diff --git "a/deduped/dedup_0944.jsonl" "b/deduped/dedup_0944.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0944.jsonl"
@@ -0,0 +1,40 @@
+{"text": "Simpson-Angus Scale (SAS) is an established instrument for neuroleptic-induced parkinsonism (NIP), but its statistical properties have been studied insufficiently. Some shortcomings concerning its content have been suggested as well. According to a recent report, the widely used SAS mean score cut-off value 0.3 of for NIP detection may be too low. Our aim was to evaluate SAS against DSM-IV diagnostic criteria for NIP and objective motor assessment (actometry).Ninety-nine chronic institutionalised schizophrenia patients were evaluated during the same interview by standardised actometric recording and SAS. The diagnosis of NIP was based on DSM-IV criteria. Internal consistency measured by Cronbach's \u03b1, convergence to actometry and the capacity for NIP case detection were assessed.Cronbach's \u03b1 for the scale was 0.79. SAS discriminated between DSM-IV NIP and non-NIP patients. The actometric findings did not correlate with SAS. ROC-analysis yielded a good case detection power for SAS mean score. The optimal threshold value of SAS mean score was between 0.65 and 0.95, i.e. clearly higher than previously suggested threshold value.We conclude that SAS seems a reliable and valid instrument. The previously commonly used cut-off mean score of 0.3 has been too low resulting in low specificity, and we suggest a new cut-off value of 0.65, whereby specificity could be doubled without loosing sensitivity. Reported prevalences for neuroleptic-induced parkinsonism (NIP) in schizophrenia patients are usually in the range 19% to 36% . As NIP Simpson-Angus Scale (SAS) is a 10-item rating scale that has been used widely for assessment of NIP in both clinical practice and research settings . It consAccording to our recent study  there waAccelerometric methods have been developed to identify and monitor motor NIP symptoms, such as tremor ,19 and hThe discrepancy between SAS and DSM-IV based NIP prevalence estimates as well as other above mentioned shortcomings suggest that SAS needs an evaluation as a method to assess NIP severity and to find reliably NIP cases.Our aims were to check the internal consistency of SAS, improve the convergence between DSM IV and SAS based NIP case finding, and to evaluate how well the scale measures objective motor symptoms verified by actometry.We recruited 99 chronic schizophrenic institutionalized adult patients from a state nursing home in central Estonia . InclusiAn experienced clinician (SJ) assessed all the subjects to identify NIP cases in accordance with DSM-IV. The DSM-IV diagnostic criteria for other neuroleptic-induced movement disorders (NIMD) were also checked because of frequent comorbidity and common aetiology. Clinical NIP symptoms were assessed by SAS and the motor activity during rest was measured by actometry. Each item of the 10-item SAS is rated on a 5-point scale (0\u20134), and the mean score is obtained by adding the items and dividing by 10 . NeuroleThe actometric recording was performed during sitting in a standardized clinical interview for 30 minutes, a method described previously as measuring \"controlled rest activity\" ,21. ContCronbach's \u03b1 was assessed to evaluate the internal consistency of the scale. The correlations between the lower limb activity (the mean of right and left ankle movement indices) and individual item scores and mean SAS scores were analysed. Differences between the NIP and non-NIP, as well as the NIMD and the non-NIMD groups in the SAS mean score and lower limb activity were analysed. The performance of SAS mean score and individual item scores in case identification was evaluated by receiver operating characteristics (ROC) analyses against DSM-IV NIP diagnosis. Validity coefficients  for different mean SAS score thresholds were calculated. To explore the discriminatory power of each single SAS item we performed ROC analyses for each item separately. We also explored the effect on the validity coefficients of merging the six rigidity items of SAS into one single item, to de-emphasise the influence of rigidity on the mean SAS score. The Spearman test was used to correlation analysis and the Mann-Whitney 2-tailed U-test for the comparison between two groups because of the non-normal distribution of the data. The software used in analyses was SPSS 11.0. .Of the 99 participants, 45 (45.5%) were male and 54 (54.5%) female. The mean age was 49.7 (SD 9.5) years. The mean continuous treatment in hospital or in nursing home was 13.6 (SD 9.0) years. Seventy-nine (79.8%) patients used conventional antipsychotics  and 20 (20.2%) used clozapine (one was receiving clozapine combined with sulpiride). Low-dose antipsychotics in this study were haloperidol, cyclopentixol, perphenazine and fluphenazine; high dose antipsychotics were chlorpromazine, thioridazine, levomepromazine, chlorprotixen and sulpiride. Sixteen (16.2%) patients were receiving combinations of typical antipsychotics (either predominantly low-dose [N = 10] or predominantly high-dose [N = 6] neuroleptic regimens), and 63 (63.6%) were receiving monotherapy . No new atypical antipsychotics were used. The mean daily chlorpromazine equivalent conditions. The prevalence of any NIMD according to DSM-IV was 61.6% in the whole sample. Cronbach's \u03b1 for SAS was 0.79. dose  was 328 The SAS mean score for DSM-IV NIP patients  was significantly higher from that  of non-NIP patients . The mean scores of each single SAS item are presented in Table Actometric data was missing for one male patient due to non-co-operation. The median lower limb activity for NIP patients was not significantly higher than that of non-NIP patients . The median lower limb activity for NIMD patients was significantly higher from that of non-NIMD patients .The SAS mean score did not correlate significantly with actometric lower limb activity either in the whole population , in the NIP group , or in the pure NIP subgroup . Even after a post-hoc analysis of co-variance in the whole population, where the effect of akathisia  and tardive dyskinesia (AIMS severity score) were controlled for, no significant correlation between SAS mean score and the lower limb activity could be found .The tremor item of the SAS correlated significantly with the lower limb activity in the whole population  but not in the NIP population  or in the pure NIP subgroup . No correlation was evidenced between the hypokinesia item of the SAS and lower limb activity in the whole population  either in NIP population  or in pure NIP subgroup .No correlation was evidenced between the mean of rigidity items of the SAS and lower limb activity in the whole population  either in NIP population  or in pure NIP subgroup .ROC-curve for screening performance of SAS mean score is presented in Fig ROC-curve for screening performance of SAS mean with single averaged rigidity item was clearly inferior to the original SAS mean curve with AUC of 0.80 (CI = 0.70\u20130.89).The screening performances of the individual SAS items for NIP case finding are shown at Table As SAS elbow rigidity item had case finding power similar to SAS mean score, we calculated optimal cut-off for this item. Cut-off threshold of 1.5, with sensitivity of 0.826 and specificity of 0.974, was superior to cut-off threshold of 0.5 with sensitivity of 0.957 and specificity 0.553.Our study aimed to evaluate some of the characteristics of the SAS and its utility for identifying and measuring NIP in a naturalistic schizophrenia sample. The internal consistency of SAS was satisfactory, which suggests sufficient reliability for the scale. We compared the SAS with the DSM-IV to assess its discriminant validity and evaluate it in detecting NIP cases. The comparison with objective movement assessment aimed to estimate the concurrent validity of SAS in NIP severity measurement.As expected, the SAS had discriminant validity for a clinical diagnosis of NIMD. SAS mean score discriminated NIMD patients well from those without NIMD, and more specifically, also NIP patients from other patients. Actometry discriminated NIMD patients from non-NIMD patients, but did not identify DSM-IV NIP patients.According to ROC analysis the SAS had good case finding properties converging with the DSM IV NIP diagnosis. In our population the commonly used threshold 0.3 was inappropriate: according to our results the optimal cut-off point should be between 0.65 \u2013 0.95 depending on the emphasis in the trade-off between sensitivity and specificity. We suggest that the new cut-off value for screening NIP could be 0.65, whereby specificity could be doubled without loosing any sensitivity. To be useful for diagnostic purposes a combination of high specificity and high positive predictive value (PPV) is reached at cut-off \u2013 0.75 . To answUsing the single elbow rigidity item for case detection had the same (or slightly better) case detection capacity as the SAS mean score. This finding supports the use of elbow rigidity testing when assessing parkinsonism in clinical settings, as cut-off value 0.5 has good sensitivity and specificity for DSM-IV NIP.We found that SAS mean score did not correlate with actometric lower limb activity, and hypokinesia observed during gait item of SAS did not correlate with actometric motor activity during the 30-minute recording. There are a few explanations for that:First, actometry measures only the productive motor dimension of the parkinsonian symptoms while SAS takes into account also rigidity, gait, salivation and glabella tap, with a clear emphasis on rigidity. Lack of correlation with actometric findings in NIP subgroup indicates that tremor may not be the core feature of NIP. This is also supported by the small AUC for the tremor item of SAS.Secondly, we used lower-limb actometry while the clinical assessment by SAS and DSM-IV considered predominantly upper limbs. Parkinsonism may be more symptomatic in upper limbs, and the upper limb disturbances may have influenced our SAS and DSM IV assessments more than lower limb disturbances. Our findings indicate that lower limb actometry is not suitable for diagnosing NIP.Thirdly, diurnal naturalistic actometry may have more power in detecting hypokinesia.This study was limited to a few aspects of utility/validity of the SAS: internal consistency, convergence to DSM-IV NIP diagnosis and convergence to objectively measured motor activity. Many aspects of the scale's reliability (e.g. test-retest and inter-rater reliability) and validity (e.g. construct) were not evaluated.DSM-IV was used as a standard in this study, but there is not much data available on the validity of NIP criteria of the DSM-IV. A better golden standard in this study would probably have been an expert-consensus diagnosis. Furthermore, as there was only one rater for the scales, a cross-scale contamination issue might have occurred.It is known that with age the prevalence of spontaneous NIMD rises. Our material did not allow a thorough examination of the issue, but age correlated with SAS mean score in our sample.The measurement of motor activity here was purely quantitative; we did not assess the patterns of the disordered movements.As a conclusion, SAS seems be a reliable and a valid instrument. It performs well and similarly to DSM-IV in NIP case detection. The optimal SAS mean score cut-off value in a naturalistic population of neuroleptic-treated schizophrenia patients is higher than the commonly used 0.3. We suggest that the new cut-off value for screening NIP could be 0.65, whereby specificity could be doubled without loosing sensitivity. Combining SAS rigidity items does not seem to improve the performance of the scale.The author(s) declare that they have no competing interests.SJ contributed to the study design, collected the data, contributed to the analyses and data interpretation, made the literature search and was responsible for manuscript preparation with MMH.MMH contributed to study design, made most of the analyses and data interpretation, and was equally responsible for manuscript preparation with SJ.KT contributed to study design, statistical analysis, data interpretation and manuscript preparation.KW supervised the study design and contributed to statistical analysis, data interpretation and preparation of the manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "Interleukin-2 (IL-2) is now registered for the treatment of renal cell carcinoma in a number of European countries. The subcutaneous (sc) route of administration is being used increasingly because of its better toxicity profile compared with higher dose intravenous (iv) protocols. We report here a patient who developed a lobular panniculitis at the site of sc IL-2 injection which prevents continuation of sc therapy. Subsequent administration of the same IL-2 dose by iv injection caused recurrence of the problem again necessitating discontinuation of IL-2 treatment."}
+{"text": "Plasmodium Berghei Anka (PbA)infected. In non infected mice, incidence of apoptosis was lower in the lymph nodes of CD18-/- and uPAR -/- than in +/+ mice, as seen by FACS analysis to count the number of hypodiploidand Annexin-V binding cells. Infection of mice with PbA resulted in a marked increasein the size of spleen and lymph nodes 7\u20138 days after infection, which was slightly higher inuPAR -/- and CD18 -/- than in +/+ mice. PbA infection increased about 7 fold the incidence ofapoptosis in the lymphoid organs of +/+, especially in the white pulp and germinal centers ofthe spleen and lymph nodes, while in contrast it was unchanged in PbA infected CD18 -/- oruPAR -/- mice. Serum IgG levels, and number of circulating leukocytes were significantlyhigher in both uPAR and CD18 -/- than in +/+ mice. These results indicate that the CD18 anduPAR surface molecules, which are known to be associated in the cell membrane, have animportant influence upon the incidence of cell survival in both normal or stimulated lymphoidorgans.Incidence of apoptosis was investigated in the spleen and lymph nodes of +/+, CD18 -/- andurokinase receptor  -/- mice, untreated or"}
+{"text": "C1QTNF5 gene product causes autosomal dominant late-onset retinal macular degeneration (L-ORMD) in humans, which has clinical and pathological features resembling age-related macular degeneration. We generated and characterised a mouse \u201cknock-in\u201d model carrying the Ser163Arg mutation in the orthologous murine C1qtnf5 gene by site-directed mutagenesis and homologous recombination into mouse embryonic stem cells. Biochemical, immunological, electron microscopic, fundus autofluorescence, electroretinography and laser photocoagulation analyses were used to characterise the mouse model. Heterozygous and homozygous knock-in mice showed no significant abnormality in any of the above measures at time points up to 2 years. This result contrasts with another C1qtnf5 Ser163Arg knock-in mouse which showed most of the features of L-ORMD but differed in genetic background and targeting construct.A single founder mutation resulting in a Ser163Arg substitution in the  Late-onset retinal macular degeneration (L-ORMD) is a fully penetrant autosomal dominant disorder associated with a late-onset macular degeneration resembling age-related macular degeneration (AMD) C1QTNF5) gene C1QTNF5  encodes a short-chain collagen which is strongly expressed in RPE, ciliary epithelium and adipose tissue MFRP) MFRP is expressed as a dicistronic transcript with C1QTNF5Mfrp rd6 mutant, which is associated with retinal degeneration et al. reported that the expression of C1QTNF5 is increased in mtDNA-depleted myocytes and that it stimulates the phosphorylation of AMP-activated protein kinase L-ORMD is caused by a single founder Ser163Arg mutation in the Complement 1q Tumour Necrosis Factor 5  cassette flanked by flippase (Flp) recombination target (FRT) sites in order to remove the neo cassette following successful targeting  cells and 271 G418 (neo) resistant clones were isolated. These were initially screened by polymerase chain reaction (PCR) amplification, which identified 10 potentially targeted clones, which were further characterised by PCR, Southern blotting and sequencing (data not shown). Four ES cell clones with the C1qtnf5 Ser163Arg neo allele present were fully validated and 3 of these were injected into C57BL/6J mouse blastocysts to generate chimaeric mice. Two highly chimaeric males (with 85% and 98% chimaerism) were each mated with two Flp recombinase deleter C57BL/6J females to remove the neo cassette. Two mice  were found to be mosaic for the Ser163Arg mutation in the F1 progeny. The two mosaic mice were each mated with wild-type mice, which gave rise to 15 pups. The 15 animals were screened by PCR to determine whether complete excision of the neomycin cassette had occurred at the targeted C1qtnf5 locus. Five animals were heterozygous for the C1qtnf5 Ser163Arg mutation and were validated by Southern blotting and sequencing  and homozygous (C1qtnf5Ser163Arg/Ser163Arg) mice were fertile, with normal weight and lifespan, and did not show evidence of systemic disease.Both human C1QTNF5 and mouse C1qtnf5 proteins contain 243 amino acids with 94% identity. In humans, the Ser163Arg mutation is caused by a single point mutation in codon 163 (AGC>AGG) changing the encoded serine to an arginine residue. In the mouse, serine is also encoded by an AGC codon, therefore the same point mutation (AGC>AGG) in mouse argeting . LoxP siquencing . IntercrC1qtnf5 Ser163Arg allele was found by reverse transcriptase PCR (RT-PCR) to be expressed at similar levels to the wild-type allele, showing that the introduction of the mutant allele did not affect its expression  mice were also similar to wild-type . This suggests that the observed RPE damage increases with age in all three groups and so is most likely to be due to normal ageing and not to an effect of the Ser163Arg KI allele. These findings are very similar to those in a previous study, in which we also showed a significant increase of RPE damage with age in wild-type mice over a period of 2 to 24 months To assess any possible differences in age-related RPE pathology between wild-type, heterozygous or homozygous mutant C1qtnf5+/Ser163Arg and C1qtnf5Ser163Arg/Ser163Arg KI mice at 15\u201316 months of age respectively. There was no significant difference in autofluorescence in inner and outer retina between wild-type and C1qtnf5 Ser163Arg KI mice, although the number of autofluorescence spots in the inner and outer retina of C1qtnf5Ser163Arg/Ser163Arg mice were slightly greater than those of wild-type mice but this was not statistically significant  in three wild-type, nificant .C1qtnf5 Ser163Arg KI mice at 10\u201312 and 15\u201318 months of age (C1qtnf5 Ser163Arg KI mice were similar to each other and to wild-type (276\u00b156 \u00b5V) mice (P>0.05). Cone b-wave amplitudes in homozygous (122\u00b123 \u00b5V) and heterozygous (109\u00b120 \u00b5V) C1qtnf5 Ser163Arg KI animals were also similar to each other and to wild-type (115\u00b123 \u00b5V) mice (P>0.05). Recovery of the a-wave (expressed as a fraction of dark-adapted results) in both homozygotes (0.38\u00b10.08) and heterozygotes (0.45\u00b10.10) reached levels comparable to those of wild-type (0.43\u00b10.09) mice (P>0.05).The electroretinogram (ERG) was used to assess retinal function in s of age . Represes of age . Rod a-win vivo fluorescein angiography and immunohistochemistry. There was no obvious difference between the CNV laser lesions at 1 and 2 weeks post-laser in wild-type mice compared to those in C1qtnf5 Ser163Arg KI mice , choroidal neovascularization or retinal atrophy Mouse models of human inherited retinal diseases have proved to be invaluable tools for the analysis of disease mechanisms and, more recently, for evaluating therapy C1qtnf5 Ser163Arg knock-in mice up to 24 months is therefore disappointing but by no means unprecedented in view of the mixed success with mouse models of late-onset macular degeneration. The lack of a macula in the mouse seems unlikely to be a problem since L-ORMD becomes a pan-retinal disease in the later stages. Another possible factor is the short lifespan of the mouse compared with humans, in whom it may take 60\u201370 years to develop the full disease et al.et al.C1qtnf5 deletion knockout) and FRT sites flanking the neomycin selection cassette but these, together with the S163R mutation, were introduced into a bacterial artificial chromosome (BAC) containing the Mfrp and C1qtnf5 genes rather than our approach in which right and left arms were PCR amplified and cloned separately into a plasmid construct and the mutation introduced by standard site directed mutagenesis. In our study, expression of both Mfrp and C1qtnf5 were found to be unaffected in the resultant knock-in mice compared with wildtype  cell and maintained the resultant knock-in mice on a 100% C57BL/6J genetic background whereas the present mouse model was constructed using a targeted 129SV ES cell and analysed on a mixed 129SV and C57BL/6J background.The lack of overt phenotypic abnormality in wildtype . The exphttp://phenome.jax.org/) Rpe65 locus, has proved useful C1qtnf5 knockout mice reported here and by Chavali et al.Phenotypic differences in mouse models of human disease are commonplace, as are effects of genetic backgrounds  and extends for 7.5 kb. The Mfrp/C1qtnf5 gene is composed of 14 exons which are expressed in a 4.22 kb bicistronic mRNA. The mouse Mfrp protein is encoded by exons 1 to 13, while the C1qtnf5 protein is encoded by exons 13 and 14  homology arm which contained exons 7 to 13 and part of exon 14; the short (3\u2032) homology arm containing the 3\u2032 end of exon 14 and the region located downstream of the Mfrp/C1qtnf5 gene; and a central fragment, containing a portion of exon 14. The Ser163Arg mutation (base change AGC to AGG) in C1qtnf5 exon 14 was then introduced by site-directed mutagenesis into the central fragment . Positive selection was started 48 hours after electroporation by addition of 200 \u00b5g/ml of G418. G418-resistant clones were screened for the correct homologous recombination event by PCR and southern blotting. Three ES clones were used to inject into C57BL/6J blastocysts and a total of 19 chimeric mice were produced from the three injection sessions. Two highly chimeric males (displaying 85% and 98% chimerism) were each mated with two Flp-deleter C57BL/6J females to get heterozygous mice carrying the mutated C1qtnf5 allele devoid of the neo selection cassette. Agouti F1 progeny were screened for assessing the Flp-mediated excision event of the neo cassette on the C1qtnf5 targeted allele by PCR and southern blotting, using genomic DNA isolated from tail biopsies  fragment corresponding to the wild-type allele and a 548 bp fragment for the mutant (Ser163Arg) allele using the following primers:-The 3 and 14 . We emplfragment . The abofragment  was tranbiopsies . As therGAGATGAGTAGTTCCTGAGATGACCACAAGGForward primer WRI1-F; TTGGCAAACCTGGGTGTGTTATCGReverse primer WRI1-R; The annealing temperature was 65\u00b0C (30 secs) and amplification was continued for 35 cycles.in vivo procedures, the mice were anesthetized by a single intraperitoneal (i.p.) injection of a mixture of medetomidine hydrochloride , and ketamine (60 mg/kg body weight) in water. Whenever necessary, the pupils were dilated with 1 drop of 1% tropicamide.For Autofluorescence imaging was performed using a HRA2 scanning laser ophthalmoscope with a 55\u00b0 angle lense as described previously C1qtnf5 Ser163Arg KI  mice and age-matched wild-type mice (n\u200a=\u200a25) were dark adapted (>12 hours) and anesthetized with ketamine HCl (65 mg/kg) and xylazine (5 mg/kg) intramuscularly under dim red light. Pupils were dilated with 1% tropicamide and 2.5% phenylephrine. Medium energy (10-\u00b5s duration) and high energy (1-ms duration) flash stimulators with unattenuated luminances of 0.8 and 3.6 log scot-cd \u00b7 s \u00b7 m\u22122, respectively, were used. Neutral density  and blue  filters served to attenuate and spectrally shape the stimuli. Dark-adapted ERGs were obtained with a single blue 2.2 log scot-cd \u00b7 s \u00b7 m\u22122 flash. After a 2 minute wait, a series of three white flashes (3.6 log scot-cd.s.m\u22122) were presented in the dark at \u223c5-sec intervals which completely suppresses the murine, rod-dominated ERG a-wave. The bright blue stimulus was presented again within 30 seconds of this bleaching light and this elicits an ERG dominated by a cone-mediated b-wave. Next, the extent of recovery of the dark-adapted (DA) rod mediated a-wave was assessed 10 minutes later by recording a further response to the bright blue stimulus. The b-wave amplitudes were measured conventionally, from baseline or a-wave trough to positive peak; a-wave amplitudes were measured from baseline to the trough of the a-wave.ERGs were recorded according to previous methodology in vivo FFA was performed by i.p. injection of 200 \u00b5l of 2% fluorescein in PBS and imaging of the fundus at 90 seconds (early) and 7 min (late phase) after fluorescein injection using a small animal fundus camera with appropriate filters . The pixel area of CNV-associated hyperfluorescence was quantified for each lesion using image-analysis software . Endothelial cells were labelled with TRITC-conjugated lectin BS-I  at a 1\u223610 dilution .Laser-induced CNV and quantification with fundus fluorescein angiography (FFA) were performed as described previously http://rsb.info.nih.gov/ij/). The thickness of Bruch's membrane (BM), defined from the basal lamina of the RPE cell to the basal lamina of the choroidal vessel, was measured in a uniform, randomized way to prevent a potential bias in the observer's choice. The average BM thickness in each eye was obtained from single images taken at a standard magnification of 5000, positioned approximately 1 mm on each side of the optic nerve. After the calibration of Image J, BM was rotated to the horizontal or vertical, and a grid was superimposed on the image. Ten measurements were taken at points where grid lines passed across BM to yield an average value. Finally, the average measurements for superior and inferior field were added, and a mean value \u00b1 SD was obtained for BM thickness in each animal.Semithin and ultrastructural analyses were performed as previously described C1qtnf5 knock-in mice between 6 and 24 months of age and in lentivirus treated C57BL/6 mice between 5 and 16 weeks post injection, we assessed the respective sections (semithins for the knock-in line and cryosections for the lentivirus treated mice) under bright field microscopy using a 100\u00d7 objective and a 10\u00d7 ocular lens, and counted the number of separate individual pathological events, such as cell lysis, pyknosis, swelling, thinning, proliferation and thickening of RPE from the superior to the inferior end of the retina, in each section. From the individual sums of damage per section we calculated the mean sum of RPE alterations from three sections per animal to obtain a representative measure of the RPE damage score per animal, according to a scheme described by Hollyfield et al.To evaluate pathological effects of the Ser163Arg allele in 4 HeLa cells were plated in DMEM+10% FCS+antibiotic/antimycotic (D10) in 96-well plates and incubated overnight. On the following day, cells were infected with either LNT.CTRP5-WT or LNT.CTRP5-Mut in D10. At 72 h post-infection, cells well fixed with ice-cold methanol, washed with PBS containing 0.05% Tween-20 (PBS-T). Cells were blocked with 3% BSA in PBS-T for 1 hr at room temperature (RT) before they were incubated with rabbit-anti-CTRP5  as previous described Total RNAs from mouse eye cup tissues were extracted using RNAeasy Mini kit (QIAGEN) according to the manufacturer's instructions. Two micrograms of the resulting RNA was reverse transcribed with random primers using a Transcriptor High Fidelity cDNA Synthesis Kit (Roche). The cDNAs of C1qtnf5 Ser163Arg knock-in mice were lysed in a buffer containing 50 mM Tris-Cl pH 7.5, 150 mM NaCl, 1% NP-40, 0.5% deoxycholate, 0.05% SDS, 2 mM EDTA, 1 mM sodium-vanadate, 5 mM sodium-fluoride and 10 mM iodoacetamide with a protease inhibitor cocktail (Roche). The lysates were centrifuged for 10 min at 13,000 rpm and the post-nuclear supernatants were collected. Equal amounts of protein were electrophoresed on 10% SDS-polyacrylamide gels and transferred to a nitrocellulose membrane. The primary antibodies were used at 1\u22361,000 dilution for anti-C1QTNF5 and 1\u22362,000 dilution for anti\u03b2-tubulin antibodies. HRP-conjugated secondary antibodies were used at 1\u22365,000 dilution. The membrane-bound antibodies were detected by ECL (Amersham Biosciences).Eyecups from wild-type, heterozygous and homozygous C1qtnf5 wild type or the murine C1qtnf5 Ser163Arg mutant cDNA or the GFP reporter gene (Lenti.GFP). All vectors contain deletions in the 3\u2032 long-terminal repeats, making them self-inactivating, and include the central polypurine tract (cPPT), which is necessary for second-strand DNA synthesis, and may enhance the nuclear transport of the provirus. All cDNAs are driven by the spleen focus-forming virus (SFFV) promoter and each vector contains the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) to stabilize mRNA and increase expression. Vectors were produced using transient triple transfection of 293T cells as described previously Second generation HIV-1-based self-inactivating lentiviral vectors pseudotyped with the vesicular stomatitis virus glycoprotein envelope contained either the murine 8 particles/ml) into the subretinal space to produce a bullous retinal detachment in the superior hemisphere and a second in the inferior hemisphere. Mice received C1qtnf5-wild type virus in one eye and C1qtnf5-Ser163Arg mutant virus in the other eye. Control mice received PBS or titre-matched Lenti.GFP. Retinal vessels remained patent during and following the injections. All animals received chloramphenicol 1% eye ointment to the cornea.Subretinal administration of vectors was performed in anesthetized 12 to 16-week-old C57BL/6 mice (Harlan UK Ltd.), under direct retinoscopy through an operating microscope as previously described Statistical analyses were performed using GraphPad Prism 5 for Windows . Changes in the thickness of Bruch's membrane or in RPE damage with age were assessed using Pearson correlation statistics, a parametric measure of association for two continuous random variables. Differences in autofluorsecence were assessed using a Kruskal-Wallis with Dunn's multiple comparison test. RPE and outer nuclear layer disease scoring was assessed on randomized images using a one-way analysis of variance."}
+{"text": "As public awareness of consequences of environmental exposures has grown,estimating the adverse health effects due to simultaneous exposure tomultiple pollutants is an important topic to explore. The challenges ofevaluating the health impacts of environmental factors in a multipollutantmodel include, but are not limited to: identification of the most criticalcomponents of the pollutant mixture, examination of potential interactioneffects, and attribution of health effects to individual pollutants in thepresence of multicollinearity.In this paper, we reviewed five methods available in the statisticalliterature that are potentially helpful for constructing multipollutantmodels. We conducted a simulation study and presented two data examples toassess the performance of these methods on feature selection, effectestimation and interaction identification using both cross-sectional andtime-series designs. We also proposed and evaluated a two-step strategyemploying an initial screening by a tree-based method followed by furtherdimension reduction/variable selection by the aforementioned five approachesat the second step.Among the five methods, least absolute shrinkage and selection operatorregression performs well in general for identifying important exposures, butwill yield biased estimates and slightly larger model dimension given manycorrelated candidate exposures and modest sample size. Bayesian modelaveraging, and supervised principal component analysis are also useful invariable selection when there is a moderately strong exposure-responseassociation. Substantial improvements on reducing model dimension andidentifying important variables have been observed for all the fivestatistical methods using the two-step modeling strategy when the number ofcandidate variables is large.There is no uniform dominance of one method across all simulation scenariosand all criteria. The performances differ according to the nature of theresponse variable, the sample size, the number of pollutants involved, andthe strength of exposure-response association/interaction. However, thetwo-step modeling strategy proposed here is potentially applicable under amultipollutant framework with many covariates by taking advantage of boththe screening feature of an initial tree-based method and dimensionreduction/variable selection property of the subsequent method. The choiceof the method should also depend on the goal of the study: risk prediction,effect estimation or screening for important predictors and theirinteractions. As public awareness of consequences of environmental exposures has grown, estimatingthe adverse health effects due to simultaneous exposure to multiple pollutants iscurrently an important topic to explore .It can 2.5) has been one of the mostfrequently studied pollutants = and thecovariance matrix =1.00,i=1,\u2026,4, and off-diagonal elements =0.52,2, PM2.5 and SO2in the Detroit Asthma Morbidity, Air Quality and Traffic (DAMAT) study, whereeach of the pollutants were standardized to have a unit variance [X to denote a 20-component vector from a multivariate lognormaldistribution with the mean\u03bc=E[X]=,\u03bci=1.00, i=1,\u2026,20, and thecovariance matrix j=1,\u2026,5, i\u2260j; and\u03a32 denotes an identity matrixI15*15.Lognormal distribution is an empirically justified density for many pollutantconcentration levels . Amultivariance . SimilarY given X in the cross-sectional study. We considered thetrue generation model to be a standard multiple linear regression modelincluding main effects of a subset of pollutants and some pairwise interactions,as follows:A normal linear regression model was used to generate the continuous outcome\u03f5 was assumed to be independent and follow a normaldistribution \u03f5\u2009~\u2009N.Regression coefficients were pre-specified: in simulation Scenario 1(K=4), \u03b20 =0.1, \u03b22=\u03b23=0.5, \u03b2i=0,i=1,4, \u03b323=0.2,\u03b3ij=0, \u2260; and in simulation Scenario 2 (K=20),\u03b20=0.1,\u03b21=\u03b22=\u03b26=\u03b27=0.5,\u03b2i=0, i\u22601, 2, 6 or 7,\u03b312=\u03b316= \u03b367 =0.2,\u03b3ij=0, \u2260,  or . This choice of the error distributionand regression coefficients ensures that the ratio of the sum of squares forregression to the total sum of squares R2 was fixedat the level of 0.25. For each simulation scenario, we simulated 1000 datasetsof a moderate sample size 250. No confounding factors were taken into accountfor the purpose of simplicity.where Xt  corresponding todaily exposure measurements on a period of 400\u00a0days was generated by anautoregressive model depending on previous 10\u00a0days. Specifically,Under the time-series design with four pollutants, the multivariate vectorci  denotes theconstant vector controlling for the seasonal effect ofXt, \u03d5kj isthe partial autocorrelation function (PACF) coefficient for thek-th pollutant at lag day j,k=1,\u2026,4 and j=1,\u2026,10. Specification of seasonaleffects and PACF coefficients were estimated from data in the DAMAT study[where AT study , daily average relative humidity (RH), smooth functionSpline(.) of daily average temperature (Temp) and day of the study(t). Next, the estimated counts of asthma eventsIn this model, \u03c8t refers to the time-varying mean counts (afterremoving the effect of the confounding factors), main and interaction effects offour pollutants were specified as\u03b21=\u03b23=0.3,\u03b2i=0, i\u22601 or 3,\u03b313=0.1,\u03b3ij=0, \u2260. Time-series asthma counts of length 400\u00a0daysrepresenting an average number of 13.3 counts/day were then generated fromPoisson distributions with mean \u03c8t.where \u03bc=,\u03bci=1.00, i=1,\u2026,10 andcovariance matrix i=1,\u2026,4, 2 refers to an identity matrixI6*6. Seasonal effects were the same as in thefour-pollutant framework, while PACF coefficients were obtained from the DAMATdata under an autoregressive model on previous 5\u00a0days for reducedcomplicity \u2260 or . Considering the increased number of pollutants involved, dailycounts were simulated for 800\u00a0days with an average rate of 14.7 events/day.Although some time-series studies have assessed health effects of exposure tomultiple pollutants on longer time scales, relative performances of differentstatistical methods should remain similar given the sample size we chose.Time-series counts for simulation Scenario 4 were generated in a similar fashion,but assuming a ten-pollutant multivariate structure with meanIn addition to the simulation study, we applied the above methods to data fromthe National Health and Nutrition Examination Survey (NHANES) collected between2005 and 2008. NHANES is an ongoing cross-sectional study designed to measuresubject exposure to various environmental chemicals, dietary intake patterns,and various health outcomes . OurpreIn this combined dataset, we included subjects aged 12 and up with complete dataon all exposures, outcomes, and covariates, containing age, ethnicity, andpoverty income ratio used in the sampling process, and gender, body mass index,serum cotinine, and urinary creatinine considered to be correlated with theoutcome, which resulted in a final sample size of 3,773. The populationdistribution by covariates is presented in Additional file p-value in thesingle-exposure regression model was retained  Wefirst regressed the outcome (bilirubin or GGT) on the covariates listed aboveand used the residuals from the regression model as the response for modelselection in the following steps. 2) We performed correlation analysis toassess the presence of collinearity within each group of environmental exposures study. Li et al. (2011) analyzed time-series count data from2004\u20132006 on asthma morbidity in the pediatric Medicaid population ofDetroit, Michigan. Concentrations of pollutants PMt models . We now2, SO2 and PM2.5, andmeteorological data including temperature and relative humidity, were alsoobtained for this study period. Previous analyses suggested strong evidence ofrise in daily asthma events with increasing 3-day lag of concentrations forSO2 and PM2.5, so this lag specification of airpollutants was used as exposure variables. The mean 3-day lag of air pollutantswere 0.43\u00a0ppm for CO, 16.8\u00a0ppb for NO2, 3.78\u00a0ppb forSO2, and 15.0\u00a0\u03bcg/m3 for PM2.5.This study design corresponds to Scenario 3 in our simulation analyses:time-series data with a count response and four air pollutants measured at 3-daylags.Daily asthma events were identified from emergency department visits andhospitalizations for the Detroit Medicaid-insured population, and furtherrestricted to children 2\u201318\u00a0years of age due to the difficulty ofasthma diagnosis for children under 2. A total of 12,933 asthma events wereobserved from 7,063 children during the 1,096\u00a0days, representing an averagerate of 11.8 events per day . DailymX\u2019s represent the fourexposures. Note that this two-step approach is adopted only due to a logisticalinconvenience that some of the model selection tools available in existingstatistical software do not allow inclusion of a set of \u201cforcedvariables\u201d in the model without performing variable selection on this setof confounders. Ideally, one would work with a single model that performsvariable selection in the presence of confounders to be adjusted for.To control for the temporal pattern and weather effects in the time-series data,we applied the two-stage generalized linear model (GLM) as described in the datageneration of Scenario 3 in the simulation. The estimated daily counts from thefirst Poisson regression in (12) were used as an offset in the second Poissonregression model in (13) where the The collection of main effects and pairwise interactions identified to beassociated with the outcome within each method were incorporated into an omnibusGLM, with confounding factors such as year, season, DOW, time, RH and Tempadjusted and potential over-dispersion considered. Finally, a proposed modelwith non-significant exposure variables eliminated was constructed.Under each simulation configuration, we generated 1000 datasets. For eachexamined study design, we present the average of estimated effects with theirempirical standard errors for non-zero predictors, the percentage of modelscorrectly identifying the non-zero coefficients, and the average model size over1000 replicates for five different statistical methods . We also considered additional measures, including false positive rate(FPR), true positive rate (TPR), and mean squared error (MSE) for thecoefficients corresponding to truly null and truly associated predictors, tohelp evaluate the performances of competing statistical methods as displayed inAdditional file 1 and the loading factors of predictors in theconstruction of first principal component \u03b11s (i.e.Zs\u2009\u2208\u2009Z\u2009'). InBMA analysis, predictors were considered to be identified if their posteriorprobabilities exceeded 10%, where the cut-off value was chosen in an ad-hocmanner. In the presence of a long list of candidate pollutants, we also assessedidentification and estimation of non-zero coefficients using a two-step modelingstrategy, which employs an initial screening by CART followed by furtherdimension reduction/variable selection by the five methods at the second step.This strategy was not used in the time-series studies because existing packagedoes not apply CART to count data. The main findings of the simulation study aresummarized as follows.For the ease of interpretation, the regression model in SPCA was fit on the firstprincipal component of the reduced matrix Z\u2019, and accordingly theestimated effects of predictors highly associated with the outcome can beexpressed as the products of estimated regression coefficient for the firstprincipal component bK=4). Note that LASSO estimates of non-zero coefficients are the leastbiased and most efficient, with smallest MSE among all methods as displayed inAdditional file Table\u00a0bma package, and a stepwise procedure isapplied automatically to eliminate the redundant explanatory variables. Amongfour available approaches, none of these methods appear to be a desirable choicein terms of variable selection because an appreciable number of null predictorsare included conservatively, but LASSO regression is much superior to others.Compared to the results from simulation Scenario 1, estimated main effects fromLASSO regression are shrunk heavily in order to induce a sparse model andcompensate for the instability caused by multicollinearity. Interestingly,estimation for interaction effects by LASSO regression appears to be robust, andits interaction detection rate remains high. DSA algorithm also selects smallmodels, yet it has a very limited ability of identifying interactions. SPCA hashigh detection rates for all non-zero coefficients, but the use of this methodis restricted by its considerably large FPR and average model size. The MSE ofnull predictors within PCA-based methods (i.e. SPCA and PLSR) has been foundmuch smaller and this may relate to the weak associations between nullpredictors and the outcome considered in the construction of principalcomponents , whereas other pollutantsless than 13%. This result suggests that as an exploratory procedure forvariable selection, CART is able to detect important variables and reduce thenumber of variables for regression model. Compared to the simulation results inTable\u00a0CART is widely used for detecting complex effects among a large number ofexplanatory variables, so as an alternative strategy we decided to apply CART tothe complete set of candidate predictors prior to the five regression methods.The simulation results from this two-step strategy are given in Table\u00a0Table\u00a0A large number of candidate predictors in a time-series setting can becomputationally intensive, so we simulated daily counts with 10 air pollutantsand present results regarding relative performances of four approaches inTable\u00a0Table\u00a0p\u22640.001) but wouldmiss a few weaker associations. For instance, among five significantinteractions in the omnibus model for outcome GGT, the most significant two orthree were typically detected by BMA and SPCA. Similar as in the simulation, DSAperforms poorly by failing to detect any interactions either for bilirubin orGGT.Examining results from the NHANES data suggest the usefulness of CART in featureselection. LASSO regression identifies all the significant main effects andinteractions in the omnibus models but yields slightly large models. BMA andSPCA detect highly significant interactions  is the coefficient vector of the g-thgroup, g = 1,\u2026,G. It has the attractive property ofperforming variable selection at the group level and is invariant under groupwiseorthogonal transformations like ridge regression [In this equation, gression ,77. Anotgression ,781 and \u03bb2 referto the tuning parameters for L1 andL2 norm penalty. As a compromise between ridgeand lasso regression, the elastic net has the characteristic of both selectingvariables like LASSO and shrinking the regression coefficients of correlatedpredictors like ridge. Therefore, it outperforms LASSO regression by encouraginggrouping effects and improving the prediction accuracy when there are highcorrelations between predictors [where edictors ,78. BothAs a nonparametric technique, CART is well suited for exploring complex relationshipsunder a multipollutant framework, however, it is limited by the fact that enforcingmonotonicity constrains in building a regression tree is not possible. Some ideashave been provided in the construction of monotone classification trees. Potharstand Bioch suggested imposing monotonicity constraints by adding corner elements ofnodes to the existing data . FeelderIn this study, we proposed a two-step strategy for estimating health effects when alarge number of candidate pollutants exist. As an initial step, we use CART toexplore the associations between individual pollutants and the response. At thesecond step, different methods  are applied to thesubset of important pollutants selected by CART. The advantage of this two-stepstrategy comes from the reduction of some less important dimensions at the firststep, and consequently the signal in the dataset carried forward to the second stepis boosted. However, in real data analysis, there is possibility that a true effectfailed to be identified at the initial step given a weak exposure-responseassociation will be missed in the regression model. Therefore, the performance ofthis two-step strategy depends heavily on the initial screen by CART. Compared tounivariate associations assessed in the first step of SPCA, CART uses theinformation from the set of all candidate variables as a whole and examines thecomplex interactions among exposures and responses, thus we expect this two-stepmodeling strategy to be adaptable in a multipollutant context.2, PM2.5)[One limitation of our study is that only linear main effects and linear interactionterms between pollutants were assumed in our simulation and data analyses, however,this assumption may not always be true as evidences of nonlinear relationship, suchas threshold effect, polynomial effect or other non-parametric relationship, havebeen provided in multiple studies ,82-84.A, PM2.5),93,94, bAmong the five methods evaluated for regression analysis, there is no uniformdominance of one method across all examined simulation scenarios and data examples.Assuming that exposure distributions are reasonably approximated by lognormaldistributions and the strength of correlations among pollutants is moderate, theperformances of competing methods differ according to the nature of the responsevariable, the sample size, the number of exposure variables involved, and thestrength of exposure-response association. In addition, supported by our results,the two-step modeling strategy proposed in this paper is potentially applicableunder a multipollutant framework by taking advantage of both the screening featureof CART and dimension reduction or variable selection property of the subsequentstatistical method. Extension of these methods under complex sampling schemes andcorrelated data with accompanying software packages merits further development.Characterizing uncertainty in appropriate ways to proceed with tests of significanceand construction of valid confidence intervals (often with biased estimates)following the variable selection/shrinkage methods we have discussed is a veryimportant problem that is not fully resolved. This is typically done by advancedbootstrap or resampling strategies that is non-trivial and computation intensive.Bayesian methods have an advantage of providing measures of uncertainty based on theexact draws from a posterior distribution, an idea that translates to complexmodels. In this paper we have not discussed fully Bayesian methods. Bayesianapproaches require a complete and thorough independent study.Modeling of non-linear and complex exposure surfaces that are truly high dimensionalis a daunting problem, recent attempts toward targeted estimation of parameters thatare relevant for policy-making using reduced hierarchical models are extremelynoteworthy in this context . AfterbPM2.5: Particulate matter less than 2.5 micrometers in diameter; PM10-2.5:Particulate matter between 2.5 and 10 micrometers in diameter; CO: Carbon monoxide;SO2: Sulfur dioxide; NO2: Nitrogen dioxide; O3: Ozone; BMA: Bayesian modelaveraging; DSA: Deletion/Substitution/Addition; LASSO: Least absolute shrinkage andselection operator; PLSR: Partial least-square regression; SPCA: Supervisedprincipal component analysis; PACF: Partial autocorrelation function; DOW: Day ofthe week; Temp: Temperature; RH: Relative humidity; NHANES: National Health andNutrition Examination Survey; DAMAT: Detroit Asthma Morbidity, Air Quality andTraffic; FPR: False positive rate; TPR: True positive rate; MSE: Mean squarederror.The authors declared that they have no competing interests.ZS conducted simulation studies, performed data analysis of the second example, anddrafted the manuscript. YT assisted in simulation studies, performed statisticalanalysis of the first example, and drafted portions of the article. SL has beeninvolved in data cleaning and statistical analysis of the second example, anddrafted portions of the article. KKF helped to clean data for the first example,drafted portions of the article, and edited the article carefully. JDM designed thestudy of the first example and edited the article. SKP provided insightful comments.SAB designed the DAMAT study and revised the article critically. BM conceived thestudy, directed its implementation and coordination, provided statisticalmethodology insights, and edited the article. All authors have read and approved thefinal manuscript.Annotated R-codes.Click here for fileSupplemental material.Click here for file"}
+{"text": "Metabolic profiles in localized regions were obtained using HR-MAS Slice Localized Spectroscopy and Chemical Shift Imaging at high magnetic fields. These methods enabled measurement of metabolite contents in anatomic regions of the fly, demonstrated by a decrease in \u03b2-alanine signals in the thorax of flies showing muscle degeneration.We have developed new methods enabling  For example, it has been used to study intact tumors67in vivo metabolic profiles of bacteriaC. elegans worms11Drosophila melanogaster flies131H HR-MAS NMR offers a direct access to metabolic phenotypes. However, the one-dimensional (1D) spectra of whole organisms remain complex and, while several metabolites can be directly identified and quantified, some 1H peaks cannot be assigned to specific molecules due to spectral overlap. This limitation is usually overcome using appropriate two-dimensional (2D) homonuclear (1H-1H) and/or heteronuclear (1H-13C) correlation experiments which provide enhanced spectral resolution allowing distinct overlapping signals to be discriminated and assigned123813High-resolution magic angle spinning (HR-MAS) proton nuclear magnetic resonance H NMR spein vivo localized NMR measurements in small organisms require much higher spatial resolution than that needed to study larger animal models. In this study, we introduce two new 1H HR-MAS NMR methods to spatially localize metabolites in a small living organism and demonstrate their promising applications in in vivo metabolic profiling in the case of drosophila, a widely used genetic model.Although these HR-MAS methods enable metabolic profiling in small organisms, they do not enable localizing metabolites in different parts of the body or specific organs. Adding spatial resolution provides important additional information, as it allows assigning metabolites to specific regions of the organism and even evidencing subtle change of metabolite concentrations in these regions. However, 1H HR-MAS Slice Localized Spectroscopy (SLS) and HR-MAS Chemical Shift Imaging (CSI), provide direct information about the spatial distribution of metabolites along the anteroposterior body axis of the specimen studied. As mentioned above, localization in small organisms such as drosophila requires increased spatial resolution and thus high sensitivity. The experiments therefore greatly benefit from the use of a high magnetic field (17.6 T) which enhances both sensitivity and spectral resolution. Performing in vivo HR-MAS measurements in drosophila also requires a viable environment minimizing the centrifugal forces induced by rapid sample spinning. For this purpose, the anteroposterior axis of the fly is aligned along the spinning axis by positioning the insect in a shaped insert in the center of the rotor. This allows the use of spinning frequencies up to 2.7 kHz while keeping the fly alive (without observable damage). Under these experimental conditions, spatial localization along the anteroposterior body axis of the living fly is obtained simply using pulsed magnetic field gradients along the MAS axis corresponding to the usual orientation of gradient coils in HR-MAS NMR probes. With HR-MAS SLS, a localized 1D 1H spectrum is obtained by selecting a transverse slice of the fly body with a defined thickness (http://creativecommons.org/licenses/by-sa/4.0/), while HR-MAS CSI provides a 2D map of spatially arrayed 1H spectra along the whole fly body  showing degenerative muscle hypercontraction of indirect flight muscles was used171H HR-MAS SLS spectrum of the thorax was recorded in vivo. A significant decrease in the \u03b2-alanine concentration in the thorax (about four times less) of the mutant with respect to Oregon-R was observed  and this result was found to be highly reproducible  are easily distinguishable in the 2D CSI spectra confirming that some metabolites are predominantly localized in one of these specific regions  were recorded and the 1H peaks characteristic of Ac and PE were mainly observed in the penis apparatus, while intense signals of galactoside and phosphocholine were detected in the paragonia and testis, respectively . Fly stocks were maintained in our laboratory by mass culture on standard medium at 22\u00b0C . Experiments were performed on adult flies (7 to 10 days old).in vivo HR-MAS experiments, a fly was placed in a cylindrical PTFE insert  located in the center of the rotor, such that the anteroposterior axis of the fly was aligned along the spinning axis. A petri dish, filled with ice was covered with aluminum foil and the fly was put on this foil to cool for anesthesia purposes. The aluminum foil was perfectly dry to avoid the fly sticking to it. The anesthetized drosophila was then placed in the insert with small tweezers under a magnifying glass. The 1H NMR experiments were performed at 3\u00b0C to keep the fly anesthetized and aliveTo perform all 2O) under a stereomicroscope. The organs, heads or thorax were then placed in a 4 mm HR-MAS rotor containing the same saline solution. 1H HR-MAS experiments were performed at 3\u00b0C.To study the dissected parts of drosophila, flies (2 to 5) were first dissected in saline solution (9g/L NaCl in D1H HR-MAS NMR experiments were carried out on a Bruker AVANCE III spectrometer operating at a magnetic field of 17.6 T (corresponding to 1H Larmor frequency of 750.13 MHz). In vivo measurements were performed using a Bruker Micro 2.5 gradient system , with a Bruker 3.2 mm double resonance MAS microimaging probe. Proton-free commercial rotors (zirconia), caps (PTCFE) and home-made shaped inserts (PTFE) were employed. For localized experiments, a pulsed field gradient was applied along the MAS axis using a combination of the three orthogonal gradients  of the microimaging system such that in vivo measurements were conducted at a spinning frequency of 2630 Hz. The spectra of the dissected parts of the fly were recorded at a spinning rate of 4000 Hz using a Bruker 4.0 mm double resonance MAS probe and commercial HR-MAS rotors and caps.All 1H chemical shifts were referenced using the resonance of the (CH2)n of drosophila fatty acids at 1.3 ppm2O resonance (low-power pulse duration of 1 s). Data were processed with zero filling of twice the number of real points. Exponential apodization with a 2 Hz line broadening was applied prior Fourier transform. Uncertainties on isotropic chemical shift measurements are 0.02 ppm (i.e. 15 Hz).For all experiments, the spectral width was set to 10000 Hz and the 90\u00b0 and 180\u00b0 pulse durations were 25 \u00b5s and 50 \u00b5s, respectively (rf-field strength of 10 KHz). 1H HR-MAS spectra of living drosophila and of the dissected parts of the fly were recorded using a spin echo sequence (echo time TE = 0.19 ms). 512 transients were acquired with a recycle delay of 2 s, corresponding to an experimental time of ~ 20 min. Assignment of the 1H resonances was performed using 2D through-bond 1H homonuclear correlation HR-MAS spectra and data from the literature13191H\u20131H correlation spectra were obtained using the adiabatic TOBSY pulse sequenceThe 1H HR-MAS Slice Localized Spectroscopy (SLS) measurements in living drosophila were performed using the pulse sequence shown in MAS  = 139 Gauss/cm (i.e. 80 Gauss/cm per axis). The recycle delay was set to 2 s. The frequency and bandwidth of the selective pulse, allowing choice of the position and thickness of the selected slice along the anteroposterior fly axis, were determined from a 1D water density image of the whole fly along its anteroposterior axis. This 1D image (recorded using the sequence in MAS  = 139 Gauss/cm) is not uniform and evidences separate regions attributed to the head, thorax and abdomen of the fly . A comparison of the in vivo1H HR-MAS SLS spectrum of the thorax and the conventional 1H HR-MAS spectrum of a single dissected thorax is shown in The  the fly . 1D wate1H HR-MAS Chemical Shift Imaging (CSI) spectra were obtained using the pulse sequence depicted in MAS pulse was 400 \u00b5s with a maximum strength of 29.5 Gauss/cm. The corresponding field of view was 5 mm (the length of the drosophila being ~ 2.5\u20133 mm) with a spatial resolution of 189 \u00b5m. The total experimental time was ~ 3.5 h.The 2D V.S.K. and F.F. developed the experiments. V.S.K., N.J, F.L., M.Y., F.S, M.D., J.C.B performed the NMR experiments. M.D. performed the laboratory growth of the drosophila and dissection for the ex vivo analyses S.M. and D.M. contributed to analysis of results and discussion. V.S.K., F.F., M.D, J.C.B. wrote the manuscript.Supplementary Information"}
+{"text": "The United States continues to become more racially and ethnically diverse, and racial/ethnic minority communities encounter sociocultural barriers to quality health care, including implicit racial/ethnic bias among health care providers. In response, health care organizations are developing and implementing cultural competency curricula. Using a community-based participatory research (CBPR) approach, we developed and evaluated a cultural competency training program to improve the delivery of culturally appropriate care in Marshallese and Hispanic communities.We used a mixed-methods evaluation approach based on the Kirkpatrick model of training evaluation. We collected quantitative evaluation data immediately after each training session  and qualitative data about implementation at 2 points: immediately after each session and 6 months after training. Individuals and organizational units provided qualitative data.We delivered 1,250 units of in-person training at 25 organizations. Participants reported high levels of changes in knowledge (91.2%), competence (86.6%), and performance (87.2%) as a result of the cultural competency training. Organizations reported making policy and environmental changes.Initial outcomes demonstrate the value of developing and implementing cultural competency training programs using a CBPR approach. Additional research is needed to determine the effect on long-term patient outcomes. The United States continues to grow more racially, ethnically, and culturally diverse ; approxiImplicit biases often exist outside of conscious awareness and are therefore difficult to acknowledge and remedy . The InsThe population in northwest Arkansas is growing and becoming more racially, ethnically, and culturally diverse. The most dramatic population change in northwest Arkansas is among Hispanic and Pacific Islander populations, which increased approximately 150% and 300%, respectively, from 2000 to 2010 \u201321. ManyTo better understand the disparities in health between non-Hispanic white populations and racial/ethnic minority populations in northwest Arkansas, the University of Arkansas for Medical Sciences (UAMS) used a community-based participatory research (CBPR) approach during 2 years (January 2013\u2013September 2014) to conduct a needs assessment and set an agenda to address health disparities. The needs assessment consisted of a review of secondary data, community-based surveys, and qualitative interviews. This process is detailed elsewhere . The neeThe needs-assessment team continued to use a CBPR approach to address the communities\u2019 concern for culturally and linguistically appropriate care through the collaborative development, implementation, and evaluation of a cultural competency training series. Partners were the Arkansas Coalition of Marshallese, Gaps in Services to Marshallese Task Force, the local chapter of the League of United Latin American Citizens, Workers\u2019 Justice Center, faith-based leaders, other key stakeholders in the Marshallese and Hispanic communities, and 14 local hospitals and clinics. Using the National Standards for Culturally and Linguistically Appropriate Services in Health and Health Care  as a guiIn December 2014 and January 2015, we developed the cultural competency training (CCT) program by using a multiple module approach, which allowed training sessions to fit the needs of each organization. The general CCT module established the framework for cultural competency, explored the rationale for culturally competent care, examined the issue of implicit bias in health care settings, and discussed knowledge and skills health care providers and workers should possess when working with a diverse patient population. Two additional training modules were developed with emphasis on the Hispanic and Marshallese communities: the Hispanic CCT module and the Marshallese CCT module. The overall goal of the training modules was to contribute knowledge and encourage behavioral changes so that health care professionals and organizations could more effectively serve a diverse patient population.All cultural competency training modules took place from March 19, 2015, to November 30, 2016, and were 1 hour in length. The general CCT module was presented by a master\u2019s-level registered nurse or a PhD-level cultural competency professional, or both, who were the lead trainers. The population-specific training modules were presented by a community member , who were supported by the lead trainers. The training modules included reference guides, handouts, information on cross-cultural communication tactics, interactive activities, a self-assessment of implicit bias, and a self-assessment of cultural competency. Each training module ended with a question-and-answer segment. Although organizations were encouraged to complete all 3 cultural competency training modules, the modules were offered separately, and organizations were allowed to choose the ones that best fit their needs.The target audience was health care professionals, including physicians, nurses, pharmacists, health care educators, and allied health care professionals, as well as health care administrators and office staff members. Training sessions were held at the health care organization\u2019s facility or a location convenient for the employees of each organization. An internal champion was identified at each organization, and that champion ensured that all staff members who had patient interaction were invited to participate. Most internal champions were a chief nursing officer or a director of human resources. All training sessions were offered free of charge and were certified for continuing education credits for physicians, pharmacists, nurses, and certified health care education specialists.The training program was evaluated using a mixed-methods approach based on the Kirkpatrick Four-Level Training Evaluation Model . The KirFor individual participants, data on 5 items were captured by surveys at 2 points: immediately after each training session and 6 months after training. Surveys completed immediately after training collected basic information about participants , and 3 yes/no survey items measured the trainings\u2019 effects on knowledge, competence, and performance related to working with culturally diverse patients. These 3 items were designed according to the Accreditation Council for Continuing Medical Education\u2019s Accreditation Criteria 2 and 11 . ParticiSix months after the training, participants completed a brief online follow-up questionnaire focused solely on behavior changes (level 3) to understand how participants implemented the information they learned (level 2). Among the questionnaire\u2019s 3 open-ended questions was the following key question: \u201cAs a result of this cultural competency training program, did you personally make any specific changes in the way you do your job to improve the experience of patients/clients from a culture other than your own?\u201d As an incentive to complete the 6-month follow-up questionnaire, participants who completed the follow-up questionnaire were entered into a drawing for a $50 gift card. Organizations were also contacted for an online interview 6 months after the training session to assess changes at the organizational level. One organizational representative was interviewed at each organization. This person was typically a chief nursing officer or a director of human resources. Organizational representatives were asked to report any organizational changes that occurred as a result of the training.All quantitative and qualitative data analysis took place in February 2017. We examined immediate post-training survey results evaluating learning (level 2) and behavior (level 3). We conducted quantitative analysis based on the number of units of cultural competency training delivered, rather than the number of unique participants. Participants could be counted more than once if they completed an evaluation for more than one training module. Because all evaluation measures were completed anonymously, participants\u2019 immediate post-training and 6-month follow-up responses could not be matched. We calculated descriptive statistics for all demographic items. For the 3 immediate post-training survey questions related to knowledge, competence, and performance, we calculated the percentage of responses that indicated increased knowledge, increased competence, or improved performance. We conducted qualitative analysis on more than 2,000 open-ended responses from the immediate post-training surveys, the 6-month follow-up questionnaires, and organizational interviews. We reviewed and coded responses by using the Kirkpatrick model\u2019s learning (level 2) and behavior (level 3) domains as a priori codes. In the a priori codes, 3 qualitative themes emerged: 1) learning, awareness, and appreciation of cultural differences (level 2); 2) individual and organizational behavioral changes within human resources (level 3); and 3) individual and organizational behavioral changes in communication/materials (level 3). Two qualitative researchers  independently coded the data and then compared and discussed the codes to ensure intercoder agreement. Three researchers  then organized codes in a codebook and compared response themes from individual and organizational participants and found them to be consistent.From March 19, 2015, to November 30, 2016, we conducted 51 in-person training sessions at 25 organizations and delivered 1,250 units of cultural competency training. Of those, 672 immediate post-training surveys were completed . The general CCT module was delivered to 370 health care professionals, the Hispanic CCT module was delivered to 382 health care professionals, and the Marshallese CCT module was delivered to 498 health care professionals. Most (88.1%) participants were women, and more than half (54.1%) had previous training in cultural competency. .Of the immediate post-training surveys with valid responses, 91.2% (602 of 660) reported an increase in knowledge, 86.6% (568 of 656) reported an increase in competence, and 87.2% (574 of 658) reported an improvement in performance. The percentage of participants who increased their knowledge (98.8%) and competence (96.1%) and improved their performance (94.6%) was greatest among participants in the Marshallese CCT module .Seventeen percent of participants responded to the 6-month follow-up survey. We also received feedback from 7 organizational representatives . Individual and organizational participants reported learning about cultural differences, as well as increased awareness and appreciation of the cultural differences of their patient population. Participants also reported behavior changes in human resources and in communication and materials.Learning, awareness, and appreciation of cultural differences. Participants reported learning about the many elements associated with health and culture, with an emphasis on family, food, and health care practices in Hispanic and Marshallese patients. Individual participant A said, \u201cI think about cultural significance of foods and of natural medicine and try to incorporate these things.\u201d Individual participant A continued, \u201cI try to keep [in mind] cultural practice and importance of cultural foods when talking about diet and explaining anatomy.\u201d Other participants, including individual participant B, simply indicated they had become \u201cmore aware of family dynamics.\u201dMany participants, including individual participant C, indicated significant gains in cultural awareness and appreciation, reporting, \u201cI became much more aware of how people within their own culture have differing perspectives based on their experiences.\u201d Organizational participant A indicated that she has made an \u201cattempt to be even more aware of cultural needs of the children and families we provide services to.\u201d Individual participant A reported, \u201cI try harder to be aware that other people may not have the same cultural upbringing as me. I try to watch for visual cues [like] body language or verbal tones to alert me of someone\u2019s discomfort, and proceed accordingly.\u201dSimilar changes to learning, awareness, and appreciation of cultural differences were reported at the organizational level. Organizational participant B reported \u201cstaff is much more aware of our Spanish and Marshallese patients and how to best interact with them.\u201d Organizational participant C discussed the value of the training and how it continues to be used as a teaching method: \u201cThe knowledge I received from UAMS is very valuable when teaching others to be sensitive to the culture. By the end of this discussion the health care providers seem more understanding towards the Marshallese patients\u2019 cultural differences.\u201dBehavioral changes within human resources. In addition to becoming more aware, participants reported changes to human resources at their workplaces. Human resources changes included recruitment efforts to create a more diverse applicant pool and hire more demographically diverse employees to better serve the diverse client population. Organizational participant A described human resources\u2019 \u201cincreased efforts to recruit and hire Hispanic employees to better service our Hispanic families.\u201d Organizational participant A\u2019s organization has also \u201cbegun to brainstorm on how to increase efforts to recruit and hire bilingual employees to better provide services provided to our Marshallese families.\u201d Organizational participant D stated, \u201cI have worked with our HR person to get the Marshallese interpreter job description changed to better match the applicant pool.\u201dNew roles and processes were also created to ensure that cultural competency trainings were incorporated into organizations and sustained. Organizational participant E stated, \u201cFor annual in-service, we created a short video in which we highlighted the challenges that come with seeking health care when major language barriers exist.\u201d Organizational participant E also noted that \u201cinformation on inclusion and cultural competency has been implemented in our new staff orientation.\u201d Participants described new human resources practices, including the creation of a cultural champion. For instance, individual participant D\u2019s organization \u201ccreated a cultural competency champion for the organization. Added this team member to the ethics committee. Charged this team member to incorporate cultural learning opportunities with our team meetings\u201d and will \u201cprovide ongoing team education.\u201d Participants reported that staff meetings were being used as opportunities for cultural discussion. Individual participant E stated, \u201cI have made it a point to discuss the cultural training material at staff meeting,\u201d and noted that doing so allows for much broader dialogue about the need for culturally appropriate care.Behavioral changes in communications and materials. Several participants made changes in their materials and communication methods to provide in-language oral and written communications to their patients and clients. One of the primary changes reported was having information translated into the primary language of the patients and having more interpreters available. Individual participant F described \u201cutilizing medical interpreters for communication instead of relying on family members.\u201d Participants also reported using teach-back communication methods suggested during the training. As individual participant G reported, \u201cI make sure that I follow up more frequently and ask more specific questions during [health] assessment and/or evaluation. [I] try to have materials printed out in Marshallese for education.\u201d Individual participant H explained they are continuing their efforts to obtain \u201cmore language specific materials,\u201d and Individual participant I described efforts to get \u201cmore literature in different languages.\u201d In addition, participating organizations stated they are investing in language services. Organizational participant E noted, \u201cWe have sponsored training for two Latino staff members in Spanish medical terminology.\u201d Organizational participant B described how several changes are taking place simultaneously:[The] training has increased awareness of various cultures throughout the facility and our clinics. For one, there is more signage in Marshallese and Spanish throughout the facility/clinics. We also plan to put up [bilingual] signage in our new women services facility. We also have more patient education in Marshallese and Spanish, and we are looking to having the rest of our materials translated.Organizations also reported policies to ensure more culturally sensitive use of bilingual interpreters. For instance, organizational participant F stated, \u201cI now require an interpreter of the same sex when possible for physicals and follow up for our Marshallese employees.\u201dRacial/ethnic minority populations encounter sociocultural barriers to quality health care, including implicit bias when seeking health care. Providing quality, culturally appropriate care to all community members is a priority of Healthy People 2020 . AlthougThis evaluation went beyond traditional evaluations because it measured both knowledge and behavioral changes at the individual and organizational level by using a mixed-methods approach. The primary limitation of the evaluation is that it has yet to determine if the training modules will lead to long-term improvements in patient care. Additionally, the evaluation response rates were lower than expected, with only 53.8% of 1,250 training units evaluated, and only a 17.0% response rate to the 6-month follow-up questionnaires. The evaluation of changes in knowledge and behavior via self-report alone is also a limitation. However, substantial changes with examples were described in learning, awareness, and appreciation of cultural differences, as well as individual and organizational behavioral changes in human resources and communications and materials. The initial outcomes are encouraging and demonstrate the value of using a CBPR approach to develop and implement cultural competency training programs."}
+{"text": "The past decade has witnessed great advances in the treatment of chronic myeloid leukemia (CML), brought about in large part by the development of BCR-ABL tyrosine kinase inhibitors (TKIs). Bosutinib joins the armamentarium of approved TKIs for the treatment of chronic phase (CP), accelerated phase (AP), and blast phase (BP) Philadelphia chromosome (Ph)\u2013positive CML resistant to or intolerant of prior therapy. Bosutinib has an adverse-event (AE) profile distinct from that of other TKIs. Diarrhea is the predominant toxicity associated with bosutinib treatment; other commonly reported nonhematologic AEs include rash and liver enzyme elevations. Cardiac events, fluid retention, and electrolyte abnormalities are infrequent. Optimal response to bosutinib requires adherence, which depends, in part, upon optimal management of associated toxicities. The oncology clinician can facilitate this process by providing patient education, timely patient follow-up, and close monitoring to promptly identify and manage AEs. Thus, optimal patient management requires a thorough and current understanding of toxicity profiles and AE management paradigms. This review provides an overview of bosutinib safety data derived from ongoing clinical trials and offers practical clinical strategies currently used to manage toxicities associated with bosutinib treatment in patients with Ph-positive CP, AP, and BP CML. Chronic myeloid leukemia (CML) is caused by a chromosomal translocation between the Abelson (Abl) gene on chromosome 9 and the breakpoint cluster region (BCR) on chromosome 22, resulting in the constitutively active BCR-ABL tyrosine kinase that promotes myeloid proliferation . WhereasDespite its demonstrated efficacy, approximately 30% to 40% require additional treatment beyond imatinib therapy . HoweverThe second- and third-generation TKIs offer patients the potential for durable cytogenetic response measured in terms of years as well as clinically meaningful improvements in health-related quality of life HRQOL; . Both daDespite the efficacy reported with dasatinib, nilotinib, and ponatinib, each of these TKIs is associated with potentially serious complications that may preclude their use in certain patient populations .Bosutinib is an orally active dual Src/Abl TKI that was approved in 2012 in the United States for the treatment of patients with Ph+ CML resistant to or intolerant of prior therapy . BosutinThe growing number of approved and investigational TKIs available for treating CML has introduced new challenges for clinicians in deciding which agent to use as first-line therapy and as second-line/subsequent therapy . Issues In a study of patients with CML receiving imatinib, adherence rates were significantly lower among patients who experienced adverse events of asthenia, muscle cramps, nausea, and joint or bone pain . ImportaAn understanding of the divergent toxicity profiles associated with each of the currently approved TKIs, along with knowledge of patients\u2019 comorbidities and BCR-ABL mutational status, is critical to tailoring a particular TKI treatment to an individual patient . AlthougThese differences in toxicity profiles across TKIs demand caution in extrapolating from experience with managing toxicities associated with prior TKIs to guide patient management and monitoring approaches when using a different TKI. Given that oncology advanced practitioners interact closely with patients, they are well positioned to provide patient education to assist in prompt identification and management of TKI-associated adverse events.Therefore, it is imperative that oncology advanced practitioners have a thorough and current understanding of the differences in toxicity profiles across TKIs and adverse event management strategies to facilitate treatment adherence. This review provides an overview of the practical clinical strategies currently used to manage toxicities associated with bosutinib treatment in patients with Ph+ CP-, AP-, or BP-CML.The rapid and ongoing advancements in the treatment of CML require continual update of clinical practice guidelines, including those from the National Comprehensive Cancer Network (NCCN) and the European LeukemiaNet ELN; . There aThe current practice standard is attainment of complete cytogenetic response (CCyR), which is considered the main objective of TKI therapy because of the demonstrated association between CCyR and prolonged survival . AchieviAlong with response monitoring, effective monitoring of treatment adherence is of paramount importance in routine clinical practice . It can Molecular monitoring is also important, as increasing BCR-ABL1 transcript levels may be an indication of nonadherence; thus, results of molecular monitoring are useful for guiding discussions surrounding treatment adherence. In addition, incorporation of patient-reported outcome (PRO) measures, which assess symptom burden from the patient\u2019s perspective , might result in more effective monitoring .The safety and efficacy of bosutinib were first reported in a phase I/II trial of patients with CP- CML receiving bosutinib as second-line therapy after imatinib failure, with a median treatment duration of 14.9 months (< 2-year report) and as third/fourth-line therapy after imatinib and dasatinib and/or nilotinib failure, with a median treatment duration of 8.3 months , CP-CML (n = 118) patients receiving bosutinib as third-line therapy and beyond (3-year update), and advanced leukemia  patients resistant/intolerant to prior imatinib or to multiple prior TKIs  trial compared the safety of bosutinib (n = 248) and imatinib (n = 251) as first-line therapy in CP-CML patients after > 30 months of follow-up . In the In retrospective analyses of data from the phase I/II study of bosutinib, the incidence of cross-intolerance between bosutinib and prior imatinib therapy was evaluated, with cross-intolerance defined as the patient having an adverse event that led to permanent treatment discontinuation of both bosutinib and prior imatinib therapy . NotablyDiarrheaIn the phase I/II trial of bosutinib as second/third/fourth-line therapy in patients with CML or Ph+ ALL, diarrhea was the most prominent TEAE  across cohorts irrespective of disease stage or bosutinib treatment line . In geneIn keeping with the manageability of diarrhea adverse events in these patients, nearly all patients with diarrhea adverse events were maintained on bosutinib therapy; treatment discontinuation due to diarrhea occurred in only 1% of patients, despite its high incidence . DiarrheDiarrhea was also the most commonly reported TEAE among newly diagnosed CP CML patients receiving bosutinib in the phase III BELA trial , with anThese findings suggest that diarrhea is generally manageable and that patients with these events can be maintained on bosutinib treatment. In the phase III BELA trial protocol, it was recommended that antidiarrheal agents such as loperamide or diphenoxylate/atropine be instituted at the first sign of diarrhea, which was found to be effective in controlling most cases of diarrhea .Approaches for identifying and managing bosutinib-associated diarrhea, as well as patient education points, are included in \u00a0 \u00a0 Skin RashIn the phase I/II trial of bosutinib as second/third/fourth-line therapy, the incidence of rash adverse events (any grade) was 33%, including 6% at grade 3/4 severity; these adverse events occurred at similar rates across cohorts irrespective of CML phase or bosutinib treatment line . Among pA meta-analysis, which evaluated the incidence and clinical characteristics of rash associated with dasatinib and nilotinib, indicated that rash commonly presented as perifollicular 1\u20132 mm hyperkeratotic papules, which could appear on any part of the body and were often accompanied by pruritus . AlthougApproaches to identifying and managing bosutinib-associated skin rash are described in Hematologic Adverse EventsMyelosuppression was frequently reported in the phase I/II trial of second/third/fourth-line bosutinib . Across Patients with myelosuppression were most commonly managed by dose interruption (46%) and dose reduction (32%), but these events infrequently led to treatment discontinuation (7% of patients), emphasizing the manageability of these adverse events and the ability to maintain treatment adherence . Among sMyelosuppressive events were also common among patients receiving first-line bosutinib in the phase III BELA trial . The incApproaches to identifying and managing bosutinib-associated myelosuppression are described in Liver Transaminase ElevationsAcross second and third/fourth-line CP-CML and advanced leukemia cohorts in the 4-year/3-year update of the phase I/II study, alanine aminotransferase (ALT) and aspartate aminotransferase (AST) elevation TEAEs occurred in 17% and 14% of patients, respectively, with grade 3/4 ALT and AST TEAEs occurring in 7% and 3% of patients, respectively . The medManagement strategies for patients with elevated ALT and AST levels consisted of dose interruption (35%), dose reduction (18%), or concomitant medication 13%; . Among 3Approaches to identifying and managing bosutinib-associated AST/ALT elevations are described in Cardiac and Vascular Adverse EventsAlthough the rates of cardiac and vascular adverse events in clinical trials of patients with CML generally have been relatively low, concerns surrounding potential toxicities with CML-directed TKI therapy have arisen. In particular, an increased risk of life-threatening blood clots and severe narrowing of blood vessels was observed with ponatinib treatment, which resulted in the temporary suspension of marketing and sales of this agent in the United States, followed by a narrowing of the indication, addition of a boxed warning label, and implementation of additional safety measures to monitor patients and manage these events in 2013 .In the updated phase I/II study, cardiac TEAE rates across CP-CML second/third/fourth-line and advanced leukemia cohorts were generally low, with an all-cause cardiac TEAE incidence of 18% overall (6% considered bosutinib-related) based on the combined Medical Dictionary for Regulatory Activities (MedDRA) system organ class terms Cardiac Disorders and Investigations (cardiac and vascular terms). Most patients (10%) experienced a maximum grade 1/2 event, whereas 5% experienced a maximum grade 3, 2% a maximum grade 4, and 1% a maximum grade 5 event . Most paOverall, patient management of cardiac adverse events included concomitant medication (40%), dose interruption (24%), and dose reduction (7%). Among the 24 patients with dose interruption, 19 (79%) were subsequently rechallenged with bosutinib, with 4 of these rechallenged patients ultimately discontinuing bosutinib treatment . These fAs with cardiac events, the rate of all-cause vascular TEAEs (MedDRA system organ class term: Vascular Disorders) observed in the phase I/II study was relatively low (13%); hypertension was the only vascular TEAE that occurred in \u2265 2% of patients overall , dose interruptions (47%), and concomitant medications (58%); four patients discontinued bosutinib due to pleural effusion . In the The current NCCN guidelines recommend the use of diuretics and supportive care for the management of fluid retention events  and hypophosphatemia (8%), with the former occurring more frequently in patients with prior TKI intolerance vs. resistance in both the CP-CML second-line and third/fourth-line cohorts . Grade 3In patients with TKI-treated CML, it is important to capture electrolytes as part of the routine laboratory monitoring. In some cases, dietary supplements may be necessary to maintain potassium and magnesium levels, particularly given the association of these electrolytes with cardiac function.The following case study illustrates practical management strategies for the bosutinib-associated toxicities previously described.A 50-year-old man was diagnosed with Ph+ CP-CML; front-line TKI therapy with imatinib at 400 mg daily was initiated. After 1 year, the patient had not achieved a cytogenetic response and had 80% Ph+ cells , thrombocytosis, and neutrophilia. The patient\u2019s disease remained minimally responsive to a standard dose of imatinib, for which the patient\u2019s adherence to treatment was determined not to be a contributing factor. Imatinib treatment was discontinued because the patient was intolerant to dose escalation, and he was subsequently prescribed bosutinib, which was initiated at a dose of 500 mg daily.To facilitate adherence and encourage prophylactic behavior, the patient was proactively provided with educational information on how to better manage his condition and expectations as well as possibly mitigate any potential study drug\u2013related side effects. The patient was informed that diarrhea was the most common side effect in patients taking bosutinib, and, if it occurred, it was predominantly of low severity and transient, typically starting 1 to 2 days after initiation. The patient was advised to report any gastrointestinal events to his oncology care provider immediately, and standard-of-care interventions would be initiated at the first sign of diarrhea .The provider also recommended that the patient take steps to decrease the likelihood or severity of possible dermatologic side effects; they involved protecting his skin from direct sunlight, using sunscreen outdoors, avoiding alcohol-based and/or scented skin products, and keeping his skin adequately moisturized using a hypoallergenic emollient cream. At the outset, timely communication between the provider and patient was encouraged in relation to treatment adherence as well as the patient\u2019s health and well-being.The patient reported grade 2 diarrhea 2 days after starting bosutinib treatment. The patient also experienced grade 1 fatigue on day 5 of bosutinib treatment, which was associated with secondary dehydration caused by diarrhea. Using standard treatments, diarrhea resolved by day 28 of bosutinib treatment.In addition, 1 week after bosutinib treatment initiation, the patient experienced grade 1 rash, which was pruritic and located on the trunk and neck. In addition to the nonpharmacologic management of his skin, the patient was treated with topical hydrocortisone cream 1% four times daily, and the rash resolved within 2 weeks.The patient also experienced grade 1 AST elevation and grade 2 vomiting intermittently during the first year of bosutinib treatment; events of AST elevations resolved spontaneously, whereas vomiting events were treated with antiemetics; neither type of event required dose interruptions or dose reductions.During clinic visits, adverse events and the importance of adhering to daily bosutinib therapy continued to be discussed. Within 12 months, the patient achieved a CCyR and continued receiving bosutinib therapy without recurrence of diarrhea or rash.The oncology care provider should be aware of the toxicity profiles of available TKIs to manage such toxicities effectively. The toxicity profile of bosutinib is distinct from that of other TKIs; therefore, clinical experience gained with one TKI such as imatinib should not necessarily govern management and monitoring of adverse events in patients treated with another TKI such as bosutinib.Diarrhea is the predominant toxicity associated with bosutinib treatment and is generally self-limiting, either with or without supportive intervention . Based oSkin rash is not unique to bosutinib, and referral to a dermatologist may be needed for comprehensive care. The other adverse events described in association with bosutinib, including hematologic and nonhematologic electrolyte abnormalities, liver enzyme elevations, fluid retention, and less frequently reported cardiac events, all have been managed in clinical trials to date.An analysis of data from the phase I/II trial of second/third/fourth line bosutinib in patients with CML showed that the frequency of bosutinib-associated toxicities and treatment discontinuations due to adverse events among patients with CP-CML is greatest within 1 year of treatment initiation and declines over time thereafter, indicating that these patients experience an improvement in tolerability during long-term bosutinib treatment .Overall, TKI-treated patients should be educated about early identification of toxicities such as diarrhea, rash, and myelosuppression to afford the opportunity for early intervention . HoweverIn the current TKI era, the optimal treatment of CML in patients who fail to respond to a second-generation TKI is a major outstanding question, with few guidelines and clinical trials addressing this issue to date . OptimizAcknowledgmentsThe authors thank Patricia A. Jordan Cole, RN, OCN\u00ae, for her clinical insights regarding the management of side effects associated with bosutinib treatment in patients with CML. Medical writing support was provided by Simon J. Slater, PhD, and Cynthia L. Gobbel, PhD, CMPP, of Complete Healthcare Communications, Inc., and was funded by Pfizer Inc."}
+{"text": "Although the diagnosis of prolactinoma is often straightforward and the treatment strategy has been well defined in recent guidelines, several challenging issues persist in their management. The differential diagnosis of a large pituitary tumour with moderately elevated prolactin (PRL) concentrations is sometimes difficult, and prolonged treatment with a dopamine agonist may be inappropriate when the diagnosis of a prolactinoma is not sufficiently well substantiated. Also, timely withdrawal of dopamine agonist treatment and the remaining indications of transsphenoidal surgery are still matters of debate. Last but not least, the management of resistant or aggressive prolactinomas remains a challenge for the clinician, especially when they occur in young patients. This affection has a large female predominance and a median age of 30 years at diagnosis.diagnosis of prolactinoma is usually based on the concomitant observations of a persistent hyperprolactinaemia and a pituitary adenoma at magnetic resonance imaging (MRI) with a good correlation between hormone levels and tumour size.1 It is rarely confirmed by immunocytochemistry of the tumour, as most prolactinomas are never operated. Macroprolactinomas can usually be recognised with a high degree of confidence when prolactin (PRL) concentrations are above 200 \u03bcg/l 5. In patients with histologically confirmed non-functioning pituitary macroadenoma and stalk compression, PRL concentrations usually remain lower than 150 \u03bcg/l.6 In cases of doubt , a 3- to 6-month trial with a dopamine agonist (DA) may be helpful, as most prolactinomas will show some degree of shrinkage under medical therapy. A thyrotropin-releasing hormone (TRH) stimulation test usually is not helpful in such circumstances.The 3 Noticeably, most microprolactinomas will be symptomatic, readily visible on dedicated MRI as a lateral nodule with a different T1 or T2 intensity than normal pituitary tissue, and exhibit PRL concentrations >40 \u03bcg/l . The absence of one or more of these criteria is still compatible with the diagnosis, but the clinician must be aware of other aetiologies and consider surveillance or early withdrawal of DA treatment before embarking the patient on long-term therapy. Discordance between excellent hormonal control under DA therapy and ongoing tumoral expansion must also lead to re-evaluation of the diagnosis.It may be even more difficult to formally confirm the diagnosis of a microprolactinoma. Symptoms of hyperprolactinaemia are not specific of a tumoral origin, MRI findings may be ambiguous, non-functional pituitary incidentalomas are frequent and several other causes of moderate hyperprolactinaemia must be ruled out. Among them, drug-induced hyperprolactinaemia is a common condition (see 7 for review), and assessment for the presence of macroprolactin is also highly recommended in patients with asymptomatic hyperprolactinaemia.treatment of prolactinomas with a DA is the cornerstone of therapy, and cabergoline (CAB) is the first choice due to its high efficacy and good tolerability profile.4 Even in the case of very large adenomas with suprasellar extension, CAB induces rapid tumour shrinkage and visual field improvement in 80\u201390% of patients.5 One remaining factor is to decide when treatment can be safely withdrawn. Discontinuation of DA therapy is indeed possible with reasonably good chances of remission in well-defined conditions:8 (a) the patient has been continuously treated for at least 2 to 3 years (probably more for macroprolactinomas); (b) a low PRL concentration has been obtained with a low dose of DA (<0.5 mg/week of CAB); (c) a disappearance or a more than 50 % reduction in the maximal tumoral diameter has been observed; and (d) there is no cavernous sinus invasion. When such criteria are met, prolonged remission is observed in about one-third of the patients, more often after the use of CAB in the context of microprolactinomas (50 %) than with bromocriptine or in macroprolactinomas.8 These patients require, however, longterm surveillance, and a loss of follow-up with later resurgence of the prolactinoma is a potential risk of such strategy. It is also possible to discontinue dopaminergic therapy after menopause3 or after one or more pregnancies, which seem to increase the likelihood of remission.9Medical 3 Besides these classic indications and some acute complications, such as apoplexy or cerebrospinal fluid (CSF) leakage, new indications have emerged, such as young patients with a high likelihood of complete tumour resection who do not wish to take prolonged medical treatment10 or patients who require high doses of CAB, in whom surgical debulking may significantly improve post-operative hormonal control.11 It is essential that the surgical procedure be performed by an experienced pituitary neurosurgeon. In such centres, immediate post-operative remission rates of 70\u201390 % have been reported for microprolactinomas and of 30-50 % for macroprolactinomas (reviewed in 12).Neurosurgical treatment of prolactinomas is less effective than medical therapy, and recurrence of hyperprolactinaemia is frequent (10\u201350 % of patients). Nevertheless, transsphenoidal surgery should be considered in symptomatic patients who cannot tolerate any of the currently available DAs or who are not responsive to maximally tolerated doses of DAs.4 This resistance is rare in microadenomas, more frequent in cases of macroprolactinomas (3\u20135 %) and quite characteristic of invasive tumours.2 Although a decreased expression of D2 receptor has been evidenced in resistant prolactinomas, the mechanisms are still not completely understood.13Resistance to DA treatment is another therapeutic challenge, being defined by a failure to achieve normal PRL levels on maximally tolerated doses of DAs and/or failure to achieve a 50 % reduction in tumour size.13 If the patient is treated with another DA, it is recommended to switch to CAB. About 70\u201380% of patients resistant to bromocriptine may indeed achieve PRL normalisation on CAB.3 Next, standard doses of CAB may be increased stepwise to maximal tolerable doses. In a Japanese study,14 increasing the CAB dose up to 12 mg/week allowed the overcoming of DA resistance in a few patients, but perhaps at the price of long-term undesirable side effects. Therefore, in the absence of any intolerable symptoms or emergency situation, we rather recommend keeping the maximal dose at 3.5 mg/week, which may, in turn, lead to hormonal control in half of the cases after 15 to 72 months.2 Finally, the resistant prolactinoma is also a valuable indication for transsphenoidal neurosurgery, aiming at large tumoral debulking and improved postoperative medical control.11 Irradiation must be considered only in the rare patients who fail surgical treatment and harbour aggressive prolactinomas.3 It may require up to 20 years for maximal effects to be achieved, and normalisation of hyperprolactinaemia occurs in only one-third of cases4. Finally, in aggressive prolactinomas or PRL-secreting carcinomas, a last therapeutic option may be the use of temozolomide, an orally administered alkylating agent, which might reduce PRL hypersecretion and control tumour growth in about 50 % of cases.16Several therapeutic options may be considered in cases of DA resistance.17 long-term echocardiographic surveillance  is indicated in patients who chronically need higher doses of DAs. It is also important to keep in mind that true resistance of prolactinomas to adequate medical treatment is often associated with a more aggressive behaviour of the tumour. These patients must therefore be followed more closely in a specialised centre.Although the risk of restrictive cardiac valve disease seems to be very low at conventional doses (\u22641.0 mg/week) of CAB,"}
+{"text": "Bifidobacterium longum, BF) and lycopene (LYC) have been individually researched for their beneficial effects in the prevention of CRC. However, the effect of a combined treatment of microencapsulated BF and LYC on IGF-1/IGF-1R/IGFBPs (Insulin-like growth factor-binding proteins) expression in an azoxymethane (AOM)-dextran sulfate sodium (DSS)-induced CRC model have not been demonstrated. BF was microencapsulated by the spray drying technique, with high viability, and daily gavaged with LYC for 16 weeks to CD-1 mice in an AOM-DSS model. The results indicated that BF- and BF + LYC-treated groups had significantly lower inflammation grade, tumor incidence (13\u201338%) and adenocarcinoma (13\u201314%) incidence compared to the AOM + DSS group (80%), whereas LYC treatment only protected against inflammation grade and incidence. Caecal, colonic and fecal pH and \u03b2-glucuronidase (\u03b2-GA) values were significantly normalized by BF and LYC. Similarly, BF and BF + LYC treatments significantly reduced both the positive rate and expression grade of IGF-1 and IGF-1R proteins and normalized Insulin-like growth factor-binding protein-3 (IGFBP3) expression. Based on intestinal parameters related to the specific colon carcinogenesis in an AOM-DSS-induced model, LYC and microencapsulated BF supplementation resulted in a significant chemopreventive potential through the modulation of IGF-1/IGF-1R system.The Insulin-like growth factor-I/Insulin-like growth factor-I receptor (IGF-1/IGF-1R) system is a major determinant in colorectal cancer (CRC) pathogenesis. Probiotics ( Cancer is a genetic disorder characterized by an altered balance between proliferation and mechanisms of cell death. Colorectal cancer (CRC) worldwide ranks third in terms of incidence, but second in terms of mortality. Most CRC risk factors are related to dietary and lifestyle factors, which are increased after high meat consumption due to the stimulation of insulin secretion, and increased fat intake. Carcinogenesis caused by insulin resistance leads to increased cell proliferation and reduced apoptosis .Recently, the evidence highlights the insulin/IGF system as an important molecular target for the pathogenesis, progression and treatment of CRC. Among the important components in CRC, the IGF-1 factor and its receptor (IGF-1R) promote both the growth and malignant transformation of adenomatous polyps. IGF-1 factor is found to be more highly expressed in adenocarcinomas compared to adenomas and normal colon samples from patients, while IGFBP3 is lower in patients than in healthy individuals ,3. This Bifidobacterium longum (BF) has been suggested.The dietary bioactive compound lycopene (LYC), an acyclic isomer of \u03b2-carotene found mainly in tomatoes, exerts excellent antioxidant, singlet oxygen quencher and anti-inflammatory properties, and it has been found to be protective against different types of cancer in animal models and epidemiological interventions, with minimal to no toxic effects along with its pleiotropic effects. LYC has promising chemopreventive effects on CRC by modulating IGF-1 system components through direct and indirect actions on pathways such as the Ras/MAPK and PI3K/AKT/Wnt signaling pathways ,5,6,7,8.B. longum include: control of cell growth and differentiation, fermentation of non-digestible carbohydrates to produce short-chain fatty acids, modulation of the gut microbiome, reduction of pH caused by the excessive presence of bile acids in feces, inhibition of colon carcinoma cell proliferation as well as induction of apoptosis in colon carcinoma cells [7 viable cells has been suggested as the minimum intake to provide a protective effect. However, several factors have been claimed to affect the viability of probiotics, including heat processing and gastrointestinal conditions [The anticarcinogenic mechanisms associated with the administration of ma cells ,10. A danditions ,12. Due nditions . The sprnditions . Althougnditions , there iIn order to evaluate the chemopreventive efficacy of the combined probiotic BF + LYC supplementation in an AOM-DSS model, body weight, and fecal pH values, \u03b2-glucuronidase (\u03b2-GA) activity and viable BF were determined weekly .There were no significant differences in the initial and final body weights after 16-weeks treatment among the experimental groups ; althougIncreased colonic pH and \u03b2-GA values have been previously reported in chemical-induced colorectal carcinogenesis models . Similarv/v in drinking water, ad libitum). We observed that, the daily intragastrical administration (8.992 \u00d7 1010 cells\u00b7mL\u22121) of a symmetrical sphere of BF (as observed in Scanning Electron Microscopy) with an effective diffusivity had a protective effect on the mucosa, lamina propria, fecal \u03b2-GA and body weight in CD-1 mice, while promoting the colonization of BF in luminal content (5.3 to 6.3 Log CFU/g) and its adhesion in the GIT (5.2 to 5.9 Log CFU/g) (data not shown) [In a previous study, the GIT transit of BF BAA-999 (American Type culture collection number-ATCC) microencapsulated by the spray drying technique was monitored for 14 days in an acute model of inflammation in CD-1 mice (2% DSS t shown) . As thesIn the second instance, to obtain further information on the preferential colonization site of BF, luminal a and tisp < 0.05); meanwhile, the AOM + DSS control group showed 60% and 80% early lesions and tumor incidence, respectively. Although a higher percentage of animals with flat-type lesions were found in BF-, LYC-, and Metformin-treated groups (71\u201388%), these groups showed lower tumor incidence  and lower mean tumor number, being statistically significant only for BF-treated groups (p < 0.05). The metformin group also had a significantly reduced mean tumor number as compared to that of the AOM + DSS control group. The majority of the flat-type lesions and tumors in AOM + DSS-treated groups were found in the distal portion of the colon (67\u2013100%) confirming that this initiation-promotion model predominantly produces tumors in the distal zone [Morphological examination of the colonic mucosae of AOM + DSS-treated animals showed the formation of protuberances into the lumen of the colon; flat-type lesions (named early lesions) and pedunculate, sessile, exophytic and endophytic lesions (tumors) were observed in the proximal and distal colon . As expetal zone ,19, excep < 0.00002), whereas 80% of the animals in the AOM + DSS group developed adenocarcinomas, and two animals showed inflammation grade +++. BF, BF + LYC- and Metformin-treated groups showed lower adenocarcinoma incidence  but higher inflammation incidence . Although BF administration and its combination with LYC showed lower inflammation grades (+ and ++) and significantly protected against adenocarcinomas incidence (p < 0.00002), LYC co-administration did not exert synergistic anticarcinogenic protection, but it protected against inflammation (p < 0.00002).According to the histopathology study, different grades of inflammation and dysplasia were found ; howeverInterestingly, colitis was practically absent from AOM + DSS-treated mice after 16 weeks of treatment. However, inflammation was still present at the end of the 16-weeks of experimental period, thus a quantitative and descriptive classification of the damage in the colon, according to lymphocyte infiltration, eosinophils, calceiform cells, epithelial ridges, Peyer\u2032s patches, necrosis, and mitosis presence in tissues of the colon  was perfp < 0.05). Similar to the histopathology analysis, only BF administration and its combination with LYC significantly reduced both the positive rate and expression grade of IGF-1 and IGF-2 proteins; however, LYC co-administration did not further lessen these values. Moreover, BF + LYC-treated groups showed lower IGF-1R expression . In addition, metformin administration was also significantly effective in reducing IGF-1, IGF-2, and IGF-1R expressions  than that of the AOM + DSS control group.As IGF-binding proteins (IGFBPs) modulate the amount of bioavailable IGFs in a positive or negative manner ,22, bothp < 0.05). Moreover, the BF + AOM + DSS group had the lowest IGF2BP1 expression grade, and LYC co-administration had a minor additional effect only on IGFBP2 expression, particularly at the highest concentration (LYC 50). Interestingly, only BF and its combination with LYC significantly increased both the positive rate and expression grade of IGFBP3 protein. On the other hand, metformin administration was effective in reducing the positive rates of IGF2BP1 (by 44%) and IGFBP2 (by 33%) protein expressions (p < 0.05) was observed in the Metformin-treated group.Our results demonstrate that BF and its combination with LYC significantly reduce both the positive rate and expression grade of IGF2BP1 and IGFBP2 proteins  is a carotenoid that selectively stimulates the growth of probiotics in the GIT and potentiates the beneficial effects of these microorganisms . Using a10 viable cells\u00b7mL\u22121) might exert protection in a CRC model. Conversely, Singh and collaborators [Bifidobacterium strain of two Log cell counts/g feces in only 24 h after the intragastric administration at day 14 under healthy conditions. Several factors have been claimed to affect the viability of probiotics, such as gastrointestinal conditions ,12. Therborators  reportedp < 0.05), while in the tissue-adherent zone, the bacterial colonization was only negatively correlated with the overactivity of \u03b2-GA in the caecum, colon, and feces. Our results agree with the anticarcinogenic mechanisms associated to the administration of BF [The adhesion to intestinal epithelial cells and mucus as a feature that supports the colonization and persistence of Bifidobacteria in the GIT; cell surface components that promote colonization and adhesion to the intestinal epithelium include sortase-dependent proteins, exopolysaccharides and lipoproteins, as well as the pili of Bifidobacteria, wich were shown to modulate immune responses. Another aspect contributing to the high or low ability of BF to stably colonize mice might be a better adaptation to its original habitat, i.e., the human infant gut, due to the fact that host adaptation of bifidobacteria has been shown on the level of carbohydrate utilization. BF has the capacity to utilize plant oligo- and polysaccharides that are derived from the diet of the host . As expeon of BF ,10. Howep < 0.05), thus confirming that these circumscribed masses of cells that project above the surface (polyps) might develop to colorectal carcinomas [In this study, tumor  and adenocarcinoma incidence  induced by AOM + DSS were significantly correlated -induced colon carcinogenesis ) by significantly increasing apoptosis as compared to LYC-, oligofructose + B. lactis- and DMH-treated groups [The protective role of LYC in the prevention of chronic diseases including cancer has been previously reported ,7,8, andd groups . Howeverd groups . This fid groups  and the d groups .p < 0.05). However, a negative correlation between IGF-1 and IGF-1R expressions and caecal/colonic-adherent and fecal viable bacteria was observed (p < 0.05) (New evidence has demonstrated that the overexpressions of IGF-1 and IGF-1R contribute to the development and progression of colon cancer in patients  and in a < 0.05) ; thus, tp < 0.05) (p < 0.05)  , respect < 0.05) .Similar to the higher IGF-2 and IGFBP2 expressions in the AOM + DSS control group, mean IGFBP2 SD scores and expressions were significantly higher in sera and tumors from patients with colonic neoplasia compared to healthy individuals, whereas mean IGF-2 SDs were elevated in Dukes A and Dukes B cases compared with controls, but not in advanced disease ,35.p > 0.05) and a relevant fecal BF viability during the 16 weeks of treatment. Additionally, the preferential colonization site of BF was in the caecum and colon, with a higher bacterial concentration in the luminal zone. Moreover, this group was shown to exert beneficial changes in colonic physiology by decreasing caecal, colonic, and fecal pH, along with \u03b2-GA activity, and showing lower inflammation grade, local lymphocyte infiltration, and the suppression of adenocarcinoma incidence compared to those of the AOM + DSS control group. Therefore, it has become clear that the modulation of gut microbiome is likely to be the key element of the health-promoting activity of BF in the colon. Our results, with a low concentration of lycopene, are in agreement with Amir and collaborators [As an effective strategy for colon cancer chemoprevention, is worth mentioning that the BF + LYC 20 treatment group showed the best similarity to the Normal group  strain BAA-999, provided by ATCC , wich was freeze-dried; the cellular viability was evaluated in a Neubauer chamber  with trypan blue as a viability contrast colorant. BF culture was growth with MRS broth   supplemented with 0.05% (w/v) L-cysteine hydrochloride  at 37 \u00b0C for 24 h, according to Dobrowolski [The culture used was the collection of rowolski ; 2 mL ofrowolski .\u22124 kg\u00b7s\u22121 and atomizing air flow of 1.3 \u00d7 10\u22124 m3\u00b7s\u22121 with a supply nozzle diameter of 0.7 mm. The microencapsulated BF were stored in sterile falcon\u00ae tubes  at 4 \u00b0C. With these conditions, we maintained bacterial survivability 2 logs above the suggested value in the literature, with this acting as an ideal system for delivering probiotic bacteria to the GIT.In a previous study, an exhaustive experimental orthogonal design with 72 encapsulated mixtures was designed to selected the mixture with the best physicochemical-dynamical-mechanical-thermal characteristics, based on Young\u2032s modulus, Dynamic Mechanical Analysis, Differential Scanning Calorimetry, diffusivity, and the profile of concentrations through time, as the representative analyses, with high performance under simulated gastrointestinal conditions (data not shown) . In the n = 10) received only sterile NaCl 0.9%; group 3  and groups 4\u20135  received 8.992 \u00d7 1010 cells\u00b7mL\u22121 of microencapsulated BF dissolved in NaCl 0.9% or LYC . LYC was extracted from softgels and homogenized with NaCl 0.9% to provide the corresponding concentration; groups 6\u20137  received 20 and 50 mg kg\u22121 of LYC, respectively. Metformin  has been reported to provide in vivo and in vitro anti-inflammatory effects through inhibition of NF-\u03baB signaling [n = 7) received 600 mg\u00b7kg\u22121 of metformin , dissolved in NaCl 0.9%. The corresponding treatments were prepared daily and gavaged every morning  to all mice throughout the 16 weeks, with the exceptions of weeks 5 and 6. After 4 weeks, animals in groups 2\u20138 were treated with a single subcutaneous injection of azoxymethane  10 mg\u00b7kg\u22121, dissolved in NaCl 0.9%; then, at week 5, 2.0% dextran sulfate sodium  was administered ad libitum for 7 days [For the carcinogenesis study, 64 male ICR/CD-1 mice  at 5\u20136 weeks of age 28\u201330 g) were maintained in a temperature and humidity-controlled facility under the conventional 12 h:12 h light/dark cycle. Water and standard diet  were given ad libitum . The expignaling ,30,44; t g were mr 7 days . Body weBifidobacterium was proved by the successful genus-specific qPCR amplification of tested isolates and the good agreement among plate counting and molecular methods [B. longum spp. from in vivo models [The BF strain was isolated from fecal or tissue samples from experimental animals. For this purpose, fecal pellets and the luminal contents of the stomach, small intestine, caecum, and colon were weighed and homogenized in 1 mL of phosphate buffer solution  by vigorous vortexing. For quantification of tissue-adherent BF in the stomach, small intestine, caecum, and colon, each section was triturated using a polypropylene pestle and homogenized in 1 mL of PBS. Log CFUs were determined by plating serial dilutions in PBS on BSM agar (Bifidus Selective Agar). The appropriateness of the BSM medium for  methods . Besideso models . A singlo models . The resSpecific \u03b2-GA and pH values in the caecal, colonic, and fecales content were determined according to Jenab and Thompson .At the end of the experimental period of 16 weeks, all animals were sacrificed and subjected to complete autopsy. The stomach, small intestine, colon and caecum were removed, flushed with sterile cold saline solution, and opened longitudinally. The colon was divided into proximal and distal sections and inspected for macroscopic pathological lesions. Macroscopic lesions were fixed in 10% buffered formalin for 6 h and embedded in paraffin blocks; histological procedures for subsequent H&E staining and tumor classification were realized according to Per\u0161e and Cerar . LesionsThe colon tissues in paraffin blocks, obtained from the histopathology analysis, were cut into 4-\u03bcm slices. Immunostaining expressions of IGF-1 , IGF-2 , IGF-1R , IGF2BP1 , IGFBP2 , and IGFBP3  were determined with mouse monoclonal antibodies  according to the procedures reported by Han and collaborators [After coloration with diaminobenzidine (DAB) chromogen for 1 min, specimens were rinsed with PBS for 2 min. Hematoxylin was added for counterstaining for 30 s. For the negative control, the primary antibody was replaced with PBS. The classification was according to the proportion of positive cells as follows: single-cell staining and positive cells < 5%, negative (\u2212); small groups of staining and positive cells 5\u201324%, weakly positive (+); clustered staining and positive cells 25\u201350%, positive (++); mass staining and positive cells > 50%, strongly positive (+++).\u00ae 2005  software, with p < 0.05 as a significant difference.Categorical data are expressed as means \u00b1 SEM, using the one-way analysis of variance (ANOVA), followed by the comparison of means by Tukey HSD or Dunnett test. The incidence and histopathological classification of colonic lesions, as well as the positive rates of IGF system expressions, were analyzed by the chi-square test. Correlations were assessed by Pearson correlation coefficient analysis. Statistical analyses were performed using the STATISTICA 7 StatSoft"}
+{"text": "Cancer evolution is fueled by epigenetic as well as genetic diversity. In chronic lymphocytic leukemia (CLL), intra-tumoral DNA methylation (DNAme) heterogeneity empowers evolution. Here, to comprehensively study the epigenetic dimension of cancer evolution, we integrate DNAme analysis with histone modification mapping and single cell analyses of RNA expression and DNAme in 22 primary CLL and 13 healthy donor B lymphocyte samples. Our data reveal corrupted coherence across different layers of the CLL epigenome. This manifests in decreased mutual information across epigenetic modifications and gene expression attributed to cell-to-cell heterogeneity. Disrupted epigenetic-transcriptional coordination in CLL is also reflected in the\u00a0dysregulation of the transcriptional output as a function of the combinatorial chromatin states, including incomplete Polycomb-mediated gene silencing. Notably, we observe unexpected co-mapping of typically mutually exclusive activating and repressing histone modifications,\u00a0suggestive of intra-tumoral epigenetic diversity. Thus, CLL epigenetic diversification leads to decreased coordination across layers of epigenetic information, likely reflecting an admixture of cells with diverging cellular identities. In chronic lymphocytic leukemia (CLL), evolution is driven by transcriptional and epigenetic heterogeneity. Here, the authors integrate epigenomic analyses to show how intra-tumoral epigenetic diversity results in divergent chromatin states in CLL cells, increasing cell-to-cell transcriptional heterogeneity. Chronic lymphocytic leukemia (CLL)\u2014a common B cell malignancy\u2014serves as a highly informative model for cancer evolution as it undergoes substantial genetic diversification4 and evolution with therapy5.Cancer growth, progression, and relapse are the result of an evolutionary process fueled by intra-tumoral diversity8. In fact, the stable propagation of the ancestral epigenome allowed the use of DNA methylation (DNAme) patterns to precisely retrace the initially transformed cell-of-origin from which different CLLs emerge8. In addition to the largely stably inherited epigenome, we have previously shown that growing CLL populations also undergo ongoing somatic DNAme changes akin to the process of genetic diversification through ongoing mutations, leading to high intra-leukemic epigenetic heterogeneity, greater clonal evolution, and adverse outcome9, as has been shown for other malignancies10.In addition to genetic changes, the CLL epigenome is an important disease-defining feature linked to its cell-of-origin and is predictive of outcome12, we reasoned that intra-leukemic epigenetic heterogeneity may extend to histone modifications, likely promoting lineage plasticity by enabling permissive chromatin states. To address this question, we complemented bulk reduced representation bisulfite sequencing (RRBS) analysis with a chromatin immunoprecipitation sequencing (ChIP-seq) compendium of histone post-translational modifications and gene expression, together with joint DNAme and transcriptome single cell analysis in a cohort of 22 primary CLL and 13 healthy B lymphocytes samples. Our integrative analysis revealed a markedly decreased coordination between different layers of the CLL epigenome, whereby ongoing epigenetic diversification leads to an admixture of cells with diverging epigenetic identities, thus providing a novel perspective into the epigenetic dimension of cancer evolution.However, DNAme constitutes only a single layer of the epigenetic information encoding cell identity. Given the importance of histone modifications to lineage plasticity in cancerIGHV mutated and unmutated CLL , as well as 12 healthy B lymphocytes samples  and transcriptome sequencing (bulk RNA-seq) in a cohort of 20 primary 14, revealed core enhancer and super-enhancer , with increased H3K27ac in proximity to genes critical for lymphocyte proliferation and differentiation, including BCL2, LEF1, and CTLA417  and CLL patient samples  using a targeted bisulfite sequencing capture assay, which preferentially evaluates dynamic CpGs at gene-regulatory elements22  between CLL and normal B samples, most of which were hypomethylated in CLL \u2014which measures how much can be learned from one variable about another (see Methods). Consistent with disrupted coordination across these two layers of the CLL epigenome, we observed lower pairwise MI between bulk DNAme and H3K27ac in CLL samples  compared with normal B cell samples at super-enhancer regions .The observed intermediate bulk DNAme patterns at H3K27ac regulatory regions are reminiscent of our previous observation of intermediate DNAme in promoters stemming from stochastic DNAme intra-leukemic diversification during CLL evolutionn\u2009=\u200996 cells [1 sample], n\u2009=\u2009288 cells [2 samples], respectively; Fig.\u00a0t-test, P\u2009<\u20090.0001), the matched single-cell MI increase was higher in CLL compared with normal B cells  and gene expression, in CLL relative to normal B cells , compared with normal B cells when adding RNA information into the DPM analysis, indicating that the transcriptional output of epigenetic states is less uniform in CLL  were associated with uniform gene silencing in B cells, they were associated with variable expression in CLL  signaling pathway  and transcriptional output, we modeled the combinatorial patterns of histone modifications  and DNAme (based on bulk bisulfite sequencing), with or without gene expression (based on bulk RNA-seq), using a Dirichlet Process Mixture (DPM) approach, which allows learning de novo the number of combinatorial states. We observed a significantly higher number of states across CLL samples  H3K27me3hi/H3K4me3low/H3K27aclow-marked genes were indeed associated with significantly higher intra-leukemic expression information entropy compared to normal B cells (n\u2009=\u200984), or compared to a set of genes with matched mean expression but not marked by H3K27me3hi/H3K4me3low/H3K27aclow  on CLL and normal B cells data based on three of the different histone modifications , DNAme (based on bulk bisulfite sequencing), and gene expression information (based on bulk RNA-seq). We identified 12 distinct epigenetic states that fell into two broad categories. First, a category that correlated with active transcription including active promoters , enhancers , and 5\u2032 and 3\u2032 boundaries of transcribed genes (\u201cI\u2013IV transcription\u201d). Second, a category of genes with no or little detectable transcription, including bivalent or poised , repressed Polycomb (\u201cPRC\u201d), and mCpG-rich (\u201cmCpG\u201d) states  between H3K27ac and H3K27me3 marks at H3K27ac-H3K27me3 segments identified in our data , linking regulatory chromatin variability to stem-like cell programs, according to the notion that epigenetic variability in cancer may lead to a drift toward a hybrid stem-somatic cell state31  via its catalytic Ezh2/Ezh1 subunit34, these results are consistent with CLL epigenetic landscape being marked by incomplete Polycomb complex-mediated gene silencing resulting in permissive chromatin states in a fraction of cells. Furthermore, as DNAme is important for appropriate retargeting of PRC2 and H3K27me3 histone modification across cell divisions35, stochastic DNAme alterations during CLL evolution9 may lead to redistribution of the repressive activity of the PRC2 complex and the H3K27me3 mark, and cell-to-cell variation in the efficiency of PRC2 transcriptional silencing36.To further extend the evaluation of epigenetic co-ordination beyond two epigenetic layers, we modeled the combinatorial patterns of histone modifications, DNAme, and gene expression. Interestingly, we observed a dysregulation of the transcriptional output as a function of the combinatorial chromatin states. Specifically, while in normal B cells H3K27me337. Thus, epigenetic diversification leads to corrupted coherence across the different layers of the epigenome in CLL, consistent with ongoing epigenetic diversification leading to an admixture of cells with diverging epigenetic identities  and repressing (H3K27me3) histone modifications, closely associated with activation of stem-like programs and greater cell-to-cell transcriptional heterogeneity. Notably, the co-mapping of these typically mutually exclusive histone modifications was previously observed in the context of embryonic stem cell neural differentiation, reflecting cellular heterogeneity due to admixture of differentiated and undifferentiated cellsies Fig.\u00a0.39, epigenetic evolutionary routes are a major emerging theme across cancer, including prostate cancer, lung cancer and melanoma40. Cancer cells can display profound non-genetically mediated transcriptional variability, which may enable adaptive changes such as therapeutic resistance, persistence or lineage plasticity. Notably, these states are efficiently propagated to progeny cells suggesting stable epigenetic encoding. Indeed, in CLL, non-genetic persistence as well as lineage transformation have been reported as potential routes of escape from therapeutic inhibition41. Our data demonstrates that these adaptive capacities may be fueled by significant intra-tumoral epigenetic diversity resulting in permissive chromatin states across cells, leading to greater cell-to-cell transcriptional variation  counts for the CLL patient samples used in our analyses were in a range of 50\u2013394\u2009K (median of 201\u2009K), consistent with a purity of >90% based on previously published sequencing data3. Immunoglobulin heavy-chain variable (IGHV) homology  were determined43. Cytogenetics were primarily evaluated by FISH analysis for the most common CLL abnormalities   and conducted in accordance to the Declaration of Helsinki protocol. Blood samples were collected in EDTA blood collection tubes (BD Biosciences) from patients and healthy adult volunteers enrolled on clinical research protocols at the Dana-Farber/Harvard Cancer Center (DF/HCC), Memorial Sloan Kettering Cancer Center (MSKCC), and NewYork-Presbyterian/Weill Cornell Medical Center (NYP/WCMC). We note that the IRB does not permit collection of demographic information of healthy donors. Informed consent on DF/HCC, MSKCC and WCMC IRB-approved protocols for genomic sequencing of patient samples was obtained prior to the initiation of sequencing studies. The diagnosis of CLL according to World Health Organization (WHO) criteria was confirmed in all cases by flow cytometry, or by lymph node or bone marrow biopsy. B cells from healthy donors and CLL patient samples were isolated from blood samples using Ficoll-Paque Plus  density gradient centrifugation and red blood cell lysis, followed by EasySep\u2122 Human B Cell Enrichment Kit  as per manufacturer recommendation. Cells were then cryopreserved in 50% FBS/40% RPMI/10% DMSO and stored in vapor-phase liquid nitrogen until the time of analysis. Tonsillar B cell populations were affinity-purified from de-identified human tonsillectomy specimens by magnetic cell separation+ naive B cells (CD19+CD23+CD27\u2212IgD+) and germinal center memory B cells (CD19+CD23+CD27+IgD\u2212) were sorted using PE/Cy7 anti-human CD27  and FITC mouse anti-human IgD  antibodies with a FACSAria II instrument . Tonsillar CD20+ cells were sorted as CD19+CD20+CD38++. CD5+ normal B cells were not profiled due to their low frequency, and previous data7 showed minimal DNA methylation differences between CD5+ and CD5\u2212 na\u00efve B cells. Antibodies used for ChIP include anti-H3K4me3 , anti-H3K27ac , anti-H3K27me3 .Purified CD1944. Briefly, immunoprecipitation reactions were performed with the above-indicated antibodies, each on approximately 500,000 cells, and incubated overnight at 4\u2009\u00b0C. The immune complex was collected with protein A/G agarose or magnetic beads and washed sequentially in the low salt wash buffer , the high salt wash buffer , the LiCl wash buffer  and TE. Chromatin was eluted with elution buffer , and then reverse cross-linked with 0.2\u2009M NaCl at 65\u2009\u00b0C for 4\u2009h. DNA fragments were purified using Agencourt AMPure XP beads . Barcoded immunoprecipitated DNA and input DNA were prepared using the NEBNext ChIP-seq Library Prep Master Mix Set for Illumina  and TruSeq Adapters (Illumina) according to the manufacturer\u2019s protocol on a SX-8G IP-STAR Compact Automated System (Diagenode). Phusion High-Fidelity DNA Polymerase (New England Biolabs) and TruSeq PCR Primers  were used to amplify the libraries, which were then purified to remove adapter dimers using AMPure XP beads and multiplexed on the HiSeq 2000 . Previously published CLL and normal B cells ChIP-seq datasets were downloaded from the Blueprint DCC portal .A minimum of 2 million purified human cells were used. Briefly, cells were fixed in a 1% methanol-free formaldehyde solution and then resuspended in sodium dodecyl sulfate (SDS) lysis buffer. Lysates were sonicated in an E220 focused-ultrasonicator  to a desired fragment size distribution of 100\u2013500 base pairs. ChIP assays were processed on a SX-8G IP-STAR Compact Automated System  using a direct ChIP protocolhttps://www.encodeproject.org/chip-seq/histone/). Raw reads were mapped to the human genome GRCh37 assembly using Burrows-Wheeler Aligner45 (BWA v0.7.17). Duplicate reads were removed using Picard (https://broadinstitute.github.io/picard/) and bigwig files were created for visualization. Peaks were identified with Macs246 (v2.0.10) with a q-value threshold of 0.01. De novo motif enrichment analyses were performed using Homer47 against JASPAR CORE database . Peaks overlapping with Satellite repeat regions and Encode Blacklist were discarded. All ChIP-seq reads were normalized and displayed as read counts per million mapped reads. Super-enhancers in H3K27ac peaks were defined as in48. First, for each sample, H3K27ac peaks without any overlap with known gene promoters (TSS\u2009\u00b1\u20092.5\u2009kb) were identified. Then, H3K27ac peaks within 12.5\u2009kb of each other were concatenated and these regions were ranked by their total normalized H3K27ac signal. H3K27ac intensity was plotted against the corresponding concatenated enhancers rank. The cut-point between super-enhancers and enhancers was defined on the enrichment profile as the tangent with slope equal to 1. Enhancers on the right of the inflection point were defined as super-enhancers  >2 and Benjamini-Hochberg adjusted P-value\u2009<\u20090.01. We note that few differences in the super-enhancer landscape were observed between the two major known CLL subtypes, even with less stringent fold-change and P-value thresholds .ChIP-seq data were processed according to the ENCODE Histone ChIP-seq Data Standards and Processing Pipeline  RNeasy columns according to the manufacturer\u2019s instructions. Subsequently, 500\u2009ng of total RNA was used for polyA selection and TruSeq library preparation according to the instructions provided by Illumina (TruSeq RNA Sample Prep Kit v.2), with 8 cycles of PCR. Samples were barcoded and run on a HiSeq 4000 in a 125\u2009bp paired-end mode, using the TruSeq SBS Kit v.3 . An average of 75 million paired reads was generated per sample. Raw reads were mapped to the human genome GRCh37 using STAR (v2.5.2a) aligner52. Reads were further filtered if: (i) the read did not align to an autosome, (ii) the read failed platform/vendor quality checks (SAMtools flag 0\u2009\u00d7\u2009200), and/or (iii) the read did not align to an MspI cut site. The methylation state of each CpG was determined by comparing bisulfite-treated reads aligning to that CpG with the genomic reference sequence. The methylation level was computed by dividing the number of observed methylated cytosines (which did not undergo bisulfite conversion) by the total number of reads aligned to that CpG. In addition, the number of CpG measurements on each read was noted.Genomic DNA from CLL samples and normal B cell samples were used to produce RRBS libraries. These were generated by digesting genomic DNA with MspI to enrich for CpG-rich fragments, and then were ligated to barcoded TruSeq adapters  to allow immediate subsequent pooling. This was followed by bisulfite conversion and PCR. Libraries were sequenced and 29mers were aligned to the hg19 genome using MAQ version 0.6.653 with the following parameters: bsmap -s 16 -v 0.1 -S 1 -n 1 -q 20 -r 0. Subsequently, we used Picard tools (http://picard.sourceforge.net) version 2.16.0 to further process and QC the aligned data files. Standard performance metrics for each library are available in Supplementary Data\u00a054 software suite with standard parameter settings. Then, we converted the resulting CpG level files to bigBed files for visualization in IGV55, filtering out all CpGs that were covered with less than five reads. Analysis of targeted bisulfite sequencing capture assay data was conducted using the methylKit package56 and a 500-bp tiling of the target capture set. Briefly, we imported the CpG level methylation call files from mcall into R using the methylKit function \u201cmethRead\u201d and then computed the weighted methylation mean for each 500-bp tile using the function \u201cgetData\u201d, weighting the methylation level of each CpG with its coverage. We then merged the tile level methylation information across all samples and retained only those tiles covered with more than 10 reads in 70% or more of all samples. To compute differentially methylated tiles, we performed Fisher\u2019s exact test on pooled CLL vs. normal B samples for each tile. Subsequently, we corrected the resulting P-values using Benjamini\u2013Hochberg correction and defined regions with a Q-value \u2264 0.05 and an absolute methylation difference \u2265 0.3 as differentially methylated. Finally, we merged differentially methylated tiles into larger differentially methylated regions (DMRs) if they were less than 400\u2009bp apart22.Hybrid-selected sequencing libraries were prepared combining Accel-NGS Methyl-Seq DNA Library Kit (Swift Biosciences) with the NimbleGen SeqCap Epi Enrichment System (Roche NimbleGen), enabling lower input DNA quantities while maintaining library complexity. Briefly, pre-capture libraries were constructed following the \u201cbisulfite-conversion first\u201d library construction protocol of the Accel-NGS Methyl-Seq DNA Library Kit (Swift Biosciences) with the following exceptions: (1) To minimize the off-target sequencing rate, we sheared the input DNA to ~200\u2009bp fragments instead of shearing to ~400\u2009bp fragments; (2) we doubled the PCR volume and used 8 PCR cycles for the pre-capture library amplification in 1\u00d7 HiFi HotStart ReadyMix (Kapa Biosystems). SeqCap Epi hybridization reactions contained a total of 1\u2009\u00b5g of a pool of 2\u20134 PCR-amplified pre-capture libraries, a total of 1 nmol of 2\u20134 index-specific blocking oligonucleotides, and the custom SeqCap probe pool designed for the targets listed in Supplementary Data\u00a057 was used to calculate overlaps between differentially methylated regions with the different genomic features investigated, requiring a 50% minimal overlap fraction. Promoters were defined as 1\u2009kb upstream and 1\u2009kb downstream of hg19 RefGene gene transcription start sites (TSSs), unless stated otherwise. The set of CpG Islands (CGIs) were defined using biologically-verified CGIs58. ChIP-seq peak sets were defined as above-described. For the pathway analysis in Supplementary Fig.\u00a059 to identify associated biological themes, using default association rule .BEDTools v2.25.0IGHV mutated and two IGHV unmutated CLL patient samples were used to produce whole-exome libraries. Details of whole-exome library construction and analysis have been detailed elsewhere3. Briefly, output from Illumina software  was processed by the Picard data processing pipeline to yield BAM files containing aligned reads with well-calibrated quality scores. We used the ABSOLUTE algorithm60 to calculate tumor purity\u2014the ratio of tumor cells to total cells in the sample\u2014and obtained a very high degree of purity , consistent with a negligible contamination of non-malignant cells in our CLL samples.Genomic DNA from two +CD5+ cells, which in CLL patients are overwhelmingly malignant61 (\u226595%). Plates were stored at \u221280\u2009\u00b0C until further processing. The day of the experiment, cells were lysed for 2\u2009h at 50\u2009\u00b0C in 1\u00d7 CutSmart buffer supplemented with Proteinase K  and Triton X-100  for a final volume of 5\u2009\u03bcL. Proteinase K was heat-inactivated for 30\u2009min at 75\u2009\u00b0C. DNA was incubated with 10 units of the restriction enzyme Msp1 (Fermentas) in 6.5\u2009\u03bcL final volume reaction during 90\u2009min at 37\u2009\u00b0C. Heat-inactivation was performed for 10\u2009min at 70\u2009\u00b0C. Digested DNA was filled-in and A-tailed at the 3\u2032 sticky ends in 8.5\u2009\u03bcL final volume of 1\u00d7 CutSmart with 2.5 units of Klenow fragment . Reaction was supplemented with 1\u2009mM dATP and 0.1\u2009mM dCTP and 0.1\u2009mM dGTP (NEB) and performed as follows in a thermocycler: 30\u2009\u00b0C for 25\u2009min, 37\u2009\u00b0C for 25\u2009min and heat-inactivation at 70\u2009\u00b0C for 10\u2009min. Custom barcoded methylated adapters (0.1\u2009\u03bcM) were then ligated overnight at 16\u2009\u00b0C with the dA-tailed DNA fragments in the presence of 800 units of T4 DNA ligase (NEB) and 1\u2009mM ATP (Roche) in a final volume of 11.5\u2009\u03bcL of 1\u00d7 CutSmart buffer. T4 DNA ligase heat-inactivation was performed at 70\u2009\u00b0C for 15\u2009min the next day. Genomic DNA from 24 individual cells were pooled together according to their barcodes, giving, for a 96-well plate, 4 pools of 24 cells. Pooled genomic DNA was cleaned-up and concentrated using 1.8\u00d7 SPRI beads (Agencourt AMPure XP\u2014Beckman Coulter). Each pool was then sodium bisulfite converted  following manufacture recommendations. To ensure full bisulfite conversion, two cycles of conversion were performed. The double-stranded DNA was first denatured 10\u2009min at 98\u2009\u00b0C and then incubated for 20\u2009min at 60\u2009\u00b0C. Hundred nanogram of dephosphorylated and sheared bacterial DNA was added as carrier to every pool prior to conversion. Converted DNA was then amplified using primers containing Illumina i7 and i5 index. Following Illumina pooling guidelines, a different i7 index was used for every 24-cell pool, allowing multiplexing of 96 cells for sequencing on one Illumina HiSeq lane. Library enrichment was done using KAPA HiFi Uracil\u2009+\u2009master mix (Kapa Biosystems) and the following PCR condition was used: 98\u2009\u00b0C for 45\u2009s; 6 cycles of: 98\u2009\u00b0C for 20\u2009s, 58\u2009\u00b0C for 30\u2009s, 72\u2009\u00b0C for 1\u2009min; followed by 12 cycles of: 98\u2009\u00b0C for 20\u2009s, 65\u2009\u00b0C for 30\u2009s, 72\u2009\u00b0C for 1\u2009min. PCR was terminated by an incubation at 72\u2009\u00b0C for 5\u2009min. Enriched libraries were cleaned-up and concentrated using 1.3X SPRI beads. DNA fragments between 200\u2009bp and 1\u2009kb were size-selected and recovered after resolving on a 3% NuSieve 3:1 agarose gel. Libraries molarity concentration calculation was obtained by measuring concentration of double stranded DNA (Qubit) and quantifying the average library size (bp) using an Agilent Bioanalyzer. Every 24-cells pool was mixed with the others pool in an equimolar ratio. All cells from a 96-well plate were sequenced as paired-end on HiSeq 2500 with 10% PhiX spike-in. Negative controls (empty wells with no cell) were used to control for non-specific amplification of the libraries.Single cell experiments were performed by sorting DAPI negative cells in 96-well plates in 3\u2009\u03bcL of 0.1\u00d7 CutSmart buffer (New England Biolabs) per well using a BD Influx sorter . Nucleated CLL cells were gated and index-sorted as CD1962  running on bowtie2-2.2.8 aligner63. Bismark methylation extractor (--bedgraph --comprehensive) was used to determine the methylation state of each individual CpG. For downstream analyses, a site was considered methylated or unmethylated only if there was 90% agreement of the methylation state for all reads mapped to the site.Each pool of 96 cells was first demultiplexed by Illumina i7 barcodes  enzymatic reaction . MscRRBS protocol was then performed on the digested gDNA after the restriction enzyme digestion step.Single cells were sorted by flow cytometry into 2.5\u2009\u03bcL of RLT Plus buffer (Qiagen) supplemented with 1\u2009U/\u03bcL of RNase Inhibitor (Lucigen). Sorted cells were immediately stored at \u221280\u2009\u00b0C. Genomic DNA (gDNA) and mRNA have been separated manually. A modified oligo-dT primer  was conjugated to streptavidin-coupled magnetic beads  according to the manufacturer\u2019s instructions. To capture polyadenylated mRNA, we added the conjugated beads (10\u2009\u03bcL) directly to the cell lysate and incubated them for 20\u2009min at room temperature with mixing to prevent the beads from settling. The mRNA was then collected to the side of the well using a magnet, and the supernatant, containing the gDNA, was transferred to a fresh plate. Single-cell complementary DNA was amplified from the tubes containing the captured mRNA according to the Smart-seq2 protocol50 (version 2.5.2a) with the annotation of GENCODE65 (version 19). The number of read counts overlapping with annotated genes were quantified applying the \u201cGeneCounts\u201d option in the STAR alignment. We filtered out poor quality cells when the detected number of genes was below 500 or the fraction of mitochondrial gene counts was higher than 20%. To compare the cells in terms of their transcriptional differences, we normalized the read counts by scaling for the total number of counts per cell. To assess potential confounding effect due to cell cycle phase, we classified CLL cells into cell cycle phases using AUCell method implemented in the SCENIC analytical toolkit66. Briefly, AUCell uses the area under the curve (AUC) to identify cells with active gene sets, by calculating the proportion of genes in each input gene set that is enriched within the expressed genes for each cell. Each cell is assigned an AUC score for each gene set. Cells expressing many genes from the gene set will have higher AUC score than cells expressing fewer. Last, the highest AUC threshold is used to consider a gene set \u201cactive\u201d in a given cell. The Molecular Signature Database67  C2 curated gene sets \u201cBIOCARTA_G2_PATHWAY\u201d and \u201cBIOCARTA_G1_PATHWAY\u201d were used as input gene sets for this analysis. We observed that the vast majority of cells are classified as being non-cycling cells , with a negligible number of cells being in either G2/M  or G1 phase , consistent with the majority of CLL cells being in a resting non-cycling state68.The sequenced read fragments were mapped against the hg19 human genome assembly using the 2pass default mode of STARn\u2009=\u2009759 genes).To begin, cells with fewer than 500 detected genes or a proportion of mitochondrial or ribosomal reads above 20% were removed from the analysis for quality control. Constitutively highly expressed mitochondrial genes and genes encoding ribosomal proteins across all cells were then removed. Then, cells in the bottom 10th percentile of total read counts for a given sample were discarded, and each of the remaining cells was probabilistically downsampled to match the number of reads at this cutoff. Subsequently, genes with reads detected in less than five cells were removed from the analysis. At single-cell resolution, a gene\u2019s promoter methylation rate was represented by the proportion of methylated CpGs in the region 2500 base pairs upstream and downstream of the transcription start site. Genes with less than 10 CpG observations in the promoter region for a given cell were removed. We then computed the mutual information between promoter methylation rate and gene expression for each cell using a threshold of zero, implying that any detected methylation or expression for a given gene was treated as having a value of 1 for that cell, and 0 otherwise. For a gene to be included in the final analysis, it was required to have at least 10 cells with sufficient CpG data for a methylation call (10 CpG observations) as well as greater than 10% non-zero expression across all cells to mitigate the impact of dropout. The approach was validated by a non-parametric premutation test, in which we randomly permuted the cell methylation values for each gene while holding the corresponding expression vector constant (such that RNA and DNAme are no longer linked at the single-cell level) and computed an unmatched version of the mutual information. This was repeated as many times as cells were available for a given gene, and the final unmatched mutual information value provided corresponds to the median of the result for each of these permutations. We note that the analysis for Fig.\u00a067 . Specifically, we used the C2 curated gene sets and Benjamini-Hochberg FDR adjusted P-value cut-off of 0.05.Gene set enrichment analysis was performed using GSEA software, and Molecular Signature Database69, which is based on a multivariate HMM, using H3K4me3, H3K27ac, H3K27me3, whole cell extract, RNA-seq and DNAme (based on bulk RRBS) datasets as input. ChIP-seq reads were shifted in the 5\u2032\u20133\u2032 direction by 100\u2009bp. Reads counts were computed in 200\u2009bp non-overlapping bins. Normalized raw counts were then modeled with an HMM assuming that the hidden state vector followed a negative binomial distribution. We trained several HMM models in parallel mode with the number of states ranging from 5 states to 25 states and chose a 12-state model as the best model that captures all the key interactions between the epigenetic marks and cover all possible genomic elements  that we expected to resolve given the selection of datasets we used . Genomic regions were then annotated with the state with the maximum posterior probability in the 200\u2009bp bin. State enrichment in different genomic features was calculated dividing the percentage of nucleotides occupied by a state in a particular genomic feature by the percentage of nucleotides that this genomic feature represents in the entire genome.Chromatin states across the genome were defined using EpicSegInfinite mixture model with the Dirichlet process was used to model the normalized signal count matrix and to derive a segmentation of the chromatin tracks. The scikit-learn Python library (sklearn.mixture.BayesianGaussianMixture v0.19) was used to generate an independent model for each sample. Cross-validation for each sample was performed training on a random 1/10 of the genome, applying the cross-validation model to the sample and repeating this procedure 100 times. Subsequently, a leave-one-out procedure was implemented to assess the contribution of each chromatin and transcriptome track independently. Unsupervised hierarchical clustering of state emission was performed to identify unique states.To test for significance of association of chromatin state status with expression heterogeneity in Figs.\u00a010 scale.The association with chromatin state status was tested using a\u00a0generalized additive model (implemented by gam R package). The following type of model was tested:U-test, Welch\u2019s t-test, paired t-test, non-parametric permutation test or Kolmogorov\u2013Smirnov test as appropriate. P-values were adjusted for multiple comparisons by Benjamini-Hochberg FDR procedure, as appropriate. All P-values are two-sided and considered significant at the 0.05 level unless otherwise noted.Statistical analysis was performed with Python 2.7.13 and R version 3.4.2. Categorical variables were compared using the Fisher\u2019s Exact test. Continuous variables were compared using the Mann\u2013Whitney Further information on experimental design is available in the\u00a0Supplementary InformationDescription of Additional Supplementary FilesSupplementary Data 1Supplementary Data 2Supplementary Data 3Supplementary Data 4Supplementary Data 5Supplementary Data 6Supplementary Data 7Supplementary Data 8Supplementary Data 9Supplementary Data 10Supplementary Data 11Supplementary Data 12Reporting Summary"}
+{"text": "HIV/AIDS stigmatization is a public health impediment . Stigmaswhat experiences you have ever had with HIV?\u2019This qualitative content analysis was conducted in Shiraz, Iran in 2016. This study was supported by Shiraz HIV/AIDS (H/As) Research Center at Shiraz University of Medical Sciences. Study participants included 11 women infected with H/A and referred in an H/As-dedicated center, called Lavan. Data were collected with focus group discussions (FGDs) method. The main questions in discussions was \u2018Results showed that all participants experienced discrimination by the society as well as health providers. They have experienced discrimination in hospitals or clinics. Three of them narrated the worst experience in the clinic. A participant with back pain referred to general physician and the doctor pushed her chair back and said \u2018do not move\u2019 to the patient. Other participants with hyperthyroidism and gynecologic problems were disrespected by their doctors, too. Because of this, these women come to a conclusion that if their diseases were revealed somewhere they were ignored. Therefore, they fear of diagnostic disclosure and they try to hide their diseases as well as possible. This finding is in line with another study that showed doctors and nurses involved with HIV patients, treat them very badly; with insult, humiliation, neglect and lack of response . MoreoveIn this situation, health system in Iran needs to pay close attention to the disparities and discrimination against people living with HIV seriously. Socialization of healthcare providers especially physicians and nurses about the importance of stigma and discrimination is inevitable. In addition, health law needs to pay attention to the lost rights of these people. Since health is important rules must be in a direction that if anyone discourages these patients or refuse treatment and care he/she is being convicted."}
+{"text": "Microscopic and molecular studies suggest that lichen symbioses contain a plethora of associated fungi. These are potential producers of novel bioactive compounds, but strains isolated on standard media usually represent only a minor subset of these fungi. By using various in vitro growth conditions we are able to modulate and extend the fraction of culturable lichen-associated fungi. We observed that the presence of iron, glucose, magnesium and potassium in growth media is essential for the successful isolation of members from different taxonomic groups. According to sequence data, most isolates besides the lichen mycobionts belong to the classes Dothideomycetes and Eurotiomycetes. With our approach we can further explore the hidden fungal diversity in lichens to assist in the search of novel compounds. Lichens are self-sustaining symbiotic associations of specialized fungi (the mycobionts), and green algae or cyanobacteria (the photobionts), which are located extracellularly within a matrix of fungal hyphae and from which the fungi derive carbon nutrition . LichensSuch work still needs to be accomplished with the fungal associates of lichens, but it is known that numerous lichenicolous fungi can modify the morphology of their hosts ,14. The However, some technical issues remain to be solved with complex symbiotic systems, such as lichens. Externally visible fungi, or those which produce phenotypic symptoms on their hosts, are not necessarily the same fungi that can be retrieved easily in culture. In fact, symptomless fungi residing or growing in lichens are very common . The bioCulturing protocols are available since long time for the mycobiont of lichens and these were improved over the past decades ,27,28,29Phoma lineage and in Myriangiales. Leotiomycetes and Sordariomycetes are the least represented among the retrieved strains: only 11 isolates have been identified in addition to those reported by Muggia et al. [We report here the isolation of 92 lichen-associated fungal strains: 67 Eurotiomycetes, 14 Dothideomycetes, eight Leotiomycetes and three Sordariomycetes . These iTrebouxia Medium (TM) and Lilly & Barnet Medium (LBM), whereas Dichloran/Glycerol agar medium DG18 turned out to be ineffective for their growth  seem to be important for the growth of Sordariomycetes. Fungal growth in our experiments was not dependent on the pH of the media, as this was kept within a narrow range in all media with values of (5.2\u2013) 5.6 (\u20136.0).We observe that the presence of magnesium, potassium, iron and glucose in growth media is pivotal for the successful isolation of all the fungal classes a. AlternThe great majority of the isolated strains represent melanized fungi belonging to the classes Eurotiomycetes and Dothideomycetes. They were isolated mostly on TM, and this seems to correlate with the abundant presence of metal ions in the medium. Non-melanized fungi, alternatively, have been mostly isolated on SAB. The percentages of melanized and non-melanized fungi isolated on the other four media differ only slightly b.The environmental samples used as source of fungal isolation are lichens belonging to the class Lecanoromycetes, to which also certain lichenicolous fungi belong. In the environmental samples the morphological determination of lichenicolous fungi revealed the presence of Arthoniomycetes, Dothideomycetes and Eurotiomycetes. Lecanoromycetes are, however, the least obtained isolates  and the highest number of isolates is represented by Eurotiomycetes (266) and to a lesser extent by Dothideomycetes (representing the lichenicolous and the endolichenic fungi). Arthoniomycetes did not grow on any medium used. The presence of Agaricomycetes, Leotiomycetes and Sordariomycetes in the thalli could be assessed only when the corresponding isolates were genetically identified.Isolates belonging to Eurotiomycetes, Dothideomycetes, Leotiomycetes and Sordariomycetes developed a mycelium of 5\u201310 mm in diameter within three months. Isolates corresponding to lichen mycobionts were characterized by a slower growth rate and mycelia of up to 5 mm in diameter could be recovered only one year after the original inoculation. To our knowledge, only Vinayaka et al.  have comThe diversity of lichen\u2013associated fungi recovered in culture may depend on the type of surface sterilization applied on the thallus and the growth medium used in the initial isolation step. Several protocols for thallus sterilization have been reported in the literature ,36,37, wCorynespora sp. from Usnea cavernosa with cytotoxic activities against cancer cell lines [A recent review highlights the potential of lichenicolous fungi as bioresources of novel bioactive compounds . Due to ll lines . Furtherll lines . Some ofll lines ,41. Aspergillus, Chaetomium, Penicillium, Sporomiella, Trichoderma\u2014of endophytes commonly found as plant pathogens and saprotrophs [Aspergillus versicolor, producing three new anthraquinones derivatives, isolated form the lung lichen Lobaria retigera [Sporomiella irregularis producing the new xanthone glycoside sporormielloside, isolated from Usnea mutabilis [The fungal strains tested so far for their metabolite production mostly derived from epiphytic and terricolous macrolichens, the thalli of which are leaf-like or fruticose , and represent very widespread genera\u2014such as rotrophs . In manyretigera , and Spoutabilis . Interestingly, many of the isolates obtained here or previously characterized by Muggia et al.  from epiSo far, crustose lichens have been seldom considered as sources of lichen-associated fungi, but our results highlight that they harbor a great diversity of lichen-inhabiting fungi, which excrete pigments into the medium  and deseWith our work we intended to expand the spectrum of cultivable lichenicolous fungi by using a wider range of media conditions. Certainly, this will not lead to a complete inventory of these interesting fungi, but provide means for selective isolation and for better growth of biotechnologically or pharmaceutically interesting fungi. We think that lichen-specific fungi are worth of further investigation for bioactive principles, as these fungi are adapted to live in symbioses with their hosts. As a further step towards uncovering the metabolic potential of lichen-inhabiting fungi, we envision the efficiency of co-culturing of symbionts, which may also involve bacteria as a common component of lichens. Lichen-associated bacteria have already been shown to represent chemically interesting bioresources , but theLichen thalli were sampled in May\u2013July 2012  on the K2 fragments of infected lichen thalli were dissected with a sterile razor blade. The fragments were washed three times for 15 min with distilled sterile water, 30 min with 500 \u03bcL Tween 80 (diluted 1:10) and finally twice for 15 min with sterile water. As the aim of the study was to isolate lichenicolous fungi and any other fungus residing within the lichen thallus [Trebouxia medium ; Treboudium (TM ), Malt Ydium (TM ), Sabourdium (TM ). MY, SAdium  for homogenization, frozen and ground using a TissueLyserII . The DNA was extracted following either the cetyltrimethyl ammonium bromide CTAB protocol of Cubero et al.  or usingThe identity of the cultured fungal strains was studied with sequences of the nuclear large and partial nuclear small ribosomal subunits (nucLSU and nucSSU) and the mitochondrial small ribosomal subunit (mtSSU). Primers and PCR conditions, sequencing and sequence analysis were performed as in Muggia et al. . We checked the identity of the newly generated sequences with sequences available in the GenBank database by BLAST similarity search  and withAs the single locus analyses were congruent for the four individual classes, the final sequence analyses were performed on combined 3-locus datasets  for Dothideomycetes and Eurotiomycetes and 2-locus datasets (nuLSU and nuSSU) for Leotiomycetes and Sordariomycetes as in previous studies ,69,70,71Analyses and figures of media composition and growth preferences of fungal groups were performed in Microsoft Excel 2010  and CorelDrawX7."}
+{"text": "Background: Proteases cleave proteins, thereby providing essential amino acids for protein synthesis, and degrade misfolded and damaged proteins to maintain homeostasis. Proteases also serve as signaling molecules, therapeutic agents and find wide applications in biotechnology and pharmaceutical industry.\u00a0 Plant-derived proteases are suitable for many biomedical applications due to their easy availability and activity over a wide range of pH, temperature, and substrates.Moringa oleifera Lam (Moringaceae) is a very common food plant with medicinal property and geographically distributed in tropical countries. Here, we isolate proteases from the leaves ofMoringa oleifera and characterize its enzymatic activity.Methods: Proteases were isolated from the aqueous leaf extract of Moringa oleifera by ammonium sulfate precipitation and purified by ion exchange chromatography. Subsequently, the enzyme kinetics was determined using casein as a substrate and calibrated over different pH and temperature range for maximal activity.Results: We obtained purified fraction of the protease having a molecular weight of 51 kDa. We observed that for the maximal caseinolytic activity of the protease, a pH of 8 and temperature of 37\u00baC was found to be most effective.Conclusion: The plant-derived proteolytic enzymes are finding increasing clinical and industrial applications. We could extract, purify and characterize the enzymatic activity of proteases from the leaves ofMoringa oleifera. Further molecular characterization, substrate specificity and activity of the extracted protease are required for determining its suitability as a proteolytic enzyme for various applications. Proteases derived from plants, animals and microbes find wide industrial applications including in the leather, food, brewery and pharmaceutical industry4 corresponding to approximately 60% of the total worldwide enzyme sales5.All organisms contain proteases that hydrolyze peptide bonds in order to maintain systemic homeostasis and for its normal growth and developmentMoringa oleifera is one of the best known medicinal plants widely distributed in the tropical regions6. It contains a mixture of several hydrolytic enzymes, in which proteases are the key enzymes reported to show pharmacological activity7. We attempted to investigate the protease activity of aqueous extracts ofMoringa oleifera leaf. Here, we have isolated and purified the protease from Moringa leaves and carried out enzyme kinetics study and find that the protease exhibited optimal caseinolytic activity in alkaline pH.Moringa Oleifera leaves were collected from a plant located near TIU campus, Salt Lake Kolkata and crushed along with 20mM phosphate buffer (pH 7.5) and 0.1% tween 20 detergent and protease cocktail inhibitor followed by centrifugation with plastocraft table top refrigerated centrifuge machine (Rota 4RV/FM) at 10000 rpm for 10 mins at 4\u00b0C. The crude soup was mixed with 40% ammonium sulphate to obtain the protein precipitate, which was then dissolved in 20 mM tris buffer for further evaluation.Mature8 using Sigma\u2019s Bradford reagent (B6916). In this assay, a series of BSA standard solutions (0.1 \u2013 1.2mg/ml) were used to prepare the standard curve. Bradford assay was performed by adding 1 mL of Bradford reagent to 20 \u03bcl of each standard solutions or unknown solution, and homogenized by using vortex mixer. The samples were incubated in dark conditions for 10 minutes and the absorbance was read at 595 nm.The total protein content of the solutions at different stages of protein purification was determined by Bradford methods9 for gel electrophoresis. The samples were mixed with equal volume of gel loading buffer and heated at 95\u00b0C in dry heating bath for 2 mins. The electrophoresis process was run with 90 V for first 10 mins and then run at 150 V with Biorad mini protean gel electrophoresis system. After complete run the gel was stained with Coomassie Brilliant Blue. We have used protein marker (10kD to 250 kD) from GCC biotech (Pre-stained protein marker GCR-P4B) for determination of molecular weight. We imaged the gels in Biorad gel documentation system. Acrylamide, bis acrylamide, Tris and TEMED (T9281) are from Sigma Aldrich. Coomassie Brilliant Blue R250 (93473) and Ammonium per sulphate (28575) was from SRL (Sisco Research Laboratories).We performed sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis (PAGE) using 12% resolving and 5% stacking gels for separating proteins. We followed the Laemmli\u2019s methodDialysis: The pellet dissolved in Tris buffer as obtained above was then dialyzed in 3.5cm/ml dialysis tubing (SIGMA Aldrich D6066 overnight in a magnetic stirrer by immersing the tubing in a buffer containing Tris (pH 8) and phenylmethylsulfonyl fluoride (PMSF) SRL, which was repeated thrice for complete exchange of buffer.Diethylaminoethyl (DEAE) cellulose ion exchange chromatography: The protein sample was loaded in the DEAE cellulose (SIGMA Aldrich 30477) column. Ion exchange column chromatography was carried out by using an assembly of Biorad\u2019s Econo pump model EP-1, UV monitor and chart recorder from Atto, Japan and Biorad\u2019s fraction collector model 2110. A gradient of 0.05 M to 0.5 M NaCl was used to elute the protein from the column. The gradient was run for 150 min with a flow rate of 1ml/min. Optical density (OD) of all the fractions were taken at 280 nm with Schimadzu 2401 UV Vis Spectrophotometer.Samples at different stages of purification were tested for albuminolytic property of protease by using BSA SIGMA as substrate. BSA digestion was performed at 37\u00b0C and pH 7.5 for 1 hour. Further, each of the samples were mixed with protein gel loading dye in 1:1 ratio and loaded in SDS PAGE and the gel was imaged with Biorad gel documentation system.In this assay, \u03b2-casein was used as substrate. If protease digests casein, the amino acid tyrosine is liberated along with other peptide fragments. Folin\u2019s reagent reacts with free tyrosine to generate a blue colored product, which is quantifiable and measured as an absorbance value on the Schimadzu UV 2401 spectrophotometer at 660 nm. A tyrosine standard calibration curve is constructed to determine the amount of tyrosine released after the proteolytic activity. A series of tyrosine standard solutions at different concentrations (5 \u2013 50 \u03bcg/mL) were prepared from the 0.18mg/mL L-tyrosine stock solution with deionized water. L-tyrosine was purchased from Himedia, Fohlin\u2019s reagent was obtained from SRL and \u03b2-casein from SIGMA.We have assayed the protease activity in terms of caseinolytic activity with plant leaf extracts at different stages of purification . All the three samples were dialysed to remove protease inhibitor and EDTA before the protease assay. The protease activity of pure protein was examined at different pH range 4\u20139 and temperature range 4\u201370\u00b0C.The enzyme activity assay for protease was conducted with different concentrations of \u03b2-casein as substrate, at pH-8 in 37\u00b0C respective optimum conditions as determined with the previous experiments described above (optimum temperature and pH conditions). Here the substrate concentration (\u03b2-casein) varied in the range  mg/ml keeping the enzyme concentration fixed.Moringa oleifera leaves are reported to contain protease but there are no detailed studies on the purification and kinetic parameters of the enzyme. Here, we obtain partially purified protease from the aqueous extract of the leaves by ion exchange chromatography such that in anion exchange the proteins show a peak at 280 nm implying a positively charged protein.Moringa oleifera leaves at various stages of purification is shown inThe protein concentration from matureResults fromUV-vis absorption spectra of the pure protease were shown inIn both crude extract and purified protein, protease activity was measured as described in methods. Reactions in different pH 4, 5, 6, 7, 8 and 9 were done . The resThe protease assay with \u03b2-casein as substrate was performed at a range of temperatures; 4\u00b0C, 25\u00b0C 37\u00b0C, 55\u00b0C and 70\u00b0C  accordinSpecific activity of the protease was calculated by enzyme activity from the protease assay using \u03b2-casein as substrate and the total protein content of the protease solution. We can see a large increase in specific activity after the final purification .M and Vmax from the corresponding double reciprocal plot i.e. Lineweaver Burk plot as shown in the inset graph .Moringa oleifera contains a protease with an approximate molecular weight of 51kD, with an optimum temperature of 37\u00b0C and optimum pH of 8.0 for its caseinolytic property. This is the first report of purification of a protease fromMoringa oleifera to our knowledge. Further determination of molecular characterization, substrate specificity and activity of the protease are required to determine its suitability for industrial applications.Our study concludes that mature leaves fromThe data referenced by this article are under copyright with the following copyright statement: Copyright: \u00a9 2018 Banik S et al.Data associated with the article are available under the terms of the Creative Commons Zero \"No rights reserved\" data waiver (CC0 1.0 Public domain dedication).10.5256/f1000research.15642.d212249Dataset 1: Enzyme kinetics data. Zip file containing underlying data of all enzyme activity assays with raw gel images et al.\u00a0describes the isolation and further characterization of protease activity of partially purified protein fraction from the leaves ofMoringa oleifera. The manuscript is well-written with detailed description of materials, methods and results. It, indeed, identified the protease activity with sufficient detailing. It has the potential for future investigation of biochemical characterization and functional relevance of this plant derived protease.The manuscript by BanikIn Figure 2, it is apparent that the first lane is not a part of original figure. Adding a separate lane in an otherwise complete picture is not accepted. A repeat experiment with all the lanes is suggested.The referencing requires to be more elaborate.The discussion should describe potential application of the findings, based on literature review. Addressing these issues will strengthen the acceptability of the finding described in this manuscript. However, there are a few concerns, as pointed below:I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Moringa oleiferaExtraction, purification, and activity of protease from the leaves of\u00a0\u2019 by Banik et al. appears to be an interesting topic related to purification of protease from an economically and medicinally important plant speciesMoringa oleifera.The article entitled \u2018 Overall, the manuscript is well composed, the background and objectives of the study has been mentioned clearly and also justified. The introduction part also appropriately reviews some of the relevant information. The results are sound and explained properly and supported with further explanation in the Discussion part. Therefore, in summary, I\u2019m recommending acceptance and publication of this article.\u00a0 \u00a0 However, for future research interest, the introduction section could have been more extensive, indicating relevant information from recent past and current studies for getting meaningful insight into the background of this research as well as the lacunae which motivated to set the objectives for carrying out this study. The methods part is quite sufficient. However, for the purification part, describing the isolation of the indicated protease activity from Moringa leaf extracts may be more extensive and apart from Coomassie blue staining, quality of purification may be assessed by silver staining procedure to compare the results and enrichment of purification after the column chromatographic techniques. Finally, a discussion section may be included to compare and discuss the findings in light of the related research. In concluding note, application and future research possibilities using the gained knowledge and information may be mentioned.I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Moringaoleifera by Banik S, Biswas S and Karmakar S\u201d explains the extraction, purification and activity of a protease that has been isolated from the leaves of the plantMoringa oleifera. The work is unique and can be of great applications sinceMoringa oleifera is reported to have various medicinal properties.The research article entitled \u201cExtraction, purification, and activity of protease from the leaves of\u00a0 This work may be recommended for indexing only after incorporation of a few changes listed as follows:Major Revision:Figure 2 \u2013 Lane numbers are missing; Marker positioning wrong; data of BSA+POOLED+PMSF and BSA+CRUDE+PMSF missing. Try to include these data for a better clarification to the readers.Figure 4 \u2013 What happens after pH 8, is not reflected in the graph? Then how can this be concluded as optimum pH? A range of pH 4 \u2013 12 at least, would be better for any such conclusion.Figure 5 \u2013 The data points are very scattered. More data points must be included in the graph for proper conclusion, especially between 25\u00b0C and 37\u00b0C and 37\u00b0C and 55\u00b0C.m is outside the substrate concentration range taken in the graph. Km is usually expressed in units of \u03bcM or mM and not mg/ml. The Lineweaver-Burk plot is also erroneous. If the linear line is extrapolated backwards, it will give a negative y-intercept, i.e., a negative 1/Vmax value. The Vmax values obtained by the authors can neither be correlated to the Michaelis \u2013 Menten graph nor to the Lineweaver-Burk plot. Then how is this value obtained?Figure 7 \u2013 This is very confusing. The graph does not look like a Michaelis \u2013 Menten graph. Number of data points must be increased. KMinor Revision:Under the Methods section, in Preparation of crude extract and Purification of protein, the authors have used \u201cTris\u201d buffer. It is usually written as Tris-HCl buffer. Moreover, under the two above mentioned sub-headings, somewhere the pH of the buffer is missing and elsewhere its concentration. Clear information should be provided.Under the Enzyme kinetics assay, it is written \u201ckeeping the enzyme concentration fixed\u201d. The concentration used must be specified.Figure 1B \u2013 is a bit confusing. Marker should be preferably loaded into any of the side lanes. AS 40% pellet also has multiple bands, quite similar to the ladder. If possible, change the gel picture with proper loading arrangement and labelling.Figure 3 \u2013 The peak at 280 nm is quite blunt and the 260/280 ratio is close to 1, suggesting the presence of impurities. Purer fractions must be used.Moringa oleifera\u201d.Figure 6 \u2013 There is no need to write \u201cMoringa samples\u201d in the X-axis title. Instead, it should be mentioned in the figure legend as \u201cSamples fromWhy is this paper cited as a reference as well? Can this be done? Details about the datasheet is provided in the manuscript itself, after conclusion.We have read this submission. We believe that we have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however we have significant reservations, as outlined above."}
+{"text": "In addition to canonical open reading frames (ORFs), thousands of translated small ORFs (containing less than 100 codons) have been identified in untranslated mRNA regions (UTRs) across eukaryotes. Small ORFs in 5\u2032 UTRs (upstream (u)ORFs) often repress translation of the canonical ORF within the same mRNA. However, the function of translated small ORFs in the 3\u2032 UTRs (downstream (d)ORFs) is unknown. Contrary to uORFs, we find that translation of dORFs enhances translation of their corresponding canonical ORFs. This translation stimulatory effect of dORFs depends on the number of dORFs, but not the length or peptide they encode. We propose that dORFs represent a new, strong, and universal translation regulatory mechanism in vertebrates. In contrast to upstream ORFs, translation of small open reading frames located in 3\u2032 untranslated regions of mRNA promotes translation of the canonical ORF, independent of length or sequence of the encoded peptide. Ribosome and proteomic profiling have revealed many small, translated open reading frames (ORFs) within regions of mRNAs that were previously designated \u201cuntranslated regions\u201d (UTRs) as well as in long non\u2010coding RNAs from multiple species and viruses ORFs\u2014by ribosome profiling and proteomics . The sequence between the stop codon of the canonical ORF and start codon of the dORF  , the dORF amino acid sequences are so different that it cannot be aligned  Fig\u00a0C. For exgned Fig\u00a0. Taken tet\u00a0al, et\u00a0al, et\u00a0al, P\u00a0=\u00a00.927, human dORF vs. dORF control; P\u00a0=\u00a00.806, human uORF vs. uORF; P\u00a0=\u00a00.82 zebrafish dORF vs. dORF control; P\u00a0=\u00a00.332, zebrafish uORF vs. uORF, Wilcoxon rank\u2010sum test). After controlling for mRNA levels, we then interrogated the translation efficiency of each group compared to their respective control. As expected, mRNAs containing uORFs had lower translation efficiency than the control group     Figs\u00a0D. Interest) Figs\u00a0D. Similast) Figs\u00a0E and F, st) Figs\u00a0F, when cst) Figs\u00a0A. No sigest) Fig\u00a0B. SimilaP\u00a0<\u00a02.2e\u201016, human; P\u00a0=\u00a06e\u201015, zebrafish, Wilcoxon rank\u2010sum test) and longer 3\u2032 UTR  compared to genes without translated dORF  as well as similar RNA level   Figs\u00a0E. Togethet\u00a0al, et\u00a0al, et\u00a0al, et\u00a0al, et\u00a0al, y\u2010axis). Interestingly, mRNAs containing dORFs had higher translation efficiencies in all 28 databases analyzed , indicating that the positive effect on canonical ORF translation is a robust and general characteristic of dORFs. Furthermore, the average change in translation efficiency attributable to dORFs is comparable to that observed for uORFs . These regulatory effects are similar in strength to those attributable to microRNAs  and zebrafish embryos at different hpf  to their counterparts in which dORF translation was prevented by insertion of a premature stop codon following the dORF translation start site (dMUT) Fig\u00a0A. For alysis Fig\u00a0F, translin\u00a0vitro transcribed mRNA molecules were transfected directly into the cells, suggesting that this effect is independent of transcription or mRNA processing  from untranslated dORFs based on ribosome profiling did not display significant mCherry fluorescence intensity differences between the dORF1 and their counterparts (dMUT1) , which shows enhanced mCherry fluorescence intensity when coupled to the endogenous dORF, but not with artificial dORF sequences (dORF1) , in which dORF2 differs from dORF1 by only a single nucleotide insertion which leads to an early frameshift and a completely different codon compositions. As described before, paired control reporters with premature stop codons were also generated for dORF1 and dORF2   Fig\u00a0B. Moreovrrm1 iUTR and artificial dORF1 resulted in higher levels of mCherry fluorescence intensity than in their respective controls (each NTG dMUT) for all non\u2010ATG codons, indicating that alternative start codons are indeed functional , indicating that the number of dORFs correlates positively with increased translation efficiency , there is minimal correlation between 3\u2032 UTR length and number of translated dORF   Fig\u00a0C, suggesEIF1), which contains two translated dORFs according to the ribosome profiling data . mCherry fluorescence intensity was diminished when either of the two dORFs was disrupted by the addition of a premature stop codon (dORFa or dORFb), and further diminished when both dORFs were disrupted (dMUT), suggesting the dORF number has an additive regulatory impact   Figs\u00a0E. The nust) Figs\u00a0 and EV5.et\u00a0al, et\u00a0al, et\u00a0al, Our findings support the existence of a previously uncharacterized, strong, conserved, and prevalent post\u2010transcriptional regulatory pathway in vertebrates. Specifically, translation of small ORF in the 3\u2032 UTR, dORF, enhances translation of canonical ORFs within the same mRNA. More than one thousand mRNAs contain translated dORF in human cells and zebrafish embryos. The presence of dORFs in orthologous genes suggests a selective pressure to maintain these dORFs. All groups of mRNAs containing translated dORF displayed higher translation efficiency, independent of their translation start site  or of the dORF detection confidence. Specifically, the fact that even the group with the low\u2010confidence dORF detection still displays higher translation efficiency suggests that we might be underestimating the number of mRNAs with translated dORF. The regulatory strength (approximately twofold) of dORF on translation efficiency is comparable to uORFs, microRNAs  within the iUTR is encrypted to recruit ribosomes and/or drive translation. Previous work has revealed enriched IRES activity from 3\u2032 UTR regions . For HeLa cell RNA decay data, it was downloaded from Wu et\u00a0al , and hg38 (human) genomes. RNA\u2010Seq data were mapped using STAR . Ribosome profiling reads were first trimmed (Fastx_clipper \u2010Q33 \u2010n \u2010z \u2010v) using TGGAATTCTCGGGTGCCAAGG (human) and AGATCGGAAGAGCACACGTCT (zebrafish) adapter sequence. Ribosomal RNAs were eliminated using Bowtie2 and mapped using STAR . Only 28\u201330 and 28\u201329\u00a0bp ribosome footprints were used for human and zebrafish, respectively.et\u00a0al  and hg38 and Ens91 (human), the isoform with the most distal stop codon was selected. Potential open reading frames were first defined from the most distal ATG to paired stop codon in all three frames across the entire mRNA. For non\u2010ATG  dORF, only the annotated 3\u2032 UTR regions were used and non\u2010ATG dORF with an ATG in frame was excluded. Only dORF from 10 to 100 codons were selected. The ORFscore has been run as Bazzini et\u00a0al . For eac2(RNA level) less than 1 in all time points (human and zebrafish), and translation efficiency was calculated as log2((rpkm of RPF\u00a0+\u00a00.05)/(rpkm of RNA level\u00a0+\u00a00.05)) of the canonical ORF, excluding the first and last coding codons to rule out ORF size effects due to strong peak at the beginning and ends of the ORF. Then, control groups with similar level of RNA to the interrogated groups  were generated. Control samples falling below the minimum RNA level of dORF\u2010containing genes were first removed. Then, dORF RNA level was divided into 10 quantiles. Probability of sampling control transcripts from a given quantile was calculated as the proportion of dORF transcripts within that range divided by the number of control transcripts within that range.Aligned reads were filtered to exclude any genes which had a logHomo sapiens, the 7\u2010way alignment included Pan troglodyes, Macaca mulatta, Canis lupus familiaris, Mus musculus, Rattus norvegicus, and Monodelphis domestica. The output from Galaxy was split such that one file contained multiple alignments for one dORF; then, all files were scored using PhyloCSF with the following parameters: hg38.7way \u2013strategy omega \u2013files [filelist] \u2013minCodons\u00a0=\u00a010 \u2013removeRefGaps. dORFs were considered conserved if they had a score of >\u00a050, and weakly conserved if they had a score >\u00a00.dORF transcript coordinates were converted into genomic coordinates in R using the ensembldb package. Spliced dORFs were removed. Coordinates were adjusted so they included only the coding sequence of the dORF (no stop codon). Human 7\u2010way multiple sequence alignment was downloaded from UCSC and uploaded to Galaxy, and multiple alignments were extracted using the Stitch MAF Blocks function. In addition to t\u2010test.Human orthologs of zebrafish transcripts were downloaded from Ensembl version 91. First, we defined a set of 9,242 one\u2010to\u2010one human\u2013zebrafish orthologs where each ortholog was present in our dORF analysis. Then, the number of genes which contained translated dORF in both species was determined. To determine whether this intersection was significant, genes were randomly sampled from human and zebrafish equal to the number of transcripts containing dORFs in each species. This was repeated 1,000 times, with the intersection of each random group being determined at each iteration, the 95% confidence interval was determined, and the resampled group was compared to the true intersection using a et\u00a0al, 2009), with running mode of two unranked lists of genes. The human dORF\u2010containing genes are used as target; human resampled control genes with similar mRNA level but no translated dORF are used as background.The GO analysis is done on Gorilla website  were used. These transcripts must also satisfy CDS, 5\u2032 UTR, and 3\u2032 UTR length all greater than or equal to 50\u00a0bp. To estimate RPKM expression, reads were trimmed to the 5\u2032\u2010most base. Next, we shifted the 5\u2032\u2010 and 3\u2032\u2010position of each transcript by \u221212 and \u221215\u00a0bp, respectively. The two windows (each with length 100\u00a0bp) were chosen for the metagene plots around the coding start and end positions. For each transcript, read counts were computed for each position in the two windows and then scaled by the total number of reads within the two windows. The metagene plots were produced by taking the mean normalized read counts of each position in the two windows for all transcripts selected. In this way, the plots were not biased toward transcripts with extremely high read counts. Also, the two windows are interdependent after normalization to the same scale, making them directly comparable.For human and zebrafish genes with translated dORFs, we separate them by different start codons. The 20 nucleotides surrounding each dORF were extracted, and frequencies of nucleotides at each position were determined. To determine whether a nucleotide has significant bias at a given position, the nucleotide frequencies were compared to the frequency of nucleotides in the 3\u2032 UTR as control of each species using a chi\u2010squared test. Enrichment analysis of the 4\u2010mer consisting of the three nucleotides upstream and one nucleotide downstream of the dORF start codon was performed by first determining frequencies of 4\u2010mers in each start codon in human and zebrafish. 4\u2010mer frequencies were compared to frequencies of the same 4\u2010mer in untranslated dORFs of the same start codon as control using a binomial test. PCA was done for both the 4\u2010mer frequency and nucleotide bias nearby dORF start codon. Kozak sequence  frequencies were included as a reference for translation initiation in either species.l\u2010glutamine, and penicillin/streptomycin. The cells were ordered from tissue culture facility from the Stowers Institute, at relatively low passage, lower than passage 15.293T were cultured with DMEM media, supplied with 10% FBS, All the cloning to insert iUTR or dORF after mCherry was done by Gibson assembly with NEBuilder HiFi DNA Assembly Master Mix following protocols. This will avoid any gap between mCherry\u2010iUTR or iUTR\u2010dORF. Sequence information is included in the expanded view tables and also snapgene files. For DNA transfection in 293T cells, it was transfected with Lipofectamine 3000 based on manufacturer's instruction. The plate is set overnight before transfection in 24\u2010well plate, so the cells are around 70% confluent the day for transfection. 500\u00a0ng total DNA per well was added with transfection reagents. 24\u00a0h post\u2010transfection, cells are collected for cytometry or RNA extract. For cytometry, we have two biological replicates\u00a0\u00d7\u00a02 technique replicates. For RNA analysis, we have two biological replicates\u00a0\u00d7\u00a03 technique replicates.in\u00a0vitro transcribed using SP6 mMessage mMachine Kit (Life technology), following in\u00a0vitro polyadenylated with Poly(A) Tailing Kit from Ambion. mRNA was purified by Qiagen RNeasy Mini Kit, and the RNA concentration was quantified by Qubit RNA Broad Range Kit. For RNA transfection, cells were transfected with TransIT\u00ae\u2010mRNA Transfection Kit from Mirus Company based on manufacturer's instruction in 24\u2010well plate with 500\u00a0ng total RNA per well. 24\u00a0h post\u2010transfection, cells are collected for cytometry.The plasmid constructs containing dORF\u2010related reporters were linearized with Not1HF; similarly, GFP\u2010containing control plasmid was also linearized with Not1HF. To generate normal cap and poly(A) mRNA, linearized plasmids were then The florescent reporter intensity of the cells was quantified in ZE5 equipment, using laser of GFP (488/510) and mCherry (587/610), cells were suspended in DMEM with 10% FBS for running cytometry. Cells were not fixed. Cytometry data.fsc file was analyzed with FlowJo, median intensity of the cells was used to represent fluorescent intensity.\u00ae Chemiluminescent Hybridization and Detection Kit from Thermo Fisher, using streptavidin\u2013HRP. The probe for mCherry is cctttctgatgacgcttcccat cccattgt\u2010/3Bio, and the probe for GFP (zsgreen) is CTTGGACTCGTGGTACATGCA GTTCTCCTC\u2010/3Bio/.Total RNA from 24\u2010well plate was extracted with TRIzol chloroform, and the RNA was suspended with 20\u00a0\u03bcl nuclease\u2010free H2O. The concentration of RNA was measured by Qubit, to load around 500\u00a0ng RNA per well. RNA gel running was following the protocol from Lonza Bioscience. Total RNA was resuspended with 1\u00d7 MOPS buffer, formaldehyde, and deionized formamide. Heat at 70\u00b0C for 10\u00a0min, chill on ice, and add loading buffer before running. Then, RNA was migrated using 1\u00d7 MOPS at 100\u00a0V for 3\u00a0h and transferred with 10\u00d7 SSC overnight. Oligonucleotide DNA probes with 3\u2032\u2010biotin were ordered from IDT with HPLC purification. Probing and detection were done following the protocol of North2SouthThe authors declare that they have no conflict of interest.Expanded View Figures PDFClick here for additional data file.Dataset EV1Click here for additional data file.Dataset EV2Click here for additional data file.Dataset EV3Click here for additional data file.Dataset EV4Click here for additional data file.Dataset EV5Click here for additional data file.Table\u00a0EV1Click here for additional data file.Video EV1Click here for additional data file.Review Process FileClick here for additional data file.Source Data for Expanded ViewClick here for additional data file."}
+{"text": "To provide an appropriate tillage fertilization model for improving N utilization efficiency and increasing production, the\u00a0field experiments were\u00a0conducted to study the effects on root distributions and N utilization efficiency of summer maize involving different straw mulching modes combined with N fertilization. No (N0), low (N1), medium (N2), and high (N3) levels of N fertilization were incorporated into soil combined with the surface coverage straw (Treatment B) and the deeply buried straw (Treatment S). The traditional cultivation was used as control treatment. The results shown that treatments S had significantly promoted deep root growth, and the root length density (RLD) increased with increases in N application rate. SN2 and SN3 treatments\u2019 average RLD were significantly increased by 67.5% and 68.1% in the greater than 40 cm\u00a0soil layers. While the Treatment B had significantly increased the RLD in 0\u2009\u201330\u00a0cm soil layers only. With increases in N application rate, the effect on summer maize yields increase under Treatment B were not significantly, and only BN3 increased by 0.4%, while under Treatments S were found to first increase, and then decrease. The apparent recovery efficiency of applied N, N uptake and summer maize yield of SN2 had increased by 66.8%, 20.4%, and 9.3%. Therefore the rational tillage fertilization model was deeply buried straw combined with medium N fertilizer in Hetao Irrigation District. These positive actions could play important roles in the sustainable development of agricultural resources. The results of previous related studies have shown that the returned straw could reduce evaporation, also activate valuable soil nutrients2. When combined with the appropriate fresh or brackish water, it had improved water productivity levels and reduced the salt content in ploughed layers3. The returned straw was found to regulate soil temperatures, and the larger the returned straw mulching amount was, the more obvious the cooling results would be4, which had obvious promoting effects on summer maize roots5. Roots are plants\u2019 most active organs, and are used to absorb both water and nutrients6. The returned straw not only improves the roots distributions but enhances the roots ability to absorb deeply buried water and nutrients, which are particularly important links in the formation of crop yields8. Previous studies have shown that more than 85% of crop roots are distributed in the 0 to 40\u00a0cm soil layers, and at below 20\u00a0cm root layers contribute to 48% of the crop yields10. The root distributions are greatly affected by the soil ecological environmental, such as soil water and fertilizer11. As an important nutrient for crop growth, N affects both crop yields and quality. The main source of N for cultivated plants is through fertilizer application. In agricultural production, large amounts of N have been blindly applied for improving crop\u00a0yields. However, such practices have not only failed to improve crop\u00a0yields, but have easily led to excessive N content levels in soil13. Subsequently, agricultural ecological environments have faced pollution risks, and the N utilization efficiency has been reduced14. Wang et al.15 indicated that one-time applications of N during the seedling stage could better coordinate the supply of N during growth stage, and promote the absorption and utilization of N. Meanwhile, when fertilization was carried out in stages during the growth periods, and appropriate N applications were administered during the grouting periods, significantly increases both yields and N utilization rates could be achieved16. Previous studies18 found that of excessive N fertilizer applications were not conducive to the transfer of N and phosphorus to seeds. It was observed that the yield had not significantly increased, although serious pollution risks to the farmland environments had been caused. The results indicated that reasonable N applications could promote inter-cropping crop yield increases and effectively improves the water use efficiency19. Bi et al.2 found that reduced inter-plant evaporation had occurred regardless of whether irrigated fresh or brackish water was used under covered surface straw mulching. Wang et al.20 and Li et al.21 both determined that straw mulching practices could significantly increase soil organic carbon content levels. It found that straw mulching significantly reduced soil temperatures and straw mulching combined with suitable N fertilizer applications could improve the soil nutrients, N utilization efficiency, and economic benefits of the crops23.In recent years, the crop straw amounts in Hetao Irrigated District have increased year by year, and low utilization rates have been observed. And the environmental pollution issues caused by the burning of crop straw have become increasingly serious. Therefore, as an effective farming measureHowever, there have been few studies conducted regarding the effects of high efficiency N fertilizer on the rhizosphere regulation of crops under straw mulching conditions in arid areas at present. The previous studies have mainly focused on the effects of only mulching or only N fertilizer applications on crop yields, and water use efficiency\u00a0and N utilization. Meanwhile, few studies have considered the effects of rhizosphere regulation on the efficiency of N fertilizer under the combined actions of straw mulching and N fertilizer applications. Therefore, this study was a breakthrough point, in that various modes of straw mulching combined with different amounts of nitrogen fertilizer applications were explored. The study\u2019s field experiments were carried out in Hetao Irrigation District of Inner Mongolia, China. The experiments examined the effects of straw mulching combined with N fertilizer applications on root distributions, the N utilization efficiency, and summer maize yields. And the interaction mechanisms among the straw mulching modes, N fertilizer applications, and rhizosphere regulation were investigated. The results obtained in this study potentially provide some useful references for future improvements in fertilizer utilization efficiency and increased crop yields under the straw mulching combined with reasonable N fertilizer applications, which will enrich the current theories regarding returning straw to soil in similar agricultural areas.\u22121; total nitrogen was\u00a00.87\u00a0g\u00b7kg\u22121; available phosphorus was\u00a014.66\u00a0mg\u00b7kg\u22121; and available potassium was\u00a0180.8\u00a0mg\u00b7kg\u22121. The average bulk density of the soil was 1.51\u00a0g\u00b7cm-3. This study\u2019s experiments were carried during the period ranging from April of 2017 to October of 2018. The total rainfall during the growth period of summer maize in 2017 and 2018 were 75.3\u00a0mm, and 126.9\u00a0mm, respectively. In 2017, rainfall during the growth period mainly concentrated in early June and early August, and the rainfall mainly concentrated in early July and late August in 2018. The observed daily rainfall and temperature changes in experimental area during the growth stage of the summer maize are detailed in Fig.\u00a0The\u00a0experiment plot was located in Jiuzhuang demonstration area, Hetao Irrigation District, Inner Mongolia, China . The plot had the characteristics of a semi-arid continental climate, with an average annual evaporation rate of 2332\u00a0mm. The surface accumulations of salt were observed to be serious during spring and winter seasons. The test soil was determined to be silty loam. The analysis results of the soil samples obtained from the same experimental area in April of 2017 revealed that the top 100\u00a0cm of soil were characterized as follows: Organic matter was\u00a015.33\u00a0g\u00b7kg\u22122 (treatment N1), medium N application rate of 180\u00a0kg\u00b7hm\u22122 (treatment N2), and high N application rate of 225\u00a0kg\u00b7hm\u22122 . The factors of straw mulching depth were 2 set specific treatments, namely surface cover straw mulching , and deeply buried straw mulching . The traditional cultivation was used as control treatment . There were nine treatments . The factors of the N applications were set as 4 specific treatments, which included no N application (treatment N0), low N application rate of 135\u00a0kg\u00b7hmThe summer maize used in this study\u2019s experiment was Junkai 918, which was locally grown varieties and sown using a mechanical seeding process at early May and harvested in late September. The spacing of the summer maize plants was 0.35\u00a0m apart, and the row spacing was set as 0.45\u00a0m.24. The above-ground plants and root samples were placed at 105\u00a0\u00b0C and dried at 80\u00a0\u00b0C to a constant weight, then reweighed. The quality of above-ground dry matter and root samples was measured. The root samples were scanned using an Epson Perfection 4870 root scanner, and the root lengths and other relevant data were analyzed using the Win RHIZO Program.Three representative plants were randomly selected at elongation stage, silking stage, and maturity stage, respectively, and the\u00a0Monolith 3D spatial sampling method was used to collect the maize root samples2SO4/H2O2 boiling process.The yields of the summer maize and its components were measured during the harvesting period. During the harvesting processes, five upper parts of the maize plants were randomly collected from the field, and the stalks, stems, leaves, and seeds were collected. Then, the above-ground plant parts were placed in an oven at 105\u00a0\u00b0C for 30\u00a0min. The oven temperature was then adjusted to 80\u00a0\u00b0C, and the samples were a constant weight. At that point, the dry matter was reweighed. The samples were then crushed and sifted. The total nitrogen content was determined using a Kjeldahl Method via an Hpartial factor productivity of the applied nitrogen  referred to the harvest crop grain yields by the amount of nitrogen applied per unit. The calculation is shown in Eq.\u00a0 referred to increases in crop grain yields associated with the amounts of nitrogen applied per unit. The calculation is shown in Eq.\u00a0 also referred to the recovery rate of the applied nitrogen, which was reflected in the proportion of nitrogen absorbed by the plants from the fertilizer. The calculation was as per Eq.\u00a0, followed by Tukey HSD's multiple range tests. Excel 2010 was used to draw the graph.All data obtained within the individual years were processed using Excel 2010, presented as mean\u2009\u00b1\u2009standard deviation , and analyzed by IBM SPSS Statistics 20. A one-way ANOVA was applied to check the significance of the treatments during the study period (P\u2009<\u20090.05). These results indicated that Treatment B had significantly improved the RLD of 0 to 30\u00a0cm surface soil layers. Meanwhile, Treatment S was conducive to deep root growth, particularly in the RLD of greater than 40\u00a0cm soil layers. And for the 0 to 30\u00a0cm soil layers, it was observed that RLD first increased and then decreased with the increases in N application amounts. The no-nitrogen and low-nitrogen treatments were significantly decreased when compared with Treatment\u00a0CK, with average decreases of 25.2% and 13.9%. It was also found that the medium N (N2) and high N (N3) treatments only increased 4.9% and 3.8% on average. These findings indicated that low N application amounts significantly reduced the RLD of the crops\u2019 surface root systems, while high N application amounts did not, which was not substantially different from CK treatment results. In the 30 to 40\u00a0cm soil layers, the no-nitrogen and low-nitrogen treatments displayed significant decreases when compared with CK treatment, with average decreases of 28.3% and 14.9%, respectively (P\u2009<\u20090.05). The medium and high N treatments were found to have increased by 8.7% and 10.3% on average. In the greater than 40\u00a0cm soil layers, the RLD of no-nitrogen treatment was found to have decreased by 37.1% on average compared with CK. In the other 3\u00a0N treatments, increases of 3.9%, 57.5%, and 56.0% on average were observed. These results indicated that for the deeply buried straw mulching tillage method, the effects of insufficient N applications on the deep root systems were more significant than the effects on the roots closer to the surface. The N2 and N3 treatments both had significant effects on the deep RLD, which was conducive to the growth of deeper root systems.The root length density (RLD) was one of important indexes used to study the root systems of crops, and tend to better reflect the distributions of crop roots in soil layers. Since the distribution trend of 2-year RLD was consistent, the statistical index of the following analysis adopts 2-year average value. From the perspective of different straw mulching methods . During the 2 investigative years, the maximum plant N uptake of Treatments B was observed the BN3 treatment, which had increased by only 0.21%. Meanwhile, the maximum plant N uptake in the S treatments was observed in the SN2 treatment, which increased by 20.4%. Therefore, the plant N uptake could be significantly increased by SN2 treatment in deeply buried straw mulch tillage method with significantly reduced N application amounts. The N uptake of the summer maize plants in 2018 was determined to have increased by between 6.7% and 19.9% when compared with that of 2017. The largest increases were achieved by BN0 and SN0 treatments, which were 19.9% and 14.0%, respectively. This may have been caused by the heavy rainfall which occurred in 2018, and the detailed effects of water on plants N uptake abilities will require further study. When comparing the results detailed in Fig.\u00a0From the perspective of N application amounts Fig.\u00a0, the sumP\u2009<\u20090.05). However, the differences between CK and straw mulching treatments with high N application amounts were not significant. From the perspective of different straw mulching methods, the PFPN at the same N application amounts in Treatments S displayed average increases of 8.6%, 8.6%, and 3.6%, respectively, when compared with Treatments B. At the same N application amounts of the AEN under the different treatments, the AEN values of Treatments S were higher than those observed for Treatments B, with the rate of increase first increasing and then decreasing with the increases in the N application amounts. The SN2 treatment was found to be the largest, being 52.8% higher than CK treatment. The change trends of the REN and AEN were consistent, and SN2 treatment was also determined to be the largest at 66.8% .With increases in N application amounts, the PFPN, AEN, and REN were observed to first increase and then decrease Fig.\u00a0 in the oThe analysis results detailed in Figs.\u00a0P\u2009<\u20090.05).Ear lengths, ear thicknesses, and 100-grain masses are the main agronomic traits of summer maize, which directly affect the yields and Harvest Index Table . The earP\u2009<\u20090.05), and the other treatments were significantly reduced. Under different N application levels, the summer maize yields of Treatments S had average increases of 4.3%, 8.8%, 10.8%, and 4.1%, respectively, compared with Treatments B. At the same N application level, the yields undergoing Treatments S were significantly higher than that of Treatments B, and had increased significantly with the increases in the N application amounts. The summer maize yields of Treatments B had increased with the increases in the N applications amount, then the increase range gradually decreased. The yield of high N (BN3) treatment were found to be the highest, and the effects of the increasing yields were not significant. The summer maize yields in Treatments S first increased and then decreased, and the medium N treatment (SN2) was the largest. The yields of SN2 significantly increased by 9.3% on average. The analysis results detailed in Fig.\u00a0The 100-grain mass values of Treatments B with high N application amounts BN3) displayed no differences with CK treatment, and the other treatments had displayed significantly reduced. While,compared with CK treatment, the 100-grain mass values of the medium and high N application with Treatments S were found to be significantly increased by 8.8% and 9.3% 27, particularly the deep root (>\u200930\u00a0cm), which tend to be affected by the growth environment, fertilization, and other factors10. The RLD was one of the important indexes for studying crop root systems. The results showed that Treatments B had significantly (P\u2009<\u20090.05) increased RLD of the surface soil layers (0 to 30\u00a0cm), with average increases of 14.2% in 2\u00a0years compared with CK treatment. While, Treatments S had significantly increased RLD of deep soil layers, with average increases of 46.5% observed. Under different straw mulching treatments, the RLD had first increased and then decreased with the increases in N application amounts. Barraclough28 found that when RLD was less than 0.8 to 1.0\u00a0cm\u00b7cm\u22123, the absorption abilities of water and nutrients by crop roots would be influenced. Under Treatments S conditions, with the exception of SN0 treatment, the effects tended to increase during the later growth stage, and the percentage of RLD (>\u20090.8 to 1.0\u00a0cm\u00b7cm\u22123) increased significantly. These indicated that deeply buried straw mulch combined with N application in arid areas was more beneficial to deep roots. Generally speaking, the overall effects of SN2 treatment was the most significant.It was determined that the crop root systems were the key to improving the nutrient absorption rates, which was a key factor for high crop yields8. The effects of the same N levels in Treatments S were found to be better than those of Treatments B. Both types of straw mulching had good effects when combined with medium N application (N2), with SN2 treatment found to be the most effective. The PFPN, AEN, and REN of SN2 had increased by 34.1%, 52.8%, and 66.8% on average (P\u2009<\u20090.05) compared with CK treatment. The change trend of SN2 during the maturity stage was consistent with the change trend of the deep soil RLD. Although high N application amount could guarantee the nutrients needed for the growth of plant roots, they could not fully absorb, which reduced the N utilization rates, and resulted in pollution of the agricultural ecological environment. Therefore, it was ascertained that developed deep root systems was one of the key factors for improvements in the N utilization efficiency of crops in arid areas.The results showed that the N uptake abilities of summer maize plants under Treatments S were significantly higher than those under Treatments B. Also, the plant N uptakes were found to be increased within an appropriate range of N application amounts. The N uptake of SN2 treatment was the largest, with an average increase of 20.4% observed when compared with CK treatment. There were consistencies observed between the change trends of the deep RLD and the plants\u2019 N uptake, with the deep RLD found to be increased by the improved N uptake abilities. Treatments B had significantly increased the RLD of the surface soil layers, while the effects of the increased plant N uptake were limited. These findings were similar to the conclusions previously reached by Kang et al.30. Meanwhile, excessive supplies will lead to decreases in N utilization rates, which will in turn cause significant reductions in crop yields, and pollution risks in the ecological environments31. Under Treatments B, the crop yields were significantly increased with increases in the N application amounts, while the yield increases were found to gradually decrease over time32. The summer maize yields of treatments with high N application (BN3) had only increased 0.4% on average when compared with CK treatment. This was due to the fact that the \u201clow temperature effects\u201d22 caused by the Treatments B had affected the development of summer maize during the seedling stage. The \u201clow temperature effects\u201d delayed the growth of the underground crop parts, and also inhibited the N absorption and dry matter transference after the flowering stage5. However, due to the special \u201ccooling effects\u201d of the straw-covered surfaces, it was found to be beneficial to improve the root activities during the middle and later growth stages, in order to delay the plants aging processes. Therefore, the crop yields could be stabilized under high N application (BN3), but the increasing yield effects were not significant. Generally speaking, the results of Treatments B showed that the effects on summer maize yields were significantly positively correlated with the N application amounts , which was consistent with the conclusions of Jiao et al.33. However, the conclusions were significantly different from the results of Treatments S in this study. The summer maize yields and yield components examined under Treatments S were observed to first increase and then decrease with the increases in N application amounts. The SN2 treatment showed the largest effects, with an average yield increase of 9.3% compared with CK treatment. The yields were found to be consistent with the variation trends of RLD in the deep soil layers, which were significantly positively correlated . However, there were no significant relationships observed between the yields and the total RLD. It could be seen that developed deep root systems were the key to high yields in arid crops.N fertilizer applications are one of the important measures used to increase crop yields. The formations of crop yields require certain amounts of nitrogen fertilizer, and insufficient supplies of N fertilizer will lead to crop losses34 by improving the deep soil RLD. The spatial dislocations of nutrients and water could be relieved in a certain extent, and the coupling of water and nutrients in space could be effectively realized; 3. The promotion of root development should be achieved with appropriate fertilizer applications to regulate the water and fertilizer in the root systems, which would increase summer maize root systems absorbing nitrogen and water in the deep soil layers. In this way, both N utilization efficiency and yields would be improved. This study suggests that it will be beneficial to achieve the aforementioned goals by the deeply buried straw mulch combined with medium N application (SN2).It was recommended that the following goals be achieved for summer maize in Hetao Irrigated District: 1. The redundant roots of the surface soil must be properly eliminated to reduce the consumption of soil moisture during the early growth stages to the greatest extent; 2. The role of plant root systems in carrying water will be enhancedIn this study, the dynamic responses of summer maize yields, root length\u00a0distributions, and N utilization rates to the interactions between straw mulching and N application were preliminarily revealed. The most effective treatment was the deeply buried straw mulch combined with medium N fertilizer application (SN2), which increased deep root length densities by 67.5%, enhanced N use efficiency by 66.8%, and increased in production by 9.3% when compared with CK treatment. In addition, the summer maize root system distributions were improved. Therefore, the results obtained in this study provided certain theoretical information for the effective utilization of straw and rational N application practices in the future in Hetao Irrigation District.However, under straw mulching model, there were still many aspects worthy of attention. For example, the effects on grain yields of the depths and locations of N applications when combined with straw mulching and irrigation processes require investigation to improve summer maize quality and ecological environments. In addition, the coupling effects of water-fertilizer should be analyzed and coupling models of water-fertilizer established, which should include the important soil nutrient factors following straw mulching processes."}
+{"text": "Bio-based coatings and release systems for pro-angiogenic growth factors are of interest to overcome insufficient vascularization and bio-integration of implants. This study compares different biopolymer-based coatings on polyethylene terephthalate (PET) membranes in terms of coating homogeneity and stability, coating thickness in the swollen state, endothelial cell adhesion, vascular endothelial growth factor (VEGF) release and pro-angiogenic properties. Coatings consisted of carbodiimide cross-linked gelatin type A (GelA), type B (GelB) or albumin (Alb), and heparin (Hep), or they consisted of radically cross-linked gelatin methacryloyl-acetyl (GM5A5) and heparin methacrylate (HepM5). We prepared films with thicknesses of 8\u201310\u2009\u00b5m and found that all coatings were homogeneous after washing. All gelatin-based coatings enhanced the adhesion of primary human endothelial cells compared to the uncoated membrane. The VEGF release was tunable with the loading concentration and dependent on the isoelectric points and hydrophilicities of the biopolymers used for coating: GelA-Hep showed the highest releases, while releases were indistinguishable for GelB-Hep and Alb-Hep, and lowest for GM5A5-HepM5. Interestingly, not only the amount of VEGF released from the coatings determined whether angiogenesis was induced, but a combination of VEGF release, metabolic activity and adhesion of endothelial cells. VEGF releasing GelA-Hep and GelB-Hep coatings induced angiogenesis in a chorioallantoic membrane assay, so that these coatings should be considered for further in vivo testing. Presently, formation of fibrotic encapsulation around implants and tissue engineered grafts remains a fundamental limitation in clinical translation , 2. BiocLong-term function of implants has been proposed to be improved by hydrogel coatings releasing drugs locally controlled, e.g., to prevent infection by releasing antibacterial proteins , or to rGelatin is produced by partial hydrolysis of collagen, mainly type I, via an acidic hydrolysis leading to gelatin type A (GelA) with an isoelectric point (IEP) at approximately pH 9.0, or via an alkaline hydrolysis leading to GelB with an IEP at approximately pH 5.0 . AlbuminIn a recent study we showed that the IEP governed the release of VEGF from carbodiimide cross-linked GelA-heparin, and albumin-heparin as well . In anotWith regard to improve the functionality of implant surrounding tissue, or even implanted artificial tissue which was cultured in vitro by stimulation of capillary ingrowth, it seems so far unclear from literature which material system would be most qualified. In the current study, we developed VEGF releasing coatings based on carbodiimide cross-linked GelA-heparin, GelB-heparin, albumin-heparin, and radically cross-linked methacryl-modified gelatin-heparin (GM5A5-HepM5) on polyethylene terephthalate (PET) substrates. PET substrates are for example of interest as cell carriers for ophthalmic applications \u201330. We aN-Morpholino)ethansulfons\u00e4ure (MES), N-Hydroxysuccinimide (NHS), propidium iodide (PI), acetic anhydride (AcAnh), methacrylic anhydride (MAAnh), sodium hydroxide (NaOH), ammonium peroxodisulfate (APS), N,N,N\u2032,N\u2032-Tetramethylethylenediamine (TEMED), 2,2\u2032-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), sulphuric acid, magnesium chloride (MgCl2), sodium acetate (AcNa), acetic acid (AcH), bovine serum albumin (BSA), sodium dodecyl sulfate (SDS) and Dulbecco\u2019s phosphate buffered saline without (PBS\u2212) or with MgCl2 and CaCl2 (PBS+) were purchased from Sigma Aldrich (Germany). Dispase, fetal calf serum (FCS), Gibco\u00ae versene solution and trypsin were purchased from Thermo Fisher Scientific (Germany). Tween\u00ae-20 and sodium 3-trimethylsilyl-propionate-2,2,3,3-d4 (TMSP) were purchased from Merck (Germany). Other reagents were purchased from the following sources (given in parentheses): Alcian blue 8GX , glutaraldehyde solution , Casyton , Cell Titer 96 Aqueous Solution Cell Proliferation Assay -5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS)), Endothelial Cell Growth Medium MV SupplementPack , deuterium Oxide , penicillin/streptomycin , heparin sodium salt , gelatin type A , gelatin type B , rhVEGF165 , human VEGF Standard ELISA development kit , PET membranes , fertilized chicken eggs . Buffers required for the VEGF-ELISA were prepared with a 0.01\u2009M PBS with pH 7.2, without magnesium and calcium ions (PBS\u2212). Dialysis was conducted using dialysis membranes  from Medicell International Ltd (UK).Human recombinant albumin (HSA), 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC), fluoresceindiacetat (FDA), 2-(+) for 10\u2009min at 37\u2009\u00b0C under gentle shaking for pre-activation of surface carboxyl groups.Each PET membrane was incubated in 2\u2009mL NaOH (1% w/v) at 37\u2009\u00b0C for 30\u2009min under gentle shaking and afterwards washed in deionized water to obtain a clean surface. Then, the membranes were incubated in 2\u2009mL EDC/NHS solution each  for GelA and GelB, and in MES buffer (pH\u2009=\u20094.5) for albumin: 12.5% (w/w) gelatin/albumin, 10% (w/w) heparin, 2\u2009M EDC. Heparin was pre-activated using 25\u2009\u03bcL heparin stock solution, 18.75\u2009\u03bcL EDC stock solution, and 6.25\u2009\u03bcL PBS+ (for GelA and GelB)/MES  for 10\u2009min at room temperature (RT). Then 200\u2009\u00b5L of gelatin/albumin stock solution were added. Coatings on the PET membrane were prepared by doctor blading on a glass plate, directly after adding the gelatin/albumin to the heparin solution: In case of gelatin doctor blade and plate were pre-heated. 200\u2009\u00b5L of the hydrogel precursor solution were pipetted on each pre-activated, dried PET membrane and distributed using the 25\u2009\u00b5m side of the doctor blade. The films were left for cross-linking overnight at 4\u2009\u00b0C or for 2\u2009h (gelatin)/4\u2009h  at 37\u2009\u00b0C in a humidified atmosphere, then washed in PBS+ at 37\u2009\u00b0C for 24\u2009h under gentle shaking and subsequently dried under vacuum for 1\u2009h at 60\u2009\u00b0C. Prior to use, membranes were re-swollen in release medium (70\u2009\u00b5g BSA/mL in PBS+\u2009+\u20091% penicillin/streptomycin) at 37\u2009\u00b0C under gentle shaking overnight unless specified otherwise for further experiments.All stock solutions were prepared in PBSn\u2009=\u20093) and 0.638\u2009\u00b1\u20090.023\u2009mmol/g ; the total degree of modification (methacryl\u2009+\u2009acetyl amount) for GM5A5 was determined to be 0.807\u2009\u00b1\u20090.162\u2009mmol/g (n\u2009=\u20093).Gelatin functionalized with methacrylic (GM5) or methacrylic and acetic residues (GM5A5) was prepared and characterized according to a previously described procedure from gelatin type A . The degn\u2009=\u20093).Heparin methacrylate (HepM5) was prepared and characterized according to a previously described procedure . The deg2O was prepared and the pH was adjusted to 5.2 with 0.1\u2009M sulfuric acid. Each PET membrane was incubated in 2\u2009mL NaOH (1% w/v) at 37\u2009\u00b0C for 30\u2009min under gentle shaking and afterwards washed in deionized water to obtain a clean surface. Then, the membranes were incubated in the glutaraldehyde-GM5 solution (2\u2009mL per membrane) for 2\u2009h at room temperature. Before subsequent film deposition, the activated membranes were washed with distilled water.Changed according to a procedure published in , a solut+ (pH\u2009=\u20097.3) for GM5A5 (20% w/w), HepM5 (10% w/w), APS (2\u2009M), TEMED (0.5\u2009M). Stock solutions were mixed in a hydrogel precursor solution to the final concentrations of 10% GM5A5, 1% HepM5, 0.075\u2009M APS and 0.0188\u2009M TEMED. The pre-coated membranes were placed in aluminium moulds (27\u2009mm diameter) with a 50\u2009\u00b5m deep recess, the hydrogel precursor solution was pipetted into the mould and the mould was covered with a quartz glass pane simultaneously. Hydrogel coatings were left for radical cross-linking 2\u2009h at 37\u2009\u00b0C. Subsequently the glass pane was removed and the coated membranes were then washed in PBS+ at 37\u2009\u00b0C for 24\u2009h under gentle shaking and subsequently dried under vacuum for 1\u2009h at 60\u2009\u00b0C. Prior to use for further experiments membranes were re-swollen in release medium at 37\u2009\u00b0C under gentle shaking overnight unless specified otherwise.Stock solutions were prepared in PBSUnless specified otherwise, coated membranes were used before re-swelling as described in 2.2 and 2.3, uncoated membranes were treated with NaOH as described in 2.2 and 2.3, respectively, and used after drying under vacuum for 1\u2009h at 60\u2009\u00b0C.Membranes were characterized using scanning electron microscopy (SEM), X-ray photoelectron spectroscopy (XPS), infrared spectroscopy (IR) and contact angle measurements. SEM pictures of dry membranes were collected on a Zeiss Leo 1530 VP  to analyze the surface morphology. IR spectra were collected on a Vertex 70 spectrometer  (spectra see supporting information). Water-air contact angles of membranes re-swollen in ultrapure water were measured using the captive bubble method with an OCA40 . XPS spectra were measured on an AXIS Supra surface analysis instrument .2; GM5A5-coatings: 1% alcian blue in 3% acetic acid (pH\u2009\u2248\u20092.5)) for 24\u2009h or 1\u2009h (GM5A5-HepM5-coatings) at RT under gentle shaking in the dark. Membranes were then washed with deionized water, photographed and cut into quarters using a scalpel. From each quarter a thin stripe was cut and placed with the cut edge facing upwards on a double-sided tape in a petri dish. A drop of water was put on the strip for 1\u2009min to ensure full re-swelling. Light microscopy of the layer and thickness determination was done at \u00d7500 magnification.Film thickness and long-term stability of hydrogel coatings were determined after re-swelling (24\u2009h), and after 7 d, 14 d and 28 d of incubation in release medium at 37\u2009\u00b0C under cell culture conditions. Membranes were stained by alcian blue staining  with addition of 0.3\u2009M MgCl+\u2009+\u200970\u2009\u00b5g BSA/mL\u2009+\u20091% penicillin/streptomycin) and incubated for 1\u2009h at 37\u2009\u00b0C under gentle shaking. After the loading time the VEGF solution was replaced by 2\u2009mL release medium. The release medium was changed at predetermined time points  and was stored at \u221219\u2009\u00b0C until analysis for typically maximum 4 weeks. Quantification of VEGF content in the samples was performed using an ELISA-kit following the manufacturer\u2019s instructions. The absorption was measured using a fluorescence microwell plate reader, Tecan Synergy2 Multi-Mode Microplate Reader, from BioTek (Germany) for the last step of the ELISA protocol.For the determination of the release properties for VEGF, coated and re-swollen membranes were prepared according to 2.2 and 2.3. They were loaded with VEGF by using 2\u2009mL VEGF solution per membrane  with 36,075 cells/mL medium (=7500 cells per cm\u00b2) were pipetted onto the membranes and cell adhesion was allowed for 24\u2009h under standard cell culture conditions . Then rings were removed and the membranes were washed with PBS+ to remove non-adherent cells. Adherent cells were stained through live-dead-staining  for 3\u2009min in an incubator and washed with PBS+. Fluorescence microscopy was done at \u00d72, \u00d74, and \u00d710 magnification. Disturbing background signals were reduced by black balance and haziness was corrected with haze reduction. Numbers of livings cells were counted from \u00d72 magnification and overlay-pictures were prepared in the \u00d74 and \u00d710 magnification.Endothelial cells were isolated from human skin biopsies received from the Robert-Bosch-Krankenhaus, Klinik Charlottenhaus, Stuttgart (Germany) with given consent of each donor and cultivated as previously described in . Hydroge2), and incubated for another 120\u2009h. The embryos were controlled every day and dead embryos were removed from the incubator.Fertilized chicken eggs were pre-incubated for 72\u2009h at 37.5\u2009\u00b0C with 61% humidity and turned every 2\u2009h. The ex-ovo method was used and incubation devices were prepared as described before in . Under sOn embryonic day 9 (counted from the beginning of the pre-incubation) test materials were placed on the CAM of the chicken embryos in order to evaluate if the released VEGF induced a pro-angiogenic response. Re-swollen hydrogel-coated PET-membranes were cut into squares of 5\u2009mm\u2009\u00d7\u20095\u2009mm and loaded with VEGF by incubation in growth factor solution  for 1\u2009h at 37\u2009\u00b0C. Coated membranes incubated in release medium without addition of growth factor served as control. Six samples were applied on each embryo and were placed on the CAM distant from main blood vessels. Photographs were taken every 24\u2009h to control the development of the embryos and the capillary system of the CAM.On embryonic day 12 the embryos were transferred in a petri dish and the samples with the surrounding capillary system were observed with a digital microscope. Afterwards the embryos were sacrificed by decapitation.t test. P values less than 0.05 were considered statistically significant. All data are presented as mean\u2009\u00b1\u2009standard deviation. Unless stated otherwise, the value of n is defined as the number of independently performed experimental iterations.Statistical analysis was performed using Student\u2019s The uncoated membranes were characterized via XPS, SEM and contact angle measurements to examine surface chemistry and structure. SEM measurements showed a homogeneous distribution of pores with a size of approx. 1\u2009\u00b5m as expected from the manufacturer\u2019s specifications Fig. . AccordiFour different types of hydrogel coatings were investigated in this study with regard to their suitability as cell-adhesive, pro-angiogenic coatings for PET. Hydrogel coatings consisted of 10% protein  and 1% heparin, and were cross-linked via carbodiimide chemistry, referred to as GelA-Hep, GelB-Hep and Alb-Hep. Alternatively, the hydrogel coatings consisted of 10% gelatin methacryloyl-acetyl and 1% heparin methacrylate which were cross-linked radically, referred to as GM5A5-HepM5. The carbodiimide cross-linked coatings were applied to the PET membrane via doctor blading and immobilized by pre-activation of the membranes\u2019 carboxyl groups with carbodiimide. The radically cross-linked coating was applied to the PET membrane in an aluminum mould and covered with glass during cross-linking. Cross-linking of GM5A5-HepM5 films was not successful if atmospheric oxygen interfered with the radical reaction (data not shown); therefore, simple doctor blading was not possible. Immobilization of GM5A5-HepM5 was achieved by pre-treatment of the membrane with glutaraldehyde and pre-coating with GM5.The protein layers formed smooth coatings at the membrane surface as can be recognized from exemplary SEM pictures Fig. . RepreseIR-ATR spectra of the coated membranes showed bands from the biopolymer coatings but not from the underlying PET membranes , while Alb-Hep and GM5A5- HepM5 coatings did not change the contact angle significantly (p\u2009>\u20090.2).The water contact angles of the GelA-Hep and GelB-Hep coated PET Table  were smaThe homogeneity, thickness and stability of swollen hydrogel coatings were characterized applying alcian blue staining and light microscopy-based measurement of the film thicknesses Figs.  and 3. TAll hydrogel coatings showed a homogeneous blue staining after re-swelling of the coated and washed membranes . However, the film thickness of GelA-Hep and GelB-Hep coatings increased during the 28 days of incubation. GelA-Hep was 9.5\u2009\u00b1\u20090.8\u2009\u00b5m thick after re-swelling and significantly thicker with 13.1\u2009\u00b1\u20090.6\u2009\u00b5m (+39%) after 28 days incubation in buffer solution (p\u2009<\u20090.01). GelB-Hep showed the highest increase in thickness with 9.5\u2009\u00b1\u20090.6\u2009\u00b5m after re-swelling and 16.5\u2009\u00b1\u20091.2\u2009\u00b5m (+73%) after 28 days of incubation (p\u2009<\u20090.01). Alb-Hep showed a slight decrease in thickness; coatings were 7.6\u2009\u00b1\u20092.5\u2009\u00b5m after re-swelling and 6.2\u2009\u00b1\u20090.6\u2009\u00b5m (\u221212%) after incubation for 28 days (p\u2009>\u20090.2). GM5A5-HepM5 showed a slight increase in thickness with 8.5\u2009\u00b1\u20090.5\u2009\u00b5m after re-swelling and 9.5\u2009\u00b1\u20090.8\u2009\u00b5m (+12%) after incubation for 28 days (p\u2009>\u20090.05).The thicknesses of the different biopolymer coatings Fig.  did not p\u2009<\u20090.05) and similar viabilities in Alb-Hep (p\u2009>\u20090.1) or GM5A5-HepM5 (p\u2009>\u20090.1) extracts compared with the negative control . The numbers in Fig. p\u2009>\u20090.1) and significantly lower compared to TCPS (p\u2009<\u20090.001). All gelatin-based coatings enhanced the endothelial cell adhesion compared to the uncoated PET membrane (p\u2009<\u20090.001) and showed significantly higher cell numbers compared to TCPS (p\u2009<\u20090.05). Cell adhesion between GelA-Hep and GelB-Hep was not significantly different (p\u2009>\u20090.1), while GM5A5-HepM5 showed lower cell numbers than GelA-Hep and GelB-Hep (p\u2009<\u20090.05). In relative numbers approximately 89% of the applied cells adhered to GelB-Hep, 69% to GelA-Hep, 42% to GM5A5-HepM5, 32% to TCPS, 10% to PET and 7% to Alb-Hep.Endothelial cell adhesion to the coatings was investigated using live-dead staining after 24\u2009h. The adherent, viable cells of at least three different donors were counted, and cell numbers were compared between the coated membranes, uncoated PET membranes, PS and TCPS. Representative images of the live-dead staining for the different materials can be found in the supporting information. Endothelial cell adhesion was on all surfaces higher than on PS (+\u2009+\u200970\u2009\u00b5g/mL BSA)  were loaded with vascular endothelial growth factor (VEGF) by incubation in growth factor solution  in order to investigate the influence of the polymer nature and loading concentration onto the release of VEGF. Release experiments were conducted over 28 days at 37\u2009\u00b0C under cell culture conditions in release medium  as well. Concerning the percentage release of the coatings, these values were calculated based on the amount of VEGF applied for loading. Here, gelatin type A coated membranes released a similar percentage of VEGF at both loading concentrations overall, while the released percentages for the three other coatings had a trend to be lower at the lower loading concentration  of all coatings match with the expectations. The strongly pronounced signal at approx. 3288\u2009cmThe resulting reduced contact angles for the coatings with unmodified gelatin are in accordance with literature , 8. TherLooking at the wet film thickness, we assign the increase in film thickness of Gel-Hep gels to enhanced swelling capacity of the coatings due to hydrolytic break of biopolymer chains without substantial mass loss, while the downward trend in thickness of Alb-Hep gels might indicate actual loss of biopolymer because of more advanced degradation within the polymer layer. This interpretation is supported by earlier results obtained for bulk hydrogels of comparable composition : There, Comparing the data obtained in this study for increased endothelial cell adhesion on gelatin and albumin coatings to literature studies published so far for coating of polymeric substrates with these materials in general, inconsistent data can be found: gelatin-based coatings were described not to change , 9 or enThe release of VEGF from the coatings was similar to previous studies from our group investigating macroscopic hydrogel samples: releases were dependent on the loading concentration  and possStill, despite the different release profiles, GelA-Hep and GelB-Hep loaded with VEGF induced significant vessel formation in the CAM assay, while Alb-Hep coatings did not induce angiogenesis, although releasing comparable VEGF amounts as GelB-Hep. Therefore, finally the sustained release of VEGF did only lead to a pro-angiogenic response in combination with the observed advantageous properties of GelA-Hep and GelB-Hep for HDMVEC adhesion and elevated HDMVEC metabolic activity. GM5A5-HepM5 coatings showed favorable cell adhesion properties, but due to low VEGF release and possibly, also due to lower metabolic cell activity no pro-angiogenic response was induced in this case. This issue has so far to our knowledge not been described in literature, where usually VEGF-release is seen as the decisive factor for a pro-angiogenic response. Still, the data in this study suggest that also other factors have to be considered carefully i.e. endothelial cell adhesion and metabolic activity.ex ovo, but Alb-Hep coatings did not.We successfully prepared biopolymer coatings on PET membranes and studied their performance in terms of VEGF release, and support of endothelial cell functions. The results indicate that besides release properties for VEGF also additional aspects such as endothelial cell adhesion and metabolic activity of adhesive cells in vitro have to be taken into account to predict whether materials and coatings induce angiogenesis: The VEGF release from carbodiimid-cross-linked, negatively charged GelB-Hep coatings and Alb-Hep coatings was nearly identical, however, gelatin-heparin coatings showed favourable high HDMVEC adhesion, while albumin-heparin coatings did not change cell adhesion significantly compared to the uncoated PET membranes. Interestingly, the VEGF loaded Gel-Hep coatings (GelA-Hep and GelB-Hep) induced angiogenesis in the chorioallantois membrane assay In general, VEGF release from the investigated thin biopolymer-hydrogel coatings was dependent on the IEP, composition, and loading concentration in the same way as described for bulk hydrogels with similar composition. The release from the radical cross-linked methacryl-modified gelatin GM5A5 with hydrophobic (poly) methacryl domains was significantly lower than the carbodiimid-cross-linked counterparts. All coatings prepared on porous PET foil in this study showed good coating homogeneities and stability over 4 weeks under cell culture conditions.Taking all material properties into account, thin hydrogel coatings based on carbodiimide-cross-linked gelatins type A or type B with heparin are most promising for the preparation of pro-angiogenic coatings and should be further considered for in vivo studies.Supplementary Figure S1Supporting Information"}
+{"text": "Adequate B-vitamins concentrations in human milk are considered to be a prerequisite for healthy development of infants in early life. This study aims to determine the concentrations of B-vitamins in human milk from Chinese women and the relationships between their concentrations and different geographical origin, lactation stages, socioeconomic characteristics, and dietary intake.n\u2009=\u2009150), Suzhou (n\u2009=\u2009146), and Guangzhou (n\u2009=\u2009147) cities. Thiamine, riboflavin, vitamin B3 (nicotinamide and nicotinic acid), and vitamin B6  in human milk were analyzed by high performance liquid chromatography-tandem mass spectrometry. Pantothenic acid, biotin, and folates in human milk were analyzed by microbiological assay. The information from one 24-h dietary recall and socioeconomic characteristics were collected by interview and structured questionnaire, respectively.Human milk was obtained from 443 healthy lactating women from Beijing ; riboflavin 20.8, 20.2, 11.9, 13.6, 15.6 (\u03bcg/100\u00a0g); vitamin B3 194.0, 300.0, 261.0, 212.5, 218.0 (\u03bcg/100\u00a0g); pantothenic acid 236.5, 291.0, 254.0, 179.0, 189.0 (\u03bcg/100\u00a0g); vitamin B6 6.34, 7.58, 8.60, 9.34, 10.20 (\u03bcg/100\u00a0g); biotin 0.462, 0.834, 0.606, 0.523, 0.464 (\u03bcg/100\u00a0g); folates 0.730, 2.390, 2.440, 2.420, 2.330 (\u03bcg/100\u00a0g). The levels of B-vitamins presented regional differences and varied significantly among different lactation stages. The inversely associations of thiamine, vitamin B6, and folates with maternal BMI were found in multivariate analyses (p\u2009<\u20090.05), as well as higher pantothenic acid, folates, and biotin concentrations in lactating women with supplement intake when compared with those without (p\u2009<\u20090.05). Riboflavin concentrations associated with regular exercise was found in multivariate analyses (p\u2009<\u20090.05).B-vitamins concentrations in human milk varied greatly among individuals. The median concentrations of B-vitamins of The present study indicated regional and socioeconomic factors, lactation stage, and supplement intake may influence B-vitamins concentrations of human milk in healthy Chinese mothers. Further studies on accurate and complete analysis of all vitamin forms are crucial for giving a more comprehensive understanding of vitamin status in human milk.NCT01971671. Registered 13 October 2013.ClinicalTrials.gov, The online version of this article (doi:10.1186/s40795-017-0139-1) contains supplementary material, which is available to authorized users. According to the global strategy for Infant and Young Child Feeding from World Health Organization, exclusive breastfeeding is recommended during the first 6\u00a0months of life to ensure an optimal growth, development, and health of the infant , 2. Ther6, biotin, and folates are essential nutrients for maternal health during pregnancy and lactation and particularly important for the growth of infant , riboflavin-, nicotinic acid-d4, nicotinamide-d4, pyridoxine-d2, pyridoxal-[2H3] and pyridoxamine-[2H3] at a concentration of 200\u00a0\u03bcg/L) were added. Sample analysis was performed on a HPLC-MS/MS system. Liquid chromatography (LC) was performed using an Agilent 1100  LC system. Chromatographic separation was carried out with a Waters Acquity HSS T3 column . Column temperature was set to 30\u00a0\u00b0C and the autosampler remained stable at 15\u00a0\u00b0C. Ammonium formate aqueous solution  and acetonitrile (solvent B) served as mobile phase at a flow rate of 0.6\u00a0mL/min. The gradient process was: 0\u00a0min, 75% A; 1\u00a0min, 75% A; 1.1\u201310\u00a0min, 50% A; 10.1\u201315\u00a0min, 50% A; 15.1\u201316.5\u00a0min, 75% A; 16.6\u20130\u00a0min, 75% A. An API 4000 triple quadrupole mass spectrometer  was used for detection of the chromatographic separation. Nestle Internal reference material (bovine milk-based infant formula) was used for method validation and quality control (QC) sample as well, reference values were established by Nestle Proficiency Test participated by Nestle laboratories and third party laboratories. Coefficient of variation of repeatability is ranged from 3.7 to 13% and Coefficient of variation of intermediate reproducibility is ranged from 5.4 to 12%. The internal reference samples were regularly included and analyzed in duplicate during analytical runs. The limit of detection (LOD) for thiamine, riboflavin, vitamin B3 and vitamin B6 were 0.65, 1, 1, and 0.65 (\u03bcg/100\u00a0g), respectively. Recovery rates of vitamin B1, vitamin B2, vitamin B3, and vitamin B6 were ranged from 92 to 107%. Cross-talking in scheduled multiple reaction monitoring (MRM) was not observed between internal standards and analytes. The result of Vitamin B3 is the sum of nicotinamide and nicotinic acid, and it is expressed as nicotinic acid (niacin). As the mol masses are nearly identical both masses are only summed up. The result for Vitamin B6 is reported as pyridoxine. Thus pyridoxal hydrochloride (correction factor 0.831) and pyridoxamine dihydrochloride (correction factor 0.702) are converted to pyridoxine.One gram of sample was weighted in 15\u00a0mL centrifuge tube and hydrolyzed with 0.5\u00a0mL of hydrochloric acid (1\u00a0M) in autoclave for 30\u00a0min at 120\u00a0\u00b0C. Samples were cooled down and pH was then adjusted to 4.5\u2009\u00b1\u20090.5 by addition of HCl or NaOH. 0.01\u00a0g of taka-diastase was added to the samples, placed in water bath at 45\u00a0\u00b0C for 3\u00a0h. Sample volume was then adjusted to 10\u00a0mL with water and filtrated through 0.45\u00a0\u03bcm filter. 1\u00a0mL of sample extract was taken and isotopic labeled internal standards . After having applied all kit instructions including microorganism incubation at 37\u00a0\u00b0C in the dark for 20\u201324\u00a0h (pantothenic acid) or 44\u201348\u00a0h (biotin and folates), the turbidity of each vial was measured with a microtiter plate reader at 610\u2013630\u00a0nm , for the calculation of pantothenic acid, biotin, and folates concentration. The LOD values for pantothenic acid, biotin, and folates were 0.074, 0.080, and 0.160 (\u03bcg/100\u00a0g), respectively. The measurements of QC samples described above  at predetermined intervals were regularly performed to obtain QC curve for the demonstration of method\u2019s reliability. Recovery rates of pantothenic acid, biotin, and folates were ranged from 93 to 112%.One gram of sample was weighed and diluted with deionized water (40\u00a0mL). Sample extraction was then performed in a water bath at 95\u00a0\u00b0C for 30\u00a0min. After centrifugation , sample extracts could be further diluted with sterile water provided from the test kit if needed. Sample extracts were then pipetted on the commercially available microtiter plate VitaFastExperienced and trained researchers conducting dietary interviews obtained the information of dietary recall during the previous 24-h from participants by face-to-face interview when milk samples were collected. All of the foods intakes were coded and B-vitamins  were analyzed using a database according to Chinese Food Composition (CFC) tables 2004 & 2009 consist of 1773 food items , 38. Conpostpartum, 12\u201330 d postpartum, 31\u201360 d postpartum, 61\u2013120 d postpartum, and 121\u2013240 d postpartum). Before the progress of analysis about B-vitamins, Shapiro-Wilk test was employed to determine whether B-vitamins in human milk had a normal distribution or not. Because of non-normal distribution in human milk vitamins, naturally logarithmic transformations were applied when doing analysis of variance (ANOVA) according to research cities and lactating stages. Multivariate linear regression analysis was used to describe the relationship between B-vitamins concentrations in breast milk (dependent variables) and socioeconomic characteristics (independent variable) of lactation women. A stepwise forward selection process was used in which the independent variables and confounders  were added to the models according to their significance . Homogeneity and bias was showed in the analyses of the residuals of the final models. The associations between B-vitamins concentrations and diet characteristics such as dietary B-vitamins intakes were evaluated by partial-correlations adjusted for research cities and lactation stages. All statistical analyses were performed by using the SPSS software (Ver. 20.0) , and the level of significance was set at p\u2009<\u20090.05 based on a two-sided calculation.Socioeconomic characteristics of lactating women were described as count (percentage) for categorical variables and median value with interquartile range for continuous variables without normal distribution. Chi-squared tests  and Kruskal-Wallis tests (continuous variables) were used to compare participants\u2019 characteristic according to stages of lactating period. Median (interquartile range) and mean\u2009\u00b1\u2009standard deviation were calculated for each of B-vitamin according to research cities  and stages of lactation  (B1 vitamer), flavin adenine dinucleotide (FAD) and flavin mononucleotide (FMN) (B2 vitamer) and pyridoxal 5\u2019-phosphate (PLP) (B6 vitamer) Therefore, these vitamin concentration are likely to be underestimated.The selected methodologies in this study allowed us the quantification of thiamine as B6 and folates increased progressively with duration of lactation (p for trend\u2009<\u20090.001). In contrast, riboflavin and pantothenic acid concentrations fell over time (p for trend\u2009<\u20090.01). Unlike the other vitamins, the levels of vitamin B3 and biotin remained almost constant as lactation stage increased (p for trend\u2009>\u20090.05).The concentrations of B-vitamins in different stages of lactation are shown in Table\u00a0p\u2009<\u20090.05) except for biotin in human milk. The concentrations of thiamine and riboflavin were significantly higher in human milk from Beijing city than those from Suzhou and Guangzhou cities (p\u2009<\u20090.001). The concentrations of vitamin B3 and vitamin B6 were significantly lower in human milk from Suzhou city than the other two cities (p\u2009<\u20090.05). The level of pantothenic acid was significantly higher in human milk from Suzhou city than those from Guangzhou (p\u2009<\u20090.05). Meanwhile, the folates content in human milk from Suzhou city was significantly higher than that from Beijing city (p\u2009<\u20090.001).The concentrations of B-vitamins in human milk from Chinese mothers living in Beijing, Suzhou, and Guangzhou cities are shown in Table\u00a0p\u2009>\u20090.05). The adjusted associations between B-vitamin concentrations in human milk and the socio-economic characteristics of lactating women are summarized in Table\u00a0p\u2009<\u20090.05). Additionally, compared with lactating women with normal BMI, lower vitamin B6 in those overweight and obesity women and higher folates in those underweight women were found in this study . After adjustment for potentially confounding factors, significantly higher pantothenic acid, biotin, and folates were observed in lactating women with dietary supplement intake when compared with the other women . Meanwhile, the concentrations of riboflavin in human milk from the lactating women with regular exercise were significantly higher than those women without (p\u2009<\u20090.05).No significant correlations were observed between B-vitamins and maternal age, educational level, family income, and delivery mode in single factor analysis .In partial-analyses, after adjustment for investigated cities and lactation stages, no significant correlations were observed between vitamins in human milk and the corresponding vitamins in dietary intakes (3 concentrations were found in this study when compared with other previous studies in China [1 (thiamine), Vitamin B2 (riboflavin), Vitamin B3 (nicotinamide and nicotinic acid), and Vitamin B6  so that the contents of these vitamins analyzed by HPLC-MS/MS methods were much lower than the microbiological assays.When compared with previously reported results of investigations into human milk of Chinese lactating women, the same vitamers were analyzed and our results were generally comparable \u201314. Thouin China , 14, ourin China . Generalin China . HPLC-MS6  concentrations increased with lactation stage increasing, which were consistent with our results. The finding from Ford et al. [6 increased progressively with duration of lactation, our results of only part of the total vitamin contents within these trends. However, riboflavin and pantothenic acid concentrations decreased as the lactation stage increasing in the present study, which are contradictory with the previous studies [postpartum 8\u201314 d) and then decreased with lactation stage increasing, which are consistent with our results. With lactation stage increasing, folic acid concentrations increased, which are similar to the trend of Ford et al. [Ren et al.  reportedd et al.  and Sakud et al.  showed t studies , 40. The studies  showed t1), Beijing had higher proportion of other cereals such as wheat and millet. This may explain the higher concentration of Thiamine in Beijing. Furthermore it is well known Riboflavin is widespread throughout many kinds of foods, especially from animal sources. Higher levels of riboflavin in human milk from Beijing city may be due to higher milk and eggs intake than those from Suzhou and Guangzhou cities. . According to the results from 24\u00a0h dietary recall, highest intakes of folates were found in lactating women from Suzhou compared to others , and it was expected that folic acid were higher in human milk from Suzhou city. Actually, regional differences of water-soluble vitamins in human milk including between rural and urban area [Remarkably, dietary intakes and supplementations may play core roles in the levels of B-vitamins in human milk , 16\u201319. ban area , 14, betban area  had been6, and folates, were found in the present study. High postpartum weight retention is a strong independent risk factor for several chronic diseases such as obesity, cardiovascular disease, and type 2 diabetes [6, biotin, and folates concentrations. Indeed, in this study, the levels of pantothenic acid, biotin, and folates found in human milk from women using vitamin supplement were markedly higher than those without, and these findings agreed with previous studies [According to the previous studies , 44, matdiabetes , thus ladiabetes . Furtherdiabetes , 20, 46  studies \u201320 on th6 intake on the content of the vitamin in milk from 19 healthy subjects, and found significant correlation  between them. Similarly, Johnston et al. [r\u2009=\u20090.65, p\u2009<\u20090.01) between pantothenic acid in the diet of the mother the day preceding milk collection and the pantothenic acid content of the milk. Results of this study could not confirm this due to likely a limitation of the dietary intake assessment method [Mother\u2019s B-vitamins intake has been found to clearly correlate with their concentrations in human milk , 16\u201319. n et al.  found a t method  which onAlthough state-of-the-art and/or reference analytical methodologies were applied, caution should be taken when trying to make conclusions about absolute vitamin content in human milk from Chinese mothers. Since some metabolites could not be estimated, only partial information was given on some vitamins.In conclusion, our results of B-vitamin concentrations in human milk generally agree with previously reported studies conducted in China. Our findings suggest that some regional, lactation stage, socio-economic factors including maternal BMI, regular exercise, and dietary supplement may have effects on B-vitamins in human milk from healthy Chinese mothers. In view of adequate B-vitamins concentrations in human milk as a prerequisite for healthy development in early life, further studies on accurate and complete analysis of all vitamin forms (vitamers/metabolites) are crucial for giving a more comprehensive picture of vitamins concentrations and evolution in human milk.Additional file 1:Table S1. Multivariate linear regression models considering riboflavin and biotin concentrations in human milk after the ln transformation as the dependent variables and the other variables studied as independent variables. After adjustment for potentially confounding factors, significantly higher biotin were observed in lactating women with dietary supplement intake when compared with the other women (p\u2009<\u20090.05). Meanwhile, the concentrations of riboflavin in human milk from the lactating women with regular exercise were significantly higher than those women without (p\u2009<\u20090.05). (DOCX 16\u00a0kb)"}
+{"text": "Manual analysis of human high-resolution colonic manometry data is time consuming, non-standardized and subject to laboratory bias. In this article we present a technique for spectral analysis and statistical inference of quasiperiodic spatiotemporal signals recorded during colonic manometry procedures. Spectral analysis is achieved by computing the continuous wavelet transform and cross-wavelet transform of these signals. Statistical inference is achieved by modeling the resulting time-averaged amplitudes in the frequency and frequency-phase domains as Gaussian processes over a regular grid, under the influence of categorical and numerical predictors specified by the experimental design as a functional mixed-effects model. Parameters of the model are inferred with Hamiltonian Monte Carlo. Using this method, we re-analyzed our previously published colonic manometry data, comparing healthy controls and patients with slow transit constipation. The output from our automated method, supports and adds to our previous manual analysis. To obtain these results took less than two days. In comparison the manual analysis took 5 weeks. The proposed mixed-effects model approach described here can also be used to gain an appreciation of cyclical activity in individual subjects during control periods and in response to any form of intervention. Colonic manometry is a procedure involving the placement of a flexible catheter incorporating pressure sensors into the colon to record contractile activity. It has been used to distinguish normal colonic contractions in healthy adult subjects  from theDespite the improvements in catheter design, analysis of manometric recordings still relies upon either visual identification of propagating motor patterns or a generalized approach using area under the pressure curve (AUC) or motility index (MI) measurement. Visual identification of colonic motor patterns has identified differences in the count, velocity and amplitude of propagating pressure waves between health and patient groups, however, this approach is also subject to some fundamental problems. In some manometry traces the large number of pressure events can make identifying individual motor patterns very difficult. This is highlighted in Composite measures such as AUC or MI avoid visual identification of motor patterns, however, their non-specific nature makes useful interpretation of the data very limited. For example, an increase or decrease in AUC or MI, within or between subjects, tells us little about the altered characteristics of specific motor patterns.Automated approaches that identify and quantify changes in motor patterns, standardize analysis between laboratories and remove potential personal bias, all within a workable time frame would be very beneficial to the international community. There have been attempts to achieve this previously  but thosIn this current article, we developed a computerized approach for the analysis of high-resolution colonic data. The technique is based upon a wavelet transform method, currently used in analyzing time-series in fields such as neuroscience, geophysics, meteorology and oceanography . The wavThe structure of the article is as follows. Section \u201cSpectral Decomposition\u201d describes spectral decomposition with the wavelet and cross-wavelet transforms. Section \u201cStatistical Framework\u201d details the statistical framework that is used to compare the spectra between groups of subjects. We present an application of this technique to colonic manometry data described in Section \u201cData,\u201d with results shown in Section \u201cResults.\u201d The article concludes with a discussion in Section \u201cDiscussion.\u201dx(t) \u2208 \u211d into the time-scale domain w \u2208 \u2102 with equation (2.1):The continuous wavelet transform  is a uset) \u2208 \u2102 is an admissible wavelet function, and the * superscript represents the complex conjugate. An admissible wavelet function is one which has zero mean and its Fourier transform is continuously differentiable  measures the variation of x(t) within a neighborhood at t of size proportional to s.where \u03c8 via fast Fourier transform (FFT) utilizing the convolution theorem with:In practice, we choose s \u2208 S, \u03a8 = \u2131[\u03c8] is frequency-domain wavelet function, X = \u2131[x] is the frequency-domain signal, \u2131 and \u2131\u22121 are the Fourier and inverse Fourier transforms, and \u03c9 represents the frequency-domain locations in radians per second. The wavelet transform is susceptible to harmonic artifacts, and we solve this problem by applying the \u201cMesaClip\u201d algorithm as described in our recent article  to frequencies (Hz) we use \u201cSynchrosqueezing\u201d . Synchro\u03d5 = unwrap) represents the time-differentiable \u201cunwrapped-in-time\u201d phase in radians with the complex argument (or angle) denoted by the parentheses-less function \u2220:\u2102\u2192 returns 1 if x and f are in the same bin, and 0 otherwise.where T = {t1,\u2026,tN} we can view the wavelet spectrum as v:T\u00d7F\u2192\u2102. The time-average of the squared amplitudes produces the global wavelet power spectrum:Switching to discrete-time representation with samples recorded at times The cross-wavelet transform combines two wavelet spectra with the complex-conjugated product:v_a and v_b are the synchrosqueezed wavelet transforms of the two signals labeled a and b. The combined subscript vab denotes the cross-wavelet transform between the two signals.where vab as shown for v in equation (2.4). However, this discards the useful phase information contained in vab. The effect of the complex-conjugated product is that the resulting phase represents the difference in phase between the two signals. For each frequency, computing a squared-amplitude-weighted histogram of the phase-differences yields a 2D histogram in the frequency-phase domain, analogous to the global wavelet power spectrum but stratified by phase-differences.A global wavelet power cross-spectrum could be computed in the same way for Since phase-differences are actually phases, in the rest of this section we will refer to them simply as \u201cphases,\u201d keeping in mind that they represent the phase-difference between two signals, rather than the phase of one or the other.M equally and linearly spaced phase bins with centers H = {\u03c61,\u2026,\u03c6M}, we define the 2D histogram of frequencies and phase-differences by:Given a set of \u03c6(x) returns 1 if x and \u03c6 are in the same bin, and 0 otherwise. T\u03c6(f) is the set of all time samples such that \u2220vab is in the bin containing \u03c6.where binf (Hz) and the separation between the pair of sensors d (cm) can be used to determine the apparent velocity of propagation u (cm/s) with the simple formula:If pairs of sensors are spaced sufficiently close together in the environment being recorded, then the cross-wavelet transform between sensors in such a pair allows us to measure propagating quasiperiodic activity. The sign of the phase-difference determines the direction of propagation. The value of the phase-difference \u03c6 (rad) at the frequency of interest u\u22121 (s/cm), where synchronous events (or phase-locking) between the two signals may have a more robust-for-modeling pace of 0, rather than a velocity at \u00b1\u221e.For quasiperiodic pressure signals in these data, a more appropriate measure of propagation may be \u201cpace\u201d which is the inverse velocity For each unit of statistical data, we obtain from the wavelet analysis a 1D curve x in either the frequency x \u2208 F or frequency-phase x \u2208 F\u00d7H domains. However, performing an independent fit at each location would require a multiple-comparison adjustment, and would fail to account for correlations between locations, effectively weakening the power of the analysis.An independent regression model could be fit for each location Instead, we capture correlations between locations by treating the response curves and surfaces as individual functions rather than simply collections of independent points. We model these functions as samples from Gaussian processes, which allow us to specify a formula for correlation between locations, without needing to specify a formula for the shape of the functions themselves.k, which when given a finite set of locations x \u2208 {x1,\u2026,xN} allows us to build an N\u00d7N covariance matrix \u03a3 with elements \u03a3ij = k. We have only finite data, and so the kernel function is evaluated only at the available data locations when fitting the GP. However, we can inspect the GP at any number of arbitrary locations in the kernel\u2019s domain, hence the infinite nature of the model as a step beyond a multivariate Gaussian. An analogy is fitting a simple regression line. The line is fit only to a finite set of data, but once we have an intercept b and slope a we can define a function y(x) = ax + b, where y-locations can be calculated for any choice of x-locations, not just those for which we have data.A Gaussian process (GP) is a probability distribution with an infinite number of random variables, such that any finite set of variables form a multivariate Gaussian distribution. This is achieved by specifying a covariance kernel function The latent GP function-on-scalar mixed-effect model we use can be written in the form:\ud835\udca2\ud835\udcab represents the Gaussian process distribution, k\u03c3 is a kernel function describing the structured \u03c9-standardized noise covariance, y_i is the response function for observation i \u2208 {1,\u2026,N}. The responses are based on the transformed power where 1 for a Stan model source code example).which facilitates efficient inference by not requiring the structured residuals on the right-hand-side of equation (3.5) to be sampled, nor requiring a matrix inversion per observation. When evaluating the likelihood specified by equation (3.5), for the 1D case a simple Cholesky decomposition is sufficient, but for the 2D case an eigen decomposition is needed to separate the kernel functions from the unstructured noise X \u2208 \u211dN\u00d7P is a design matrix of P population-level predictors (a.k.a. fixed-effects) with Xi \u2208 \u211dP1\u00d7 representing the row vector of predictors pertaining to observation i. \u03b2= is a P\u00d71 vector of iid latent GPs representing the P population-level effects. Z \u2208 \u211dN\u00d7J is a design matrix of J group-level predictors (a.k.a. random-effects). b =  is a J\u00d71 vector of potentially correlated latent GPs representing the group-level effects. Depending on the experimental design, an optional offset term o\u03b7 is included in equation (3.3) which may be either set to the mean of all y as a way of centring the data, inferred to include a measure of variability in the centering, or given a different value per observation if some measure of exposure needs to be incorporated that would not otherwise fit as its own predictor in X or Z.In the mean specified by equation (3.3), X and Z for the mean, the matrices W \u2208 \u211dN\u00d7Q and U \u2208 \u211dN\u00d7R are respectively, the population-level and group-level predictors for the log standard deviation equation (3.4), with corresponding effects \u03b3 and u. An explicit offset term is missing here since such an offset is implicitly handled by the scale of k\u03c3.Analogous to the predictors Each GP function in each vector of population-effects is given an iid prior:However, for the vectors of group-effects functions we include correlations between functions via multivariate or multi-output GPs:b and \u03a3u are covariance matrices dependent on the structure of the Z and U design matrices. These \u03a3 matrices will generally be block-sparse, facilitating efficient computation.where \u03a3kb,u}{\u03c3,\u03b2,\u03b3, and their parameters, also known as hyperparameters of the GPs, will be covered in the next subsection \u201cKernel Functions.\u201dThe kernel functions y_i, and the design matrices X, Z, W, and U are the supplied \u201cinput\u201d data. The vectors of functions \u03b2, b, \u03b3, u, and hyperparameters, are to be estimated and correspond to \u201coutputs\u201d of the inference. The structure of the design matrices depends on the experimental design, and we find it easiest to derive the design matrices  based on formula notation as specified in section 2 of The response functions x=f is a scalar that represents frequencies. To fit over frequencies and phase-differences, x =  is a 2D point that represents frequencies in one dimension and phase-differences in the other.We are interested in modeling power that was calculated using the wavelet transform as described in sections \u201cWavelet Transform\u201d and \u201cCross-Wavelet Transform.\u201d To fit the power over frequencies, k depend on whether the response functions are 1D or 2D. There are many potential kernels to choose from, and they can even be built up from smaller kernels \u2212log(f\u2032)| between any two frequencies f and f\u2032. At a distance of 0 we have equal frequencies f = f\u2032, where the correlation is 1 and covariance is \u03c42. As the distance approaches \u221e the correlation and covariance approach 0.with \u03bb specifying the lengthscale of the correlation based on the distance |log and (3.9) k is a kernel function used in constructing a correlation matrix by setting \u03c4 = 1, since including a free parameter for variance in k would make the model non-identifiable due to the variance parameters already defined in \u03a3b and \u03a3u.For equations (3.6) and (3.7), The kernel in equation (3.11) is separable, such that we can write it as:k and k are different functions, with k defined in equation (3.10) and k defined in equation (3.13). Since we can factorize the 2D kernel equation (3.12), we can create a covariance matrix using the Kronecker product of the individual covariance matrices built from kernels equations (3.10) and (3.13):where with abuse of notation we are identifying kernel functions based on their argument symbols, such that The Kronecker factorization of the kernel matrices also allows for a substantial speed up in the numerical calculation of the Cholesky and eigen decompositions of the covariance matrices  used in b,u (subscript omitted for brevity) is treated independently, unless otherwise specified. We used \u03bb\u223cLognormal with the exception \u03bb\u03c3\u223cLognormal while ensuring \u03bb\u03c3 < \u03bbf,\u03c6}{. For the correlation between \u03bbf and \u03bb\u03c6 we used \u03c1f\u03c6\u223cBeta, and \u03c4\u223c\u0393.Prior distributions for hyperparameters \u03bb and \u03c4 are experiment dependent, and will in general depend on the scale of the data. For the application presented in section \u201cResults,\u201d each \u03c3,\u03b2,\u03b3,A coarse grid was chosen for the functional domain so that posterior sampling could complete within a reasonable time. The grid can be refined relatively quickly after the expensive sampling step. Rather than the na\u00efve linear or cubic interpolation, we can use GP prediction such that the covariance between locations is faithfully preserved in the refinement.N grid coordinates x, a vector of M refined coordinates x\u2217, a vector of N function values y corresponding to x, and the kernel function k, then we can produce a vector of M refined function values y\u2217 at x\u2217 with:Given a vector of x,x) is the N\u00d7N covariance matrix obtained by applying k to the coordinates in x, and \u03a3 is the M\u00d7N matrix given by the covariances obtained by applying k to x\u2217 and x.where \u03a3 recorded from the descending and sigmoid colon of 11 healthy volunteers and 12 patients with slow-transit constipation, during 1 h preprandial and postprandial periods. Using formula notation:X and Z are constructed from formula equation (3.15), and W and U from equation (3.16), according to the construction process described by group predictor is a categorical variable indicating the group each subject belongs to: healthy or slow-transit constipation. The region predictor is a categorical variable indicating from which region of the colon the unit of data was recorded: descending or sigmoid. The meal predictor is a categorical variable indicating whether a recording was obtained during the preprandial or postprandial state, corresponding to a meal effect. The categorical variable subject identifies the subject.the design matrices nchan predictor in equation (3.16) is a real-valued standardized count of the number of sensors (or channels) in the recording, which varies per subject and per region. When computing weighted-averages over time as specified in sections \u201cWavelet Transform\u201d and \u201cCross-Wavelet Transform,\u201d we average not only over time but over both time and channels by effectively flattening the wavelet results into a single channel of length c|T|, where c is the number of channels and |T| is the number of time samples. Fewer channels are expected to result in a greater variation in the global averages, which is why we included it as a confounding factor of the signal variance. We set U = 0 with the formula equation (3.16) since we don\u2019t have repeated measurements, and so a within-subject variation is poorly identified.The y\u2032s in model equations (3.1\u20133.4). For the 1D responses 33 frequency-bins were used, and for the 2D responses 17 frequency-bins and 18 phase-bins were used. After sampling from the posterior, the 1D responses were subdivided by a factor of 4 from 33 to 129 frequency2 bins, and the 2D responses were subdivided by a factor of 6 from 17 to 97 frequency-bins and 18 to 108 phase-bins via GP interpolation equation (3.14).Two types of responses were analyzed, given by the 1D and 2D power from equations (2.4) and (2.6). The power was log-transformed to obtain the For each response type, the Hamiltonian Monte Carlo run consisted of 500 warm-up iterations and 500 sampling iterations over 8  chains resulting in 4000 samples from the posterior distribution. We used an adapt-delta of 0.9. Diagnostics showed no divergent transitions, a top tree depth of 10, and visual inspection of trace plots showed good convergence that was validated by an 2.19.1.1  with 8 pWe apply the aforementioned spectral decompositions and associated statistical analysis to colonic manometry data obtained to compare healthy volunteers and patients with slow-transit constipation. Pre-processing of the data was done to remove baseline drift and synchronous pressure increase removal in the same manner as detailed in The details of the healthy subjects, constipated patients, catheter types, placement, protocols and data collection have been described in a previous publication . These aColonic manometry was performed in 14 patients with scintigraphically confirmed slow transit constipation . Colonic scintigraphy studies indicated that 13 of the 14 patients had >90% retention of isotope at 72 h. The remaining patient had no reading at 72 h but had >50% retention at 96 h. These data were compared to the colonic manometry recordings from 12 healthy adults . Abdominal x-rays, taken at the end of each study, confirmed that the catheter tip was clipped to the ascending or hepatic flexure in 8 patients and to the transverse or splenic flexure in 6. In healthy subjects the catheter tip was located distal to or at the hepatic flexure in 11 and at the splenic flexure in 1. As all subjects had pressures sensors located in the descending and sigmoid colon, we used data from these regions for the analysis and results described in this article.All participants in the study had given written, informed consent and the studies were approved by the Human Ethics Committees of the South Eastern Area Health Service, Sydney and the University of New South Wales , and The Southern Adelaide Health Service / Flinders University Human Research Ethics Committee .\u00ae Boston Scientific, MA, United States).Colonic manometry was recorded with a fiber optic catheter containing 72 sensors spaced at one-centimeter intervals. On the day prior to the manometric recording, the bowel was cleared using sodium picosulphate and polyethylene glycol . All subjects drank clear fluids overnight. Lying in the left lateral position, with conscious sedation using midazolam and fentanyl, the manometry catheter was introduced with a colonoscope and clipped to the mucosa using Endoclips  and a chicken sandwich. Colonic pressures were then recorded for a further 2 h.Recordings were commenced within 60 min of the subject waking after the catheter placement. After a 2-h basal recording period, all subjects were given a 700Cal meal . The meal consisted of 300ml of TwoCalAn example of the analysis applied to a recording from the sigmoid colon in a healthy adult is shown in In this example, the meal induced a large increase in power at 2\u20134 cpm , which pIn this section we constructed power vs. frequency plots of motor events and compare them between healthy adults and patients in the descending and sigmoid colon.The 1D analysis provides an indication of the power of pressure waves of different frequencies over a 1 h period. Preprandial activity is compared to the 1 h postprandial period. Furthermore, the difference between the periods can then be plotted to reveal significant changes caused by the meal, or significant differences between groups prior to or after the meal. During the preprandial recordings for healthy adults  and patiThe effect of the meal  is shown in As with the descending colon, peak frequencies in the sigmoid colon were between 2 and 4 cpm, in both healthy adults and patients, in the pre- and postprandial periods . The posTo determine if the automated removal of the synchronous pressure increases had any impact upon these results we re-ran the analysis without any removal of data. The results remained unchanged See , indicatth to 16cpm).The data used in the 1D analysis can be re-analyzed using a 2D group analysis which illustrates the direction of propagation of pressure waves across the range of frequencies  the cyclic motor pattern made up 69% of all propagating activity. (ii) It propagated in predominately retrograde direction. (iii) A meal was shown to increase the count of all motor patterns however, the major effect of a meal upon colonic motility was a significant (P < 0.001) increase in retrograde cyclic motor pattern. With our novel, automated technique, we have also shown at after a meal the retrograde cyclic activity between 2 and 8 cpm is of significantly greater power than antegrade cyclic activity at the same frequency [see sections \u201cHealthy Adults vs. Patients With Slow Transit Constipation; Descending Colon  in both groups, prior to and after a meal, the dominant frequency of pressure waves in the descending and sigmoid colon is between 2 and 6 cpm and a meal results in a significant increase in the power of pressure waves across a wide range of frequencies (1/16 \u2013 8 cpm); (ii) in healthy adults only, the retrograde cyclic activity between 2 and 8 cpm is of significantly greater power than antegrade cyclic activity at the same frequency; (iii) in the sigmoid colon, the meal induced an increase in the power of antegrade, synchronous, and retrograde propagating activity with frequencies between 2 and 6 cpm, which was of significantly greater power in healthy adults than in patients.Previously we had presented our first step in the computerized development of software for the analysis of colonic pressure waves . That woImportantly, the outcomes of the colonic manometry analysis provided in this article do not contradict our manual analysis of these same data published previously , 2015. TThe cyclic nature of colonic pressure waves shown in this analysis is not a new finding. Indeed, regular human rectal pressure waves at approximately 2\u20133/min were reported in In addition to the 2\u20136 cpm activity, a recent publication by A common feature of many colonic manometry recordings is the high amplitude propagating contraction (HAPC). These events are associated with movement of content , defecatIn addition to HAPCs, articles on colonic manometry provide counts of all other propagating contractions and their extent of propagation. Such data is not available with this automated approach. However, software to both count the number of individual propagating contractions and calculate their propagation length, has been developed and validated by our colleges in New Zealand . This woIt is also important to note that we have based our findings upon these data after we removed synchronous pressure increases that occurred across all recording channels. Recently there have been publications in which these synchronous pressure increases have been included in the analysis . HoweverThe raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving human participants were reviewed and approved by the Human Ethics Committees of the South Eastern Area Health Service, Sydney and the University of New South Wales , and The Southern Adelaide Health Service/Flinders University Human Research Ethics Committee . The patients/participants provided their written informed consent to participate in this study.LW devised the methodology and wrote the software and technical parts of the manuscript. PD wrote the manuscript. MC and PD established the concepts. MC, SB, and SS made critical revision of the manuscript for important intellectual content. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Signaling mediated by cytokines and chemokines is involved in glaucoma-associated neuroinflammation and in the damage of retinal ganglion cells (RGCs). Using multiplexed immunoassay and immunohistochemical techniques in a glaucoma mouse model at different time points after ocular hypertension (OHT), we analyzed (i) the expression of pro-inflammatory cytokines, anti-inflammatory cytokines, BDNF, VEGF, and fractalkine; and (ii) the number of Brn3a+ RGCs. In OHT eyes, there was an upregulation of (i) IFN-\u03b3 at days 3, 5, and 15; (ii) IL-4 at days 1, 3, 5, and 7 and IL-10 at days 3 and 5 ; (iii) IL-6 at days 1, 3, and 5; (iv) fractalkine and VEGF at day 1; and (v) BDNF at days 1, 3, 7, and 15. In contralateral eyes, there were (i) an upregulation of IL-1\u03b2 at days 1 and 3 and a downregulation at day 7, coinciding with the downregulation of IL4 at days 3 and 5 and the upregulation at day 7; (ii) an upregulation of IL-6 at days 1, 5, and 7 and a downregulation at 15 days; (iii) an upregulation of IL-10 at days 3 and 7; and (iv) an upregulation of IL-17 at day 15. In OHT eyes, there was a reduction in the Brn3a+ RGCs number at days 3, 5, 7, and 15. OHT changes cytokine levels in both OHT and contralateral eyes at different time points after OHT induction, confirming the immune system involvement in glaucomatous neurodegeneration. Glaucoma is a multifactorial neurodegenerative disease, characterized by progressive damage of the optic nerve produced by retinal ganglion cells\u2019 (RGCs) death . One of Activated microglial cells, such as macrophages, show two M1 and M2 activation phenotypes. M1 produces an intense inflammatory response and is characterized by the release of inflammatory mediators (nitric oxide and reactive oxygen species) and pro-inflammatory cytokines . Uncontrolled activation of the M1 phenotype can induce chronic inflammation, which leads to neuronal death. However, the M2 phenotype is characterized by the release of neurotrophic factors (brain-derived neurotrophic factor (BDNF), neurotrophins, glial cell-derived neurotrophic factor (GDNF), etc.) and anti-inflammatory cytokines , transforming growth factor beta (TGF-\u03b2)) and can contribute to controlling inflammation and improving neuronal survival ,19.By using a mouse model of unilateral laser-induced ocular hypertension (OHT), we performed a study comparing the different signs of microglial activation  at different time points  after laser application ,9,20,21.p < 0.01; p < 0.01; p < 0.05; p > 0.05; In the eyes where OHT was induced, the IOP showed the highest difference with respect to the na\u00efve and contralateral eyes one to three days after laser induction  and three days (p < 0.01). However, after seven days, contralateral eyes showed a significant decrease (p < 0.01) in comparison with na\u00efve eyes. In the OHT eyes, IL-1\u03b2 expression was significantly lower than in na\u00efve eyes after one day (p < 0.01), five days (p < 0.05), and seven days (p < 0.01). After three days, in contralateral eyes, the IL-1\u03b2 expression was significantly higher (p < 0.01) than in OHT eyes , and five days (p < 0.05) compared with na\u00efve eyes. In the contralateral eyes, this significant increase was detected at days 1, 5, and 7  after laser induction; however, at day 15, a significant decrease (p < 0.05) was observed with respect to na\u00efve eyes. In contralateral eyes, with respect to OHT eyes, the IL-6 expression was significantly lower after one and three days (p < 0.01) and significantly greater after seven days (p < 0.01)  a. The im < 0.01) b (Table  < 0.01) .p < 0.01), 5 (p < 0.05), and 15 (p < 0.01) after laser induction. No difference was observed between contralateral and na\u00efve eyes. The comparison between contralateral and OHT eyes showed that the INF-\u03b3 expression in contralateral eyes was significantly lower after 15 days (p < 0.01)  a. In the < 0.01) b (Table  < 0.01) .p < 0.01) with respect to na\u00efve eyes; however, this expression was significantly greater than in OHT eyes at all time points analyzed . In the OHT eyes, the IL-17 expression was significantly lower than in na\u00efve eyes at all time points analyzed   a. The im < 0.01) b (Table  < 0.01) .With respect to the TNF-\u03b1 expression in this work, a detectable concentration level of this cytokine was not obtained, but the immunohistochemical analysis showed that TNF-\u03b1 expression was localized in the microglial cells a and astp < 0.01) after laser photocoagulation. However, in the contralateral eyes, this significant increase was observed at days 7 and 15 (p < 0.01) after laser induction. The comparison between OHT eyes and contralateral eyes showed that, in contralateral eyes, the IL-4 expression was significantly lower (p < 0.01) at days 1, 3, and 5 and significantly higher at day 15 (p < 0.01) than in OHT eyes.  and five days (p < 0.01), while seven days after OHT induction, the IL-10 expression was significantly lower (p < 0.05) than in na\u00efve eyes. In contralateral eyes, the IL-10 expression was significantly higher after three (p < 0.01) and seven days (p < 0.05) with respect to na\u00efve eyes. Compared to OHT eyes, contralateral eyes showed a significant increase in IL-10 expression after three (p < 0.05) and seven days (p < 0.01), with this expression being significantly less after five days (p < 0.01)  a. Immuno < 0.01) b (Table  < 0.01) .p < 0.01). In contralateral eyes, BDNF expression was significantly lower than in na\u00efve eyes after 1 day (p < 0.01), and 3 and 15 days (p < 0.05). Contralateral eyes showed significantly lower BDNF expression compared to OHT eyes at days 1, 3, and 15   a. Immuno < 0.01) b (Table  < 0.01) .p < 0.01), and in contralateral eyes, it was significantly lower (p < 0.01), both in comparison with na\u00efve eyes. This VEGF expression in OHT eyes and in contralateral eyes was significantly lower at days 7 and 15 (p < 0.01) than in na\u00efve eyes. In addition, in comparison with OHT eyes, contralateral eyes showed a significant decrease in VEGF expression after one day (p < 0.01), with this expression being significantly greater 15 days (p < 0.01) after laser induction  in comparison with na\u00efve eyes. However, this expression of fractalkine in OHT eyes was significantly lower than in na\u00efve eyes at all the other time points analyzed . The contralateral eyes showed a significant decrease in fractalkine expression at days 1, 3, and 5  compared to na\u00efve eyes.In the OHT retinas, we observed a significant increase in fractalkine expression after one day (p < 0.01) and significantly greater after seven days (p < 0.05) than in OHT eyes , and the decrease became more severe at days 5, 7, and 15  compared with control na\u00efve eyes. In the contralateral eyes, a modest decrease was also observed, but it only achieved statistical significance after 3 and 15 days (p < 0.05) with respect to na\u00efve eyes , anti-inflammatory cytokines , neurotrophic factors with neuroprotective and anti-inflammatory properties , and fractalkine (CX3CL), a microglial activation regulator, in a mouse experimental model of unilateral laser-induced OHT.Chronic microglial activation has been shown to be one of the main pathogenic mechanisms involved in the development of neurodegenerative diseases, including glaucoma ,10. ActiOur study showed a significant increase in the expression of inflammation mediator IFN-\u03b3 at days 3, 5, and 15 in the OHT eyes with respect to the na\u00efve ones after the laser OHT induction. In the contralateral eyes, although the values were also elevated  with respect to the na\u00efve eyes, these changes were not statistically significant. In addition, in our immunohistochemical sections, the immunolabeling of IFN-\u03b3 was related to the microglial cells. IFN-\u03b3 is one of the most efficient natural inductors of microglial activation . This moIn the present study, we found a significant decrease in the expression of IL-1\u03b2 in OHT eyes at days 1, 5, and 7 in comparison to na\u00efve eyes. However, in the contralateral eyes, we found a significant increase in IL-1\u03b2 at days 1 and 3 and a significant decrease at day 7, being expressed by both microglia and macroglia, as we could observe in our immunohistochemical study. These results seem to be contradictory to previous results from other models. In hypoxia conditions, amoeboid microglial cells increased the production of TNF-\u03b1 and IL-1\u03b2, suggesting that the binding of the cytokines to their respective receptors could be one of the most important factors related to RCG death . IL-1\u03b2 wContrary to what was observed in OHT eyes, we were able to detect an upregulation of IL-1\u03b2 in the contralateral eye. The downregulation of IL1- \u03b2 at days 1, 3, 5, and 7 in OHT eyes could be explained by the action of IL4 and IL10. These cytokines may inhibit the production of IL-1\u03b2 and TNF-\u03b1 by monocyte-derived macrophages and may be important in controlling the immune response by negatively regulating the production of pro-inflammatory mediators ,37. In oIn our work, we found a significant increase in IL-6 in OHT eyes at days 1, 3, and 5 after OHT induction with respect to na\u00efve eyes, being expressed by microglial cells, as we observed in our immunohistochemical study. There is substantial evidence of a strong relationship between IL-6 secretion and increased IOP. Johnson et al.  found eaIL-17 is an inflammatory response-inducing cytokine, as it can induce other cytokines and inflammatory chemokines . AstrocyMicroglia express the chemokine fractalkine receptor (CX3CR1), and their signaling could regulate microglial behavior in glaucoma. Fractalkine (CX3CL1) is constitutionally expressed by the neurons and endothelial cells of the retina and is upregulated in conditions of inflammation ,56. In oIn the present study, we observed that, one day after OHT induction, there is a significant VEGF upregulation, not found at later time points after OHT laser induction or in the contralateral eyes. It has been demonstrated that VEGF can induce increased vascular permeability and is a chemoattractant of monocytes/macrophages (which have VEGF receptors), allowing them to migrate into the tissues . In the Another factor that could have a protective effect against the neurodegeneration produced by OHT is BDNF. This factor can be produced locally by RGCs, astrocytes , and micAs in previous studies, we found a decrease in Brn3a+ RGCs in the OHT eyes in this mouse model of OHT. These studies were performed one week and later after OHT induction ,43,44. HIn contralateral eyes, we observed a minor decrease in Brn3a+ RGCs that only reached a slight significance at days 3 and 15. The decrease in Brn3a+ RGCs was initiated at day 3 in the temporal retinal region, with its superior and central zones being the only ones affected, and it was also significant at day 7, only in the temporal central retina, and at day 15 in the temporal central and temporal nasal retina. As occurred with OHT, a transient downregulation of Brn3a+ expression may occur in some RGCs. This Brn3a+ downregulation may coincide with increased microglial cell activation in the contralateral eye at days 3 and 5 after laser induction, although to a lesser degree than in the OHT eyes . In addiAlbino male Swiss mice (12\u201216 weeks of age and 40\u201245 g in weight) from the University of Murcia breeding colony were used in this study. Animals were given free access to water and a standardized diet and were kept under a light intensity ranging from 9 to 25 lux and controlled temperature.\u00ae, Laboratorios Carlier SA, Barcelona, Spain) and ketamine . To prevent possible desiccation and corneal infection after surgery, ocular topic tobramycin  was applied on the corneal surface during the anesthesia recovering time. Animals were handled in such a way as to minimize discomfort and pain during the experiments. An intraperitoneal overdose of pentobarbital  was used to kill the animals.All procedures, OHT induction, and IOP measurement were performed under intraperitoneal general anesthesia with a mixture of xylazine  and the Animal Health Service of the Murcia Regional Ministry of Agriculture and Water . All animal procedures were performed using the institutional guidelines, European Union regulations for the use of animals in research, and the Association for Research in Vision and Ophthalmology (ARVO) statement for the use of animals in ophthalmic and vision research.Animals were divided into six groups: one na\u00efve control group, not submitted to any procedure, and five OHT groups, in which animals were sacrificed at different time points after OHT laser induction , and both the treated OHT eye and the untreated contralateral eyes were analyzed. In the present study, two separate sets of animals were employed. For the multiplexed immunoassay, 12 animals per experimental group were used, and five animals per group were used for the immunohistochemistry study.A single session with a diode laser  in the left eyes was used to induce OHT, as previously described ,78. The g for 5 min at 4 \u00b0C. Supernatants were collected and centrifuged again with the same procedure. Final supernatants were transferred to an aliquot and total protein concentration was estimated by Bradford protein assay  and analyzed with Multiskan lector . The total protein concentration obtained was sufficient to perform our immunoassay.The animals were sacrificed with a pentobarbital overdose, and then the retinas were dissected and snap frozen. Given the small amount of retinal tissue obtained from each mouse, three retinas were needed to obtain enough protein concentration to perform the assay. Thus, four samples  were employed in the present study. Retinal tissue was homogenized in a lysis buffer , on ice, at a proportion of 1:3 (weight/volume) and then frozen overnight at \u221270 \u00b0C. The next day, samples were centrifuged at 12,000\u00d7 \u00a9 technology. In summary, retinal tissue samples (25 \u00b5L) and magnetic beads (25 \u00b5L) conjugated to the specific antibody for different cytokines/myokines  were incubated with shaking overnight at 4 \u00b0C. After that, wells were washed three times using a wash buffer and a biotinylated antibody was added for detection. We incubated those for 1 h at room temperature. After incubation, beads were incubated with streptavidin-PE (Phycoerythin), a reporter molecule that completes the reaction on the surface of each microsphere for 30 min, at room temperature. Samples were washed three more times and the detection compound included in each immunoassay kit was added. Samples incubated with conjugated beads were analyzed using the Bio-Plex suspension array system 200 and mean fluorescence intensity was analyzed using Bio-Plex Manager Software 4.1 .Cytokines and myokines were measured in duplicate using two multiplexed magnetic bead immunoassay kits . This method of analysis is based on the Luminex\u00ae O.C.T.\u2122 Compound, Sakura Finetek Spain, Barcelona, Spain), preserving eye anatomical references in order to assure the spatial orientation of the retinas, and kept at \u221230 \u00b0C until use.Animals were deeply anesthetized, as mentioned previously, and transcardially perfused with 0.9% saline solution followed by 4% paraformaldehyde (PFA 4%) in a 0.1 M phosphate buffer. Eyes were removed and post-fixed for 24 h, at 4 \u00b0C, in the same fixative solution. Twenty-four hours later, corneas and lenses were removed and optical cups with the retina were kept in the same solution overnight at 4 \u00b0C. The day after, they were washed three times, 30 min each, in phosphate buffer saline (PBS), pH 7.2, and cryoprotected in 11% sucrose in PBS at 4 \u00b0C, for 24 h; samples were then transferred to PBS containing 33% sucrose and conserved at 4 \u00b0C for 48 h. Finally, the samples were embedded in a tissue-freezing medium  in 16 \u03bcm-thick serial sagittal sections from the nasal to temporal retina . Tissue Immunohistochemical techniques were used to evaluate which cells of the retina expressed the different cytokines and factors analyzed in the multiplex assay. We selected those eyes  and time points where their expression was greatest, showing the most notable changes in our glaucoma model; namely, IL-1\u03b2, IL-6, IL-17, IFN-\u03b3, BDNF, VEGF, CX3CL1, TNF-\u03b1, IL-4, and IL-10. Colocalization of these cytokines with microglial cells, macroglia (astrocytes and M\u00fcller cells), and retinal ganglion cells , identified with Iba-1 (red fluorochrome-conjugated), GFAP, and Brn3a and NF-200 , while incubations were performed in PBS, pH 7.2, containing 0.1% Triton X-100 and 10% R.T.U Animal-Free Blocker and Diluent, , which constituted the immunohistochemistry buffer (IB). After three washes in WB, sections were incubated overnight at 4 \u00b0C with the primary antibodies see , then ri\u00ae mounting medium with DAPI .After incubations, sections were washed three more times with WB, then coverslipped with a Vectashield Vibrance Antifaden = 5 per experimental group), as well as an internal control (omitting the primary antibody), to check the specificity of the immunoreaction and rule out unspecific binding. Three different batches were run for each primary antibody.Immunostaining batches contained slides of the nasal, central, and temporal retina of every animal from the selected experimental group  associated with the Apotome-2 module  and high-resolution camera Axio Cam 503 Mono . The microscope was equipped with a Zeiss 10 filter set for Alexa Fluor 488, a Zeiss 64 filter set for Alexa Fluor 594, and a 49 filter set for Alexa Fluor 405. Images taken were analyzed using ZEN2 software . All lighting conditions and magnifications were kept constant during the capture process. Figures were prepared using Adobe Photoshop CS4 Extended 10.0 .n = 5), contralateral eyes (n = 5), and na\u00efve eyes (n = 5) on high-resolution digital microphotographs, which were captured at the 20x magnification objective. The number of Brn3a+ RGCs was estimated by counting the number of immunoreactive Brn3a+ cells in the RGCs layer (Dogiel cells were not included in the quantification) of two consecutive microphotographs  from each region  of the retina and within these regions in three zones . Equivalent areas of the retina were consistently selected in all slices. Therefore, we counted all the immunoreactive Brn3a+ cells that came into focus in nine spatial areas of the retina: nasal\u2012superior, nasal\u2012central, and nasal\u2012inferior; central\u2012superior, central\u2012central, and central\u2012inferior; and temporal\u2012superior, temporal\u2012central, and temporal\u2012inferior (We quantified the number of Brn3a-positive (Brn3a+) RGCs using a double-blind procedure: counts were performed on coded slides, with unbiased evaluation; one slide per retinal region  and animal was randomly selected, and two tissue sections per slide were analyzed. Quantification of Brn3a+ RGCs was performed in OHT eyes  and reported as the mean . The significant differences among na\u00efve, contralateral, and OHT eyes were determined using a two-way analysis of variance (ANOVA) with Bonferroni test correction. A We can conclude that increased IOP causes changes in the levels of pro-inflammatory and anti-inflammatory cytokines, BDNF, VEGF, and fractalkine, in a mouse experimental model of unilateral laser-induced OHT, both in OHT eyes and in contralateral normotensive eyes, associated with the neurodegenerative process. At the earliest time points , the expression of pro-inflammatory cytokines would be compensated for by the expression of anti-inflammatory cytokines, in an attempt to control the damage to the RGCs. However, more prolonged exposure to pro-inflammatory factors such as IFN-\u03b3 could lead to the death of RGCs from three days after OHT laser induction, as we observed in this study. The main changes in the expression of cytokines and other factors occurring at days 1, 3, and 5 after laser induction may be related to the activation of microglial cells. In previous works, we observed that at these time points , the main signs of microglial activation are seen in the eyes of OHT, which would support the results of this study. Further, in normotensive contralateral eyes (where there is a modest decrease in the number of Brn3a+ RGCs), changes in the levels of cytokines and other molecules occur, although they are slighter than those observed in OHT eyes, which would coincide with the signs of microglial activation observed in contralateral eyes in previous studies. Therefore, with this study, we can confirm the participation of the immune system in glaucomatous neurodegeneration."}
+{"text": "Sex differences in behaviors relevant to nicotine addiction have been observed in rodent models and human subjects. Behavioral, imaging, and epidemiological studies also suggest underlying sex differences in mesolimbic dopamine signaling pathways. In this study we evaluated the proteome in the ventral tegmental area (VTA) and nucleus accumbens (NAc) shell in male and female mice. Experimental groups included two mouse strains (C3H/HeJ and C57BL/6J) at baseline, a sub-chronic, rewarding regimen of nicotine in C3H/HeJ mice, and chronic nicotine administration and withdrawal in C57BL/6J mice. Isobaric labeling with a TMT 10-plex system, sample fractionation, and tandem mass spectrometry were used to quantify changes in protein abundance. In C3H/HeJ mice, similar numbers of proteins were differentially regulated between sexes at baseline compared with within each sex after sub-chronic nicotine administration. In C57BL/6J mice, there were significantly greater numbers of proteins differentially regulated between sexes at baseline compared with within each sex after chronic nicotine administration and withdrawal. Despite differences by sex, strain, and nicotine exposure parameters, glial fibrillary acidic protein (GFAP) and dopamine and cAMP-regulated phosphoprotein of 32 kDa  were repeatedly identified as significantly altered proteins, especially in the VTA. Further, network analyses showed sex- and nicotine-dependent regulation of a number of signaling pathways, including dopaminergic signaling. Sub-chronic nicotine exposure in female mice increased proteins related to dopaminergic signaling in the NAc shell but decreased them in the VTA, whereas the opposite pattern was observed in male mice. In contrast, dopaminergic signaling pathways were similarly upregulated in both male and female VTA after chronic nicotine and withdrawal. Overall, this study identifies significant sex differences in the proteome of the mesolimbic system, at baseline and after nicotine reward or withdrawal, which may help explain differential trajectories and susceptibility to nicotine addiction in males and females. Nicotine or control treatments began at 10\u201312 weeks of age, following at least one week of acclimation to the vivarium. Mice were group-housed with cagemates of the same sex and strain, maintained on a 12-h light-dark cycle (lights on at 7:00 AM), and provided standard chow. All procedures were approved by the Yale University Institutional Animal Care and Use Committee.Sub-chronic nicotine administration was used in the setting of conditioned place preference (CPP) training. Due to the variability in effective CPP conditioning paradigms, we used C3H/HeJ mice and a training schedule which has successfully produced CPP in both male and female mice in our hands  to ensurC57Bl/6J mice were exposed to nicotine chronically in the drinking water as described , and braMice were euthanized by rapid decapitation and brains were quickly removed from the skull and placed on a brain matrix to create 1 mm coronal sections from the frontal cortex through the midbrain. These coronal sections were then carefully placed into a petri dish of cold 1\u00d7 PBS over ice. Bilateral 1 mm punches were taken from NAc shell- and VTA-enriched regions, deposited into separate 1.5 ml Eppendorf tubes, and immediately frozen on dry ice.Four mice from each group (sex \u00d7 treatment) in each experiment (sub-chronic or chronic nicotine administration) were included for proteomic analysis. Samples were excluded if there were any technical difficulties in collecting a sufficient amount of tissue using the brain punch.g at 4\u00b0C  and 1\u00d7 cOmplete protease inhibitor cocktail (Roche)]. The homogenate was incubated at 4\u00b0C on ice for 10 min and then sonicated on ice for 3 \u00d7 10 s with 30 s intervals. A soluble fraction was obtained following centrifugation for 10 min at 14,000 \u00d7 g at 4\u00b0C . A BCA pg at 4\u00b0C . A labelFractionation and TMT data acquisition were performed as previously described . Briefly5.Reversed phase-liquid chromatography-mass spectroscopy (RP-LC-MS/MS/MS) was performed at the Yale/Keck MS & Proteomics Resource with a nanoACQUITY UPLC system  connected to an Orbitrap Fusion Tribrid  as described . SPS-MS3RRID:SCR_014485) version 1.6.1.0 with a false-discovery rate (FDR) < 0.01 at the level of proteins, peptides and modifications using the Andromeda search engine integrated into the MaxQuant environment, and using the Mouse UniProt FASTA database . For Group Specific Parameter changes, \u201ctype\u201d was set as \u201creporter ion MS3\u201d and \u201c10plex TMT.\u201d Oxidized methionine (M) and acetylation (protein N-term) were selected as variable modifications, and carbamidomethyl (C) as a fixed modification with minimum peptide length of seven amino acids. Trypsin was selected as the protease allowing for up to two missed cleavages, and the peptide mass was limited to a maximum of 4,600 Da. Quantification of peptides and proteins was performed by MaxQuant using \u201cunique + razor peptides\u201d including unmodified peptides and modified peptides [oxidation (M) and Protein N-term acetyl]. \u201cMatch between runs\u201d (MBR) was enabled with a matching time window of 0.7 min. In general, values of parameters in MaxQuant have not been changed from their default values unless explicitly stated  version 1.3.1093. Each experiment  consisted of two TMT 10-plex runs with two biological replicates of each experimental group (sex \u00d7 treatment) and two pooled channels of equal ratios  of the eight experimental channels within the TMT run. First, data were normalized within each TMT 10-plex experiment to account for small variations in sampling loading and labeling efficiency. To accomplish this first normalization, a global scaling factor was applied to the total ion reporter intensity of each channel such that each channel was adjusted to the average total intensity across all ten channels. A second normalization step called \u201ctrimmed means of M values\u201d (TMM), originally developed for RNA-seq data  version 1.6.0.7. Values were first log2 transformed to achieve normal distribution. Proteins were filtered to remove \u201conly identified by site,\u201d \u201creverse,\u201d and \u201cpotential contaminants.\u201d In addition, proteins with missing values in any individual sample were filtered out. For the sub-chronic VTA, sub-chronic NAc, and chronic NAc analyses, an additional step of multiple ANOVA tests with FDR < 0.05 was implemented due to the relatively lower numbers of proteins identified in these experiments  compared to the chronic VTA experiment , and the higher variability in protein expression values observed in those three analyses. This step reduced the variability in protein expression values in the sub-chronic VTA, sub-chronic NAc and chronic NAc data, thereby improving data quality as assessed by the clustering of replicates in principle component analyses (PCA). Pairwise comparisons between male control and female control, male nicotine (MN) and male control (MC), and female nicotine (FN) and female control (FC) in each experiment were then conducted to determine differentially regulated proteins by sex and by nicotine treatment. In each pairwise comparison above, the second group served as the reference group . Moderated t-tests were performed with FDR < 0.05 and s0 = 0.5. The s0 parameter incorporates expression values into significance determinations, such that s0 = 0 relies solely on FDR to determine significance and s0 > 0 uses both fold change and FDR cutoffs. Default settings for FDR determination were used (permutation-based FDR with 250 randomizations applied).Normalized ion intensities were statistically analyzed in Perseus software  version 11.02  database  version 3.8.2. The required interaction score and FDR were set at minimums of 0.7 and 1%, respectively. The Molecular Complex Detection (MCODE) plug-in  (RRID:SCR_001881) for GO and KEGG pathway enrichment analysis.Further sub-network analyses were performed by importing protein interaction data into Cytoscape   was usedRaw data and results of analyses are provided in The VTA or NAc shell proteomes were examined after sub-chronic nicotine administration and after withdrawal from chronic nicotine administration as shown by the workflow depicted in Proteins were identified by applying the criteria of <1% FDR for peptides and proteins, and no missing value across the biological replicates in sex \u00d7 treatment groups in each brain region after each nicotine treatment. These criteria identified 1,813 proteins in the VTA  and 1,56The reproducibility and overall quality of the data were confirmed. t-tests were performed with FDR < 0.05 and s0 = 0.5. This analysis is depicted as summary data in Differentially regulated proteins in each group were calculated as described in the section \u201cMaterials and Methods,\u201d such that moderated In contrast, there were more strikingly varied patterns of differential protein expression in C57BL/6J mice. In the VTA, 392 proteins were differentially expressed between MC vs. FC, far exceeding the 74 proteins that were differentially expressed in FN vs. FC mice, and the 7 proteins that were differentially expressed in MN vs. MC mice . An overWe further evaluated the pairwise comparisons to identify similarities in sub-chronic vs chronic nicotine-induced and sex-dependent alterations in protein expression within the NAc shell and the VTA . DiffereFor each sex, the proteins regulated by sub-chronic nicotine and chronic nicotine were compared to find proteins that may be key regulators of nicotine\u2019s effects across reward and withdrawal . In the There was only one protein significantly altered in the NAc shell in FN vs. FC after chronic nicotine administration and withdrawal, and none in MN vs. MC. This protein, Tagln, was altered in opposite directions in sub-chronic and chronic groups.Within sub-chronic and chronic nicotine administration experiments, nicotine-induced protein alterations between sexes were compared to find sex-independent effects of nicotine . BetweenIn the VTA after chronic nicotine administration and withdrawal, 6/7 (85.7%) proteins significantly up-regulated in MN vs. MC were also up-regulated in FN vs. FC , and were the same five pathways as those enriched for proteins upregulated in MC over FC . For theSixty-seven proteins significantly upregulated in MN vs. MC were submitted to the STRING database, and the five most significantly enriched KEGG pathways terms of 46 total in these proteins included amphetamine addiction, calcium signaling, and dopaminergic synapse . The lisFor the 59 proteins with significantly greater expression in the NAc of MC vs. FC C3H/HeJ mice, the five most significantly enriched KEGG pathways included signaling-related terms such as dopaminergic synapse, calcium signaling pathway, and cGMP-PKG signaling pathway . The fulThe five most significantly enriched KEGG pathways among the 71 proteins upregulated in FN vs. FC mice in the NAc shell after sub-chronic nicotine administration included primarily metabolic pathways and one KEGG pathway related to Parkinson\u2019s disease . The fulThere was only one significantly enriched KEGG pathway among the 43 proteins upregulated in MN vs. MC mice in the NAc shell after sub-chronic nicotine: synaptic vesicle cycle. The five most significantly enriched KEGG pathways of 20 total among the 93 proteins decreased in MN vs. MC included terms related to neuropsychiatric functions, such as dopaminergic synapse, alcoholism, and retrograde endocannabinoid signaling, and metabolic terms, including arginine and proline metabolism as one term, and beta-alanine metabolism .For the 207 proteins with greater expression in the VTA of C57BL/6J mice after chronic nicotine administration and withdrawal, the five most significantly enriched KEGG pathways of eight total included ribosome, metabolic pathways, fatty acid metabolism, and pyruvate metabolism, as well as GABAergic synapse . For theAmong the 48 proteins upregulated in FN vs. FC mice, the five most significantly enriched KEGG pathways terms of eight total included ribosome, alcoholism, cocaine addiction, amphetamine addiction, and dopaminergic synapse . For theAfter chronic nicotine administration and withdrawal, there were no significantly enriched KEGG pathways among the 10 proteins significantly increased in the NAc shell of FC over MC mice.p < 0.05) GO and KEGG pathways as determined with further DAVID database analysis. The input for these analyses were all significant differentially regulated proteins, both up- and down-regulated, in each pairwise comparison.Additional analyses were performed using MCODE in Cytoscape in order to identify PPI networks. The top three network clusters in each analysis are shown in In the VTA after sub-chronic nicotine administration, two PPI clusters were identified among proteins differentially regulated in the MC vs. FC comparison . In clusIn the NAc after sub-chronic nicotine, the top three protein clusters for the MC vs. FC comparisons are shown . EnricheIn the VTA in the chronic nicotine administration and withdrawal group, the top three PPI network clusters are shown for the MC vs. FC comparisons . EnricheIn this study, we analyzed whole tissue homogenates from VTA and NAc shell brain punches in male and female mice with and without nicotine administration. We not only examined differential protein expression between sexes under control conditions to analyze baseline sex differences, but we also investigated and compared the effect of nicotine within sex. An advantage of this experimental design is the use of two nicotine administration schedules, two mouse strains, and two sexes for proteomic comparisons. The breadth of these experimental manipulations not only allows for comparisons between nicotine reward and withdrawal, but also between strains, which is a known but underreported source of variability .In comparison to the number of proteins regulated after nicotine exposure in each sex, the number of proteins differentially expressed between sexes under control conditions were similar in C3H/HeJ mice and much greater in C57BL/6J mice. Other proteomic studies examining sex as a variable have also shown equivalent if not greater amounts of differential protein expression based on sex compared to other experimental manipulations . BetweenThe KEGG pathways enriched in MC vs. FC comparisons in the VTA and NAc shell of C3H/HeJ mice, and in the VTA of C57BL/6J mice, were many of the same pathways observed for the effect of nicotine within sex. These KEGG pathways were related to dopaminergic signaling, GABAergic signaling, calcium signaling, and neurological disorders. Pathways not specific to neurons were also enriched, such as certain metabolic pathways and ribosomal terms. Both the STRING analyses of each pairwise comparison and the further step of PPI sub-network analyses in Cytoscape and DAVID databases supported these findings. Importantly, these results suggest that the pathways exhibiting sex differences at baseline are relevant for neuronal function and for sex differences in the effects of nicotine.The experiments that comprise this study also provide complementary and converging evidence for the breadth of sex differences in nicotine\u2019s effects. In the VTA and NAc shell after sub-chronic nicotine administration the total numbers of proteins that were significantly altered by nicotine in pairwise comparisons within sex were similar. However, only \u223c20% of those proteins were identical and altered in the same direction, and the STRING analyses showed divergent patterns between sexes. The KEGG pathways enriched in the VTA proteins upregulated after sub-chronic nicotine in female mice were similar to those KEGG pathways enriched in the proteins that were conversely downregulated after sub-chronic nicotine in male mice. Similarly, the KEGG pathways enriched in proteins downregulated after sub-chronic nicotine in female mice were more similar to the KEGG pathways enriched in proteins upregulated after sub-chronic nicotine in male mice; these KEGG pathways were more closely related to dopaminergic signaling, including dopaminergic synapse, tyrosine metabolism, and amphetamine addiction. In the NAc after sub-chronic nicotine administration, these dopamine signaling-related KEGG pathway terms were enriched in the proteins that were either upregulated or downregulated in FN vs. FC. However, the proteins representing these enriched pathways were more specific to dopaminergic function in the upregulated proteins  than in the downregulated proteins . In males, dopaminergic signaling-related KEGG pathway terms were enriched for the NAc shell proteins that were downregulated after sub-chronic nicotine exposure. The results suggest that a rewarding, sub-chronic schedule of nicotine administration produces sex- and brain region-dependent differences in dopaminergic signaling. Unlike baseline sex differences, for which the results of STRING and Cytoscape network analyses converged, the Cytoscape analyses for the effects of nicotine within sex were less informative of dopaminergic changes than the STRING analyses. Thus, based on the STRING analyses, sub-chronic nicotine administration in female mice increased dopaminergic signaling proteins in the NAc shell but decreased them in the VTA, while producing the opposite pattern in male mice .These results appear consistent with prior literature showing sex differences in the brain region-specific regulation of dopaminergic signaling. For example, striatal dopamine release is differentially affected by nicotine and estrogen in male and female gonadectomized mice, in which estrogen increased nicotine-induced dopamine release in female striatal tissue and decreased it in male striatal tissue . DecreasIn the chronic nicotine administration and withdrawal experiment, there were two notable contrasts to the sub-chronic nicotine administration experiment in the VTA. First, there were 10 times more proteins significantly altered by chronic nicotine treatment and withdrawal in female than in male VTA, whereas similar numbers of proteins were differentially regulated in each sex by sub-chronic nicotine. Second, unlike in the sub-chronic nicotine experiment, similar KEGG pathways related to dopaminergic function and addictions were enriched in the proteins upregulated after nicotine withdrawal in both female and male mice. However, one major KEGG pathway enriched in FN vs. FC but not MN vs. MC was the ribosome, represented by almost a third (15/48) of the significantly upregulated proteins in the female nicotine group. This upregulation could represent an adaptive mechanism. For example, following developmental stress exposure, females appear to exhibit greater adaptability based on the increased expression of proteins related to protein synthesis and energy metabolism . AlternaAn analysis of the proteins commonly altered across nicotine administration groups, sex, and strains revealed key proteins that may represent highly conserved mechanisms in nicotine addiction. Most consistently, GFAP and Ppp1r1b (DARPP-32) were significantly altered by nicotine reward or withdrawal and between sex, especially in the VTA.Glial fibrillary acidic protein is a marker of astrocytes, which contribute to the blood-brain barrier, regulate neurotransmission and prevent neurotransmitter diffusion into extra synaptic spaces by active uptake of glutamate, glycine, and GABA, and are essential to synapse formation. Emerging research suggests that astrocytes, or glia in general, have more active roles in brain function than initially assumed . For exaIn the current study, levels of GFAP were significantly altered in almost all pairwise comparisons. At baseline, GFAP was increased in male C3H/HeJ VTA, increased in female C57BL/6J VTA, and in female C3H/HeJ NAc shell. After sub-chronic nicotine, GFAP was decreased in the VTA of both male and female C3H/HeJ mice, whereas after chronic nicotine exposure and withdrawal it was increased in the VTA of both C57BL/6J sexes. Additionally, GFAP was decreased in NAc shell of female mice after sub-chronic nicotine. The direction of change was not uniform, suggesting that GFAP may be a more prominent player in the VTA than in the NAc shell, and that its regulation depends on sex and duration of nicotine administration.in vivo after nicotine abstinence (Dopamine and cAMP-regulated phosphoprotein of 32 kDa is a phosphoprotein highly expressed in dopaminoceptive regions that can function as an inhibitor of protein phosphatase-1 (PP-1) or of protein kinase A (PKA), depending on its phosphorylation state . Multiplstinence . These sstinence . In the The findings shown here also point to potentially novel mechanisms underlying nicotine addiction. For example, beta-alanine metabolism was downregulated in male NAc shell and upregulated in female NAc shell after sub-chronic nicotine administration. Beta-alanine is an endogenous ligand of glycine receptors and has been implicated in regulating dopamine release in the striatum in response to alcohol, nicotine, and \u03949-tetrahydrocannabinol . AlthougPDE2A and PDE10A, the two proteins comprising the morphine addiction KEGG pathway that was upregulated in male VTA after chronic nicotine and withdrawal, can modulate dopaminergic signaling but have not been linked to nicotine addiction directly . Both prAnother example of a finding in our analyses that could provide novel targets for future investigations is Arpp21, or regulator of calmodulin signaling (RCS), a cAMP-regulated phosphoprotein of 21 kDa . RCS wasAn important consideration in examining changes in individual proteins is the sensitivity and specificity of the proteomic technique used. Isobaric labeling, such as with TMT as used in our study or iTRAQ, is a powerful tool for multiplexed sample analysis. One potential pitfall of isobaric labeling is its vulnerability to ratio compression due to co-fragmentation of precursor ions . AlthougThere have been mixed findings on the possible inverse relationship between the number of channels in a multiplexed experiment and the number of peptides identified . Howeverq-value to determine significance cutoffs, increasing the likelihood of detecting biologically significant changes. One limitation of our statistical analysis may be the multiplicity of pairwise comparisons without corrections for multiple comparisons. However, such a correction may be too restrictive to perform in addition to the Benjamini-Hochberg corrections applied to each individual protein comparison. Further, our pathway analyses using the STRING database accounted only for protein identity and not quantitative protein levels. However, our findings were strengthened by additional PPI network analyses that provided converging evidence of enriched pathways.Another important consideration is the statistical and analytic techniques used to detect significant changes in protein abundance and to probe their functional relevance. In the current study, we used the s0 parameter in Perseus as a weighting factor to take into consideration both fold-change and Following the identification of differentially regulated proteins by nicotine and between sex using an unbiased proteomic method as presented here, more targeted methods may be used to investigate the regulatory  and behavioral significance of these findings. With respect to sex differences, in particular, the relationship between protein changes and behavioral output may be particularly important to investigate given the possibility for divergent mechanisms leading to convergent outcomes . The rolSex differences in the mesolimbic system proteome are significant under baseline conditions as well as in response to nicotine. The scale of baseline sex differences is at least equivalent, or in C57BL/6J mice much greater than, that of sex differences after nicotine exposure. After a rewarding sub-chronic administration of nicotine, dopaminergic signaling pathways were altered in opposite directions in male and female mice, such that they were increased in the NAc and decreased in the VTA of female mice, and decreased in the NAc and increased in the VTA of male mice. These findings support previous literature on sex differences in primary reinforcement vs. regulation of negative affect driving the development of nicotine addiction in males vs. females, respectively. Further, the disproportionate protein regulation identified in female compared to male VTA after chronic nicotine and withdrawal suggests a greater effect of withdrawal in females, which might also explain sex differences in response to stress and rates of relapse to smoking in human tobacco users. Finally, this study compared the proteome across two sexes, two nicotine administration paradigms, and two mouse strains. Despite the breadth of experimental conditions and the hundreds of unique proteins that were differentially regulated, two proteins were repeatedly identified as significantly altered in sex and nicotine group pairwise comparisons, suggesting that GFAP and DARPP-32 are key proteins regulating the response to nicotine in male and female mice, especially in the VTA. Other unique pathways and proteins as identified in the data suggest novel targets for further investigation.https://www.ebi.ac.uk/pride/, PXD023859.The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: The animal study was reviewed and approved by Yale University IACUC.AL, MM, AN, and MP conceived and designed the study. AL performed all mouse work. MM prepared samples for proteomic analysis. RW and TL performed mass spectrometry experiments. MM and AL performed statistical analyses. AL wrote the first draft of the manuscript, with writing contributions from MP, MM, and AN. All authors contributed to the manuscript revision, read, and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Shigella isolates are so prominent for epidemiological studies and infection prevention strategies. We developed and evaluated RAPD and ERIC-PCR coupled with HRM for differentiation of non-dysenteriae Shigella species as potential alternative methods. After isolation of eighteen Shigella strains from faecal specimens collected from children under 2\u00a0years of age with diarrhea (n\u2009=\u2009143), the species of the isolates were identified by slide agglutination assay. Also, species were identified using developed RAPD-PCR-HRM and ERIC-PCR-HRM techniques. Differentiation of the data sets was measured by principal component analysis as a dimension reduction method. Then, sensitivity and specificity of the methods were evaluated.Species identification of Shigella species in clinical specimens. However, sensitivity and specificity of ERIC-PCR-HRM were evaluated 33 and 46% respectively and significantly lower than that of RAPD-PCR-HRM assay. Regardless of inherent poor reproducibility of DNA fingerprinting-based methods, RAPD-PCR-HRM assay can be considered as a potential alternative method to identify non-dysenteriae species of Shigella in clinical specimens. As we observed in the current study, HRM technique is more rapid, inexpensive, and sensitive than gel electrophoresis method to characterize PCR amplicons.We found RAPD-PCR-HRM method with high sensitivity and specificity (100 and 85% respectively) to identify non-dysenteriae  Shigella is a facultative anaerobe, gram-negative bacilli belonging to Enterobacteriaceae family and associated with intestinal and extraintestinal pathogenicity in human (Shigellosis). Four species have been characterized for Shigella including: S. sonnei, S. flexneri, S. boydii, and S. dysenteriae. Shigella species can cause mild to severe diarrhea as intestinal pathogens in adults and children ; however, S. dysenteriae type 1, as an extraintestinal pathogen, may lead to hemorrhagic uremic syndrome [Shigella species [Shigella species plays a crucial role in providing clinical investigation and tracing of outbreaks caused by this pathogen [Shigella spp. is to differentiate species from each other [ species . Epidemipathogen . The mosch other . Some ofch other .Sequence-based genotyping techniques are more expensive, time consuming, and complicated than other type . Random Sh. sonnei, Sh. flexneri and Sh. boydii strains isolated from clinical specimens.High resolution melting curve analysis (HRMA) characterizes the amplified PCR products as an alternative assay of gel electrophoresis with higher precision and differentiation ability . This prShigella species, using DIFCO Shigella species specific antisera kit  according to the manufacturers` instructions [S. sonnei ATCC 25931; S. flexneri ATCC 12022; and S. boydii ATCC 12030, purchased from Pasteur institute of Iran , as the reference strains.Children under 2\u00a0years of age with diarrhea (n\u2009=\u2009143) in Qazvin, Iran, during December 2019 to February 2020 were referred to the central laboratory of Ghods Children Hospital of Qazvin for microbiological examination . All speructions . We usedBacterial isolates and the reference strains were inoculated into Luria\u2010Bertani broth (LB) and incubated at 37\u00a0\u00b0C overnight. After centrifugation at 6000 RPM for 10\u00a0min, bacterial pelletes were subjected to DNA extraction using Sinaclon gram-negative DNA extraction Kit  according to the instructions described by the manufacturer. The quantity and quality of the extracted genome was evaluated using NanoDrop Spectrophotometer . Before performing PCR-HRM, concentration of all DNA templates was adjusted to 50\u00a0ng\u00a0\u00b5L-1.PCR-HRM method has been used for genotyping of different microbial isolates. As DNA fingerprinting methods such as RAPD and ERIC were used for differentiation of microbial species previously, we used these methods coupled with HRM to evaluate a more precise, specific and sensitive assay to identify the Shigella species in this study. We used the single random oligonucleotide primer UBC245 5`-CGC GTG CCA G-3` for RAPD-PCR and species identification of the isolates . Each reWe used a dimension reduction method as a novel strategy for molecular subtyping by clustering and analysis of melting profiles which has previously been described by Reja et al. . PrincipShigella species in specimens collected from 18 out of 143 children under 2\u00a0years old with diarrhea (12.58%) consisting of 11 S. sonnei , 3 S. boydii , and 4 S. flexneri  isolates using culture dependent techniques and serological tests. Then we developed and evaluated RAPD and ERIC-PCR coupled with HRM methods as a sensitive and specific potential alternative method for the species identification of Shigella isolates. Normalized and difference melting curves of the isolates using RAPD-PCR-HRM are shown in Fig.\u00a0Shigella among the isolates. Except one isolate which was S. boydii, species of other isolates were identified correctly using RAPD-PCR-HRM assay , 2 S. boydii , and 4 S. flexneri ).We isolated and identified Shigella isolates. Figure\u00a0Shigella isolates. Difference plots of ERIC-PCR-HRM was analyzed using PCA assay to identify the different plot groups as three species of Shigella isolates. 3D scores plot obtained from PCA of the data set of ERIC-PCR-HRM has been shown in Fig.\u00a0S. sonnei , 1 S. boydii , and 2 S. flexneri ). It has shown that RAPD-PCR-HRM assay is more sensitive and specific than ERIC-PCR-HRM to identify Shigella species when they are analyzed by PCA. Sensitivity and specificity of RAPD-PCR-HRM assay were calculated 100 and 85%, respectively. However, sensitivity and specificity of ERIC-PCR-HRM method were measured 33 and 46% respectively.ERIC-PCR-HRM was evaluated for species identification of Leptospira isolates to the serovar level. They were successful to develop a new method based on RAPD-PCR-HRM assay which was an inexpensive and rapid method to identify different serotypes of Leptospira isolates [Pasteurellaceae species by amplification of different regions of 16\u00a0s rDNA sequences and they found this method sensitive and specific for Pasteurellaceae species identification [Escherichia coli isolates and they found it sensitive, specific, and practical. There are limited studies about species identification and genotyping of bacterial pathogens using DNA fingerprinting methods coupled with HRM; however, several researchers applied these methods for differentiation of eukaryotic cells [DNA-fingerprinting methods recently have been proposed as the method for the purpose of microbial species identification. Tulsiani et al. (2010) used HRMA of RAPD-PCR products for characterization of isolates . Miller fication . Chen etic cells .ERIC-PCR-HRMA has not been developed and used for molecular characterization of microbial genomes yet. We evaluated this method as a novel molecular technique for diagnostic and differentiation purpose . During Enterobacteriaceae family genomes [ERIC sequences are repetitive elements located on some specific genomic regions present throughout the  genomes . In RAPD genomes . As prev genomes . It is wShigella species from clinical samples. We found RAPD-PCR-HRM assay more sensitive and specific than ERIC-PCR-HRM as the potential of alternative method for differentiation of non-dysenteriae Shigella species with sensitivity and specificity of 100 and 85%, respectively. however, future studies with more sample size and novel molecular techniques are suggested to be implemented.At the present study we introduced RAPD-PCR-HRM assay as a potential alternative method to differentiate non-dysenteriae Shigella isolates from clinical samples may not be sufficient to develop a species identification method.18 The most prominent drawback of RAPD and ERIC based methods is inherent poor reproducibility.Also, the inherent limitation of PCR-HRM assay is its inability for simultaneous identification and differentiation of microbial species in a single reaction tube."}
+{"text": "A wide array of microRNAs (miRNAs) is differentially expressed in breast tumors and also functions as tumor suppressors. Herein, the current study sought to unravel the function of miR-4731-5p in breast cancer progression. First, breast cancer-related miRNA and mRNA microarray data sets were retrieved for differential analyses. Subsequently, the expression patterns of miR-4731-5p, PAICS, and FAK in breast cancer tissues and cells were determined, in addition to analyses of their roles in glycometabolism, migration, invasion, epithelial\u2013mesenchymal transition (EMT) analyzed through functional assays. Next, the targeting relation between miR-4731-5p and PAICS was validated. Xenograft tumors in nude mice were further established to reproduce and verify the in vitro findings. miR-4731-5p was poorly expressed and PAICS was highly expressed in breast cancer tissues and cells. PAICS was confirmed as a target of miR-4731-5p. Moreover, miR-4731-5p exerted an inhibitory effect on glycolysis, EMT, migration, and invasion in breast cancer cells via regulation of PAICS-dependent phosphorylation of FAK. In vivo assay further validated the significance of the miR-4731-5p/PAICS/FAK axis in vivo tumorigenesis and lung metastasis in breast cancer. Collectively, our findings indicated that miR-4731-5p inhibited breast cancer cell glycolysis and EMT through the reduction of PAICS-induced phosphorylation of FAK. Despitechanisms . In lieuInherently, miRNAs are defined as short, non-coding RNAs, which possess the ability to repress the translation of target messenger RNA (mRNA)s and induce their degradation . One sucInitial analyses of the GSE57897 microarray data set indicated a reduction in miR-4731-5p expression in breast cancer samples Fig. , howeverFurther quantitative analysis of the top 10 genes  with the highest interaction scores validated that the difference in PAICS expression was the most pronounced  inhibitor or miR-4731-5p inhibitor into normal breast cell line MCF10A, and decreased miR-4731-5p expression levels were documented in response to miR-4731-5p inhibition  were identified using the R language \u201climma\u201d package, with normal samples as controls. The different p values were corrected with the false discovery rate method. The false-positive rate was decreased by adjusted p values using the Benjamini and Hochberg false discovery rate method by default. Additionally, the target genes of miR-4731-5p were obtained from the starBase and TargetScan databases. Furthermore, the differentially expressed genes in the TCGA and GTEx databases were downloaded using the GEPIA server. Thereafter, an interaction analysis was performed on the candidate target genes with the interaction scores obtained with the help of the GeneMANIA database.First, breast cancer-related miRNA microarray data set GSE57897  and mRNA microarray data set GSE3744  were retrieved from the Gene Expression Omnibus (GEO) database. Differentially expressed genes  years. None of the included patients had received antitumor therapy prior to specimen collection and were confirmed as breast cancer by means of postoperative pathological biopsy.2 in air . Cells at the logarithmic phase were trypsinized and inoculated in a six-well plate, at a density of 1\u2009\u00d7\u2009105 cells per well. Following a 24-h period of regular culture, the cells were transfected upon reaching 75% confluence. The concentration of NC, miRNA mimic, or miRNA inhibitor was set as 50\u2009nM . Transfection was carried out using the Lipofectamine 3000  reagent.Breast cancer cell lines  were all purchased from ATCC . The obtained cells were cultured in RPMI-1640  containing 10% fetal bovine serum , 100\u2009\u03bcg/mL streptomycin, and 100\u2009U/mL penicillin, and placed in a humidified incubator at 37\u00b0C with 5% CO\u2212\u0394\u0394Ct quantification method, with \u03b2-actin and U6 serving as internal references. The absolute copy number of each miRNA was determined with a standard curve. To this end, miRNA oligonucleotides  were utilized to produce standard curves at various concentrations (1\u2009\u00d7\u2009101\u20138 molecules/reaction). The sequence of mature miRNA was CCUAAUUUGAACACCUUCGGUA.Total RNA content was extracted from the aforementioned cells using the TRIzol reagent . The primers used in the current study were synthesized by Sangon  , GLUT1 , PAICS , FAK , p-FAK , Snail , Slug , N-cadherin , Zeb1 , E-cadherin , Vimentin , and glyceraldehyde-3-phosphate dehydrogenase , and the secondary antibody horseradish peroxidase-labeled goat anti-rabbit immunoglobulin . The protein quantitative analysis was performed with the gray value of each protein and the gray ratio of the internal reference GAPDH using the ImageJ software. All the aforementioned antibodies were purchased from Abcam .g at 25\u00b0C for 10\u2009min, with the supernatant collected for later use. A spectrophotometer/plate reader was subsequently warmed up for >30\u2009min, with the wavelength adjusted to 505\u2009nm for detection purposes.The degree of glycolysis in breast cancer cells under different conditions was detected by means of a glycolysis assay . Meanwhile, the degree of glucose consumption in breast cancer cells was measured using the micro method . Briefly, the collected cells were centrifuged with the supernatant removed. According to the ratio of 500:1\u20131000:1 of the number of cells : volume of distilled water (mL), the cells were broken by ultra-sonification  and then water-bathed at 95\u00b0C for 10\u2009min (cover tightly to prevent water loss). After being allowed to cool down, the cells were centrifuged at 8000\u2009\u00d7\u2009Additionally, the micro method was applied another time for detection of the degree of lactic acid production , and the steps were the same as those for glucose detection. The spectrophotometer/plate reader was warmed up for more than 30\u2009min, with the wavelength adjusted to 570\u2009nm for detection purposes.After detachment, cells were seeded in a 24-well plate, and upon reaching 90% cell confluence, scratches were made using a sterile pipette tip. After a phosphate-buffered saline (PBS) rinse, the corresponding treatment was performed. Followed a 48-h treatment period, images were obtained. The ImageJ software was adopted to calculate the scratch area.5/ml). The lower chamber was added with 10% FBS, and 100\u2009\u03bcL of cell suspension was added to the Transwell chamber  coated with Matrigel . Following a 24-h incubation period at 37\u00b0C, the cells that did not invade the cell surface were gently removed with cotton swabs. The remaining cells were then fixed with 100% methanol and stained with 20% crystal violet (Sigma). The stained invaded cells were counted manually under five randomly selected areas using an inverted optical microscope , and each experiment was repeated three times to obtain the mean value. The procedure of the migration experiment was the same without Matrigel.Breast cancer cells were cultured in a serum-free medium for 12\u2009h, harvested, and resuspended in a serum-free medium . Subsequently, the 3\u2032-UTR luciferase vector (150\u2009ng) and miR-4731-5p mimic (50 nmol/L) or NC were co-transfected into breast cancer cells using the Lipo 3000 reagent . The luciferase activity was detected using luciferase detection kits (Promega) and a Glomax20/20 luminometer (Promega).Following cell-processing, the medium was removed at the corresponding time points, and the cells were rinsed with PBS thrice, fixed with 4% paraformaldehyde for 15\u2009min, and then stored at 4\u00b0C for short-term storage. Subsequently, the cells were rinsed thrice with a PBS solution containing 0.1% Tween-20, PBS solution containing 0.25% Triton X-100 (PBST) at room temperature for 10\u2009min, and PBST solution containing 1% BSA\u2009+\u200922.52\u2009mg/ml Glycine\u2009+\u20090.1% Tween-20 for 30\u2009min at room temperature. Next, the cells were incubated with the following corresponding primary antibodies: rabbit anti-E-cadherin  and rabbit anti-Vimentin  at 4\u00b0C overnight. The following day, the cells were rinsed thrice with PBST solution and incubated with the corresponding fluorescent secondary antibody at room temperature for 1\u2009h. Afterward, the cells were stained with 1\u2009\u00b5g/mL DAPI at room temperature for 5\u2009min, rinsed thrice with PBST solution, followed by observation and photography with a fluorescence microscope.Paraffin-embedded sections were fixed with formalin and sectioned (thickness of 4\u2009\u03bcm), dewaxed in xylene, and rehydrated. Endogenous peroxidase activity was quenched with the addition of 3% hydrogen peroxide dissolved in methanol for 10\u2009min, and the sections were subjected to antigen repair for 15\u2009min. Next, the sections were blocked for 20\u2009min with normal rabbit serum and incubated with anti-p-FAK (Abcam) and anti-PAICS (Abcam) overnight at 4\u00b0C. The following day, the sections were incubated with the secondary antibody for 30\u2009min, and stained with streptavidin peroxidase detection system, counterstained with hematoxylin with diaminobenzidine as a chromogenic agent. PBS was adopted as the NC.A total of 60 healthy female nude mice  were raised in an SPF animal laboratory in single cages under controlled conditions . All mice had ad libitum access to food and water and were raised under 12\u2009h light and dark cycles. The experiment was performed after 1 week of acclimation and the health of the nude mice was observed prior to the experiment.6 cells/50\u2009\u03bcL, 1\u2009\u00d7\u2009107 cells/mL), which was prepared using MDA-MB-231 cells at the logarithmic phase of growth, into the skin under the left armpit to induce xenograft tumors. Mice were euthanized by cervical dislocation 6 weeks later, followed by tumor growth observation. Tumor weight was detected using a balance.MDA-MB-231 cells were transduced with 50\u2009nM of agomir NC, oe-NC, oe-PAICS, or miR-4731-5p agomir alone or in combination to establish stably transduced cells. agomir NC, and miR-4731-5p agomir were all purchased from Sangon. Subsequently, 10 nude mice were selected from each group and injected with MDA-MB-231 cell suspension (2\u2009\u00d7\u2009105 cells/50\u2009\u00b5L) cells were injected into nude mice (n\u2009=\u200910/group) via a tail vein injection to establish breast cancer lung, metastasis models. Mice were euthanized by cervical dislocation 5 weeks later, and the metastatic tumor nodules were collected.MDA-MB-231 . Measurement data were presented as mean\u2009\u00b1\u2009standard deviation. Comparisons between two groups were performed through independent full and uncropped western blotssupplementary files"}
+{"text": "Streptococcus mutans has been recognized as a major cariogenic bacterial species. The present study is aimed at investigating how cold-light bleaching would change enamel roughness and adhesion of Streptococcus mutans. Human premolars were divided into 72 enamel slices and allocated into 3 groups: (1) control, (2) cold-light bleaching with 35% hydrogen peroxide (Beyond\u2122), and (3) 35% hydrogen peroxide (Beyond\u2122) alone. Biofilms of Streptococcus mutans were cultivated on enamel slices in 5% CO2 (v/v) at 37\u00b0C for 1 day or 3 days. Enamel surfaces and biofilms were observed using scanning electron microscope (SEM). Atomic force microscopy (AFM) was applied to quantify the roughness of enamel surface, and the amounts of biofilms were measured by optical density of scattered biofilm and confocal laser scanning microscopy (CLSM). Cold-light bleaching significantly increased (p < 0.05) surface roughness of enamel compared to controls, but significantly inhibited (p < 0.05) adhesion of Streptococcus mutans on enamel in the bacterial cultures of both 1 day and 3 days. In conclusion, cold-light bleaching could roughen enamel surface but inhibit Streptococcus mutans adhesion at the preliminary stage after the bleaching treatment.Tooth bleaching is becoming increasingly popular among patients with tooth staining, but the safety of bleaching agents on tooth structure has been questioned. Primarily thriving on the biofilm formation on enamel surface,  In the case of cold-light bleaching, light can activate peroxide to promote the chemical redox reactions in the bleaching process [Tooth bleaching has enjoyed great popularity among patients suffering from intrinsic and extrinsic tooth staining. It can efficiently improve the shade of dental fluorosis, tetracycline pigmentation teeth, and pulpless tooth . Hydroge\u2212 and OH . CP, whi\u2212 and OH , 5. Appl\u2212 and OH . The eff process .in vivo and in vitro studies have focused on the changes of morphology and microecology in oral cavity after bleaching treatment. Detrimental alterations in enamel have been reported, including the increase of surface roughness and the decrease of microhardness [To investigate the negative effect of bleaching treatment and improve bleaching products, numerous hardness \u20139. Howevhardness , 11. EitStreptococcus mutans (S. mutans) are one of the primary pathogens in the development of dental caries. Producing acids and bacteriocin, they are highly tolerant to acid and possess high-affinity systems for the assimilation of various carbohydrate sources. Thus, this study is aimed at investigating the effect of cold-light bleaching on enamel surface and adhesion of S. mutans on enamel. The null hypotheses are as follows: (1) cold-light bleaching has no effect on enamel surface and (2) it has no effect on bacteria adhesion.As a group of highly adherent bacteria, Twenty-four maxillary premolars extracted for orthodontic purpose, with no caries lesions, enamel hypoplasia, cracks, or other defects on axle enamel surfaces, were collected. Volunteers all signed informed consent, and the study gained approbation of West China Hospital of Stomatology Institutional Review Board (WCHSIRB-ST-2015-128). The collected teeth were rinsed under high-pressure water for 10\u2009min to remove the materia alba . Then, tPreviously described protocol was applied with minor modifications . Every t\u2122) alone.To control interfering factors from individual variations among every tooth, we randomly allocated three specimens from one tooth into the three groups: (1) control, (2) cold-light bleaching, and (3) 35% hydrogen peroxide  was applied on the enamel surface in the treatment group, and the thickness of gel was approximately 2\u2009mm. The bleaching process lasted for 8\u2009min with the cold-light lamp  vertically 1\u2009cm above enamel slices . The bleaching procedure was repeated twice, and the gel was removed during the intervals. The control group was mock-treated by 0.9% saline (w/v) along with cold-light bleaching for the same time as the bleached group. After bleached, all enamel specimens were washed in running deionized water again for 1\u2009min and then sterilized [The cold-light bleaching was processed according to the manufacturer's instructions. 35% HP gel  were maintained in Brain Heart Infusion (BHI) broth. Bacteria were incubated in BHI with 1% (w/v) sucrose (BHIS) for biofilm formation. The biofilms were incubated in the condition of 5% CO2 (v/v) at 37\u00b0C without agitation.\u03bcl prepared planktonic bacteria mixed with 900\u2009\u03bcl fresh BHI with 1% (w/v) sucrose (BHIS) was added to each well of 48-well tissue culture plate, in which the specimens were placed with the enamel surface uppermost. The plate was placed in 5% CO2 (v/v) at 37\u00b0C, and specimens were transferred into new wells containing fresh BHIS every 24\u2009h. Biofilms on enamel specimens were collected after cultured for 1 day (n = 3 for each group) or 3 days (n = 3 for each group). Samples were rinsed by sterilized water to eliminate planktonic bacteria, and biofilm on them was removed by cell scrapers and then suspended in 100\u2009\u03bcl saline  in tubes. Biofilms were sonicated for 10\u2009min to separate cells by an ultrasonifier . The turbidity was obtained by optical density (OD) at 595\u2009nm using a microplate reader  to quantify the amounts of biofilms on enamel.A protocol of biofilm formation described previously was conducted with some modifications . All enan = 3 for each group). For the scanning of biofilm, the specimens adhered by S. mutans were fixed with 2.5% glutaraldehyde at 4\u00b0C overnight, dehydrated in series concentration of ethanol ranging from 30% to 100%, and sputter-coated with gold [The sterile specimens were coated by gold and sent to perform SEM (ith gold . Specimen = 3 for each group). For surface roughness, the images of morphology and values of roughness average  were observed by SPM-9600 AFM system  in the tapping mode with a silicon nitride tip of NSG11  under ambient circumstances. Each specimen was scanned at three randomly selected sites covering an area of 10 \u00d7 10\u2009\u03bcm at 1\u2009Hz scanning rate. Adhesion forces of the enamel surface were measured in the contact mode with a tipless cantilever. Seventy force-distance curves were attained at seven random regions for each slice at a scanning rate of 0.5\u2009Hz, ramp size of 18\u2009\u03bcm, and trigger force of 5\u2009nN. A built-in software within the STM9700 system was applied to calculate adhesion forces from the curves.The AFM test was performed according to previous descriptions , 16 with\u03bcl prepared planktonic bacteria (OD = 0.2 at 600\u2009nm), 900\u2009\u03bcl BHIS, and Alexa Fluor 647  to label formed exopolysaccharide (EPS) as previously described [2 (v/v) at 37\u00b0C in the dark for 1 day (n = 3 for each group) or 3 days (n = 3 for each group), during which specimens with biofilm were transferred into new wells with fresh BHIS and Alexa Fluor 647 every 24\u2009h. After incubation, the specimens were rinsed by 0.9% saline (w/v) to remove the planktonic cells and then dried with a sterile filter paper. SYTO 9 nucleic acid stain  was applied to label S. mutans for 15\u2009min. Specimens were washed and dried again. The whole process was completed in the dark, and the stained specimens were glued on glass slides for laser scanning confocal microscopy  which was equipped with a 60x oil immersion objective lens. 485 and 650\u2009nm were used, respectively, as the absorption maxima wavelength for the nucleic acid stain and the EPS dye, and 498\u2009nm was used as the emission maxima wavelength. At least three randomly selected positions of each specimen were captured. Images were taken from the bottom of the biofilm, section by section to the top layer of the biofilm instructed by previous study [Enamel specimens were placed in 48-well plates with 100\u2009escribed . The plaus study . 3D imagt-test was used to compare the difference between groups for turbidity of scattered biofilm solution, while adhesion forces were analyzed by nonparametric analysis .Each experiment was repeated at least three times independently. All data were analyzed by SPSS 16.0. We set the level of significance to be 0.05. The Shapiro-Wilk test was used to test the distribution of data first. The independent p < 0.05) in the CLB and HP groups than in the control group  group and 35% hydrogen peroxide (HP) group, enamel surface morphology became rougher with more pittings in images of SEM  and 3D i Figures .S. mutans adhesion on enamel surfaces via turbidity test. The solution of scattered biofilm cultured for 3 days had significantly higher (p < 0.05) OD values comparing to that incubated for 1 day (p < 0.05) than those from the control group, which implicated the possible bacteria inhibitory effect of bleaching procedure (p > 0.05).Next, we tested or 1 day . The OD rocedure . There wS. mutans on enamel after incubation for 1 day and 3 days. From SEM images of biofilms incubated for 1 day, thinner S. mutans biofilms were formed on CLB and HP specimens  and EPS (red) in biofilms cultured for 3 days (S. mutans on CLB and HP enamels.Compared to biofilms incubated for 1 day, there was an apparent increase in the thickness of r 3 days . From 3Dr 3 days , biofilmper se [Up to now, there is no agreement on whether bleaching treatment exerts adverse effects on enamel structure and adhesion of caries-associated microorganisms. One of the proposed mechanisms of tooth bleaching is the agents' effect on changing the reflection of light of the enamel. The increase in surface roughness after tooth whitening may lead to increased reflectance spectra and therefore to improved digital color reading , 19, 20.per se . We obseS. mutans on both CLB and HP enamels in our study is also consistent with some previous in vitro and in vivo studies. Yuan et al. [S. mutans' adhesion to bleached enamel comparing to unbleached one during the first two weeks after cold-light bleaching. A similar change of bacteria adhesion after cold-light bleaching was also reported in an in vivo study [In addition, the inhibited biofilm formation of n et al.  found thn et al.  reportedvo study . Besidesvo study .S. mutans' adhesion to bleached enamel decreased. This might be the effect of the residual agents' effect in enamel [The roughness of enamel surface increased after being bleached, while n enamel . The figS. mutans' adhesion between bleached and unbleached enamels after incubated for 24\u2009h. Besides, Hosoya et al. [S. mutans adhering to bleached enamel in the biofilms incubated for 3 days. Indeed, the seemingly contradiction of those studies with ours can probably be explained by the antiseptic effect of bleaching agents itself and its roughening influence on enamel surface. The time it takes to eliminate the residual agents to the minimal inhibitory concentration depends on the types of agents, whitening process, and enamel rinsing procedure after bleaching. Different experimental designs could also have varied impacts on the morphology of enamel, and there is still no agreement on the correlation between the morphology of enamel and adhesion of bacteria.However, Ittatirut et al.  reporteda et al.  reportedS. mutans till 3 days. In order to investigate the change of biofilm adhesion after bleaching treatment, future researches are needed to investigate the formation of biofilms in a relatively longer period. Also, it is necessary to explore the adverse effects of different sorts of bleaching treatments on enamel and bacteria adhesion to improve products and procedures.Within the limitation of this in vitro study, we concluded that cold-light bleaching could significantly increase enamel surface roughness but inhibit the formation of biofilms of"}
+{"text": "In the last decade, machine learning has attained outstanding results in the estimation of bio-geo-physical variables from the acquired images at local and global scales in a time-resolved manner. Gaussian processes (GPs)\u00a0[Earth observation (EO) by airborne and satellite remote sensing and es (GPs)\u00a0, as flexes (GPs)\u00a0. GPs proradiative transfer models (RTMs), which implement the equations of energy transfer. These codes are needed for modelling, understanding and predicting some variables of interest related to the state of the land cover, water bodies and atmosphere. An RTM f operating in forward mode generates a multidimensional radiance observationparameter state vectorinverse problem implies learning the function g using x* each time a new satellite observation y* is acquired. GPs have been used to learn both the often costly forward model f as well as the inverse model g. Learning the forward model allows for faster simulations, while learning an inverse model has allowed the provision of physically meaningful, spatially explicit and temporally resolved maps of variables of interest.In remote sensing, we often deal with mentclass2pt{minimdata-driven physics-aware models that respect signal characteristics, be consistent with elementary laws of physics, and move from pure regression to observational causal inference.Despite great advances in forward and inverse modelling, GP models still have to face important challenges, such as the high computational cost involved or the derivation of faithful confidence intervals. More importantly, we posit that GP models should evolve towards The most important shortcoming of GPs is their high computational cost and the memory requirements, which grows cubically and quadratically with the number of training points, respectively. Recently, great progress has been made in constructing scalable versions of GPs, demonstrating their utility in big data regimes\u00a0.warped GP model has allowed learning a non-parametric optimal transformation from data, and has shown very good results in predicting vegetation parameters  from hyperspectral images\u00a0[An important challenge in Earth observation relates to the fact that data come with complex non-linearities, levels and sources of noise, and non-stationarities. Standard GPs often assume homoscedastic noise and use stationary kernels though. The current state-of-the-art GP to deal with heteroscedastic noise makes use of a marginalized variational approximation\u00a0. The metl images\u00a0. Anotherl images\u00a0.extrapolation analysis as an ambitious far-end goal. Besides, note that we ultimately aim to characterize model error by comparing simulators to reality, calibrate models by proper estimation of (hyper)parameters, and make uncertainty statements about the world that combine models, data, and their corresponding errors. We think that the Bayesian formalism of GPs is the natural framework to tackle these yet unresolved problems.Making inferences with GPs is not only about obtaining point-wise estimates but also faithful uncertainty estimates, essential in performing error propagation. Inference should also contemplate emulation, based on GPs is gaining popularity in remote sensing. Emulators are essentially statistical models that learn to mimic the RTM code using a representative dataset f first. Recent more efficient alternatives construct an approximation to f starting with a set of support points selected iteratively\u00a0[Surrogate modelling, also known as entclass1pt{minimaratively\u00a0. This toad hoc rules, heuristics and non-differentiable links that hamper analytic treatment. Emulation allows one to account for input errors, derive predictive variance estimates, infer sensitivity values of parameters, calculate Jacobians and perform uncertainty propagation and quantification analytically. Besides, a lot of physical knowledge used for designing RTMs could be translated in designing priors . These excellent capabilities have not been widely exploited in EO applications though.RTMs are the result of many decades of scientific research and continuous development, so they often include signal features such as non-stationarity, circularity, spatial\u2013temporal relations, coloured-noise processes and non-i.i.d. relations. Nevertheless, data-driven GP models should be further constrained to provide physically plausible predictions. Recent approaches consider designing joint observation\u2013simulation cross-covariances\u00a0[The GP framework allows us to include constraints and priors adapted to ariances\u00a0. Recentlariances\u00a0, which cLearning dynamical physical systems is very challenging. Recent regression approaches have learned the governing equations of non-linear dynamical systems from data, such as the Lorenz, Navier\u2013Stokes and Schr\u00f6dinger equations. Models typically impose sparsity and hierarchical modelling, but also a GP probabilistic approach has excelled in discovering ordinary and partial differential, integro-differential and fractional order operators\u00a0.consistency and faithfulness. As a by-product, the hybridization process has an interesting regularization effect, as physics discards implausible models and promotes simpler structures.The integration of physics into GP models not only achieves improved generalization but, more importantly, endorses these grey-box models with Understanding is more challenging than predicting, especially when no interventional studies can be conducted, as in the Earth sciences. Causal inference from observational data to estimate causal graphical models has become a mature science with effective machine-learning methods to deal with both time series and non-time-ordered data; see ,9 and re"}
+{"text": "Mesenchymal stem cells (MSCs) are a class of pluripotent cells that can release a large number of exosomes which act as paracrine mediators in tumour\u2010associated microenvironment. However, the role of MSC\u2010derived exosomes in pathogenesis and progression of cancer cells especially osteosarcoma has not been thoroughly clarified until now. In this study, we established a co\u2010culture model for human bone marrow\u2010derived MSCs with osteosarcoma cells, then extraction of exosomes from induced MSCs and study the role of MSC\u2010derived exosomes in the progression of osteosarcoma cell. The aim of this study was to address potential cell biological effects between MSCs and osteosarcoma cells. The results showed that MSC\u2010derived exosomes can significantly promote osteosarcoma cells\u2019 proliferation and invasion. We also found that miR\u201021\u20105p was significantly over\u2010expressed in MSCs and MSC\u2010derived exosomes by quantitative real\u2010time polymerase chain reaction (qRT\u2010PCR), compared with human foetal osteoblastic cells hFOB1.19. MSC\u2010derived exosomes transfected with miR\u201021\u20105p could significantly enhance the proliferation and invasion of osteosarcoma cells in vitro and in vivo. Bioinformatics analysis and dual\u2010luciferase reporter gene assays validated the targeted relationship between exosomal miR\u201021\u20105p and PIK3R1; we further demonstrated that miR\u201021\u20105p\u2010abundant exosomes derived human bone marrow MSCs could activate PI3K/Akt/mTOR pathway by suppressing PIK3R1 expression in osteosarcoma cells. In summary, our study provides new insights into the interaction between human bone marrow MSCs and osteosarcoma cells in tumour\u2010associated microenvironment. Recurrence and metastasis are the main reasons for the unsatisfactory treatment of OS.Classically, MSCs play its role mainly through cell contact\u2010dependent mechanisms and soluble factors.In previous studies, we found that MSC\u2010derived exosomes enhance the proliferation of OS,22.12 at 37\u2103. Following the guidelines of the International Conference on Harmonization (ICH) E\u20106 Good Clinical Practice and approved by the ethics committee of Lanzhou university second hospital  and informed written consent, primary human MSCs were isolated from bone marrow of 6 patients (15\u201337\u00a0years old) who have been diagnosed as OS and were adhere\u2010wall cultured to isolation, and it has been described in detail in our previous study.Human U2OS, MG63 and Human osteoblasts (hFOB1.19)  were cultured in DMEM with 10% foetal bovine serum and 1% penicillin\u2010streptomycin. All cells were cultured in an incubator with a humidity atmosphere of 5% CO2.2g centrifugation for 10\u00a0min to remove cells, to 2000\u00a0\u00d7\u00a0g centrifuged for 10\u00a0min to remove dead cells, and at 10,000\u00a0\u00d7\u00a0g for 30\u00a0min to remove cell debris and retain the supernatant for further ultracentrifugation. At twice 100,000\u00a0\u00d7\u00a0g ultracentrifugation for 70\u00a0min, the pellets (exosomes) were retained, and the supernatant was discarded. Purified exosomes were negatively stained with uranyl acetate by means of floating method and observed by transmission electron microscope. The particle size distribution of exosomes was characterized and quantified by NanoSight LM10 system (NanoSight).Cellular surface antigens of MSCs were examined with flow cytometry, and it has been described in detail in previous experiment.2.34\u00a0cells/cm2, and OS cells seeded in 6\u2010well chambers with 0.4\u00a0\u03bcm polycarbonate membrane pores. The membrane was permeable, and cells could not pass through the membrane, but the cytokines secreted by cells could pass through. Cells were co\u2010cultured for 2\u00a0weeks, and then, induced MSCs were collected for further experiments.MSCs were seeded in a 6\u2010well plate of a density of 1\u00a0\u00d7\u00a0102.4http://www.ncbi.nlm.nih.gov/geo/), and the GEO accession Nos. are GSE58027 and GSE89930. The heat map of miRNAs showed significant differences using the hierarchical clustering method.We obtained the microarray data from Gene Expression Omnibus  is a publicly accessible online cancer microarray database, which helps to promote the research of genome\u2010wide expression analysis.Oncomine database  was used to label OS cell nuclei. The process of OS cells uptake of exosomes was observed under a Nikon Eclipse 80i confocal fluorescence microscope.2.7For the inhibition of exosome generation, MSCs were pre\u2010treated with exosome\u2010free media containing 10\u00a0\u03bcM GW4869 (Umibio) for 24\u201348\u00a0h. When wall\u2010adhered MSCs reached 90% confluence, the culture supernatants were collected for further cell proliferation assays.2.8After reaching 80% confluence, OS cells inoculate into 96\u2010well plates (100\u00a0\u03bcl/well). OS cells were treated with or without 40\u00a0\u03bcg of MSC\u2010derived exosomes. In order to eliminate the effect of MSC\u2010derived exosomes on OS cells, GW4869\u2010treated MSCs were added to OS cells as MSC\u2010GW4869 group. Cell growth was measured with a 10\u00a0\u03bcl cell counting kit  according to the manufacturer's instruction (CCK\u20108 assay). Absorbance was read at 450\u00a0nm using a microplate reader (Tecan Infinite 200 Pro). OS cells were co\u2010cultured with different culture medium; then, OS cells labelled with CFSE  and detected by flow cytometry (Becton Dickinson) according to the manufacturer's instruction.2.95\u00a0cells per well. When cells grew to 95% confluence, monolayers were wounded by a sterile 10\u00a0\u03bcl plastic micropipette tip, washed and added different culture medium according to the needs of the experiment. The width of the scratch gap under the microscope was observed and photographed.OS cells were divided into a 6\u2010well plate at a rate of 1\u00a0\u00d7\u00a0102.10OS cell invasion experiments were conducted using 24\u2010well chambers with 8.0\u2010\u03bcm PET membrane pores. The number of cells invading through the membrane was calculated in 10 regions/well.2.11OS cells were transfected with miR\u201021\u20105p mimics/inhibitor or different combinations of control sequence, psiCHECK\u20102\u2010PIK3R1 3\u2019UTR\u2010WT and psiCHECK\u20102\u2010PIK3R1 3\u2019UTR\u2010Mut for 48\u00a0h. The dual\u2010luciferase reporter kit (Promega) was to evaluate relative luciferase activity.2.12RNA extraction and real\u2010time quantitative real\u2010time polymerase chain reaction (PCR) analysis were performed as mentioned earlier.2.13Protein extraction and Western blotting were performed as described previously.2.146) through subcutaneous injection. After 1\u00a0week of tumour growth, mice were randomly divided into the following groups (n\u00a0=\u00a06): OS cells mixed with miR\u201021\u20105p\u2010exosomes (MSCs were treated with miR\u201021\u20105p mimic to purify miR\u201021\u20105p\u2010exosomes) and OS cells mixed with miR\u2010NC\u2010exosomes. In control mice, we injected intra\u2010tumour, the same volume of PBS (vehicle) alone. Each mice (n\u00a0=\u00a06/group) was injected with MSC\u2010derived exosomes suspension (400\u00a0\u03bcg/ml) by intra\u2010tumour injection every week. After injection, calliper was used to measure the tumour size, and the following formula was used to calculate the tumour volume: Tumour volume (mm3)\u00a0=\u00a00.52\u00a0\u00d7\u00a0width (mm)2\u00a0\u00d7\u00a0length (mm). At the end of the 5th week, nude mice were sacrificed using 20% overdose pentobarbital.All experiments were approved by the Animal Research Ethics Committee of Lanzhou university second hospital. In the assessment of the effect of MSC\u2010derived exosomes on OS growth in vivo, all nude mice were inoculated subcutaneously with MG63 cells (5\u00a0\u00d7\u00a0102.15https://www.ibm.com/support/pages/node/723919) and GraphPad Prism 5.0 software (URL: https://download.csdn.net/download/qq_31202341/9095763). The heat maps were made by heml 1.0.3.7 software (URL: https://download.pchome.net/development/html/download\u201013816.html). p\u2010values <0.05 were considered to be statistically significant. All experiments were performed using at least three independent experiments.The data were presented as mean\u00a0\u00b1\u00a0standard deviation and statistically analysed by IBM SPSS Statistics 21.0 software , while there was no difference between MSC\u2010GW4869 group and normal group  in vitro, OS Cells were measured at 24, 48 and 72\u00a0h after MSC\u2010derived exosomes and MSC\u2010GW4869 (blockage of exosome generation) treatment. The CCK\u20108 assay showed that compared with normal group (untreated group), the proliferation rates of both U2OS and MG63 cells were highly observed after MSC\u2010derived exosomes treatment for 72\u00a0h (3.4http://www.ncbi.nlm.nih.gov/geo/). Compared with adult fibroblasts cells (AFB), miR\u201021\u20105p exhibited highly upregulated expression in MSC\u2010derived exosomes and MSCs   in MSC\u2010derived exosomes, the miRNA profiling by array is available in the Gene Expression Omnibus (GEO) database  Figure\u00a0.3.5We analysed the expression of PIK3R1 in human different sarcomas using Oncomine database. Cancer and normal samples from different patient datasets showed that PIK3R1 expression was significantly lower in pleomorphic myxofibrosarcoma, myxofibrosarcoma, myxoid/round cell liposarcoma, leiomyosarcoma and malignant fibrous histiocytoma Figure\u00a0.p\u00a0<\u00a00.05)  Figure\u00a0. These r3.6p\u00a0<\u00a00.05). The level of miR\u201021\u20105p in U2OS and MG63 internalized with MSC\u2010derived exosomes (MSCs treated with miR\u201021\u20105p mimic) was much higher compared with that in the normal group (p\u00a0<\u00a00.001). In addition, we did not find significant changed in miR\u201021\u20105p expression in U2OS and MG63 cells between the negative control groups and normal groups . However, compared with the normal groups, OS cells internalized with MSC\u2010derived exosomes (MSCs treated with miR\u201021\u20105p inhibitor) have no significantly increase , while U2OS and MG63 cells proliferative abilities remarkably decreased when treated with the MSC\u2010derived exosomes (MSCs with miR\u201021\u20105p inhibitor) . Compared with that of the normal groups, the rates of wound healing were significantly attenuated in the miR\u201021\u20105p inhibitor group  was much lower compared with that in the normal group  Figure\u00a0. Scratch3.7p\u00a0>\u00a00.05, Figure\u00a0p\u00a0<\u00a00.05, Figure\u00a0p\u00a0<\u00a00.05, Figure\u00a0To study the effect of exosomal miR\u201021\u20105p derived from MSCs on OS growth in vivo, all mice were injected subcutaneously with MG63 and U2OS cells. After 1\u00a0week of OS growth, miR\u201021\u20105p\u2010exosomes, miR\u2010NC\u2010exosomes and the same volume of vehicle were weekly administered via intra\u2010tumour injection into mice. In the second week, there was no difference in tumour volume and weight in each group . However, the expressions of Akt, mTOR and PI3K were relatively stable in OS cells ; Investigation ; Methodology ; Software . Yapeng Wang: Formal analysis ; Methodology .Not applicable."}
+{"text": "The global environment is dominated by various small exotic substances, known as secondary metabolites, produced by plants and microorganisms. Plants and fungi are particularly plentiful sources of these molecules, whose physiological functions, in many cases, remain a mystery. Fungal secondary metabolites (SM) are a diverse group of substances that exhibit a wide range of chemical properties and generally fall into one of four main family groups: Terpenoids, polyketides, non-ribosomal peptides, or a combination of the latter two. They are incredibly varied in their functions and are often related to the increased fitness of the respective fungus in its environment, often competing with other microbes or interacting with plant species. Several of these metabolites have essential roles in the biological control of plant diseases by various beneficial microorganisms used for crop protection and biofertilization worldwide. Besides direct toxic effects against phytopathogens, natural metabolites can promote root and shoot development and/or disease resistance by activating host systemic defenses. The ability of these microorganisms to synthesize and store biologically active metabolites that are a potent source of novel natural compounds beneficial for agriculture is becoming a top priority for SM fungi research. In this review, we will discuss fungal-plant secondary metabolites with antifungal properties and the role of signaling molecules in induced and acquired systemic resistance activities. Additionally, fungal secondary metabolites mimic plant promotion molecules such as auxins, gibberellins, and abscisic acid, which modulate plant growth under biotic stress. Moreover, we will present a new trend regarding phytoremediation applications using fungal secondary metabolites to achieve sustainable food production and microbial diversity in an eco-friendly environment. As a result, it has positive effects on plant growth, by improving nutrient acquisition and/or water uptake, and the plant nutrient use efficiency , were defined by  as molecThese molecules have also been identified\u00a0in plants as\u00a0herbivore repellents, pollinator attractants, allelopathic agents, toxicity protection, UV-light shielding, and signal transduction.\u00a0Diverse fungal bioactive secondary metabolites include phytotoxins (SMs secreted by phytopathogenic fungi that attack plants), mycotoxins , pigments (colored substances with antioxidant properties), and antibiotics  . Additio22.1via signaling hormones and attractive substances for pollinators and seed development that modulate plant growth  seedlings concerning infection with Trichoderma virens and Trichoderma atroviride  flavonoids and phenolic compounds, (2) N- containing alkaloids, and (3) terpenoids. These metabolites are essential for plant fitness and survival t growth . A recent growth  argued troviride . Anotherroviride  measuredn action .Phytohormones such as ethylene (ET) , salicylMagnaporthe oryzae can release IAA at the site of hyphal infection. In turn, this also stimulates the host to synthesize endogenous IAA at these sites. However, it remains unclear how M. oryzae induces host IAA production at the molecular level  inducible cell wall biosynthesis and lignification . In addiar level .2.2Hebe cupressoides and blackcurrant (Ribes nigrum) produce the phytoanticipin flavanone sakuranetin (Oryza sativa) (de novo in response to biotic (pathogens) or abiotic stressors . These SMs may be generated in one organ while being constitutively utilized in another. For example, phytocassanes, a type of phytoanticipin, include flavonoids and phenolics   burst via cell membrane binding, causing cell component leakage   1, which codes a polyketide synthase (PKS) involved in manufacturing the fusaric acid toxin, is inhibited /PKS mycotoxin, nectriapyrones, phytotoxic polyketide compounds, and pyriculols do not play significant roles  . The seclignans) . The lealignans) . Phenolilignans) . These clignans) . Plant h leakage . In addiosporus) . Plant sosporus) . Generalosporus) . Recent irulence . In addinhibited . Thus, int roles . Many funt roles . Neverthnt roles .2.3via plant roots (root exudates) into the rhizospheric zone, actively using ATP as an energy source\u00a0or passively through diffusion. Root components that influence plant microbiome signal interactions in the rhizosphere are becoming more widely understood (via root exudates (Glycine max) has been investigated for its mutualistic connections with an arbuscular mycorrhizal fungus, which releases a variety of metabolites into the soil   . Flavano bicolor . In line bicolor .3via hydrolytic enzyme secretion or indirectly\u00a0through natural openings such as stomata or physical wounds  for host tissue penetration, initial lesion development in host tissue, lesion enlargement, then eventually, the death of the vulnerable plant . Howeverl wounds .via HSTs is well recognized, and around 20 HSTs have been identified. While the earliest stages of the disease do not differ significantly between necrotrophs, hemibiotrophic, and obligate biotrophic fungi, diverse techniques for acquiring nutrients\u00a0are employed. For example, necrotrophic fungi have a more comprehensive host range than biotrophic fungi  isolates form the pathotype Oryza, which causes rice blast disease. M. oryzae infections typically lose 10-30% of rice production annually. This fungus affects all aerial portions of rice, causing leaf blast, collar rot, neck and panicle rot, and node blast , a typical plant SM, scytalol D synthesized by Scytalidium spp., and\u00a0the lipid biosynthesis inhibitor cerulenin  increase the availability of nutrients and water uptake for host plants, resulting in 4-25% of their photosynthetic energy toward AMF roots . As obli2+ has a crucial role as a messenger molecule in the signaling process for various processes (via resistance (R) genes, resulting in effector-triggered immunity (ETI), which improves and accelerates the immune response. When one or more pathogen effectors successfully obstruct PTI responses, pathogens can infect susceptible hosts (ETS)  . There a outcome . PTI and outcome . Endogen4.2Ralstonia solanacearum causes bacterial wilt in many plants that can also produce molecules such as ralstonins, isoquinolines, and lipopeptides. Contrastingly, these molecules are involved in the growth inhibition of the pathogen Aspergillus flavus by BGC downregulation , comprised of synthases and/or synthetases  that utilize primary metabolites as substrates to create carbon backbones, which are further modified by tailoring enzymes . Some BGgulation . It is s4.2.1creA and/or cre1 genes. The Velvet complex component veA, the blue light receptor FphA, and the phytochrome FphA of the organism Aspergillus nidulans form a complex that has been used to explain the connection between light perception and the production of SMs  heal inflammation, sinusitis, and tuberculosis and have been used in traditional medicinal practices. Laricifomes officinalis, an herbal remedy, can treat diarrhea and night sweats  is apparent in all biological systems and present in most evolutionary lineages . The widDeath signals in the intrinsic death pathway cause the release of mitochondrial proteins, which amplifies the caspase cascade . SignalsThe fundamental cellular similarities between pathogenic fungi and their hosts make it challenging to develop and administer effective antifungal/fungicide therapy. However, long-term use is not recommended because many antifungal medications are incredibly harmful . AntifunC. Albicans to initiate a PCD response, characterized by the rapid emergence of several traditional apoptotic markers seen in mammalian cells. This includes a loss of cell viability when stained with dye propidium iodide, sustained oxygen consumption, and metabolic activity during cell death, and the production of ROS in apoptotic cells  from the surrounding environment to prevent the growth of other fungi as a plant protection mechanism  to resist the insect herbivore Spodoptera frugiperda. Upon T. atroviride inoculation of maize, increased plant growth, decreased herbivory, and altered insect feeding patterns were noted. Increased volatile terpene emission and accumulation of jasmonic acid, which activates defense responses against herbivory, were associated with plant protection. Furthermore, a recent study by  in Bacillus subtilis. They observed increased siderophores-mediated bioaccumulation of Cd (II) by B. subtilis, which was siderophore dose-dependent. Here, the optimum siderophore concentration was 50 SU/ml, where higher concentrations negatively affected the B. subtilis growth due to the chelation of essential nutrients. A study by  due to their high immobilizing affinity toward metals through biosorption, insoluble oxalate formation, and/or melanin-like polymer chelation  by enhancing plant tolerance. Some studies summarized that AMF alleviates heavy metal stress by hindering its uptake by the host plant. For example, AMF decreased the heavy metal impact on Calendula officinalis (pot marigold) development by reducing the uptake of heavy metals (Cd and Pb) and enhancing the beneficial secondary metabolites compared to non-mycorrhizal plants. Similarly, Zn uptake and concentration were reduced in the tomato plants inoculated with mycorrhizal fungi. In addition, heavy metals enter the root cell pathways . To imprpathways . Their spathways Figure\u00a03pathways . Naturaland Fe,. . These mand Fe,. . Furtherand Fe,. . In receand Fe,. . Howeverand Fe,.  examinedstudy by  examinedxidation . Trichodhelation . In the ompounds . White rompounds  investigdosulfan . Thus, m8Trichoderma and other fungi are being used as biocontrols, and then circle back to the general knowledge of their having roles in enhancing SAR/ISR among mutualistic interactions with plants. Although this work targets SMs role in improving crop yield and growth during global climate change, it is also important to remember the pharmaceutical and industrial/economic contribution as outlined in (As the human population expands, food security and safety will become more threatening than ever before. For this reason, it has become imperative that research explore alternative methods to help adopt more sustainable practices to meet the needs of people worldwide. Here, an exciting new avenue for research has been reviewed: fungal secondary metabolites, their origin, biological roles, and current and future applications. Beneficial endophytes such as lined in Figure\u00a02Additionally, increased production of cellular metabolites to protect plants from disease offers potential for application in biocontrol to reduce significantly synthetic pesticide use, representing an economical and eco-friendly way forward for agricultural sustainability. Besides, the fundamental knowledge governing plant-microbe interactions significantly increased crop yield and food supply. Secondary metabolites play a vital role in plant health by regulating the anti-pathogenic mechanisms in the host plants. Thus, understanding the pathway of SMs and their role in biological control strategies will be essential for improving crop yield and providing novel future green agriculture opportunities. Knowledge of genomic clustering and regulation of SM genes will yield new insight into the evolution of fungal pathogenesis and host defense.Conceptualization NAE, OH, AZ, DP; original draft, NAE, OH, AM, OE, AZ , SH, and AE-T. Create and software figures, NAE, OH, AZ, and OE. Review and language editing, OH and AM. All authors approved the submitted version."}
+{"text": "The spectrophotometer has been used for decades to measure the density of bacterial populations as the turbidity expressed as optical density\u2013OD. However, the OD alone is an unreliable metric and is only proportionately accurate to cell titers to about an OD of 0.1. The relationship between OD and cell titer depends on the configuration of the spectrophotometer, the length of the light path through the culture, the size of the bacterial cells, and the cell culture density. We demonstrate the importance of plate reader calibration to identify the exact relationship between OD and cells/mL. We use four bacterial genera and two sizes of micro-titer plates (96-well and 384-well) to show that the cell/ml per unit OD depends heavily on the bacterial cell size and plate size. We applied our calibration curve to real growth curve data and conclude the cells/mL\u2013rather than OD\u2013is a metric that can be used to directly compare results across experiments, labs, instruments, and species. The Beer-Lambert law  relates However, the Beer-Lambert law applies only to solutions in which molecules of solute are uniformly distributed throughout the solvent. It does not apply to suspensions of particulate matter such as microbial cells. Rather than absorbing light, particles scatter light, which is why we express turbidity as OD  instead of A (absorbance). The relationship between cells/mL and OD is complex and depends on several factors including length of light path, size of the particles (cells), and number of particles. There is no simple factor equivalent to \u03f5 that relate number of cells/mL to OD.It is not a trivial matter to determine the number of cells/mL or the mass of cells in a culture. The classic way was to dry a culture and weigh the cells, a method that does not lend itself to easy measurement of cell densities in small cultures, . It can be important to determine cell densities easily and quickly, i.e., when monitoring growth in fermenters to determine when to harvest cells.The convenience of measuring cell populations in microtiter plate readers led us to determine the relationship between OD and cells/mL for several microbial species and for plates of different sizes. Given that relationship OD can be used to calculate cell numbers just as A is used to calculate concentration of a solute.Spectrophotometers have been used for over 6 decades as a means of measuring the population density of microbial cultures \u20134. PopulTo precisely estimate cell titers from observed OD measurements, it is necessary to calibrate the spectrophotometer. The relationship of OD to cell titer depends on four components: 1) the configuration of the spectrophotometer, 2) the length of the light path through the suspension, 3) the size of the cells, and 4) the cell culture density. Therefore, it is necessary to calibrate each spectrophotometer model separately for each microbial species that is to be studied.Until about a decade ago ODs were determined by putting a sample of the culture into a cuvette of, typically, a 1 cm light path. Determining the growth rate required sampling from a culture at timed intervals and recording the OD at each time point. In practical terms it was difficult to follow more than about 20 cultures simultaneously. The advent of using a microtiter plate reader to monitor the growth of cultures in the wells of a microtiter plate permits high throughput measurements of microbial growth kinetics. However, the same considerations of calibration apply to microtiter plate readers as to spectrophotometers . MicrotiE. coli and do not consider microtiter plate size, well-depth, or other sizes of bacterial species. Here, we demonstrate the importance of calibrating a plate reader using a Biotek Epoch 2 plate reader, both 96-well and 384-well microtiter plates and four bacterial species that span a wide range of cell sizes. We then apply the calibration to a set of growth curves for Escherichia coli and show that using cells/mL yields the same growth rates as using OD.A recent study shows the benefit of plate reader calibrations using silica microspheres . HoweverEscherichia coli K12 strain DH5\u03b1 (F\u2013\u03c680lacZ\u0394 M15 \u0394 (lacZYA-argF) U169 recA1 endA1 hsdR17 (rK\u2013mK+) phoA supE44 \u03bb- thi\u20131 gyrA96 relA1) from ThermoFisher, Escherichia coli strain CFT073 O6:K2:H1 Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author </font> 1. Does the manuscript report a protocol which is of utility to the research community and adds value to the published literature?Reviewer #1:\u00a0Yes********** <font color=\"black\"> 2. Has the protocol been described in sufficient detail? </font> Descriptions of methods and reagents contained in the step-by-step protocol should be reported in sufficient detail for another researcher to reproduce all experiments and analyses. The protocol should describe the appropriate controls, sample sizes and replication needed to ensure that the data are robust and reproducible.Reviewer #1:\u00a0Yes********** <font color=\"black\"> 3. Does the protocol describe a validated method? </font> The manuscript must demonstrate that the protocol achieves its intended purpose: either by containing appropriate validation data, or referencing at least one original research article in which the protocol was used to generate data.Reviewer #1:\u00a0Yes********** <font color=\"black\"> 4. If the manuscript contains new data, have the authors made this data fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #1:\u00a0Yes********** <font color=\"black\"> 5. Is the article presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please highlight any specific errors that need correcting in the box below. Reviewer #1:\u00a0Yes********** <font color=\"black\"> 6. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0A good technical manuscript with a few obvious typos. The message nicely confirms well-known concepts in terms of accuracy of OD vs cell count, the influence of cell size, etc.********** <font color=\"black\"> 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Reviewer #1:\u00a0No**********https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step. </div> While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0 19 Sep 2022Journal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdfDone2. Thank you for stating the following financial disclosure:\u201cWe are grateful for funding from a KL2 Fellowship (PJY) through the NIH/National Center for Advancing Translational Science (NCATS) UCLA CTSI Grant Number UL1TR001881 as well as the Presidential Postdoctoral Fellowship to Dr. Portia Mira\u201dPlease state what role the funders took in the study. If the funders had no role, please state: \"The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.\"If this statement is not correct you must amend it as needed.Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.Done \u2013 this has been updated in the cover letter above.3. Thank you for stating the following in the Acknowledgments Section of your manuscript:\u201cWe are grateful for funding from a KL2 Fellowship (PJY) through the NIH/National Center for Advancing Translational Science (NCATS) UCLA CTSI Grant Number UL1TR001881 as well as the Presidential Postdoctoral Fellowship to Dr. Portia Mira.\u201dWe note that you have provided additional information within the Acknowledgements Section that is not currently declared in your Funding Statement. Please note that funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:\u201cWe are grateful for funding from a KL2 Fellowship (PJY) through the NIH/National Center for Advancing Translational Science (NCATS) UCLA CTSI Grant Number UL1TR001881 as well as the Presidential Postdoctoral Fellowship to Dr. Portia Mira\u201dPlease include your amended statements within your cover letter; we will change the online submission form on your behalf.Done \u2013 this has been revised and included at the end of the cover letter above as well as on the online form. http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions.4. We note that you have indicated that data from this study are available upon request. PLOS only allows data to be available upon request if there are legal or ethical restrictions on sharing data publicly. For more information on unacceptable data access restrictions, please see In your revised cover letter, please address the following prompts:a) If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail  and who has imposed them . Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent.http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories.b) If there are no restrictions, please upload the minimal anonymized data set necessary to replicate your study findings as either Supporting Information files or to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. For a list of acceptable repositories, please see We will update your Data Availability statement on your behalf to reflect the information you provide.Raw data has been added as a supplementary file and referenced in the methods section of the paper.5. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.We have included all raw data files as supplementary files (.xlsx). The cover letter has been revised accordingly.6. We note that you have included the phrase \u201cdata not shown\u201d in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository  and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.We have included this data in the supplementary files and have indicated the location in the main text.http://journals.plos.org/plosone/s/supporting-information.7. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: All supplemental files have been given captions and titles and are updated in the manuscript accordingly. 8. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article\u2019s retracted status in the References list and also include a citation and full reference for the retraction notice. To our knowledge, we have not cited any retracted papers. [Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Does the manuscript report a protocol which is of utility to the research community and adds value to the published literature?Reviewer #1: Yes2. Has the protocol been described in sufficient detail?Descriptions of methods and reagents contained in the step-by-step protocol should be reported in sufficient detail for another researcher to reproduce all experiments and analyses. The protocol should describe the appropriate controls, sample sizes and replication needed to ensure that the data are robust and reproducible.Reviewer #1: Yes3. Does the protocol describe a validated method?The manuscript must demonstrate that the protocol achieves its intended purpose: either by containing appropriate validation data, or referencing at least one original research article in which the protocol was used to generate data.Reviewer #1: Yes4. If the manuscript contains new data, have the authors made this data fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.Reviewer #1: Yes5. Is the article presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please highlight any specific errors that need correcting in the box below. Reviewer #1: Yes6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1: A good technical manuscript with a few obvious typos. The message nicely confirms well-known concepts in terms of accuracy of OD vs cell count, the influence of cell size, etc.Thank you for your feedback. We have revised according to journal requirements and fixed typos throughout.7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: No 28 Sep 2022Estimating microbial population data from optical densityPONE-D-22-14390R1 <span style=\"color: rgb; font-family: verdana, geneva, arial, helvetica, sans-serif; font-size: 11.2px; background-color: rgb;\"> Portia Mira, </span> Dear Dr. We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Abdelwahab Omri, Pharm B, Ph.D, Laurentian UniversityAcademic EditorPLOS ONE 5 Oct 2022PONE-D-22-14390R1 Estimating microbial population data from optical density Dear Dr. Mira:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofDr. Abdelwahab Omri Academic EditorPLOS ONE"}
+{"text": "The inclusion of the third dimension in 3D cell culture influences the spatial organization of cell surface receptors that interact with other cells and imposes physical restrictions on cells in compared to Two-dimensional (2D) cell cultures. Spheroids\u2019 distinctive cyto-architecture mimics in vivo cellular structure, gene expression, metabolism, proliferation, oxygenation, nutrition absorption, waste excretion, and drug uptake while preserving cell\u2013extracellular matrix (ECM) connections and communication, hence influencing molecular processes and cellular phenotypes. This protocol describes the in vitro generation of tumourspheroids using the low attachment plate, hanging drop plate, and cellusponge natural scaffold based methods. The expected results from these protocols confirmed the ability of all these methods to create uniform tumourspheres.Three-dimensional (3D) cell culture models can help bridge the gap between  However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.\u00a0Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:\u00a0\u00a0[Science Foundation Ireland (SFI) Grant Number 17/CDA/4653 Teagasc Walsh Fellowship 2017228 (JMW)].\u00a0\u00a0Please state what role the funders took in the study. If the funders had no role, please state: \"The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.\"\u00a0If this statement is not correct you must amend it as needed.\u00a0Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions.\u00a05. We note that you have indicated that data from this study are available upon request. PLOS only allows data to be available upon request if there are legal or ethical restrictions on sharing data publicly. For information on unacceptable data access restrictions, please see In your revised cover letter, please address the following prompts:a) If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail  and who has imposed them . Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent.http://www.bmj.com/content/340/bmj.c181.long for guidelines on how to de-identify and prepare clinical data for publication. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories.b) If there are no restrictions, please upload the minimal anonymized data set necessary to replicate your study findings as either Supporting Information files or to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. Please see We will update your Data Availability statement on your behalf to reflect the information you provide.6. Please include your full ethics statement in the \u2018Methods\u2019 section of your manuscript file. In your statement, please include the full name of the IRB or ethics committee who approved or waived your study, as well as whether or not you obtained informed written or verbal consent. If consent was waived for your study, please include this information in your statement as well.\u00a0[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author </font> 1. Does the manuscript report a protocol which is of utility to the research community and adds value to the published literature?Reviewer #1:\u00a0NoReviewer #2:\u00a0YesReviewer #3:\u00a0Yes********** <font color=\"black\"> 2. Has the protocol been described in sufficient detail? </font> Descriptions of methods and reagents contained in the step-by-step protocol should be reported in sufficient detail for another researcher to reproduce all experiments and analyses. The protocol should describe the appropriate controls, sample sizes and replication needed to ensure that the data are robust and reproducible.Reviewer #1:\u00a0PartlyReviewer #2:\u00a0YesReviewer #3:\u00a0No********** <font color=\"black\"> 3. Does the protocol describe a validated method? </font> The manuscript must demonstrate that the protocol achieves its intended purpose: either by containing appropriate validation data, or referencing at least one original research article in which the protocol was used to generate data.Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0No********** <font color=\"black\"> 4. If the manuscript contains new data, have the authors made this data fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0Yes********** <font color=\"black\"> 5. Is the article presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please highlight any specific errors that need correcting in the box below. Reviewer #1:\u00a0YesReviewer #2:\u00a0YesNo:\u00a0There are several grammatical grammatical errors throughout the text, which have to be corrected.Reviewer #3:\u00a0********** <font color=\"black\"> 6. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0Review for PLOS One \u2013 PONE-D-22-12260Wanigasekara et al. \u201cThree-Dimensional (3D) in vitro cell culture protocols to enhance glioblastoma research.\u201dThe manuscript by Wanigasekara et al. with the title \u201cThree-Dimensional (3D) in vitro cell culture protocols to enhance glioblastoma research.\u201d describes the generation of glioblastoma tumorspheroids. Three different approaches are presented, based on the utilization of low attachment plates, hanging drop plates, and cellusponge natural scaffold. Using different cell numbers and incubation times, the authors investigate the growth of these glioblastoma tumorspheroids associated with the three different experimental approaches.In general, the presented topic touches on an important aspect, as there is a lack of preclinical models recapitulating glioblastoma biology and the associated tumor microenvironment. However, the manuscript is neither comprehensive enough nor sufficiently detailed to support other researchers in the field with the advancement of glioblastoma 3D culture and translational research.Major concerns:1. In line with the existing knowledge on molecular heterogeneity of glioblastoma, the investigation of only one cell line is a major drawback of the presented manuscript.2. The methodological section is partly presented online, however it remains unclear how data were quantified. For example, while at least three experiments were performed, it is not known how many spheroids were measured within each of the three biological repetitions.3. The manuscript does do not offer new perspectives into how the described 3D models might be of relevance to glioblastoma research. For example: Are these assays adaptable to further functional endpoints? Does the Cellulsponge scaffold mimic physiological architecture of the brain or glioblastoma tumor? etc.4. The manuscript lacks a critical discussion of the current literature on the topic of glioblastoma 3D culture as well as specific and relevant conclusions on how to move forward in this research field.Reviewer #2:\u00a0The manuscript \u201cThree-Dimensional (3D) in vitro cell culture protocols to enhance glioblastoma research\u201d provide a good protocol for different 3D cultures of GBM.I only miss a discussion, where the author reflects on the data presented from the 3 models. I think a discussion would complement the introduction part and the results.Reviewer #3:\u00a0The manuscript by Wanigasekara et al. entitled \u201eThree-Dimensional (3D) in vitro cell culture protocols to enhance glioblastoma research\u201c describes different ways to generate tumor spheroids from cultured astrocytoma cell lines. This protocol is interesting and helpful per se, however, it is not acceptable in ist current form.Major points:1) The protocols were established on one cell line: U-251. This cell line is long-term cultured and used in high passage. As a result, a genetic drift can be anticipated, accompanied by variations in phenotypic marker expression and an increased growth rate in vitro. Particularly, this was previously reported for U-251 cells :812-24). Hence, experiments must be repeated with primary cells freshly taken from glioblastoma patients.2) The protocol lacks any functional analyses, such as drug response testing (at least towards the most commonly used drug TMZ) or gene expression studies .3) The authors describe viability analysis of tumorspheroids using Alamar Blue\u2122 cell viability reagent. The more commonly used method is the CellTiter-Glo\u00ae 3D Cell Viability Assay, based on quantitation of the ATP present. I strongly suggest repetition of the analyses using the latter to perform a side-by-side comparison and to draw meaningful conclusions on the method of choice. At least, representative images on viablity, such fluorescence microscopy are warranted to evaluate viability.4) Experiments on migration/invasion should be incorporated to judge which method is preffered for invasion analyses.5) This lab protocol lacks information on organoid formation. The authors should at least mention this in vitro model in the introduction part6) The material & methods section is incomplete, there is no information on the statistics and applied tests. By contrast, in the results section, every third sentence includes ANOVA.Minor:7) There are several grammatical errors throughout the text. Please check carefully and correct grammar.8) Make size information uniform, i.e. 150\u00b5m vs. 150 \u00b5m.9) Introduce abbreviation at its first mention in the text, e.g. EMT, ANOVA, etc.10) Generally, revise the text since there are several typing and spelling errors in the current version.********** <font color=\"black\"> 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Reviewer #1:\u00a0NoReviewer #2:\u00a0NoReviewer #3:\u00a0No**********https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0AttachmentPONE-D-22-12260.pdfSubmitted filename: Click here for additional data file. 20 Sep 2022We have included a separate response to reviewers document with this resubmission.AttachmentResponse to Reviewers.docxSubmitted filename: Click here for additional data file. 4 Oct 2022Three-Dimensional (3D) in vitro cell culture protocols to enhance glioblastoma researchPONE-D-22-12260R1Dear Dr. Curtin,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Nils Cordes, M.D., Ph.D.Section EditorPLOS ONEAdditional Editor Comments :Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author </font> 1. Does the manuscript report a protocol which is of utility to the research community and adds value to the published literature?Reviewer #2:\u00a0YesReviewer #3:\u00a0Yes********** <font color=\"black\"> 2. Has the protocol been described in sufficient detail? </font> Descriptions of methods and reagents contained in the step-by-step protocol should be reported in sufficient detail for another researcher to reproduce all experiments and analyses. The protocol should describe the appropriate controls, sample sizes and replication needed to ensure that the data are robust and reproducible.Reviewer #2:\u00a0YesReviewer #3:\u00a0Yes********** <font color=\"black\"> 3. Does the protocol describe a validated method? </font> The manuscript must demonstrate that the protocol achieves its intended purpose: either by containing appropriate validation data, or referencing at least one original research article in which the protocol was used to generate data.Reviewer #2:\u00a0YesReviewer #3:\u00a0Yes********** <font color=\"black\"> 4. If the manuscript contains new data, have the authors made this data fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #2:\u00a0N/AReviewer #3:\u00a0Yes********** <font color=\"black\"> 5. Is the article presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please highlight any specific errors that need correcting in the box below. Reviewer #2:\u00a0YesReviewer #3:\u00a0Yes********** <font color=\"black\"> 6. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #2:\u00a0I have no further comments and the paper is ready for publication.I have no further comments and the paper is ready for publication.Reviewer #3:\u00a0The authors addressed all my comments and improved the manuscript accordingly. I have no further demands.********** <font color=\"black\"> 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Reviewer #2:\u00a0NoYes:\u00a0Claudia MaletzkiReviewer #3:\u00a0********** 14 Oct 2022PONE-D-22-12260R1 Three-Dimensional (3D) in vitro cell culture protocols to enhance glioblastoma research\u00a0 Dear Dr. Curtin:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofProf. Dr. Nils Cordes Section EditorPLOS ONE"}
+{"text": "Erwinia amylovora and Escherichia coli), fungi  and nematodes (Globodera rostochiensis). On average, the pairwise identity between the generated consensus sequences and best GenBank BLAST matches was 99.6 \u00b1 0.6%. Additionally, assessing the generated insect genomic dataset, the potential power of the workflow to detect pesticide resistance genes, as well as arthropod-infecting viruses and endosymbiotic bacteria is demonstrated.The unintentional movement of agronomic pests and pathogens is steadily increasing due to the intensification of global trade. Being able to identify accurately and rapidly early stages of an invasion is critical for developing successful eradication or management strategies. For most invasive organisms, molecular diagnostics is today the method of choice for species identification. However, the currently implemented tools are often developed for certain taxa and need to be adapted for new species, making them ill-suited to cope with the current constant increase in new invasive species. To alleviate this impediment, we developed a fast and accurate sequencing tool allowing to modularly obtain genetic information at different taxonomical levels. Using whole genome amplification (WGA) followed by Oxford nanopore MinION sequencing, our workflow does not require any a priori knowledge on the investigated species and its classification. While mainly focusing on harmful plant pathogenic insects, we also demonstrate the suitability of our workflow for the molecular identification of bacteria ( Agronomic pests and pathogens cause enormous economic losses to global food production \u20133 and thhttps://qbank.eppo.int/) \u00a0 Please clarify whether this publication was peer-reviewed and formally published. If this work was previously peer-reviewed and published, in the cover letter please provide the reason that this work does not constitute dual publication and should be included in the current manuscript.3. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.4. We note that you have included the phrase \u201cdata not shown\u201d in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository  and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author </font> 1. Does the manuscript report a protocol which is of utility to the research community and adds value to the published literature?Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 2. Has the protocol been described in sufficient detail? </font> Descriptions of methods and reagents contained in the step-by-step protocol should be reported in sufficient detail for another researcher to reproduce all experiments and analyses. The protocol should describe the appropriate controls, sample sizes and replication needed to ensure that the data are robust and reproducible.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 3. Does the protocol describe a validated method? </font> The manuscript must demonstrate that the protocol achieves its intended purpose: either by containing appropriate validation data, or referencing at least one original research article in which the protocol was used to generate data.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 4. If the manuscript contains new data, have the authors made this data fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 5. Is the article presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please highlight any specific errors that need correcting in the box below. Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 6. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0ID PONE-D-22-03204: \u201cNext generation biosecurity: Towards genome based identification to prevent spread of agronomic pests and pathogens using nanopore sequencing\u201d by Frey et al.The manuscript reports a protocol that can be useful to the research community interested in the identification of agronomic pests. The traditional methods are based on classical barcoding (or metabarcoding) that targets one or a few genomic regions of one or a small group of species. The barcoding approach requires some prior knowledge of the target organisms, which sometimes is lacking. In this manuscript, the authors take the metagenomic approach by sequencing all the DNA of the sample, so any genomic region of any organism can be sequenced and, if there is enough genomic information in the repositories, identified. In consequence, the proposal is more flexible than the classical one based on barcoding. I reckon that in the future (with richer genomic repositories) methods like the one proposed here based on metagenomics will overcome (meta)barcoding methods.The protocol is described in sufficient detail in the main text and the supplementary material. The method is validated using more than 60 artificial single-species libraries of insects and a few more of bacteria, fungi, and nematodes.Despite being very positive about the manuscript, I don\u2019t like how results are presented. I have a couple of suggestions that may be useful to the authors in the preparation of a new version of the manuscript.Perhaps Figure 1 is unnecessary. It is just to be expected to find a highly significant linear relationship between the number of mapping reads and the number of collected reads. This information can be included in the text.On the contrary, I\u2019ve found the description of sample identification too shallow (l. 231-237). The authors only provide summary statistics (Table 1 and 2) that show that the process of species identification is good, in general. However, this is not always the case, as there are 9 libraries in which the \u201cassumed species\u201d is different to the \u201cspecies ID\u201d (Supplementary Table 2: please clarify the meaning of these two columns). This criticism does not invalidate the method but is proof that the method is not perfect . I encourage the authors to acknowledge the limitations of their method in the main text (in the results) and explain, if possible, the reason for the wrong or partial identification of some species (in the discussion).A final comment about the application of the method to real samples. The manuscript uses artificial single species libraries and the bioinformatic pipeline is intended to provide one species per sample. But what would happen if the original sample contained more than one insect species? Ideally, the method should provide all of them, but would it? In addition, if the sample contained two phylogenetically close species (e.g. two species of Bactrocera) would their reads map in different contigs or would they be mixed? I understand that these questions can be difficult to handle at this stage, but the authors might consider adding their reflections to the discussion. Depending on their willingness, they could simulate two-species libraries by merging the fastq files of two single-species libraries, run the entire pipeline using the new fastq file, and see what happens.Reviewer #2:\u00a0This manuscript is introducing a WGA based protocol utilizing ON MinION sequencing to improve DNA-based species identification. the methods is described very well, sufficient details on all steps are provided. My major point of criticism is that the discussion section lacks several aspects mentioned in the results e.g., on the presence of genes of interest such as insecticide resistance genes, and the presence of arthropod-infectingviruses and endosymbiotic bacteria. for a protocol description such as this it would be also very interesting to discuss the reference libraries used \u2013 where they sufficient? If not, how to improve that, where are the gaps, etc. ; or what about the pipelines you used? Where they useful, what could be alternatives also given that Geneious is not cheap?Minor things:L29 - 658 basepairs if you refer to COIL58 - is needed not are neededL64 - shown not proofedL125 - add a 'the' between extractions and DNAL128 - add the missing )L214 \u2013 How did you compensate for retained sequences of prior runs? MinION flow cells are known to retain up to 15% of former runs even if their wash kits are used. Did you see a difference (or overlap) between runs of reused flowcells? This should also be briefly discussed.L239 \u2013 table caption talks about Nematode data, but none is shown.L309 \u2013 remove \u201cshould essentially enable to\u201d and use \u2018could\u2019L314 \u2013 Interest not interests********** <font color=\"black\"> 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Reviewer #1:\u00a0NoReviewer #2:\u00a0Nohttps://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0 14 Apr 2022Responses to all issues raised are in the file \"Responses to Reviewers.docx\"AttachmentRespones to Reviewers.docxSubmitted filename: Click here for additional data file. 20 Jun 2022Next generation biosecurity: Towards genome based identification to prevent spread of agronomic pests and pathogens using nanopore sequencingPONE-D-22-03204R1Dear Dr. Buehlmann,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Patrizia FalabellaAcademic EditorPLOS ONEAdditional Editor Comments :Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author </font> 1. Does the manuscript report a protocol which is of utility to the research community and adds value to the published literature?Reviewer #1:\u00a0Yes********** <font color=\"black\"> 2. Has the protocol been described in sufficient detail? </font> Descriptions of methods and reagents contained in the step-by-step protocol should be reported in sufficient detail for another researcher to reproduce all experiments and analyses. The protocol should describe the appropriate controls, sample sizes and replication needed to ensure that the data are robust and reproducible.Reviewer #1:\u00a0Yes********** <font color=\"black\"> 3. Does the protocol describe a validated method? </font> The manuscript must demonstrate that the protocol achieves its intended purpose: either by containing appropriate validation data, or referencing at least one original research article in which the protocol was used to generate data.Reviewer #1:\u00a0Yes********** <font color=\"black\"> 4. If the manuscript contains new data, have the authors made this data fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #1:\u00a0Yes********** <font color=\"black\"> 5. Is the article presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please highlight any specific errors that need correcting in the box below. Reviewer #1:\u00a0Yes********** <font color=\"black\"> 6. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0This is the second time that I review this manuscript. As in this first occasion, I am positive about its quality. The protocol is described in sufficient detail in the main text and the supplementary material, and the method is validated using artificial single-species libraries. The suggestions that I made in my previous review are satisfactorily considered in the new version, so I almost have nothing else to add.Just one word of caution to the suggestion that Kraken is a good alternative to their bioinfomatic approach to identify species in DNA libraries. Kraken, like many other metagenomic classifiers, is rather prone to produce false positives :779-794).********** <font color=\"black\"> 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Reviewer #1:\u00a0No********** 13 Jul 2022PONE-D-22-03204R1 Next generation biosecurity: Towards genome based identification to prevent spread of agronomic pests and pathogens using nanopore sequencing Dear Dr. B\u00fchlmann:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofProf. Patrizia Falabella Academic EditorPLOS ONE"}
+{"text": "Circular RNA (circRNA) is a noncoding RNA class with important implications for gene expression regulation, mostly by interaction with other RNA species or RNA-binding proteins. While the commonly applied short-read Illumina RNA-sequencing techniques can be used to detect circRNAs, their full sequence is not revealed. However, the complete sequence information is needed to analyze potential interactions and thus the mechanism of action of circRNAs. Here, we present an improved protocol to enrich and sequence full-length circRNAs by using the Oxford Nanopore long-read sequencing platform. The protocol involves an enrichment of lowly abundant circRNAs by exonuclease treatment and negative selection of linear RNAs. Then, a cDNA library is created and amplified by PCR. This protocol provides enough material for several sequencing runs. The library is used as input for ligation-based sequencing together with native barcoding. Stringent quality control of the libraries is ensured by a combination of Qubit, Fragment Analyzer and qRT-PCR. Multiplexing of up to 4 libraries yields in total more than 1\u20132 Million reads per library, of which 1\u20132% are circRNA-specific reads with >99% of them full-length. The protocol works well with human cancer cell lines. We further provide suggestions for the bioinformatic analysis of the created data, as well as the limitations of our approach together with recommendations for troubleshooting and interpretation. Taken together, this protocol enables reliable full-length analysis of circRNAs, a noncoding RNA type involved in a growing number of physiologic and pathologic conditions.MetadataAssociated content. https://dx.doi.org/10.17504/protocols.io.rm7vzy8r4lx1/v2. Circular RNAs (circRNAs) are a class of noncoding RNA, which is generated by a form of alternative splicing termed back-splicing. Their ring-like structure and lack of free 5\u2019 and 3\u2019 ends render them exonuclease resistant and more stable than linear RNAs. This is the reason why they escape detection by the highly used poly(A)-selected mRNA sequencing , 2. circet al. followed this approach to analyze plant RNA  and is included for printing as supporting information file 1 with this article.\u201d For more information, please see our submission guidelines: https://journals.plos.org/plosone/s/submission-guidelines#loc-guidelines-for-specific-study-types2. Thank you for providing the following Protocols.io DOI in your submission form [Protocols.io DOI]. In keeping with our submission requirements, please add the Protocols.io DOI to the Methods section of your manuscript as well using this format: \u201cThe protocol described in this peer-reviewed article is published on protocols.io, http://journals.plos.org/plosone/s/latex.3. Please update your submission to use the PLOS LaTeX template. The template and more information on our requirements for LaTeX submissions can be found at [Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author </font> 1. Does the manuscript report a protocol which is of utility to the research community and adds value to the published literature?Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 2. Has the protocol been described in sufficient detail? </font> Descriptions of methods and reagents contained in the step-by-step protocol should be reported in sufficient detail for another researcher to reproduce all experiments and analyses. The protocol should describe the appropriate controls, sample sizes and replication needed to ensure that the data are robust and reproducible.Reviewer #1:\u00a0NoReviewer #2:\u00a0Yes********** <font color=\"black\"> 3. Does the protocol describe a validated method? </font> The manuscript must demonstrate that the protocol achieves its intended purpose: either by containing appropriate validation data, or referencing at least one original research article in which the protocol was used to generate data.Reviewer #1:\u00a0NoReviewer #2:\u00a0Yes********** <font color=\"black\"> 4. If the manuscript contains new data, have the authors made this data fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #1:\u00a0NoReviewer #2:\u00a0Yes********** <font color=\"black\"> 5. Is the article presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please highlight any specific errors that need correcting in the box below. Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 6. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0In this manuscript, the authors have developed a circRNA sequencing protocol that allows full length analysis using Oxford nanopore. Overall, the attempt to identify the full length of circRNAs is appreciated. However, the authors need to include the full detailed protocol within this manuscript with full analysis, troubleshooting, challenges, expected results and interpretations. The authors should also provide other data than those published at protocols.io with examples of fully delineated sequences of various circRNAs and confirmed by sanger sequencing.Reviewer #2:\u00a0Fuchs et al. present a comprehensive protocol based on the published Full-length sequencing protocol by Zhang et al. The adapted approach differs in several aspects, such as the optimization of different circRNA lengths and addition of cleanup procedures as well as QC steps.1. The authors mention \u201cModification of the ribodepletion method\u201d as one of the parts changed in the adapted protocol. A short description on what the change is would be helpful in the abstract part of the protocol.2. The protocol suggests use of qRT-PCR for validation of circRNAs and linear RNAs. It might be helpful to include a link to tools that can easily generate circRNA-specific primer pairs, as standard tools usually do not easily work with circular RNAs.3. It would be helpful to directly state in the abstract on protocols.io the required amount of starting material, as this is crucial in cases where only little material is available.4. In general, the generated data data is freely available, however, the GEO entry has an embargo date of March 2023, thus the data is not immediately available.********** <font color=\"black\"> 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Reviewer #1:\u00a0NoReviewer #2:\u00a0Nohttps://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0 25 Jun 2022Dear Dr. Andr\u00e9s-Le\u00f3n,Thank you very much for the consideration of our manuscript and the assessment. Further, we would like to thank you for the deadline extension, which allowed us to perform a thorough review. We appreciate the comments of the two reviewers that were very helpful for us. We carefully took their concerns and recommendations into account and now provide a much more detailed protocol (version 2), including further information about the bioinformatics analysis, challenges and limitations together with expected results of this protocol and their interpretation. Further, we created new in vitro data to show the robustness of our approach by validating several circRNAs detected by Nanopore via Sanger sequencing. Changes in the manuscript are marked in blue and are italicized. We updated our protocol on protocols.io and attached a .pdf copy as supplementary file to the manuscript. The changes in the protocol we made are described in detail below, since the protocols.io website does not allow tracking of the changes.We hope that the following explanations as well as our point-by-point response to the reviewers, where we have addressed all of their concerns and comments, will make the manuscript acceptable for publication in PLOS ONE. If you require any further information, please do not hesitate to contact us directly. Thank you for your time and consideration. We look forward to hearing from you at your earliest convenience. Yours sincerely, Steffen Fuchs----------------------\u2003Reviewer #1: In this manuscript, the authors have developed a circRNA sequencing protocol that allows full length analysis using Oxford nanopore. Overall, the attempt to identify the full length of circRNAs is appreciated. However, the authors need to include the full detailed protocol within this manuscript with full analysis, troubleshooting, challenges, expected results and interpretations. The authors should also provide other data than those published at protocols.io with examples of fully delineated sequences of various circRNAs and confirmed by sanger sequencing.Response:We thank the reviewer for the appreciation of our provided approach to sequence circRNAs in full length and for the provided feedback and comments. We agree with the reviewer that more methodical details of the protocol, including its limitations and challenges together with troubleshooting and further more details on the expected results and their interpretation will be very helpful for the researchers planning to use it. We therefore expanded our protocol and added those details to \u201cSteps\u201d and added these new sections to the protocol: 5) Suggestions for Nanopore sequencing, 6) Recommendations for bioinformatics analysis of the data, 7) Expected results and interpretation, 8) Limitations and challenges, 9) Troubleshooting. Although, the creation of the sequencing libraries and the sequencing itself follows the official protocol provided by Oxford Nanopore (kits EXP-NBD104 and SQK-LSK109), we provide now explanations and suggestions for modifications that improved sequencing for us. For instance, we included an optional part on washing the flow cell during a sequencing run and reloading the library to obtain more sequencing reads. While the focus of this protocol lies on the generation of the enriched circRNA-fraction for library generation, we agree with the reviewer that more information concerning the data analysis should be provided. Therefore, we provide now detailed recommendations concerning the bioinformatics analysis including the used commands, the limitations of the analysis and how to overcome them (in the protocol at section 6) \u201cRecommendations for bioinformatics analysis of the data\u201d and in sections 7 to 9).This protocol is part of the materials and methods section of the manuscript and further attached as supplementary data file, now in the more detailed version 2. In the manuscript we added a summary of all this information in the abstract lines 71-73 (page 3), the introduction at lines 117-118 (page 5), and in the expected results section at lines 189-194 (page 8) and lines 236-254 .We appreciate the recommendation of the reviewer to validate circRNAs by Sanger sequencing that we detected by Oxford Nanopore. This approach will help to show the robustness of our workflow. We now selected randomly 5 circRNAs that were detected by Nanopore. The circRNAs were amplified by PCR and Sanger sequencing was performed. With this approach we could confirm all of the selected circRNAs as indicated by the detected back-splice junction in one of the anaplastic large-cell lymphoma cell lines that we sequenced by Nanopore. This information is now added as Figure 5 and supplementary figure S1 in the manuscript. Text was added to the manuscript in lines 124-140 , 217-234 .Reviewer #2: Fuchs et al. present a comprehensive protocol based on the published Full-length sequencing protocol by Zhang et al. The adapted approach differs in several aspects, such as the optimization of different circRNA lengths and addition of cleanup procedures as well as QC steps.1. The authors mention \u201cModification of the ribodepletion method\u201d as one of the parts changed in the adapted protocol. A short description on what the change is would be helpful in the abstract part of the protocol.Response:We thank the reviewer for this comment. Indeed, the ribodepletion method is crucial for the enrichment of circRNAs for the generation of libraries, since their abundance is much lower than that of ribosomal RNA. In the basic protocol from Zhang et al. the authors propose the use of a commercial ribodepletion kit . This kit, like other newer kits e.g. from New England Biolabs , is based on the protocol of Adiconis et al.[1], which uses a pool of DNA oligonucleotides directed against human rRNAs followed by a digest of DNA:RNA hybrids by RNaseH. However, the exact composition of the commercial kits remains proprietary and the used sequences are not public. In our protocol, we use the method published by Baldwin et al. [2] that is an updated and more efficient version of the Adiconis method. We use this method routinely as well successfully for the creation of Illumina RNA-sequencing libraries. Key changes are an increased ratio of DNA oligonucleotides to RNA  and a higher incubation temperature of RNaseH (65\u00b0C in comparison to 45\u00b0C), which increases the activity and reduces the incubation time. We compared the commercial kit with the Adiconis and the Baldwin method. Adiconis and Baldwin\u2019s methods outperformed the kit, while Baldwin\u2019s method led to the most efficient ribodepletion. We added this information to the manuscript in line 110-112 (page 5) and in the protocol in the section \u201cSteps\u201d.2. The protocol suggests use of qRT-PCR for validation of circRNAs and linear RNAs. It might be helpful to include a link to tools that can easily generate circRNA-specific primer pairs, as standard tools usually do not easily work with circular RNAs.Response:We thank the reviewer for this helpful remark. Indeed, it is important to carefully design divergent primers to specifically amplify the backsplice-junction of a circRNA without amplifying the cognate linear RNA transcribed from the same gene. We added information in the protocol to section \u201c4) Quality control, Step 15 Validation of circRNA enrichment\u201d on how to design primers to specifically detect circRNAs and linked two tools for primer design: CircInteractome [3] and CircPrimer 2.0 [4].3. It would be helpful to directly state in the abstract on protocols.io the required amount of starting material, as this is crucial in cases where only little material is available.Response:We appreciate this useful remark of the reviewer and we agree that it is crucial to mention the amount of needed starting material to prepare the sequencing libraries, especially when it comes to patient samples, which might be limited. We tested different RNA quantities to enrich for circRNAs and found that 7 \u00b5g, as we wrote in the protocol, works best and further provides enough material to sequence the samples several times to create enough data. However, we also tried 3-5 \u00b5g as input, and we could observe no major change in the amount of obtained reads, especially when multiplexing several samples, which should still lead to sufficient pore occupancy while sequencing. We added this information to the abstract and the materials section of the protocol and further in the \u201cExpected results\u201d part of the manuscript, lines 238-242 (page 9).4. In general, the generated data are freely available, however, the GEO entry has an embargo date of March 2023, thus the data is not immediately available.Response:https://www.ncbi.nlm.nih.gov/geo/, dataset ID: GSE197872, temporary reviewer password: erkpwyakjfezzed.We thank the reviewer for this comment. The data was uploaded to the public repository NCBI GEO and is freely available, thus following the recommendations of PLOS ONE. However, we put an embargo on the dataset for the moment, to protect our data while the manuscript is still under revision. The data will be open as soon as the manuscript is accepted, which is in line with the NCBI GEO recommendations. We are happy to provide a temporary reviewer access to the data for the purpose of the review, which is as follows: NCBI GEO: New references added: 1. Adiconis X, Borges-Rivera D, Satija R, DeLuca DS, Busby MA, Berlin AM, et al. Comparative analysis of RNA sequencing methods for degraded or low-input samples. Nat Methods. 2013;10(7):623-9. doi: 10.1038/nmeth.2483. PubMed PMID: 23685885; PubMed Central PMCID: PMCPMC3821180.2. Baldwin A, Morris AR, Mukherjee N. An Easy, Cost-Effective, and Scalable Method to Deplete Human Ribosomal RNA for RNA-seq. Curr Protoc. 2021;1(6):e176. Epub 2021/06/25. doi: 10.1002/cpz1.176. PubMed PMID: 34165268.3. Dudekula DB, Panda AC, Grammatikakis I, De S, Abdelmohsen K, Gorospe M. CircInteractome: A web tool for exploring circular RNAs and their interacting proteins and microRNAs. RNA biology. 2016;13(1):34-42. doi: 10.1080/15476286.2015.1128065. PubMed PMID: 26669964; PubMed Central PMCID: PMCPMC4829301.4. Zhong S, Wang J, Zhang Q, Xu H, Feng J. CircPrimer: a software for annotating circRNAs and determining the specificity of circRNA primers. BMC bioinformatics. 2018;19(1):292. doi: 10.1186/s12859-018-2304-1. PubMed PMID: 30075703.AttachmentResponse to reviewers.pdfSubmitted filename: Click here for additional data file. 5 Aug 2022Generation of full-length circular RNA libraries for Oxford Nanopore long-read sequencingPONE-D-22-06858R1Dear Dr. Fuchs,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Eduardo Andr\u00e9s-Le\u00f3nAcademic EditorPLOS ONEAdditional Editor Comments :Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author </font> 1. Does the manuscript report a protocol which is of utility to the research community and adds value to the published literature?Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 2. Has the protocol been described in sufficient detail? </font> Descriptions of methods and reagents contained in the step-by-step protocol should be reported in sufficient detail for another researcher to reproduce all experiments and analyses. The protocol should describe the appropriate controls, sample sizes and replication needed to ensure that the data are robust and reproducible.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 3. Does the protocol describe a validated method? </font> The manuscript must demonstrate that the protocol achieves its intended purpose: either by containing appropriate validation data, or referencing at least one original research article in which the protocol was used to generate data.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 4. If the manuscript contains new data, have the authors made this data fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 5. Is the article presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please highlight any specific errors that need correcting in the box below. Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 6. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0The authors have adressed my comments. They have expanded on the protocol, added more information regarding the method and also bioinformatics. They also have performed RT-qPCR validation. Please accept with or without changes.Reviewer #2:\u00a0The authors addressed all of my points, I have no further questions. Congratulations on a very helpful protocol.********** <font color=\"black\"> 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Yes:\u00a0Kotb AbdelmohsenReviewer #1:\u00a0Reviewer #2:\u00a0No********** 26 Aug 2022PONE-D-22-06858R1 Generation of full-length circular RNA libraries for Oxford Nanopore long-read sequencing Dear Dr. Fuchs:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofDr. Eduardo Andr\u00e9s-Le\u00f3n Academic EditorPLOS ONE"}
+{"text": "As the amount of genomic data continues to grow, there is an increasing need for systematic ways to organize, explore, compare, analyze and share this data. Despite this, there is a lack of suitable platforms to meet this need.opengenomebrowser.github.io and a demo server is freely accessible at opengenomebrowser.bioinformatics.unibe.ch.OpenGenomeBrowser is a self-hostable, open-source platform to manage access to genomic data and drastically simplifying comparative genomics analyses. It enables users to interactively generate phylogenetic trees, compare gene loci, browse biochemical pathways, perform gene trait matching, create dot plots, execute BLAST searches, and access the data. It features a flexible user management system, and its modular folder structure enables the organization of genomic data and metadata, and to automate analyses. We tested OpenGenomeBrowser with bacterial, archaeal and yeast genomes. We provide a docker container to make installation and hosting simple. The source code, documentation, tutorials for OpenGenomeBrowser are available at To our knowledge, OpenGenomeBrowser is the first self-hostable, database-independent comparative genome browser. It drastically simplifies commonly used bioinformatics workflows and enables convenient as well as fast data exploration.The online version contains supplementary material available at 10.1186/s12864-022-09086-3. Driven by advances in sequencing technologies, many organizations and research groups have accumulated large amounts of genomic data. As sequencing projects progress, the organization of such genomic datasets becomes increasingly difficult. Systematic ways of storing data and metadata, tracking and denoting changes in assemblies or annotations, and enabling easy access are key challenges. While standardized data formats and free software are widely used in the field to process genomic data, data exploration is often still cumbersome. This is especially true for non-bioinformaticians, although numerous platforms have been developed to simplify data access.Pseudomonas spp. [Most of these platforms have different user interfaces and sometimes limited functionality. The reason for this heterogeneity is that most of them have been developed independently, i.e., each one for a specific genomic dataset. Such platforms exist for many well-studied organisms, such as nas spp. , but alsnas spp.  and corknas spp. . These pnas spp. ), and linas spp. , Microbenas spp. , WormBasnas spp. , Genomicnas spp. , MicroScnas spp.  and Chlanas spp. , includeHowever, these platforms tend to be tied to the characteristics of a specific dataset and adapting their software to other projects would be extremely difficult. This is surprising given that the underlying data are essentially the same: genome assemblies, genes, proteins, and their annotations. Fortunately, this information is stored in standardized data formats across many fields, which in principle would allow code reuse and collaborative development. Even while some degree of purpose-built software tools may still be necessary for certain projects, independent development comes at a significant initial cost as well as a long-term maintenance cost and a higher risk of becoming outdated.dataset-independent \u2013 i.e., not bound to any specific genomic dataset. A comparison of OpenGenomeBrowser and similar platforms is available in Table SWe addressed these issues by developing OpenGenomeBrowser, a self-hostable, open-source software based on the Python web framework Django . OpenGenfolder structure\u201d. The subsequent section \u201cOpenGenomeBrowser tools\u201d describes a set of scripts that simplify the handling of the aforementioned folder structure.To enable automated processing of genomic data, as in OpenGenomeBrowser, it is essential that the data is stored in a systematic fashion. We present our solution to this problem in detail in the section \u201cEvery sequencing project faces an important challenge: systematic storage of data and metadata according to the FAIR principles . These porganisms folder contains a directory for each biological entity, e.g., a bacterial strain. Each of these folders must contain a metadata file, organism.json  at the top right corner of the page.The following section describes the main features of OpenGenomeBrowser. The reader may try them out at genomes table view  and a description . The tag detail view . The gene loci comparison reveals that in all queried Lacticaseibacilli, the genes are located in syntenic regions, i.e., next to the same orthologous genes.The iew Fig.\u00a0 enables iew Fig.\u00a0B. Furtheiew Fig.\u00a0C. Figureannotation search view .Despite conceptually and technically straightforward, searching for annotations in a set of genomes can be tedious or even impossible for non-programmers. In OpenGenomeBrowser, annotation search is quick and easy, thanks to the PostgreSQL backend that allows fast processing of annotation information. In the iew Fig.\u00a0, users crix Fig. C with onrix Fig. D, while gene comparison view.Pathway maps, particularly the ones from the KEGG , are valWhile OpenGenomeBrowser does not include KEGG maps for licensing reasons, users with appropriate rights can generate them using a separate program . The patOpenGenomeBrowser allows users to perform a local alignment of protein and nucleotide sequences using BLAST . The resOpenGenomeBrowser computes three kinds of phylogenetic trees. The fastest type of tree is based on the NCBI taxonomy ID which is registered in the metadata. It is helpful to get a quick taxonomic overview, but it entirely depends on the accuracy of the metadata.The second type of tree is based on genome similarity. The assemblies of the selected genomes are compared to each other using GenDisCal-PaSiT6, a fast, hexanucleotide-frequency-based algorithm with similar accuracy as average nucleotide identity (ANI) based methods . This alThe third type of tree is based on the alignment of single-copy orthologous genes. This type of tree is calculated using the OrthoFinder  algorithDot library [Dot plot is a simple and established  method o library . The resgene trait matching view enables users to find annotations that correlate with a (binary) phenotypic trait. The input must consist of two non-intersecting sets of organisms that differ in a trait. OpenGenomeBrowser applies a Fisher\u2019s exact test for each orthologous gene and corrects for multiple testing  using the Benjamini-Hochberg method [compare genes view.The g method , 39. Theflower plot view provides the users with a simple overview of the shared genomic content of multiple genomes. The genomes are displayed as petals of a flower. Each petal indicates the number of annotations that are unique to this genome and the number of genes that are shared by some but not all others. The number of genes shared by all genomes is indicated in the center of the flower. .downloader view facilitates the convenient download of multiple raw data files, for example all protein FASTA files for a set of organisms.The OpenGenomeBrowser has a powerful user authentication system and admin interface, inherited from the Django framework. Instances of OpenGenomeBrowser can be configured to require a login or to allow basic access to anonymous users. Users can be given specific permissions, for example to create other user accounts, to edit metadata of organisms, genomes, and tags, and even to upload new genomes through the browser.OpenGenomeBrowser is not resource intensive. An instance containing over 1400 bacterial genomes runs on a computer with 8 CPU-cores (2.4\u2009GHz) and 20\u2009GB of RAM. The Docker container is about 3\u2009GB in size and the Postgres database takes 21\u2009GB of storage (SSD recommended).OpenGenomeBrowser is, to our knowledge, the first comparative genome browser that is not tied to a specific dataset. It automates commonly used bioinformatics workflows, enabling convenient and fast data exploration, particularly for non-bioinformaticians, in an intuitive and user-friendly way.The software has minimal hardware requirements and is easy to install, host, and update. OpenGenomeBrowser\u2019s folder structure enforces systematic yet flexible storage of genomic data, including associated metadata. This folder structure (i) enables automation of analyses, (ii) guides users to maintain their data in a coherent and structured way, and (iii) provides version tracking, a precondition for reproducible research.OpenGenomeBrowser is flexible and scalable. It can run on a local machine or on a public server, access may be open for anyone or restricted to authenticated users. Annotation types can be customized, and ortholog-based features are optional. While the demo server only holds 70 genomes, the performance scales and is still outstanding even when hosting over 1400 microbial genomes .We believe that our software will be useful to a large community since sequencing microbial and other genomes has become a commodity. Therefore, researchers performing new sequencing projects can directly benefit from OpenGenomeBrowser by saving development costs, making their data potentially FAIR, and adapting the browser for their purposes. It could also replace older, custom-made platforms which may be outdated and more difficult to maintain. Because our software is open-source, adaptations of OpenGenomeBrowser and new features will be available for the whole community under the same conditions. The open-source model also allows problems to be identified and quickly fixed by the community, making OpenGenomeBrowser a sustainable platform.Additional file 1: Table S1. Comparison of OpenGenomeBrowser\u2019s features with alternative software platforms. Legend: \u2714: feature present; \u00a2: feature present, but with limitations; \u00d1: feature absent. Features were inferred to the best of our knowledge.Additional file 2: Fig. S1. Detail views. (A) Genome detail view: Shows genome-associated metadata. (B) Gene detail view: Displays a gene\u2019s annotations, nucleotide- and protein sequence, metadata extracted from the GenBank file, as well as an interactive plot that shows the adjacent genes. (C) Tag detail view: Shows the tag\u2019s name, its description and the organisms and genomes that have it. (D) TaxId detail view: Shows the NCBI TaxId, its taxonomic rank, its parent TaxId and the organisms and their genomes that belong to it."}
+{"text": "Coronavirus disease 2019 (COVID-19) spread worldwide and presented a significant threat to people's health. Inappropriate disease assessment and treatment strategies bring a heavy burden on healthcare systems. Our study aimed to construct predictive models to assess patients with COVID-19 who may have poor prognoses early and accurately. This research performed a retrospective analysis on two cohorts of patients with COVID-19. Data from the Barcelona cohort were used as the training set, and data from the Rotterdam cohort were used as the validation set. Cox regression, logistic regression, and different machine learning methods including random forest (RF), support vector machine (SVM), and decision tree (DT) were performed to construct COVID-19 death prognostic models. Based on multiple clinical characteristics and blood inflammatory cytokines during the first day of hospitalization for the 138 patients with COVID-19, we constructed various models to predict the in-hospital mortality of patients with COVID-19. All the models showed outstanding performance in identifying high-risk patients with COVID-19. The accuracy of the logistic regression, RF, and DT models is 86.96, 80.43, and 85.51%, respectively. Advanced age and the abnormal expression of some inflammatory cytokines including IFN-\u03b1, IL-8, and IL-6 have been proven to be closely associated with the prognosis of patients with COVID-19. The models we developed can assist doctors in developing appropriate COVID-19 treatment strategies, including allocating limited medical resources more rationally and early intervention in high-risk groups. Syndrome coronavirus-2 (SARS-CoV-2) is the causative agent of coronavirus disease 2019 (COVID-19), which infected more than 180 million people. Compared with a similar acute respiratory syndrome caused by the severe acute respiratory syndrome coronavirus, COVID-19 seems milder but more infectious . Due to via complex networks and serve as biomarkers for many diseases  algorithms have been widely applied in the medical field, including diagnosing and predicting prognosis. ML models are also used in every aspect of the diagnosis and treatment of COVID-19 due to their fantastic data processing capabilities. Previous ML studies have used multiple indicators, including clinical and blood text indicators, to determine the prognosis of patients with COVID-19. Due to cytokine tests' simplicity, high efficiency, and accuracy, they gradually became an alternative plan for the early prediction of COVID-19 prognosis. Abers et al.  fit a Con = 50 and Barcelona cohort n = 88). Clinical parameters and laboratory data for each patient during the first 24 h of hospitalization were included in the dataset. Final clinical outcomes were classified into discharge from the hospital and in-hospital death. All inpatients in the study cohort were older than 18 and SARS-CoV-2 positive diagnosed by reverse transcription-polymerase chain reaction (RT-PCR) test and were sampled at hospital entry. Dataset included cytokines measured through the ELLA Simple Plex system and ELISA kits. The COVID-19 antibody concentration in serum was measured through ELISA, and other clinical indicators were obtained by routine tests. Data acquisition is presented in the study by Mueller et al. . R packages \u201cvegan\u201d and \u201cstats\u201d were applied to perform the principal component analysis (PCA) and draw the PCA figure. Besides, we used \u201cggplot2\u201d for the figure drawing.p < 0.1 in the single logistic regression were filtered for the following research. We applied multiple logistic regression (backward: likelihood ratio method) multivariate analysis for the hub variables, and the coefficients derived were used to generate a prognostic model. A prognostic model was constructed based on the logistic regression coefficients. For verification, we generated ROC and calibration curves to calculate the model results for the training set and validation set. The area under the curve (AUC) and 95% confidence interval (CI) were used to verify the model efficiency. Moreover, to obtain a more comprehensive evaluation of the application value of the signature, decision curve analysis (DCA) was performed, demonstrating the net benefit to the patients with COVID-19 after applying the model for prognosis. These steps above were finished using SPSS (version 26.0) and Stata software (version 16). The Cox regression was performed using STATA (version 16), too. The Cox prognostic model was based on the Cox regression coefficients. The ROC and DCA were both drawn to evaluate the model.Our research selected the following five algorithms: Cox regression, logistic regression, RF, support vector machine (SVM), and decision tree (DT). COVID-19 cases located in different areas were conducted to verify the accuracy of each model to ensure the model's reliability. In the logistic regression model, we input all the inflammatory cytokine values, age, and sex into the logistic regression in the training set. Then, the variables with In supervised ML, we evaluated the residuals of both methods for the model's accuracy and compared the residuals in our research. After confirming that the RF model is a better method with fewer residuals, we created an RF model to obtain the variables' significance. Artificial neural network (ANN) model training was performed, and the ROCs were used to verify the model efficiency. What is more, we constructed a DT based on all inflammatory cytokines, sex, and age through the R package \u201crpart\u201d and calculated the accuracy of the DT in the training set and validation set. The RF model was constructed using R packages \u201crandomForest\u201d and \u201cneuralnet.\u201d DT was finished through R package \u201crpart.\u201d Additionally, the R package \u201cpROC\u201d was applied to perform ROC.A flowchart is shown in the There are 138 patients with COVID-19 participating in our study cohort. There were 27 (19.6%) deceased cases, containing 18 (13.0%) dead cases in the Barcelona cohort and 9 (7.0%) dead cases in the Rotterdam cohort. In We compared the patients with COVID-19 with different outcomes. There existed a significant difference between survival and death cases in age, some antibodies, and cytokines, indicating that these characteristics might play a key role in promoting death .p < 0.1 might play a vital role in the COVID-19 patients' classification  were entered into the RF classifier. We set the optimal parameter mtry to 2 as a default setting. The optimal number of trees in the classifier was set as 500, maintaining a low error for the classifier . We usedThe PCA of hub cytokines from RF and age shows that patients with COVID-19 with different outcomes are separate in both training and validation sets, revealing that the model possesses good discrimination . In the To simplify the model and improve the feasibility of models for clinical application, we performed DT for all the variables previously mentioned. DT showed the interrelationship among the selected variables screened by the DT algorithm. The DT became the most straightforward tree when the complexity parameter (CP) was 0.1944444 . The firWe listed the results of the three models' performance in overall patients with COVID-19 in our cohort . According to This research found that old age and several inflammatory cytokines played a crucial role in promoting severe COVID-19. We constructed multiple predictive prognostic models based on these factors to identify patients with COVID-19 at high risk of death at hospital entry. The models were validated using external datasets, and all models' performance is satisfactory. What we did may provide a novel insight into evaluating COVID-19 patients' conditions.SARS-CoV-2, caused by COVID-19, spread worldwide at an unpredicted speed and brought profound and unfolding impacts on every aspect of human life. Previous studies revealed that patients with COVID-19 expressed huge heterogeneous characteristics, ranging from asymptomatic to losing lives , 15. COVIn the research, we filtered out some prominent inflammatory cytokines in predicting the prognosis of COVID-19. IFN-\u03b1 also has immunoregulatory effects, which might activate inflammatory responses and cause uncontrolled pathogenic damage  indicateDue to our work, we found that age was a key factor for all models and scored the highest in the RF model. There exist significant differences in age between survival and death cases. O'Driscoll et al.  declaredConsidering all models involved in this study comprehensively, the models developed with RF and logistic regression happened to be two well-rounded models, with considerable AUC in the training set and AUC = 0.783 in the validation set and high accuracy. However, the complexity of these models might bring some inconvenience in clinical applications. The model constructed by DT had good accuracy, specificity, and convenience. As for areas with underdeveloped medical conditions, it is an excellent choice to apply the DT model we constructed which was a simple model with good accuracy.Building COVID-19 prognostic models through blood inflammatory cytokines levels is a novel thought. Thus, our research suggests that more extensive cohort studies should be conducted to reveal the role of inflammatory cytokines in predicting long-term post-COVID-19 complications.In this research, we identified that advanced age, IFN-\u03b1, IL-8, and IL-6 have been identified as potential prognostic predictors of COVID-19 outcomes by multiple models in our research, which indicated that these cytokines might play a vital role in the progression of SARS-CoV-2. Therefore, we advised that accurate and quantitative detection of the inflammatory cytokines could be performed when necessary. The RF, logistic regression, and DT models based on blood inflammatory cytokines performed well in identifying patients with COVID-19 at risk of death. We strongly suggest that the models developed with RF and logistic regression should be applied in the regions with more abundant medical resources, and the model developed by DT could be used in the regions with less abundant medical. The models we developed can assist doctors in applying individual strategies to different risk cohorts to perform early intervention and treatment to benefit patients with COVID-19.sunshiren@medmail.com.cn.The data and codes we used in this passage could be obtained from the corresponding author with reasonable requests. Requests to access these datasets should be directed to SS, Ethical review and approval was not required for the study on human participants in accordance with the local legislation and institutional requirements. Written informed consent for participation was not required for this study in accordance with the national legislation and the institutional requirements.ZY and XL conducted the analysis and prepared an initial draft. JZ collected data. SS offered ideas for the project. All authors contributed to the article and approved the submitted version.This study was funded by the Special Scientific Research Project of Shanghai Medical Assistance Team from Air Force Military Medical University in 2022, 2022YH-1009.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "It is recommended to limit added sugars to below 10% of the daily energy intake, as excessive consumption has been associated with several chronic non-communicable diseases. This exploratory qualitative study used focus groups to investigate the knowledge and perception of Brazilian university students about added sugars concepts, consumption recommendations, and health effects. Focus groups were led by a moderator using a semi-structured discussion guide. The focus groups were recorded, transcribed verbatim, and subjected to thematic analysis. Five focus groups were conducted with a total of 32 participants . Participants could not distinguish added sugars from sugars naturally present in foods and were unaware of the health impacts associated with excessive added sugar consumption, except for the risk of diabetes. Although most participants reported limiting sugar consumption, they had no knowledge of official consumption recommendations. Given that current public policy agendas aim to reduce added sugar intake, there is a need to strengthen strategies for disseminating information on added sugar concepts, recommendations, health effects and how to identify them in the foods products. Sugars, chemically defined as monosaccharides and disaccharides, are included in the group of carbohydrates, together with starch and dietary fibers . Sugars There is no evidence indicating harmful health effects associated with the consumption of intrinsic sugars. In contrast, several studies have been demonstrating association of excessive added sugar consumption and development or worsening of non-communicable diseases, such as hypertension, cardiovascular diseases, and dental caries \u201310. In 2Despite such recommendations, global food supply data from 2000, 2006, and 2013 demonstrated that there has been an increase in sugar availability, mainly through sugary drinks. In addition, the Latin America region has the second highest consumption of sugary drinks per capita, with Brazil ranking among the top countries in sugary drink sales . In addiAlthough it is known that high consumption of added sugars is a worldwide problem and global recommendations for limiting added sugars have been in place since 2015, there is scarce scientific discussion on the topic. The few studies that have examined consumers' understanding and perceptions of added sugars demonstrated lack of understanding about sugar concepts, consumption, and recommendations \u201322. No sExploratory qualitative research can help to understand consumers' perceptions of issues related to sugar intake and thus guide the development of targeted strategies to limit added sugar consumption by specific populations. Considering the excessive intake of added sugars by the Brazilian population, particularly by young adults, and the lack of studies on the topic, this study aimed to investigate the knowledge and perceptions of university students about the concepts, consumption recommendations, and health effects of added sugars.This qualitative investigation used the focus group method to examine the perception of university students about added sugars attitudes. The study was conducted with a convenient sample of university students from a major university located in a South capital city in Brazil. The targeted university has more than 30,000 undergraduate and postgraduate students enrolled in more than 100 on-campus courses. Students are from all parts of Brazil with different socioeconomical status.Participants were recruited through printed and online posters containing information about the survey, an electronic address, and a QR code linked to an online questionnaire. The questionnaire was used to collect sociodemographic, anthropometric, and health data as well as information on time availability for participation in the study. A screening question about the use of food label was included. Only university students who reported paying attention to food labels were invited to participate. The printed posters were spread through the university campus close to areas with a high flow of students such as the library, the convention center, and the cafeterias. The online posters were published on the social medias of the research group. All students had equal access to the advertising materials, although the online posters were more likely to be viewed by health students than students from other schools.via e-mail and telephone to confirm their availability and schedule the face-to-face meeting. During recruitment, participants were asked to share recruitment information with friends and colleagues who met eligibility criteria without mentioning the content of the discussion, as a form of snowball sampling.The following eligibility criteria were used: (i) undergraduate and/or graduate university student aged 18 years and older, (ii) not enrolled in nutrition courses or holding a nutrition degree, (iii) not being part of the research study group, (iv) willingness to participate in the study and signing an informed consent form, and (v) completing the online recruitment form and appearing in person on the day of the focus group. Participants were contacted Focus groups were conducted in Portuguese between May and June 2019. Each focus group had a minimum of 4 and a maximum of 10 participants, and sessions lasted up to 75 min. The endpoint of data collection was defined as the point of idea saturation, when new thoughts were not emerged by the participants. Focus groups were facilitated by one investigator (TS) supported by a research assistant (IPS). The investigator explained the importance of all participants contributing to the discussion and emphasized that there were no correct answers. All discussions were audio-recorded.Focus groups were conducted using a semi-structured guide containing short open questions in an easy-to-understand language. Questions were designed to examine students' understanding of added sugar concepts, consumption recommendations, and health impacts. Some encouraging sentences (probes) were included between questions to stimulate discussion . Prior to focus groups, the discussion guide was tested for clarity of wording and meaning with experts and members of our research group.Speechnotes and imported into MAXQDA\u00ae for analysis. Thematic analysis was used for extraction of codes, categories, and central themes . All participants involved in this study gave written informed consent before participating. Consent was confirmed verbally before recording devices were turned on during focus groups.Eighty university students filled in the recruitment questionnaire. All of them were contacted at least twice by the researchers to schedule a suitable time for participating in the focus groups. From the 80 respondents contacted, 32 (40%) were available to attend an in-person meeting. The 32 students were spread into five focus groups according to their availability. Overall participants' mean age was 23 \u00b1 4.1 years, half of them were female and 75% were undergraduate students from different courses, such as health sciences, economics, engineering, and biology. Most participants (94%) did not report a diagnosis of chronic non-communicable diseases, and 22% reported dietary restrictions (mostly lactose intolerance). Thematic analysis of focus group transcriptions revealed four major themes: (i) characterization and differentiation of types and sources of sugars, (ii) confusion about the concept and metabolism of sugars and carbohydrates, (iii) unawareness of recommendations for sugar consumption, and (iv) negative health impacts of sugar consumption.The participants associated sugars mainly with sensory characteristics, such as sweetness and tastiness, and their role as energy sources. Many students reported not knowing how to distinguish \u201cnatural\u201d sugars from those added to foods and they also demonstrated difficulty in conceptualizing the different types of sugars. Students had different perceptions of sugar types and consumption sources. Packaged foods, particularly soft drinks, were cited as sources of sugars. Whereas some participants identified differences between sugars from a chemical point of view, others mentioned that there are differences between natural sugars and those present in packaged foods. Some participants had low or no knowledge about the differences between added and naturally occurring sugars.I know that some sugars have different names, so we often can't identify them. This kind of deceives the consumer, using large chemical names so we won't know what sugar is. I know these little tricks. \u201d\u201cAll focus groups discussed the different types of sugars found in foods. Some participants considered that fruit sugar is the best type of sugar. Honey was deemed to be as natural as fruit sugar. According to some participants, sugars differ in nutritional quality. Brown and organic sugar were reported as being nutritionally better than refined sugar, although price was cited as a major determinant of purchase intention. As the discussions progressed, students showed interest in reducing sugar consumption, particularly that of sugars added to homemade foods.I've tried several types of sugars to see what they're like. Price is also important; organic and brown sugar are much more expensive. I prefer brown sugar for its color. I read that the darker, the healthier. \u201d\u201cIn some focus groups, participants associated the concept of sugars with that of carbohydrates. Some seemed to be confused about this point, assuming that all carbohydrates are sugars. Others believed that sugars were correlated with carbohydrates but could not clarify the relationship between the two components.That's a doubt I have. Sometimes it's written [on food labels] sugars and carbohydrates. Yeah, but aren't carbohydrates sugars?\u2026 For me, carbohydrates are sugars. \u201d\u201cSome participants have also stated that sugars are metabolized differently in each organism, which is why they consider it difficult for some people to understand how much sugar they need to eat. Students believed that many people do not understand the relationship between consuming foods that contain carbohydrates and the provision of sugars to the body for energy supply.About this issue with carbohydrates\u2026 because people eat carbohydrates. For example, bread. People eat bread but they don't know that they're eating sugar. People eat pasta and they don't know that they're consuming sugar. So how many diabetics eat these foods unaware? \u201d\u201cMost of the participants reported that consuming less sugar is better for health. Some mentioned that they have been trying to reduce daily sugar consumption, especially from the addition of sugars in homemade foods. Despite this concern, participants could not specify the amount of sugars they considered suitable for consumption. When participants were asked about how much sugar can be consumed as part of a healthy diet, most of them remained silent or generally answered \u201cI do not know.\u201dI imagine that there is some recommendation for consumption [of sugars] but I have no idea how much it is .\u201d\u201cIn some focus groups, however, students cited values that were close to WHO thresholds. Some considered that sugar limits depend on the level of physical activity and/or individual energy expenditure. Only one student reported the WHO daily recommendation for sugar intake.I think it depends on a person's energy expenditure. If the person performs physical activity, they will need more carbohydrates, right? \u201d\u201cI have a mobile app that tells me my ideal sugar intake. It says 47 g, almost 50 g. But it's just an app; it's not a reliable source, right [laughs]? \u201d\u201cParticipants associated excessive sugar consumption with negative health effects, particularly the development of diabetes. Other chronic diseases, such as obesity, cancer, and atherosclerosis, were also mentioned, as well as dental and thyroid problems. In addition, the relationship between sugar consumption and anxiety, stress, and depression was something that has emerged in all focus groups. According to some participants, consumption of high-sugar foods is common under these situations and may momentarily relieve tension.I rarely eat refined sugar. But at the end of the semester, I usually have a sweet tooth\u2026 I feel more like eating sweets when I'm stressed. \u201d\u201cFinally, few participants reported their perception that sugar consumption may lead to addictive behaviors and because of that is a nutrient that should be eaten with attention.Especially in periods of high demand, I like to eat a lot of sugar; if not, it feels like my body can't relax. So, I think it's an addictive thing and it's hard to stop. \u201d\u201cThe results of the present study indicate that most participants could not distinguish intrinsic sugars from added sugars and deemed that the type of sugar (brown vs. refined) was more important than the fact of being added or intrinsic. Participants considered that sugar consumption can cause dependence and that excessive consumption is associated mainly with diabetes development and, less frequently, with other health problems such as obesity and tooth decay. In general, participants were unaware of sugar intake recommendations.In the present study, participants identified sugars as energy sources. Similar results were observed in a qualitative study conducted in Australia, in which participants reported that high consumption of sugary drinks was associated with trying to prevent an energy deficit . The AusParticipants reported that packaged foods, particularly soft drinks, contain high amounts of sugars. In a study in South Africa, consumers considered fruit-based soft drinks to be high in sugar but frequently consumed these products, mainly because of low prices, marketing strategies, and personal preferences . ParticiStudy participants cared about the type of sugars, as they valued brown, organic, and fruit sugars instead of refined sugar. This perception is consistent with the results of a study conducted with adult consumers in Switzerland, which showed that using the label \u201cfruit sugar\u201d instead of \u201csugar\u201d in packaged foods increased participants' perceived healthiness of the foods . RegardiIn the current study, participants demonstrated confusion or unawareness of the concepts of sugars, not being conscious about the types of sugars. This lack of information was also observed in a qualitative focus group study on the understanding of US consumers about sugar labeling. The US participants reported that the presence of added sugar labels indicated that food contained more sugar than usual, added by the manufacturer, making the product less desirable . A lack Many participants in the present study associated sugar consumption with pleasure or reward, often as compensation for hard work or physical exercise. Similarly, university students from the Emirates related added sugar consumption to emotional factors, stating that they consume more added sugars when feeling stressed . The perAlthough WHO recommendations for free sugar consumption were published in 2015, 4 years before our data collection, only one student was able to accurately report the official values, demonstrating that almost all participants had no knowledge of the topic. Similarly, in a study conducted in Taiwan with 122 mothers, 40% of participants with high education could not inform WHO sugar recommendations, even after receiving face-to-face and online training on the topic and the proportion reached 80% when considering those who received online training only .Some limitations of this study need to be considered. We conducted a voluntary survey and because of the topic of the survey it is possible that individuals with more health concerns have been volunteered. Nevertheless, during focus groups, participants seemed to be unaware or confused about sugar consumption recommendations and they have demonstrated mixed feelings about health concerns. Another limitation is that the results of this study are not representative of individuals in other contexts, with different socioeconomic status, or from other parts of the country. However, care was taken in ensuring heterogeneity among participants regarding sex, field of study, and age, excluding students from nutrition courses. Nevertheless, future studies with students from other universities or with young adults out of the university environment are needed to produce a broader perspective and representativeness of the findings to the whole age group. In addition, we recommend that future studies investigate the source of nutritional information that students use to make their foods choices and what are their perceptions about artificial sweeteners, the main sugar alternative. Finally, the findings of this study can be used for planning large scale surveys or interventions investigating the topic in a bigger sample, as well as to subsidize discussions around interventions aiming to lower the sugar intake in the Brazilian population.The current results demonstrate unawareness about the types of sugars and lack of knowledge about the recommendations for added sugar consumption among a sample of Brazilian university students. Some students considered carbohydrates to be synonyms for sugars or to have equal metabolic effects. Sugars were viewed as energy sources, deemed to be sweet and tasty, and considered more or less healthy depending on their sources.Unawareness of consumption recommendations and the harmful health effects resulted from excessive added sugar intake can be reasons why young adults have a high intake of added sugars. Broad approach for disseminating the risks of excessive sugar consumption and interventions aiming to lower the sugar intake by these populations are strongly recommended.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving human participants were reviewed and approved by the Human Research Ethics Committee (CEPSH) at the Federal University of Santa Catarina (Under No. 3.063.750). The patients/participants provided their written informed consent to participate in this study.IS and TS was responsible for conceptualization, methodology, formal analysis, investigation, writing\u2014original draft, and writing\u2014review and editing. VR was responsible for conceptualization, methodology, formal analysis discussing, writing\u2014original draft, and writing\u2014review and editing. GB and PU were responsible for conceptualization and writing\u2014review and editing. AF was responsible for conceptualization, methodology, formal analysis discussing, writing\u2014original draft, writing\u2014review and editing, and supervision. RP was responsible for conceptualization, methodology, writing\u2014original draft, writing\u2014review and editing, and supervision. All authors contributed to the article and approved the submitted version.This research was supported by the Brazilian Federal Agency for Support and Evaluation of Graduate Education (CAPES) through a Ph.D. Scholarship (Award No. 41/2018) for TS and by the Brazilian National Council for Scientific and Technological Development (CNPq) through a research productivity scholarship granted to RP (Award No. 305068/2018-0) and Scientific Initiation Scholarship (PIBIC) granted to IS. None of the sponsors influenced the study design, data collection or analysis, manuscript preparation or revision, or publication decisions.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Acinetobacter baumannii. Non-capsulated and avirulent bacteria can revert into a capsulated and virulent state upon scarless excision of an ISAba13 insertion sequence under stress conditions. Reversion events fully restore capsule production and in vivo virulence. This increases our knowledge about A. baumannii genome dynamics, and the regulation of capsule production, virulence and resistance.We identify a new mechanism mediating capsule production and virulence in the WHO and CDC priority ESKAPE pathogen  Acinetobacter baumannii is an opportunistic human pathogen and a constant growing threat because of its propensity to aquire multidrug resistance [A. baumannii overall virulence and its regulation [A. baumannii isolates. So far, at least 128 different K-locus types [A. baumannii which allows interconversion between virulent (VIR-O) and avirulent bacteria (AV-T) [sistance . For thisistance , ranked sistance  and CDC sistance , new antgulation , 6. Howeus types  have beea (AV-T) \u201312.A. baumannii, which modulates capsule formation by the insertion/excision of the insertion sequence (IS) element ISAba13. Our study therefore contributes to an increased knowledge about genome plasticity and virulence and resistance regulation in A. baumannii.Here, we identify a new mechanism that controls the virulence and resistance of Acinetobacter baumannii isolates derived from the modern and broadly used parental AB5075 reference strain [itrA::ISAba13, only stable translucent bacteria are observed. We sequenced and compared de novo assembled whole genomes for both strains (Supplementary Table.\u00a0Aba13 Insertion Sequence (IS) interrupting the itrA gene of the itrA::ISAba13 mutant  combined with capsule staining to directly visualize the exopolysaccharide capsule in the WT and ria Fig.\u00a0. To assebacteria , 16. Thipromoter   in the WT strain abolishes virulence and capsule formation whereas complementation or in situ reparation of itrA in the itrA::ISAba13 mutant restores the virulence phenotypes  while no opaque colony are detected for the non-reversible \u2206itrA deletion strain , showing that natural reversion events can occur, but at very low frequency in the tested conditions  and polymyxin B (Revertant PO-B) revertants confirm the excision of the ISAba13 element and that the WT coding sequence is completely restored in a scarless manner  in the siaA gene involved in capsule expression and endogenous LOS sialylation [A. baumannii, out of 246 complete chromosome sequences available to date in GenBank, partial or complete insertion sequence within K-loci is identified in 23 isolates (9.31%)  of all the published genomes of A. baumannii, and several other IS elements are commonly present as potential key contributors to the genome dynamics [The reversion mechanism described in our study differs from the previously identified transient phenotypic phase variation . The staredation . Therefolylation . Concerndynamics .A. baumannii isolate exchanged deserves a careful and in-depth monitoring at the genetic level, using whole genome sequencing, along with a constant tracking of bacterial stocks.Our study also highlights that every LS, Luria-Bertani formulation) from Duchefa Biochemie under agitation (166\u2009rcf) or on solid LB-agar plates (25\u2009ml) unless indicated otherwise. 30\u2009\u00b5g/ml of Apramycin sulfate salt (Sigma\u2013Aldrich) or 10% of crystalized sucrose (Duchefa Biochemie) were used for the selection/counter selection of recombinant/ transformant clones. Four consecutive passages (~64\u2009h) were done in liquid culture to assess the phenotypical stability of the itrA::ISAba13 isolate as described in Supplementary Fig.\u00a0t test with GraphPad Prism 9. All experiments were carried out in biological triplicates unless stated otherwise.Bacterial strains and plasmids used in this study are listed in Supplementary Table.\u00a0 plates 2\u2009ml unlesitrA::ISAba13 are two clonally isolated strains originating from the parental AB5075 reference strain [de novo assembled and compared. Genomic DNA was extracted using the QIAGEN Genomic-tip 100/G following the manufacturer\u2019s recommendations. The short reads from MiSeq (Illumina) were trimmed for quality (Q\u2009\u2264\u200920) and adaptor residues using Trimmomatic V0.36 [https://github.com/rrwick/Porechop) and BBDuk (https://sourceforge.net/projects/bbmap/) with default settings, respectively. The short reads were used to polish the long reads employing Ratatosk v0.7.0 [https://github.com/isovic/racon) and Medaka v1.0.3 (https://github.com/nanoporetech/medaka) and subsequently using the short reads in two rounds of Pilon [itrA::ISAba13 the mean coverage was 37x and 490x, respectively. The K-loci of the WT and itrA::ISAba13 were typed using Kaptive v0.7.3 , compared by pair-wise alignment in Geneious R9  [itrA in AB5075-VUB   and visuZealand)  v2.2.2. attTn7 site of AB5075-VUB were carried out following an adapted version of the previously published protocols [attTn7 site [strong (modified Ptac without lacO sites) and the RBS of the superfolder GFP (sfGFP) [sacB-aaC selection/counter-selection cassette flanked by 1\u20132\u2009kb homologous regions upstream and downstream of the targeted site was inserted at the locus of interest. The itrA coding sequence, the homologous regions flanking itrA and the attTn7 site were amplified by PCR from gDNA, the sfGFP coding sequence and Pstrong promoter from the pASG-1 plasmid and the sacB-aaC cassette from the pMHL2 plasmid. PCR were performed using PrimeStarMax; TaKaRa (high fidelity DNA polymerase) and the resulting products were checked on agarose gel (1%) and purified using the Wizard SV Gel and PCR Clean-Up System (Promega) following the manufacturer\u2019s recommendations. The final chimeric DNA fragments were generated using the NEBuilder HiFi DNA Assembly Master Mix to sew the independent fragments. First the fragment containing the sacB-aaC cassette was introduced at the targeted locus and the recombinant strain selected on Apramycin 30\u2009\u00b5g/ml, was then transformed with a chimeric product containing the final desired fragment without any marker and counter selected on LB without NaCl  \u2013 agar 10% sucrose and incubated 6\u2009h at 30\u2009\u00b0C.Plasmids and primers used to generate the strains used in this study are, respectively, listed in the Supplementary Table\u00a0rotocols  to obtaiTn7 site  and the  (sfGFP) . All con (sfGFP) . BrieflyLS agar plates containing a volume of 25\u2009ml of medium. After incubation (non-inverted) at 37\u2009\u00b0C for 24\u2009h, back light pictures of the petri dishes were taken with a Canon hand camera. Area of the macrocolonies were analyzed using ImageJ.The colony morphology was assessed by spotting 5\u2009\u00b5l of stationary phase bacteria from O/N culture on LB2O, Merk) was used to semi-quantify capsule production of the different strains. The gradient solution was autoclaved before use and stored at 4\u2009\u00b0C. 1\u2009ml of O/N culture was centrifuged for 5\u2009min at 5000 rcf. The pellet was suspended in 1\u2009ml of PBS. 750\u2009\u00b5l of PBS resuspended bacteria were mixed with 250\u2009\u00b5l of LUDOX colloidal silica. This mix was then centrifuged for 30\u2009min at 9000 rcf. Pictures were taken directly after the centrifugation using a Canon hand camera in front of black background.LUDOX Colloidal Silica (30 wt. % suspension in HBacteria were fixed and stained according to the previously published protocol . After t2O) solution and diluted to a concentration of 1.107\u2009CFU/ml. Before injection, the larvae were incubated for 30\u2009min at 4\u2009\u00b0C. 10\u2009\u00b5l of bacterial suspension in PS (1\u2009\u00d7\u2009105\u2009CFU/ml) were injected in the last left proleg of the larvae using a 0.3\u2009ml insulin syringes (BD MicroFine). 10 larvae were in inoculated per replicate. One control group was injected with PS as negative control and another group with the virulent AB5075-VUB WT as positive control of virulence. Survival was monitored every day over a 5 days period by checking the keratinization and mobility phenotypes. Infection experiments were done in biological duplicates, with a total of 20 larvae tested for each condition.Larvae were purchased from BioSystems Technology, TruLarv, stored at 15\u2009\u00b0C and used within the 5 days after arrival. Bacteria were washed twice in physiological saline . After 20\u2009s the excess of liquid was removed, and the plates were dried and incubated at 37\u2009\u00b0C for 6 days. The \u2206itrA strain was used as a negative control of non-reversible phenotype. The itrA::ISAba13/sacB-aaC and itrA::ISAba13/sfGFP strains were used as additional controls, each of them carrying genetic markers, to show the absence of contamination by the marker-less WT strain. The presence or absence of ISAba13 in the itrA coding sequence was verified by PCR using the IS13V2_fw and IS13V2_rev primers (see Supplementary Table.\u00a0Aba13 insertion in itrA was screened by PCR, then sequenced to verify the itrA coding sequence.To assess the Supplemental Material"}
+{"text": "Risk communication and the degree of trust are major factors that affect the public's behavioral coping strategies and play an important role in emergency risk management. However, the internal formation mechanism involved in the public's psychological behavior remains unclear. This study aimed to investigate the association among risk communication, trust, risk perception, negative emotions, and behavioral coping strategies during the coronavirus disease 2019 (COVID-19) pandemic, and to identify and quantify the factors that influence public behavior.We launched an online survey through social media from April to July 2020 in China. Relevant data were elicited using a self-designed questionnaire that mainly examined respondent characteristics, risk communication, trust, risk perception, negative emotions, protective coping behavior, and excessive coping behavior in the context of the COVID-19 pandemic. A total of 735 valid responses were obtained. A structural equation model was then used to explore relationship pathways among the components.p < 0.05) and trust , the lower the public risk perception. Risk communication and trust had a direct effect on public behavioral coping strategies during the COVID-19 pandemic. The higher the level of risk communication  or trust , the more likely it was that this would encourage the public to adopt protective coping behaviors, while the public was less likely to engage in excessive coping behaviors as the degree of trust increased . Risk perception influenced by poor risk communication and trust generated negative emotions , and such negative emotions further positively influenced public behavioral coping strategies .The higher the degree of risk communication (\u03b2 = \u22120.10, Risk communication, trust, risk perception, and negative emotions were significantly directly or indirectly related to public behavior. The findings provide useful information for emergency risk management and a theoretical basis for follow-up research on public coping behavior during the COVID-19 pandemic. Coronavirus disease 2019 (COVID-19), a fulminant infectious disease, has been sweeping the globe, causing extensive losses of life and generating significant worldwide concern (Public risk perception (RP) changes with time, which is an important consideration in public health emergencies and risk management decision-making , while iThe COVID-19 pandemic is deeply affecting all aspects of societies, this continuous long-term battle with the pandemic not only poses a huge burden on healthcare but also affects our daily life, social interactions, and work performance . COVID-1Trust is a key factor that encourages people to comply with public health regulations. One online survey indicated that higher trust in governmental organizations was linked to greater compliance in terms of adopting protective behaviors during the second wave of the Covid-19 outbreak . People Currently, as part of an overall consideration of risk control, governments from different nations facing the spread of the global COVID-19 pandemic are imposing strict and severe mitigation measures to influence people's behaviors . RP has The COVID-19 outbreak has brought increasingly psychological distress to the worldwide population , 35. SomOver recent decades, many behavioral risk management studies have focused on external influencing factors, such as RC, trust, and personal characteristics, but have not elucidated the internal mechanisms involved. Therefore, to further explore the internal formation mechanism involved in the public's psychological behavior during the COVID-19 pandemic, a relationship model comprising influencing factors such as public RP, NE, and behavioral coping strategies was constructed using a structural equation model (SEM) .Accordingly, we will assess the relationships among influencing factors such as RC, trust, public RP, NE, and behavioral coping strategies ; the mediating effect of NE on RP and behavioral coping strategies; and the effects of these influencing factors on public behavioral coping strategies when faced with COVID-19 from a psychological perspective , 21, 39.We launched an online survey through social media, including Tencent WeChat or QQ and Sina Weibo, that was available from April to July 2020 in China. A total of 781 questionnaires were distributed, and incomplete or erroneously completed questionnaires were excluded. Finally, 735 valid responses were obtained with an efficiency recovery rate of 94%.Data were elicited using a self-designed questionnaire in line with the relevant literature. The questionnaire consisted of three parts: (1) basic personal information of the respondents who participated in the survey, (2) each measurement scale, and (3) other items such as risk communication mediums. After the questionnaire was piloted, some questions were excluded.The study protocol was approved by the ethics review board of Gannan Medical University, and the study was conducted in accordance with the ethical guidelines of the Declaration of Helsinki and relevant policies in China. Informed consent forms obtained from the participants stated that the questionnaire was to be completed anonymously and that the information provided was confidential.totally disagree\u201d and 5 to \u201ctotally agree\u201d for the following three questions: (RC01) \u201cDo you think media reports affected your judgment of the COVID-19 pandemic?;\u201d (RC02) \u201cDo you believe media reports on COVID-19 are true?;\u201d and (RC03) \u201cDo you believe that government departments are timely and transparent in the release of pandemic information?\u201dRC, as a key link in the entire process of emergency response, is defined as the exchange of real-time information, advice, and opinions between experts and people facing threats to their health, economic, or social well-being . Social very distrusting\u201d and 5 to \u201cvery trusting\u201d for the following 4 questions: (DT01) \u201cCan the pandemic be effectively controlled?;\u201d (DT02) \u201cWhat is your DT in the pandemic control ability of medical workers?;\u201d (DT03) \u201cWhat is your DT in your self-protection capabilities?;\u201d and (DT04) \u201cWhat is your DT in the government's ability to prevent and control the pandemic?\u201dTrust involves an overall positive expectation concerning the worthiness of words, promises, and statements of either another person  or an institution . Based on previous literature , 44, we totally controllable\u201d to 5 \u201ctotally uncontrollable\u201d).Owing to different risk scenarios and research methods, the RP dimension has not been consistently defined; however, the controllability of risk is the most representative dimension employed in different fields, for example, the field of natural disasters and food safety . Slovic never\u201d to 5 \u201calways\u201d) in relation to the following questions: \u201cWhat was your worry (NE01), fear (NE02), and anxiety (NE03) frequency during the COVID-19 pandemic?\u201dNE were assessed using a 5-point Likert scale  in relation to the following questions: (PCB01) \u201cDid you reduce contact with others during the pandemic?;\u201d (PCB02) \u201cDid you always wear a mask when you went out during the pandemic?;\u201d (PCB03) \u201cDid you try to avoid going to crowded places for activities during the pandemic?;\u201d (PCB04) \u201cDid you increase the amount of handwashing during the pandemic?;\u201d (PCB05) \u201cDid you open windows more often for ventilation during the pandemic?;\u201d (PCB06) \u201cDid you reduce the number of dinner parties held during the pandemic?;\u201d (PCB07) \u201cDid you increase exercise during the pandemic?;\u201d (PCB08) \u201cWere you more proactive in paying attention to and seeking health information during the pandemic?;\u201d (PCB09) \u201cDid you remind your family or friends to take measures to prevent and treat infection due to COVID-19 during the pandemic?;\u201d and (PCB10) \u201cDid you try to avoid contact with wild animals during the epidemic?\u201dPCB was measured using a 5-point Likert scale  \u201cDid you panic buy during the pandemic? If yes, please indicate whether any of the following items were involved: personal protective equipment, disinfectant, antiviral drugs, other directly pandemic-related purchases, or none of these;\u201d (ECB02) \u201cDid you hoard during the pandemic? If yes, please indicate whether any of the following items were involved: personal protective equipment, disinfectant, antiviral drugs, other directly pandemic-related purchases, or none of these;\u201d (ECB03) \u201cWere you influenced by a bandwagon effect led by rumor (herding behavior)? If yes, please indicate whether any of the following was involved: taking Shuanghuanglian (a drug with no preventive effect) to prevent COVID-19, sterilizing with white vinegar, taking other antiviral drugs while not been infected, other similar behavior, or none of these.\u201d One point was assigned for each type of behavior, with points ranging from 0\u20134 points for each item.p < 0.05.For statistical analysis, descriptive measures were performed using IBM SPSS  software to summarize the principal results. Confirmatory factor analysis (CFA), assessment of normality, and SEM analyses were performed using SPSS AMOS  software. Statistical significance was set at 2/df, confirmatory factor index (CFI), expected cross validation index (ECVI), incremental fit index (IFI), normed fit index (NFI), parsimony comparative fit index (PCFI), root mean squared error of approximation (RMSEA) were adopted to determine whether the models fit the data .Compared with other methods [e.g., traditional multivariate statistical analysis , artificThe characteristics of the respondents are set out in A wide range of sources of information and knowledge about COVID-19 was identified, mainly comprising the Internet in terms of news websites and forums (80.3%), followed by television news and newspapers (68.4%), health educators in hospitals or communities (43.3%), family or friends (36.9%), official agencies such as health administration departments and Centers for Disease Control and Prevention (26.1%), and others (5.0%). COVID-19 pandemic information media comprised official media, such as government documents and press conferences (70.7%); social networks, for example, Sina Weibo, Tencent WeChat, or QQ (69.4%); traditional media such as radio, television, and newspapers (55.8%); search engines, such as Baidu and Google (51.2%); and others (8.2%).We tested the affiliation between the measurement and latent variables using CFA. Some items were removed because of low loading values or cross loadings. Specifically, the items RC01, PCB07, PCB01, and ECB03 with standardized factor loadings <0.6 were deleted step-by-step. Items PCB03, PCB10, and PCB08 were deleted when a strong and significant correlation was found between sets of variables  in terms of the latent variable PCB based on modification indices. The items in the final model are shown in The model fit of \u03c72/df = 2.427 \u2264 3, RMSEA = 0.044 \u2264 0.05, estimated after CFA, showed that the scale had adequate structural validity. The AVE values of each latent variable were all >0.5 , with CR2/df = 2.408, RMSEA = 0.044). Path H7 (RC-ECB) was deleted because the path coefficient was significantly small . The final SEM is shown in To test our hypothesis, we constructed a structural equation model  with RC p < 0.05) or DT , the lower the public RP; (2) RC and DT had a direct effect on public behavioral coping strategies during the COVID-19 pandemic. The higher the level of RC  or DT , the more likely it was that the public were encouraged to adopt PCB, whereas the public were less likely to engage in ECB as DT increased during the COVID-19 pandemic . (3) RC and DT had an indirect effect on public behavioral coping strategies during the COVID-19 pandemic, and psychological factors may be an intermediary variable in relation to behavioral coping strategies stimulated by RC and DT. Specifically, RP as influenced by RC and DT could positively generate NE , which would further positively influence public behavioral coping strategies . It was clear that NE had a stronger direct effect on ECB.After verifying and correcting the model, the paths were tested. Overall, our results  were conThe results showed that the nine direct paths of the model hypothesis, except for the path between RC and ECB, reached significance. The results of the model analysis are discussed below according to the standardized path coefficients and load coefficients of each component.Government regulation of the public's RP based on the current pandemic situation is a key part of emergency risk management. Our results showed that RC and DT had a direct negative effect on RP, indicating that those responsible for risk management need to use relevant media to convey appropriate guidance to inform public opinion; promote RC; and strengthen the public's DT in self-protection, medical workers, and the government, thereby more effectively regulating the public's RP. The spread of pandemic information can significantly affect the public's RP, and the media largely construct the public's perception of risk. In the early stages of prevention and control of the pandemic, people used various media to obtain relevant information and to understand the development of the pandemic and how society in general was responding. The results showed that the largest source of public information or knowledge about COVID-19 was the Internet (80.3%), which may be partly related to the increase in internet use during the pandemic. Research has shown that 46.8% of 6,416 Chinese people increased their dependence on the Internet and 16.6% had longer hours of internet use during the COVID-19 pandemic . HoweverFaced with a pandemic, PCB will substantially influence the effectiveness of risk control measures performed by the government , 20; thuThe results showed that DT in self-protection capabilities, medical workers, and the government's ability in relation to effective control of the pandemic had a direct positive effect on PCB and a negative effect on ECB, suggesting that building social trust is a key measure for promoting effective public awareness in terms of epidemic prevention.Public behavior was also driven by intrinsic psychological factors . An onliIn conclusion, our hypothesis was verified. We used an SEM to evaluate the internal potential relationships between influencing factors and coping behaviors of the public facing COVID-19 risk. Compared with conventional statistical methods, the analysis results of the SEM were likely to be more comprehensive as the theoretical model constructed in this study had an excellent fit, as indicated by the various fit indices. The results showed that RC, DT, RP, and NE were significantly directly or indirectly related to public behavior. The reported findings provide useful information for emergency risk management and a theoretical basis for follow-up research on public coping behavior during a pandemic. Furthermore, the research results on the relevant formation mechanisms involved and the relationship between factors and behaviors are likely to be useful in guiding subsequent research.However, this study had several limitations. First, due to the pandemic, the questionnaire was applied using convenience sampling on the Internet so that only certain types of respondents may have become involved. Specifically, the respondents were all internet users, were often relatively young, and could not be considered representative of the entire population. However, considering the high internet penetration rate in China 71.6%) and that the proportion of mobile internet users was reported to be 99.6% (as of June 2021) , we cons% and thaThe original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author/s.The studies involving human participants were reviewed and approved by Gannan Medical University. Written informed consent to participate in this study was provided by the participants' legal guardian/next of kin.JG and RH conceived this study and designed the questionnaire. JG performed data analysis, interpreted the results, and wrote the paper. RH, XW, JT, and WY collected the relevant data. CW contributed to the interpretation and revision of the paper. All authors have read and approved the final manuscript.This work was supported by Humanities and Social Sciences Project of Jiangxi Colleges and Universities (No. JC21204) and the Social Science project of Ganzhou (No. 2021-018-0008).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Temporary arterial occlusion (TAO) is a widespread practice in the surgical treatment of intracranial aneurysms. This study aimed to investigate TAO\u2019s role during ruptured aneurysm clipping as an independent prognostic factor on short- and long-term outcomes.This prospective cohort included 180 patients with ruptured intracranial aneurysms and an indication of microsurgical treatment. Patients who died in the first 12 hours after admission were excluded.TAO was associated with intraoperative rupture (IOR)  and surgical complications . The group with TAO and IOR had no significant difference in clinical (p = 0.06) and surgical (p = 0.94) complications compared to the group that had TAO, but no IOR. Among the 111 patients followed six months after treatment, IOR, number of occlusions, and total time of occlusion were not associated with Glasgow Outcome Scale (GOS) in the follow-up . Among patients who underwent TAO, IOR was also not associated with GOS in the follow-up (p = 0.29).TAO was associated with IOR and surgical complications, being the latter independent of IOR occurrence. In long-term analysis, neither TAO nor IOR were associated with poor clinical outcomes. The surgical treatment indication relies on the patient\u2019s age and neurologic status, aneurysm location, quality of the angiographic image, and need for vascularization with bypass,\u2013\u2013Although being a widespread technique, TAO is associated with perioperative stroke in ruptured aneurysm cases, which is more likely to occur in patients with older age, Hunt-and-Hess grade IV and V, early surgery, and single prolonged clip placementDespite the relevance of TAO for IA surgery, most studies about the complications and the prognostic value of this technique are limited to the assessment of clinical and radiological evidence of perioperative stroke. Therefore, this study aimed to investigate the prognostic value of TAO in ruptured aneurysm surgery on short- and long-term outcomes.This prospective cohort study was conducted at the Central Institute of Hospital das Cl\u00ednicas of Medical School at Universidade de S\u00e3o Paulo. The study was approved by the local ethics committee and conducted in accordance with relevant guidelines and regulations. All patients were fully informed about the study and provided informed consent, as approved by the local institutional review board.All patients admitted between January 2018 and May 2019 with subarachnoid hemorrhage were enrolled. The inclusion criteria were patients with the diagnosis of aneurysmal subarachnoid hemorrhage and indication of microsurgical treatment. Patients who died in the first 12 hours after admission, or had previous neurological disability were excluded.The clinical condition of patients with a ruptured aneurysm was assessed through Hunt-Hess Scale on admission. The clinical assessment also included comorbidities, history of smoking or alcohol abuse, previous SAH, and occurrence of surgical or clinical complications during hospitalization. Surgical data collected included: time from admission to surgery, presence of TAO, number of TAO in each case, total time of TAO, and occurrence of IOR. The radiological assessment included the modified Fisher (mFisher) on admission and the aneurysm location. The patients\u2019 outcomes were prospectively evaluated at discharge and at six months after surgery. The patients were followed for six months and evaluated using the Glasgow Outcome Scale (GOS).2 test. A two-tailed alpha level of 5% was adopted. The analyses were performed using the GraphPad Prism 8.0.0 software .Categorical data were described as frequencies, while continuous variables were described as mean (standard deviation) or median (interquartile distance), as appropriate under normal data analysis. To compare means of continuous variables, the T-Student or Mann-Whitney\u2019s test was used, as appropriate. Dichotomous variables were analyzed using the \u03c7The study included 180 patients. Sixty-nine (38.3%) patients lost follow-up and were excluded from the long-term analysis (n = 111). The short-term analysis included 131 females (72.7%) and 49 (27.2%) males, while the long-term analysis included 69 (62.1%) females and 42 (37.8%) males .The median age in the study population was 57.5 years old (range 21\u201388), while in the follow-up group it was 59 (range 21\u201386). Among the 111 patients followed, 60 (54%) had hypertension, 41 (36.9%) were smokers, 30 (27%) had diabetes mellitus, 17 (15.3%) had alcohol abuse history, and 12 (10.8%) had a previous SAH .Time between ictus and surgery was assessed in 172 (95.5%) cases. Fifty-two patients (30.2%) were treated on day 0 to 2, 28 (16.2%) on days 3 and 4, 55 (31.9%) on day 5 to 10, and 37 (21.5%) on day 11 or later.Hunt and Hess (HH) score was evaluated in all ruptured cases (n = 180). Among the ruptured cases that underwent TAO (n = 38), 20 (52.6%) had HH < 2, and 18 (47.3%) had HH > 2. Among the patients with ruptured aneurysms who did not undergo TAO (n = 142), 96 (67.6%) had HH < 2, and 46 (32.4%) had HH > 2 .The modified Fisher scale (mFisher) was assessed in 178 (98.8%) ruptured cases. All ruptured cases that underwent TAO (n = 38) had mFisher grade assessed: patients with grades 0\u20132 accounted for seven (18.4%), patients with grade 3 accounted for 10 (26.3%), and patients with grade 4 accounted for 18 (55.2%). Concerning the patients who did not undergo TAO (n = 142), mFisher was assessed in 140 (98.5%) cases, resulting in 40 (28.1%) patients with grade 0\u20132, 40 (28.1%) patients with grade 3, and 60 (42.2%) with grade 4 .The most common aneurysm location was the middle cerebral artery , followed by the posterior communicating artery , anterior communicating artery , internal carotid artery , and others (n = 30). Among the patients who underwent TAO (n = 38), the most common aneurysm location was also MCA (n = 17), followed by ACoA (n = 11), PCoA (n = 4), ICA (n = 2) and others (n = 4). Aneurysm location was not associated with clinical complications (p = 0.98), surgical complications (p = 0.67), or GOS in the follow-up (p = 0.14). Regarding patients who had TAO, aneurysm location was also not associated with either of these variables .TAO was performed in 38 (21.1%) out of the 180 cases included. TAO was performed in 22 (57.8%) females and 16 (42.1%) males. Regarding the type of craniotomy, the Pterional was the most frequent one, accounting for 20 cases, followed by Minipterional (n = 6), Frontopterional (n = 5), Nanopterional (n = 3), Frontal (n = 3), Pre-temporal (n = 1) and others (n = 1).Twenty-eight (73.6%) patients had one temporary clip, seven had two (18.4%) temporary occlusions, and three (7.8%) had three or more. The total time of occlusion was assessed in 37 (97.3%) ruptured cases: 30 (78.9%) patients had TAO for \u2264 15 minutes, two (5.2%) for 15\u201320 minutes, and five (13.1%) for \u2265 20 minutes. Data on IOR was assessed in 37 (97.3%) cases and occurred in 15 (40.5%). The association between TAO and IOR was statistically significant .Among the 180 patients included, 56 (31.1%) had one or more surgical complications, and 125 (69.4%) had one or more clinical complications. The most frequent clinical complications were vasospasm, hydrocephalus, intracranial hypertension, brain swelling, urine infection, pneumonia, hemiparesis, and death. The most frequent surgical complications were ischemia, cerebral bleeding (not related to IOR), and vascular injury .In the group of patients with TAO (n = 38), clinical complications accounted for 31 (81.5%) cases, while surgical complications accounted for 18 (47.3%) cases. In the group without TAO (n = 142), clinical complications accounted for 94 (66.1%), while surgical complications accounted for 38 (26.7%).TAO was associated with surgical complications , but not with clinical complications (p = 0.1). The total time of occlusion was neither associated with surgical (p = 0.16) nor with clinical complications (p = 0.6), while the number of occlusions was associated with clinical complications (p = 0.04), but not with surgical complications (p = 0.09).The group with TAO and IOR (n = 15) had 10 (66.6%) cases of clinical complications and seven (46.6%) cases of surgical complications. On the other hand, the group with TAO without IOR (n = 22) included 20 (90.9%) cases of clinical complication and 10 (45.4%) cases of surgical complication . In the Among the 180 patients included in the short-term analysis, only 111 (61.6%) were followed six months later. Thirty-seven (33.3%) died after discharge (GOS 1), seven (6.3%) presented severe disability (GOS 3) and 49 (44.1%) had none or slightly significant disability (GOS 5). TAO was not associated with GOS in the follow-up (p = 0.84). IOR, number of occlusions, and total time of occlusion were also not associated with GOS in the follow-up .The HH score was associated with the GOS score in the follow-up . Each 1 point in HH was associated with OR = 0.7 for a worse outcome in the follow-up . The regression analysis demonstrated that IOR (in patients with TAO) is not associated with GOS in the follow-up (p = 0.29).\u2013In recent years, endovascular coiling has gained increased space as IA treatment. However microsurgical clipping remains an important and widely used method for this condition. One of the main uses of TAO is for the prevention and management of IOR. IOR is a common intraoperative complication, accounting for 3.2\u201350% of cases of aneurysms treated surgically and associated with poor outcomes,\u2013,,\u2013There is evidence that TAO may induce cerebral ischemia, which extension would mainly depend on the duration of occlusion, location of clip placement, and presence of collateral vesselsIn the current study, TAO had a significant association with IOR and surgical complications. Since TAO is usually required to manage IOR, patients who underwent TAO were expected to demonstrate intra- and post-operative complications secondary to IOR, and not to TAO per se. However, there was no significant difference in clinical or surgical complications between the groups that underwent TAO and had IOR and the groups that had TAO and no IOR.,Regarding the total duration of TAO, it was neither associated with short-term outcomes  nor long-term outcomes. Griessenauer et al.,,In this study, except for hydrocephalus cases, the group that had TAO presented higher rates of all clinical complications when compared to the group that did not have it. Previous investigations have suggested that the additional manipulation required for the temporary clip placement might be associated with vasospasm in patients with multiple and ruptured aneurysmsThis study has some limitations. First, most patients had temporary clips for less than 15 minutes, which is considered a safe time frame according to most authors. As a result, the absence of association between TAO duration and clinical outcomes may be related to the use of TAO for brief periods. Second, the loss of follow-up resulted in a 38.3% decrease in our initial sample size and, consequently, a decrease in the statistical power of our analysis. Finally, in tandem with other studies in the area, GOS was used to measure clinical outcomes in the follow-up; however, it is a limited tool to assess subtle changes in brain function.TAO was associated with surgical complications in patients with ruptured aneurysms, regardless of IOR occurrence. In the follow-up, neither TAO nor IOR was associated with GOS. Increased total time of occlusion and number of occlusions were not associated with poor outcomes after six months."}
+{"text": "Despite being twice as likely to get Alzheimer\u2019s disease (AD), African Americans have been grossly underrepresented in AD research. While emerging evidence indicates that African Americans with AD have lower cerebrospinal fluid (CSF) levels of Tau compared to Caucasians, other differences in AD CSF biomarkers have not been fully elucidated. Here, we performed unbiased proteomic profiling of CSF from African Americans and Caucasians with and without AD to identify both common and divergent AD CSF biomarkers.Multiplex tandem mass tag-based mass spectrometry (TMT-MS) quantified 1,840 proteins from 105 control and 98 AD patients of which 100 identified as Caucasian while 103 identified as African American. We used differential protein expression and co-expression approaches to assess how changes in the CSF proteome are related to race and AD. Co-expression network analysis organized the CSF proteome into 14 modules associated with brain cell-types and biological pathways. A targeted mass spectrometry method, selected reaction monitoring (SRM), with heavy labeled internal standards was used to measure a panel of CSF module proteins across a subset of African Americans and Caucasians with or without AD. A receiver operating characteristic (ROC) curve analysis assessed the performance of each protein biomarker in differentiating controls and AD by race.Consistent with previous findings, the increase of Tau levels in AD was greater in Caucasians than in African Americans by both immunoassay and TMT-MS measurements. CSF modules which included 14\u20133-3 proteins (YWHAZ and YWHAG) demonstrated equivalent disease-related elevations in both African Americans and Caucasians with AD, whereas other modules demonstrated more profound disease changes within race. Modules enriched with proteins involved with glycolysis and neuronal/cytoskeletal proteins, including Tau, were more increased in Caucasians than in African Americans with AD. In contrast, a module enriched with synaptic proteins including VGF, SCG2, and NPTX2 was significantly lower in African Americans than Caucasians with AD. Following SRM and ROC analysis, VGF, SCG2, and NPTX2 were significantly better at classifying African Americans than Caucasians with AD.Our findings provide insight into additional protein biomarkers and pathways reflecting underlying brain pathology that are shared or differ by race.The online version contains supplementary material available at 10.1186/s13024-023-00638-z. ABCA7 gene has stronger associations with AD risk in individuals with African ancestry than in individuals with European ancestry [ABCA7 also has a stronger effect size in African Americans than even the strongest genetic risk factor gene for AD, the APOE epsilon 4 allele (APOE \u03b54) [APOE \u03b54 allele being more prevalent amongst African Americans, APOE \u03b54 confers a lower risk for AD compared to Caucasians [African Americans are almost twice as likely to have Alzheimer\u2019s disease (AD) compared to Caucasians \u20133. Curreancestry , 7. ABCAAPOE \u03b54) . Yet, deucasians . Beyond ucasians . Furtherucasians . This hi1-42 (A\u03b242) and Tau, two core cerebrospinal fluid (CSF) protein biomarkers, comprise the major pathologic hallmarks of senile plaques and neurofibrillary tangles found in AD brain [42 and total Tau\u00a0(tTau) levels, established from predominantly Caucasian populations, are widely used as diagnostic measures for AD in the clinic [42 CSF ratio as an enrollment criterion [Amyloid-betaAD brain , 10. Thre clinic \u201315. Emere clinic , 17. Afre clinic , 17, whie clinic . Consistriterion , 20. It riterion , which sProteins are the ideal markers for understanding diseases such as AD because they are most proximal to the phenotypic changes. Unbiased proteomics of human brain coupled with network analysis has emerged as a valuable tool for organizing complex unbiased proteomic data into groups or \u201cmodules\u201d of co-expressed proteins that reflect various biological functions linked to AD \u201325. The In this study, we used a tandem mass tag mass spectrometry (TMT-MS) approach to generate a deep CSF proteome, without albumin depletion, from over 200 control and AD samples, with over half of the samples derived from African Americans. Over 1,800 CSF proteins were organized into 14 modules based on co-expression network analysis. These modules were associated with brain cell-types and biological pathways known to be altered in AD brain, including synaptic, immune and metabolic processes. Notably, Tau mapped to a module with a magnitude of increase greater in Caucasians than African Americans with AD. In addition, network analysis revealed a core class of CSF markers that demonstrated equivalent disease-related elevations in both African Americans and Caucasians with AD, whereas other modules demonstrated more profound disease changes within race. Namely, a module enriched with post-synaptic neuronal proteins was significantly lower in level in African Americans than Caucasians with AD. Using a targeted MS approach, selected reaction monitoring (SRM), we measured the neuronal proteins within this module including VGF, SCG2, and NPTX2 which were better classifiers for AD in African Americans than Caucasians. Overall, these results demonstrate the utility of a systems-based approach in the identification of CSF proteins that could serve as markers for AD across a more diverse population. Moreover, these data highlight a need for further investigations into how AD heterogeneity varies across different racial backgrounds.https://alz.washington.edu/BiospecimenTaskForce.html), and identical pre-analytic steps were followed in all groups. Measurements of Amyloid-beta1-42 (A\u03b242), total Tau (tTau), and phosphorylated Tau181 (pTau181) were performed on the Roche Diagnostics Elecsys platform [All CSF samples were collected as part of ongoing studies at Emory\u2019s Goizueta Alzheimer\u2019s Disease Research Center (ADRC) including participants in the ADRC Clinical Core, the Emory Healthy Brain Study, and the ADRC-affiliated Emory Cognitive Neurology Clinic. All participants provided informed consent under protocols approved by Emory University\u2019s Institutional Review Board. Clinical diagnosis of AD as well as classification as cognitively normal controls was based on review of clinical history, neurological examination, detailed cognitive testing, and diagnostic studies including magnetic resonance imaging and CSF AD biomarker testing. Diagnosis of AD was made by subspecialty certified Cognitive and Behavioral Neurologists with additional input from Neuropsychologists based on current National Institute on Aging and Alzheimer's Association (NIA-AA) criteria , 29. A cplatform \u201332 using2PO4, pH 8.5) and 3.5\u00a0\u03bcg of LysC (Wako), was added to each sample, resulting in a final urea concentration of 4\u00a0M. The samples were then mixed well, gently spun down, and incubated overnight at 25\u00a0\u00b0C for digestion with LysC. The following day, samples were diluted to 1\u00a0M urea with a blend of 468 \u03bcL of 50\u00a0mM ammonium bicarbonate [In order to sample the CSF protein in an unbiased manner, and given that we have previously shown that immunodepletion resulted in only a marginal improvement in proteomic coverage, the CSF samples were not immunodepleted prior to digestion , 33. Firarbonate  and 7\u00a0\u03bcgarbonate . To normarbonate , 100\u00a0\u03bcl arbonate . All indAll CSF samples were balanced for diagnosis, race, age, and sex (in that order) across 16 batches using ARTS (automated randomization of multiple traits for study design) . Using a4OH, 0.01125% (vol/vol) FA, and 90% (vol/vol) ACN. The sample elution was performed over a 25\u00a0min gradient with a flow rate of 0.6\u00a0mL/min with a gradient from 0 to 50% solvent B. A total of 96 individual equal volume fractions were collected across the gradient. Fractions were concatenated to 48 fractions and dried to completeness using vacuum centrifugation.Dried samples were re-suspended in high pH loading buffer  and loaded onto a Water\u2019s BEH column (2.1\u00a0mm\u2009\u00d7\u2009150\u00a0mm with 1.7\u00a0\u00b5m particles). A Vanquish UPLC system (ThermoFisher Scientific) was used to carry out the fractionation. Solvent A consisted of 0.0175% (vol/vol) NH4OH, 0.01125% (vol/vol) FA, and 2% (vol/vol) ACN; solvent B consisted of 0.0175% (vol/vol) NHAll samples (~\u20091\u00a0\u00b5g for each fraction) were loaded and eluted by an Easy-nLC 1200 (Thermo Scientific) with an in-house packed 15\u00a0cm, 150\u00a0\u03bcm i.d. capillary column with 1.7\u00a0\u03bcm CSH (Water\u2019s) over a 35\u00a0min gradient. Mass spectrometry was performed with a high-field asymmetric waveform ion mobility spectrometry (FAIMS) Pro front-end equipped Orbitrap Lumos (Thermo) in positive ion mode using data-dependent acquisition with 1\u00a0s top speed cycles for each FAIMS compensative voltage. Each cycle consisted of one full MS scan followed by as many MS/MS events that could fit within the given 1\u00a0s cycle time limit. MS scans were collected at a resolution of 120,000 . Only precursors with charge states between 2\u2009+\u2009and 5\u2009+\u2009were selected for MS/MS. All higher energy collision-induced dissociation (HCD) MS/MS spectra were acquired at a resolution of 50,000 . Dynamic exclusion was set to exclude previously sequenced peaks for 30\u00a0s within a 10-ppm isolation window.All raw files were analyzed using the Proteome Discoverer Suite . MS/MS spectra were searched against the UniProtKB human proteome database . The Sequest HT search engine was used to search the RAW files, with search parameters specified as follows: fully tryptic specificity, maximum of two missed cleavages, minimum peptide length of six, fixed modifications for TMTPro tags on lysine residues and peptide N-termini (+\u2009304. 304.2071\u00a0Da) and carbamidomethylation of cysteine residues (+\u200957.02146\u00a0Da), variable modifications for oxidation of methionine residues (+\u200915.99492\u00a0Da), serine, threonine and tyrosine phosphorylation (+\u200979.966\u00a0Da) and deamidation of asparagine and glutamine (+\u20090.984\u00a0Da), precursor mass tolerance of 10\u00a0ppm and a fragment mass tolerance of 0.05\u00a0Da. Percolator was used to filter peptide spectral matches and peptides to an FDR\u2009<\u20091%. Following spectral assignment, peptides were assembled into proteins and were further filtered based on the combined probabilities of their constituent peptides to a final FDR of 1%. Peptides were grouped into proteins following strict parsimony principles. A complete TMT reporter ion abundance-based table output of assembled protein abundances without adjustments can be found in Supplemental Table n\u2009=\u20091,840 proteins). Of the 1,840 proteins, 1,327 proteins were quantified across all samples. As previously reported [https://github.com/edammer/TAMPOR), an iterative median polish algorithm for removing technical variance across batch. Multidimensional scaling (MDS) plots were used to visualize batch contributions to variation before and after batch correction Noticeably, prior to batch correction, cases within the same batch clustered together and batches ran consecutively tended to cluster more closely together  to identify differentially expressed proteins across diagnosis and within each race. Differentially expressed proteins for comparisons of interest  were then presented as volcano plots using the pairwise.wilcox.test R function with Bonferroni correction, a pairwise Wilcox test was performed to calculate pairwise comparisons between each group with corrections for multiple testing.As previously published , 24\u201326, https://github.com/edammer/GOparallel). Significant ontologies for each module are included in Supplemental Table To characterize co-expressed protein module biology, gene ontology (GO) annotations were retrieved from the Bader Lab\u2019s monthly updated\u00a0.GMT formatted ontology lists downloaded July 5, 2022 . A Fishe2 transformed and true zero values were replaced after log2-transformation with the minimum value for that peptide minus 1  assays were performed on 195 of the 203 cases\u00a0to determine whether a separate targeted proteomic approach could replicate proteomic changes seen in TMT discovery proteomics. An attempt was made to include all 203 samples from discovery TMT for SRM analysis however, sample\u00a0GUIDs\u00a0 52524, 51520, 52055, 48617, 48769, 49537, and\u00a045707 had low remaining sample volume and had to be removed. Sample 62762 was later removed due to irregularities in retention time shifts. Peptide selection, sample preparation, peptide quantification, and data acquisition for the SRM assay was performed as previously described . Brieflyp\u2009=\u20090.8848, AD: p\u2009=\u20090.9998). As expected, AD cases had lower Montreal Cognitive Assessment (MoCA) scores than controls, but there were no statistically significant differences between MoCA scores across race within controls and AD . The AD cases also had lower Amyloid-beta1-42 (A\u03b242) levels and elevated total Tau (tTau) and phosphorylated Tau181 (pTau181) levels. Notably, A\u03b242 levels were significantly lower in African American controls compared to Caucasian controls (p\u2009=\u20090.0021) but not different between African American AD and Caucasian AD. This may indicate potentially early changes in brain amyloid deposition or processing of APP in African American controls versus Caucasian controls. Notably, the distribution of APOE4 carriers did not differ significantly by race in the control population and so does not account for the pattern observed  but not different between African American and Caucasian controls. Data on comorbid conditions, including whether or not the person had hypertension, diabetes, dyslipidemia, or cerebrovascular disease, is presented for all cases in Supplemental Table The main objective of this study was to perform an unbiased proteomic study of CSF to define biomarkers and pathways that are similar or divergent between African Americans and Caucasians with AD. Figure\u00a0r\u2009=\u20090.83, p\u2009=\u20094.7e-47). As expected, Tau levels were significantly elevated in both African Americans and Caucasians with AD across both platforms compared to controls  Fig.\u00a0A. In totols Fig.\u00a0B and C. ols Fig.\u00a0C. Thus, n\u2009=\u2009183 proteins) the number of decreased DEPs in AD (n\u2009=\u200974 proteins)  differentially expressed in both races. Furthermore, a correlation analysis of both shared and unique DEPs showed overall high agreement in direction of change  Fig.\u00a0A. In conns) Fig.\u00a0C, with tCo-expression network analysis of the AD brain proteome organizes proteins into modules related to molecular pathways, organelles, and cell types impacted by AD pathology \u201325. MoreProtein-based network analysis in AD brain tissue has shown that the cellular composition represents a major source of biological variance and that many of the network modules are enriched in proteins that are expressed by specific brain cell types , 25. To 42, tTau, and pTau181. The protein network resulted in three main groups/clusters based on module relatedness , and the hallmark AD biomarkers A\u03b2ess Fig.\u00a0B which sess Fig.\u00a0A, sugges42 ratio. With the exception of M11, these modules also exhibited positive correlations to APOE \u03b54 risk   was comprised of six modules  that were all increased in AD  and cognition, which in some cases were also influenced by race.The final group of modules Group 3) contained two modules, M1 \u201cPostsynaptic Membrane\u201d and M4 \u201cCell Morphogenesis\u201d, that showed strong correlations to both race and AD diagnosis  to assess technical reproducibility. Of the peptides targeted, 85\u00a0peptides (mapping to 58 proteins) had a coefficient of variation of\u2009<\u200920% in both the control and AD pools with no missing values  that reached significance and that mapped to proteins in CSF modules associated with race and/or AD. Consistent with the TMT-MS protein measurements, proteins measured by SRM within M7 (GAPDH and YWHAG) and M8 (YWAHB and PPIA) had strong elevations (p\u2009<\u20090.001) in abundance in AD in both races, whereas proteins in M12  had a greater magnitude of change in Caucasians than African Americans with AD , with heavy labeled internal standards to measure CSF proteins across 195 of the 203 cases included in the discovery TMT-MS assays  compared to African Americans AUC\u2009=\u20090.7618 . Similar findings were observed for another M12 protein, LDHB, as well as M6 proteins PKM and ALDOA. However, the M1 protein VGF was only nominally significant at classifying AD in Caucasian AUC\u2009=\u20090.6030 , yet highly significant in African Americans AUC\u2009=\u20090.7593 . Similar results were observed for other synaptic M1 proteins, NPTX2 and SCG2, whereas NPTXR showed only a modest improvement in the AUC between African Americans compared to Caucasians with AD  curve analysis was performed to assess the performance of each peptide biomarker in differentiating controls and AD by race Fig.\u00a0. We gene AD Fig.\u00a0. CollectHere we performed an unbiased quantitative analysis of the AD CSF proteome to identify protein biomarkers reflective of underlying brain physiology that are shared or unique across race. Using a network analysis, we organized the CSF proteome into 14 modules of highly correlated proteins. Notably, these modules were associated with cell-types and biological pathways in brain and largely overlapped with modules in a consensus human AD brain proteomic network . Consistn\u2009=\u200940) and mapped these proteins onto a human AD brain co-expression network, which revealed that approximately 70% of the CSF proteome overlapped with the brain network [In a previous study we performed unbiased TMT-MS from a small discovery cohort of control and AD CSF samples , tauopathy (T), and neurodegeneration (N) also termed the A/T/N framework . CSF rema priori performed on these study participants to confirm enrichment of African vis a vis European ancestry [Although a strength of our study was the large number of African Americans included there are several limitations that should be noted. First, we acknowledge that many of the protein changes we observe in the CSF across race could be due to ancestral or genetic differences , 56. Theancestry  as we stancestry \u201360. It iancestry , 62, whiancestry  is to inancestry , 5, thesancestry . TherefoWe developed a TMT-MS based quantification pipeline for proteomic analysis of human CSF in both Caucasians and African Americans with AD that led to additional insights into proteins and pathways reflecting underlying brain pathology that are shared or differ by race. Our findings also demonstrate the utility of a systems-based approach in the identification of CSF proteins that could serve as markers for AD across a more diverse population. Ultimately, these results highlight a need for further investigations into how AD heterogeneity varies across different racial backgrounds and affirm the urgency and importance of increased inclusion of under-represented groups to ensure the completeness and generalizability of research findings.Additional file 1:\u00a0Supplemental Table 1. Cohort characteristics (A\u03b242 levels that reached saturation (1700 pg / mL) were excluded from calculations and analysis). Supplemental Table 2. TMT batch arrangement. Supplemental Table 3. TMT output before adjustments. Supplemental Table 4. Post-regression protein table. Supplemental Table 5. TMT MS anova table. Supplemental Table 6. WGCNA KME table. Supplemental Table 7. Module go terms and P-values. Supplemental Table 8. Cell type marker list. Supplemental Table 9. SRM PEPTIDE coefficients of variation. Supplemental Table 10. SRM ratio abundances pre-regression. Supplemental Table 11. SRM ratio abundances post-regression. Supplemental Table 12. Correlation values between SRM AND TMT-MS. Supplemental Table 13. SRM culled list. Supplemental Table 14. SRM anova table. Supplemental Table 15. ROC-AUC analysis table.Additional file 2:\u00a0Supplemental Figure 1. Batch correction, outlier removal and bootstrap regression.\u00a0Multidimensional scaling (MDS) plots were used to illustrate batch contributions to variance before and after batch correction. In MDS plots, the distance a case is from one another is reflective of how similar or dissimilar a case is from the other. (A) Prior to batch correction, the samples clustered by batch (B) After batch correction, the samples no longer cluster by batch. (C)\u00a0 After batch correction, a principal component (PC)-based outlier removal method was utilized to detect outliers. By graphing the eigenvalue of each component against the PC number, the elbow or bend in the graph, which in this case was 7, was indicative of the ideal number of components to include within the parameters. (D) With a criterion for computing cutoff values set to 0.99, the cutoffs for the detection of outliers for the orthogonal distance and score were 16.79257 and 4.654674 respectively. This resulted in the detection of 15 outliers . B14.133N was such an extreme outlier because it was an empty channel. \u00a0(E) After outlier removal, the matrix underwent bootstrap regression to remove variations in the dataset that were due to age and sex. Variance partition plots were employed to illustrate the percent contribution of diagnosis, race, age, and sex to the variance of each protein. (F) Following bootstrap regression, variations explained by age and sex were removed.Additional file 3:\u00a0Supplemental Figure 2. (A)Protein module enrichment across the CSF and brain was assessed by matching gene symbols of proteins in each module from the CSF network against gene symbols for protein in each module from a human AD consensus brain network using a one-tailed Fisher\u2019s exact test. The degree of enrichment increases from pink to light purple to dark purple with asterisks denoting the following statistical significance (**p\u22640.01 and ***p\u2264.001). (B) Similar to CSF, cell-type enrichment was assessed by cross referencing brain module proteins against a list of proteins determined to be enriched in neurons, oligodendrocytes, astrocytes, and microglia using a one-tailed Fisher\u2019s exact test. The degree of cell-type enrichment increases from yellow to green-yellow to dark green with asterisks denoting the following statistical significance(**p\u22640.01 and ***p\u2264.001).Additional file 4:\u00a0Supplemental Figure 3. Additional CSF network protein modules. (A) Eigenprotein levels were distributed by race and diagnosis for remaining modules not shown in main Figure 4. This includes M5, M2, M10, and M13.Additional file 5:\u00a0Supplemental Figure 4. Stratification of SRM CSF protein measurements in by APOE genotype and comorbidity.\u00a0(A) Within each race, protein levels for were not affected by APOE \u03b54 genotype for YWHAB, GAPDH, SMOC1, PKM, VGF, PPIA, SPP1, LDHB, ALDOA, and NPTX2. (B) Within each race, protein levels for were not affected by patient co-morbidities  for YWHAB, GAPDH, SMOC1, PKM, VGF, PPIA, SPP1, LDHB, ALDOA, and NPTX2.\u00a0Only\u00a0cases with co-morbidities  were included in these\u00a0boxplots."}
+{"text": "Conventional progressive concentric strengthening exercise (CSE) to improve bone mineral density (BMD) and bone mineral content (BMC) may not be feasible for populations with chronic musculoskeletal and/or metabolic conditions, such as osteoporosis or obesity. Muscle lengthening exercise, also known as an eccentric strengthening exercise (ESE), may have a special utility for those populations due to greater force generation versus CSE. In fact, greater mechanical loading can be induced on bone at lower resistance levels with ESE. However, effects of ESE on BMD and BMC are unclear. Thus, the purpose of this review was to interrogate the effects of ESE on BMD and BMC.d was calculated to determine the magnitude of the effects of ERE on site-specific outcome measures of BMD and/or BMC.A literature review was conducted between January 1995 and April 2022 focusing on randomized controlled trials investigating the effects of ESE on BMD and/or BMC in humans. Terms covering the domains of exercise, bone, and populations were searched on PubMed, CINAHL, and Scopus. The methodological quality of each interventional study was rated using Physiotherapy Evidence Database (PEDro) scale. Cohen\u2019s n\u2009=\u20095, PEDro\u2009=\u20095\u20137) versus middle-aged  or older  adults. BMD and BMC generally improved due to ESE; however the effects of ESE on BMD and BMC were non-homogenous. Effect size (d) ranged from 0.10\u20130.87 in young adults while it was 1.16 in older adults. Effect size (d) could not be calculated for the middle-aged adult study due to critical methodological limitations of the intervention.Out of 1,182 articles initially found, a total of seven full length articles met our inclusion criteria. Of the seven studies, most of the interventions were performed in young (Large variability exists for the effectiveness of ESE on BMD/BMC across the human life spectrum. The benefits of ESE on BMD holds promise but rigorous studies are lacking. Further research is needed to examine if the dose, mode, age, and sex-specificity dictate effects of ESE on BMD/BMC. Mechanical loading on bone induced by strong muscle contractions generates potent osteogenic signals,  thus driCSE is based on the determination of one repetition maximum (1RM), which is the maximum load a muscle can lift concentrically, or during its shortening phase, which is typically an open kinetic chain exercise. Typically, CSE programs require participants to lift 70-85% of 1RM to achieve beneficial effects on BMD . AlthougMuscle lengthening exercise, also known as eccentric strengthening exercise (ESE), is another technique of exercise training where muscle lowers a load under resistance. An example of ESE is slowly lowering oneself from standing to sitting while wearing a weighted vest, which is an example of closed kinetic chain exercise. High stretch forces are created during ESE which can exert significant mechanical loading on the skeletal system, thereby providing an anabolic bone stimulus. This is corroborated by the fact that ESE increases BMC and BMD in young \u201321 and oThus, the purpose of our review was to methodically examine the available evidence on the effects of ESE on BMD and BMC in young, middle-aged, and older adults. We have reported our review based on articles found between the years 1995 - 2022. To our knowledge, there are no reviews on the effects of ESE on BMD and BMC in humans. Due to the very low number of intervention studies, lack of consistency with the ESE technique, and unique protocols employed in each intervention study, we could not perform meta-analyses. Our review provides the state of current evidence regarding the potency of ESE to increase BMD and BMC in humans while also providing recommendations for clinical practice and directions for future research in this area.A review of randomized clinical trials that included ESE intervention was performed.Our literature search included terms as shown in Fig. Studies selected for inclusion met the following criteria: 1) were randomized controlled trials, 2) were written in English and published between January 1995 and April 2022, 3) included an eccentric exercise intervention, 4) included outcome measures of BMD and/or BMC, and 5) included participants 18 years of age or older. Studies were excluded if they were not in English or employed combined interventions which were not uniquely eccentric exercise.n = 1,182) found from the aforementioned three databases and searched using a standardized form, created specifically to determine studies\u2019 relevance to this review. If the relevance of the article could not be obtained by the title, the article\u2019s abstract was consulted. Any discrepancies between the two reviewers were brought to a third reviewer (HS) for discussion until a final consensus was obtained. After a consensus had been obtained, the pertinent article abstracts (n = 658) were read by the two reviewers (BM and HS).Figure n = 7) were redistributed among the reviewers for complete review and data extraction. Each reviewer ascertained the study\u2019s principal author, a description of the intervention, population characteristics including sex, the intervention period, any secondary interventional procedure that was performed, and the outcome measures of each full-length article. Reviewers then met to discuss any disagreements from the data extraction and to consolidate data. No disagreements were noted between the reviewers for the final 7 full-length articles.Each reviewer independently assessed identified abstracts against the previously mentioned inclusion/exclusion criteria and then met to discuss and obtain consensus on the relevancy of the articles\u2019 abstracts. Upon obtaining consensus, the full-length articles  scale Table , which irvention  and thusrvention .Table 1Sd for 6/7 studies 80 large . An effeSeven randomized clinical trials , 31, 32 Five of the seven studies found in our search fit into the young adult population. ESE intervention in these studies ranged from 12 weeks to 20 weeks. In an early study examining the effects of 18 week ESE training on bone, authors , total fIn middle-aged and older adults, there is a lack of studies investigating the effects of ESE intervention on bone. Our search found only one middle-aged adult study published in 1998  and one Chen et al.  recruiteTo our knowledge, this is the first review article to report the effects of ESE on BMD and BMC in humans. The main finding of our review paper is that evidence regarding beneficial effects of ESE on BMD and/or BMC in young, middle-aged, and older adults is inconsistent and variable. We also noticed a site-specific effect of ESE on BMD/BMC with skeletal sites of lower extremity , 20, 22 Indirect mechanical loading on bone from muscle contractions generates potent anabolic signals on bone  and thusHigh stretch forces created during ESE exert significant mechanical loading on the skeletal system and thus could prove anabolic stimuli to bone. This was corroborated by one of the included studies which reported greater positive changes in BMD of the mid femur which performed ESE versus the contralateral leg which exercised with CSE in young adults . A greatAccording to the Mechanostat model,  mechanicA recent review article  showed tWe were also interested to examine other factors that could explain potential of ESE to positively influence BMD as noted in our review. Prior evidence shows that increased BMD due to ESE could also be dictated, in part, by an increase in bone metabolism. For example, evidence shows that a single bout of eccentric contractions can increase bone formation markers such as osteocalcin and bone resorption markers such as cross-linked N-telopeptide of type I collagen . It needThinking from a \u2018researcher\u2019s mind and clinician\u2019s heart\u2019 approach, we wanted to examine the clinical feasibility of applying ESE in older adults. We think that the low metabolic cost of ERE contraction should propel it to the forefront of skeletal rehabilitation for older adults, especially for individuals with osteopenia/osteoporosis. The high stretch forces of eccentric contractions place lower metabolic demand than high muscle shortening forces . Indeed,It is critical that we understand a clear difference between ESE and eccentric damage/injury . EccentrSkeletal benefits of ESE were achieved in a short time frame which was a major strength of their intervention. For example, Miller et al. , Nickolsp-value is recorded and presented to the reader in order to show whether there is a statistical difference between groups, effect size has been calculated in order to show a more \u201csubstantive significance\u201d [In addition, it is important to acknowledge the effect size relative to the p-values reported in each manuscript. Effect size in the current work was calculated as the \u201cmagnitude of the difference due to the intervention only\u201d . While tficance\u201d . CalculaIt can be postulated that the variance of results previously shown in ESE-only exercise studies can be partly explained by the specificity of the training protocols of each study Table . No two Although high stretch forces can induce unique cellular and molecular signaling resulting in increased BMC and BMD; studies used in our review article comprised of ESE utilizing open kinetic and closed kinetic chain. It is well known that mechanical loading interacts with muscle contraction forces during closed kinetic chain versus only muscle contraction forces act on bone during open kinetic chain. Interestingly, the greatest effect of ESE was observed in the study which comprised of closed kinetic chain exercise . Thus, wThe results may also be partially explained by the method by which BMD or BMC was obtained. As with any form of measurement, varying types of BMD or BMC estimates have their own advantages and disadvantages. These studies have made use of three different techniques: DXA, mechanical response tissue analyzer, and quantitative ultrasound. Four studies used DXA \u201321, whicOne of the strengths of this review is the quality appraisal of studies. The PEDRO scale was used to conduct a quality assessment of studies reported in this review article. Effect sizes are also reported to show the effect of various ESE interventions on BMD and BMC. Although we have not reported weighted effect sizes based on site-specific effects, an overall effect size provides us a framework to design an evidence based ESE program for skeletal rehabilitation. The results from our study can also be used to design effective randomized controlled trials to assess the skeletal effects of eccentric training. Limitations of this paper include inclusion of only randomized controlled trials, as well as the use of only two output measures related to bone status: BMD and BMC. We used only BMD and BMC for a focused review. Moreover, besides BMD and BMC, there is a lack of consistency in reporting other outcome measures related to bone status such as bone formation and bone resorption markers, bone architecture, and bone strength. Notably, BMD and BMC are robust measures strongly related to bone strength . Due to Overall, our study shows that ESE has some potential to increase BMD and BMC in young, middle-aged, and older adults. However, there is large variability in ESE dosage and the administrative techniques of ESE among the published studies. Specifically, it is unknown if the effect of ESE on bone can be affected by the technique of utilizing different modes such as open kinetic chain vs closed kinetic chain exercise. Whether BMD and BMC effects of ESE are dictated by mode, dosage, age, or sex remains unknown and needs further investigation."}
+{"text": "Background: Several exercise methods with virtual reality devices have been used in treatments for older adults and patients with neurodegenerative diseases, although the mechanisms continue to be elucidated. The aim of this study is to establish the feasibility and effectiveness of a rehabilitation programme using low-cost virtual reality aimed at improving postural balance in older adults. It also seeks to compare low-cost virtual reality under two delivery modalities, telerehabilitation (TR) in elderly centres and face-to-face (FtF) in rehabilitation centres. Methods: The study is set up as a non-inferiority two-arm parallel triple-blind randomised controlled clinical trial. Sixteen persons aged 65 to 75-years-old will be included. Eighteen Wii therapy sessions (25\u201330 min) will be provided through both FtF  and TR , both with a Nintendo Wii balance board. Data will be collected at baseline (week 0), during the Wii therapy sessions , and during the follow-up (weeks 8 and 10). The primary outcome will be the area of centre-of-pressure (CoP) sway; secondary outcomes will be medial\u2013lateral and anterior\u2013posterior velocity and standard deviation of CoP; and tertiary outcomes will be clinical measures: single-leg stand, timed up-and-go tests, Barthel Index, and Tinetti\u2019s scale. Statistical analyses will be performed using SPSS 20.00 for Windows. The trial adheres to the Declaration of Helsinki and the Chilean laws of rights and duties of the patient and research in humans. Ethical approval was obtained from the Ethics Committee of the University of Talca. Written informed consent will be obtained from participants. Discussion: In this trial, older adults from a Chilean city with a large rural and underserved population share will be included to test the feasibility and effectiveness of a rehabilitation programme using low-cost VR aimed at improving postural balance to generate evidence to support decision makers generating public health policy. Trial registration: Australian New Zeeland Clinical Trials Registration (ACTRN12621001380886). One of the most affected motor skills in the elderly population is the loss of postural balance, accentuating the risk of falls and a series of traumatic events that include hip fracture . For sevPhysical exercise has been widely recognised for its numerous benefits in the older adult population. It enhances neural function, cardiopulmonary performance, physical integration, respiratory muscle performance ,12,13, pRespiratory diseases that affect the elderly not only affect inspiratory muscles but also negatively affect postural balance in this population, accentuating the risk of falls and their traumatic consequences . These fSeveral exercise methods with virtual reality (VR) devices have been used in treatments for older adults and patients with neurodegenerative diseases ,24,25,26The recognition of VR-based therapies as accessible and low-cost systems primarily applies to developed or high-income countries ,32. HoweThe benefits of VR-based therapies in older people and other populations have been demonstrated in in-person or face-to-face modalities, where a physiotherapist typically guides the therapy ,24,25,26The aim for this study is to establish the feasibility and effectiveness of a rehabilitation programme using low-cost VR aimed at improving postural balance in older adults. It also seeks to compare low-cost VR under two delivery modalities, TR in elderly centres and face-to-face (FtF) in rehabilitation centres.This is a non-inferiority randomised, triple-blind, controlled clinical trial. Reporting follows Standard Protocol Items: Recommendations for Interventional Trials . The second environment is a remote facility, where there is no therapist present, and a low-cost virtual reality intervention is delivered through TR. This will take place in two elderly centres, and the choice of location will be based on the participants\u2019 access to equipment and space. The assessments will be conducted at the facility where the therapy was performed.2, an alpha of 0.05, and 80% statistical power were also considered. A 5% attrition rate was also considered, thus it was determined that a minimum of 8 participants in each group  would be required. The sample size calculation was performed using GRANMO .The sample size was determined to detect significant changes in the effects of postural balance between FtF and TR groups after six weeks that are clinically relevant. Our proposed difference of equal to or greater than 1.5 units is based on data from previous studies ,15,16. AThe considered inclusion criteria are: People aged 65 to 75-years-old (women and men), occasional or permanent corrected lens wear, Mini Mental State Examination (MMSE) score of over 24 points, and no falls history in the last 12 months. Exclusion criteria are vestibular impairment and/or access at home to a Nintendo Wii before the intervention. The objective of this study is to evaluate and contrast the outcomes resulting from the implementation of affordable virtual reality technology across FtF and TR modalities. The low-cost virtual reality intervention entails the utilization of a Nintendo Wii balance board, facilitating the engagement of participants in four exergames.The FtF group will receive training from a physiotherapist at the telerehabilitation centre of Universidad de Talca, specifically designed for elderly patients. In contrast, the TR group will be trained by an older adult who has undergone six months of training in the rehabilitation program using low-cost virtual reality. These trained older adults will act as therapists for their peers, who belong to two senior citizen centres located near their homes. These centres offer recreational and sports activities for older adults who attend daily. The elderly therapist will receive remote guidance from the telerehabilitation centre at Universidad de Talca, Chile.FtF and TR groups will undergo a total of 18 sessions, which will be delivered over a period of 6 weeks, with a frequency of 3 times per week  for 25 min per session, followed by four weeks of follow-up for the older adults. For the first 3 weeks, each participant will perform three sets of exercises with manual guidance and verbal instructions. Subsequently, only verbal instructions will be provided by a physiotherapist or elderly therapist. The rehabilitation program has three sets of exercises that improve postural balance in the sagittal, frontal, and transversal planes of motion. The games used in the first two sets of exercises are Snowboard, Penguin Slide, and Super Hula Hoop, while the Yoga game is used in the third set. In the first set of exercises, the older adults will stand in a relaxed position with their arms and hands at their sides. In the second set of exercises, each game will be repeated in a standing position with their hands on their waists. Between the first and second sets of exercises, a one to two minute break will be given, during which the participants will sit on a chair until they have recovered. The third set of exercises involves maintaining a relaxed posture during the Yoga game with their eyes open and then repeating it with their eyes closed.To encourage adherence, all participants in both the FtF and TR groups will receive telephone reminders. At this stage, no modifications to the intervention protocols will be made throughout the study.The trial will use posturographic and clinical measures to assess the differences in the effects of FtF and TR groups using low-cost virtual reality interventions for postural control. Posturographic measures assess postural control by measuring the centre-of-pressure sway, including variables such as sway area, trajectories, and velocity in the medial\u2013lateral and anterior\u2013posterior directions . These marea) as a dependable and credible indicator of postural control across diverse clinical and nonclinical populations, as demonstrated by previous studies [area serves as a comprehensive metric of the balance control system\u2019s capacity to sustain a stable upright posture, and higher values of CoParea signify suboptimal balance control.The present investigation will utilize the CoP sway area  or experimental group (TR) with 1:1 allocation as per a computer-generated randomization schedule stratified by site and the baseline score of the Action Arm Research Test using permuted blocks of random sizes. For concealing treatment allocation, the block sizes utilised in this study will not be divulged. This statistical approach, tailored to the randomised and block design, has been adopted to ensure the practicality and cost-effectiveness of conducting the clinical trial.At the beginning of the study, participants will be informed about their random assignment to either the FtF or TR group. To ensure engagement and compliance, older adults in both groups will be regularly asked about the content of the interventions they receive. Data entry will be conducted by an employee outside the research team, who will use separate datasheets to prevent researchers from accessing information about group allocation during data analysis.The raw data will be stored electronically in encrypted text files, while the calculated and clinical outcome measures will be saved in an encrypted Excel spreadsheet. To ensure data security and prevent loss, backups will be created on a weekly basis.All measurements will be conducted under identical conditions and by the same assessor at each time point, at a consistent time of day. Posturographic assessments (CoP displacements) for both groups will be obtained utilizing an AMTI OR67 force platform . AMTI NetForce software  will be utilised for the acquisition of moments and forces at a rate of 100 Hz. Data will be recorded, assigned a code, and saved on a personal computer. CoP variables will be determined using Matlab R2022 .All primary and secondary posturographic measures will be evaluated across eight distinct postural tasks, each lasting 60 s, except for the dynamic postural task which will last 30 s. The postural tasks will comprise two static conditions: (i) standing motionless with eyes open, and (ii) standing motionless with eyes closed. In addition, six dynamic conditions will be evaluated: voluntary sway in the mediolateral direction, following a metronome set at 30 Hz ((i) and (ii)) and 60 Hz ((iii) and (iv)), with eyes open and closed for each frequency. Multidirectional sway will also be assessed while playing two different videogames that challenge (v) anterior\u2013posterior postural control  and (vi) medial\u2013lateral postural control (Penguin). It is anticipated that all assessments, including clinical evaluations, will be completed within 40 min.t-tests and \u03c72 tests). Statistical analyses will be conducted using SPSS 20.00 for Windows. Descriptive statistics will be utilised to determine the demographic and clinical characteristics of participants in both groups .The normality and homogeneity of variance of all outcome measures will be assessed using the Shapiro\u2013Wilk and Levene tests, respectively. If the assumptions of normality are met, a t-test will be employed, otherwise, the Mann\u2013Whitney U test will be used to determine differences between the FtF and TR groups. Additionally, if the assumptions of normality are fulfilled, a repeated measures analysis of variance (RM-ANOVA) will be employed, otherwise, Friedman\u2019s test will be used. Post hoc pairwise comparisons will be used to determine the intervention\u2019s effect over time for each group (FtF and TR). Cohen\u2019s d will be used to report effect sizes for the CoP variables. To allow repeated measures analysis, missing data will be adjusted by (1) replacing with the non-missing average values for each variable/week and (2) performing multiple imputations. Both methods will be used to make sure that the results are concordant. For all analyses, a Continuous monitoring will be conducted by the clinical team, overseen by the research team and the Ethics Committee of the University of Talca. In the event of any adverse events, the Ethics Committee of the University of Talca will be immediately notified to determine if any modifications or termination of the trial are necessary.No patients will be involved in the design of the trial.The trial is in accordance with the Declaration of Helsinki and adheres to the Chilean laws regarding the rights and obligations of patients and research involving human subjects. Ethical approval for the trial was granted by the Ethics Committee of the University of Talca (Ref. No. 24-2018). This protocol was registered with the Australian and New Zealand Clinical Trials Registry (ACTRN12621001380886). Written informed consent will be obtained from all participants.Anticipated findings from this trial suggest that the TR modality will exhibit non-inferior effectiveness to the FtF modality, as evaluated through clinical and posturographic assessments. This expectation draws support from preliminary evidence surrounding the implementation of TR and VR interventions in different settings. According to a recent systematic review, telemonitoring and telerehabilitation were the most used methods of telecare interventions in older populations. The findings from various studies indicated that these interventions had a positive impact on different dimensions of quality of life, particularly in older adults. Evaluating the impact of telecare interventions can provide valuable insights for system developers to improve the effectiveness of current and future telecare technologies to better meet the needs of users, particularly older adults. Future research can focus on evaluating the impact of specific telecare systems on targeted populations using diverse research methodologies. This can help in understanding the effectiveness of telecare interventions in different settings and for different populations and guide the development and implementation of telecare technologies that are tailored to specific user requirements . SimilarThe feasibility and efficacy of telerehabilitation programs seems to be comparable to conventional physiotherapy in terms of functionality level and quality of life, but the evidence is limited to a small corpus of studies. Telerehabilitation has been shown to achieve high levels of patient satisfaction and adherence, with values like those of traditional face-to-face/in-person rehabilitation methods. This suggests that telerehabilitation can be a viable and effective alternative for delivering rehabilitation interventions, with outcomes to comparable those of conventional in-person physiotherapy . In the last three years, research on telerehabilitation has risen not only because of the technological improvements and population aging, but also to address rehabilitation needs during lockdowns and to treat post-COVID syndromes as Long COVID . During Recent research like this trial has found that telerehabilitation, specifically a home-exercise program supervised by physical therapists, has the potential to be as effective as supervised rehabilitation in improving functional outcomes in female patients with patellofemoral pain syndrome . In the In the case of telerehabilitation focused on older patients, several systems and programmes have been developed over the last years, including some using VR solutions. For example, the use of Virtual Reality Comprehensive Rehabilitation Rooms (VRCRR) in physiotherapeutic treatment for older adults living in a community has been shown to significantly improve their functional performance, particularly in terms of static balance. This innovative approach, using VR technology, offers a viable alternative to traditional physiotherapy methods for enhancing individual functional performance. The self-designed VRCRR solution allows for a tailored physiotherapy programme to be pursued in the comfort of one\u2019s own home environment, making it a promising option for improving physical function in older adults. Therefore, VR technology can be used effectively in physiotherapy management to enhance individual functional performance, especially in terms of static balance, and can be conveniently used at home through a self-designed VRCRR solution. Overall, this suggests that VR can play a valuable role in the rehabilitation of older adults in the community setting . FurtherMoreover, telerehabilitation could be used in frail or cognitively impaired older patients. Telerehabilitation has shown promise in improving the quality of life for older patients with mild cognitive impairment or cognitive frailty, and it can serve as a useful and supportive digital platform for healthcare. Commonly used technologies for telerehabilitation include smartphones or telephones with Internet, television-based assistive integrated technology, mobile applications, and video conferencing. Despite its potential, the utilization of telerehabilitation in managing cognitive frailty among older adults is still limited, and further research is needed to evaluate its feasibility and acceptability. Although telerehabilitation has been implemented among older adults with mild cognitive impairment or cognitive frailty, social support is still necessary to improve adherence and effectiveness. Future research should focus on evaluating the acceptance and existing knowledge of participants towards telerehabilitation to better achieve its intended outcomes. By understanding the perceptions and attitudes of older adults towards telerehabilitation, interventions can be tailored to address potential barriers and enhance acceptance. Additionally, further research can explore the role of social support in facilitating the implementation and effectiveness of telerehabilitation in older adults with cognitive frailty. This can include strategies to provide adequate support, such as caregiver involvement, community resources, and technological assistance, to overcome challenges and ensure successful telerehabilitation outcomes. Overall, continued research and evaluation of telerehabilitation in older adults with cognitive impairments can contribute to optimizing its use as an effective and feasible approach for improving their health and wellbeing . The utiIn summary, telerehabilitation has the potential to provide accessible and convenient rehabilitation services, particularly for individuals who may have limited access to traditional in-person rehabilitation, such as older adults or those in remote or underserved areas. Further research and evidence in this area can contribute to the broader adoption and integration of telerehabilitation as a valuable approach in rehabilitation practice. In this trial, older adults from a Chilean city with a large rural and underserved population share will be included to test the feasibility and effectiveness of a rehabilitation programme using low-cost VR aimed at improving postural balance to generate evidence to support decision makers generating public health policy. This aspect warrants significant attention as a substantial portion of the research pertaining to this topic is predominantly conducted in urban areas of high-income countries, which may have socioeconomic conditions that are markedly distinct from those of rural, poor, or underserved areas. As a result, the findings derived from this trial hold particular relevance for settings where the need is most acute. The evidence generated by this study has the potential to be of immense value in informing and guiding interventions in resource-constrained areas, where access to appropriate healthcare resources and services may be limited. By addressing the research gap in diverse settings, including those with varying socioeconomic profiles, the findings of this trial can contribute to a more comprehensive and nuanced understanding of the issue, leading to contextually relevant interventions and policies that are tailored to the specific needs of vulnerable populations in underserved areas. This will facilitate the development of more equitable and inclusive approaches to addressing the research question at hand, with a focus on reducing disparities and improving health outcomes in marginalised communities. Consequently, the outcomes of this trial will not only advance scientific knowledge but also have practical implications for policy making and implementation, particularly in settings that are often overlooked or underrepresented in research conducted in more affluent urban areas."
\ No newline at end of file