inoculated and the non-inoculated series. It is only through the effect of DWV inoculation on adult mortality (see later) that we know that the inoculum actually had an effect on the bees. For the ABPV infection time-course experiments there is clearer evidence of a slow progressive increase in ABPV titres, in both larvae and adult bees, and for all populations, suggesting that the inoculation resulted in an active infection. There was no great difference in the background ABPV titres between the DWV-inoculated and non-inoculated individuals for either the larval or adult infection experiment. For the adult experiment there was a slight increase in these background ABPV titres over time, whereas for the larval experiment there was not.The virus infection time courses for the two viruses were very similar to those reported previouslyAlthough both inoculated and background virus titres tended to increase slightly over time in both the larval and adult experiments and for all populations, often enough to suspect that these represented active infections, these increases were not large enough with respect to the replicate error variance to be significant. For the remainder of the analyses therefore the values from the time-course were pooled, effectively treating time post-inoculation as a random factor in the GLMM analyses. This meant that the data from the entire time-course were compressed into a single value, which can be taken as a measure of the overall susceptibility of the population to DWV or ABPV infection over the entire time-course, as well as the susceptibility to background DWV or ABPV infections due to inoculation with the alternate virus Fig.\u00a0. These e23. As indicated above, the adult infection experiment was dominated by the extremely high background DWV levels, making it impossible to detect any additional increase in DWV titre due to oral inoculation. Consequently, the DWV titres for the DWV-inoculated, ABPV-inoculated and non-inoculated bees were similar within each population, with no effect of the different virus inoculation treatments  Swedish populations Fig.\u00a0; Table 1The general pattern seen for the DWV titres as response variable was repeated with ABPV titres as the response variable, but with some key differences. Again, the inoculation treatment was highly significant, both in larvae and in adults, as shown by the difference between the ABPV titres in the ABPV-inoculated series compared to the DWV-inoculated and non-inoculated series. Again there is no difference in ABPV titres between non-inoculated and DWV-inoculated larvae for each population. For the larval inoculation, there was highly significant difference between the populations in ABPV susceptibility Table , althoug1. Consequently, relationship between colony-level varroa infestation and virus susceptibility of the adult bees is much more pronounced, with higher infestation rates associated with greater susceptibility to oral virus infection  and time post infection  were relevant.The phoretic varroa infestation rate of the colonies consistently had a highly significant effect on the ABPV and DWV susceptibility of the colonies Table . The rel45, the colony-level varroa infestation rates were included in the modelling of adult mortality, to neutralize the effect of the differential varroa infestation rates between the colonies and populations  which shows both the size of the effect and the direction, with values\u2009<\u20091.00 indicating a lower mortality due to the factor, and values\u2009>\u20091.00 a higher mortality. As is also shown in Fig.\u00a02 and associated probability (p\u2009=\u20090.02). This result is due to a couple of (Control) colonies with very large varroa infestation rates that significantly overperformed with respect to expectation, together with several low-infestation colonies that underperformed. The interesting result is that the same bees, with the same infestation rates, reacted so very differently depending on whether they were inoculated with DWV, with ABPV or not inoculated at all. Obviously, non-inoculated bees survive much better than DWV-inoculated or ABPV-inoculated bees, with or without varroa  post-inoculation. This mortality data was analysed with reference to the population of origin and the inoculation treatment, using Cox\u2019s Proportional Hazard analyses. Without any experimental virus inoculation there is no difference between any of the populations in background mortality Fig.\u00a0, which i44\u00a0h post49. Therefore, laboratory studies, like this one, that remove these confounding factors, are ideal for isolating and exploring the mechanisms involved in the interactions between viruses and bees, especially at individual level. Here we investigated the susceptibility of young larvae and emerging adults from four distinct varroa-resistant honeybee populations to oral inoculation with two major honeybee viruses, DWV and ABPV, relative to those of a varroa-susceptible Control population, as well as the mortality of the adult bees from the experiments. We also looked at the influence of confounding factors on virus susceptibility and adult mortality, such as the colony-level varroa infestation rates and the apiary origins of the colonies supplying the bees for the experiments. The results can be summarised as follows. First, oral inoculation generally elevated virus titres above pre-inoculum titres plus passive acquisition of the inoculum, and increased slightly with time, indicating that the inoculation resulted in infection. The exception is the inoculation of the adult bees with DWV, where the exceptionally high background DWV levels precluded any conclusive evidence of infection. Second, there were clear differences between the different populations in susceptibility to DWV and ABPV infection, either through inoculation and/or as background infections, both before and after correcting for the effects of varroa and apiary origin, with the Control population usually displaying the highest susceptibility. Third, inoculation with one virus generally did not affect the background levels of the other virus relative to the non-inoculated control, for any of the populations or inoculation experiments, similar to what we found previously23. Fourth, adult bees from the varroa-susceptible Control population had much higher mortality after oral DWV or ABPV inoculation than bees from any of the four varroa-resistant populations, while there was no major difference between non-inoculated bees from the various populations. Clearly, infection with these viruses is tolerated much better by the varroa-resistant bees than the varroa-susceptible bees, independent of any differences in virus titres. Fifth, varroa infestation and apiary origin have significant effects on virus susceptibility and mortality in adult bees. Colony-level varroa infestation is associated with higher susceptibility of adult bees to both DWV and ABPV infection, and with much higher mortality of both non-inoculated and ABPV-inoculated bees, but not of DWV-inoculated bees. This absence of an independent effect of varroa infestation on adult bee mortality in only DWV-inoculated bees is particularly interesting in light of the many other exceptional features of DWV that are peculiarly adaptive to optimal co-existence with varroa48, and that have elevated DWV from relative obscurity to global prominence in the wake of varroa50. Apiary effects are a well-known source of error in honeybee research, particularly for colony-level experiments. Here we show that such landscape-level differences can also affect individual level laboratory results, serving both as a caution for those contemplating laboratory studies without due regard for the origin of the bees and as a promise for investigating in greater molecular detail the mechanisms linking the influence of the environment on honeybee molecular health51.Honeybee colony health and pathogen abundance and prevelence is regulated by a variety of factors including season, geographical location, colony dynamics, pathogen strain and the individual and colony level immune responses52, and from there to the rest of the colony through larval care and social interactions54. Any systematic difference between queens in the level of virus infection55 and/or the efficiency of vertical transmission would lead to differences in \u2018background\u2019 DWV or ABPV infection in young, newly hatched larvae, such as used in these experiments. ABPV is rare in Sweden and Norway56, very common in France4 and moderately common in The Netherlands57, which does not match very well with the relative background ABPV levels in the larvae from these populations. Furthermore, a large survey of virgin and mated queens from southern France showed no ABPV infection of the queen ovaries, in contrast to the high frequency (and levels) of DWV-A, DWV-B and BQCV infection. Therefore, even if the queens did vertically transmit viruses from their geographic origin to the larvae used in these experiments, it would not fully explain all the differences in the larval background virus levels between the populations. It is therefore possible that some of these differences at least are related to the genetic background of the populations, either directly, at individual bee level, or as mediated through colony-level processes that also differ between the populations. For the adult experiments the DWV background levels were so high as to preclude any conclusion of the infectivity of the DWV inoculum in these experiments. Again there are very clear and consistent differences between the populations in the background DWV levels, suggesting a corresponding difference between the populations in background tolerance or resistance to DWV infection. The background ABPV levels in the adult bees were more uniform between the populations, suggesting no such differential tolerance-resistance between the populations for background ABPV infection.Another consistent feature of these experiments is the large variation in the background virus levels between the five populations in all experiments, which contributed majorly to the significance of the population effect in the analyses. The only experimental difference between these colonies was the origin of the queens during establishment in 2016, after which the colonies developed according to the local environmental conditions in the apiaries and the colony development characteristics associated with the genotype of the queen. The colonies of the five populations were distributed systematically and evenly among the four apiaries; three colonies of each population to each apiary, with only these colonies present in each apiary. The four apiaries were located near the center of the extensive SLU Agricultural Research Station at L\u00f6vsta, several kilometres from any surrounding bee colonies. In the absence of any compelling environmental explanation, the conclusion is that these background virus levels are also a characteristic trait of these colonies and populations, although the significance of this is as yet unclear. The differences are particularly striking for the larvae inoculation experiments. Both DWV and ABPV can be vertically transmitted, from queen through her eggs to the resulting progeny24. The most likely explanation for this elevated tolerance to virus infections is that the natural adaptation of these populations to uncontrolled varroa infestation included a degree of tolerance to virus infections in addition to their already well established genetically adapted varroa-resistant traits20. Recent studies on the naturally adapted mite-resistant honeybee population on Gotland, Sweden, have demonstrated adapted host tolerance to virus infections at both levels of honeybee social and biological organization: the colony24 and the individual bee23. Apart from this, few studies have explored host-adaptations to virus infections59. The populations in this study provide the opportunity to explore possible tolerance or resistance mechanisms that have arose in populations through natural selection having been exposed to long-lasting likely subclinical virus infections inducing a substantial selective pressure. Virus tolerance and resisance could provide a new and exciting avenue for breeding healthier bees. Tolerance is a highly effective mechanistic response to disease60. Unlike resistance mechanisms, tolerance adaptations do not inflict harm on the parasite and is therefore expected to fix in the population rather than causing an open-ended antagonistic coevolution, as is the case with resistance evolution60. In addition to uncontrolled mite infestations and high virus levels, environmental influences would have also shaped the genetic adaptations in responses to these parasites61. The different geographical origins of the populations used in this study, ranging from Scandinavia to South of France, have dramatically different environmental conditions such as the season length, temperature, and floral resources. The possible influence of such environmental factors on the nature of the adaptive process and the consequences for the different varroa-resistant and virus-tolerant traits of these populations is a topic of current and future research.The most significant conclusion from these five major results is that adult bees from naturally varroa-resistant bee populations are much more tolerant to oral DWV or ABPV infection than bees from regular varroa-susceptible control populations, as shown both here and, independently, in our earlier studies45, it also acts as both a mechanical and biological vector of DWV and other viruses63, significantly enhancing the epidemiological potential and lethality of virus infections15. Varroa mite parasitism also comprimises the honeybee host\u2019s immune response to virus infections by suppressing the expression of immune response related genes64 and increasing viral titres in the bee, both of which reduce adult bee survivorship and colony fitness66.The varroa infestation rates in the colonies that were used for these experiments significantly increased the probability of adult bee mortality regardless of inoculation with either virus. This is by itself not surprising, since varroa infestation causes a range of physical and physiological effects for both individual bees and the colony. Not only does varroa mite parasitization directly affects the longevity of adult bees70, but also with considerable gaps in knowledge and understanding71. The large set of precise samples generated during this study together with the extensive metadata relating to the genetic and environmental background of the colonies provides a rich source of material to address these knowledge gaps from a number of perspectives.The interactions between the mites, the viruses and the honeybee molecular antiviral defense mechanisms and immune functions is a subject of considerable current researchSupplementary Information."}
+{"text": "A titanium(III)\u2010catalyzed desulfonylation gives access to functionalized alkyl nitrile building blocks from \u03b1\u2010sulfonyl nitriles, circumventing traditional base\u2010mediated \u03b1\u2010alkylation conditions and strong single electron donors. The reaction tolerates numerous functional groups including free alcohols, esters, amides, and it can be applied also to the \u03b1\u2010desulfonylation of ketones. In addition, a one\u2010pot desulfonylative alkylation is demonstrated. Preliminary mechanistic studies indicate a catalyst\u2010dependent mechanism involving a homolytic C\u2212S cleavage. Catalyst\u2010controlled cleavage: A transition\u2010metal\u2010catalyzed desulfonylation gives access to functionalized nitriles and ketones from readily\u2010available \u03b1\u2010sulfonylated precursors. The homolytic reductive C\u2212S cleavage occurs under the control of an in situ generated titanium(III) catalyst and it can be combined with a Michael addition reaction to achieve a one\u2010pot desulfonylative alkylation. O5 was submitted to the reaction without titanium catalyst. A rapid C\u2212S cleavage occurred and nitrile 2\u2009a was obtained in 78\u2009% yield after 3\u2005hours (Scheme\u20051\u2009a was reacted with a stoichiometric amount of pregenerated Cp*2TiCl (with the excess of zinc removed by filtration) and nitrile 2\u2009a was formed in 30\u2009% yield (33\u2009% conversion) \u2010mediated reduction steps had occurred, preventing a quantitative conversion of 1\u2009a into 2\u2009a.To gain insight into the mechanism of the desulfonylation, thioether s Scheme\u2005. In a se) Scheme\u2005. This ex2TiCl2 a dual activation mode, as was established for the related titanium(III)\u2010catalyzed decyanation, was considered  while the formation of 6\u2010Cp* became more favorable . Overall these observations were in agreement with the postulated change from a dual activation to a single activation mode. However, further studies will be required to completely rule out a dual activation.We hypothesized that the condition\u2010dependent change in catalyst reactivity observed during the optimization studies  complex.2 again prevents catalyst inhibition by the nitrile product.A mechanism is proposed that starts with the reduction of the titanium(IV) catalyst to a titanium(III) species Scheme\u2005. Then, cIn conclusion, a broadly applicable titanium(III)\u2010catalyzed desulfonylation of \u03b1\u2010arylsulfonyl and \u03b1\u2010methanesulfonyl nitriles has been developed. The reaction can be applied to the \u03b1\u2010desulfonylation of ketones as well. We have further realized a one\u2010pot desulfonylative cross\u2010coupling with acrylonitrile as a representative Michael acceptor. First experiments suggest that the reaction proceeds via a homolytic C\u2212S cleavage that is induced by electron transfer from a single titanium(III) species. The reaction complements the existing desulfonylation protocols and the environmentally friendly early base metal catalyst as well as the non\u2010problematic additives and solvents render it attractive for future applications in organic synthesis.The authors declare no conflict of interest.As a service to our authors and readers, this journal provides supporting information supplied by the authors. Such materials are peer reviewed and may be re\u2010organized for online delivery, but are not copy\u2010edited or typeset. Technical support issues arising from supporting information (other than missing files) should be addressed to the authors.SupplementaryClick here for additional data file."}
+{"text": "The mathematical model is based in the restricted three-body problem. The use of this maneuver makes it possible to obtain the variations of energy in the trajectory, replacing expensive maneuvers based on fuel consumption. To observe the effects of the maneuvers, different values of pericenter velocity and altitude were selected for prograde and retrograde orbits. The innovation of this research is the application of an integral method to quantify the delta-V of the aero gravity maneuver, comparing the cost of the maneuver with the traditional methods of space propulsion. The results allow the identification of orbits with conditions to capture, and the perturbative maps show the velocity variations.The perturbative integral method was applied to quantify the contribution of external forces during a specific interval of time in trajectories of spacecraft around asteroids and under the Luni-solar influence. However, this method has not been used to quantify the contributions of drag in aerocapture and aerobraking. For this reason, the planet Mars is selected to apply this method during an aerogravity-assisted maneuver. Several trajectories are analyzed, making use of a drag device with area to mass ratios varying from 0.0 to 20.0\u00a0m The PI quantifies the contribution of each acceleration involved in the spacecraft trajectory. It was implemented to find the less perturbed orbits around the Earth and under Lunisolar influence2. It was also applied to map orbits around asteroids3 and to analyze the effect of the terms of the expansion of the gravity field of the Earth1. Other applications include the quantification of perturbative forces in harmonic and duffing oscillators and measurements of the perturbations in satellites4. Those ideas were later generalized, and four types of PI were described in the literature to calculate perturbation maps around asteroids5 and to quantify the effects of the accelerations during a Powered Aero-Gravity Assisted Maneuver (PAGAM)6. The results showed that the PI measures the evolution of the perturbations, indicating the Delta-V (DV) given by those forces and so predicting the orbital changes they made in the trajectory of the spacecraft. An important improvement appeared in the literature when studying the irregular shape of the Earth7, which made an important step in this type of integral index and developed a version that is much more accurate in several types of applications when there are forces in opposed directions involved in the trajectory.A method to quantify the influence of orbital perturbations called Perturbative Integral (PI) was presented in Refs.12.As was presented, the PI was applied in several problems in orbital dynamics, however, it has not been used to analyze aeromaneuvers, with a focus on aerocapture, which is useful for future interplanetary flights. For example, the PI could be applied to quantify the contribution of the aerodynamic forces during a final approach in planets like Venus, Mars, and Jupiter, which present a significant atmospheric density. Conceptual missions are projected to include aerocapture and aerobraking maneuvers, instead of traditional propulsion systems, reducing the costs of the missionSuccessful missions to Mars, like the InSight (2018), showed that the interest in the exploration of the planet continues to grow. A highlight of InSight was the transportation of two small spacecraft: MarCO A and MarCO B, the first interplanetary CubeSats. The sizes of the SmallSats restricted the use of traditional propulsion systems, due to the limited mass and volume. This scenario allows the exploration of alternative techniques as aeromaneuvers, which are possible due to the implementation of drag devices, a low-cost technology with a higher level of maturity, compared to the small propulsion systems for NanoSats.Considering the use of small spacecraft in space exploration missions, the maturity of the technology, and the future missions to Mars, the present paper contributes to this topic by applying the PI technique to calculate the contribution of the drag during aeromaneuvers. The idea is to measure the variation of velocity given by drag during the whole trajectory of the spacecraft, so the savings in propulsion systems can be measured and expressed by the PI scalar index.16. If the conditions are optimal, the approach can end in aerocapture. Different studies about the aerocapture have been discussed in the scientific literature20, showing the DV savings due to the aerodynamic effect of the atmosphere of Mars.Due to the close approach, the resulting trajectory could be a Gravity Assisted Maneuver (GAM), or swing-by, and, with the pericenter located inside the atmosphere, in an Aero-Gravity Assisted Maneuver (AGAM)A/m), the methodology, followed by a discussion of the results obtained and the conclusions.The next section describes the mathematical model of the trajectory and the mapping techniques of the PI used to quantify the contribution of drag as a function of the spacecraft\u2019s Area-to-Mass ratio  is approaching Mars. In this case, the spacecraft has a drag device to increase the A/m, generating a larger effect of aerodynamic deceleration (AD). At the beginning of the simulations, the spacecraft is orbiting the Sun in a transfer orbit from the Earth, and then it makes a passage inside the atmosphere of Mars.The mathematical model selected for the simulations is the Circular Restricted Three-Body Problem (CRTBP), a model that was implemented with success in the analysis of GAM and AGAM13 with the addition of the acceleration due to drag, in a 2D maneuver. The two dynamical equations, as a function of the potential The dynamic equations in the plane of the rotating coordinate system in dimensionless variables, and restricted to the plane of the primaries, are derived from the potential of the CRTBP(\u03bc). The potential function is:The potential is a function of the spacecraft\u00b4s position vectors to the Sun 13. Using the variables of the system, the general form of the orbital energy of the spacecraft with respect to Mars is:The derivation of the Eqs.\u00a0 to 3) i i3) is dV2). The acceleration given by drag is a function of the A/m, the atmospheric density (CD), which is assumed to be constant . The acceleration due to drag is described in more detail in21, and it is represented by:The drag is a dissipative force acting in the direction opposite to the motion of the spacecraft relative to the atmosphere (CDA/m) is known as the ballistic parameter (B).For practical considerations, the constant value along the trajectory (3) and H is the scale height 22. The upper limit of the atmospheric model is assumed to be 2500\u00a0km of altitude.Equation\u00a0 shows thPI is defined as the integral of the AD, from the beginning of the atmospheric passage (ti) to the end of the passage inside the planetary atmosphere (tf). In this case, it is selected the version of the PI that integrates the magnitude of the acceleration, because there is no compensation of accelerations coming from different directions during the trajectory, since the drag always removes energy from the spacecraft5. The study is made numerically, so the assumption of Keplerian orbits is not made. Equation\u00a0. After one day of the passage of the spacecraft by the pericenter, the two-body energy relative to Mars and its distance is evaluated to classify the resulting trajectory, because the value of the energy indicates which type of trajectory the spacecraft has relative to Mars after the first approach.To determine the initial conditions of the AGAM from the selected pericenter, the trajectories are propagated in negative times using the GAM, stopping when a distance of 0.5 DU from the center of Mars is reached. During this propagation, it is monitored the conservation of the Jacobi Constant with an accuracy lower than 1\u2009\u00d7\u200910The mathematical model was coded using the numerical integrator RKF-7/8 to solve the dynamic equations of motion (1) and (2). In the case of Eq.\u00a0 change from 100 to 150\u00a0km, in steps of 0.1\u00a0km.The trajectories were propagated with For the trajectories arriving from the transfer orbit in GAM, two velocities at the pericenter of Mars were selected, 0.246 and 0.336 VU, which are calculated from a Hohmann transfer assuming a perihelium equal to the Earth\u00b4s semimajor-axis and an aphelion larger than the semimajor-axis of Mars, to generate a hyperbolic trajectory. The initial points are the same for all the trajectories (GAM and AGAM), since the trajectories come from the Earth. The angle of approach was selected to be 0\u00b0, indicating that the pericenter is in the apsis line, in front of the planet and in the line of the apsides.A/m and does not appear for the GAM (B\u2009=\u20090.0 m2/kg). Just above the collision region, the capture zone (red color) appears. After the capture, the continuum interaction of the spacecraft with the atmosphere generates aerobraking trajectories. It is possible to observe the aerobraking effect in the changes in the red regions of Fig.\u00a0A/m, atmospheric density, and velocity, being sensitive to small density variations . The losses of energy in this region have intermediary values, which are large enough to transform the hyperbolic trajectory into an elliptic orbit (capture), but not large enough to make a reentry in less than one day.Figure\u00a0The last region of Fig.\u00a0A/m larger than 12 m2/kg ended in collisions less than one day after the close approach , searching to stabilize the orbit of the spacecraft for a long period. In this case it is possible the use active control to keep the orbit.A total of 250,000 trajectories were simulated for each scenario. For approaches with a velocity of 0.246 VU, one day after the passage by the pericenter, only 5,536 trajectories resulted in aerocapture. After one month, this number was reduced to 943, due to the aerobraking, which reduced the limit of the altitude ending in collision Fig. a,b. For 2/kg, at 140\u00a0km of hp, after 1\u00a0day of the passage. Initial GA trajectories are represented in black (zero drag), escape in blue, captures in red, and captures ending in collisions in green. Mars is the orange circle and the atmospheric limits are shown by the blue dots. It is possible to observe the resulting geometry of the orbit after the closest approach. The trajectories are plotted in the plane of the synodic frame  is the retrograde motion, which main effect is the increase in the relative velocity between the spacecraft and the atmosphere. In the rotational frame, the resulting VFrom Figs. Figure\u00a015. In this case, it was analyzed the influence of the angle of approach in the collision, capture, and escape regions. The results show that the regions are constant for a selected velocity of approach and A/m, independent of the angle of approach, since the relative velocity to the atmosphere is the same.The variations of the angle of approach for a selected altitude and velocity at periapsis during a GA, generate changes in the energy and velocity after the close approachThe resulting trajectories after the closest approach (aerocapture and AGAM), are analyzed using the PI technique, which means that we will measure the value of the total variation of velocity (DV) given by the drag. This method can measure the reduction in costs of fuel obtained by the AGAM because the PI measures the contribution of the atmosphere to the maneuver, which is equivalent to the impulse necessary to reduce the velocity of the spacecraft to place it in its final orbit.3\u00a0m/s and an upper limit of 2.05\u2009\u00d7\u2009103\u00a0m/s for the captured orbits (velocity of the GAM at periapsis is 0.246 VU). Orbits with PI lower than 1.0\u2009\u00d7\u2009103\u00a0m/s resulted in escape trajectories, while values larger than 2.05\u2009\u00d7\u2009103\u00a0m/s generate collisions  therefore, it generates larger values of DV see Fig.\u00a0. It is aA/m\u2009=\u20091.0, at 122.4\u00a0km of pericenter altitude and velocity 0.246 VU at periapsis, the semi-major axis resulting from the aerocapture is 6.37819 MR with a PI-DV of 1207.33\u00a0m/s. At this point, it is calculated the orbital velocity of the elliptical orbit that the spacecraft would have if the atmosphere were not present. The required DV to transform the orbit, assumed the same final orbit given by the maneuver using the atmosphere, can be calculated from the \u201cvis-viva\u201d equation, and the result is 1115.4\u00a0m/s. This is the value saved in the propulsion system by the effect of the atmosphere. Table To compare the results given by the PI-DV with the single impulse maneuver (without drag), it was determined the eccentricity and semi-major axis of the resulting trajectories for one day after the aerocapture. From the initial trajectory, it is possible to calculate the DV required. For example, in the case of captures with 2/kg and initial velocity at the pericenter of 0.246 VU.The use of the PI also allows the identification of the variations in the trajectories. In the case of aerocapture, the PI shows an initial large variation in a short time, showing the DV dissipated by the atmosphere during the first approach. In the next days, the variations in DV are negligible compared to the values required for the capture but show small variations that represent the aerobraking. After several days, the largest variation occurs, which represents the change from decay orbit condition to reentry and collision. Then, the PI-DV as a function of time is useful to observe these behaviors, to quantify the DV dissipated by the atmosphere and the duration of the changes. In Fig.\u00a0In this research, for the first time, it was applied the technique known as PI to measure the total impulse obtained from the Martian atmosphere during the close approach. The PI technique allows us to measure the savings that the atmosphere provided during aerocapture, aerobraking, and AGAM. The results show a particularly good agreement between the PI and the savings calculated by the analytical impulsive method. It means that the PI is a valid method to be used to predict the savings generated by drag. This technique should be used to complement the design of future aeromaneuvers.With the use of the PI-DV technique, it was possible to map the regions of capture, as well as to calculate the DV dissipated by the atmosphere, the savings obtained for the propulsion system, and to quantify the boundary values of the capture regions. Therefore, we can also see the best form to use the atmosphere of Mars for this maneuver and to quantify accurately the savings obtained.The submitted work is original and not have been published elsewhere in any form or language. The work presents the results of a single study. The results are presented clearly, honestly, and without fabrication, falsification, or inappropriate data manipulation. No data, text, or theories by others are presented as if they were the author\u2019s own."}
+{"text": "Setting up strongJosephson coupling in van der Waals materialsin close proximity to superconductors offers several opportunitiesboth to inspect fundamental physics and to develop cryogenic quantumtechnologies. Here we show evidence of Josephson coupling in a planarfew-layer black phosphorus junction. The planar geometry allows usto probe the junction behavior by means of external gates, at differentcarrier concentrations. Clear signatures of Josephson coupling aredemonstrated by measuring supercurrent flow through the junction atmilli-Kelvin temperatures. Manifestation of a Fraunhofer pattern witha transverse magnetic field is also reported, confirming the Josephsoncoupling. These findings represent evidence of proximity Josephsoncoupling in a planar junction based on a van der Waals material beyondgraphene and will expedite further studies, exploiting the peculiarproperties of exfoliated black phosphorus thin flakes. Among all, high-quality two-dimensionalelectron gases (2DEGs) have been inspected in so-called planar JJs,exploiting peculiar features such as long ballistic transport andconductance quantization in combination with proximity-induced superconductingcorrelations.22To date,Josephson junction(JJ) devices find a wide range of applications, such as highly sensitivemagnetometers,33 Planar junctions based on 2D exfoliated materials constitute a veryinteresting and intriguing platform for several reasons. To startwith, such devices offer the great opportunity to study fundamentalaspects of distinct physics, such as Dirac-like relativistic behaviorin combination with superconductivity,37 and are a promising platformfor advanced sensing and detection down to the single photon in awide spectral range.4 Importantly, thesuperconducting contacts can be placed laterally, retaining the surfaceof the device free, allowing for the spatially resolved investigationof correlations and transport properties, providing also the possibilityto add top gates. This has triggered great experimental efforts torealize hybrid JJs with 2D flakes and led in 2007 to the fabricationand characterization of a graphene-based JJ device,34 demonstrating a bipolar tuning of supercurrent amplitudewith well-developed Josephson coupling.In the study of 2D materials, recent advances in mechanicalexfoliationtechniques allowed for the fabrication of devices with thickness rangingfrom a single 2D layer, like graphene and its van der Waals relatives,to multilayer systems with different and tunable properties.41 promoting graphene-based JJsas a good candidate to investigate the emergence of topological statesof matter.43Since then, a vast varietyof graphene\u2013superconductor hybridstructures have been explored  in between Nb slabs45 and in a vertical interconnect between MoS2 and MoRe46 has been reported recently. In these structures,the semiconducting van der Waals material is used as a thin, almosttransparent barrier, and the transport in the vertical direction,across the layers, is probed. There, however, gate tuning of the proximitizedsystem is very difficult and can be achieved only laterally, resultingin a strong anisotropic modulation of carrier density in the semiconductingmaterial.45 In this respect, planar junctionsrepresent a scalable and versatile technology, where homogeneous gatingcan be easily obtained. In addition, planar junctions allow the investigationof the superconducting proximity effect in the extreme single layer(monolayer) limit, which is not possible in the vertical configuration.Graphene is only one exampleof the large family of van der Waalsmaterials that can be exfoliated down to monolayer thickness.50 Theoretical studies for superconducting JJs with monolayer bP havebeen put forward, with intriguing features that may emerge in ballisticsamples in combination with ferromagnetic elements.53In this work, we report on the fabrication and characterizationof planar JJ devices based on few-layer black phosphorus. bP is alayered semiconducting material, whose peculiar properties mainlystem from the anisotropic shape of its band structure, which affectsboth its electronic and optical properties.T = 33mK, demonstrating supercurrent flow and clear evidence of Josephsoncoupling.Here,we perform transport measurements on bP planar JJs with Nbcontacts at cryogenic temperatures down to in situ, to removeany residual oxide under the contacts. Superconducting Ti/Nb contactsof 10/60 nm thickness were deposited by a sputtering technique. Thecritical temperature Tc of the Ti/Nb electrodeswas measured to be 8.3 \u00b1 0.2 K, which corresponds to a bulk superconductinggap of the electrodes of \u0394S = 1.76kBTc = 1.26 \u00b1 0.03 meV,in line with the expected value for bulk Nb.54Exfoliated bP flakes were depositedon B-doped Si substrates. Ageometry with four parallel contacts was designed to allow for thecharacterization of several JJs on a single BP flake. The deviceswere realized by electron beam lithography, with a procedure describedin detail in the L \u2248 500 nm, while their widths W range from1.6 \u03bcm (between contacts 1\u20132) to 2.0 \u03bcm (betweencontacts 2\u20133 and 3\u20134), due to a slight trapezoidal shapeof the bP flake. We estimate the uncertainty in these numbers to be\u00b125 nm. The flake thickness of the few-layer bP, inferred fromthe optical microscopy image, is about 10 nm. In the following, wewill present results obtained between contacts 2 and 3 (with contacts1 and 4 floating). We underline that we have obtained consistent resultsfrom device 1\u20132 .The devices shown in -type semiconductor.49 For a back gate voltage Vbg = \u221280V, the bP is deep in the p-type branch. Sweepingthe back gate toward zero voltage, the Fermi level of the semiconductoris shifted into the band gap, which results in a strong increase inresistance or, equivalently, a strong decrease in conductance. Thisis shown in the back gate sweep in -typeregime, as shown in the Supporting Information. From the back gate sweep, a field effect mobility \u03bc = 360cm2/(V s) is obtained from a linear fit of G versusVbg in the range \u221230 V to \u221280 V.Black phosphorus is an intrinsically pV\u2013I characteristics ofthe device measured in a current bias configuration at a back gatevoltage of \u221280 V. A clear and pronounced Josephson supercurrentwith an amplitude of 5 nA is observed. Once the bias current exceedsthis critical value, the device switches from the superconductingto the normal state, with a resistance of RN = 560 \u03a9. As can be seen in Isd = 0 is not strictly zero but R0 \u2248 200 \u03a9. This is due to the effect of thermalfluctuations in the junction and can be understood in the frameworkof the theory by Ambegaokar and Halperin.56 In fact, the McCumber parameter \u03b2c of the junctionis \u03b2c = \u03c9J\u03c4RC,with \u03c9J = 2eVc/\u210f the characteristic Josephson frequency and \u03c4RC = RNC the decay time within the RCSJ model.58 Approximating the junctioncapacitance C with a parallel plate capacitor model,we obtain \u03b2c = 1.2 \u00d7 10\u20135 \u226a1 . Thus, the junction is in the overdamped regime, and the nonvanishingjunction voltage even in the limit Isd \u2192 0 can be attributed to a phase-slip resistance contribution.Consistent with this interpretation, the measured V\u2013I curves do not show any hysteresis; thatis, switching and retrapping current, Isw and Irt, respectively, are equal.Vbg = \u221280 V. The supercurrentbranch is resolved as the central dip, due to the reduced resistancein the V\u2013I curve at the origin.The differential resistance curve shown in i.e., a superconductor\u2013insulator\u2013normal\u2013insulator\u2013superconductorhybrid system. From Ri of each S\u2013N interface from the difference in differentialresistance at low bias (RN = 560 \u03a9= RbP + 2Ri) and at high bias RbP = 1.6 k\u03a9/\u25a1. Within a two-dimensionalDrude model we obtain a carrier concentration at Vbg = \u221280 V of n = 1.1 \u00d7 1013 cm\u20132. Using \u210fkF\u03bc/e and the Fermi wave vector 60 we estimatethe elastic mean free path to be L. The coherencelength of the N region (bP) is61m* = 0.41m0 the averagein-plane effective mass of holes in bP.62 Therefore, L is greater than \u03beN. This indicates thatthe device operates in the long-junction regime.63From the data shownin 66ETh = \u210fD/L2; here ETh = 6.0 \u03bceV. Thus, \u0394S \u226b ETh. The thermal energy kBT is slightly smaller than ETh (here kBT = 2.8 \u03bceV)and also smaller than the Josephson energy66EJ = \u210fIc(T)/2e (here EJ = 10.3 \u03bceV), however, sufficiently large thatthermal fluctuations would be relevant, supporting an interpretationof the data in terms of the Ambegaokar\u2013Halperin picture.56The natural energy scale for the proximityeffect is the ThoulessenergyV/dI of the junction as a function of biascurrent Isd and back gate voltage Vbg. Reducing the back gate voltage from \u221280to 0 V, the switching current is reduced from 5 nA to zero. This reductionin supercurrent is accompanied by an increase in the resistance ofthe normal branch . via EJ = \u210fIsw/2e. ETh (via an increase in the sheet resistance). At about Vbg = \u221240 V, the Josephson energy EJ, which is proportional to the critical current,becomes smaller than the thermal energy kBT. Beyond this point Isw displays strong thermal fluctuations, until a complete suppressionis observed at Vbg = \u221225 V, a backgate voltage at which also the Thouless energy becomes smaller thanthe thermal energy kBT. Also at about Vbg = \u221225 V, theresistance at zero current R0 becomeslarger than the resistance in the normal branch, underlining the quenchingof the Josephson coupling due to the increased Schottky barrier, asalso shown in the V\u2013I curvesin The supercurrent in the junction can be controlled by an externalback gate. This is shown in Isw(Vbg) is well described in the framework of diffusiveJosephson junctions with opaque S/N interfaces.68 The details of the theoretical model aredescribed in the Methods section. As shownin Isw(Vbg), adding further evidencefor the presence of a Schottky barrier at the interface between bPand the superconductor.The monotonic decay of R0 of the V\u2013I curves at Isd = 0 increases due to thermallyactivated phase slips. An Arrhenius plot of ln(R0) vs 1/T  shows a linear trendbetween 200 and 600 mK, with slope \u2212256.0 mK. According toHalperin etal.,69EJ = 11 \u03bceV is obtained, ingood agreement with the value of EJ obtainedat base temperature (33 mK).It is well known that an increase intemperature suppresses proximity-inducedsuperconductivity. y-axis, the switching current as a functionof temperature on a logarithmic scale. The right axis shows the correspondingenergy scale. The graph shows that the Thouless energy ETh is approximately constant, since the normal resistancedoes not change significantly in this temperature range. At low temperatures,the supercurrent appears to be approximately constant until kBT becomes larger than EJ, possibly due to a saturation of electrontemperature below 100 mK. Above that point, a linearly decreasingtrend in switching current and thus in Josephson energy is observed, compatible with an exponential decrease with temperature.However, when the Josephson energy becomes approximately equal tothe Thouless energy, a deviation from this exponential decrease isobserved, with EJ \u2248 ETh, until finally at T \u2248 500 mKthe switching current drops to zero. An exponential decrease in switchingcurrent is typical of ballistic long junctions,63 but a quasi-exponential temperature dependence of the critical currentis also expected for a diffusive system in the long junction regime,as shown by Courtois and Sch\u00f6n.71 An analysis of the measured switching current withthe function Isw = I0 exp(\u2212T/T*) yieldsas best fit parameters I0 = 7.3 nA and T* = 194 mK. The fit is also indicated in etal.,71kBT* = 12E*/\u03c0,with E* = ETh(1 + 0.7Ri/RbP),68 and thus from T* we get a valueof the Thouless energy of 5.0 \u03bceV, in excellent agreement withthe value obtained from the data shown in ETh \u226a \u0394S.Isw can be well represented by the theoretical model ofa diffusive mesoscopic Josephson weak link with opaque interfaces = Ic(0)|sin(\u03c0\u03a6/\u03a60)/(\u03c0\u03a6/\u03a60)|, with Ic(0) the critical currentat zero magnetic field, \u03a6 the magnetic flux, and \u03a60 = h/2e the superconductingflux quantum.73 The corresponding Fraunhoferpatterns are included in 2, in good agreement with the effective geometrical area ofthe junction74A = W(L + 2\u03bbL) = 1.16 \u00b10.06 \u03bcm2, with \u03bbL = 39 \u00b1 5nm the London penetration depth of Nb.75 The slight difference between the two values can be explained bya magnetic field focusing due to the Meissner effect.77These data were analyzed with the well-known conventionalFraunhoferformula T = 33 mK, demonstrating a sizable supercurrent up to 5nA and unequivocal evidence of Josephson coupling. The supercurrentcan be controlled by a back gate. Application of a small perpendicularmagnetic field leads to the formation of a well-developed Fraunhoferpattern. Supercurrent signal disappears above a temperature of 500mK. All these observations are clear manifestations of proximity-inducedsuperconductivity in the bP planar junction and place bP in the spotlightas a valid 2D van der Waals material for applications in quantum technology.We anticipate that optimization of the ohmic contacts to the bP willimprove device performance and eventually allow the observation ofambipolar supercurrent in such devices. Further progress in devicefabrication, e.g., by encapsulationof the bP flakes in hexagonal boron nitride, will allow the realizationof ballistic junctions, in which the crystalline anisotropy of bPmight be employed for innovative devices and quantum sensors. Amongall, bP devices are exploited as widely tunable infrared photodetectors,80 and optimized bP-based planar Josephson junctions are thus a promisingplatform for infrared single-photon detectors.81Insummary, we have presented transport measurements on bP planarJJs with Ti/Nb contacts performed at cryogenic temperatures down to 82 For details,see the Supporting Information. There wealso show a Raman spectrum of the flake used in this work. The highreactivity of exfoliated bP represents the major challenge for therealization of high-quality devices, including JJ-like devices, wherethe quality of the interfaces represents one of the main bottlenecks.To address this issue, bP exfoliation was carried out in a glovebagunder a nitrogen atmosphere. After the transfer of the flakes ontothe Si wafer substrate, the samples were immediately coated with alayer of protective polymer (poly(methyl methacrylate), PMMA), whichis also the lithographic resist. The geometry of the device was definedby electron beam lithography (EBL) using a Zeiss Ultraplus SEM equippedwith Raith Elphy Multibeam software. After development of the resist,a combined and optimized cleaning procedure was applied to the sample.83 First, a mild oxygen plasma of 10 W for 1 minwith 40 sccm of oxygen was performed to efficiently remove all theresist residuals. Then the sample was transferred to the vacuum chamberfor the metal sputtering, and an in situ cleaningwith Ar plasma was performed at 50 mTorr with 4 W power for 30 min.The etching conditions were tuned to have a gentle etching and a bettercontrol of the process. The etching time was calibrated to minimizethe contact resistance. This last cleaning step was performed afterthe presputtering of the two metallic targets for metal deposition,during which the sample was preserved from contamination thanks toa closed shutter and a rotating carousel that allowed moving the sampleaway from the plasma source. Then 10 nm of Ti and 60 nm of Nb weredeposited. The Ti layer was found to decrease the contact resistanceand to allow for a better growth of the Nb overlayer. In fact, anaverage increase of the critical temperature of the devices with aTi layer was observed, compared to devices with an Al/Nb bilayer orwith Nb grown directly onto the bP.83 Afterthe sputtering process, the sample underwent a fast lift-off in acetoneat 55 \u00b0C. Then it was immediately coated with a bilayer of methylmethacrylate methacrylic acid copolymer and PMMA, to guarantee protectionfrom oxidation. This protection layer is more than 500 nm thick; thereforeholes for the bonding pads have been opened in a second EBL step.BP crystals were fabricated followinga well-established procedure.T = 33 mK. V\u2013I curves weremeasured in DC current biasing, using a Yokogawa DC source on a 10M\u03a9 bias resistor. The voltage drop across the junction was measuredin four-probe configuration with a DL Instruments voltage preamplifier(gain 104) and an Agilent multimeter, while the currentwas measured with a DL Instruments current preamplifier (gain 107) and another Agilent multimeter. The back gate was biasedwith a Keithley DC source. We have verified that the loss currentfrom gate to sample was below the detection limit of the source meter.The differential resistance measurements shown in The low-temperature transportdata were measured in a filtered closed-cycle dilution refrigeratorfrom Leiden Cryogenics with a base temperature of Ic of the junction canbe modeled by solvingthe associated quasi-classical Usadel equation.84 To properly reproduce the experimental data, a sizableS/N interface resistance (Ri) has beenintroduced, considering diffusive Josephson junctions with opaqueS/N interfaces. In this case, the critical current can be obtainedby68n = (2n + 1)\u03c0kBT is carried out numerically.Here, kB is the Boltzmann constant, RbP = RN \u2013 2Ri isthe resistance of the junction excluding the interfaces, r = Ri/RbP. Using L = 650 nm and T = 110 mK. The same model has been used to simulate the evolutionof the critical current as a function of the gate voltage (D. The variation of r withback gate voltage was approximated by a linear function:r(Vbg) data extracted from a series of V\u2013I curves measured in a wide biasrange at different back gate voltages. This allows calculating Rs from RN in measurementsfor which the bias range was not wide enough to determine Rs directly. Finally, this allows the calculationof the diffusion constant D from RN.The observed behavior of thecritical current"}
+{"text": "Mobile healthcare service has become increasingly popular thanks to the significant advances in the wireless body area networks (WBANs). It helps medical professionals to collect patient\u2019s healthcare data remotely and provides remote medical diagnosis. Since the health data are privacy-related, they should provide services with privacy-preserving, which should consider security and privacy at the same time. Recently, some lightweight patient healthcare authentication protocols were proposed for WBANs. However, we observed that they are vulnerable to tracing attacks because the patient uses the same identifier in each session, which could leak privacy-related information on the patient. To defeat the weakness, this paper proposes a privacy-preserving authentication protocol for WBANs in healthcare service. The proposed protocol is only based on one-way hash function and with exclusive-or operation, which are lightweight operations than asymmetric cryptosystem operations. We performed two rigorous formal security proofs based on BAN logic and ProVerif tool. Furthermore, comparison results with the relevant protocols show that the proposed protocol achieves more privacy and security features than the other protocols and has suitable efficiency in computational and communicational concerns. Advances in mobile networking for Internet of Things (IoT) are powering the fourth industrial revolution. It connects physical things with digital worlds and allows for better collaboration and access across network participants, application services and people ,2,3,4,5.However, privacy and security play key roles in protecting these data during data collection and transmission since remote healthcare service is vulnerable to various attacks ,27,28,29There have been many authentication protocols for WBANs in healthcare applications ,39,40,41Primitives based on ECC or bilinear pairing have computational overhead than any other cryptographic primitives and thereby they are heavily weighted on WBANs. To cope with the overhead, Khan et al. proposed an anonymous biometric-based authentication protocol using chaotic maps . To use The contributions of this paper are as follows:(1) A new privacy-preserving authentication protocol for WBANs in remote healthcare applications is devised. In the protocol, an entity could protect privacy and security with a session key establishment for secure communication.(2) The proposed protocol utilizes lightweight operations, which are based on the hash function and exclusive-or operation. This makes the protocol suitable for WBANs in remote healthcare applications.(3) The formal security proof in BAN logic  demonstr(4) Efficiency analysis is done based on the complexity analysis of computation and communication overheads. The results show that the proposed protocol has a little overhead than the existing protocols.The remainder of this paper is structured as follows. In the digital age, hospitals and health service providers have pursued innovations for rich healthcare services. WBAN technology allows patients to be treated always even in remote areas and enables doctors to diagnose diseases and treat patients in medical institutions. And its technology can help anyone to easily access medical information . It alsoSA: It sets up system parameters and registers participants by deploying important secret values in the memory of each party.HN: It has a very important role as the central server for the healthcare service, which collects and keeps a database of electronic health records (EHRs) for the registered PTs. In addition to this, it works also as a registration center for all network participants and issues SNs and APs for PTs. Furthermore, it works as an authentication server to check the authenticity of system entities.AP: AP works as a communication gateway from SN to HN and vice versa via wireless communication link. Thereby, it does not perform any validation of messages. It is assumed that an AP belongs to a specific PT only.SN: Some SNs are deployed on a PT, as notated as 1, 2, 3, 4 and 5 in the left part of PT: PT is a subject of the remote healthcare service. Normally, PT does not take part in the network communication directly but subscribes the service to SA or HN. Then, SA or HN issues some SNs and an AP of the PT for the service.Doctor: Doctors make the diagnosis based on PT\u2019s EHRs by accessing HN. Doctors need to regularly check the health status of PTs and provide proper medical treatments via on-line.The target remote healthcare service is based on WBAN for patients. As shown in This subsection describes the widely accepted and well-known Canetti and Krawczyk (CK) threat model, which defines the ability of an adversary and is one of the foundations for formal privacy and security analysis on cryptographic protocol ,45. In tThe healthcare system should provide privacy and security at the same time ,47. Norm[SP1] Mutual authentication: To allow only authorized PT to get the medical services provided by HN, mutual authentication between SN and HN is required.[SP2] Session key agreement: After a successful process of mutual authentication, further EHR data communications between SN and HN should be encrypted based on the session key to achieve confidentiality and integrity.[SP3] Message freshness: Each entity in the system needs to check message freshness to cope with various attacks. It could be supported either by using timestamp or random nonce.[SP4] Perfect forward secrecy: It could assure that the security of the system will not be compromised even if long-term secrets used in the protocol are compromised.[SP5] Attack resistance: Due to the open environment in the remote healthcare service, the transmitted messages among network entities may be intercepted, modified and replayed by the adversary. Therefore, the proposed authentication protocol should be able to withstand various attacks, such as replay attack, impersonation attack, man-in-the-middle attack and known session-specific temporary information attack.[PP1] Anonymity: Anonymity is an important privacy feature in the remote healthcare service. To protect the identity privacy of PT, the proposed protocol should guarantee that no one can get the PT\u2019s identity from the intercepted messages on the public channels.[PP2] Unlinkability: Unlinkability is another important privacy feature in the remote healthcare service, which guarantees that the adversary cannot distinguish whether these different session\u2019s messages are related or not. The cryptographic protocol should not only guarantee the PT\u2019s anonymity but also provide unlinkability between sessions.t is agreed on mutually. The proposed protocol consists of four phases, i.e., initialization phase, registration phase, authentication phase and identity modification phase. First of all, the initialization phase sets up a security building block for the overall network. PT possessed with SN and AP is a target for the registration phase to either SA or HN. The authentication phase is for the basic security service to check whether the entity is legal or not and is also to set up a session key for further secure communications. The identity modification phase is used when PT wants to change SN\u2019s identity for privacy reasons. In this section, a privacy-preserving authentication protocol for WBANs in healthcare service is proposed. The proposed protocol uses only the hash function with exclusive-or operations to provide the design goals. We assume that all the participants are synchronized on time using any proper scheme and a maximum transmission delay \u2206HNKS for HN.Step 1. SA selects a long-term master key HNKS in the memory of HN.Step 2. SA stores For the system initialization, SA performs the following steps.When a PT wants to subscribe to a remote healthcare service, HN performs the following steps after issuing SN and AP for PT as shown in Step 1.SNID and APID for SN and AP, respectively, and sends them to HN. After receiving the information, HN generates four random numbers SNa, S1SN, S2SN and iHC for SN, forms a set <SNID, S1SN, S2SN, iHC> and stores it in the memory.PT chooses two identities Step 2.SNX = SNa \u2295 HNKS, SNY = SNID \u2295 h(HNKS||SNa) and APPID = APID \u2295 h(SNa||HNKS), composes a set <SNID, SNX, SNY, S1SN, S2SN, iHC> and stores it in the memory of SN. They are used for authenticity check of PT.After that, HN calculates Step 3.APPID in the memory of AP.HN stores When a PT wants to use the subscribed remote healthcare service, PT with SN and AP needs to use this phase to log-in HN as shown in Step 1.T1SN, calculates a message authentication code SRID = (SNID||SNX||SNY||S2SN||iHC||T1SN) and composes a message {SNX, SNY, SRID, T1SN} to submit to AP.SN gets the current timestamp Step 2.PIDAP to the message {SNX, SNY, SRID, T1SN, PIDAP} and sends the message to HN.When AP receives the message, it adds a session dependent pseudo identity Step 3.T1HN and verifies the freshness of the message by validating T1HN \u2212 T1SN \u2264 \u2206t where \u2206t is the allowed transmission delay of the network. If it does not hold, HN treats this message as a replay attack and aborts the session. Otherwise, HN calculates SNa\u2032 = SNX \u2295 HNKS and APID\u2032 = PIDAP \u2295 h(aSN\u2032||HNKS). After that, HN calculates SNID\u2032 = SNY \u2295 h(HNKS||aSN\u2032) and compares it with SNID stored in its memory. Only if the verification is successful, HN calculates SRID\u2032 = h(SNID\u2032||SNX||SNY||S2SN||iHC||T1SN) using the parameters in its repository. Finally, HN checks whether SRID\u2032 is equal to SRID or not.When HN receives the message, it gets the current timestamp Step 4.T2HN, generates two random numbers q and SNna, and calculates SNX\u2032 = SNna \u2295 HNKS, SNY\u2032 = SNID\u2032 \u2295 h(HNKS||SNna), NPIDAP = APID\u2032 \u2295 h(SNna||HNKS), j = SNID\u2032 \u2295 SNY \u2295 SNX, r = q \u2295 j, g = h(q||j||S2SN), APZ = h(APPID||APNPID||APID\u2032), SNNX = SNX\u2032 \u2295 g, SNNY = SNY\u2032 \u2295 g, SNC = h(q||SNID\u2032||j||SNX\u2032||SNY\u2032||T2HN) and SK = h(q||S1SN||S2SN||iHC). After that, HN overwrites S1SN into S2SN and changes S2SN with SK in its memory, which are used for the next authentication for privacy provision. And then, HN calculates iHC\u2032 = h(iHC) and replaces it to iHC as iHC = iHC\u2032, which is for updating the session key parameter. After that, HN composes a message {r, SNNX, SNNY, SNC, T2HN, NPIDAP, APZ} and sends it to AP.Only after all verifications are successful, HN could believe the authenticity of SN and AP and forms a reply message with two options, one is to be authenticated to SN and AP and another is to update the authentication parameters for the next authentication for SN and AP, respectively. For this, HN gets the current timestamp Step 5.APZ\u2032 = h(APPID||APNPID||APID) and verifying whether APZ\u2032 is the same as APZ in the message or not. Only if the verification is successful, AP overwrites APNPID into APPID in its memory. After that, AP drops APNPID and APZ from the message and sends the reformed message {r, SNNX, SNNY, SNC, T2HN} to SN.After receiving the message, AP checks the freshness of message by calculating Step 6.T2SN and verifies the freshness of the message by validating T2SN \u2212 T2HN \u2264 \u2206t. If it is not successful, SN aborts the session, which is treated as a replay attack. Otherwise, it calculates j\u2032 = SNID \u2295 SNY \u2295 SNX, q\u2032 = r \u2295 j\u2032, g\u2032 = h(q||j\u2032||S2SN), SNX\u2033 = SNNX \u2295 g\u2032, SNY\u2033 = SNNY \u2295 g\u2032 and SNC\u2032 = h(q\u2032||SNID||j\u2032||SNX\u2033||SNY\u2033||T2HN) and validates SNC\u2032 by comparing it with SNC in the message. It aborts the session if the validation fails. Otherwise, SN implicitly accept the authenticity of HN and calculates a session key SK\u2032 = h(q\u2032||S1SN||S2SN|| iHC) and overwrite S1SN into S2SN and changes S2SN with SK. SN replaces the two parameters, SNX\u2033 and SNY\u2033 into SNX and SNY, respectively, which are the next authentication parameters. Finally, SN calculates iHC\u2032 = h(iHC) and replaces it to iHC as iHC = iHC\u2032, which is for updating the session key parameter.When SN receives the message, it gets the current timestamp Step 1.T1SN, selects a new identity SNNEWID, calculates SNNID = SNNEWID \u2295 S2SN and SRID = h(SNID||SNX||SNY||S2SN||SNNID||iHC||T1SN), composes a message {SNX, SNY, SRID, T1SN, SNNID} and submits it to AP.SN sets the current timestamp Step 2.PIDAP to the message {SNX, SNY, SRID, T1SN, SNNID, PIDAP} and sends the message to HN.When AP receives the message, it adds Step 3.T1HN. And HN validates the freshness of the message by verifying T1HN \u2212 T1SN \u2264 \u2206t. If SNT is not fresh, HN aborts the session. Otherwise, HN calculates authentication parameters SNa\u2032 = SNX \u2295 HNKS and APID\u2032 = PIDAP \u2295 h(SNa\u2032||HNKS). After that, HN calculates SNID\u2032 = SNY \u2295 h(HNKS||SNa\u2032) and compares it with SNID stored in its memory. Only if the verification is successful, HN calculates SRID\u2032 = h(SNID\u2032||SNX||SNY||S2SN||SNNID|| iHC||T1SN) using the parameters in its repository. Finally, HN checks whether SRID\u2032 is equal to SRID.When HN receives the message, it sets the current timestamp Step 4.SNNEWID\u2032 = SNNID \u2295 S2SN. After that, HN generates current timestamp T2HN and random numbers q and calculates the new identity related authentication parameters SNY\u2032 = SNNEWID\u2032 \u2295 h(HN||aSNKS\u2032), j = SNID \u2295 SNY \u2295 SNX, r = q \u2295 j, g = h(q||j||S2SN), SNNY = SNY\u2032 \u2295 g and SNC = h(q||SNID||j||SNY\u2032||T2HN). Then HN overwrites SN\u00a0NEWID\u2032 into SNID in its memory. Next HN composes a message {r, SNNY, SNC, T2HN} and sends it to AP.Only after all verifications are successful, HN withdraws the new identity from SN by computing Step 5.r, SNNY, SNC, T2HN} to SN.After receiving the message, AP sends the message {Step 6.T2SN. And SN validates the freshness of the message by verifying T2SN \u2212 T2HN \u2264 \u2206t. If T2HN is not fresh, SN aborts the session. Otherwise, SN calculates j\u2032 = SNID \u2295 SNY \u2295 SNX, q\u2032 = r \u2295 j\u2032, g\u2032 = h(q||j\u2032||S2SN), SNY\u2033 = SNNY \u2295 g\u2032 and SNC\u2032 = h(q\u2032||SNID||j\u2032||SNY\u2033||T2HN), which are withdrawing the new identity related authentication parameters. After that, SN validates SNC\u2032 by comparing it with SNC in the message. It aborts the session if the validation fails. Otherwise, SN replaces SNY with SNY\u2033 in its memory.When SN receives the message, it sets the current timestamp Whenever a PT wants to change his (or her) identity, this phase should be performed. To change identity of PT, SN sends the identity modification request to HN. Then HN provides identity modification parameter only after the successful authentication. The phase is performed as follows:This section provides security analysis of the proposed protocol by using BAN logic and ProVerif tool based on the CK threat model ,42. ThenQ|\u2261 X: Principal Q believes the statement X.X): Formula X is fresh.#: Formula X or Y is one part of the formula .Goal 2: SN|\u2261(SN)Goal 3: HN|\u2261SN|\u2261(SN)Goal 4: SN|\u2261HN|\u2261(HN)Idealized form: The arrangement of the transmitted messages between SN, AP and HN in the proposed protocol to the idealized forms is as follows:SNX>KSHN, <SNY>KSHN, <RIDs>KSHN, T1SNMessage 1. SN SNX>KSHN, <SNY>KSHN, <RIDs>KSHN, T1SN, <APPID>KSHNMessage 2. AP r>KSHN, <SNNX>KSHN, <SNNY>KSHN, <SNC>KSHN, <APNPID>KSHN, <APZ>KSHN, T2HNMessage 3. HN r>KSHN, <SNNX>KSHN, <SNNY>KSHN, <SNC>KSHN, T2HNMessage 4. AP Assumptions: The following are the initial assumptions of the proposed protocol:T1SN)A1: HN|\u2261#(T2SN)A2: HN|\u2261#(T1HN)A3: SN|\u2261#(T2HN)A4: SN|\u2261#\u2003Step 1. APAPPID>KSHN to the message and sends it to HN. Based on Message 2, we could derive:Based on Step 1, AP adds <SNX>KSHN, <SNY>KSHN, <RIDs>KSHN, T1SN, <APPID>KSHN)\u2003Step 2. HNAccording to assumption A6 and the message-meaning rule, we get:SNX>KSHN, <SNY>KSHN, <RIDs>KSHN, T1SN, <APPID>KSHN)\u2003Step 3. HN|\u2261AP|According to assumptions A1 and A2 and the freshness concatenation rule, we get:SNX>KSHN, <SNY>KSHN, <RIDs>KSHN, T1SN, <APPID>KSHN)\u2003Step 4. HN|\u2261#\u2003Step 5. HN|\u2261SN|\u2261\u2003Step 8. HN|\u2261SN|\u2261\u2003Step 9. HN|\u2261\u2003Step 10. APAccording to the message meaning rule, we get:r>KSHN, <SNNX>KSHN, <SNNY>KSHN, <SNC>KSHN, <APNPID>KSHN, <APZ>KSHN, T2HN)\u2003Step 11. AP|\u2261HN|APNPID>KSHN and <APZ>KSHN to the message and sends it to HN.Based on Step 10, AP drops <Based on Message 4, we derive:r>KSHN, <SNNX>KSHN, <SNNY>KSHN, <SNC>KSHN, T2HN)\u2003Step 12. SNAccording to assumption A5 and the message-meaning rule, we get:r>KSHN, <SNNX>KSHN, <SNNY>KSHN, <SNC>KSHN, T2HN)\u2003Step 13. SN|\u2261AP|According to assumptions A3 and A4 and the freshness concatenation rule, we get:r>KSHN, <SNNX>KSHN, <SNNY>KSHN, <SNC>KSHN, T2HN)\u2003Step 14. SN|\u2261#\u2003Step 15. SN|\u2261HN|\u2261\u2003Step 18. SN|\u2261HN|\u2261\u2003Step 19. SN|\u2261(SNSK = SK\u2032 = h(q\u2032||S1SN||S2SN).According to Steps 9 and 19, the proposed authentication protocol successfully achieves the four goals. Both SN and HN could believe that they share the common session key ProVerif is an automated tool for verifying security in cryptographic protocol . It is sWe have configured the ProVerif code as follows:\u2003\u2003(*--The two public channel--*)free ch1: channel.free ch2: channel.\u2003\u2003(*--The basic type--*)type entity.type nonce.type key.\u2003\u2003(*--Hash operation--*)fun Hash(bitstring): bitstring.\u2003\u2003(*--XOR operation--*)fun XOR: bitstring.equation forall x: bitstring, y: bitstring;XOR, y) = x.\u2003\u2003(*--Concat operation--*)fun Con: bitstring.fun Enc: bitstring.reduc forall x: bitstring, y: key;Dec,y) = x.\u2003\u2003(*--Type convertion--*)fun nontobit(nonce): bitstring .fun bittokey(bitstring): key .\u2003\u2003(*--The basic variables--*)free SN, AP, HN: entity. (*---three entities in the proposed protocol--*)free T1SN: bitstring.free T2HN: bitstring.free S1SN: bitstring.free S2SN: bitstring.free HCi: bitstring.free KSHN: bitstring[private]. (*---public key--*)\u2003\u2003(*--Authentication queries--*)event SHbegin(entity).event SHend(entity).event HSbegin(entity).event HSend(entity).query t: entity; inj-event(SHend(t)) ==> inj-event(SHbegin(t)).query t: entity; inj-event(HSend(t)) ==> inj-event(HSbegin(t)).\u2003\u2003(*--Queries--*)free svalueA, svalueB: bitstring [private].query attacker;attacker.\u2003\u2003(*--SN--*)let processSN =let (RIDs: bitstring) = Hash))))) inevent HSbegin(HN);\u2003\u2003(*-- SN > AP --*)out);\u2003\u2003(*-- AP > SN --*)in);let (xj: bitstring) = XOR) inlet (xq: bitstring) = XOR inlet (xg: bitstring) = Hash)) inlet (xXSN: bitstring) = XOR inlet (xYSN: bitstring) = XOR inlet (xCSN: bitstring) = Hash))))) inif xCSN = CSN thenlet (xKs: bitstring) = Hash))) inevent SHend(SN);out)).\u2003\u2003(*--AP--*)let processAP =in);\u2003\u2003(*-- AP > HN --*)out);\u2003\u2003(*-- HN > AP --*)in);let (xZAP: bitstring) = Hash)) inif xZAP = ZAP then\u2003\u2003(*-- AP > SN --*)out).\u2003\u2003(*--HN--*)let processHN =in);let (a: bitstring) = XOR inlet (xIDAP: bitstring) = XOR)) inlet (xIDSN: bitstring) = XOR)) inif xIDSN = IDSN thenlet (xRIDs: bitstring) = Hash))))) inif xRIDs = RIDs thenevent SHbegin(SN);new q: nonce;new nasn: nonce;let (xXSN: bitstring) = XOR(nontobit(nasn),KSHN) inlet (xYSN: bitstring) = XOR))) inlet (NPIDAP: bitstring) = XOR,KSHN))) inlet (j: bitstring) = XOR) inlet (r: bitstring) = XOR(nontobit(q),j) inlet (g: bitstring) = Hash(Con(nontobit(q),Con)) inlet (ZAP: bitstring) = Hash)) inlet (NXSN: bitstring) = XOR inlet (NYSN: bitstring) = XOR inlet (CSN: bitstring) = Hash(Con(nontobit(q), Con))))) inlet (Ks: bitstring) = Hash(Con(nontobit(q),Con))) in\u2003\u2003(*-- HN > AP --*)out);event HSend(HN);out)).\u2003\u2003(*--Start process--*)process) |) |))As mentioned in , past reSNX, SNY, SRID, T1SN, APPID}, which is a message from SN to HN via AP. Only the legal SN could be authenticated by HN in the proposed protocol because a CK adversary needs to compute SRID = h(SNID||SNX||SNY||S2SN||T1SN), which needs knowledge on SNID and S2SN at the same time even if the adversary could get and use the previous session\u2019s SNX and SNY. However, there is no way that the adversary could get them in the proposed protocol. HN needs to be authenticated by SN based on {r, SNNX, SNNY, SNC, T2HN}, which is a message from HN to SN via AP. Adversaries need to form a message, which could be validated by SN, especially SNC validation that is related with knowledge of q, SNID, j, SNX\u2032, SNY\u2032 and T2HN. However, the knowledge is related with HNKS, which is the master key of HN. It means that the proposed protocol provides mutual authentication between SN and HN and there is no way that the adversary could succeed in the authentication process.[SP1] Mutual authentication: Authentication is performed between SN and HN mutually in the proposed protocol. Authentication is related to the messages from SN to HN and vice versa. SN needs to be authenticated by HN based on {Ks = h(q||S1SN||S2SN) after the successful authentication. There is no way that a CK adversary could get any information on Ks from the session messages {SNX, SNY, SRID, T1SN}, {SNX, SNY, SRID, T1SN, PIDAP}, {r, SNNX, SNNY, SNC, T2HN, NPIDAP, APZ} and {r, SNNX, SNNY, SNC, T2HN}. The parameters of Ks are not exposed to any parameter in the messages. Especially, q is related to r = q \u2295 j but the adversary needs to know j to extract out the wanted value from r. However, the adversary could not get q from r due to the format of j = SNID \u2295 SNY \u2295 SNX, which is related with the knowledge of HNKS. Thereby, the proposed protocol provides a secure session key agreement only between SN and HN.[SP2] Session key agreement: Session key is required to establish a secure channel between SN and HN to provide confidentiality on data. SN and HN agree on a session key SNX, SNY, SRID, T1SN}, {SNX, SNY, SRID, T1SN, PIDAP}, {r, SNNX, SNNY, SNC, T2HN, NPIDAP, APZ} and {r, SNNX, SNNY, SNC, T2HN}, there are two integrity values SRID = h(SNID||SNX||SNY||S2SN||T1SN) and SNC = h(q||SNID||j||SNX\u2032||SNY\u2032||T2HN) that the adversary needs to compute. If the adversary gets a proper current timestamp T1SN\u2032, the adversary should compute two new values of SRID = h(SNID||SNX||SNY||S2SN||T1SN\u2032) and SNC = h(q||SNID||j||SNX\u2032||SNY\u2032||T1SN\u2032). However, the two computations are impossible because the adversary needs to know the other parameters except T1SN\u2032 to compute SRID and SNC. Furthermore, each entity checks the freshness of the message using \u2206t each time they receive any message. So, the proposed protocol provides message freshness.[SP3] Message freshness: There are two ways to provide message freshness in cryptographic protocol, which are based on challenge-response mechanism and timestamp mechanism. The proposed protocol uses a timestamp mechanism to cope with replay attacks because the network entity could be synchronized with a time when SA issues SN and AP for a PT during the registration phase. If a CK adversary wants to succeed in any attack against message freshness, the adversary needs to know and change timestamp-related values. From the session messages {HNK, the adversary still cannot get the session key SK. The reason is that after each successful session, the values iHC, S1SN and S2SN will be updated by one-way hash function. Because of the one-wayness of the hash function, there is no way to get these values to compute the session key to the adversary. Therefore, the proposed protocol can provide perfect forward secrecy.[SP4] Perfect forward secrecy: It is a very strong form of long-term security which guarantees that future disclosures of some long-term secret keys do not compromise past session keys . It is wT1SN and T2HN, respectively. Thereby, the proposed protocol is strong against replay attack. Impersonation attack is the second one we need to consider, which has a relationship with mutual authentication. As we mentioned in the mutual authentication, the adversary needs to form the first message {SNX, SNY, SRID, T1SN} to disguise as SN and the third message {r, SNNX, SNNY, SNC, T2HN, NPIDAP, APZ} to masquerade as HN, respectively. However, they are related to the knowledge of HNKS. So, the proposed protocol could cope with impersonation attacks. Man-in-the-middle attack is similar to an active eavesdropping in which the adversary makes independent connections with the network entities and relays messages between them to make them believe they are communicating directly to each other but in fact, the entire communication is controlled by the adversary. It is quite related to mutual authentication and confidentiality of parameters in the messages. Since we mentioned the mutual authentication provision from the proposed protocol, we will only consider confidentiality of the messages. There are only possibilities on knowing secret key-related information to legally registered SNs and HN but not any others. In the CK model, it is required that the generated session key from the protocol should not be compromised even in the case of ephemeral secrets leakage. In the proposed protocol, the ephemeral secrets are SNa and q. Having access to these two, the adversary also needs to know both S1SN and S2SN to compute the session key SK. Since only SN and HN know the values, the proposed protocol can withstand this attack. That is why any adversary could not get any useful information even if the adversary could tap into the communication link among SN, AP and HN. Thereby, the proposed protocol provides attack resilience. Finally, known session-specific temporary information attack should be considered in the protocol, which has an assumption that an adversary could get the ephemeral random number q to get the session key SK since the attacker has no way to compute the long-term key HNKS and one-time hash chain value iHC. Moreover, the messages transmitted in the public channel are unhelpful to compute the session key SK. Therefore, the proposed protocol has the ability to prevent the session-specific temporary information attack.[SP5] Attack resistance: We could argue that any attack is successful if a CK adversary finds any mechanism to do various attacks, such as replay attack, impersonation attack and man-in-the-middle attack. Most of all, replay attack is tightly related with the message freshness. It means that any protocol with challenge-response or timestamp mechanism could cope with the attack. Messages in the proposed protocol are together with timestamp as the form of SNY, SRID, SNNY and SNC, for SNID and APPID, APNPID and APZ for SNID, respectively, in the messages, which has a relationship with the identity factor. Adversaries do not have any method to identify any entity from the parameters in the proposed protocol. To do so, the adversary needs to have knowledge of HNKS, which is not feasible. As a result, the proposed protocol provides anonymity.[PP1] Anonymity: Anonymity is defined as \u201cthe state of being not identifiable within a system.\u201d Anonymity from a CK adversary\u2019s perspective means that the adversary cannot identify any entity within a system. In security protocol, it is necessary to check identity-related information in messages transmitted among system entities to consider anonymity. There are SNa, S1SN, S2SN, q and SNna and timestamps of T1SN and T2HN in the proposed protocol. It means that the proposed protocol uses session-dependent parameters to form messages to cope with unlinkability. So, the proposed protocol provides unlinkability.[PP2] Unlinkability: It has a meaning after a system with anonymity has been defined and the entities interested in linking by a CK adversary have been characterized. Unlinkability of two or more sessions of interest from the adversary\u2019s perspective means that within the system, the adversary cannot distinguish whether they are related or not. As we discussed on anonymity, session linkability is related to the identifier and the message freshness of session message parameters. Each parameter in the session messages has a relationship with the session-dependent random numbers of SK in Khatoon et al.\u2019s protocol based on the session-specific temporary information, iT, iR, sT and sR, which are parameters to compute SK and are exposed on the public communication channel. As stated above, the attacker can compute sL. Ostad-Sharif et al.\u2019s protocol is weak against the denial-of-service attack, the password guessing attack and the stolen verifier attack [As shown in r attack . So, Ostr attack . Xu et ar attack . Alzahrar attack .In this section, we provide performance analysis focused on computation and communication overheads by providing comparisons with the related protocols in ,38,40,41hT, a symmetric key encryption and decryption as symT, an elliptic curve cryptosystem as eccT and a bilinear pairing operation as bpT, respectively, but do not consider the overhead of the exclusive-or operations, which require a comparatively quite low overhead than any other operations. There are four phases in the proposed protocol, which are initialization phase, registration phase, authentication phase and identity modification phase. We will concentrate on the computation requirements of the authentication phase only from the proposed protocol because the phase is the most frequently used one. To facilitate computation analysis, we define the computational requirements of a one-way hash function as hT, symT, eccT and bpT, which are approximately 0.08 ms, 0.14 ms, 4.31 ms and 14.48 ms, respectively. The proposed protocol requires 14 hash operations, which is a bit more expensive than the protocols in [From the experiment, we acquired the required time for ocols in ,40,41 buocols in ,35. HoweFrom For the communication analysis, we assumed that the lengths of identity and random numbers are 128 bits each. However, we considered that the lengths for timestamp, hash function, symmetric key cryptosystem, elliptic curve cryptosystem and bilinear pairing are 32 bits, 160 bits, 128 bits, 256 bits and 256 bits, respectively. Protocols of Khatoon et al., Ostad-Sharif et al. and Khan et al. require 2 messages with 1472 bits, 2528 bits and 1760 bits, respectively. However, protocols of Xu et al., Alzahrani et al. and the proposed one need 4 messages of 3136 bits, 3136 bits and 3872 bits, respectively. The first three protocols in This section discusses challenges and solutions on the authentication protocol for WBAN based healthcare applications. After that, we will provide some future work.Healthcare systems can provide an opportunity to meet the needs of individuals or households facing health difficulties. However, the healthcare system has an obligation to protect the privacy of patients . And allThe first challenge is to provide security in healthcare services that use the public network. Authentication protocol based on the public network is vulnerable against various attacks such as replay attack, impersonation attack and man-in-the-middle attack. The security issues could be overcome by utilizing various cryptographic primitives including asymmetric key cryptography, symmetric key cryptography, hash function and so on. Recently, researchers have been developing lightweight protocols, such as hash-based protocol and symmetric key cryptography-based protocol, to achieve feasibility on WBANs. Furthermore, designing authentication protocols with PUFs could help to resolve the security issues.The second challenge is to preserve the privacy of network entities. Patient personal information is one of the most sensitive data in message transmission over the public network. The privacy issues could be dealt with by utilizing session-dependent information such as a one-time pseudonym for only the session usage. Recently, researchers have been deploying unidirectional hash chain values. A hash value from the chain is used only once and authentication protocol based on the value could provide unlinkability between sessions. In addition, cryptographic researchers should collaborate with healthcare professionals and medical industry workers to adopt and recognize various target field requirements from different backgrounds and aspects.In short, the proposed authentication protocol tries to generalize the process of mutual authentication and session key agreement for WBANs in healthcare applications. The proposed protocol takes full lightweight advantage of one-way hash function and exclusive-or operation to establish better security and privacy in solving authentication and session key establishment issues. In our future work, we aim to implement the proposed protocol in a real hospital environment with a big EHR database. We will focus on conducting experiments by optimizing patient side operational and communicational overhead of the proposed protocol to achieve better WBAN feasibility in terms of improved security and privacy. In addition, we will deploy a real-time adaptive artificial intelligence model on categorizing and analyzing EHR data to provide much richer patient healthcare services. Artificial intelligence can bring numerous benefits to the evolving of the healthcare industry. Based on artificial intelligence software, certain symptoms can be detected before the obvious symptoms of diseases such as lung cancer appear . In addiIn this paper, we proposed a privacy-preserving authentication protocol for WBANs in healthcare applications. First of all, we set our design goals focused on 5 security properties and 2 privacy requirements, which are mutual authentication, session key agreement, message freshness, perfect forward secrecy, attack resistance, anonymity and unlinkability. To satisfy those features, we designed a new authentication protocol based on only two simple and lightweight operations, hash and exclusive-or. Especially, to provide 2 privacy requirements, the proposed protocol uses session-dependent pseudo identifiers for SN and AP. The formal and informal privacy and security analyses demonstrate the resistance of the proposed protocol against all sorts of privacy and security attacks. Especially, the privacy and security features of the proposed protocol are formally verified and validated based on BAN logic and ProVerif simulation tool. Performance analysis showed that the proposed protocol has a reasonable overhead compared to the related previous protocols but still lightweight. We need to note that privacy-preserving is an important feature in healthcare service because healthcare information is sensitive. Nobody wants to expose their EHR-related information to others."}
+{"text": "Blastococcus, Symbiobacterium, Goffeauzyma, Entoloma, Staphylotrichum, Gymnomyces, Hirsutella, Penicillium and Suillus spp. were negatively correlated with DI, while the relative abundance of Pandoraea, Rhizomicrobium, Hebeloma, Elaphomyces, Pseudeurotium, Fusarium, Geomyces, Polyscytalum, Remersonia, Rhizopus, Acremonium, Paraphaeosphaeria, Mortierella, and Metarhizium spp. were positively correlated with DI (P < 0.05). The Mantel test showed that soil chemical properties, including available nitrogen, phosphorus, potassium, calcium, magnesium, organic matter, and pH, were significantly correlated to microbial composition. The contents of available potassium and nitrogen were positively correlated with DI, while pH and organic matter were negatively correlated with DI. In summary, we can deduce that the second year is the key period for the shift of the American ginseng rhizosphere microbial community. Disease aggravation after the third year is related to the deterioration of the rhizosphere microecosystem.The root rot disease causes a great economic loss, and the disease severity usually increases as ginseng ages. However, it is still unclear whether the disease severity is related to changes in microorganisms during the entire growing stage of American ginseng. The present study examined the microbial community in the rhizosphere and the chemical properties of the soil in 1\u20134-year-old ginseng plants grown in different seasons at two different sites. Additionally, the study investigated ginseng plants' root rot disease index (DI). The results showed that the DI of ginseng increased 2.2 times in one sampling site and 4.7 times in another during the 4 years. With respect to the microbial community, the bacterial diversity increased with the seasons in the first, third, and fourth years but remained steady in the second year. The seasonal changing of relative abundances of bacteria and fungi showed the same trend in the first, third, and fourth years but not in the second year. Linear models revealed that the relative abundances of  Plant-associated microorganisms play important roles in plant growth, nutrition, and resistance to biotic and abiotic stresses  is a perennial plant that is well-known globally for its eutherapeutic effect on some diseases  were applied per hectare. In the following years, increasing amounts of compound fertilizer were applied per hectare: 150\u2013200 kg in the second year, 300\u2013400 kg in the third year, and 450\u2013600 kg in the fourth year. The compound fertilizer used had a nitrogen, phosphorus, and potassium content >16%. This region has a northern temperate marine monsoon climate and receives an annual precipitation of ~762 mm. The plow layer in the plantation consists of gray-brown soil. In 2017, it was decided to directly sow American ginseng for 1 to 4 years in adjacent charmilles of Xishuipo Village, Dashuipo Town . For each ginseng age, four sampling points (replicates) of about 10 mDuring the spring (late May), summer (late July), and autumn (late September), at each sampling location, half-row ginsengs  were collected, and the rhizosphere soil of these ginsengs was thoroughly mixed. Some amounts of soil was stored at \u221280\u00b0C for DNA extraction, while the rest was air-dried for chemical analysis. The ginseng from each site collected in the summer and autumn was cleaned to calculate the disease index (DI). In the summer (July 20th) and autumn (September 20th) of 2018, the experiment was repeated in Liujiatuan Village of Zetou Town , another town of Wendeng District. In total, 80 = 4 replications \u00d7 4 ages \u00d7 [3 seasons  + 2 seasons ] soil samples were obtained .The root rot disease index (DI) was estimated by dividing the number of diseased ginseng roots by the total number of plants investigated. The severity of root disease observed in the pot experiment was determined by the presence of surface lesions, which were quantified on a scale from 0 to 4, with 0 representing no lesions and 1, 2, 3, and 4 standing for lesions that are <10%, 10%\u221233%, 33%\u221267%, and larger than 67% of the total area of the root. The severity of the disease at one sampling site was recorded as the DI, which was calculated as follows:Si is the severity rating, Xi is the number of roots with the corresponding severity rating, and N is the total number of roots in one sampling site , available phosphorus (AP), available potassium (AK), organic matter (OM), pH, exchangeable calcium, and magnesium (E-Ca and E-Mg), were measured with the alkali hydrolysis diffusion method, the NaHCOd by Bao .PRJNA890432 for bacteria and PRJNA890915 for fungi.Soil microbial DNA was extracted from 0.4 g soil with the PowerSoil DNA Isolation Kit  according to the manufacturer's instructions. The bacterial universal V3-V4 region of the 16S rRNA gene was amplified with amplicon PCR forward primer 338F (5\u2032-ACTCCTACGGGAGGCAGCAG-3\u2032) and reverse primer 806R (5\u2032-GGACTACCAGGGTATCTAAT-3\u2032) . The alpha (\u03b1) diversity indexes Chao1 and Shannon were calculated to assess the microbial abundance and diversity, and the differences among different groups were tested by Duncan's multiple range test. Microbial beta-diversity was quantified with two axes of a non-metric multidimensional scaling (NMDS) analysis of Bray\u2013Curtis dissimilarities in the OTUs community matrix using the \u201cvegan\u201d package in R. The alluvial figures over time for bacterial phylum and fungal class were based on the \u201cggalluvial\u201c package in R, and Proteobacteria was divided into Alpha-, Beta-, Delta-, and Gamma-Proteobacteria classes due to the high relative abundance of Protecobacteria. To obtain the biomarkers of microbial taxa across American ginseng residence time in the field, we used the Random Forests approach provided by Zhang J. et al. , and significant differences among groups were determined at the . et al.  to regre. et al. . Bray\u2013Cu. et al. . The ord. et al. .P < 0.05) than those of 1- and 2-year ginsengs in the corresponding seasons, while in Site II, 4-year ginsengs exhibited a significantly higher DI than 1-, 2-, and 3-year ginsengs. Specifically, the disease indices ranged between 7.3 and 42.0 in Site I and between 11.3 and 36.7 in Site II.During the four years of the growing phase of American ginseng, the roots gradually became larger , and theAcross all the samples, we obtained a total of 3,817,186 and 4,471,469 high-quality 16S and ITS sequences, which were respectively grouped into 9,704 and 4,415 OTUs when using the 97% sequence similarity cutoff. The most abundant bacterial phylum were Proteobacteria (50.8%), Acidobacteria (15.5%), Actinobacteria (11.4%), and Chloroflexi (6.3%), while fungal sequences were primarily composed of the phylum Ascomycota (62.1%), Mortierellomycota (16.7%), and Basidiomycota (11.3%). According to the rarefaction and species accumulation curves, it can be inferred that the sequencing depth and sample amount are enough for subsequent analysis .For bacteria at the two sites, the Shannon indices increased with season changes in the first year, peaked in the autumn, and then maintained a high level in the second year. In the third and fourth years, the indices exhibited a similar trend to the first year , B. BesiThe NMDS revealed that the soil microbial community of American ginseng rhizosphere soil exhibited a gradient change among seasons during 4 years of growth , with siThe relative abundances of bacterial phyla exhibited a distinct cyclic variation with seasons during the 4 years except for the second year . From spSulfuriferula, Pseudarthrobacter, Oryzihumus, Blastococcus, Nakamurella, Variibacter, and Symbiobacterium decreased over residence time, while that of Pandoraea and Burkholderia-Paraburkholderia increased. Based on how these bacteria are classified at the phylum level, the number of biomarkers that belong to Actinobacteria and Firmicutes has decreased over time, while the number of biomarkers that belong to Proteobacteria has both increased and decreased , and the proportion of Fusarium increased while that of Trichoderma decreased with ginseng age. In addition, Rhizopus, Plectosphaerella, Mortierella, Alternaria, Zalerion, Rosellinia, Rhizoctonia, Pythium, Penicillium, Paraphaeosphaeria, Mucor, and Chaetomium were also identified, and a few isolated fungi were not identified  and entified .Pandoraea, Rhizomicrobium, and bacterial Chao1 were positively correlated with DI, while those of Blastococcus and Symbiobacterium were negatively correlated with DI  and fungal   . To dise< 0.001) . The ordPanax notoginseng, which also belongs to Panax. The isolated Fusarium increased as the American ginseng aged, whereas Trichoderma decreased. Fusarium is a genus that contains root rot disease causal pathogens  can be found in the article/W-WG and Y-MB conceived and designed the research. Y-MB, X-MZ, X-LJ, YW, and J-FL performed the experiments. Y-MB and G-LT analyzed the data. Y-MB, W-WG, and NP wrote the manuscript. All authors read and approved the paper."}
+{"text": "Babesia. The infection may lead to anemia in infected dogs. However, anemia is not directly caused by the pathogen. The parasite\u2019s developmental stages only have a marginal role in contributing to a decreased red blood cell (RBC) count. The main cause of anemia in affected dogs is the immune response to the infection. This response includes antibody production, erythrophagocytosis, oxidative damage of RBCs, complement activation, and antibody-dependent cellular cytotoxicity. Moreover, both infected and uninfected erythrocytes are retained in the spleen and sequestered in micro-vessels. All these actions are driven by pro-inflammatory cytokines and chemokines, especially IFN-\u03b3, TNF-\u03b1, IL-6, and IL-8. Additionally, imbalance between the actions of pro- and anti-inflammatory cytokines plays a role in patho-mechanisms leading to anemia in canine babesiosis. This article is a review of the studies on the pathogenesis of anemia in canine babesiosis and related diseases, such as bovine or murine babesiosis and human or murine malaria, and the role of pro-inflammatory cytokines and chemokines in the mechanisms leading to anemia in infected dogs.Canine babesiosis is a tick-borne protozoan disease caused by intraerythrocytic parasites of the genus  Babesia. Babesia belong to the order Piroplasmida, phylum Apicomplexa [Babesia species infecting dogs: B. canis, B. vogeli, B. rossi, B. vulpes, B. gibsoni, B. conradae, and unnamed Babesia sp. \u201cCoco\u201d [Babesia coco as a formal species name [B. canis, B. vogeli, B. rossi, and B. coco are classified as \u2018large\u2019 Babesia, while B. gibsoni, B. vulpes, and B. conradae are \u2018small\u2019 Babesia species [Plasmodium and Babesia infections. These two mechanisms lead to similar pathologies in human malaria and in babesiosis in various mammalian species, including canine babesiosis [Canine babesiosis is a tick-transmitted disease caused by infection with intraerythrocytic protozoan parasites of the genus complexa . There a. \u201cCoco\u201d ,2,3,4,5.ies name . Among t species . Severitbesiosis ,9,10. Dubesiosis .Both parasitoses may cause anemia. This pathology is the second-most prevalent hematological disorder in these diseases, after thrombocytopenia. Leukopenia is another disorder observed during these infections. However, leukocytosis has been observed in some patients with malaria ,15,16,17B. rossi and B. vulpes [B. canis-infected dogs and is significantly lower in non-survivors in comparison to survivors [Plasmodium falciparum were not invaded by the parasite. In another study, a mathematical model of Jakeman et al. [B. rossi, B. canis, and B. gibsoni [Babesia spp.Anemia during canine babesiosis is observed in 20% to over 90% of infected dogs ,37,38,39. vulpes ,32,38. Durvivors . Anemia urvivors . Price eurvivors  estimaten et al.  showed t gibsoni ,44,45, a gibsoni . This inB. microti [B. microti parasitemia [Rangelia vitalii, hematocrit was lowest at peak parasitemia, before clinical signs of hemorrhage had manifested [However, it should be mentioned that a correlation between the level of parasitemia and anemia has been observed in humans infected with  microti . Moreoveasitemia . In boviasitemia . Similarnifested . Howevernifested .The lack of association between the level of parasitemia and the severity of anemia in canine babesiosis indicates that the immune response during infection contributes to decreasing the number of RBCs. Phagocytosis, oxidative damage of erythrocytes, antibodies, and the complement system participate in the response to infection. These responses lead to both killing of the parasite and anemia, with other complications of the disease occurring in more severe cases. Moreover, besides immune-mediated hemolytic anemia, sequestration of erythrocytes in microvasculature and splenic retention of RBCs may also negatively impact the RBC count in infected dogs ,39,51,52Phagocytosis is an important mechanism of innate immunity which is used to remove pathogens, cell debris, foreign substances, and apoptotic cells. These targets are recognized by various receptors on phagocytic cells. The process leads to phagosome and further phagolysosome formation, in which microorganisms and other targets are killed and degraded by reactive oxygen species, hypochlorous acid, and various hydrolytic enzymes .B. gibsoni had increased erythrophagocytic activity. This phenomenon was not observed in macrophages obtained from dogs with onion-induced hemolysis [B. gibsoni with erythrocytes, both infected and uninfected RBCs were more susceptible to phagocytosis by macrophages obtained from healthy dogs [B. rossi showed an increased proportion of both splenic and bone marrow-derived macrophages in the spleens of infected dogs in comparison to the spleens of healthy dogs [B. gibsoni or B. canis, spherocytosis has been observed  by inducible nitric oxide synthase (iNOS) in these phagocytic cells ,74,75,76B. canis ,30. Highfections ,30,79. Hnfection . TherefoB. rossi and B. canis at the beginning of the disease [B. canis on the first day of disease (but not on the seventh day) and showed a positive correlation between CSF-2 concentration and eosinophil count in affected animals. This correlation may result from the fact that eosinophils are cells that produce CSF-2. However, other cells such as fibroblasts, endothelial cells, neutrophils, T lymphocytes, and macrophages also produce this cytokine. Expression of CSF-2 is induced by TNF-\u03b1, but IFN-\u03b3 and the anti-inflammatory cytokine IL-10 suppress it [Another cytokine, CSF-2, is also involved in classical activation of macrophages . Increas disease ,30. Morepress it . IncreasP. chabaudi have been shown to have higher peak parasitemia, higher mortality, impaired splenomegaly, and a lower leukocyte count in comparison to wild-type-infected mice, despite equivalent levels of anemia in both groups [P. chabaudi infection [Babesia spp. do not produce this pigment, and consequently do not impair the CSF-2 receptor [During human malaria, the level of CSF-2 increases, but is not associated with disease severity . Howeverh groups . That stnfection . An explnfection . Howeverreceptor . CSF-2 creceptor ,85; therBabesia merozoites in the presence of TNF-\u03b1 and IFN-\u03b3 is inhibited by both IL-4 and IL-10 [B. rossi, the IL-10 serum concentration was lower in severe cases in comparison to uncomplicated cases of the disease. In the same study, the first group also had significantly lower hematocrit. While there was no correlation between hematocrit and IL-10 in infected dogs, hematocrit was strongly positively correlated with IL-8 in these dogs [B. canis-infected dogs, but only in uncomplicated babesiosis [B. canis in comparison to healthy dogs, but with no differences between medians in complicated and uncomplicated cases [B. canis infections [B. canis infections [B. rossi in comparison to healthy dogs [B. rossi infections have confirmed this supposition [B. gibsoni, both an increase and a decrease in IL-8 levels have been observed [B. canis infection. However, the research on B. gibsoni infection consisted of experimental infection of only two dogs.Classical stimulation of monocytes by nd IL-10 . These tnd IL-10 ,88. Leisnd IL-10  showed tese dogs . Alternabesiosis . Increased cases ,89. Serued cases ,91. Simifections ,89. Thisfections . The conthy dogs . A possiposition ,93. In dobserved , while aB. rossi natural infections have shown negative correlations between IL-8 concentration and the severity of disease and fatal outcomes [B. rossi infections showed a transient increase of IL-8 four days after infection, when the level of parasitemia was high. The level of IL-8 subsequently decreases, but not to low values [B. canis was also observed [Further studies of pro-inflammatory cytokines and chemokines during outcomes . Leisewioutcomes  speculatw values ,93. The w values ,93. Accow values , who obsobserved . Thus, iPlasmodium-infected RBCs, and the concentration of IL-8 has been positively correlated with the level of parasitemia in P. falciparum malaria [B. rossi-infected dogs, IL-8 is positively correlated, and IL-10 is negatively correlated, with the number of segmented neutrophils and lymphocytes [B. canis infection, Gal\u00e1n et al. [B. bovis [IL-8 and CXCL1-like are chemokines that induce chemotaxis, and activate and stimulate phagocytosis by neutrophils ,95,96. T malaria ,98. In Bphocytes . During n et al.  showed an et al. ,67. ThisB. bovis ,67. The B. canis and B. rossi [Another cytokine which may be involved in erythrophagocytosis is IL-18 . Serum lB. rossi ,30. IncrB. rossi . In humaB. rossi . MoreoveB. rossi . As thisB. rossi , it seemB. rossi ,102. AccB. rossi , RBC desB. rossi in comparison to healthy animals; however, the study was on a very small group of young (6-month-old) beagles [Babesia-infected dogs cannot be excluded.It is also worth mentioning that neutrophils together with monocytes are the main source of CXCL10 in the spleen during murine malaria . This ch beagles . Decker  beagles  and Hayn beagles  showed a beagles . Moreove beagles ,110. ThuBabesia-infected dogs is unclear and requires further study, especially in adult dogs.It seems probable that the action of neutrophils during canine babesiosis, as in malaria, may have an influence on the severity of anemia caused by phagocytosis. However, CXCL10\u2032s involvement in hemolysis in Anemia during canine babesiosis may also result from oxidative damage to erythrocytes. This is caused by the release of reactive oxygen species, which may be an intra- or extra-cellular phenomenon, as a part of phagocytosis or independent of it ,111.B. gibsoni [B. gibsoni. Moreover, Murase et al. [B. gibsoni, while Otsuka et al. [B. gibsoni, despite parasitemia being three times higher in splenectomized animals. Otsuka et al. [B. gibsoni-infected dogs in 2002. These results indicate that macrophages and the spleen contribute to the oxidative damage of RBCs in babesiosis caused by B. gibsoni.Oxidative damage of RBCs has been observed in dogs infected with  gibsoni ,112. Thee et al.  demonstra et al.  showed ta et al.  observedB. canis [B. rossi. The highest concentration of reactive nitrogen intermediates was detected in infected dogs with severe anemia. However, there was a lack of association between increased reactive nitric intermediates and the severity of the disease [B. canis and B. vogeli. The authors detected eccentrocytosis in 33% of dogs infected with B. canis, but not in dogs infected with B. vogeli. This pathology is typical of oxidative damage to RBCs, and results from peroxidation of cytoskeletal elements or cell membranes leading to shifting of the cytoplasm together with hemoglobin and leaving a pale area on one side of the margin of the erythrocyte  were higher than in control healthy dogs [B. canis, with increased activities of superoxide dismutase and catalase and decreased concentrations of zinc and copper in the blood of affected dogs [B. canis-infected animals also had pale mucosal membranes and dark urine, indicating methemoglobinuria, reflecting acute intravascular hemolysis [B. canis infection, no association between the severity of anemia and the activities of catalase or superoxide dismutase were shown [Other studies on both small and large thy dogs . Moreovethy dogs . Comparated dogs . B. caniemolysis . The resre shown .B. canis infection and oxidative stress [B. canis and B. gibsoni [Babesia species and used the same kit for determination of superoxide dismutase activity. Teodorowski et al. [B. canis-infected dogs with multiple organ dysfunction syndrome. However, even dogs with uncomplicated babesiosis had significantly lower activities of superoxide dismutase and catalase than healthy dogs [Another study on e stress  conversee stress  and Teode stress . Decrease stress . Crnogaje stress  speculat gibsoni  resulted gibsoni . However gibsoni  and Crno gibsoni  worked wi et al.  speculati et al.  observedthy dogs . The stuthy dogs  showed athy dogs . Superoxthy dogs . Moreovethy dogs  observedSimilar results indicating oxidative damage to RBCs have been observed during equine babesiosis and theileriosis, caprine babesiosis, bovine babesiosis and theileriosis, ovine babesiosis, and human malaria ,126,127.B. rossi-infected dogs were published. In one study, infected dogs had an increased percentage of platelet\u2013monocyte aggregates [Plasmodium species. In 2021, Annarapu et al. [Babesia-infected dogs.In 2015, two studies on platelet activation in gregates . The secgregates . Subsequu et al.  demonstru et al. . These ru et al. ,133,134,u et al. . NeverthTNF-\u03b1 appears to be the most important cytokine with a role in oxidative damage of RBCs during canine babesiosis. As with human malaria, increased concentrations of this cytokine have been observed in canine, bovine, murine, and human babesiosis ,137,138.B. bovis. This may indicate the involvement of monocytes in oxidative damage of erythrocytes during babesiosis. As mentioned earlier, activation of monocytes by IFN-\u03b3 results in classical activation of macrophages, leading to the release of pro-inflammatory cytokines such as IL-6 and TNF-\u03b1 [B. bovis-infected erythrocytes [Court et al.  showed tnd TNF-\u03b1 , and incnd TNF-\u03b1 ,138,146.nd TNF-\u03b1 . The autnd TNF-\u03b1 . Subseqund TNF-\u03b1 , or thatnd TNF-\u03b1 . In the nd TNF-\u03b1 . Thus, nhrocytes . HoweverB. canis, B. rossi, and B. gibsoni [B. rossi-infected dogs, a higher IL-6 concentration was associated with the severity of disease and fatal outcomes [P. vivax and P. falciparum [Studies on canine babesiosis have shown increased serum IL-6 concentrations in dogs infected with  gibsoni ,94,150. outcomes . Howeveroutcomes . This reoutcomes . Furtherlciparum . Moreovelciparum ,153,154.lciparum  observedlciparum ,156,157.lciparum ,159. IL-Another cytokine that contributes to the production of nitric oxide and reactive oxygen species is IL-18 . This cyIt is also worth mentioning that secretion of IFN-\u03b3 when stimulated by IL-18 and IL-12 requires mitochondrial reactive oxygen species as redox signaling molecules . Thus, iB. microti infection, who owing to rheumatoid arthritis was being treated with etanercept (a competitive blocker of TNF-\u03b1 and TNF-\u03b2 receptors) [Babesia control comes from an in vitro study which revealed increased production of IL-1\u03b2, IL-12, and TNF-\u03b1 by macrophages activated by B. bovis, and reduced parasite viability when the macrophages were incubated with B. bovis-infected RBCs [B. duncani led to increased serum concentrations of IL-12 and IFN-\u03b3, and that mice genetically deficient in NK cells or macrophages had higher susceptibility to infection by the parasite.It should be emphasized that cytokines such as IL-18, IL-12, IFN-\u03b3, and TNF-\u03b1 play an important role in clearance of the parasite by stimulation of reactive oxygen and nitrogen intermediates ,160,161.ceptors) ,163. A fted RBCs  showed tThe results of the studies cited above show that oxidative stress increases during infections, and that it is a likely involved in damage to RBCs, contributing to anemia. This process is modulated through the action of a number of pro-inflammatory cytokines that promote the processes involved, including phagocytosis and other mechanisms, as detailed below.Antibody-mediated opsonization of RBCs leads to complement activation and binding, antibody-dependent cellular cytotoxicity, and erythrophagocytosis and oxidative damage of erythrocytes ,166,167.B. gibsoni and B. vogeli, but not during canine babesiosis caused by B. canis [B. rossi and with severe anemia had a positive result in the Coombs test, indicating the presence of antibodies against RBCs [B. rodhaini and P. berghei, respectively [B. bovis and B. bigemina, and in human malaria caused by P. falciparum and P. vivax [B. microti, several weeks after treatment, a positive Coombs test and hemolytic anemia was observed in six asplenic patients with no history of autoimmunity, and four patients subsequently required immunosuppressive therapy with glucocorticosteroids [Antibodies binding to RBCs can cause hemolysis, which can lead to anemia . SeveralB. canis ,169,170.nst RBCs . Anti-erectively ,172. SimP. vivax ,175,176.steroids . The sucsteroids  describesteroids .B. gibsoni infection, anti-erythrocyte antibodies have been shown to react with cytoskeletal and transmembrane proteins [B. bovis, but not in cows infected with B. bigemina [B. bovis-infected cattle can explain the occurrence of hemolytic anemia during infection.During a proteins . In anotbigemina . This phbigemina . Exposurbigemina ,181. ThuB. bigemina-infected animals [P. falciparum and idiotypes of antibodies against other plasmodial and non-plasmodial antigens.Further, a study on anti-erythrocyte antibodies in cattle with babesiosis has identified autoantibodies in  animals . The aut animals , who obsBabesia-infected dogs.However, according to Taboada and Lobetti , infectePlasmodium-infected and uninfected RBCs, and that infection induces the production of antibodies against phosphatidylserine. This leads to binding of anti-phosphatidylserine antibodies to infected and uninfected erythrocytes [The association between the surface exposure of phosphatidylserine and anti-erythrocyte antibodies has also been studied in malaria. These studies revealed that phosphatidylserine is exposed on the surface of both hrocytes ,185. Ferhrocytes . Howeverhrocytes ,187.Babesia species.It is possible that similar mechanisms may be involved in the production of anti-erythrocyte antibodies during canine babesiosis. Moreover, according to the authors of this review, it is probable that anti-erythrocyte antibodies participate in hemolytic anemia over the course of canine babesiosis caused by all canine 1 and IgE [1 antibodies mediate antibody-dependent cellular toxicity in bovine babesiosis [Babesia and Plasmodium are intracellular parasites [B. microti produced Stat5a. In another study, Djokic et al. [B. microti. These results help explain IgG1 production during babesiosis; however, as the authors of the study mentioned, the increase was modest but significant [Antibodies are produced by plasma cells (mature effector B lymphocytes), and IL-7 is essential for the development of B lymphocytes ,189. IL- and IgE . However and IgE  showed tbesiosis . Howeverbesiosis . A Th2-tarasites . Howeverarasites . Xue at arasites  showed tc et al.  observednificant . During nificant .1 production may be also stimulated by IL-6 [Babesia-infected dogs, it is probable that its level would be elevated over the course of the disease. These changes associated with autoimmunity may be linked to autoantibody production during babesiosis and malaria.IgG by IL-6 . Product by IL-6 ,197. As  by IL-6 ,150,151. by IL-6 ,189,192. by IL-6 ,192. All by IL-6 ,198,199, by IL-6 . AlthougB. vogeli. Similarly, IgM antibodies to RBCs have been detected in humans infected with P. falciparum [1 production, but induces IgG2a and IgG3 [Besides IgG autoantibodies, Carli et al.  detectedlciparum . IL-6 isand IgG3 . As IFN-and IgG3 , this maand IgG3 ,174,200.B. bovis and is mediated by IgG1. Similar results were observed in human malaria caused by P. falciparum [Plasmodium-infected RBCs and erythrocytic stages of the parasite [Antibody-dependent cellular cytotoxicity (ADCC) is an immunological defense mechanism. Antibodies bound to a target cell mediate the formation of an immunological synapse between a cytotoxic cell and the target cell, and after the synapse is formed cytotoxic factors such as granulysin, granzymes, and perforin are secreted by the cytotoxic cell, which leads to lysis of the target cell . Goff etlciparum , with thlciparum , NK-drivparasite ,204. To NK cells are the main effectors in ADCC. The binding of the Fab region of IgG to an antigen, and of the antibodies\u2019 Fc fragment to the Fc\u03b3 receptor on a NK cell, starts the reaction . IL-15 iB. rossi or B. canis [B. canis-infected dogs, but not during B. rossi infection [B. canis [B. canis and B. rossi infections [All four of these cytokines have been examined over the course of canine babesiosis. Higher concentrations of IL-2 were observed only at the beginning of the disease caused by B. canis ,30. No aB. canis . The serB. canis ,79. IL-1nfection ,30,79, afections ,30.B. bovis infection [P.\u00a0chabaudi during experimental murine malaria [P. chabaudi had higher peak parasitemia and mortality in comparison to wild-type-infected mice, but both groups had equivalent levels of anemia [P. falciparum malaria [Increased expression of IL-15 mRNA in the spleen has been detected during nfection . Mice ge malaria . Moreovef anemia . The resf anemia ,28,30,79 malaria , indicatB. rossi-infected dogs during disease progression [Over 30 plasma and cell membrane proteins belong to the complement system, which is one of the major mechanisms of innate immunity. Complement can be activated through three major pathways: the classical, lectin, and alternative pathways (positively regulated by properdin). Antibodies bound to an antigen contribute only during the classical pathway of complement activation. Several effector mechanisms are common to all pathways of complement activation, including the formation of the membrane attack complex (C5b-9) leading to perforation of the cell membrane, proteolytic activation of C3, C4, and C5 to generate anaphylotoxins  that engage granulocytes and monocytes/macrophages to cytokine production, phagocytosis, degranulation, and oxidative burst, and opsonization of the target cell and binding to complement receptors on the surface of phagocytic cells . The comgression .B. rodhaini. The same authors detected that B. rodhaini used components of complement (C3 and C5) to invade human RBCs [B. rodhaini in BALB/c mice. Similar results were obtained by Levy et al. [B. bovis. Levy et al. [B. bovis infection in vitro. To the best of the authors\u2019 knowledge, the influence of complement activation on anemia development has not been studied in canine babesiosis. However, according to K\u00f6ster et al. [B. canis. Similar results were observed in another proteomic study on serum proteins in mice infected with B. microti [B. canis that developed multiple organ dysfunction syndrome compared to B. canis-infected dogs that developed systemic inflammatory response syndrome. A decrease in complement inhibitors (such as C4-binding protein or complement receptor type 1) leading to prolonged activation of complement was observed in the former cohort. Another study on serum proteins in dogs infected with B. canis showed hyper-\u03b22-globulinemia, which may result from an increased C3a protein concentration during canine babesiosis [In 1976, Chapman and Ward  demonstrman RBCs . Howeverman RBCs  showed ty et al. ,218 in sr et al.  showed i microti . In a fu microti  observedbesiosis . The resP. falciparum [P. falciparum sporozoites. In 15 out of 16 volunteers, sporozoite-specific IgM and IgG antibodies were induced, and complement was deposited on sporozoite surfaces. The membrane permeability of sporozoites was found to be increased in the presence of antibodies and activated complement. Moreover, a study by Raballah et al. [An experimental study on human malaria showed increased complement activation in volunteers infected with lciparum . Behet elciparum  showed th et al.  showed tBesides the three major complement activation pathways, serine proteases such as kallikrein and thrombin (both involved in coagulation) may also cleave C5 and C3, generating anaphylotoxins such as C5a and C3a . These pEscherichia coli sepsis in vitro. Moreover, in a study of C5aR-deficient mice (no expression of the gene for C5a receptor), production of IL-1\u03b2 and CCL2 was decreased, while in another study a C5aR antagonist decreased IL-1\u03b2, CCL2, and TNF-\u03b1 production [In sepsis and related diseases, such as severe COVID-19 and malaria, complement system activation is associated with a life-threatening cytokine storm which is caused by an excessive immune response, leading to increased release of cytokines and chemokines such as TNF-\u03b1, IFN-\u03b3, IL-1, IL-6, IL-12, IL-18, CCL2, CXCL8, and CXCL10, among others ,233,234.oduction ,237. Thuoduction , the cheoduction .B. rodhaini, the authors did not detect depletion from the properdin pathway of complement activation. On the other hand, Pawluczkowycz et al. [P. falciparum. According to Chen et al. [Moreover, activation of complement may occur via the alternative pathway . This paz et al.  has demon et al. , properdB. bovis-infected calves, splenomegaly has been shown to be caused by hyperplasia of both small leukocytes  and large leukocytes . In these animals, hyperplasia was observed in red pulp along with a reduction in white pulp, and a loss in distinction between red pulp and the marginal zone was also observed [B. rossi, where increased numbers of monocyte-macrophages of bone marrow origin, splenic macrophages, T lymphocytes, mature B lymphocytes, and plasma cells were observed in red pulp, with immature B cells and plasma cells also relocated to red pulp in infected dogs [Parasitized RBCs are cleared by the spleen in both babesiosis and malaria ,243,244.observed . Similarted dogs .P. chabaudi. Although the distinction between red and white pulp was lost in traditional hematoxylin-eosin staining, immunohistochemical examination revealed restriction of macrophages to the red pulp in infected animals, while dendritic cells had migrated from red pulp to the areas of white pulp [As in bovine and canine babesiosis, massive hyperplasia of macrophages has been observed in the spleens of mice experimentally infected with ite pulp .In human malaria, the spleen is also enlarged. The red pulp is congested with both infected and uninfected RBCs, and there is an increase in the number of macrophages . In rareP. falciparum, splenic retention of parasitized RBCs results from the fact that these erythrocytes, as less deformable, are not able to pass through very narrow inter-endothelial slits in the slow microcirculation of the splenic red pulp. However, even non-parasitized RBCs are mildly less deformable during an infection [P. vivax malaria. A similar decrease in deformability has been observed in P. berghei- and B. microti-infected erythrocytes [In human malaria caused by nfection . Mour\u00e3o nfection  demonstrhrocytes . Moreovehrocytes ,252. Addhrocytes . In thishrocytes .B. bovis. In young animals, the increase occurred just after infection, while in adult cows it was delayed, being observed five days later [B. microti-infected mice [In experimental murine malaria, Leisewitz et al.  demonstrys later . Increasys later . Althougted mice .Plasmodium infection [P. yoelii nigeriensis. As increased IFN-\u03b3 has been observed in experimental canine babesiosis [B. gibsoni. However, only two dogs were infected in that experiment [In human malaria, hyperreactive malarial splenomegaly has been associated with significantly increased concentrations of IgM, anti-parasite IgG, IL-10, and IFN-\u03b3 . Accordinfection . Moreovenfection  demonstrbesiosis , it is pbesiosis  did not periment .B. bovis, this is partially caused by variant erythrocyte surface antigen 1 (VESA1), while proteins of the P. falciparum erythrocyte membrane protein 1 (PfEMP1) family have a role during malaria [Babesia species such as B. bigemina and B. divergens express VESA proteins (VESA1 or VESA2), Jackson et al. [B. bovis infection leads to cytoadherence of infected RBCs and sequestration of erythrocytes in the microvasculature of cattle [B. bigemina. Moreover, this phenomenon has been reported as present over the course of infections caused by B. rodhaini in mice, B. duncuni in hamsters, B. divergens in humans, and B. canis in dogs [B. canis and B. rossi [B. rossi infection [B. canis-secreted proteome. According to these authors, cytoadherence and sequestration of Babesia-infected erythrocytes in dogs are another explanation for the lack of the association between the severity of infection and the level of parasitemia [Sequestration of erythrocytes in micro-vessels has been observed both in malaria and babesiosis ,258. Thi malaria . These p malaria . Althougn et al.  reportedf cattle . Howeverf cattle , cytoadh in dogs . SequestB. rossi ,133, andnfection . In 2017nfection  identifiasitemia .Babesia-infected erythrocytes can be sequestered in micro-vessels through the action of cell adhesion molecules (CAMs) [PfEMP1 [Besides parasite proteins on the surface of infected RBCs causing adherence to endothelial cells, s (CAMs) . In humas (CAMs) ,264. This (CAMs) ,264,265. [PfEMP1 ,267,268. [PfEMP1 . Its exp [PfEMP1 ,270.Plasmodium infections, which are associated with cytoadherence and RBC sequestration in micro-vessels [P. falciparum malaria demonstrated massive accumulation of infected erythrocytes in most visceral capillaries. Moreover, in cases where placentas were available, the study showed coexistence of cerebral and placental sequestration of infected RBCs [Cerebral and placental malaria are the best-known complications of -vessels ,272. Howted RBCs . This stted RBCs ,274,275.ted RBCs ,275. As Babesia infections [Wolbachia), and toxoplasmosis, as well as in bacterial, fungal, and viral infections, in experimental animal models, in in vitro experiments, and in dogs with sepsis [DIC and NETosis are other complications which may participate in the sequestration of erythrocytes in microvasculature in malaria, and probably in babesiosis. However, NETosis has not been studied in fections ,230,276.h sepsis ,283,284.In NETosis, endothelial contact with pathogens leads to sequestration and activation of leukocytes. Monocytes, activated by the expression of tissue factor, induce fibrin formation. P-selectin, ICAM-1, and CXCL1 bind and activate neutrophils to secrete decondensed chromatin, which is spread as strands of DNA bound to histones, myeloperoxidase, and neutrophil elastase. These strands of DNA and proteins form NETs, in which both pathogens and blood cells are trapped ,286. MorB. rossi, with the concentration higher in non-survivors. In 2017, Kule\u0161 et al. [B. canis had an increased concentration of soluble urokinase plasminogen activator receptor (suPAR), an increased plasminogen activator inhibitor-1 concentration, and increased plasminogen activity six days after treatment with imidocarb. Moreover, dogs with complicated babesiosis had a higher concentration of a proenzyme, thrombin activatable fibrinolysis inhibitor, in comparison to dogs with uncomplicated disease [Increased fibrinolysis has been detected in canine babesiosis ,230. In \u0161 et al.  showed t disease . However disease ,291. Nev disease , Ruiz de disease , and Bar disease , they inB. rossi, the IL-8 concentration was lower in infected dogs [B. canis and B. rossi infections in which opposite correlations between hematocrit and IL-8 were observed [Babesia-infected dogs may indicate possible development of NETosis [As mentioned above, increased ICAM-1 expression is induced by TNF-\u03b1, IFN-\u03b3, IL-1\u03b1, IL-1\u03b2, IL-6, HMGB-1, and reactive oxygen species, and the result of increased ICAM-1 expression is increased expression of VCAM-1 and production of IL-8 ,264,265.ted dogs . Atkinsoted dogs  demonstrted dogs  showed tted dogs  and Atkited dogs  may explobserved ,79. Incrobserved  on VESA observed  on ICAM- NETosis ,30,35,36 NETosis ,228,229.Regarding sequestration of RBCs in micro-vessels, it seems probable that both infected and uninfected erythrocytes are trapped in micro-vessels by various mechanisms, including the actions of VESA proteins and CAMs, and possibly with the contribution of NETs and DIC. In this way, the RBC count may decrease in canine babesiosis. However, a further study of the association between anemia and sequestration is required to show the degree of participation of RBC sequestration in the development of anemia in infected dogs. Moreover, sequestration of various blood cells in micro-vessels together with DIC and presumptive NETosis contribute to tissue hypoxia, which leads to other complications over the course of the disease.Babesia-infected dogs indicates that immune responses contribute to decreasing the RBC count. While low venous parasitemia together with severe anemia may be caused by sequestration of infected RBCs in micro-vessels, the immune response nevertheless leads to both killing of the parasite and erythrocyte destruction. Phagocytosis, oxidative damage of RBCs, and the complement system all participate in the development of anemia. These processes are driven by pro-inflammatory cytokines and chemokines. The contributions of these cytokines and chemokines in the development of anemia during canine babesiosis are presented in Direct destruction of infected RBCs by the parasite is not the main cause of anemia in canine babesiosis. The lack of association between the levels of parasitemia and anemia in Increased phagocytic activity of splenic macrophages and neutrophils, and peripheral granulocytic phagocytosis in small vessels, lead to a decrease in the number of RBCs in infected dogs. Moreover, macrophages and probably platelets contribute to oxidative damage of RBCs over the course of the disease.Babesia-infected dogs may partially result from complement activation.Antibodies to phosphatidylserine and disregard of \u201cdo not eat me\u201d signals are likely involved in antibody-dependent lysis of RBCs during canine babesiosis. Opsonization of erythrocytes by antibodies may lead to complement activation, antibody-dependent cellular cytotoxicity, erythrophagocytosis, and oxidative damage of RBCs. However, ADCC appears to contribute to the removal of the parasite, but not to the development of anemia. Increased production of pro-inflammatory cytokines and chemokines in Both parasitized and non-parasitized RBCs are less deformable over the course of infection. RBCs that are less deformable and/or covered with a parasite, including non-parasitized RBCs, may be retained by the spleen, phagocytized by macrophages and neutrophils, or lysed by complement. Thus, splenic retention may contribute to the development of anemia during babesiosis.Sequestration of erythrocytes in micro-vessels may also contribute to decreased RBC counts. This process is facilitated by VESA proteins and CAMs, and in some cases by DIC. Additionally, it is possible that NETosis also plays a role in sequestration of RBCs in micro-vessels during canine babesiosis.All these mechanisms involved in the development of anemia are driven by pro-inflammatory cytokines and chemokines. Moreover, delayed or insufficient production of anti-inflammatory cytokines, causing an imbalance between pro- and anti-inflammatory actions, favors these patho-mechanisms.While this review has highlighted a number of mechanisms that can contribute to the development of anemia during canine babesiosis , there still remains several gaps in the knowledge of how canine babesiosis progresses. Consequently, further studies of this disease examining the involvement of immune responses in the development and promotion of anemia during canine babesiosis, with a focus on the roles of cytokines and chemokines that mediate these responses, will further our understanding of this disease. Moreover, the study of NETosis in canine babesiosis and the association between anemia and sequestration of RBCs in micro-vessels is needed to discern if trapping of blood cells in microvasculature significantly contributes to the development of anemia."}
+{"text": "In addition, we performed small RNA-Seq to identify miRNA at sexual immaturity (30-days-old) and maturity (120-days-old) of HZ boar testis (using LC boar as control) to reveal the key miRNA in regulation of precocious puberty. Hormone assay results showed that high levels of T, E2, FSH, and LH may be related to precocious sexual maturity of HZ boars, and that FSH may play an important function before sexual maturity. Histological observation showed that HZ boars developed earlier than LC boars and had reached sexual maturity at 120 days. Small RNA-Seq yielded a total of 359 exist miRNAs, 767 known miRNAs and 322 novel miRNAs in 12 samples; 549, 468, 133, and 247 differentially expressed (DE) miRNAs were identified between Ha vs. Hb, La vs. Lb, Ha vs. La, and Hb vs. Lb (log2 fold change >1 and p < 0.05). Enrichment analysis showed that target genes of these DE miRNAs were enriched in many gene ontology (GO) terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) signaling pathways  were related to testicular development and spermatogenesis. Further screening, some miRNAs  were possibly associated with precocious puberty. These results provide new light on miRNA regulatory mechanisms involved in precocious puberty.Precocious puberty is closely related to testicular development and spermatogenesis, and there is increasing evidence that miRNAs are involved in regulation of testicular development and spermatogenesis. However, little is known about the regulation of microRNAs (miRNAs) during precocious maturation in Hezuo (HZ) boars. In this study, serum Testosterone (T), Estradiol (E Sexual maturation time is an important indicator of pig reproductive performance, and different breeds reach sexual maturity at different ages. Compared to foreign introduced breeds, some native pig breeds have excellent traits of early maturity that could be inherited stably during the evolutionary process. For example, Ding et al.  found th2) in their serum, for example, their testes synthesize estrogen and regulate spermatogenesis during this period (Testosterone (T), produced primarily by the Leydig cells of the testes, has long been known to be the dominant sexual steroid hormone in males and is essential for Sertoli cells prior to testicular maturation , 4. Howes period . Furthers period , mice 32 in theis period , and buls period ], FSH ses period . TherefoT in goat testis Leydig cells by targeting PPARGC1A (SMAD4 and promote CYP19A1 gene expression to affect the secretion of E2 in mouse (microRNAs (miRNAs) are types of small, endogenous, non-coding RNA with ~22 nucleotides in length. It is well\u2013known that miRNA can be bound to the 3'-untranslated region (3'-UTR) by perfect or imperfect complementary of target genes in mammals to inhibit or degrade the translation of mRNA . Testis PPARGC1A . Yao et 2, FSH, and LH) were assayed in HZ and Landrace (LC) boars at 30, 90, 120, 180, and 240 days. And 12 small RNA-Seq libraries were constructed and sequenced using Illumina-HiSeq\u2122 2,500 to identify miRNA from Tests of 30-days-old and 120-days-old HZ and LC boars, so as to explore key miRNAs that regulated early maturation process in HZ boar.Hezuo (HZ) pig is a very valuable genetic species resource, which is the unique native pig breed in Qinghai-Tibet Plateau of China, mainly distributed in Xiahe, Zhuoni, and Diebu of Gannan Tibetan Autonomous Prefecture . CompareThis study followed strictly the animal ethical standards and regulations of the College of Animal Science and Technology, Gansu Agricultural University . All works were made to minimize pain experienced by the experimental boars.2, FSH, and LH concentrations. The serum concentrations of T, E2, FSH, and LH in each boar was determined in triplicate by a commercial enzyme-linked immunosorbent assay (ELISA) kit . The serum levels of T, E2, FSH, and LH were measured according to the vendor's instructions. The data were analyzed by one-way Analysis of Variance (ANOVA) using SPSS software.In this study, 15 Hezuo and 15 Landrace boars  were used, divided in 5 periods  of 3 boars each. Blood samples of all 30 boars were drawn from the anterior vena cava. These samples were centrifuged  within 1 h of collection, stored at\u221220\u00b0C until assay for T, ETesticular samples were fixed in Bouin' solution for 72 h and then were processed into paraffin sections of 4\u20136 \u03bcm thickness, and subjected to hematoxylin and eosin (HE) and examined with a light microscope. Diameter of spermatogenic tubule was measured and the number of spermatogenic cells and Sertoli cells was counted. One-way ANOVA was performed using SPSS software.All 30-days-old  and 120-days-old  HZ boars, and LC boars at the same age were castrated to obtain the testes samples. The testes on the same side were immediately frozen in liquid nitrogen and then stored at\u221280\u00b0C until further use. Total RNA was extracted from pooled samples by Trizol reagent kit  according to the manufacturer's instructions. Quantity and integrality of total RNA was detected by Agilent 2,100  and NanoDrop 2,000  instruments, and small RNA obtained from total RNA was used to construct small RNA libraries were then tested for quality and yield using Agilent 2,100 and ABI StepOnePlus Real-Time PCR System (Life Technologies). RNA with a RIN \u22657 was used to construct small RNA libraries and subsequent sequencing. The average RIN value of the RNA samples extracted from all testis tissues was 8.4 \u00b1 0.70.\u00ae multiplex small RNA library prep kit for illumina . After total RNA was extracted, the RNA molecules in a size range of 18\u201330 nt were enriched by Polyacrylamide gel Electrophoresis (PAGE). Then the 3' Adapters and 5' adapters were ligated to the RNAs. The ligation products were reverse transcribed by PCR amplification and the 140\u2013160 bp size PCR products were enriched to generate a small RNA library and sequenced using illumina-HiSeq\u2122 2,500 by gene Denovo Biotechnology Co. . The raw datas generated were deposited in NCBI GEO (GSE192462).12 small RNA libraries were constructed using the NEBNexthttp://blast.ncbi.nlm.nih.gov) and Rfam database (http://sanger.ac.uk/software/Rfam) to identify and remove non-coding RNAs (ncRNAs), including ribosomal RNA (rRNA), small cytoplasmic (scRNA), small nucleolar RNA (snoRNA), small nuclear RNA (snRNA), and transfer RNA (tRNA). Meanwhile all of the clean tags were also aligned with the reference genome (Sus scrofa 11.1).Those mapped to exons or introns might be fragments from mRNA degradation, so these tags were removed. The tags mapped to repeat sequences were also removed. The remaining clean tags were further compared with the mature miRNAs in miRBase 22.1 (http://www.mirbase.org/) using bowtie  for sequencing. Ha, Hb, La, and Lb represent 30d Hezuo boar, 120d Hezuo boar, 30d Landrace boar and 120d Landrace boar, respectively. The sequencing raw reads were filtered by fastp (V0.18.0)  to removg bowtie  softwareg bowtie , and miR6  as the following formula: TPM = Actual miRNA counts/Total counts of clean tags \u00d7 106 . In addi6  software\u00ae Green Pro Taq HS Premix II . RT-qPCR was performed in a LightCycler 480 II instrument  and the thermal cycler program included an initial denaturation at 95\u00b0C for 3 mins, followed by 40 cycles at 95\u00b0C for 15 s; 57\u00b0C for 15 s; and 72\u00b0C for 20 s. miRNA expression was quantified relative to U6 expression using the 2\u2212\u0394\u0394Ct method  analysis. These miRNAs included ssc-miR-149, ssc-miR-217, ssc-miR-31, miR-383-x, miR-29-y, miR-93-y, miR-409-y, novel-m0010-5p, novel-m0003-5p, and novel-m0042-3p. The primer sequences of the selected miRNAs were designed and are listed in t method .http://www.geneontology.org/) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) (http://www.genome.jp/kegg/) were used to recognize the main biological functions and identify functional pathways.The functions of miRNAs on different physiological activities can be achieved through their binding to corresponding target mRNAs. The prediction and functional enrichment analysis of target genes are therefore significant ways by which the functions of miRNAs identified in the present study may be explained. The potential target genes of all the differentially expressed miRNAs in four groups were predicted using RNAhybrid , MiRandap-value < 0.05 were selected as co-expressed negative miRNA-mRNA pairs and a miRNA-mRNA interaction network was constructed. The interaction analysis was visualized by Cytoscape software , 120 (287.27 \u00b1 9.10 vs. 182.59 \u00b1 12.81 pg\u00b7ml\u22121), 180 (254.71 \u00b1 12.49 vs. 213.02 \u00b1 12.09 pg\u00b7ml\u22121), and 240 (345.92 \u00b1 10.02 vs. 194.07 \u00b1 9.32 pg\u00b7ml\u22121) days of age  and 90 (85.34 \u00b1 3.58 vs. 54.09 \u00b1 3.14 pg\u00b7ml\u22121) days of age, and lower than that of LC boars at 120 (55.07 \u00b1 2.78 vs. 115.04 \u00b1 6.10 pg\u00b7ml\u22121), 180 (50.13 \u00b1 4.36 vs. 80.04 \u00b1 5.20 pg\u00b7ml\u22121), and 240 (46.55 \u00b1 4.29 vs. 75.11 \u00b1 4.58 pg\u00b7ml\u22121) days of age , respectively  in miRbase 22.1, a total of 359 exist miRNA and 761 known miRNA were found to be expressed of the two breeds during two periods. All tags, that were not annotated to miRbase 22.1, were used to predict novel miRNA according to their genome positions and hairpin structures predicted by mirdeep2, a total of 332 miRNA was determined to be novel miRNAs . In all Based on normalized all miRNA count, principal component analysis (PCA) was conducted. These results showed that the six samples for the Ha and Lb group were close, while the six samples at Hb and Lb were more remote. miRNA expression was distinct between during two periods, and was different in 120-days-old HZ and LC boar . Moreovep-value < 0.05. A total of 331 up- and 218 down-regulated, 400 up- and 68 down-regulated, 45 up- and 88 down-regulated, and 146 up- and 101 down-regulated miRNA were detected in Ha vs. Hb, La vs. Lb, Ha vs. La and Hb vs. Lb, respectively  for BP, CC, and MF, respectively. These signal pathways include PI3K-Akt (ssc04151), Hippo (ssc04390), Rap1 (ssc04015), Glycolysis/Gluconeogenesis (ssc00010), and Ras (ssc04014) signaling pathways. This implies that these molecules may play a key role in regulating precocious puberty through the above signaling pathways. The top 20 KEGG pathways  were shown in The mRNA expression data of 12 samples from our previous study were used for a pairwise integrated analysis . To explAccording to the negative regulatory effects of miRNAs on mRNAs, these 158 candidate miRNAs were targeted for association with 984 mRNAs previously screened to further explore the potential involvement of HZ boar precocious miRNAs. A total of 2,525 miRNA-mRNA relationship pairs were identified . To bett2, FSH, and LH) of HZ and LC boars at 30, 90, 120, 180, and 240 days were measured and compared, and the miRNAs in the testes of HZ and LC boars at 30 and 120 days were identified and comparatively analyzed using small RNA-Seq.The reproduction performance of sire is crucial in livestock production, which can bring higher economic benefits. Early sexual maturity is an excellent reproductive characteristic of some local pig breeds in China, such as Hezuo (HZ) pig. It can improve the utilization of female animals, shorten the generation interval of excellent females, and accelerate the genetic breeding process. Our previous works have shown that HZ boars have reached sexual maturity at 4 months of age . To explT levels were generally on the rise and were higher in HZ boars than in LC boars at all ages, which is consistent with other local pig breeds [such as Xiang pig  to screen for co-differentially expressed miRNAs. A total of 158 miRNAs were initially screened out for subsequent focused analysis. Based on our previous RNA-Seq data, we predicted target genes for these miRNAs and performed GO and KEGG analysis on these target genes. The results showed that most of them were involved in metabolism of various materials and were enriched in some common pathways , which play a functional role in testis development and spermatogenesis \u201344. By fDnmt3a and Dnmt3b essential for gonadal development . High levels of sex hormones may be correlated with the precocious development of HZ boars. Small RNA-Seq was used to identify the miRNA of testes in HZ boars and LC boars at 30 and 120 days. Based on our previous RNA-Seq data, a joint analysis was performed to initially screen out some miRNAs  that may regulate precocious sexual maturation traits in HZ boars. The study provides an improved understanding of the roles of miRNAs in precocious sexual maturation in HZ boars.In this study, we compared the serum T, EThe datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/The animal study was reviewed and approved by Faculty Animal Policy and Welfare Committee of Gansu Agricultural University. Written informed consent was obtained from the owners for the participation of their animals in this study.BZ, ZY, and SG designed the study. BZ performed the research and analyzed the data with the support of ZY in statistics and prepared and wrote the original draft. ZY, YG, JL, ZW, PW, QY, XH, and SG supervised the project. ZY and SG reviewed the paper. All authors contributed to the article and approved the submitted version.This work was supported by the Breeding and Cultivation of New Local Pig Breeds (Synthetic Lines) in the Northern Region (2021YFD1301200) and the Protection and Quality Improvement of Gansu Local Pig Germplasm Resources (GSLK-2021-13).Author YG was employed by Jilin Rongtai Agricultural Development Co., Ltd., China. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Interest in the use of zinc oxide nanoparticles (ZnO NPs) in surface coatings and films has increased as its incorporation can significantly improve the mechanical and antimicrobial properties of coatings and film solutions. In an effort to produce green or eco-friendly products, the potential use of ZnO NPs biosynthesized from natural resources to replace conventional petroleum-derived polymers has been investigated. This review provides an insight into the growing trend of incorporating ZnO NPs into synthetic or semi-synthetic or bio-based polymeric materials via different synthesis methods as well as its characteristics and potential applications in surface coatings and films. The antimicrobial potential of ZnO NPs to inhibit the growth of various types of microorganisms as well as its use in surface coatings or films to impart antimicrobial activities that prevent the spread of microorganisms, especially the COVID-19 virus, was also discussed. Staphylococcus aureus (S. aureus) and Escherichia coli (E. coli) [Large structures  and smaller structures  require protection for effective long-term use. As such, surface coatings comprising polymeric materials and additives are often used to provide protection from foulants, harmful microorganisms, moisture, and UV radiation. Furthermore, in the food and beverage industry, it is crucial to use packaging film with adequate antimicrobial properties to ensure that food quality is maintained and that food is preserved from food-borne bacteria . PetroleE. coli) , 11.1. Introduction\u2009 2.1. Comparison of green-synthesized and nongreen-synthesized ZnO NPs\u2009 2.2. Green approaches for surface coatings and film as biopolymeric materials\u2009 \u20032.2.1. Bio-based materials\u2009 \u20032.2.2. Plant-based materials\u2009 2.3 Incorporation of ZnO NPs in coating materials and films and its compatibility\u2009 2.4. Surface and coating method selection for ZnO NPs.2. ZnO NPs in surface coatings and films\u2009 3.1. Mechanical properties\u2009 3.2. Antimicrobial properties\u2009 \u20033.2.1. Bacteria\u2009 \u20033.2.2. Fungi\u2009 \u20033.2.3. Algae\u2009 3.3. Antiviral potentials\u2009 3.4. Integration of ZnO NPs with other NPs for surface coatings and films3. Potential of ZnO NPs in surface coating and film properties\u2009 4.1. Food packaging\u2009 4.2. Textiles for biomedical applications\u2009 4.3. Paint industry\u2009 4.4. Marine antifouling\u2009 4.5. Preservation works4. Application of ZnO NPs in surface coatings and films5. Emerging research on natural polymeric materials containing ZnO NPs as a coating for antimicrobial and antiviral purposes6. ConclusionsThis review is aimed at providing the current state and biosynthesis of ZnO NPs that have been incorporated into film and surface coating solutions via different methods and types of surfaces. The interactions that occur between ZnO NPs and the polymeric matrices of surface coatings and films will also be discussed. The properties of ZnO NPs were also compared with that of another NP. This review provides insight into the potential behaviour of ZnO NPs when used as an additive in surface coatings and films. This discussion elaborates each of the topics as follows:Different methods, such as direct blend with determined ZnO NPs or through top-down or bottom-up techniques, can be used to introduce ZnO NPs into surface coating and film solutions \u201314.  FigMohan et al.  describeHowever, physical and chemical methods have disadvantages as they require costly equipment, high temperatures, and high pressures , as wellAnisochilus carnosus, Plectranthus amboinicus, Vitex negundo, Russian olive [Bacillus licheniformis, Aeromonas hydrophila, and Sargassum muticum to name a few. The study reported that the presence of phytochemicals such as polyphenols in these natural strains and plant extracts acts as a reducing and capping or stabilizing agent during NP synthesis. Similarly, Obeizi et al. [Eucalyptus globulus essential oil act as a capping and reducing agent during ZnO NP synthesis, where the colour of the mixture was monitored from visible to light yellow. Fabaceae and Rutaceae species, which is responsible for the reduction of metal salts. As the synthesized NPs were narrowly distributed, they were capable of significant antibacterial, electrochemical, sensory, and photocatalytic activity.Over the years, multiple studies have investigated green-synthesizing NPs. Agarwal et al.  examinedan olive , and Raman olive  as well i et al.  conclude\u22121 and 380\u2013667\u2009cm\u22121, which represents the Zn-O bonds of biosynthesized and chemically synthesized ZnO NPs, respectively [As seen in ectively \u201319. TherAegle marmelos, and Eucalyptus globulus were compared with that of nongreen-synthesized ZnO NPs . The resulting peaks were found to range between 375 and 470\u2009cm\u22121, indicating coherence between both green and nongreen synthesis methods. This can be attributed to the various parameters used during ZnO NP fabrication such as precursor concentration, methods, and reaction times to name a few that contribute to the shifting peaks seen in the FTIR spectra. Furthermore, some variations in wavenumber were also observed during green synthesis using different plant extracts (extracts . This maCitrus maxima (Pomelo) juice as a reducing agent during ZnO NP fabrication and found that the average size of the NPs ranged between 15 and 35\u2009nm at different concentrations. Ghasem et al. [Thymus pubescent leaf extract and compared the XRD diffractograms of the samples with that of commercial ZnO NPs  at different metal oxide percentages to improve the surface coating properties. It is noteworthy that the incorporation of metal oxides could enhance the properties of bio-sources and eventually be used as an alternative to nonbiodegradable polymers.Although plant-based polymers are less scratch-resistant than petroleum-based coatings, different initiators or resins can be added to these plant- or bio-based materials to improve their scratch resistance. Al-Naamani et al.  investigZnO NPs are commonly integrated with synthetic, semi-synthetic, and biopolymeric materials via blending and have been used as a finishing on various surfaces. As seen in Jatropha curcas oil-based polyol comprising polyurethane (PU) and different concentrations of ZnO NPs that possess anticorrosive properties. The study found that low concentrations (<7%) of ZnO NPs facilitated smooth dispersion while agglomeration started to occur at ZnO NPs concentrations exceeding 7%, which decreased the anticorrosive performance of the coating. However, a few factors such as the pH, concentration, size, smoothness, and distribution of the NPs need to be taken into consideration when selecting coating materials and films to be embedded with ZnO NPs. This is because the inhomogeneity of ZnO NPs in a matrix, due to a high concentration of NPs, could cause agglomeration that degrades its performance and aesthetical values , 50. AunWeththimuni et al.  incorporShaban et al.  investig\u2212) in the solution [The dispersion of ZnO NPs in a surface coating can also be affected by its pH. This is because NPs tend to agglomerate and nucleate at low pH due to the presence of fewer hydroxyl groups  and transmission electron microscope (TEM) images. Amjadi et al.  observednd films , 31. ZnO[2+ ions , 55, rel[2+ ions .2+ ions, especially for applications in the food industry and marine environments [2+ ions could cause cytotoxicity in aquatic organisms, which will eventually lead to toxicity in humans. Furthermore, certain solvents such as water can promote the leaching of ions. The following equation explains the possible ionization of Zn2+ ions from ZnO NPs after exposure to water [According to the Food and Drug Administration (FDA), macrosized ZnO is safe for use in the eco-friendly food packaging industry , 58. Howronments . This isto water :(1)ZnO+H2+ ions during the production of ZnO NPs has become a major concern. As such, researchers have discovered a way of overcoming this issue by encapsulating ZnO NPs in a polymeric agent, which modifies its antimicrobial activity. Therefore, the addition of a support matrix to ZnO NPs is an alternative that could be used to overcome the toxicity issue [The leaching and aggregation of Znty issue . Tisseraty issue  used pol2+ from coating solutions.Tajau et al. , 46 repoAs the dispersion of ZnO NPs in a biopolymer increases the transparency of the biopolymer film, it is suitable for surface coatings as it will not change the aesthetics, which can damage the value of the surface. Furthermore, as the polymer is found to be less in water in the presence of ZnO NPs, it makes coated surfaces such as steel, glass, and wood become more durable . Films cIn the roller coating method, bar rollers automatically apply a uniform thickness of the coating solution on a flat surface. Aung et al.  used theIn the textile industry, the dip-spin coating method is commonly used to coat the surfaces of fiber-textured materials as it provides strong adhesion to ensure that the ZnO NPs are embedded on each strand. Meanwhile, smaller fabrics are immersed in a selected coating solution, withdrawn, and then dried at a suitable temperature. This process is repeated in cycles to ensure that the surfaces are well-coated. Altering parameters such as the type and concentration of the coating solution could modify the ability of NPs to adhere to the surface of a textile. R\u0103dulescu et al.  altered Sol-gel spin coating is another technique that is commonly used to coat cotton with ZnO NPs . This isThe brushing method is commonly used to coat surfaces such as buildings with NPs. This is a feasible method of depositing polymeric resins containing ZnO NPs on surface . WeththiMechanical properties are the physical properties that a material exhibits upon the application of forces. Variations in materials, techniques, and parameters could change the mechanical properties of materials. Therefore, the presence of ZnO NPs on the surface of a coating or film will modify and improve its mechanical characteristics such as hardness, ability to adhere to surfaces, and UV resistance, as well as its tensile characteristics such as elongation time to break (ETB), ultimate tensile strength (UTS), and Young's Modulus (YM). \u2212 group in the matrix. Furthermore, the starch-ZnO NPs matrix became more hydrophobic, relative to the original starch, due to the presence of ZnO NPs that filled up the empty spaces and consequently facilitated hydrogen bonding [As seen in  bonding . Amjadi  bonding  reported bonding . Das et  bonding  also sugFurthermore, hardness is also an important mechanical property that is commonly tested. This test is performed by firmly pushing the lead of a pencil into the surface of a material at a 45\u00b0 angle. The hardness of a surface that had been coated with a coating containing ZnO NP filler was found to have increase as a 6H pencil was required to scratch the coated surface, while a HB pencil was sufficient to scratch the uncoated surface , 74.ZnO NPs are known to possess antimicrobial properties that can inhibit the presence of microorganisms such as fungi and bacteria. According to extant studies , 36, 75,The agar diffusion method is commonly used to test the antimicrobial activity of a compound. A broth solution is first prepared using a specific agar media depending on the microorganisms tested. In general, yeast extract glucose chloramphenicol (YGC) agar is used for fungi, while nutrient agar is used for bacteria , 29. TheAnother method that can be used to determine antimicrobial activity is microbroth dilution . In thisSome of the several proposed mechanisms by which ZnO NPs inhibit microorganisms include the ionization of ZnO NPs, the photocatalytic activity of the reactive oxygen species (ROS) produced by the ZnO NPs, and the accumulation of ZnO. 2+ ions that disturbs the cell wall of a microorganism. These Zn2+ ions eventually pass through the cells and disrupt the enzymatic system of the cell, which subsequently kills the microorganisms [1O2), hydroxyl radicals (.OH), hydrogen peroxide (H2O2), and superoxide (O\u2212\u2022) under UV irradiation. They initiated oxidative stress of mitochondria and endoplasmic reticulum dysfunction in E. coli resulting in irreversible membrane damage, DNA mutation, and death in E. coli. According to their study, the antibacterial potential of ZnO NPs was not mediated by Zn2+ ions, which suggested that the Zn2+ ions were not escaped from NP or NP network. H\u00fcbner and Haase explained that zinc itself is redox-inactive and always present in the valence state Zn (II) in biological systems causing the zinc unable to directly participate in redox reactions [ZnO NPs are believed to undergo ionization, which releases Znrganisms \u201379. The rganisms  in whichrganisms , 82. Jinrganisms  describeeactions . Lastly,eactions , 86. Thieactions .E. coli, Pseudomonas aeruginosa (P. aeruginosa), Xanthomonas oryzae pv. oryzae (Xoo) strain GZ 0003, Pseudoalteromonas nigrifaciens, Klebsiella pneumoniae (K. pneumoniae), and Pseudomonas fluorescens [S. aureus, Bacillus subtilis (B. subtilis), and Listeria monocytogenes [ZnO NPs possess antimicrobial properties towards various species of gr\u2212 bacteria such as orescens , 42, 47 ytogenes , 21, 42.ytogenes . Therefoytogenes , 42.S. aureus and K. pneumoniae but are less effective against E. coli, Salmonella typhimurium, and B. subtilis than commercially available antibiotics. Therefore, coating materials loaded with ZnO NPs can inhibit the growth of bacteria over a period of time.The antimicrobial activity of the synthesized ZnO NPs is usually determined using common antibiotics such as Chloramphenicol, Ampicillin, and Gentamycin, to study the effectiveness of materials in these properties. According to previous studies , 31, matCandida albicans  and Aspergillus Niger  [A. Niger (black mould) and Fusarium solani, was almost negligible, which contradicts the former statement. These results may vary from one another due to the synthesis methods, the type of fungus, and the size of the NPs used.Apart from bacteria, ZnO NPs also show significant antimicrobial activity against fungi species such as k mould) , 36. Afsk mould)  found thk mould) .  Figure2+ ions in cells, and disrupts the cell membrane with electrostatic forces [Chlorella, Amphora, and Arthrospira that were deposited on the antifouling paint and left for 30 days in sea and freshwater. Al-Naamani et al. [Navicula sp and found that coatings with ZnO NPs particle sizes ranging between 50 and 60\u2009nm possess good antidiatom activity. Apart from antimicrobial potential, ZnO NPs are also reported to have the ability to act as antiviral agents.Other than bacteria and fungi, ZnO NPs can also inhibit the growth of algae species. The interactions between NPs and algae are similar to its interactions with bacteria, in which it generates ROS, accumulates ZnO NPs or Znc forces . Accordic forces , coatingi et al.  synthesi2+ ions into virus cells and (ii) the formation of free radicals from ZnO NPs [Viruses such as influenza A, H1N1, human papilloma virus (HPV), and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) can be transferred from one host to another via aerosolized particles and droplets on surfaces . Therefo ZnO NPs . Recent  ZnO NPs  have con ZnO NPs , indicatP. aeruginosa, was used for the antimicrobial test as the amino acids present in P. aeruginosa are very similar to the spike receptor-binding domain (RBD) of SARS-CoV-2.El-Megharbel et al.  used ZnO2 NPs. As such, ZnO NPs have been added to surface coatings and films that contain other NPs to overcome the weakness of pristine NPs. For instance, Ag NPs are highly toxic to human cells and the environment as it releases Ag+ ions. Therefore, Nguyen et al. [2 NPs as ZnO NPs are biocompatible and have better photocatalytic activity, higher durability, and higher heat resistance than TiO2 NPs alone. Peighambardoust et al. [ZnO NPs possess better mechanical strength and antimicrobial potential than other NPs such as Ag NPs and TiOn et al.  immobilin et al.  integratt et al.  examinedt et al. .The integration of two or more antimicrobial NPs, by combining with ZnO NPs in a system, fosters bio-activity against infections and controls resistance of bacterial or fungal strains. For instance, the addition of different percentages of magnesium (Mg) dopants in ZnO NPs coatings on cotton has been found to vary the performance of ZnO NPs . IncreasCoating a material is an important part of ensuring that its performance, and aesthetics do not degrade easily . In receP. aeruginosa, S. aureus, and E. coli. Meanwhile, chitosan NPs loaded with ZnO NPs have also been used as food packaging to reduce the release of excessive Zn2+ ions into food. Fruits and vegetables such as oranges, apples, carrots, and broccoli are commonly required good food packaging to prevent the growth of bacteria and mould that could deteriorate the freshness of these foods. According to previous literature [2) groups in the chitosan as well as the presence of the bio-active components of azadirachtin in the neem oil.Although the FDA has deemed macrosized ZnO safe, ZnO NPs are highly toxic to humans and are a major concern that requires alternatives to overcome the toxicity issue . Howeverterature , the fooApart from food packaging, ZnO NPs are also useful in the textile industry, especially for biomedical applications, as they could potentially control antimicrobial activities and protect the surface of textiles from microorganisms. The application and functionality of ZnO NPs in the textile industry is discussed in the next subtopic.E. coli [The use of ZnO NPs in the textile industry is increasing due to its unique properties such as hydrophobicity, UV protection, self-cleaning, and antimicrobial activity , which cE. coli , 22, 31.\u2212 groups, they are easily stained by liquids that eventually lead to bacterial growth. Recently, ZnO NPs have been reported to create superhydrophobic surfaces on cotton fabrics via the Lotus effect [Cotton is generally used in daily life due to its softness and affinity to skin , 98. As s effect , 100. Wos effect . The ants effect . This isFurniture, decorations, and walls are familiar surfaces in homes that could harbor and support the growth of microorganisms such as fungi, viruses, and bacteria, especially in moist environments. Wood such as maple and rubber wood are popular choices of materials for furniture and decorations in homes. However, they are easily exposed to the formation of fungi and bacteria. Therefore, the addition of ZnO NPs into resin coatings such as varnish could improve the quality of wood surfaces as ZnO NPs are less pigmented, hydrophobic, and self-cleaning, which is favoured in painting applications as the coating needs to be transparent, restrict moisture penetration as well as require only a few cleanings . Paints Antifouling agents are important in the marine industry as the presence of foulants such as marine algae and bacteria can degrade mechanics and aesthetics of infrastructure. For instance, an increase in the growth of microorganisms on the hull of ships can contribute to decreased vessel performance such as slower speed and higher fuel consumption , 103. ThC. albicans (white mould), fungus, and dirt as well as provide a UV protective barrier. Protective coatings such as paper varnish could also be blended with ZnO NPs to preserve coloured oil paintings in museums for a longer period of time [A. niger (black mould) on stone monuments by tenfold [The preservation of old manuscripts and buildings are necessary to restore culture heritage sites. As such, ZnO NPs are widely used in the preservation industry due to their resistance to microorganisms and its self-cleaning ability \u2013109. As  of time . Additio of time \u2013113. Mor tenfold . As seenAt present, the paint industry has extensively explored the integration of nanotechnology to maintain the conditions and properties of material surfaces. Therefore, utilizing ZnO NPs in surface coatings and films has greatly contributed to various applications such as paint, textiles, and food packaging, to name a few. The incorporation of ZnO NPs in biopolymeric materials via green approaches has attracted significant attention among researchers in the hope of sustaining the environment. Therefore, future studies may use natural materials to synthesize ZnO nanocomposite coatings without removing the natural synthesizing agent. For instance, palm olein (PO), a natural polymer, has been found to be able to synthesize ZnO NPs as NPs are amorphous and possess potential biodegradable chemical compositions . As PO iParameters such as material type, method of use, temperature, and reaction time should be taken into consideration to control the adhesion performance and quality of ZnO NPs. The use of polymeric nanomaterials with stable encapsulating properties and biocompatibility is favoured to maintain the features and values of ZnO NPs. As most natural-based biopolymers contain \u2212H groups that facilitate surface modifications that improve the properties of nanocomposites, it birthed the idea of using green materials to encapsulate ZnO NPs so that these eco-friendly materials have the potential to prevent the SARS-CoV-2 virus . Neverth2+ ion leaching. It is strongly recommended that future studies examine assimilating bio-sources or waste into ZnO NPs and coating and film solutions to support green technologies. As most of the biopolymeric materials available for surface coatings and films have inadequate mechanical properties to replace nonsustainable materials, ZnO NPs are an excellent filler that can enhance this physical behaviour. It is hoped that this review spurs the exploration of ZnO NPs in coating materials and films, especially natural-based, so that more emerging research on sustainable bio-composites will be published.In conclusion, ZnO NPs hold great potential as surface coatings and films due to their ability to blend with polymeric solutions. Apart from excellent antimicrobial activity against bacteria, fungi, algae, and viruses, ZnO NPs are also highly durable in external conditions such as UV, friction, and humidity, which is vital for coating and film applications. The addition of ZnO NPs in polymer matrices seems to be an effective way of overcoming issues such as agglomeration and Zn"}
+{"text": "Food additive zinc oxide (ZnO) nanoparticles (NPs) are widely used as a Zn supplement in the food and agriculture industries. However, ZnO NPs are directly added to complex food-matrices and orally taken through the gastrointestinal (GI) tract where diverse matrices are present. Hence, the dissolution properties, interactions with bio- or food-matrices, and the ionic/particle fates of ZnO NPs in foods and under physiological conditions can be critical factors to understand and predict the biological responses and oral toxicity of ZnO NPs. In this review, the solubility of ZnO NPs associated with their fate in foods and the GI fluids, the qualitative and quantitative determination on the interactions between ZnO NPs and bio- or food-matrices, the approaches for the fate determination of ZnO NPs, and the interaction effects on the cytotoxicity and oral toxicity of ZnO NPs are discussed. This information will be useful for a wide range of ZnO applications in the food industry at safe levels. Zinc oxide (ZnO) is widely applied to the food industry as a Zn supplement, nutrient fortifier, and agricultural fertilizer due to the role of Zn in various biological functions including cell division, cell growth, immune function, enzyme activity, DNA synthesis, and protein production . Zn is aNanotechnology development has led to the production of nano-sized ZnO particles possessing different physicochemical properties such as small constituent particle size 1\u2013100 nm), large surface area to volume ratio, and high reactivity compared with bulk-sized ZnO . A highe0 nm, larIn this review, recent studies on the dissolution properties and ionic/particle fates of ZnO NPs in simulated food-matrices and commercial processed foods as well as in vitro, ex vivo, and in vivo digestion systems are discussed. Methodological approaches for the fate determination of ZnO NPs in complex foods, cells, and biological systems, the characterization on the interactions between ZnO NPs and bio- or food-matrices, together with the interaction effects on cytotoxicity and in vivo oral toxicity, are summarized. These aspects should be essentially considered for a wide range of application of ZnO NPs in the food industry at safe levels.Many reports have demonstrated that ZnO tends to dissolve under aqueous, acidic, and biological conditions ,19,20,21ZnO is considered to be insoluble in water, but highly soluble in acidic solutions where the pH ranges from 2 to 4 ,25. Such4CO3(OH)6\u00b7H2O or Zn3(PO4)2\u00b7xH2O (x = 2 or 4) from the Zn ions in the cell culture media containing the carbonate and phosphate anions necessary for buffer capacity [The solubility of ZnO NPs in the GI fluids can be different from the digestion systems tested. The dissolution levels of ZnO NPs were reported as not being consistent, depending on the in vitro digestion systems applied such as a single digestive fluid , a three-step digestion system , and a semi-closed dynamic digestion system  . Jung etcapacity . The lowcapacity .Another important aspect to be considered is that food additive ZnO NPs are directly added to complex foods composed of various components including proteins, carbohydrates, lipids, minerals, vitamins, and other additives. Moreover, some food-matrices have acidic or alkaline pH in aqueous solutions, which critically affect the dissolution property and fates of the ZnO NPs ,37. HencThe solubility results under different conditions are summarized in NPs after oral intake encounter harsh biological environments such as the GI tract where low pH, many enzymes, diverse bio-matrices, and immune systems are present. Interactions between the ZnO NPs and the matrices occur to some extent, which may cause changes in the physicochemical properties, fates, biological responses, and oral toxicity of the ZnO NPs. The interactions between the ZnO NPs and bio-matrices and their impact on biological responses have recently been explored ,40. IndeKathiravan et al. and Bhunia et al. reported the formation of a stable BSA-ZnO NP corona associated with the conformational change or unfolding of BSA interacting with ZnO NPs ,45. BukaThe interactions between the ZnO NPs and food-matrices have not been relatively well investigated, although food additive ZnO is directly added to processed foods containing diverse matrices. Saccharide is one of the most abundant components in foods. ZnO interactions with various types of saccharide-based food-matrices were quantitatively analyzed including acacia honey composed of several saccharides  and other trace nutrients , sugar mixtures , and monosaccharide solutions  by high performance liquid chromatography . The resFood protein\u2013ZnO NP interactions were also investigated with complex protein food-matrices, skim milk , and simple a protein matrix, casein, showing significant changes in the hydrodynamic diameters and zeta potentials of ZnO NPs, an increase in the fluorescence quenching ratios of the proteins, and the structural conformational changes of the proteins by the interactions . The conIn this context, various dispersing agents for NPs are based on bio- or food-matrices. Indeed, glucose, BSA, fetal bovine serum (FBS), carboxymethyl cellulose, and other bio-or food-matrices have been extensively used to disperse NPs for biological applications. A decrease in the hydrodynamic diameters of ZnO NPs in the presence of such dispersants was generally observed, inhibiting the formation of the agglomeration or aggregation of NPs ,52. Mei\u00dfThe most critical point to be considered for the toxicity of food additive ZnO NPs is that the particles are present in intact nano-sized particles, agglomerates/aggregates, or decomposed/ionic forms when they are applied in foods and orally taken. If the ZnO NPs do not contain a fraction of NPs , extended toxicity evaluation recommended for NPs is not further necessary, rather a guidance for conventional materials is sufficient . In otheIn the actual state, the determination and detection of ZnO NPs as particles without any deformation in processed foods and biological systems are challenging. Inductively coupled plasma (ICP)-atomic emission spectroscopy (AES), ICP-mass spectrometry (MS), and atomic emission spectroscopy are widely applied to determine metallic NPs. However, these methods require harsh digestion conditions including acid and heat treatments to completely digest the organic matrices, thereby leading to Zn release from the ZnO particles. Moreover, the instruments are designated to qualitatively and quantitatively measure the atomic concentrations, and thus the total ionized Zn levels can be determined after Zn ion release from the ZnO particles . RecentlA surfactant, Triton X-114 (TX-114)-based cloud point extraction (CPE) approach was recently developed to detect ZnO NPs as intact particle forms in complex systems such as commercial foods and human intestinal cells . The CPEThe toxicity mechanism of ZnO NPs in biological systems cannot be simply understood because they dissolve in aqueous biological fluids to a certain degree. ZnO NPs have been well reported to be internalized into cells by the endocytosis mechanism, an energy-dependent particle uptake, localized in organelles such as lysosomes, and finally decomposed into Zn ions ,66,67. TAnother important point to be addressed is whether the released Zn ions from the ZnO NPs remained in their ionized forms or not, without re-forming the crystalline phase with the other ligand molecules massively present in the body. Gilbert et al. demonstrated that ZnO NPs can be taken up by cells in the particle form and completely dissolve inside the cells, generating intracellular Zn ions complexed with molecular ligands by high resolution X-ray spectromicroscopy and high elemental sensitive X-ray microprobe analysis . A time-On the other hand, manufacturing processes such as heating, cooling, mixing, and coating can also influence the particle or decomposed fates of NPs. Until now, little information is available on the presence and fate of ZnO particles in foods. The ionic or particle fates of ZnO particles in Zn-fortified commercial foods where ZnO additions are indicated as labeled were investigated using the TX-114-based CPE approach . The res2) and titanium dioxide (TiO2) has been reported, probably related to the high toxicity of Zn [2 > TiO2, whereas the structural stability of BSA decreased in the order of the presence of TiO2 > SiO2 > ZnO [The toxicity of ZnO NPs is generally accepted to be associated with the released Zn ions from the particles and the generation of reactive oxygen species (ROS), suggesting an important role of the dissolution levels in the toxicity under physiological conditions ,73,74. Tty of Zn . On the ty of Zn . Anders ty of Zn . Janani ty of Zn . PrecupaO2 > ZnO . In otheO2 > ZnO . It is sFood-grade albumin from chicken egg reduced the hydrodynamic diameter of ZnO NPs , causing increased cell growth inhibition, membrane damage, and ROS generation at high concentrations of ZnO NPs (125\u2013500 \u03bcg/mL) compared with the ZnO NPs in the DW or cell culture medium in the human intestinal Caco-2 cells . The stuOn the other hand, the toxicokinetics and oral absorption of ZnO NPs have been reported to be affected by the interactions. Among the saccharides including honey, a sugar mixture, fructose, and glucose, the ZnO NPs in glucose significantly enhanced the oral absorption (13.4%), followed by the order of ZnO NPs in fructose (9.6%) > sugar mixture (8.2%) > DW and honey (~7.0%) after a single-dose oral administration in rats . ZnO NPsFood additive ZnO NPs are added in complex food-matrices and orally taken, and thus a comprehensive understanding of their characteristics and fates in processed foods and in the body is required to understand and predict their potential toxicity and toxicity mechanism. ZnO NPs can dissolve into Zn ions in food-matrices and the GI fluids to some extent, related to the low pH and NP interactions with the matrices. However, the question as to whether ZnO NPs completely decompose into Zn ions or re-form a crystalline phase with other molecular ligands present in the intestine and tissues remains to be answered. The formation of ZnO NPs in living organisms in nature also needs to be elucidated. The detection of ZnO NPs as intact particle forms in complex bio- or food-matrices is also challenging. The toxicity and biological responses of ZnO NPs seem to be associated with both the ZnO particles and released Zn ions. The current available information suggests that the interactions between the ZnO NPs and bio- or food-matrices can modulate the cytotoxicity and cellular uptake of ZnO NPs in cell lines. The interactions can enhance the oral absorption of ZnO NPs after a single-dose administration, but may not affect acute oral toxicity. However, the increased absorption effect on the oral toxicity of ZnO NPs after long-term use must be confirmed. Future perspectives that remain to be answered to ascertain the safety aspects of food additive ZnO NPs are listed in"}
+{"text": "Theropithecus gelada), primates endemic to the Ethiopian highlands. We tested whether neopterin captures age-related variation in inflammation arising from developing immunity in infancy and chronic inflammation in old age, inflammation related to intramuscular tapeworm infection, helminth-induced anti-inflammatory immunomodulation, and perturbations in the gastrointestinal microbiome. We found that neopterin had a U-shaped relationship with age, no association with larval tapeworm infection, a negative relationship with metrics related to gastrointestinal helminth infection, and a negative relationship with microbial diversity. Together with growing research on neopterin and specific diseases, our results demonstrate that urinary neopterin can be a powerful tool for assessing multiple dimensions of health and disease in wildlife.Neopterin, a product of activated white blood cells, is a marker of nonspecific inflammation that can capture variation in immune investment or disease-related immune activity and can be collected noninvasively in urine. Mounting studies in wildlife point to lifetime patterns in neopterin related to immune development, aging, and certain diseases, but rarely are studies able to assess whether neopterin can capture multiple concurrent dimensions of health and disease in a single system. We assessed the relationship between urinary neopterin stored on filter paper and multiple metrics of health and disease in wild geladas ( More recent research has begun to develop noninvasive markers of the immune response, including those that can be readily measured in urine such as C-reactive protein, soluble urokinase plasminogen activator receptor (suPAR), and neopterin11. Among these urinary biomarkers, neopterin has been increasingly implemented in studies of wildlife health and disease19.Ecological and evolutionary studies of health and disease in natural settings require the implementation of noninvasive diagnostics. These noninvasive diagnostics can facilitate longitudinal monitoring of infectious diseases in wildlife, allow for the assessment of changes in health connected to climate change or other human-mediated environmental disruptions, and permit the study of physiological phenomena with minimal interruption to the study subjects. Indeed, a number of noninvasive tools have been developed over the past few decades, most of which focus on identification of a particular pathogen or community of pathogens through fecal- or urine-based analysis20, can reflect changes in generalized immune investment across the lifespan. High neopterin levels in adults may capture the chronic inflammation that accompanies chronological aging21, while high neopterin levels in infants may capture the T-cell helper (Th) 2-polarization of the developing immune system22. Studies that sampled humans, semi-wild mandrills, and captive and wild capuchins across the lifespan found a U-shaped relationship between neopterin and age, with the highest neopterin in the youngest and oldest individuals24. Concordantly, studies that sampled only adults found the highest neopterin in older individuals18 and those that sampled only non-adults found the highest neopterin in younger individuals14.Neopterin is a pteridine produced by interferon-gamma (IFN-y)\u2014activated macrophages and monocytes during the T-helper cell-mediated immune response, and is therefore expected to closely mirror systemic inflammation. Elevated neopterin levels, which are detectable at biologically meaningful and largely concordant levels in blood and urine28, as are infectious diseases that recruit the inflammatory immune response, including Plasmodium falciparum malaria, tuberculosis, SIV, and hepatitis A, B, and C30. Neopterin can also be a useful marker of infection progress, with levels tracking the severity of clinical symptoms in dengue fever31. Across primate studies, urinary neopterin levels have been associated with respiratory disease symptoms in captive bonobos15, deaths involving respiratory disease in wild chimpanzees32, SIV viremia in captive rhesus and long-tailed macaques11, and Plasmodium gonderi parasitemia in wild mandrills19. Neopterin might also be expected to capture other elements of health and disease\u2014for example, lower neopterin levels could reflect the regulatory and anti-inflammatory properties of chronic helminth infections35 while higher neopterin levels might capture tissue damage from migratory or intramuscular stages of parasite infections  or disruptions in microbiome communities that play a critical role in immune balance and regulation38. Because urinary neopterin is a recent contribution to the noninvasive diagnostics toolkit, few studies have been able to assess the relationship between neopterin and multiple metrics of health and disease in a single system.Elevated neopterin levels may also reflect immune activity related to autoimmune, noncommunicable, or infectious diseases. A number of autoimmune diseases, heart and kidney failure, and coronary artery disease are all associated with significant increases in serum neopterin levelsTheropithecus gelada), a cercopithecine primate endemic to the Ethiopian highlands. Specifically, we assess whether neopterin captures age-related variation in baseline inflammation, expecting to observe the highest neopterin in the youngest and oldest individuals. We also evaluate whether urinary neopterin captures (1) inflammation associated with the intramuscular larval tapeworm Taenia serialis, which infects wild geladas and causes protuberant cysts that substantially increase mortality40, (2) regulatory and anti-inflammatory effects of gastrointestinal parasite infection41, and (3) characteristics of the gastrointestinal microbiota that reflect dysregulation .As a contribution towards defining appropriate uses of urinary neopterin as a biomarker of inflammation or disease in wildlife, we investigated the relationship between urinary neopterin, demographic variables, and metrics of health, disease, and parasite infection in wild populations of geladas  under long-term study by the Simien Mountains Gelada Research Project and from another population between 2018\u20132019 in the Guassa Community Conservation Area  under long-term study by the Guassa Gelada Research Project. We additionally collected fecal samples for gastrointestinal parasite and microbiome characterization from the SMNP population  from the date of first sample collection. Samples were stored at room temperature until analysis, which ranged from 101\u2013985\u00a0days (mean\u2009\u00b1\u2009SD\u2009=\u2009534\u2009\u00b1\u2009304\u00a0days). In addition to samples collected from wild geladas, we collected urine samples from geladas at the Bronx Zoo (n\u2009=\u200914 samples from seven adults) in 2018 to assess the accuracy and integrity of samples on filter paper and compared to samples that were immediately frozen. Urine from both wild populations was collected from the ground immediately following urination with filter papers , which were stored in labeled Whirl\u2013Pak \u00a9 bags with\u2009~\u20091\u00a0g of silica desiccant, and urine from geladas housed in zoos was pipetted directly into microcentrifuge tubes and then pooled.We collected urine samples for urinary neopterin from SMNP geladas  between February 2018- March 2020 and from GCCA geladas  between September 2018- January 2019. We estimated dates of birth for adult females and males when known dates of birth were not available. We assigned estimated dates of birth for adult females by back-calculating from observed sexual maturation dates using the average age at maturation in geladas (4.65\u00a0years)R\u2009=\u20090.99, F\u2009=\u20090.72, p\u2009=\u20090.43) and from filter paper samples \u2009=\u20095.09, p\u2009=\u20090.07; Fig. Using a commercial neopterin ELISA kit , we first assessed parallelism between the kit-derived standard curve and two serial dilutions: one from a urine pool from the zoo gelada population and one from a urine pool from reconstituted filter paper samples from the SMNP population . Samples were correlated across storage media (frozen vs. filter paper), across time points , and across each measurement of interest . Because neopterin values are typically standardized to urinary creatinine to control for urine concentrationUrine samples collected from wild geladas were reconstituted in deionized water using a 1:12 dilution so that samples fell in the mid-range of the standard curve . Samples were then assayed for urinary neopterin and urinary creatinine with the kits described above. Neopterin intra-assay CVs were 13.3% and 12.2% for low (1.57\u00a0ng/mL) and high (4.90\u00a0ng/mL) kit controls, respectively, while inter-assay CVs were 14.7% and 11.2% for low and high kit controls (n\u2009=\u200927), respectively.46 and total rainfall in the 90\u00a0days before sample collection  as a proxy of food availability in this population47 that could modulate immunity49. We included scaled time of sample collection (as a proportion of the day) to control for potential diurnal variation and storage time to account for storage times that exceeded the length of storage experiments due to extenuating circumstances . Finally, we included individual ID and batch number for neopterin and creatinine as random effects. We assessed variance inflation factors to identify collinearity across our variables and found that all values were well below generally accepted thresholds . For all downstream analyses, we include only those predictors that were significantly associated with neopterin index in this primary model.To identify the broad demographic, environmental, and technical predictors of urinary neopterin, we modeled the effects of age (linear and quadratic), sex, and climatic variables on log-transformed neopterin index concentrations using a linear mixed model (LMM) in SMNP geladas . We elected to focus on samples from a single site to reduce any potential noise arising from cross-site comparisons and because GCCA samples only spanned several months in a single year, where SMNP samples spanned seasons over two years. We included variables based on our hypotheses and to capture potential sources of biological and technical variation. In the Ethiopian highlands, seasons are characterized by temperature and rainfall; thus, we included average minimum temperature in the 30\u00a0days  before sample collection to capture physiological changes related to cold stressT. serialis infection from the same filter paper samples assayed for urinary neopterin and urinary creatinine as described above. We included samples from the GCCA population in this analysis because of their relatively higher prevalence of T. serialis infections40. We determined T. serialis infection with a monoclonal antibody-based enzyme-linked immunosorbent assay following an established protocol validated for use in gelada urine1 with minor adjustments  and the GCCA population  were analyzed for nts Fig. .T. serialis diagnosis  on log-transformed neopterin indices using an LMM, predicting that infection would be associated with increased neopterin. We included variables that had significant explanatory power in the primary neopterin analysis  and sampling site  as fixed effects and included individual ID, neopterin and creatinine batch numbers, and Taenia assay number as random effects.We modeled the effects of positive 2. Our final dataset included a total of 15 amplicon sequence variants (ASVs) assigned at the genus level to either Trichostrongylus spp. or Oesophagostomum spp. with\u2009>\u200992% percent identity match. Given the low genus richness in geladas, we calculated the richness of ASVs  in each sample.Fecal samples from the SMNP gelada population collected from these individuals over the same time period were analyzed for gastrointestinal nematode parasites with high-throughput amplicon sequencing of the Internal Transcription Spacer 2 (ITS-2), which was previously validated for use in gelada fecal samples2, sample collection time, and sample storage time as fixed effects, and individual ID and neopterin and creatinine plate numbers as random effects.Urine samples were matched with all fecal samples from each individual over the year prior to urine sample collection to capture long-term patterns in chronic gastrointestinal parasite community structure and impact on inflammatory profiles, culminating in a dataset of 140 urine samples matched to 49 fecal samples from 32 individuals . We then assessed the relationship between gastrointestinal parasite ASV richness and log-transformed neopterin index using an LMM, predicting that higher richness would be associated with lower neopterin levels as a result of the helminth-induced anti-inflammatory immune phenotype. We included age, ageFecal samples from the SMNP gelada population (N\u2009=\u20091267) were analyzed for gut microbiome composition using 16S rRNA amplicon sequencing Fig. . We matcWe modeled the effect of age-adjusted alpha diversity . Three complementary metrics of beta diversity  would predict higher neopterin indices in the following month  and log-transformed neopterin index using LMMs, expecting that higher pathobiont abundance  and Stony Brook University (773805_TR002). This research conformed to the American Society of Primatologists/International Primatological Society Code of Best Practices for Field Primatology and the ARRIVE guidelines.p\u2009=\u20090.01), creatinine , and the neopterin index  measurements derived from frozen aliquots were correlated with those derived from the same samples dried on filter paper , but did not differ between 4 and 8\u00a0months of storage . However, sample measurements were still correlated across time points (0 vs. 4 vs. 8\u00a0months) for each measurement of interest . Most critically for our study, neopterin indices measured shortly after sample collection were correlated with those assayed after 8\u00a0months of storage on filter paper . Thus, degradation between zero and four months appears to have been generally consistent across samples and did not affect the rank order of samples. However, given that some samples were assayed more than 8\u00a0months after sample collection in the field, we included time to assay as a covariate in all applicable models.Neopterin  and four of 26 GCCA individuals (15.4%) had cysts at the time of sampling or developed a cyst within one year of sample collection.We found no association between neopterin index and ion Fig.\u00a0; Table 3Oesophagostomum spp. ASVs  or Oesophagostomum spp. (96.4%), and 94.3% were positive for both.We found a significant negative relationship between neopterin index and the richness of SVs Fig.\u00a0; Table 4SVs Fig. . Across Lower microbial alpha diversity was significantly associated with higher neopterin indices, and this pattern was consistent for all three metrics of alpha diversity: individuals with lower microbial ASV richness, evenness, and phylogenetic diversity had higher neopterin indices in the following month Fig.\u00a0. None ofOesophagostomum spp. amplicon sequence variants over the year prior to neopterin sampling had lower urinary neopterin, consistent with the expected anti-inflammatory phenotype induced by gastrointestinal parasites, while individuals with lower microbiome alpha diversity had higher urinary neopterin. Neopterin was not associated with larval tapeworm infection or environmental variables but was positively associated with time of sample collection and sample storage time. Altogether, these results suggest that urinary neopterin is a useful measure of innate immunity for certain metrics of health and disease throughout the lifespan in wildlife.Our results demonstrate that urinary neopterin captures variation in innate immunity related to age, gastrointestinal helminth infection, and gut microbiome alpha diversity in a wild primate. The youngest and oldest individuals in our dataset exhibited the highest neopterin levels, suggesting that urinary neopterin captures inflammation related both to the development of the immune system and to senescence. Individuals with a higher number of 23, free-ranging mandrills19, and capuchins24, and is consistent with the patterns found in other studies that sampled from only one end of the age distribution18. High neopterin levels in infancy likely reflect the immune system\u2019s first encounters with pathogens and parasites during the development of both innate and adaptive immune responses55, and high neopterin levels in old age likely arise from increased production of pro-inflammatory cytokines  during senescence53. While an alternative explanation for this pattern is that individuals with the ability to produce high levels of neopterin are more likely to survive than others56, this is unlikely based on the demonstrated effects of inflammation on mortality57. Urinary neopterin can thus be a useful tool for the study of wildlife health and disease by facilitating the noninvasive study of early-age immune development and old-age immunosenescence in wild animals.The U-shaped association between age and neopterin in geladas recapitulates the pattern found in humans60. In captive animals, no diurnal variation has been observed15, while our results point to yet an additional pattern: higher neopterin at later collection times. This may be because we are often unable to collect the first urine sample of the day as geladas sleep on and spend the first minutes of their mornings on steep cliffs. While we collected daily urine from 8:00am-4:30\u00a0pm, this points to the importance of collecting urine samples at similar times every day, particularly for accurate within-individual comparisons. Unlike neopterin in frozen liquid samples, which is stable at -20 \u00b0C for up to 24\u00a0months14, neopterin on dried filter paper samples stored at room temperature appears to degrade over the first four months. Despite these storage-related effects, the relative ranks of samples remained stable during our storage experiments. Although our actual sample storage time  exceeded the duration of our storage experiments (up to eight months) due to unavoidable and extenuating circumstances, most expected biological patterns were supported. Collectively, these results suggest that changes over time will not preclude comparisons but that storage time should be considered, and that the storage effects of filter paper may add noise but do not obscure the biological effects. While the effects of storage time on filter paper samples may potentially be mitigated by storing filter paper samples in a freezer15, this would undercut the benefits of filter paper collection at remote field sites without consistent access to electricity. Studies that implement neopterin in other species should, in addition to establishing parallelism and accuracy, evaluate the effects of these technical variables during validations and should consider assessing the relationship between age and neopterin as a metric of validation.Both time of sample collection and sample storage time were positively associated with neopterin levels, pointing to the importance of their consideration in studies that implement filter paper-based sampling. In humans, neopterin and other immune components tend to increase in production overnight, with maximum measurements taken in the early morningT. serialis infection because taeniid larvae develop intramuscularly and are initially met with an eosinophil-based immune response61. Our lack of observed effect may be tied to the progression of the immune response over the course of T. serialis infection. Geladas become infected with T. serialis after incidentally ingesting infectious eggs shed in the feces of a carnivore infected with the adult stage of the parasite, after which asexually budding larvae develop in the gelada musculature, viscera, or soma62. These asexually budding infections can occur all over the body and often present as protuberant and highly conspicuous masses in geladas39. However, infections can also develop internally1, making it difficult to estimate the stage of infection.As a product of white blood cells stimulated with a pro-inflammatory cytokine, neopterin is expected to reflect the activated cellular immune response in the face of pathogens that elicit inflammatory immune responses. We expected neopterin levels in geladas to be positively associated with 64. One potential explanation for the lack of association between T. serialis infection and neopterin in our study is thus that our sampling approach captures infections during both Th1-dominant and Th2-dominant periods, effectively precluding our ability to parse this relationship. Because our T. serialis infection positivity threshold is based on individuals with cysts, we are likely to have a detection bias towards established, chronic infections that may not recruit the innate immune response at all. Alternatively, neopterin may not be a robust measure of the inflammatory immune response to intramuscular tapeworms at any stage of infection, just as it is not a useful marker of superficial injuries that are expected to recruit strong white blood cell responses19.In lab studies of closely related taeniids, larval establishment is met immediately with a primarily pro-inflammatory Th1 immune response that is replaced over time with a more regulatory and anti-inflammatory Th2 immune response66, higher richness of unique sequences belonging to the gastrointestinal helminth genus Oesophagostomum over the year prior to urinary neopterin sample collection was associated with lower neopterin in geladas. Gastrointestinal helminths generally elicit Th2 polarized immune responses and initiate cascades of anti-inflammatory effector mechanisms, including the antibody-based immune response and regulatory T cell production, that facilitate their long-term establishment in hosts68. The Th2-polarized immune response blocks the expansion of the Th1 response, which includes the production of Th1 cells and their associated cytokines69. Principal among the Th1 cytokines suppressed by the Th2-polarized response is IFN-y\u2014the primary catalyst of neopterin production by monocytes and macrophages28. The presence of an effect of ASVs belonging to Oesophagostomum, and not for Trichostrongylus, may reflect differences in the immune responses to each parasite and demands further investigation. Altogether, these results suggest that increased chronic richness of particular gastrointestinal parasite sequences down-regulates the pro-inflammatory immune response in geladas by suppressing Th1 effector mechanisms.As anticipated based on the regulatory and anti-inflammatory immune phenotype induced by infection with gastrointestinal helminth parasites18 assessed the effect of antihelminthic treatment on urinary neopterin levels over a ten-week period (six weeks prior to treatment and four weeks following treatment) and found no discernible effect of presence/absence metrics of helminth parasitism on neopterin. By contrast, we assessed the effect of helminth ASV richness over the year prior to neopterin sampling. This difference in effect was despite the two species exhibiting equally high rates of strongyle-type infections, with 100% prevalence of strongyle infections  in geladas and 98% prevalence of strongyle infections (likely Oesophagostomum spp.) in macaques, with the addition of Capillaria and Trichuris sp. in the macaques. As the authors of the macaque study suggest, a single antihelminthic dose may not fundamentally alter the immunological phenotype induced by chronic helminth infection in wild animals. In addition, amplicon sequence variant richness or parasite load  may be more powerful metrics of gastrointestinal parasite community structure and associated immunological changes than presence/absence metrics.The anti-inflammatory effects of gastrointestinal helminth parasites may only be reflected in lower neopterin levels when measured longitudinally. The study on Barbary macaques71, few studies have examined the relationship between gut microbiome composition and biomarkers of innate immunity74. Here, we found that geladas with low gut microbiome diversity exhibited higher neopterin levels over the following month. However, the lack of relationship between neopterin and abundances of specific microbial taxa or overall microbiota composition  suggest that higher neopterin indices are not linked to broad alterations of the microbial community or to specific microbiota profiles in geladas but rather to a depletion in microbial richness.Despite the direct involvement of the gut microbiome in the production and activity of innate immune cells77. In humans and laboratory animals, depletion of gut microbial diversity has been associated with immune dysregulation and chronic inflammation82 and higher susceptibility to infection84. Low microbial diversity in geladas may, for example, lead to a reduction in the production of anti-inflammatory microbial metabolites at the mucosal barrier  and allow for the proliferation of pro-inflammatory immune cells or otherwise catalyze an elevated pro-inflammatory response86 that would result in higher neopterin levels following low microbial diversity. Alternatively, the relationship between microbial diversity and neopterin in geladas could be the product of a complex three-way interaction between the immune system, the microbiome, and parasites, as gut microbes and helminths interact in overlapping ecological niches and the outcome of this interaction can influence the host immunological phenotype90.The association between lower microbiome diversity and higher neopterin levels in geladas may reflect the immunological consequences of microbiome disruption. The gut microbiome is a key regulator of immune homeostasis and participates in the polarization of the immune responseAltogether, our results demonstrate that urinary neopterin can be used for the non-invasive assessment of wildlife health and disease by measuring innate immune activity related to age, gastrointestinal helminth parasitism, and microbiome composition. We found that (1) very young and very old individuals had the highest neopterin levels, a pattern which may only be discernible if a study design includes adequate sampling across demographic categories, (2) very fine measures of chronic gastrointestinal helminth parasitism were associated with downregulated neopterin levels, and (3) lower microbiome diversity was associated with higher neopterin levels. In concert with other research that has shown the value of urinary or serum neopterin in predicting deaths from viral infections or reflecting viremia, our results suggest that urinary neopterin is an appropriate metric for assessing certain types of diseases  but not others . As anthropogenic activity continues to fragment habitats and alter the immunological and physiological phenotypes of wild animals, urinary neopterin will be a powerful tool for non-invasive assessment of health and disease in wildlife.Supplementary Information 1."}
+{"text": "Unemployment is considered to be one of the most stressful life events that a person may experience. There are a plethora of studies that highlighted the negative effects of unemployment on people\u2019s overall mental health and well-being. Yet, psychological resilience and self-compassion contribute positively in coping with stressful situations and seem to be particularly supportive mechanisms when one is confronted with unemployment.This study intended to investigate the relationships between resilience, self-compassion and mental health in Greek unemployed people and the contribution of specific sociodemographic characteristics in this \u2018equation\u2019.The study followed a survey design where a sample of 345 Greek unemployed participants completed an online questionnaire, examining the variables under study.According to the findings, people who reported being unemployed for more than six months showed decreased levels of mental health. Also, the unemployed with higher levels of resilience and self-compassion reported statistically significant higher levels of mental health and vice versa. Finally, self-compassion and psychological resilience were found to be statistically positive related to each other and are predictive factors of mental health with which they are statistically negative related.The results of this study may contribute to the implementation of interventions aiming at improving mental health and the overall well-being of people affected by long-term unemployment.No significant relationships."}
+{"text": "Clostridioides difficile colitis (CDI) by searching the following keywords in Embase, MedLine, and PubMed: \u201cClostridium/Clostridioides difficile\u201d, \u201cco-infection\u201d, \u201cblood-stream infection\u201d (BSI), \u201cfungemia\u201d, \u201cCandida\u201d, \u201cCytomegalovirus\u201d, \u201cprobiotics\u201d, \u201cmicrobial translocation\u201d (MT). Bacterial BSIs (mainly by Enterobacteriaceae and Enterococcus) and fungemia  may occur in up to 20% and 9% of CDI, increasing mortality and length of hospitalization. Up to 68% of the isolates are multi-drug-resistant bacteria. A pivotal role is played by gut dysbiosis, intestinal barrier leakage, and MT. Specific risk factors are represented by CDI-inducing broad-spectrum antibiotics, oral vancomycin use, and CDI severity. Probiotics administration (mainly Saccharomyces and Lactobacillus) during moderate/severe CDI may favor probiotics superinfection. Other co-infections  can complicate limited and specific cases. There is mounting evidence that fidaxomicin, bezlotoxumab, and fecal microbiota transplantation can significantly reduce the rate of co-infections compared to historical therapies by interrupting the vicious circle between CDI, treatments, and MT. Bacterial BSIs and candidemia represent the most common co-infections in CDI. Physicians should be aware of this complication to promptly diagnose and treat it and enforce preventive strategies that include a more comprehensive consideration of newer treatment options.We narratively reviewed the physiopathology, epidemiology, and management of co-infections in  Clostridioides difficile  is a spore-forming, obligate anaerobe, Gram-positive bacterium found in the intestinal tract of both humans and animals, from where its spores are shed in the environment and survive in variable and extreme conditions [nditions . Cdiff inditions . The Eurnditions . An imponditions . Howevernditions .Differently from the status of an asymptomatic carrier, the clinical spectrum of CDI may range from mild diarrhea to severe and life-threatening fulminant colitis with well-recognized complications such as sepsis, toxic megacolon, and perforation. Transmural pancolitis that may require emergency segmental or total colectomy has been reported . The oveClostridioides spp.There are several well-known risk factors involved in the acquisition of Cdiff and in the development of CDI, including admission to healthcare facilities, older age, gastric acid inhibition/reduction, comorbidities such as inflammatory bowel disorders, and most notably, broad-spectrum antibiotic use. Exposure to clindamycin, fluoroquinolones, and beta-lactam/beta-lactamase inhibitor combinations has been associated with the highest risk as compared to macrolides, sulfonamides, and penicillin . On the Strongyloides stercoralis hyperinfection or severe Dengue has already been detailed [In view of the severity and mortality related to CDI, it is fundamental to be familiar with any factors that may further affect the burden of this severe cause of increased in-hospital mortality and prolonged hospitalization. A potential frightening complication of CDI is the development of concurrent or subsequent infections due to a large spectrum of microbial entities, including other bacteria, viruses, and fungi. The contribution of microbial translocation to co-infections occurrence in other infectious diseases such as detailed ,15. LittClostridium/Clostridioides difficile\u201d, \u201cco-infection\u201d, \u201cblood-stream infection\u201d, \u201cfungemia\u201d, \u201cCandida\u201d, \u201cCytomegalovirus\u201d, \u201cprobiotics\u201d, and \u201cmicrobial translocation\u201d. In this narrative review, we provided a summary of the existing evidence on concurrent and subsequent co-infections associated with CDI trying to describe the overall burden and mechanisms of this phenomenon, to assess whether co-infections have a relevant impact on the outcomes and management of patients suffering from CDI, and to provide some practical clinical considerations.We searched for articles indexed in Embase, MedLine, and PubMed and published in English up to January 2022 by using the following keywords: \u201cIt is well established that the hematogenous translocation of bacteria residing in the gut is favored by some conditions: the loss of integrity of the intestinal mucosal barrier, the alterations of mucosal immunity, and the colonization of gut by overgrowing pathogens. During CDI, all these mechanisms take place along with an important mucosal inflammatory response . Cdiff tBacteroidetes and Bifidobacterium spp. play an important role in the mechanism of resistance to Cdiff colonization. Lower concentrations of Bacteroidetes and higher relative amounts of Firmicutes and Proteobacteria were found in the gut of patients with CDI compared to controls [While human data are scarce, murine models have already described a potential role of all these Cdiff-induced intestinal alterations in favoring microbial translocation and subsequent BSIs . It has controls . Similarcontrols . Furthercontrols .Despite all these possible mechanisms involved in BSI development, the incidence and impact of BSIs complicating CDI have not been properly characterized to date. In Candida spp, Enterobacteriaceae, and Enterococcus spp.), and 68.4% of the microbial isolates were MDR. Thirty-day mortality was significantly higher in the CDI plus BSI group compared to the CDI-only group (38.9% vs. 13.1%), as well as the incidence of intensive care unit (ICU) admission and longer hospitalization length. Higher oral vancomycin dosage (>500 mg/day), infection by Cdiff ribotype 027, Cdiff recurrence, and severe colitis were found to be independent risk factors for HA-BSI [Falcone et al. described for the first time a significant association between CDI and subsequent HA-BSI . In thisr HA-BSI . n = 59) of patients with acute leukemia [Similarly, in a study investigating non-staphylococcal BSIs in relation to the time from the first Cdiff-positive fecal sample, bacteremia from unrecognized sources (occult BSI) occurred more frequently from 3 days before to 10 days after Cdiff toxin positivity compared to the pre-Cdiff period. Of note, during the Cdiff period, positive blood cultures were characterized by a greater percentage of enterococci (50%), and the majority of occult BSI resolved without treatment . In lineleukemia . On the leukemia ,29.Enterococcus and Klebsiella spp. were the most common bacterial isolates (14% for both) [Conversely, another group observed only 86 cases of BSIs in a cohort of 570 patients with CDI (7.6%). or both) . Patientor both) . In oppoor both) . SubjectCdiff bacteremia is also possible , and in Mortality in CDI is likely multifactorial. It is possible that concurrent bacterial translocation contributes to this, but it is hard to precisely estimate its effect, considering that BSIs seem to mainly complicate the more severe CDI only. Considering that both CDI infection and subsequent BSIs represent complex interactions between pathogens, host, native microbiota, and its perturbations and that most risk factors for CDI and BSI due to gut translocation overlap, further studies are needed to investigate this relationship and plan strategies to prevent BSIs in high-risk patients. In the latest guidelines on the management of Cdiff in adults released by the Infectious Diseases Society of America (IDSA) and the Society for Healthcare Epidemiology of America (SHEA), as well as in the latest from the European Society of Clinical Microbiology and Infectious Diseases (ESCMID), fidaxomicin is suggested as the preferred agent for initial CDI and for the first recurrent episode ,33. FidaCandida spp. in blood, and it is invariably a pathological condition that requires proper evaluation, prompt treatment, and risk factor management as it cannot ever be considered a simple contamination. Candidemia is defined as the presence of Candida spp. is part of the normal gut microbiota, and translocation through the gastrointestinal wall is probably the most common mechanism by which Candida spp. enters the blood-stream in fragile patients, such as neutropenic subjects or those admitted to ICUs. The physiopathology behind the occurrence of candidemia in CDI should be the same as the one underlying bacterial BSIs. Raponi et al. have highlighted how CDI can predispose to Candida spp. overgrowth and its subsequent spread into the blood. In this prospective case-control study, they found that CDI was significantly associated with gut colonization by Candida spp. (83% in CDI-positive vs. 67% in CDI-negative), with Candida albicans being the species most often implicated [Candida spp. and Cdiff. As for CDI-associated antibiotics, Nerandzic et al. analyzed the differences in the alterations of intestinal flora following different antibiotic treatments for CDI. After fidaxomicin treatment, there was a significant reduction in the risk of colonization by VRE or in the overgrowth of Candida spp. compared to patients receiving oral vancomycin; a finding likely attributable to the different spectrum of activity on the intestinal anaerobic flora [Candida spp. overgrowth can modulate the susceptibility to CDI. In an experimental animal study, after oral inoculation of Cdiff spores, a lower rate of death due to CDI was observed in infected mice pre-colonized with C. albicans compared to those without. The subsequent growth of Cdiff in the gastrointestinal tract, the production of its toxins, and the presence of inflammation and tissue damage were similar in both groups, but the expression of specific inflammatory cytokines (such as IL-17A) in the infected tissues differed  [Lactobacillus rhamnosus [C. albicans, Cdiff was able to thrive at ambient oxygen levels when co-cultured with C. albicans, and it could secrete a compound with inhibitory activity against two virulence factors of C. albicans that modulate the transition from yeast (the invasive form) to hyphae and biofilm formation [Candida spp. may occur and which are the resulting consequences to the host, as apparently discordant preliminary data point towards enhanced severity of the clinical co-infectious episode, but also to a concurrent increase in Candida spp. invasiveness and reduced virulence in the presence of actively replicating Cdiff.plicated . Once agic flora . On the da spp.) . On the da spp.) . In thishamnosus . In anotormation . TherefoCandida spp. seems to be the single most common microbial isolate in blood during CDI, and the prevalence of candidemia following CDI varied considerably among studies (0.8\u20138.6%), but co-infection is associated with substantially increased mortality [Overall, ortality . Candideortality . This maortality . Similarortality . TherefoCytomegalovirus (CMV) infection is an important cause of morbidity and mortality among immunocompromised patients in contexts such as organ transplantation, chemotherapy, inflammatory bowel diseases (IBD) receiving immunosuppressive agents, and HIV infection [nfection . Gastroinfection .Like the clinical manifestations of CDI, CMV colitis can manifest with symptoms such as diarrhea, abdominal pain, weight loss, intestinal bleeding, or fever and lead to complications such as toxic megacolon or even bowel perforation. Despite the aforementioned non-traditional risk factors for CMV colitis  very few cases of this co-infection have been reported to date, so the incidence of this phenomenon cannot be inferred. Nevertheless, in the context of IBD, a close relationship between disease flares and CMV replication has been documented as gut inflammation seems to favor herpetic reactivation from compartmentalized intestinal sites of latent infection . The mecFew cases of CMV colitis following successful therapy for CDI have also been described: one patient admitted to ICU had colic ulceration due to CMV colitis three weeks after the resolution of a properly treated CDI, while a second elderly case showed CMV colitis as the cause of persisting bloody diarrhea at the end of oral vancomycin treatment for CDI . Although the co-infection of Cdiff and CMV seems to be a rare entity, considering the synergistic activity of these pathogens in increasing the risk of lethal intestinal perforation and toxic megacolon, clinicians should have a high index of suspicion to rule out CMV reactivation even in immunocompetent hosts, especially when other comorbidities or refractory disease are observed. Salmonella spp., Cryptosporidium spp., Giardia spp., Enterocytozoon spp., and Campylobacter spp. have been described both in community and hospital-acquired cases of CDI [Co-infections with other enteric pathogens such as s of CDI ,50. In as of CDI .Entamoeba histolytica and Cdiff may present with similar clinical features or endoscopic findings and considering that empiric use of metronidazole for colitis treatment is widely practiced in low- and middle-income countries without testing for infectious causes, it may be speculated that amoebiasis is over-diagnosed and Cdiff infection underestimated as the latter is seldom considered and probably treated unknowingly with metronidazole [Very few data are available about the co-infection of Cdiff with other common intestinal parasites. For instance, nidazole . Existinnidazole . ConsideGiardia lamblia and Cdiff was described in a 49-year-old man taking ranitidine [Co-infection with Cdiff and other gastrointestinal pathogens may also be common in children suffering from diarrhea, with a reported pooled rate of co-infections of 20.7% in Cdiff-positive children . Viral cnitidine . In anotnitidine . Due to Probiotics may play a role in the prevention of CDI by several mechanisms, including colonization resistance through maintaining a healthy gut flora, enhancing the clearance of Cdiff at the end of treatment, and inactivating the toxin receptor sites before the germination and growth of spores in the colon . NeverthLactobacillus spp.) were more likely to develop CDI compared with those who did not receive probiotics (HR 2.7) [A Cochrane meta-analysis of 39 randomized clinical trials concluded that probiotics reduce the incidence of CDI by 70% in adult and pediatric patients undergoing antibiotics for any reason, providing moderate quality of evidence in support of probiotics use in preventing Cdiff colitis. Post hoc analysis indicated that probiotics actually show preventive efficacy in patients with at least mild-moderate baseline risk of CDI and no benefit for subjects characterized by low risk . Convers(HR 2.7) . Similar(HR 2.7) .Saccharomyces cerevisiae fungemia have been reported in patients with a history of probiotic use [S. cerevisiae or Lactobacillus rhamnosus fungemia/bacteremia when probiotics containing such microorganisms were administered during CDI. In the latter case, bacteria could have been selected by the prolonged oral vancomycin therapy the patient received along with live yogurt as the administered probiotic  [Lactobacillus spp. have been reported in neutropenic patients after oral vancomycin [It is also recognized that these preparations, containing living microorganisms, can uncommonly cause different forms of invasive infections, particularly in critically ill or severely immunocompromised patients. Cases of otic use . Furtherotic use . As for otic use . In linecomycin) . Accordincomycin .While probiotics may play a role in preventing CDI in patients at risk that have not yet developed the infection, the administration of probiotics during overt and ongoing Cdiff colitis is therefore controversial and may be risky. Since the combination of enhanced intestinal permeability, altered gut microbiota, and immunosuppression is present in a large proportion of patients affected by CDI, the use of probiotics in this setting should be further evaluated to properly balance risks and benefits, especially when an extended duration of vancomycin is administered.Firmicutes spores, to patients healed from a third or further episode of CDI (after standard-of-care antibiotic treatment) reduced the relative risk of recurrent infection by about 70% compared to placebo [Finally, after a severe episode of CDI, immunological perturbations and cell damage in the intestinal mucosal barrier can occur and persist for several weeks . This fu placebo . The stuFecal microbiota transplantation (FMT), defined as the transfer of fecal microorganisms from healthy donors into the gut of recipient patients, has been associated with robust efficacy in the treatment of rCDI . One or Recent data suggest that FMT may be an alternative to antibiotic therapy also in the first CDI episode. In a small trial investigating the efficacy of FMT as a treatment for primary CDI, a clinical cure after initial treatment with no evidence of recurrence was achieved in seven patients in the transplantation group (78%) as compared with five in the metronidazole group (45%) . AdditioInterestingly, in a nonrandomized prospective single-center study, compared to antibiotics use, FMT reduced by 23% the incidence of BSIs in rCDI . A higheFirmicutes bacteria induced by antibiotics leads to increased primary bile-acid concentrations, which on the contrary, enables Cdiff spore germination [Another possible favorable mechanism of prevention of co-infection operated by FMT is represented by the modulation of fecal bile acid composition; secondary bile acids, which are products of microbial metabolism, have been shown to inhibit Cdiff germination, growth, and toxin activity. The loss of beneficial mination . Further studies are warranted to assess the potential multiple properties and mechanisms by which FMT may affect intestinal damage, inflammation, microbial translocation phenomena, and eventually, co-infection rates compared to standard of care for primary and rCDI episodes.Based on currently available evidence, as well as on the relevant gap of data, it should be important to draw physicians\u2019 attention to the possibility of concurrent and subsequent co-infections in CDI, as bacterial BSIs and Candidemia may occur in up to 20% and 9% of the cases, respectively .Before, during, or up to one month after Cdiff treatment, fungal and bacterial co-infections should be suspected in the event of any clinical change or an unexpected variation in blood tests. As an example, high fever is an infrequent sign in CDI; it should trigger an assessment to rule out common co-infections, especially in non-severe cases . Fulminant colitis is a life-threatening complication of CDI, occurring in about 3% of patients, and it is characterized by a clinical picture resembling that of septic shock: hypotension with or without the use of vasopressors, ileus, toxic megacolon, mental status changes, serum lactate levels >2.2 mmol/l, or any evidence of end-stage organ failure . Of noteClinical worsening after the resolution of a CDI episode should be interpreted as a warning sign to consider other explanations than Cdiff recurrence. Up to 25% of patients can experience recurrence of CDI within 30 days of completing treatment when antibiotic-induced microbiota disruption facilitates Cdiff spore germination, especially in the elderly, or persisting use of antibiotics and proton pump inhibitors after the diagnosis. After the second CDI episode, the risk of multiple recurrences increases to 40\u201365% . In the Prolonged diarrhea (defined as >5\u2009days after the beginning of proper anti-Cdiff therapy) or relapsing diarrhea after initial resolution should also require the evaluation for causes other than recurrency and co-infections. After ruling out these events, in the absence of alternative diagnoses, patients suffering from persisting diarrhea may have refractory CDI or inflammatory colitis such as post-infectious irritable bowel syndrome; while the latter may complicate CDI in 4\u201325% of cases , it is eTogether with clinical monitoring, a few common blood tests may help in assessing co-infections risk. Procalcitonin (PCT) remains at relatively low levels in CDI, although PCT concentration >0.5 \u03bcg/mL has been proposed as a reliable marker to identify severe CDI . MonitorCDI is an extreme ominous example of negative pharmacoenosis , where tPotential successful strategies to reduce the risk of co-infections should primarily rely on the use of targeted anti-Cdiff therapies, which have minimal impact on gut microbiota, such as fidaxomicin, bezlotoxumab, and FMT. This last approach might not be just considered as the salvage treatment following repeated failures of antibiotics but as a reliable therapeutic option, although adoption of FMT as a first-line treatment is not yet recommended, and it would require further clinical and cost-effectiveness assessments; indeed, promising but limited evidence on hypothesized relevant benefits of FMT over microbial translocation and risk of BSIs in CDI is there ,85.As for bezlotoxumab, none of the registration trials nor the few post-marketing studies reported on the incidence of BSIs in the study arms ,87. By bCandida translocation during and after Cdiff colitis has not been clearly established yet [Prophylaxis with oral nystatin has been proposed in severe CDI at high risk for candidemia, but its role in preventing shed yet . Probiotshed yet , modulatshed yet ,90, and shed yet  in both In conclusion, further efforts are needed to better detail, quantify, prevent, and effectively manage the risk of concurrent and subsequent co-infections, mainly BSIs, in patients with CDI. Although it is not properly quantifiable to date, this complication likely contributes to the global burden of CDI by increasing the length of hospital stay and CDI-related mortality. Gut microbiota represents the main source of BSIs in CDI and its preservation, and eventually, restoration is pivotal to facing this clinical complication as well as to preventing Cdiff recurrences. Promising data on post-CDI-specific probiotics and FMT bodes well for the future. In the era of MDR bacteria, but also of expanding knowledge on gut microbiota and evolving treatment options, a multi-step approach to CDI and co-infections management is warranted; this should include CDI prevention by antimicrobial stewardship and modulation of risk factors, the adoption of microbiota \u201cconciliating\u201d drugs, the prompt recognition of this underestimated co-occurrence, and proper treatments able to avoid or limit the vicious circle that arises between Cdiff, antibiotics and gut environment."}
+{"text": "Clostridioidesdifficile infection (CDI) is the culprit of millions of nosocomial infections in the United States. Programs that successfully decrease its incidence, therefore, render cost savings for the healthcare system. Toxic megacolon and perforation are two of the most significant complications with increased mortality rates. We report a 23-year-old nursing home resident hospitalized for fever, cough, and green sputum. After 3 days of antibiotic therapy, he developed abdominal distension, diarrhea, and vomiting and underwent a total colectomy. The colon was dilated to a maximum of 11 cm with markedly edematous mucosa and yellow pseudomembranes. Qualitative PCR of the stool detected Clostridioides difficile toxin B gene. While there is no consensus for the required interval between antibiotic treatment and CDI, this presentation 3 days after starting the antibiotic therapy is earlier than most proposed ranges. Clostridioidesdifficile (CD) colonizes 5% of adults and 15-70% of infants.1 In the United States (US), Clostridioides difficile infection (CDI) affects up to 3 million patients annually. Up to 8% of hospitalized patients can develop CDI.2 Costs attributed to CDI amount to $4.8 billion annually since CDI is the most common cause of nosocomial infection in US hospitals, accounting for 15% of infections.5C. difficile transferase (CDT or binary toxin). Studies have shown CDI development caused by each of the three toxins independently. These toxins and enzymes, including collagenase, hyaluronidase, and chondroitin-sulfatase, work together to cause cytoskeletal damage and, eventually, the compromised structure and functionality of the gut barrier.1The transmission route for CDI is fecal-oral and is often attributed to inadequate hand hygiene, leading to healthcare personnel transferring spores to patients. The three toxins associated with CDI are toxin A (enterotoxin A), toxin B (cytotoxin B), and 1 25% of patients with CDI may develop CD-associated diarrhea.2 The most severe cases of CDI manifest with significant complications, including systemic inflammatory response syndrome (SIRS), septicemia, intestinal paralysis, toxic megacolon, and colonic perforation.1 0.4-3% may progress to fulminant CD colitis with toxic megacolon, which has a high mortality rate (38-80%) and requires prompt surgical intervention.6The manifestations of CDI can vary widely. Some patients are asymptomatic, while others may experience mild diarrhea and recover after 5-10 days of antibiotic therapy.1 A systemic review and meta-analysis of 13 studies found a CDI incidence of 8.3 cases per 10,000 patient-days.4 It also showed an upward trend in the ranges of incidence over the past 2 decades; per 10,000 patient-days, the CDI case incidence for studies from 2000-2008, 2008- 2009, and after 2010 were 2.8 to 12.2, 6.3 to 9.6, and 6.8 to 15.8, respectively.4The most common risk factors for CDI are increased age, medical comorbidities, hospitalization, and antibiotic therapy. Increased hospital length of stay is also a significant risk factor for CDI. Due to these factors, hospitalized patients and nursing home residents have the highest risk of developing CDI.1 Furthermore, 2018 data from the CDC reports an incidence of 65.93 per 100,000 for community-associated CDI compared to 64.19 per 100,000 for healthcare-associated CDI.7 A retrospective cohort study utilizing the Healthcare Cost and Utilization Project (HCUP) database of US non-federal acute care hospitals showed that while hospital-acquired CDI decreased by 15.9% from 2006 to 2015, community-acquired CDI increased by 49.3% over the same period.3It has been shown that community-acquired CDI accounts for 30% of all cases of CDI.3 It has been suggested that \u201ctraditional risk factors\u201d may not be as significant for community-acquired CDI. Some explanations include diverse sources of infection  and genome fluidity leading to the genetic diversity of C. difficile.8This rise in community-acquired CDI cases has been attributed to low-risk patients who are younger and healthier without common risk factors such as recent hospitalizations and antibiotic use.9 A study of hospitalized adults receiving antibiotics for at least 2 days showed that compared to those receiving one antibiotic, the adjusted hazard ratio (HR) was 2.5 for those administered 2 antibiotics, 3.3 for those administered 3 or 4 antibiotics, and 9.6 for those administered 5 or more antibiotics.10Antibiotics are regarded as \u201cthe most modifiable risk factor\u201d for CDI. Variables associated with this risk are the duration of antibiotic treatment, the class of antimicrobial agent, and the number of antibiotic agents administered. An analysis of nursing home residents showed that compared with 7-day courses, 10-day courses had a 12% increased risk of CDI, and 14-day courses had a 27% increased risk of CDI. Given that cephalosporins, fluoroquinolones, and clindamycin are often associated with CDI infection, it computed the absolute risk ratio (ARR) of moxifloxacin to amoxicillin as 2.21, ciprofloxacin to nitrofurantoin as 1.89, and clindamycin to cloxacillin as 2.12.A 23-year-old male nursing home resident with a history of remote anoxic brain injury secondary to ventricular fibrillation arrest was hospitalized for evaluation of fever associated with cough and greenish sputum. He had developed abdominal distention with diarrhea and vomiting immediately before admission. He had a three-day history of antibiotic  use.oC, 34/min, and 126/min, respectively. His white blood cell count was 19.65 cells/\u03bcL (neutrophil predominance of 90%). The abdomen was mildly distended but nontender. Stool analysis revealed no ova, cyst, or parasite. Stool lactoferrin test for neutrophils was positive. CT scan of the abdomen showed marked thickening in the wall of the ascending colon  acquired by a fecal-oral route but also from the environment as a form of nosocomial infection. The number and severity of CDIs can likely be attributed to the emergence of more pathogenic strains, especially the B1/NAP1/O27 strain, producing large amounts of CD toxins A and B.12CDI is caused by toxins A, B, and 13 It has been characterized by Jalan et al.14 as having 1) dilated colon over 6 cm, 2) either fever over 38.6 \u00b0C, tachycardia over 120 beats per minute, leukocytosis over 10,500 cells/\u00b5L, or anemia, and 3) either electrolyte disorders, hypovolemia, hypotension, or altered mental status.14 Inflammatory bowel disease (51.6%), septicemia (10.2%), and intestinal infection (4.1%) account for the leading causes for hospital admission.15Toxic megacolon (TM) is a complication in 4.3% of CDI.6 Additionally, it is thought to be affected by altered colon response to chemical mediators, leading to impaired contraction of smooth muscles and lower basal luminal pressure. However, there is no consensus on the precise mechanism.19Toxic megacolon is postulated to develop from inflammation that penetrates the muscularis propria, leading to neural injury, altering gut motility, and resulting in dilation.13 Treatment is focused on addressing the underlying cause, centered on reducing inflammation to address colon motility and prevent perforation. Conservative and non-pharmacologic measures include fluid replacement, management of electrolyte derangement, bowel rest, nasogastric decompression, and encouragement of ambulation. Close observation and medical management are crucial, including monitoring labs (complete blood count and electrolytes), abdominal x-ray, maneuvers to redistribute colonic gas, and enteral feeding upon improvement. Glucocorticoids are the first-line therapy for TM in patients with inflammatory bowel disease (IBD) without evidence of impending colonic perforation. Otherwise, infliximab may be given, after three days, if there is insufficient response to glucocorticoids.13 The overall mortality rate for hospitalized patients with TM has been reported to be 7.9%.20 For those with colonic perforation, the mortality rate is 3-5 times higher.22The most common clinical manifestations are bloody diarrhea, hypotension, tachycardia, fever, and abdominal tenderness.C. difficile colitis has been defined as C. difficile colitis with systemic effects and shock leading to colectomy, intensive care unit admission, or death.23 It has previously been called severe, complicated CDI and has hypotension, shock, ileus, or megacolon as its characteristic features.24 The most significant complications of CDI are toxic megacolon and perforation.25 A retrospective review of 4,796 patients showed that fulminant CDI accounted for 4.1% of patients with C difficile colitis and had an in-hospital mortality rate of 34.7%.23Fulminant 26 In a young patient, inflammatory bowel disease is the most common cause of FCTMC. It is most often heralded by abdominal pain, abdominal distension, voluminous diarrhea with a distinctive odor, and characteristic lab findings, including granulocytic leukocytosis >15,000 cells/\u03bcL, serum creatinine >1.5X baseline, and serum albumin <3 g/dL.26Age >75 years, ischemic or infectious colitis, malignancy, organ transplantation, immunosuppression, and diabetes mellitus are risk factors for fulminant colitis with toxic megacolon (FCTMC).C. difficile colitis with perforation required surgery compared to 2% of cases without perforation.27 Signs of perforation include abdominal distension, rebound tenderness, and hemodynamic instability.13 Patients submitted to surgical intervention before perforation have an 8% mortality risk compared to 40% for those with surgery following colon perforation.28Perforation is the leading cause of mortality. 44% of cases of 29Our patient, without evidence of IBD, was at risk due to antibiotic therapy and residence in a nursing home. The Infectious Diseases Society of America (IDSA) considers the highest-risk antibiotics for CDI to be third and fourth generation cephalosporins, fluoroquinolones, carbapenems, and clindamycin.C. difficile colitis (FCDC). 100% of these colectomy patients were given antibiotics before developing symptoms, and 45% were given multiple antibiotics. 35% (7 patients) received three prophylactic doses of cefuroxime before surgery and then progressed to FCDC. The authors recommended a single dose rather than three doses for prophylactic antibiotics prior to surgery and to avoid unnecessary use of cephalosporins.30 Another study showed that occupying the bed of a prior patient who received antibiotics led to an increased risk of CDI (hazard ratio of 1.22).31A review of 528 cases of CDI found that 20 of the patients (3.7%) had a colectomy for fulminant 32 The IDSA guidelines on CDI infection in adults point out three studies showing 2-3 days to be the duration between exposure and CDI.36 More recent studies suggest the incubation period could be longer.29 Symptoms most commonly present after less than 48 hours of infection, but can also take 2-3 months to appear.38 This variability justifies that some advocate for CDI to be a non-reimbursable hospital service.37Our patient developed colitis only three days after being treated with antibiotics. Most studies show that the median incubation period is less than 7 days.36The IDSA\u2019s recommendation for treating fulminant CDI is 500 mg of vancomycin 4 times daily orally or via nasogastric tube. For patients with ileus, an alternative is a retention enema of 500 mg of vancomycin in 100 mL of normal saline administered rectally every 6 hours. 500 mg of intravenous metronidazole every 8 hours should also be added for patients with ileus in addition to vancomycin.39 The IDSA\u2019s recommendation for surgical management is subtotal colectomy with rectal preservation or diverting loop ileostomy with colonic lavage and anterograde vancomycin flushes.36Colectomy has been the standard therapy for FCTMC, but an alternative is diverting ileostomy with colonic lavage using vancomycin and metronidazole.40 One study showed a CDI recurrence rate of 15.4% after fidaxomicin versus 25.3% after vancomycin.41 Another multicenter study of 535 patients with acute CDI demonstrated that fidaxomicin may be a viable alternative to vancomycin due to its comparable efficacy and safety. It showed that clinical cure  was achieved by 91.7% of patients receiving fidaxomicin  and 90.6% of patients receiving vancomycin .42 However, fidaxomicin has not demonstrated the ability to reduce the recurrence of CDI infection with the BI/NAP1/027 strain.42Fidaxomicin has received much praise for reducing CDI recurrence while not disrupting normal colonic flora. A meta-analysis of 2,303 patients with CDI showed that fidaxomicin when compared to vancomycin, was associated with a lower CDI recurrence rate  but was not associated with a different cure rate .44 Another study of 57 patients with severe CDI and fulminant CDI (based on the American College of Gastroenterology guidelines) refractory to antimicrobial therapy showed an overall 91% cure rate at 1 month with 100% for severe CDI patients and 87% for fulminant patients. It also demonstrated a 94.7% survival rate at 1 month and a 78.6% survival rate at 3 months. These results and the absence of adverse effects or perforation suggested that using FMT instead of colectomy could be a consideration for select patients.45 However, the FMT procedure is yet to be standardized, and there is concern about infection transfer and the development of autoimmune disorders influenced by the gut microbiome.1Fecal microbiota transplantation (FMT) has also shown impressive results in preventing recurrent CDI. A 2014 study of 27 patients given fecal filtrate directly into the intestines and a 2016 study of 20 patients given freeze-dried oral capsules demonstrated 100% effectiveness.tcdA and tcdB (genes encoding toxins A and B), tcdC and tcdD (regulatory genes), and tcdE (porin gene).46 A third toxin is C. difficile transferase (CDT), also called binary toxin, which is encoded by cdtA (disruption of actin filament assembly) and cdtB , specifically an 18-base pair deletion and position 117 deletion. This leads to the strain producing higher amounts of toxin A and toxin B as well as being resistant to fluoroquinolones.49 A characterization of isolates from 124 patients in Quebec along with US, UK, and other Canadian isolates for increased genetic diversity found that toxin A production was 16 times higher and toxin B production was 23 times higher for the NAP1/027 strain.50The prevalence of the hypervirulent strain, BI/NAP/027, has increased significantly since 2000. BI/NAP1/027 is caused by mutations in the toxin regulatory gene  were BI/NAP1. Given the strain\u2019s resistance to fluoroquinolones, it is likely that US hospitals\u2019 increased use of fluoroquinolones has provided an opportunity for this hypervirulent strain to become much more prevalent in the past two decades.49In a historical database of over 6,000 isolates from 1984-1990, 18 isolates (less than 0.3%) from 14 patients were BI/NAP1. By contrast, out of 187 isolates collected since 2001 from eight healthcare facilities with 51 This normally appears as a diffuse pattern of scattered pseudomembranes throughout the mucosa. Confluent pseudomembranes on the entire mucosa may be seen in the most severe cases, and 3-8% of cases progress to a fulminant infection.52 PMC is reported to be the most common endoscopic finding in patients with CDI and is estimated to occur in 10% of patients with antibiotic-associated diarrhea.53Pseudomembranous colitis (PMC) is characterized by pseudomembranes visualized endoscopically as yellow-white plaques measuring up to two centimeters in diameter on the mucosa of the colon and composed of dead intestinal cells, fibrin, and neutrophils.C. difficile colonization. This or another inciting event causes endothelial damage, leading to necrotic areas on the surface epithelium, followed by inflammation.51 The influx of neutrophils and macrophage/monocyte activation leading to pro-inflammatory cytokine  release causes pseudomembrane formation and mucosal injury.55 Both toxins and enzymes  damage the cytoskeleton and cause the gut barrier to lose function. The cytoplasmic Rho protein (family of GTPases) is responsible for actin polymerization, stabilizing the cytoskeleton. Toxins of C. difficile inactivate Rho, leading to destabilized cytoskeleton, inflammation, and pseudomembrane formation or microulcerations in severe cases.57Antibiotics often alter the natural colonic flora, leading to 53 Hand hygiene and wearing gloves are crucial because the hands of healthcare providers are the main transmission mechanism. If a provider does not wear gloves and works with a patient with CDI, there is a 14-59% chance of hand contamination.59 Compliance with soap and water handwashing protocols for 15 to 30 seconds has been shown to be 20-40% effective.60Currently, CDI is the most common healthcare-associated infection. It is mandatory to isolate CDI patients and to thoroughly clean environmental surfaces with a chlorine-based disinfectant to prevent spread.61 The \u201dCleanyourhands\u201d campaign consisted of alcohol-based hand rub installed at the bedside, hand hygiene promotion, and hygiene audits among 187 acute trusts in England and Wales from 2004 to 2008. It led to triple the hospital procurement of liquid soap and alcohol hand rub from 21.8 to 59.8 mL per patient bed day and was associated with a CDI incidence rate ratio of 0.80 (95% CI 0.71 to 0.90).62C. difficult spores are resistant to alcohol-based hand sanitizers. Handwashing using soap and water for 15 to 30 seconds (which remove but do not kill spores) is more effective in reducing spore burden.63The rapid incubation period for CDI leads to a risk of rapidly developing symptoms and the progression to severe complications, especially for high-risk patients. Patients are at higher risk for CDI for over three months since the use of antibiotics disrupts normal gastrointestinal flora. They may be prone to develop CDI during subsequent hospitalizations within this period.We are witnessing a shift in the standard of care from metronidazole and vancomycin to fidaxomicin and fecal microbiota transplantation. A study based on 2018 IDSA treatment guidelines found that the most cost-effective treatments for CDI were fidaxomicin for the initial treatment of non-severe cases, vancomycin for severe cases, fidaxomicin for the first recurrence, and FMT for subsequent64 recurrences."}
+{"text": "Controlling the direction of magnetization with an electric current, rather than a magnetic field, is a powerful technique in spintronics. Spin\u2013orbit torque, which generates an effective magnetic field from the injected current, is a promising method for this purpose. Here we show an approach for quantifying the magnitude of spin\u2013orbit torque from a single magnetic image. To achieve this, we deposited two concentric electrodes on top of the magnetic sample to flow a radial current. By counterbalancing the current effect with an external magnetic field, we can create a stable circular magnetization state. We measure the magnitude of spin\u2013orbit torque from the stable radius, providing a new tool for characterizing spin\u2013orbit torque. Ampere\u2019s law of electromagnetism describes the magnetic field generated around a flowing current, which has traditionally been used for technology implementation. However, as devices have become smaller, magnetic field interference and energy efficiency have become limiting factors, necessitating new approaches. One such approach is spin transfer torque, which involves injecting electron spins directly into a magnetic sample to change its magnetization state10.Controlling the magnetization direction of magnetic materials with an electric current has been a research focus for some time, as this technology has numerous practical applications beyond academic interest13. This generates spin torque, known as the spin\u2013orbit torque (SOT)18. The use of this phenomenon has become increasingly common in spintronics research and applications.Efficient spin transfer effects have been observed in heterostructures consisting of a magnetic material and a heavy metal in contact. When a current passes through the heavy metal, the spin-Hall effect causes spin accumulation on each of its lateral surfaces, resulting in the injection of accumulated spins into the adjacent magnetic material22. To this end, various measurement methods have been proposed. One widely used approach is the harmonic Hall voltage measurement, which measures the harmonic signals using a lock-in amplifier on a Hall cross geometry26. Another established method is the spin torque ferromagnetic resonance (ST-FMR), in which a radio frequency (RF) signal is applied to a waveguide-patterned sample, causing oscillation of the magnetization state via spin torque29. Resonance curves obtained by changing the magnetic field or RF frequency are analyzed. In addition to electrical methods, the SOT can also be measured optically using the magneto-optical Kerr effect (MOKE) with a focused laser light source32.Quantifying the strength of the SOT has become a critical issue in spintronics research, as it is directly related to the efficiency of device operation36. Using this microscope, it is possible to observe the phenomenon in which the entire magnetization state of the sample is pushed in one direction due to the SOT effect38. The larger the SOT, the faster the magnetization state moves. A narrow wire structure often employed to better define the current direction and increase the current density.While the methods described thus far assume a uniform magnetization state in the observation area, there is an alternative method that enables the observation of non-uniform magnetization changes. This method involves the use of a microscope to observe the magnetization state of the entire area at once, with a MOKE microscope being a typical exampleThis paper proposes an alternative method for measuring SOT based on image observation. Unlike existing methods, this approach involves the use of a non-uniform current, exploiting the point at which the effects of the current and the external magnetic field balance each other. Specifically, the non-uniform current generates SOT distributions of varying intensities at different positions, resulting in no magnetization state change at the point where the effect of SOT is counterbalanced by the external magnetic field. By applying this method, the SOT efficiency can be quantified from a single image.2(substrate)/MgO(1\u00a0nm)/CoFeB(1.3\u00a0nm)/W(3\u00a0nm)/TaOx(3\u00a0nm) that exhibits perpendicular magnetic anisotropy (PMA), meaning that the magnetization direction (m) prefers to align perpendicular to the film plane (39. Two gold electric pads (thickness 100\u00a0nm) were deposited on top of the magnetic film, one with a round perforated shape (outer pad) and the other with a circular disk shape /MgO\u00a0nm/CoFeB33. In order to clearly observe the magnetization state, a background subtraction method was applied to all magnetic images in this paper. The background image was obtained by setting all magnetization directions to a uniform 41. The light gray and dark gray areas in Fig.\u00a0The real image of the probe tips in contact with the inner pad is shown in Fig.\u00a0mentclass2pt{minimThe formation process of the stripe state was further investigated without the use of probe contact. Figure\u00a0entclass1pt{minimaFigure\u00a0entclass1pt{minimaentclass1pt{minimaA brief summary of the sample's properties for magnetic fields follows: near zero magnetic field, the stripe state is stable and dominates the magnetization state. As the external magnetic field is increased, the stripe regions shrink and the uniform magnetization state becomes more stable. When the magnetic field is large enough  and the layers are so thin that the current density of the two layers is the same, r0.In Fig.\u00a043, and similar results were obtained (Supplementary Note The primary finding of this study is the ability to determine the efficiency of the SOT from the relationship between mentclass2pt{minimThis ability to measure SOT from a single image means that the proposed method is easier to apply than other methods. This ease of use includes the fact that there is no need for complex patterning of the magnetic film and no strong magnetic field is needed to tilt the magnetization vector away from the magnetic anisotropy axis.Despite these advantages, this measurement method has several limitations. First of all, we need well-made PMA films. PMA films with poor uniformity, nucleation occurs more easily than magnetic domain wall motion. In a specific situation, if nucleation occurs inside the circular magnetic domain while the circular domain is being formed, the circular domain disappears. Therefore, samples with few defects are required.37, the current flowing through the W layer causes spin-polarized electrons to accumulate on the surface. These accumulated spins are injected into the CoFeB layer, which is called spin pumping. The pumped spin induces damping-like SOT and field-like SOT22. Both SOTs act as effective magnetic fields. The effective field induced by the damping-like torque is proportional to 43, but this was not considered in this paper.The domain wall of a well-made PMA film is easily moved by a perpendicular magnetic field, but does not move easily by an in-plane magnetic field. This also means that only the damping-like component of the SOT effect is measured. Due to the spin Hall effectThis study has identified unique magnetization states that arise from the interplay between the external magnetic field and the radial current. These unusual magnetization states form a large circular region with a Supplementary Information."}
+{"text": "HIV infection presents complications that may include neuropsychiatric symptoms and whose management is important to avoid misdiagnosis and mistreatment.This case aims to highlight the importance of assessing HIV comorbidity in patients with psychiatric onset pathology.Case report and literature review.We present the case of a patient diagnosed with HIV in 1985, who after 20 years of disease with irregular adherence begins to present delusional ideation of harm and self-referential, control experiences, thought diffusion phenomena, and possible auditory hallucinations, with poor evolution despite the establishment of numerous antipsychotic treatments, which evolves over the years towards a confabulatory character and with progressive neuropsychological deterioration. After numerous admissions, and despite several treatments, the patient developed over time memory failures, bradypsychia, gait disturbances, and difficulties in self-care, which further aggravated his condition by hindering therapeutic adherence, which ended with the patient\u2019s chronic institutionalization. Diagnosis was AIDS dementia complex.HIV hardly replicates in the central nervous system but generates antigenemia which, in turn, generates an inflammatory infiltrate that can cause diffuse involvement, predominantly subcortical and limbic system. Usually, the dementia-AIDS picture is insidious and develops in patients with poor control of the primary disease. It is recommended to optimize antiretroviral therapy and neuroprotective agents, as well as symptomatic treatment by psychiatry.None Declared"}
+{"text": "Compared to a commercial insulin pump, the clockwork pump demonstrated reduced variability but greater average error due to consistent over-delivery. Further development of the design and/or manufacture should yield a device with similar performance to a commercial pump.A low-cost , low-power (1-year battery life), portable, and programmable syringe pump design is presented, which offers an alternative to high-cost commercial devices with limited battery life. Contrary to typical motor-driven syringe pumps, the design utilizes a compression spring coupled with a clockwork escapement mechanism to advance the syringe plunger. Full control over flow-rate and discrete (bolus) deliveries is achieved through actuation of a clockwork escapement using programmable, low-power electronics. The escapement mechanism allows the syringe plunger to advance a fixed linear distance, delivering a dose size of 0.001\u00a0ml in the configuration presented. The modular pump assembly is easily reconfigured for different applications by interchanging components to alter the minimum dose size. Testing to IEC 60601-2-24(2012), the average error of the clockwork syringe pump was 8.0%, 4.0%, and 1.9% for 0.001\u00a0ml, 0.002\u00a0ml, and 0.01\u00a0ml volumes, respectively. An overall mean error of 1.0% was recorded for a flow-rate of 0.01\u00a0ml\u00a0h  NZDNew Zealand DollarUSDUnited States DollarIECInternational Electrotechnical CommissionISOInternational Organization for StandardizationANSIAmerican National Standards InstituteAGMAAmerican Gear Manufacturers AssociationCADComputer-Aided DesignEDMElectrical Discharge MachiningPCBPrinted Circuit BoardSPISerial Peripheral InterfaceIDInternal DiameterODOuter DiameterCSIIContinuous Subcutaneous Insulin Infusion1Syringe pumps control the movement of fluid by mechanically advancing (or retracting) a syringe plunger. Large, externally-powered syringe pumps are commonly used in laboratory applications, and for delivering medication in acute and intensive care scenarios. Devices for medication delivery require very small delivery volumes with low variability. Extension of technologies with small delivery capability to portable applications is hampered by high power consumption, or prohibitive expense. For example, syringe pumps are used for continuous subcutaneous insulin infusion (CSII) in diabetes outpatient care via insulin pumps A significant limitation of syringe pumps is cost. In New Zealand, insulin pumps cost between $7000\u201310,000 NZD ($4400\u2013$6250 USD). In addition to large upfront cost, they are not typically able to be repaired or serviced. For relatively simple hardware \u2013 a motor-driven leadscrew which advances a plunger \u2013 this cost is very high. For insulin pumps in particular, pump cost prevents more universal uptake of CSII, which is regarded the gold-standard for glucose control and diabetes outpatient care One further common problem with motor-driven syringe pumps is a large electrical energy requirement, as all energy to deliver fluid must be provided by an electrical power source. For portable devices, this energy requirement results in either large, inconvenient batteries, or limited battery life. Commercially available insulin pumps, for example, require batteries to be changed approximately every 1\u20134 weeks.The device presented here provides a portable, low-cost, low-power, and programmable syringe pump. It achieves great generalizability through configurable components, but is intended for eventual use as an insulin pump. The design operates using a spring-driven clockwork mechanism with electrical actuation, which lends itself to long battery life, as electrical energy is only used for dose control, rather than to advance the plunger. Flow-rate and bolus dose functionality are provided, and can be modified via program. Cost is minimized through selection of off-the-shelf components for a total bill of materials of $120 NZD ($75 USD), depending on access to mechanical and electronic workshops. The modular design enables users to easily perform repairs or modifications, increasing potential application in low-resource regions.There are currently many open-source syringe pump designs suitable for a wide-range of research applications. These designs address issues of commercial pumps, including cost, compatibility, and lack of customizability. The design developed by -3\u00a0ml , the achievable pumping pressure linearly decreases from peak pressure at the fully retracted plunger position (maximum spring compression) to minimum pressure at the fully extended plunger position (minimum spring compression). For the presented design, the pressure range is 175\u00a0kPa to 50\u00a0kPa, which is considered suitable for initial testing and development of a device targeting insulin therapy. However, the achievable pressure range can easily be altered for a different pumping application by varying the stiffness of the spring. The method used to select a spring with adequate stiffness for insulin therapy is outlined in Section Provided the required pumping pressure for a given application can be met by the minimum achievable pressure of the pump, the dose delivered each actuation across the entire working range of the plunger will remain constant at 0.001\u00a0ml. A constant dose size is achieved as the escapement mechanism restrains the lead-screw to a fixed rotation each actuation, so greater spring force does not result in larger lead-screw rotations or subsequent linear plunger movement. Therefore, pump accuracy is independent from plunger position, provided the spring force can generate sufficient pumping pressure.As the pump is intended for eventual use as an insulin pump, the device must be capable of providing both pseudo-continuous flow-rates, and one-off \u2018bolus\u2019 doses. In insulin therapy, the continuous flow-rate provides a background level of insulin to manage blood sugar levels between meals, and boluses are additional doses programmed by a user to compensate for meals, or to correct blood sugar levels. The presented pump design can provide modifiable flow-rates, and deliver bolus doses when connected to an external controller. The current device does not have Bluetooth connectivity or a built-in button, so a user cannot directly program a bolus dose.\u22121. The maximum flow-rate is governed by the minimum possible cycle time (approximately 100\u00a0ms), allowing a flow-rate of 36\u00a0ml\u00a0h\u22121. The practicality of the maximum flow-rate is limited in the current design by the reservoir volume of 3\u00a0ml, allowing the flow-rate to be sustained for only 5\u00a0min before the reservoir is depleted. With all flow-rates comprised of the same 0.001\u00a0ml individual increments, flow-rate is unaffected by plunger position. Pump accuracy is also not impacted by flow-rate.Flow-rates are achieved by repeated activations of the low-power actuator at set intervals, controlled by an on-board micro-controller. Flow-rate is governed by the interval between each 0.001\u00a0ml dose (cycle time), which can be modified by program. The minimum achievable flow-rate is a function of the per-actuation dose volume, and the maximum acceptable cycle time for a certain application. If a cycle time of 1\u00a0h is considered acceptable, the minimum hourly flow-rate is 0.001\u00a0ml\u00a0hBolus deliveries of various size are possible through repeated activations of the actuator at a cycle time of 100\u00a0ms, providing rapid delivery. The minimum possible bolus size is 0.001\u00a0ml. The maximum possible bolus size depends on the period of time the dose must be delivered in. If an arbitrary period of 10\u00a0s is adopted, a maximum bolus size of 0.1\u00a0ml could be requested. Flow-rate and bolus accuracy are both tested to IEC standard in Section There is a significant difference between this design and current commercial, and open-source syringe pump designs. Other designs typically rotate a leadscrew (and advance a plunger) using a motor. The force required to deliver the fluid must be provided solely by the motor, which results in a greater electrical power requirement compared to this clockwork design. It is estimated the novel spring-based drive mechanism will offer a battery life of approximately 1 year, powered by two CR1632 cells, offering The clockwork pump is also highly configurable for different applications. The leadscrew, gearbox, and reservoir can be changed to alter the pumping resolution. The design is modular, consisting of 6 separate sub-assemblies, which can be replaced or redesigned without impacting other sub-assemblies. Although the design is well-suited for medical applications, it is a prototype, and does not meet the safety requirements required for medical device certification. The pumping mechanism and design analysis presented will be useful to researchers who wish to further develop the concept for a wide variety of applications.The clockwork pump:\u2022Enables manufacture of a syringe pump for $120 NZD ($75 USD), with battery life of \u2022Provides a highly customizable design;\u2022Allows for easy and inexpensive repair, and continued development; and\u2022Provides researchers with a novel pumping concept able to be developed for medical applications, including insulin therapy.3https://doi.org/10.17605/osf.io/j24f6. The file locations specified in The design files are all available at 3.1https://doi.org/10.17605/osf.io/j24f6 located under component drawings. DXF files for the escape wheel, pallet, and pallet lever are included in place of drawings, as these components are wire-cut.Physical design was completed in SolidWorks. CAD files for all components to manufacture are provided as SolidWorks Part files (SLDPRT). Component drawings for manufactured components are included in 3.2PCB design was performed in KiCAD. Local library files are included for both the schematics and PCB footprints. Production files for PCB B1 and PCB B2 are provided in b1.zip and b2.zip, respectively. There is minimal software included as only the pump hardware is presented here. An Arduino script providing slow, continuous administration \u2013 continuousDelivery.ino \u2013 is included only, but can be expanded for any type of basic control 4https://doi.org/10.17605/osf.io/j24f6. All subsequent references to component numbers are consistent with the identification numbers in Manufactured and purchased components are listed in 55.1Four key steps are required for the manufacture and assembly of the pump: manufacture of machined components; modification of purchased components; population of PCBs; and construction and integration of sub-assemblies. The six pump sub-assemblies are shown in 5.2https://doi.org/10.17605/osf.io/j24f6. Required tooling and equipment are listed in Manufacture components in 5.3Populate the PCBs in accordance with the KiCad project files. 5.4Instructions for modifying the purchased components are listed in 5.55.5.1Graphical instructions for assembling the leadscrew sub-assembly  to enable significant customization.Users should be aware the current design is a proof-of-concept prototype, and has not been proven to meet the requirements to act as an in-vivo medical device.1.Input the desired rate of continuous infusion into the code (continuousDelivery.ino).2.Program the ATTiny441 using a suitable programmer, for example an Arduino Nano configured as an in-system programmer. The pinout for the programming header can be seen in 3.Load the pump by pushing on the plunger until the spring is fully compressed.4.Fill the reservoir with the desired fluid using a syringe or vial, so that the rubber plunger of the reservoir sits flush with the end of the reservoir. Connect the infusion set to the reservoir, as per the manufacturer\u2019s instructions.5.Insert the reservoir into the reservoir housing, as shown in Section 6.Place the free end of the infusion set into a beaker. Screw the reservoir housing onto the spring housing. The pump plunger will engage with the reservoir plunger as the housing components are connected. Fluid will be flushed through the infusion line into the beaker, priming the infusion line.6.2Potential safety hazards during operation of the device along with measures to mitigate the risk are listed in 77.1The accuracy of the clockwork pump was assessed according to the test settings and evaluation methods provided in IEC 60601-2-24(2012), an international standard outlining safety and performance requirements for infusion pumps The flow-rate and bolus accuracy of the clockwork pump were individually assessed to clauses 201.12.103 and 201.12.105 of the IEC standard. To benchmark the clockwork pump against a commercial syringe pump, a Medtronic 640G insulin pump  was tested using the same test set-up and protocol. Specific test parameters and results for the flow-rate and bolus tests are presented in The IEC standard does not provide guidelines for quantifying measurement uncertainty. Therefore, the United States Pharmacopeia methodology was used to estimate both repeatability and accuracy contributions to the measurement uncertainty of the balance Balance repeatability is defined as the standard deviation of at least 10 repeated measurements of a test weight. The repeatability of the balance used for assessing the clockwork pump was found to be 0.014\u00a0mg. The minimum weight to be measured is 1\u00a0mg, corresponding to the minimum volume displaced by the pump (0.001\u00a0ml).-3% of the measured weight, which is negligible. The combined measurement uncertainty arising from the balance is therefore considered to be In addition to repeatability error, accuracy error of the balance was assessed from 15 repeated measurements of a test weight with mass greater than 5% of the balance capacity  Aside from measurement uncertainties associated with the balance, experimental factors could introduce error. Potential sources of error are listed in 7.1.1\u22121 was selected, as it is considered an intermediate rate for insulin therapy Flow-rate testing was carried out in accordance with clause 201.12.103 of the IEC standard. An intermediate flow-rate rate was assessed over an analysis period of 24\u00a0h, with a sampling interval of 15\u00a0min. To enable comparison to a commercial pump (insulin pump), a flow-rate of 0.01\u00a0ml\u00a0hThe flow-rate is calculated from the total recorded mass in each observation window. The largest relative measurement uncertainty will occur for the 15\u00a0min observation window, due to the smallest recorded mass  for all bolus volumes and pumps tested is shown in boxplots in Despite exhibiting improved or similar consistency to the commercial device, the median error for the clockwork pump is greater than the commercial device across all three bolus volumes . Low variability with a consistent positive median error indicates a systemic error, such as a slightly different gear ratio, or leadscrew pitch than expected. Systematic errors can be eliminated with further development and testing, and/or more precise fabrication.7.2-4\u00a0ml.The linear distance the plunger travels per actuation, 7.3The torque to rotate the escape gear through the gearbox, and the torque required to actuate the pallet of the escapement were measured. For both cases, a mass at the end of a lever was used to find the force, and torque required to initiate rotation. The test apparatus for escape wheel rotation and pallet rotation are shown in 7.4To select a spring suitable for insulin delivery, a minimum required spring stiffness was calculated. The stiffness of various off-the-shelf springs were estimated, and a spring meeting the required stiffness selected. The minimum and maximum plunger force, and achievable pumping pressure, were then calculated along with the maximum generated leadscrew torque. 7.4.1The selected spring must provide sufficient axial force across the entire working range of the plunger to back-drive the leadscrew and generate adequate pressure to deliver fluid. To ensure the selected spring meets the force requirements for successful operation of the pump, a condition for back-driving involving all forces and torques present in the system must be established. Back-driving will occur when As shown in An equation for 7.4.2To find a suitable spring, a variety of compression springs 50\u00a0mm in length with varying wire diameters, 7.4.3The minimum and maximum axial forces acting on the plunger, 7.4.4-3\u00a0N\u00a0m.Maximum torque experienced by the leadscrew, 7.5To estimate pump battery life, use as an insulin pump is considered, where a delivery requirement of up to 1\u00a0ml per day can be expected. All variables, values, and sources of values required for the battery life estimate are listed in 7.67.6.1\u22121.The circlip transfers the axial spring load to the thrust bearing. To assess the load bearing capacity of the circlip, an MTS Criterion  tensometer was used to apply an axial load directly onto a circlip sitting in the groove of a test shaft. As shown in The load cell readout is presented in 7.6.2The factor of safety on one-way bearing failure is calculated by comparing the maximum leadscrew torque to the bearing manufacturer\u2019s published torque limit. The torque limit (0.34\u00a0N\u00a0m) represents the maximum torque that can be applied to the bearing without slippage, for a lifetime of 1 million locking cycles, which occur when reloading the pump 7.6.3The tangential load applied to the input gear of the gearbox by the leadscrew, 7.7Limitations of the clockwork pump design are identified in 8A design for low-cost, low-power, portable, and programmable syringe pump is presented. The device is highly customizable, but is intended for eventual use as an insulin pump. The pump design is made accessible through construction from off-the-shelf or readily manufactured components. The flow-rate and bolus delivery accuracy of the device are similar to a commercial insulin pump. The testing results validate the novel pumping mechanism which utilizes a clockwork mechanism to achieve low-power delivery of fluid from the reservoir, showing it can compete with motor-driven devices. A systematic error in the current prototype was identified, with the pump consistently over-delivering. Further development of the design and incorporation of higher precision hardware will likely rectify the issue. Bluetooth control of the device will be included in future design iterations, allowing the user to alter flow-rates, and select bolus doses real-time, using a mobile phone.No human or animal studies were conducted in the design of this work.None."}
+{"text": "THz generation from femtosecond photoexcited spintronic heterostructures has become a versatile tool for investigating ultrafast spin-transport and transient charge-current in a non-contact and non-invasive manner. The equivalent effect from the orbital degree of freedom is still in the primitive stage. Here, we experimentally demonstrate orbital-to-charge current conversion in metallic heterostructures, consisting of a ferromagnetic layer adjacent to either a light or a heavy metal layer, through detection of the emitted THz pulses. Our temperature-dependent experiments help to disentangle the orbital and spin components that are manifested in the respective Hall-conductivities, contributing to THz emission. NiFe/Nb shows the strongest inverse orbital Hall effect with an experimentally extracted value of effective intrinsic Hall-conductivity,  By optically driving the magnetization in a magnetic system, terahertz emission can be induced from an adjacent normal metal, as a result of spin-to-charge conversion. Here, Kumar and Kumar successfully show the equivalent effect arising from orbital-to-charge conversion. These include, the spin-orbit torque (SOT), spin-pumping, magnetic memories, excitation of magnons, manipulating the magnetic damping, etc. Mainly, the spin Hall effect4 (SHE) and Rashba-Edelstein effect6 (REE), governed by the spin angular momentum (S) transfer, have been invoked commonly in the generation of a spin current from a charge current. It has become clear from a few recent studies that in certain solids9, the transport of electron\u2019s orbital angular momentum (L) and hence the associated magnetic moment, is also responsible for various interesting phenomena in the emerging field of orbitronics. Orbital Hall effect (OHE), which was conceived11 just after the SHE3, has often been neglected due to orbital quenching in the periodic solids13. Bearing many similarities with the SHE, in the OHE, a transverse flow of orbital angular momentum occurs in response to a longitudinally applied electric field. In fact, fundamentally, SHE has been proposed to originate from OHE only16. Therefore, it has helped in resolving the sign and magnitude of the reported values of spin Hall conductivities for certain materials. A few theoretical and experimental studies in the recent literature17 have indicated a gigantic OHE in the light as well as several heavy metals and therefore, it has necessitated more careful investigations of SHE-based phenomena and devising new schemes to disentangle the OHE.Efficient generation and detection of spin current are the key requirements in spintronic devices for their different potential applications20, semiconductors11, two-dimensional materials23, etc24. Unlike the SHE, whose strength greatly depends on the spin-orbit coupling (SOC) in the material, OHE, on the other hand, can be found even in the light materials, having very weak SOC20. After a few theoretical reports17 on the large orbital Hall conductivity 7 of orbital angular momentum with the local magnetization, a similar direct realization of the OHE induced torque or the orbital Hall torque (OHT) was lacking. This pertinent issue has found a regenerated interest among researchers19 to make OHT based applications viable25 by devising novel orbital-spin (L-S) conversion schemes and suitable material combinations26. It follows from the magnetization manipulation through the exerted net torque, dominated by either SHT or OHT, and acts as a key in distinguishing the orbital character indirectly from the pure spin transport, yet not in an unambiguous manner. Choi et al.16, have used magneto-optical Kerr effect (MOKE) in addition to the orbital torque measurement technique for direct detection of orbital magnetic moment accumulation created by the charge current flow in a light metal, Ti. A non-contact method is always promising to non-invasively measure the spin and orbital transport in materials.As indicated above, OHE is a fundamental phenomenon, which can be observed in a variety of materials, including transition metals27 allows an interconversion between the orbital and charge currents, where, similar to the ISHE and IREE for the spin counterpart, here, inverse orbital Hall effect (IOHE) and inverse orbital Rashba-Edelstein effect25 (IOREE) are both in play. In several studies37 in the last decade or so, ISHE and IREE have been utilized in the THz electromagnetic pulse generation from ultrafast photoexcited magnetic/nonmagnetic (NM) multilayer systems. Consequently, the scheme, in conjunction with the multilayers, is not only recognized as a source of effective THz radiation38, but also a highly sensitive contactless optical probing tool46 for the detection and control of the ultrafast processes at femtosecond time scale, spin-charge conversion mechanisms, demagnetization dynamics and transport, interfacial properties, etc. For the case of the ISHE based spintronic THz emitters, spin current from the ferromagnetic (FM) or antiferromagnetic layer is injected into the NM layer, where it gets converted to charge current. Therefore, heavy metal layer with large SOC is desirous for efficient THz generation from a bilayer47. Similar effects are envisaged to exist for the orbital counterpart too49. For the THz emission utilizing the orbital transport properties, i.e., orbital-charge conversion through IOHE, material candidates capable of generating an orbital current  and REE (IREE) are routinely used for the detection of spin transport through the spin-charge conversion, where the spin source can be one from either spin pumping or spin Seebeck current or optical excitation, etc. The Onsager reciprocityIn the current work, existence of nonlocal orbital transport is experimentally detected through IOHE mediated efficient THz emission from femtosecond NIR (near-infrared) pulse excited bi- and tri-layer metallic heterostructures using temperature-dependent THz\u00a0time-domain spectroscopy. Since the orbital degree of angular momentum is strongly correlated with the crystal field potential, therefore, the temperature-dependency of the phonon scattering would severely affect the OHE and the related phenomena, microscopically. The specifically chosen heterostructures, in this work, consist of FM and NM material combinations, where the choice of the FM is from either CoFeB or NiFe, whereas the NM is from both the light metal (Nb) as well as the heavy metals . While the THz emission from CoFeB/Pt, CoFeB/Ta, CoFeB/W, and Fe/Ta bilayers is shown to originate principally from the ISHE in the heavy metal layers therein, the same from NiFe/Nb arises primarily via the IOHE in the light metal layer of Nb. In the prior, strong ultrafast photoinduced spin current is generated in the FM layer to be further injected into the NM heavy metal layer whereas in the latter case, efficient spin-orbital conversion within NiFe layer facilitates strong ultrafast orbital current injection into the Nb layer. The temperature-dependence of the THz amplitude vis-a-vis the Hall conductivities are used to distinguish spin-to-charge and orbital-to-charge signatures in the NM layers. The wide-range temperature-dependent THz results and analysis also help to distinguish dominating extrinsic and intrinsic contributions to IOHE in different resistivity regions. For the observation of IOHE mediated THz emission from structures consisting of heavy metal layer, we fabricated a tri-layer system of CoFeB/W/Ta and measured the temperature-dependent THz amplitude and the Hall conductivities. The THz emission from such a tri-layer, having the W-insertion layer, interfaced with another heavy metal layer of same sign of the spin Hall angle and placed side-by-side, is nearly one-order stronger than the CoFeB/Ta bilayer counterpart. Such an enhancement in the THz emission is associated with efficient spin to orbital conversion due to strong SOC and long diffusion length of the orbital current in the W-insertion layer.B), having a value just above the saturation (~200\u2009Oe), is applied along the y-direction. A few consistency checks were recorded, to initially validate the origin for the generation of THz pulses, for four geometries of the direction of the optical excitation and the magnetic field, as presented in Fig.\u00a08, 8. An optimal material composition and growth of NiFe enriched with Ni can provide a better value of 50. Moreover, a transient change in the spin-orbit coupling in Ni, triggered by the high energy ultrafast excitation, has been seen to enhance the 51.Figure.\u00a052 in the NiFe layer stimulates flow of a spin current with density L) of same polarity through the L-S conversion, given48 as, 53, which possess similar symmetry properties to the spin current but can exhibit relatively different transport dynamics55. Furthermore, as the ultrafast excitation of spin and orbital magnetization has been reported58 to exhibit a similar evolution, the emergence of orbital current can also be comprehended through the analogy with the already established spin current formation53. Consequently, as indicated in Fig.\u00a060 for realizing orbital transport phenomena. In case of heavy metals, although the value of 14, but, OHE is greatly suppressed by the inherently present SOC owing to the identical macroscopic geometries between OHE and SHE in response to the applied electrical current in steady operations20. Therefore, to overcome the effect of spin transport in the realization of OHE, selection of an appropriate light element material is regarded as one of the key solutions.Following the optical pulse excitation of NiFe/Nb Fig.\u00a0, ultrafaThe spin and orbital currents injected into the Nb layer convert to respective in-plane transient charge currents. Charge current, 18. Since the spin-orbit correlation factor, Here, mentclass2pt{minim63 have been proven to be important in identifying various scattering mechanisms in the materials and subsequent determination of respective Hall conductivities. To validate the IOHE origin of the THz emission from NiFe/Nb bilayer, we have performed temperature-dependent experiments by monitoring the changes in the peak-to-peak amplitude of the THz signal as a function of the sample temperature (T) from 10\u2009K to 300\u2009K. The temperature sensitivity of the phonon scattering would have a significant impact on the OHE and associated phenomena because the orbital degree of angular momentum is strongly coupled with the crystal field potential20. The result is presented in Fig.\u00a032. For exactly determining the dominating role of either the Temperature-dependent studies\u03c1) was also determined for the Nb and NiFe/Nb films in the entire experimental temperature range  and Ni90Fe10 (NiFe) layers, and nonmagnetic Pt (platinum), Ta , W (tungsten), Nb (niobium) material layers were created by using ultra high vacuum radio frequency magnetron sputtering technique. Bilayer systems, Sub./CoFeB(2)/Pt(3), Sub./CoFeB(2)/Ta(2), Sub./Fe(2)/Ta(3) and Sub./NiFe(5)/Nb(10), and trilayer systems, Sub./CoFeB(2)/W(2)/Ta(2) and Sub./CoFeB(2)/W(1)/Ta(2), were deposited layer by layer on 1\u2009mm thick quartz substrates (Sub.). A nearly optimized thickness and phase of the individual layers in the heterostructures has been used. The W and Ta layers are in their \u03b1-phase. The information related to the film thickness, roughness, and phase is obtained by using various structural and topographical measurements techniques, such as X-ray diffraction (XRD), X-ray reflectivity (XRR), and atomic force microscopy (AFM), and can be found in Supplementary Section\u00a061 are provided in Supplementary Section\u00a02) is used. However, results with the varying pump fluence on different samples are shown in Supplementary Section\u00a00 off-axis gold-coated parabolic mirrors of focal length of 15\u2009cm. THz pulses were detected by electro-optic sampling scheme in a (110)-oriented ZnTe crystal of thickness 0.5\u2009mm by using a combination of a quarter wave plate, a Wollaston prism, a balanced photodiode, and a lock-in amplifier61. The THz setup was under the normal conditions of the room temperature and humidity.Heterostructures comprising of ferromagnetic CoSupplementary InformationPeer Review File"}
+{"text": "Patients with systemic lupus erythematosus (SLE) often suffer from chronic pain. Little is known about the peripheral mechanisms underlying the genesis of chronic pain induced by SLE. The aim of this study was to investigate whether and how membrane properties in nociceptive neurons in the dorsal root ganglions (DRGs) are altered by SLE. We found elevation of resting membrane potentials, smaller capacitances, lower action potential thresholds and rheobases in nociceptive neurons in the DRGs from MRL/lpr mice (an SLE mouse model) with thermal hyperalgesia. DRGs from MRL/lpr mice had increased protein expressions in TNF\u03b1, IL-1\u03b2, and phosphorylated ERK but suppressed AMPK activity, and no changes in sodium channel 1.7 protein expression. We showed that intraplantar injection of Compound C (an AMPK inhibitor) induced thermal hyperalgesia in normal mice while intraplantar injection of AICAR (an AMPK activator) reduced thermal hyperalgesia in MRL/Lpr mice. Upon inhibition of AMPK membrane properties in nociceptive neurons from normal control mice could be rapidly switched to those found in SLE mice with thermal hyperalgesia. Our study indicates that increased excitability in peripheral nociceptive sensory neurons contributes to the genesis of thermal hyperalgesia in mice with SLE, and AMPK regulates membrane properties in nociceptive sensory neurons as well as thermal hyperalgesia in mice with SLE. Our study provides a basis for targeting signaling pathways regulating membrane properties of peripheral nociceptive neurons as a means for conquering chronic pain caused by SLE. Systemic lupus erythematosus (SLE) is a chronic autoimmune disease in which the immune system mistakenly produces antibodies against the body\u2019s own tissues, causing damage in diverse tissues in the body, and various clinical manifestations. The majority of SLE patients live with chronic pain despite the reduction in mortality associated with SLE in recent years . ManagemMRL/Lpr mice are widely used as animal models for the study of SLE. MRL/Lpr mice are homozygous for a spontaneous mutation in the Fas gene, that develop immune dysregulation (production of anti\u2013double-stranded (ds)DNA antibodies) and damages in multiple organs (like kidney and joint) similar to those in SLE patients . RecentlPrimary sensory neurons located in the dorsal root ganglion (DRG) give rise to their peripheral processes to innervate the skin, muscles, joints, and visceral organs . DRG senAdenosine monophosphate-activated protein kinase (AMPK) is a key kinase that regulates cellular energy homeostasis . AMPK isIn this study, we characterized membrane electrophysiological properties in the nociceptive sensory neurons in the DRG in MRL/lpr mice with chronic pain, and defined the role of AMPK in the regulation of the electrophysiological properties and chronic pain induced by SLE.lpr (MRL/Lpr) and MRL/Mpj (control) mice were purchased from Jackson Laboratories . Animals were housed 3 to 5 per cage in isolated rooms with a 12-hour light and dark cycle (8:00 to 20:00). All experiments were approved by Institutional Animal Care and Use Committee at Mercer University, and were fully compliant with the National Institutes of Health Guidelines for the Use and Care of Laboratory Animals.Adult male MRL/MpJBehavioral tests were performed to assess thermal sensitivity on the hind paw , 4. BrieThe AMPK activator  and the AMPK inhibitor (Compound C) were respectively prepared in saline. MRL/lpr mice were randomly assigned into two groups: AICAR group receiving AICAR treatment, the control group receiving vehicle  treatment. Similarly, control MRL mice were grouped into a Compound C treatment group and a control group receiving vehicle treatment. The tested reagent or saline (in a volume of 25 \u03bcl) was injected subcutaneously (s.c.) into the mid-plantar hind paw  using a 30-G needle attached to a microsyringe as described previously , 19. The2 and 5% CO2. The bath solution contained (in mM): NaCl (117.0), KCl (3.5), CaCl2 (2.5), MgCl2 (1.2), NaH2PO4 (1.2), NaHCO3 (25.0), and Glucose (11.0). Osmolality was adjusted by sucrose to 320 mOsm. Before recording, connective tissues on the surface of DRG were carefully removed with fine forceps. A DRG with their nerve bundles was placed into recording chamber, filled with bath solution, and affixed by a tissue anchor. The DRG was then exposed to 0.05% of Collagenase A and 0.05% Dispase II enzymes for 6 min, and then continuously perfused with an oxygen-saturated bath solution at 2 ml/min. Temperature of the bath solution was set to 35\u00b0C and controlled by an inline solution heater . Whole-cell patch-clamp recordings were performed from the small sized DRG neurons (Cm<40 pF) [2 (0.5), MgCl2 (2.4), HEPES (10.0), EGTA (5.0), Mg-ATP (5.0), and Na-GTP (0.33). Osmolality was adjusted to 325 mOsm with sucrose with pH adjusted to 7.30 with KOH [Patch-clamp recording protocols described previously , 21 werem<40 pF) , 23. RecMice were deeply anesthetized with 2% isoflurane and laminectomy were performed and dorsal root ganglions between L4-L5 segments were extracted. The dorsal root ganglions were quickly frozen in liquid nitrogen and stored at -80\u00b0C for later use. The frozen tissues were homogenized with a hand-held pellet pestle in lysis buffer. Homogenates were then centrifuged at 14000 x g for 20 min at 4\u00b0C and the supernatants were collected. The quantification of protein contents was made using the BCA method. Protein samples (20 \u03bcg) were electrophoresed in 10% SDS polyacrylamide gels and transferred to polyvinylidene difluoride membrane . The membranes were blocked with 5% milk and incubated overnight at 4\u00b0C with primary antibodies against sodium channel 1.7 , TNF\u03b1 , IL-1\u03b2 , phospho-ERK , ERK , phosphor-AMPK (Thr172) , AMPK , and GAPDH . Then the blots were incubated for 1 h at room temperature with a corresponding HRP-conjugated secondary antibody , visualized in enhanced chemiluminescence (ECL) solution  for 1 min, and exposed onto FluorChem HD2 System. The intensity of immunoreactive bands was quantified using ImageJ 1.46 software (NIH). The ratio of each protein expression over the loading control protein GAPDH was calculated.Compound C was purchased from Tocris . AICAR was purchased from LC Laboratories . All other chemicals were purchased from Sigma .t-test was used to make the comparison between groups (unpaired) or within the same group (paired). Comparisons were conducted as two-tailed tests. A P-value less than 0.05 was considered statistically significant. Statistical analysis was performed using GraphPad Prism 9 .Using the Kolmogorov-Smirnov Test of Normality, we found that data in the present study does not differ significantly (P > 0.05) from that which is normally distributed. All data are presented as mean \u00b1 standard deviation (SD). One- or two-way ANOVA with repeated measures, followed by Bonferroni correction post hoc tests, was used to detect differences in nociceptive behaviors between MRL/Lpr and control mice, and between mice receiving different treatments. The Bonferroni correction, which multiplies the raw P values by the number of comparisons, was used to account for multiple comparisons and obtain the adjusted P values , 25. WheTo determine whether chronic pain develops in the lupus animal model, latencies of withdrawal response of hind paws to thermal stimuli were measured in control MRL mice (N = 9) and MRL/Lpr (N = 12) mice bi-weekly from the age of 8 weeks. We found that paw withdrawal latencies to thermal stimuli in MRL/Lpr mice (N = 12) and control MRL mice (N = 9) between 8 to 10 weeks of age were similar. At the age of 12 weeks, the paw withdrawal latencies in MRL/Lpr mice  became significantly (P < 0.05) shorter  than thoex vivo and DRG neurons were recorded using whole cell configuration. In order to selectively collect nociceptive neurons, only neurons with a small soma  and \u2264 40 pF , 27) wer \u2264 40 pF . Input r \u2264 40 pF . We founNext, we investigated whether there are differences in action potential firing patterns in the nociceptive DRG neurons between MRL/Lpr mice with chronic pain and control mice. Neurons recorded under the current-clamp mode were injected with a depolarizing current pulse at 2 times rheobase current intensity with 1 s duration. We found that the depolarizing current pulse could elicit a single AP at the initial of the depolarizing current or multiple APs throughout the duration of current injection in both control (15 mice) and MRL/Lpr (10 mice) mice. Among 24 small DRG neurons tested in the MRL/Lpr group, there were 10 neurons displaying multiple APs while the remaining 14 responded with a single AP. We found the percentage of neurons with multiple APs in the MRL/Lpr group  was not significantly different that  in the control group .+ channels while the activation of voltage-dependent K+ channels is responsible for the generation of the outward currents [To investigate the ion channel mechanisms underlying changes in membrane properties and neuronal excitability, we examined voltage-activated ion currents in both control (26 neurons from 15 mice) and MRL/Lpr mice (24 neurons from 10 mice). Under voltage-clamp configuration, current-voltage (I\u2013V) relationships were generated by applying a series of voltage steps  from holding potential (-70 mV). The voltage test pulses evoked inward and outward currents in the DRG neurons . The inwcurrents , 29. Thecurrents , 30. We Given sodium channel 1.7 (Nav1.7) is a major voltage-gated sodium channel for sensory neurons in the DRGs, we next determined the protein expression of Nav1.7 in the DRGs between L4 to L5 spinal segments. We found no significant difference in the protein expression of Nav1.7 in the DRGs between MRL/Lpr mice (4 mice) with thermal hyperalgesia and MRL control mice (4 mice) . These fGiven that AMPK is reportedly expressed in the peripheral sensory neurons , 34, we Next, we determined whether thermal hyperalgesia in MRL/Lpr mice can be ameliorated by a widely used AMPK activator, 5-amino-4-imidazole carboxamide (AICAR) . We founFinally, we postulated that deficient AMPK activity in nociceptive DRG neurons in MRL/Lpr mice is a culprit causing hyperexcitability in the nociceptive DRG neurons and thermal hyperalgesia in lupus mice. To test this hypothesis, we directly examined the effects of Compound C on nociceptive DRG neurons obtained from nine normal control mice using whole cell patch clamp techniques. After recording neuronal baseline activity, we suppressed AMPK in the recorded neurons via bath perfusing Compound C (concentration in the bath: 10 \u03bcMol) . We firsOur present study reveals peripheral mechanisms underlying the genesis of chronic pain in mice induced by SLE. We found that excitability in nociceptive sensory neurons in the DRGs of MRL/Lpr mice with thermal hyperalgesia is significantly enhanced, and suppression of AMPK activity is a culprit causing hyperexcitability in the nociceptive sensory neurons and thermal hyperalgesia induced by SLE. Our findings suggest that aberrant membrane properties and suppression of AMPK in nociceptive sensory neurons are critical mechanisms underlying peripheral sensitization induced by lupus disease.Sensory neurons have been considered as the first gate controlling nociceptive signaling. This gate is orchestrated by processes related to sensory transduction, as well as AP initiation and propagation in sensory neurons. Altered passive and active membrane properties in nociceptive sensory neurons are culprits leading to pathologic AP initiation and propagation in animals with chronic pain. Little is known about the membrane properties in nociceptive sensory neurons of mice with chronic pain caused by lupus. Our present study found that resting membrane potentials were significantly elevated in nociceptive sensory neurons of mice with chronic pain caused by lupus. Similar findings were reported in animals with neuropathic pain induced by nerve ligation , 37, spiAlthough AP durations and amplitudes were reportedly increased in nociceptive sensory neurons from animals with nerve injury  and inflMultiple signaling molecules are implicated in the regulation of resting membrane potentials in nociceptive sensory neurons. Resting membrane potentials in nociceptive sensory neurons are depolarized by pro-inflammatory mediators, like nerve growth factor , serotonV  channels, as well as Na+\u2013K+ ATPase pump [+\u2013K+ ATPase pump may be involved. Previous studies demonstrated that suppression of Na+\u2013K+ ATPase activity contributes to increased excitability in neurons [+\u2013K+ ATPase activity leads to hyperpolarization of resting membrane potential without changes in membrane resistance [+\u2013K+ ATPase activator [Previous studies have shown that resting membrane potentials in nociceptive DRG neurons are determined by conductance and activities in K2P \u201cleak\u201d channels, M channels , 4-AP-sensitive Kase pump . Reducedase pump , 49. Our neurons  while ensistance . Interesctivator , 53. The+ currents (IA currents) are considered to function as a brake to counteract membrane depolarization, and thereby modulate the AP action threshold and shape in sensory neurons [Another salient feature in nociceptive DRG neurons of lupus mice is a reduction of AP activation thresholds without a significant alteration in AP amplitudes. Changes in several ion channels knowingly contribute to the reduction of the AP threshold. Voltage-gated A-type K neurons . In the  neurons . It was  neurons . Activat neurons , 57. Con neurons , 58 whil neurons . TherefoMechanisms underlying chronic pain caused by lupus disease has been mainly investigated in female MRL/Lpr mice. It was reported that female MRL/Lpr mice with chronic pain exhibit increased excitatory synaptic activity and suppressed activity of glutamate transporters in the spinal dorsal horn , 4. SuchIn conclusion, our study demonstrated that the hyperexcitability in peripheral nociceptive sensory neurons contributes to the genesis of thermal hyperalgesia in mice with SLE, and suppression of AMPK activity in the nociceptive neurons is a culprit causing elevation of resting membrane potentials, lowering of AP thresholds and rheobases in nociceptive sensory neurons and thermal hyperalgesia. Our study provides a basis for targeting signaling pathways regulating membrane properties of nociceptive DRG neurons as a means for conquering chronic pain caused by SLE.S1 Data(XLSX)Click here for additional data file.S1 Fig(XLSX)Click here for additional data file.S2 Fig(XLSX)Click here for additional data file.S3 Fig(XLSX)Click here for additional data file.S4 Fig(XLSX)Click here for additional data file.S5 Fig(XLSX)Click here for additional data file.S6 Fig(XLSX)Click here for additional data file."
\ No newline at end of file