Datasets:

Joemgu

/

sumstew

like 9

Summarize: CROSS-REFERENCE TO RELATED APPLICATION This application is a divisional application Ser. No. 13/533,728, filed Jun. 26, 2012, which application is hereby incorporated by reference. FIELD OF THE INVENTION This invention relates generally to implantable medical devices and, more particularly, an implantable prosthesis and a method of making an implantable prosthesis. BACKGROUND OF THE INVENTION Drug-filled stents have been presented as an alternative or complement to conventional drug-coated stents with a coating of drug-polymer or pure drug. With drug-filled stents, the stent struts have a drug-filled center. An example of a stent strut having a drug-filled center is described in US Publication No. 2011/0008405, entitled “Hollow Tubular Drug Eluting Medical Devices,” which is incorporated herein by reference in its entirety for all purposes. After implantation, the drug is released out of holes formed in the stent struts. The drug contained within the stent struts is protected from potential damage when the stent is crimped onto a carrier device, such as a balloon catheter, and during the process of positioning the stent and catheter through a patient's vasculature to a target treatment site. A visualization method that relies on the radiopacity of the stent is often used to determine whether the stent is properly located at the target treatment site. The struts of drug-filled stents may be less radiopaque as they are hollow compared to conventional drug-coated stents having only solid metal wire struts. The reduction in radiopacity can make it difficult to visualize the stent. Accordingly, there is a need to improve radiopacity of drug-filled stents. SUMMARY OF THE INVENTION Briefly and in general terms, the present invention is directed to a method of making an implantable prosthesis. In aspects of the present invention, a method comprises placing radiopaque particles within a lumen of a strut having a plurality of side holes extending from the lumen to an exterior surface of the strut. The radiopaque particles have sizes that prevent the radiopaque particles from passing through the side holes. In other aspects, the placing of the radiopaque particles within the lumen includes introducing the radiopaque particles through an end hole of the strut. In other aspects, the method further comprises crimping, sealing or plugging the end hole after the introducing of the radiopaque particles through the end hole. In other aspects, the method further comprises forming the side holes through the strut before the introducing of the radiopaque particles through the end hole. In other aspects, the method further comprises forming the side holes through the strut after the introducing of the radiopaque particles through the end hole. The features and advantages of the invention will be more readily understood from the following detailed description which should be read in conjunction with the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a perspective view of a portion of an implantable prosthesis. FIG. 2 is a cross-section view of a hollow strut of the implantable prosthesis of FIG. 1, showing radiopaque particles in a lumen of the strut. FIG. 3A is a diagram of adjoining radiopaque particles within a lumen of a hollow strut, showing a partial enlarged view of a contact between two adjoining radiopaque particles. FIG. 3B is a diagram of adjoining radiopaque particles within a lumen of a hollow strut, showing a partial enlarged depiction of atomic diffusion which has bonded two adjoining radiopaque particles. FIG. 4 is a cross-section view of a hollow strut of an implantable prosthesis, showing a therapeutic agent between radiopaque particles. FIG. 5 is a cross-section view of a hollow strut of an implantable prosthesis, showing holes through which a therapeutic agent can be released after implantation. FIG. 6 is a perspective view of a hollow strut of an implantable prosthesis, showing holes through which a therapeutic agent can be released after implantation. FIG. 7 is a cross-section view of a hollow strut, showing radiopaque particles retained in the strut by an external binder, adhesive, or similar material. FIG. 8 is a cross-section view of a hollow strut, showing radiopaque particles and therapeutic agents carried by an external binder, adhesive, or similar material. FIG. 9 is a flow diagram of an exemplary method of making an implantable prosthesis. DETAILED DESCRIPTION OF EXEMPLARY EMBODIMENTS As used herein, any term of approximation such as, without limitation, near, about, approximately, substantially, essentially and the like mean that the word or phrase modified by the term of approximation need not be exactly that which is written but may vary from that written description to some extent. The extent to which the description may vary will depend on how great a change can be instituted and have a person of ordinary skill in the art recognize the modified version as still having the properties, characteristics and capabilities of the modified word or phrase. For example, and without limitation, a feature that is described as “substantially equal” to a second feature encompasses the features being exactly equal and the features being readily recognized by a person of ordinary skilled in the art as being equal although the features are not exactly equal. As used herein, “implantable prosthesis” is a device that is totally or partly introduced, surgically or medically, into a patient's body (animal and human). The duration of implantation may be essentially permanent, i.e., intended to remain in place for the remaining lifespan of the patient; until the device biodegrades; or until the device is physically removed. Examples of implantable prostheses include without limitation self-expandable stents, balloon-expandable stents, grafts, and stent-grafts. As used herein, a “therapeutic agent” refers to any substance that, when administered in a therapeutically effective amount to a patient suffering from a disease or condition, has a therapeutic beneficial effect on the health and well-being of the patient (animal and human). A therapeutic beneficial effect on the health and well-being of the patient includes, but is not limited to: slowing the progress of a disease or medical condition; causing a disease or medical condition to retrogress; and alleviating a symptom of a disease or medical condition. As used herein, a “therapeutic agent” includes a substance that when administered to a patient, known or suspected of being particularly susceptible to a disease, in a prophylactically effective amount, has a prophylactic beneficial effect on the health and well-being of the patient. A prophylactic beneficial effect on the health and well-being of a patient includes, but is not limited to: (1) preventing or delaying on-set of the disease or medical condition in the first place; (2) maintaining a disease or medical condition at a retrogressed level once such level has been achieved by a therapeutically effective amount of a substance, which may be the same as or different from the substance used in a prophylactically effective amount; and (3) preventing or delaying recurrence of the disease or condition after a course of treatment with a therapeutically effective amount of a substance, which may be the same as or different from the substance used in a prophylactically effective amount, has concluded. Also, the phrase “therapeutic agent” includes substances useful for diagnostics. The phrase “therapeutic agent” includes pharmaceutically acceptable, pharmacologically active derivatives of those agents specifically mentioned herein, including, but not limited to, salts, esters, amides, and the like. Referring now in more detail to the exemplary drawings for purposes of illustrating exemplary embodiments of the invention, wherein like reference numerals designate corresponding or like elements among the several views, there is shown in FIG. 1 a portion of exemplary implantable prosthesis 50. The implantable prosthesis includes a plurality of interconnected struts 52. Struts 52 form undulating rings 54 that are connected to each other. As shown in FIG. 2, one or more of struts 52 is hollow. Hollow strut 52 has lumen 56 and metal layer 58 that surrounds lumen 56. Radiopaque particles 60 are disposed with lumen 56. In some embodiments, struts 52 have outer diameter D 1 from about 0.06 mm to about 0.3 mm. In some embodiments, struts 52 have inner diameter D 2 from about 0.01 mm to about 0.25 mm. Inner diameter D 2 corresponds to the diameter of lumen 56. In some embodiments, metal layer 58 has thickness T of about 0.01 mm or greater. Other outer diameters, inner diameters, and thicknesses can be used. The selected dimension can depend on the type of implantable prosthesis and where the prosthesis is intended to be implanted in a patient. As shown in FIGS. 3A and 3B, in some embodiments radiopaque particles 60 are bonded directly to each other by diffusion of atoms 62 from adjoining radiopaque particles 60 a, 60 b to points of contact 64 between adjoining radiopaque particles 60 a, 60 b. FIG. 3A shows radiopaque particles 60 before bonding by diffusion of atoms 62 to points of contact 64. FIG. 3B shows radiopaque particles 60 after bonding by diffusion of atoms 62 to points of contact 64. Atoms 62 in FIG. 3B which are illustrated in relatively dark shading are the atoms that have diffused to points of contact 64. Points of contact 64 are separated from each other by gaps 66 between radiopaque particles 60. As shown in FIG. 4, in some embodiments therapeutic agent 68 is contained within gaps 66 ( FIG. 2 ) between radiopaque particles 60. As shown in FIGS. 5 and 6, in some embodiments metal layer 58 has side holes 70 for releasing therapeutic agent 68 out of lumen 56. Side holes 70 are at predetermined locations in metal layer 58. Surface areas 72 of metal layer 58 between side holes 70 are non-porous with respect to therapeutic agent 68. In some embodiments, side holes 70 have a diameter D 3 ( FIG. 5 ) that is greater than that of radiopaque particles 60. For example, the diameter of side holes 70 can be greater than 25 micrometers when radiopaque particles have a diameter not greater than 25 micrometers. Other diameters for side holes 70 can be used. Radiopaque particles 60 are retained in lumen 56 due to the radiopaque particles being directly bonded to each other (such as by sintering), due to an external binder (such as a polymer binder) carrying the radiopaque particles, or both due to the radiopaque particles being directly bonded to each other and an external binder carrying the radiopaque particles. In some embodiments, side holes 70 have a diameter that is less than that of radiopaque particles 60, so that radiopaque particles 60 remain trapped in lumen 56 after implantation in a patient. Since radiopaque particles 60 cannot pass through side holes 70, radiopaque particles 60 can be introduced into lumen 56 through end hole 71 ( FIG. 6 ) of strut 52. For example, the diameter of side holes 70 can be less than 20 micrometers when radiopaque particles have a diameter of at least 20 micrometers. Other diameters for side holes 70 can be used. End hole 71 is in communication with lumen 56. In some embodiments, lumen 56 extends through a plurality of struts of prosthesis 50. In some embodiments, lumen 56 extends through all the struts of prosthesis 50. End hole 71 is located at the free end of strut 52 and has central axis 73 substantially parallel or coaxial with that of lumen 56. Side holes 70 are not located at free end of strut 52. Sides holes 70 have central axes 75 that are substantially non-parallel with that of lumen 56. In FIG. 6, central axes 75 are substantially perpendicular to the central axis of lumen 56. Other non-zero angles can be used between central axes 75 and the central axis of lumen 56. In some embodiments, side holes 70 are in the shape of either an elongated slot or an oval, so that side holes 70 have a minor diameter and a major diameter. The minor diameter is less than the diameter of radiopaque particles 60, and the major diameter is greater than the diameter of radiopaque particles 60. Slot-shaped or oval-shaped side holes 70 can reduce or prevent clogging of side holes 70 by radiopaque particles 60. In some embodiments, side holes 70 are located exclusively on an abluminal surface of implantable prosthesis 50. The abluminal surface faces radially outward from the center of the prosthesis and supports or contacts biological tissue when implanted within an anatomical lumen, such as a blood vessel. For example, holes located through the abluminal surface allow therapeutic agent 68 to be released directly into and provide a therapeutic effect to the biological tissue adjoining implantable prosthesis 50. In some embodiments, side holes 70 are located exclusively on a luminal surface of implantable prosthesis 50. The luminal surface faces radially inward toward the center of the prosthesis and faces the central passageway of the anatomical lumen. For example, holes located through the luminal surface allow therapeutic agent 68 to be released into the blood stream and provide a therapeutic effect downstream of implantable prosthesis 50. In some embodiments, side holes 70 are located on an abluminal surface and a luminal surface of implantable prosthesis 50. In some embodiments, radiopaque particles 60 are bonded directly to metal layer 58. In some embodiments, direct bonding is achieved in a manner similar to what was described above in connection with FIGS. 3A and 3B, so that radiopaque particles 60 are bonded to metal layer 58 by diffusion of atoms from radiopaque particles 60 to points of contact 90 ( FIG. 2 ) between radiopaque particles 60 and the metal layer 58. In some embodiments, radiopaque particles 60 are bonded directly to each other without requiring an external binder, adhesive, or similar material. An external binder, adhesive, or similar material is not a part of or contained within radiopaque particles 60 and is a material that is added to or mixed with radiopaque particles 60 for the primary purpose of keeping radiopaque particles 60 trapped within lumen 56. In some embodiments, radiopaque particles 60 that are bonded directly to each other (as in FIGS. 3B, 4 and 5 ) have no external binder, adhesive, or similar material located between radiopaque particles 60. In some embodiments, radiopaque particles 60 that are bonded directly to each other are also held together by an external binder, adhesive, or similar material surrounding radiopaque particles 60. The external binder, adhesive, or similar material provides additional strength to the interconnection among radiopaque particles 60. As shown in FIG. 7, in some embodiments radiopaque particles 60 are not retained in lumen 56 by sintering or by atomic diffusion. Radiopaque particles 60 are held inside lumen 56 by an external binder, adhesive, or similar material 61 surrounding radiopaque particles 60. For example, a polymer binder can be used as an external binder. As shown in FIG. 8, in some embodiments polymer binder 61 carries therapeutic agent 68 and radiopaque particles 60. In some embodiments, polymer binder 61 is combined with therapeutic agent 68. In some embodiments, polymer binder 61 keeps radiopaque particles 60 from escaping from lumen 56 after implantation in a patient and allows therapeutic agent 68 to diffuse out of polymer binder 61 and escape lumen 56 by passing through side holes 70 after implantation. Polymer binder 61 is biostable and durable when exposed to bodily fluids, such as blood, and substantially remains in lumen 56 after implantation. In some embodiments, polymer binder 61 is bioabsorbable, biodegradable, or bioerodible. After a substantial period of time, polymer binder 61 does not remain in lumen 56. Radiopaque particles 60 can be retained in lumen 56 by having side holes 70 that are smaller in size than radiopaque particles 60. The terms “biodegradable,” “bioabsorbable,” and “bioerodible” are used interchangeably and refer to polymers that are capable of being completely degraded and/or eroded when exposed to bodily fluids such as blood and can be gradually resorbed, absorbed, and/or eliminated by the body. The processes of breaking down and eventual absorption and elimination of the polymer can be caused by, for example, hydrolysis, metabolic processes, enzymolysis, oxidation, bulk or surface erosion, and the like. The word “biostable” refers to a polymer that is not biodegradable. In some embodiments, therapeutic agent 68 can be carried within polymer binder 61 as discrete solid particles or discrete semi-solid particles. Therapeutic agent 68 can be in the form of powder particles. In some embodiments, therapeutic agent 68 can be carried within polymer binder 61 as discrete liquid droplets. In some embodiments, therapeutic agent 68 is carried within polymer binder 61 and is not in the form of discrete particles or discrete droplets within polymer binder 61. In some embodiments, therapeutic agent 68 is dissolved in polymer binder 61. A solution of therapeutic agent 68 and polymer binder 61 is disposed between radiopaque particles 60. In some embodiments, polymer binder 61 includes a binder material selected from the group consisting of a phosphorylcholine-based polymer, BioLinx™ polymer (available from Medtronic of Minneapolis, Minn.), poly(n-butyl methacrylate), poly(n-hexyl methacrylate), and styrene-isobutylene-styrene triblock copolymer. An example of a phosphorylcholine-based polymer includes without limitation PC1036. PC1036 is composed of the monomers 2-methacryloyloxyethyl phosphorylcholine (MPC), lauryl methacrylate (LMA), hydroxypropyl methacrylate (HPMA), and trimethoxysilylpropyl methacrylate (TSMA) in the molar ratios of MPC 23, LMA 47, HPMA 25, and TSMA 5. BioLinx™ polymer may comprise a blend of a hydrophilic C19 polymer, a water-soluble polyvyle pyrolidinone (PVP), and a lipophilic/hydrophobic C10 polymer. Other binder materials can be used. In other embodiments, polymer binder 61 includes a binder material selected from polyurethanes, polyphosphazenes, silicones, polyesters, polyolefins, polyisobutylene and ethylene-alphaolefin copolymers, acrylic polymers and copolymers, vinyl halide polymers and copolymers, poly(vinyl chloride), poly(vinyl fluoride), poly(vinylidene fluoride) (PVDF), poly(vinylidene chloride), poly(vinylidene fluoride-co-hexafluoropropylene) (PVDF-HFP), poly(tetrafluoroethylene-co-vinylidene fluoride-co-hexafluoropropylene), polyvinyl ethers, such as polyvinyl methyl ether, polyacrylonitrile, polyvinyl ketones, polyvinyl aromatics, such as polystyrene, polyvinyl esters, such as poly(vinyl acetate), copolymers of vinyl monomers with each other and olefins, such as ethylene-methyl methacrylate copolymers, acrylonitrile-styrene copolymers, ABS resins, and ethylene-vinyl acetate copolymers, polyamides, such as Nylon 66 and polycaprolactam, alkyd resins, polycarbonates, polyoxymethylenes, polyimides, polyethers, poly(sec-butyl methacrylate), poly(isobutyl methacrylate), poly(tert-butyl methacrylate), poly(n-propyl methacrylate), poly(isopropyl methacrylate), poly(ethyl methacrylate), poly(methyl methacrylate), epoxy resins, poly(vinyl butyral), poly(ether urethane), poly(ester urethane), poly(urea urethane), poly(silicone urethane), polyurethanes, rayon, rayon-triacetate, cellulose acetate, cellulose butyrate, cellulose acetate butyrate, cellophane, cellulose nitrate, cellulose propionate, cellulose ethers, carboxymethyl cellulose, polyethers such as poly(ethylene glycol) (PEG), copoly(ether-esters) (e.g. polyalkylene oxides such as poly(ethylene oxide), polypropylene oxide), poly(ether ester), polyalkylene oxalates, polyphosphazenes, poly(fluorophosphazene), poly(phosphoryl choline methacrylate), poly(aspirin), polymers and co-polymers of hydroxyl bearing monomers such as 2-hydroxyethyl methacrylate (HEMA), hydroxypropyl methacrylate (HPMA), hydroxypropylmethacrylamide, PEG acrylate (PEGA), PEG methacrylate, carboxylic acid bearing monomers such as methacrylic acid (MA), acrylic acid (AA), alkoxymethacrylate, alkoxyacrylate, and 3-trimethylsilylpropyl methacrylate (TMSPMA), poly(styrene-isoprene-styrene)-PEG (SIS-PEG), polystyrene-PEG, polyisobutylene-PEG, poly(methyl methacrylate)-PEG (PMMA-PEG), polydimethylsiloxane-co-PEG (PDMS-PEG), PLURONIC™ surfactants (polypropylene oxide-co-polyethylene glycol), poly(tetramethylene glycol), and hydroxy functional poly(vinyl pyrrolidone), In other embodiments, polymer binder 61 may be a material that is biodegradable, bioresorbable, or bioerodible. With such a binder, the radiopaque particles are retained within lumen 56 by their size, or by being bonded to one another or to metal layer 58. Such biodegradable binders include poly(ester amide), polyhydroxyalkanoates (PHA), poly(3-hydroxyalkanoates) such as poly(3-hydroxypropanoate), poly(3-hydroxybutyrate), poly(3-hydroxyvalerate), poly(3-hydroxyhexanoate), poly(3-hydroxyheptanoate) and poly(3-hydroxyoctanoate), poly(4-hydroxyalkanaote) such as poly(4-hydroxybutyrate), poly(4-hydroxyvalerate), poly(4-hydroxyhexanote), poly(4-hydroxyheptanoate), poly(4-hydroxyoctanoate) and copolymers including any of the 3-hydroxyalkanoate or 4-hydroxyalkanoate monomers described herein or blends thereof, poly(D,L-lactide), poly(L-lactide), polyglycolide, poly(D,L-lactide-co-glycolide), poly(L-lactide-co-glycolide), polycaprolactone, poly(lactide-co-caprolactone), poly(glycolide-co-caprolactone), poly(dioxanone), poly(ortho esters), poly(anhydrides), poly(tyrosine carbonates) and derivatives thereof, poly(tyrosine ester) and derivatives thereof, poly(imino carbonates), poly(glycolic acid-co-trimethylene carbonate), polyphosphoester, polyphosphoester urethane, poly(amino acids), polycyanoacrylates, poly(trimethylene carbonate), poly(iminocarbonate), poly(glyceryl sebacate), polypropylene fumarate), poly(ethylene oxide/poly(lactic acid) (PEO/PLA), polycaprolactone-PEG (PCL-PEG), PLA-PEG, biomolecules such as chitosan, alginate, fibrin, fibrinogen, cellulose, starch, dextran, dextrin, fragments and derivatives of hyaluronic acid, heparin, fragments and derivatives of heparin, glycosamino glycan (GAG), GAG derivatives, polysaccharide, chitosan, alginate, or combinations thereof. In some embodiments, the copolymer described herein can exclude any one or more of the aforementioned polymers. As used herein, the terms poly(D,L-lactide), poly(L-lactide), poly(D,L-lactide-co-glycolide), and poly(L-lactide-co-glycolide) can be used interchangeably with the terms poly(D,L-lactic acid), poly(L-lactic acid), poly(D,L-lactic acid-co-glycolic acid), or poly(L-lactic acid-co-glycolic acid), respectively. In some embodiments, the binder material of polymer binder 61 is selected based on the type of therapeutic agent that is intended to diffuse out of the polymer binder. Metal layer 58 can be made of any biocompatible material suitable for implantation in a human or animal body. In some embodiments, metal layer 58 comprises a base material selected from the group consisting of 316L stainless steel, CoNi MP35N, CoCr L-605, and FePtCr. Other base materials can be used. In some embodiments, the base material of metal layer 58 has a melting temperature that is either greater than or about the same as that of radiopaque particles 60. In some embodiments, metal layer 58 is not formed from sintered particles of the base material, so that metal layer 58 does not have a randomly pitted texture or granular texture which could result from sintering. In some embodiments, exterior surfaces 74 ( FIGS. 2 and 5 ) of metal layer 58 are substantially smooth. Exterior surfaces 74 can have a polished finish. In some embodiments, exterior surfaces 74 of metal layer 58 are maintained in a bare metal state. When in a bare metal state, there is no non-metal coating present on exterior surfaces 74. In some embodiments, no coating containing a therapeutic agent is present on exterior surfaces 74 of metal layer 58. Radiopaque particles 60 can be made of any material suitable for implantation in a human or animal body. Radiopaque materials are those materials with high density, or high atomic number that efficiently absorb x-ray radiation. In some embodiments, radiopaque particles 60 comprise a radiopaque material selected from the group consisting of gold, Au/Pt/Zn 85/10/5 alloy, Au/Ag/Pt/Zn 73/12/0.5/15 alloy, platinum, iridium, platinum/iridium alloys, palladium, tantalum, and niobium. Other radiopaque materials can be used. In some embodiments, radiopaque particles 60 can have a diameter from about 10 nanometers to about 25 micrometers. Other diameters for radiopaque particles 60 can be used. Referring again to FIG. 1, struts 52 form diamond-shaped cells. It should be understood that many strut configurations, in addition to the configuration shown in FIG. 1, are possible. For example, struts of an implantable prosthesis of the present invention can form other cell shapes. Strut configurations include those shown and described in U.S. Pat. No. 5,514,154 to Lau et al., entitled “Expandable Stents,” which is incorporated herein by reference in its entirety for all purposes. As a further example, the strut of an implantable prosthesis of the present invention can be helical or a coil. A plurality of helical- or coil-shaped struts can be welded together or joined by other methods to form an implantable prosthesis. As shown in FIG. 9, an exemplary method for making an implantable prosthesis includes placing radiopaque particles 60 within lumen 56 of strut 52 (block 80 ), and optionally followed by bonding radiopaque particles 60 to each other (block 82 ). In some embodiments, radiopaque particles 60 include a radiopaque material and an internal binder. The internal binder is contained within and is part of radiopaque particles 60. The internal binder holds the radiopaque material together so as to form radiopaque particles or clumps. In some embodiments, the placing (block 80 ) of radiopaque particles 60 within lumen 56 includes placing a mixture of radiopaque particles 60 and an external binder, adhesive, or similar material, or a mixture of radiopaque particles 60, therapeutic agent 68, and an external binder, adhesive, or similar material. The external binder, adhesive, or similar material 61 can be as described above in connection with FIGS. 7 and 8. The external binder, adhesive, or similar material 61 can be a polymer binder as described above. In some embodiments, the mixture is introduced into lumen 56 by passing the mixture through end hole 71 ( FIG. 6 ) of strut 52. After the mixture is introduced, side holes 70 can be made through strut 52 to allow any therapeutic agent to diffuse out of external binder 61. Optionally, end hole 71 is sealed after the mixture is introduced. In some embodiments, the mixture is introduced into lumen 56 by passing the mixture through side holes 70 ( FIG. 6 ) of strut 52. Side holes 70 are made for the purpose of loading lumen 56 with the mixture containing external binder 61 and for purpose of allowing any therapeutic agent to diffuse out of external binder 61 and escape from lumen 56. In some embodiments, the external binder, adhesive, or similar material 61 is added into lumen 56 after the placing (block 80 ) of radiopaque particles 60 within lumen 56. The adding of external binder, adhesive, or similar material 61 can be performed by immersing strut 52 in material 61 or by injecting material 61 in an opening at an end or side of strut 52. Material 61 can be a polymer binder as described above in connection with FIGS. 7 and 8. In some embodiments, the material (which is added into lumen 56 after the placing (block 80 ) of radiopaque particles 60 within lumen 56 ) is a mixture of a polymer binder and therapeutic agent 68. In some embodiments, the material (which is added into lumen 56 after the placing (block 80 ) of radiopaque particles 60 within lumen 56 ) is a polymer binder capable of absorbing therapeutic agent 68. After the polymer binder is in lumen 56, therapeutic agent 68 is allowed to infuse the polymer binder prior to implantation. Strut 52 can be immersed in a container containing therapeutic agent 68. After implantation, therapeutic agent 68 is allowed to diffuse out of the polymer binder and escape out of lumen 56. In some embodiments, the placing (block 80 ) of radiopaque particles 60 within lumen 56 includes placing into lumen 56 a mixture of radiopaque particles 60 and a sintering additive. The sintering additive is mixed together with radiopaque particles 60 prior to placing the mixture into lumen 56. The sintering additive can facilitate subsequent sintering. In some embodiments, the sintering additive has a melting temperature that is less than that of radiopaque particles 60. In some embodiments, the bonding (block 82 ) includes sintering the radiopaque particles together. During sintering, strut 52 containing radiopaque particles 60 is placed in a chamber of an oven having an internal temperature that is carefully controlled. The oven internal temperature is raised to a sintering temperature. In some embodiments, the sintering temperature is from about 500° C. to about 670° C. Other sintering temperatures can be used. In some embodiments, the sintering temperature is above 20° C. (68° F.) and is below the melting temperature of metal layer 58. Examples of melting temperatures of metal layer 58 include without limitation those listed in TABLE 1. TABLE 1 Softening Melting Material for Metal Layer Temperature Temperature 316L Stainless Steel Max use of 870° C. 1390° C. to 1440° C. CoNi MP35N — 1316° C. to 1441° C. CoCr L-605 Max use of 980° C. 1330° C. to 1410° C. In some embodiments, the sintering temperature is above 20° C. (68° F.) and is at or below the softening temperature of metal layer 58. Examples of softening temperatures of metal layer 58 include without limitation those listed in TABLE 1. In some embodiments, the sintering temperature is below the melting temperature of radiopaque particles 60. Examples of melting temperatures of radiopaque particles 60 include without limitation those listed in TABLE 2. TABLE 2 Material for Radi- Softening Melting opaque Particles Temperature Temperature Gold 1064° C. 1064° C. Au/Pt/Zn 85/10/5 Alloy 940° C. 990° C. Au/Ag/Pt/Zn 670° C. 700° C. 73/12/0.5/15 Alloy In some embodiments, the sintering temperature is above 20° C. (68° F.) and is at or below the softening temperature of radiopaque particles 60. Examples of softening temperatures of radiopaque particles 60 include without limitation those listed in TABLE 2. In some embodiments, after sintering, radiopaque particles 60 have not completely coalesced or merged with each other, and they remain distinct from each other (see, for example, FIG. 3B ). Radiopaque particles 60 form a granular and porous structure, which can be achieved by using a sintering temperature, such as any of the softening temperatures in TABLE 2, that does not completely liquefy radiopaque articles 60. In some embodiments, the sintering temperature is below the melting temperature of radiopaque particles 60 and is at or above the melting temperature of a sintering additive which is contained with lumen 56 and mixed with radiopaque particles 60. Still referring to FIG. 9, in some embodiments the bonding (block 82 ) includes causing diffusion of atoms from adjoining radiopaque particles to points of contact between the adjoining radiopaque particles. The diffusion of atoms can be facilitated by exposing the adjoining radiopaque particles 60 a, 60 b ( FIG. 3A ) to an elevated temperature above 20° C. (68° F.). An example of an elevated temperature includes without limitation a sintering temperature as described above. In some embodiments, the bonding (block 82 ) includes allowing points of contact 64 to be separated by gaps 66 ( FIG. 3B ) between radiopaque particles 60. Gaps 66 between radiopaque particles 60 can be maintained when the elevated temperature is kept below the melting temperature of radiopaque particles 60. In some embodiments, the placing (block 80 ) of radiopaque particles 60 within lumen 56 is preceded by forming strut 52 (block 78 ). In some embodiments, strut 52 is made from a single, continuous wire which has been meandered or bent to form crests. Welds 53 ( FIG. 1 ) at predetermined locations can be used to provide strength or rigidity at desired locations. In some embodiments, strut 52 is made according to conventional methods known in the art. For example, strut 52 can be a hollow wire, and forming strut 52 can include conventional process steps for forming hollow wires. As a further example, strut 52 can be made according to process steps described in the above-mentioned publication no. US 2011/0008405, entitled “Hollow Tubular Drug Eluting Medical Devices”. In some embodiments, forming strut 52 (block 78 ) includes polishing exterior surfaces 74 ( FIGS. 2 and 5 ) to give the exterior surfaces 74 a substantially smooth finish. Still referring to FIG. 9, in some embodiments the bonding (block 82 ) is followed by introducing therapeutic agent 68 into lumen 56 and between radiopaque particles 60 (block 84 ). If radiopaque particles 60 were bonded together at an elevated temperature, the introducing (block 84 ) is performed after radiopaque particles 60 have cooled below the elevated temperature. In some embodiments, the introducing (block 84 ) of therapeutic agent 68 into lumen 56 includes immersing strut 52 in a solution or mixture containing therapeutic agent 68, and allowing therapeutic agent 68 to flow into lumen 56 through an opening at the end or side of strut 52 In some embodiments, the introducing (block 84 ) of therapeutic agent 68 into lumen 56 includes applying a vacuum (negative pressure) to lumen 56 to draw a solution or mixture of therapeutic agent 68 into lumen 56. Alternatively, or in addition to the vacuum, positive pressure is applied to the solution or mixture from outside strut 52 to force the solution or mixture into lumen 56. In some embodiments, the introducing (block 84 ) of therapeutic agent 68 into lumen 56 includes introducing a mixture of therapeutic agent 68 and a carrier substance. The carrier substance can be a solvent, a polymer, or a combination thereof. The carrier substance can facilitate transportation of therapeutic agent 68, movement of therapeutic agent 68 between radiopaque particles 60, and/or control the release of therapeutic agent 68 out of lumen 56. Selection of the carrier substance can depend on the type of therapeutic agent it is intended to carry. In some embodiments, the carrier substance is a polymer binder. The polymer binder can be as described above in connection to FIGS. 7 and 8. The polymer binder can set or cure after it is introduced into lumen 56. After setting or curing, therapeutic agent 68 diffuses or elutes out of the polymer binder and escapes from lumen 56. After setting or curing, the polymer binder prevents radiopaque particles 60 from shifting in position with lumen 56 and prevents radiopaque particles 60 from escaping out of an end hole 71 or out of side holes 70 which are larger than radiopaque particles 60. In some embodiments, side holes 70 ( FIGS. 5-8 ) can be formed (block 86 ) at predetermined locations through metal layer 58 that surrounds lumen 56. Forming the holes can be performed either before or after the introducing (block 84 ) of the therapeutic agent 68 into lumen 56. In some embodiments, forming (block 86 ) of side holes 70 is performed before the placing (block 80 ) radiopaque particles 60 in strut 52. Holes 70 extend completely through metal layer 58 to allow therapeutic agent 68 to be introduced into lumen 56, or released out from lumen 56 after implantation, or both introduced into and released out from lumen 56. In some embodiments, side holes 70 are formed (block 86 ) so that side holes 70 are sized to prevent radiopaque particles 60 from escaping lumen 56 through side holes 70. Side holes 70 can be formed (block 86 ) before or after the placing (block 80 ) of radiopaque particles 60 in lumen 56 of strut 52. In some embodiments, after radiopaque particles 60 particles are placed (block 80 ) into lumen 56 through end hole 71 ( FIG. 6 ), the end hole can be crimped or plugged or sealed in order to trap radiopaque particles 60 particles in lumen 56. Side holes 70 have a diameter D 3 ( FIG. 5 ) that is smaller than a diameter of radiopaque particles 60, which prevents radiopaque particles 60 from escaping lumen 56 through side holes 70. In some embodiments, in addition to having side holes 70 sized smaller than radiopaque particles 60, radiopaque particles 60 can be bonded indirectly to each other by external binder 61 as described above and/or can be bonded directly to each other by atomic diffusion using a sintering process as described above. External binder 61 and/or sintering provides additional security for retaining radiopaque particles 60 within lumen 56. In some embodiments, forming strut 52 (block 78 ) is performed such that surface areas 72 ( FIG. 5 ) of metal layer 58 between holes 70 are non-porous with respect to therapeutic agent 68. Therapeutic agent 68 may pass through holes 70 but not through surface areas 72 between holes 70. Holes 70 can be formed by mechanical drilling, laser drilling, chemical etching, ion beam milling and any combination thereof. In some embodiments, therapeutic agent 68 is released from lumen 56 when therapeutic agent 68 passes through holes 70 at the predetermined locations. In some embodiments, the predetermined locations are selected so that holes 70 are at uniform spacing apart from each other. Holes 70 are not randomly distributed. In some embodiments, the predetermined locations are selected so that holes 70 are located in first and second regions, and are spaced closer to each other at the first region as compared to the second region. For example, the first region and second regions can correspond to different segments of strut 52. First region and second region can be a substantially straight segment 52 a ( FIG. 1 ) and a curved segment 52 b ( FIG. 1 ), or in reverse order. As a further example, the first region and second regions can correspond to different segments of implantable prosthesis 50. First region and second region can be an end segment 54 a ( FIG. 1 ) and a medial segment 54 b ( FIG. 1 ) adjacent the end segment, or in reverse order. Still referring to FIG. 9, in some embodiments the method further includes bonding radiopaque particles 60 to metal layer 58 (block 88 ). The bonding (block 88 ) can help avoid release of radiopaque particles 60 out from lumen 56. The bonding (block 88 ) of radiopaque particles 60 to metal layer 58 is performed before the introducing (block 84 ) of therapeutic agent 68 into lumen 56, and can be performed before, during or after the bonding (block 82 ) of radiopaque particles 60 to each other. The bonding (block 88 ) can be accomplished by sintering radiopaque particles 60 to metal layer 58. In some embodiments, the bonding (block 88 ) of radiopaque particles 60 to metal layer 58 includes causing diffusion of atoms from radiopaque particles 60 to points of contact 90 ( FIG. 2 ) between radiopaque particles 60 and metal layer 58. The diffusion of atoms can be facilitated by exposing radiopaque particles 60 and metal layer 58 to an elevated temperature above 20° C. (68° F.). An example of an elevated temperature includes without limitation a sintering temperature as described above. In some embodiments, subsequent operations (block 90 ) optionally includes any one or more of cleaning the outer surface of metal layer 58, applying an outer coating to the outer surface of metal layer 58, crimping of the stent onto a delivery catheter, and sterilization of implantable prosthesis 50. In some embodiments, an outer coating on metal layer 58 can include any one or a combination of a primer layer, a barrier layer, and a reservoir layer containing a therapeutic agent. Although reference was made to parts of implantable prosthesis 50 of FIGS. 1-5 in the description of the above method embodiments, it should be understood that the above method embodiments can be performed to make other types and configurations of implantable prostheses. Examples of therapeutic agents that can be used in various embodiments of the present invention, including the exemplary embodiments described above, include without limitation an anti-restenosis agent, an antiproliferative agent, an anti-inflammatory agent, an antineoplastic, an antimitotic, an antiplatelet, an anticoagulant, an antifibrin, an antithrombin, a cytostatic agent, an antibiotic, an anti-enzymatic agent, an angiogenic agent, a cyto-protective agent, a cardioprotective agent, a proliferative agent, an ABC A1 agonist, an antioxidant, a cholesterol-lowering agent, aspirin, an angiotensin-converting enzyme, a beta blocker, a calcium channel blocker, nitroglycerin, a long-acting nitrate, a glycoprotein IIb-IIIa inhibitor or any combination thereof. Examples of polymers that can be used in various embodiments of the present invention, including the exemplary embodiments described above, include without limitation ethylene vinyl alcohol copolymer (commonly known by the generic name EVOH or by the trade name EVAL™); poly(butyl methacrylate); poly(vinylidene fluoride-co-hexafluoropropylene) (e.g., SOLEF® 21508, available from Solvay Solexis PVDF of Thorofare, N.J.); poly(vinylidene fluoride) (otherwise known as KYNAR™, available from Atofina Chemicals of Philadelphia, Pa.); poly(tetrafluoroethylene-co-hexafluoropropylene-co-vinylidene fluoride); ethylene-vinyl acetate copolymers; poly(pyrrolidinone); poly(vinyl pyrrolidinone-co-hexyl methacrylate-co-vinyl acetate); poly(butyl methacrylate-co-vinyl acetate); and polyethylene glycol; and copolymers and combinations thereof. While several particular forms of the invention have been illustrated and described, it will also be apparent that various modifications can be made without departing from the scope of the invention. It is also contemplated that various combinations or subcombinations of the specific features and aspects of the disclosed embodiments can be combined with or substituted for one another in order to form varying modes of the invention. Accordingly, it is not intended that the invention be limited, except as by the appended claims.

Summary: An implantable prosthesis can comprise a strut having a lumen, radiopaque particles within the lumen, and a polymer binder. The polymer binder retains the radiopaque particles within the lumen. The strut may have side holes through which a therapeutic agent may pass and through which the radiopaque particles are incapable of passing. The polymer binder may be absent or optional. The radiopaque particles can have sizes that prevent them from escaping out of the lumen through the side holes. The radiopaque particles placed within the lumen can improve visualization of the prosthesis during an implantation procedure.

big_patent

en

Summarize: Washington (CNN) President Donald Trump hit hard at the news media at a rally Saturday in Pennsylvania to tout the accomplishments of his first 100 days, striking a tone both divisive and determined as he played to the populist sentiments of a cheering crowd. "It's time for all of us to remember that we are one people with one great American destiny, and that whether we are black or brown or white, we all bleed the same red blood of patriots, and we all share the same glorious freedoms of our magnificent country," Trump said, evoking the populist rhetoric of his inauguration speech after spending a large part of his Saturday remarks decrying the alleged shortcomings of the mainstream media. Among the crowd favorites at Trump rallies are the President's attacks on the press, and this was true again on Saturday, when many in the media were attending the annual White House correspondents' dinner in what Trump routinely calls the "swamp" of Washington -- setting up a prime-time duel with what has become his No. 1 foe, the media. "A large group of Hollywood actors and Washington media are consoling each other in a hotel ballroom in our nation's capital right now," Trump told the crowd. "They are gathered together for the White House Correspondents' dinner -- without the President. And I could not possibly be more thrilled than to be more than 100 miles away from Washington's swamp, spending my evening with all of you and with a much, much larger crowd and much better people." Trump held that divisive tone throughout the speech, prompting former presidential adviser and senior CNN political analyst David Gergen to call the remarks "deeply disturbing" in a special prime-time edition of "CNN Newsroom" with John Berman and Poppy Harlow. "This was the most divisive speech I have ever heard from a sitting American president," Gergen said. "Others may disagree about that. He played to his base and he treated his other listeners, the rest of the people who have been disturbed about him or opposed him, he treated them basically as, 'I don't give a damn what you think because you're frankly like the enemy.' I thought it was a deeply disturbing speech." JUST WATCHED Reagan adviser: Trump speech deeply disturbing Replay More Videos... MUST WATCH Reagan adviser: Trump speech deeply disturbing 00:59 Trump, who found his stride during the campaign in front of large, cheering crowds across the country in states where his populist message resonates, took the stage Saturday night alongside Vice President Mike Pence. "There is no place I'd rather be than right here in Pennsylvania to celebrate our 100-day milestone, to reflect on an incredible journey together," Trump said. As expected, the President also addressed some of the biggest issues he has tried to tackle during his first 100 days in office. The threat from North Korea, getting a health care bill passed and possibly renegotiating the Paris climate accord were among the big talking points of the nearly one-hour speech. "I'll be making a big decision on the Paris accord over the next two weeks, and we will see what happens," Trump said on the same day that protesters backing action on climate change took to the streets in Washington and other cities across the country as part of the "People's Climate March." While Trump's raucous rally was straight out of his campaign playbook, he also did something he rarely does -- call out US congressmen from Pennsylvania who were in attendance by name. "We're going to give Americans the freedom to purchase the health care plans they want, not the health care forced on them by the government," Trump said. "And I'll be so angry at Congressman (Mike) Kelly and Congressman (Tom) Marino and all of our congressmen in this room if we don't get that damn thing passed quickly." In addition to speaking at the rally, Trump signed two executive orders in Harrisburg, one directing a review all US trade agreements and the second establishing the Office of Trade and Manufacturing Policy. This marks the first time in 36 years that a sitting president has not attended and spoken at the White House correspondents' dinner. President Ronald Reagan missed the dinner while recovering in the hospital from an assassination attempt, but he still made remarks by phone. Richard Nixon was the last president to skip the dinner completely. The last time Trump attended the dinner was in 2011, when he was a New York real estate mogul and reality TV star who had just jumped into politics by getting involved in the "birther" movement, calling for President Barack Obama to release his birth certificate. Trump ended up being the butt of the jokes that night from comedian Seth Meyers and Obama himself. But no matter where he was, the spotlight was on Trump on Saturday since the day also marked a significant milestone in the career of a president. After serving as commander in chief for 100 days, his achievements, as well as shortfalls, were being closely scrutinized. On paper, Trump lacks a major legislative achievement, has the lowest approval ratings of any new commander in chief since World War II, has seen several key immigration goals held up by the courts and has failed to deliver the health care overhaul he promised again and again on the campaign trail. Trump's sole big win has been the successful nomination of Neil Gorsuch to the Supreme Court -- something a president hasn't done in his first 100 days since James Garfield appointed a justice within that time frame 136 years ago. Trump, a longtime critic of the number of Obama's executive orders, issued more executive orders in his first 100 days than any other president aside from Harry Truman. Trump's first 100 days have also been plagued with controversy, from appointing his daughter Ivanka and son-in-law Jared Kushner to key White House posts to dealing with allegations of possible ties between some of his campaign aides and Russia. His campaign promises on such major items as repealing and replacing Obamacare and overhauling the tax code -- things he rallied crowds with for months all over the country -- have yet to be enacted. Even his promise to build a wall on the border with Mexico has been caught up in a spending debate, with no support from Democrats and little to no progress being made. HARRISBURG, Pa. (AP) — President Donald Trump is turning from his dramatic debut as an outsider president to focus on advancing his plans to cut taxes and get tough on trade deals. "We are not going to let other countries take advantage of us anymore," he said Saturday in Harrisburg at the Pennsylvania Farm Show Complex and Expo Center. "From now on it's going to be America first." But even as he returned to friendly political turf in Pennsylvania, Trump seems caught between his role as an outsider candidate and that of a now-elected negotiator. He's still figuring out how to deal with the very insiders he vowed to drain from Washington's "swamp." He's spent 100 days being educated on the slow grind of government even in a Republican-dominated capital, and watching some of his promises —from repealing former President Barack Obama's health care law to temporarily banning people from some Muslim nations — fizzle. Even with his return to Pennsylvania, Trump seemed torn between who he was courting. He opened the rally with an extended attack on the media, pointing out that he was choosing to stay away from the annual White House Correspondents' Association dinner. "I could not possibly be more thrilled than to be more than 100 miles way from Washington's swamp," he said, "spending my evening with all of you and with a much, much larger crowd and much better people, right?" He then suggested that he might attend the dinner next year — but added that he'd also consider returning to Pennsylvania. The state was critical to Trump's victory over Democrat Hillary Clinton in November. Trump won Pennsylvania with 48 percent of the vote, the first time the state had voted for a Republican presidential candidate since George H.W. Bush in 1988. Trump visited the AMES Companies in Pennsylvania's Cumberland County, a shovel manufacturer since 1774. With that backdrop he signed an executive order directing the Commerce Department and the U.S. trade representative to conduct a study of U.S. trade agreements. The goal is to determine whether America is being treated fairly by its trading partners and the 164-nation World Trade Organization. Trump's rally Saturday night in Harrisburg offered a familiar recapitulation of what he and aides have argued for days are administration successes, including the successful confirmation of Neil Gorsuch to the Supreme Court, his Cabinet choices and the approval of construction of the Keystone XL pipeline. Meanwhile, North Korea's missile launch Saturday signaled its continued defiance against the U.S., China and other nations, on which Trump tweeted: "Bad!" Asked during an interview for CBS' "Face the Nation" if military action would follow a nuclear test by the North, Trump responded: "I don't know. I mean, we'll see." At the 100-day mark, polls suggest that Trump's supporters during the campaign remain largely in his corner. Though the White House created a website touting its accomplishments of the first 100 days, Trump has tried to downplay the importance of the marker, perhaps out of recognition that many of his campaign promises have gone unfulfilled. "It's a false standard, 100 days," Trump said while signing an executive order on Friday, "but I have to tell you, I don't think anybody has done what we've been able to do in 100 days, so we're very happy." Trump is turning to what he's billed as the nation's biggest tax cut. It apparently falls short of Reagan's in 1981, and tax experts are skeptical that the plan would pay for itself, as Treasury Secretary Steve Mnuchin has claimed. The economy, so far, has been Trump's ally. Polls show that Americans feel slightly better about his job performance on that subject than his job performance overall. ___ Associated Press writers Jon Lemire and Jill Colvin contributed to this report. ___ Follow Kellman on Twitter at http://www.twitter.com/APLaurieKellman

Summary: President Trump on Saturday marked his 100th day in office by claiming historic action on his agenda, reports the AP, renewing promises on health care and taxes and attacking the news media that he says is misleading Americans in a rally in Harrisburg at the Pennsylvania Farm Show Complex and Expo Center. Declaring his "only allegiance is to you, our wonderful citizens," Trump signed executive orders toughening the nation's posture on trade deals. "We are not going to let other countries take advantage of us anymore," he said. "From now on, it's going to be America first." But even as he appealed to Pennsylvania voters who helped elect him in a surprise win over Hillary Clinton, Trump seemed caught between his role as an outsider candidate and a now-elected negotiator still figuring out how to deal with the very insiders he vowed to drain from Washington's "swamp." Trump opened the rally with an extended attack on the media, pointing out that he was choosing to stay away from the annual White House Correspondents' Association dinner, which he called "a large group of Hollywood actors and Washington media... consoling each other in a hotel ballroom," per CNN. "I could not possibly be more thrilled than to be more than 100 miles way from Washington's swamp," he said, "spending my evening with all of you and with a much, much larger crowd and much better people, right?" He then suggested that he might attend the dinner next year-but said he'd also consider returning to Pennsylvania. The economy, so far, has been Trump's ally. Polls show that Americans feel slightly better about his job performance on that subject than his job performance overall. "In just 14 weeks, my administration has brought profound change to Washington," Trump said in his weekly radio and internet address.

multi_news

en

Summarize: The fascinating surface of Jupiter's icy moon looms large in this newly-reprocessed image, which is exactly how Europa would appear to the human eye. The image, remastered from one captured by Galileo in the late 1990s, shows the largest portion of the moon's surface at the highest resolution ever seen. Long cracks crisscross the surface, interrupted by dramatic ridges where the surface ice crust has been broken up and re-frozen into new patterns. Scroll down for video. The fascinating surface of Jupiter's icy moon looms large in this newly-reprocessed image, which is exactly how Europa would appear to the human eye. The image, remastered from one captured by Galileo in the late 1990s, shows the largest portion of the moon's surface at the highest resolution ever seen. It has scale of one mile (1.6 km) per pixel. North on Europa is shown on the right, and the colours across the surface are associated with differences in geologic feature and location. For instance, areas that appear blue or white contain relatively pure water ice, while reddish and brown areas include non-ice components in higher concentrations. It is not yet known what these components are, although Nasa has speculated that it may be a clay-like material. The polar regions, visible at the left and right of this view, are noticeably bluer than the more equatorial latitudes, due to differences in ice grain size. Galileo images taken through near-infrared, green and violet filters have been combined to produce this view, which has a scale of one mile (1.6 km) per pixel. Nasa attempted to create a similar image in 2001 (pictured). This features colour profiles that had been increased to make contrast across the surface more obvious. The latest image, however, is more similar to what a human would see with the naked eye. Jupiter's icy moon Europa is slightly smaller than Earth's moon. Europa orbits Jupiter every 3.5 days and is tidally locked - just like Earth's Moon - so that the same side of Europa faces Jupiter at all times. It is thought to have an iron core, a rocky mantle and a surface ocean of salty water, like Earth. Unlike on Earth, however, this ocean is deep enough to cover the whole surface of Europa, and being far from the sun, the ocean surface is globally frozen over. Many experts believe the hidden ocean surrounding Europa, warmed by powerful tidal forces caused by Jupiter's gravity, may have conditions favourable for life. Scientists claim that hidden beneath the icy surface of this incredible landscape is perhaps the most promising place in our solar system beyond Earth for life to exist. They are eager to learn if the reddish-brown fractures, and other markings spattered across the surface, contain clues about the geological history of Europa and the chemistry of the global ocean that is thought to exist beneath the ice. The Galileo mission found strong evidence that a subsurface ocean of salty water is in contact with a rocky seafloor. Scientists believe the cycling of material between the ocean and ice shell could potentially provide sources of chemical energy that could sustain simple life forms. It is believed that geysers spurting out of Jupiter’s moon may be an opportunity to spot alien life originating beneath the surface. This was based on observations by the Hubble Space Telescope in December 2013 that saw water vapour being ejected from the moon, lending evidence to the existence of jets. In September, Jupiter’s moon Europa has been found to have tectonic activity like Earth. This was the first time this specific type of geological activity has been observed in the solar system other than on our planet. The surface of Europa is slightly smaller than the Earth’s moon. Blocks on the surface are known to have shifted in the same way blocks on either side of the San Andreas Fault move past each other on Earth. Earlier this year, scientists found evidence of plate tectonics on Jupiter's moon Europa. This conceptual illustration of the subduction process - where one plate is forced under another - shows how a cold, brittle, outer portion of Europa's ice shell moved into the warmer shell interior. This view an impact crater on Europa was created in 2013 using 3D stereo images taken by the Galileo spacecraft, combined with advanced image processing techniques. The crater has a diameter of about 11 miles (18km.) Young, well-preserved craters, like this Cilix crater, are rare on Europa's surface, where ongoing geologic activity is thought to disrupt most surface features over timescales of tens of millions of years

Summary: The stunning image shows the largest portion of Jupiter's moon's surface at the highest resolution ever seen. North on Europa is on the right, and colours across surface are associated with different geological features. It was created by combining image taken by Galileo in the 1990s and has a scale of one mile (1.6 km) per pixel. Hidden beneath Europa's icy surface of is perhaps the most promising place in our solar system beyond Earth.

cnn_dailymail

en

Summarize: The present invention relates to a method for the production of endosseous implants, and more particularly to an improved method for the production of endosseous implants which do not dissolve out metal ions. BACKGROUND OF THE INVENTION The implantology which comprises the insertion of artificial materials such as artificial organs, artificial blood vessels, artificial joints, artificial bones and artificial tooth roots into living bodies so as to recover lost parts of living bodies or their functions has received much attention in recent years. It is said that a trial of implantation goes back to ancient times. Particularly in these ten-odd years, a huge number of treatments by implantation have been performed on bones and tooth roots to afford good results in the remedy of the defects or recovery of functions thereof. However, there has not yet been obtained an articial bone or tooth root which satisfies the necessary requirements as material for living bodies, i.e. affinity to living bodies, safety, and excellent durability. As metallic materials which have mainly been used for preparation of artificial bones or tooth roots, cobalt-chromium alloys, stainless steel, titanium and tantalum are exemplified. On the other hand, as ceramic materials, alumina or materials comprising predominantly carbon have been recently taken note of. Although metallic materials have excellent mechanical strength, particularly impact strength, they are deficient in their affinity to tissues of living bodies. For example, when a metallic implant is used, metal ions are dissolved out therefrom in living bodies and affect a toxic action to bone cells around the implant. Furthermore, the bone-formation is obstructed probably because the thermal conductivity of the metallic implant is too high. Among the metallic materials, titanium and tantalum are particularly superior in a corrosion-resistance and hence have been employed as fixing plates for skulls or fractured parts of bones and implants for jawbones since about 1940, but these are not necessarily satisfactory. To the contrary, ceramic materials show generally a good affinity to bones, and hence tissues penetrate into fine pores of the ceramic materials to afford a strong fixation, without reaction between the ceramic material and the tissue. Besides, they are also excellent in durability, that is, they are resistant to corrosion decomposition. On the other hand, they posses poor impact strength. There has been proposed an implant having the characteristics of both of metallic materials and ceramic materials, i.e. an implant prepared by thermally spraying a ceramic material onto the surface of a metallic core material (cf. Japanese Patent First Publication Nos. 14095/1977, 82893/1977, 28997/1978 and 75209/1978). In these methods, however, a self-bonding type bonding agent is used in order to improve the adhesion of the ceramic coating layer. The bonding agent has a problem in that it contains nickel, chromium, etc. which dissolve out in living bodies and exhibit toxicity to living bodies. SUMMARY OF THE INVENTION The present inventors have intensive conductive studies develop improved endosseous implants which have excellent impact strength and hence resistance to cracking while keeping the excellent properties of ceramic materials and further do not dissolve out toxic metal ions, and have now found that the desired endosseous implants can be prepared by thermally spraying a ceramic material onto a metallic titanium core material which is previously subjected to surface oxidation. An object of this invention is to provide an improved endosseous implant which has excellent characteristics of both of a metallic material and a ceramic material and does not dissolve out toxic metal ions. Another object of the invention is to provide an improved method for producing the excellent endosseous implant by thermally spraying a ceramic material onto a metallic titanium core material which is previously subjected to a surface oxidation treatment. A further object of the invention is to provide a method for producing the excellent endosseous implant without using any bonding agent which contains toxic metal ions. BRIEF DESCRIPTION OF DRAWINGS The present invention will become more fully understood from the detailed description given hereinbelow and the accompanying drawings which are given by way of illustration only, and thus are not limitative of the present invention, and wherein: FIG. 1 is a schematic view of an embodiment of the endosseous implant for a lower jawbone of dog, wherein 1 represents the lower jawbone, 2 and 3 are natural teeth, 4 is an artificial tooth root and 5 is an artificial tooth crown attached on the artificial tooth root 4. FIG. 2 is a partially lacked schematic view of an embodiment of the endosseous implant for a jawbone of a blade type according this invention, and (A) is a front view thereof and (B) is a side view thereof, wherein 6 represents a surface-oxidized metallic titanium core material and 7 and 8 are each a thermally plasma sprayed layer comprising predominantly ceramics. FIG. 3 is a graph showing a correlation between a heating temperature of titanium material and an adhesion strength of the coating layer formed by the thermal plasma spray. FIG. 4 is a graph showing a correlation between a heating temperature of titanium material and a change of the elastic modulus of the titanium material. DETAILED DESCRIPTION OF THE INVENTION According to the present invention, as is shown in FIG. 2, a ceramic coating is applied to the surface of a metallic implant core material so as to obtain an implant being hardly breakable with a sufficient impact strength and acting to the surrounding bone tissues in a similar manner as ceramic materials. The metallic core materials used in this invention include any conventional titanium materials which have usually been used as artificial materials for bones, joints and tooth roots which do not exhibit harmful influences on living bodies and possess an appropriate mechanical strength, for example, titanium and titanium alloys (e.g. 6% Al-4% V-Ti, etc.). The ceramic materials used in this invention include hydroxyapatite, calcium phosphate, aluminum oxide, zirconium oxide, titanium oxide, and the like, which may be used alone or in combination of two or more thereof. In order to control the pores in the ceramic layer, porcelain may be applied by thermally spraying together with the ceramic material or by baking on the ceramic coating layer. For such a purpose, there can be used porcelains such as Dentin and Enamel. Among the ceramic materials, preferred ones are hydroxyapatite and aluminum oxide in view of their excellent affinity with living bodies. A combination of hydroxyapatite and aluminum oxide is particularly suitable because it is most intimate with living bodies. The endosseous implants of this invention can be produced in the following manner. The metallic material is formed into the desired shape by conventional methods, such as cutting, casting, forging, punching, electro arc machining, laser-processing, and powdered metal techniques. The surface of the metallic titanium core materials thus formed may be made rough, for example, by mechanical methods such as grinding, sandblasting, grit blasting, etc.; chemical etching such as treatment with an acid or alkali; electrolytic etching; and the like, prior to subjecting to the surface oxidation treatment. The surface oxidation treatment of the metallic titanium core material can be carried out by various methods, for example, by heat-treatment in air, an anodizing process, and the like, but preferably by heat-treatment in air. The heat-treatment is preferably done at a temperature of 400° to 800° C. When the temperature is lower than 400° C., the ceramic coating layer formed by the thermal spray shows inferior adhesion. On the other hand, when the temperature is higher than 800° C., the strength of the materials is deteriorated and further the surface oxide becomes too thick which causes a lowering of the adhesion of the coating layer. Preferred heating temperature is in the range of 450° to 550° C. in view of the excellent adhesion of the coating layer and the strength of the materials. The heat-treating period of time is not specified, but is preferably in the range of 1 to 100 minutes in the practical viewpoint. The heat-treatment of the metallic titanium core material is usually carried out in a conventonal electric furnace or gas furnace. In the thermal spraying of ceramic materials, the portion which is not coated with the ceramic material is previously masked by an appropriate means, for instance, application of a marking ink, an aluminum adhesive tape, etc., prior to the treatment for making the surface rough. The thermal spraying of the ceramic material is also preferably carried out by a thermal plasma spraying apparatus. Some portions of the endosseous implants, for instance, the ceramic coating layer in artificial joints, are required to have high smoothness. In such a case, a porcelain is coated onto the surface and the coated product is repeatedly calcined in a vacuum furnace. In the endosseous implants of this invention, the thickness of the ceramic coating layer which optionally contains the porcelain is not particularly limited, but is preferably in the range of 10 to 200 μm. This invention is illustrated by the following Examples but should not be construed to be limited thereto. EXAMPLE A core material for an endosseous implant is prepared by using a titanium material (JIS, second class of material) in the following manner, i.e. by cutting and grinding the titanium material by electro arc machining. The metallic core material for implant is gritblasted with a blast apparatus (a mammoth type ventiblast apparatus, manufactured by Metco Inc., England; blasting agent: Metcolite VF, manufactured by Metco Inc.; pressure: 30 psi). The plasted core material is heat-treated at 500° C. for 10 minutes. Thereafter, under generation of argonhydrogen-plasma jet flame (ARC electric current 500 Amp) by a plasma spray apparatus (6MM-630 type, manufactured by Metco Inc., equipped with an electric power supplier), a ground mixture of hydroxyapatite (particle size: 10-100 μm, 80% by weight) and aluminum oxide (WA #120, manufactured by Nippon Kenmazai K.K., 20% by weight) is thermally sprayed to form a coating layer having an average thickness of about 150 μm. The thermally sprayed coating layer has excellent adhesion, and even when the product is subjected to a bending process at an angle of 160°, the coating layer is not peeled off. The product obtained above was tested as follows: The implant was embedded into the lower jawbone of dog. After 3 months, it was observed by X-ray fluoroscopy. As a result, there was confirmed the formation of dense bone around the implant. The correlations of the temperature in the heat-treatment with the adhesion of the coating layer and also with the elastic modulus of the core material are shown in the accompanying FIG.3 and FIG. 4, respectively, wherein the data in the Reference Example are also shown. The sample (width 5 mm×thickness 1 mm×length 50 mm) used in the test was prepared from the same material as used in the Example in the same manner. The adhesion of the coating layer and the elastic modulus of the core material were measured by a three-point bending test where the sample was kept at a span distance of 30 mm. As is clear from FIG. 3 and FIG. 4, the temperature for the heat-treatment is preferably in the range of 400° to 800° C. REFERENCE EXAMPLE A core material for an endosseous implant is prepared by using the same titanium material in the same manner as described in Example. The core material is subjected to grid blasting likewise, but is not subjected to heat-treatment. The blasted core material is thermally sprayed with a powdery mixture of titanium oxide and aluminum oxide in a layer having an average of about 50 μm as the first coating layer, and then further thermally sprayed thereon with a mixture of hydroxyapatite and aluminum oxide in a layer having an average of about 150 μm as the second coating layer. The resulting product has significantly inferior adhesion of the coating layer and the coating layer is easily peeled off even by a light impact. This product cannot be used as an endosseous implant. Thus, according to the present invention, by thermally spraying a ceramic material on the surrounding suface of a metallic titanium core material which is surface-oxidized, there can be produced excellent endosseous implants which improve the defect of ceramic implants being easily breakable while keeping excellent characteristics of the ceramic material. The present implants have excellent mechanical strength of metallic material and further can act to the surrounding bone tissues in a similar manner as ceramic material.

Summary: An improved method for producing endosseous implants by thermally spraying a ceramic material onto the surface of a metallic titanium core material which is previously subjected to a surface oxidation treatment, which can yield implants which have excellent characteristics of both of the metallic material and ceramic material and do not dissolve out harmful metal ions. The endosseous implants are useful for implantation in various bones including tooth roots and joints in living bodies.

big_patent

en

Write a title and summarize: In everyday life, we have to decide whether it is worth exerting effort to obtain rewards. Effort can be experienced in different domains, with some tasks requiring significant cognitive demand and others being more physically effortful. The motivation to exert effort for reward is highly subjective and varies considerably across the different domains of behaviour. However, very little is known about the computational or neural basis of how different effort costs are subjectively weighed against rewards. Is there a common, domain-general system of brain areas that evaluates all costs and benefits? Here, we used computational modelling and functional magnetic resonance imaging (fMRI) to examine the mechanisms underlying value processing in both the cognitive and physical domains. Participants were trained on two novel tasks that parametrically varied either cognitive or physical effort. During fMRI, participants indicated their preferences between a fixed low-effort/low-reward option and a variable higher-effort/higher-reward offer for each effort domain. Critically, reward devaluation by both cognitive and physical effort was subserved by a common network of areas, including the dorsomedial and dorsolateral prefrontal cortex, the intraparietal sulcus, and the anterior insula. Activity within these domain-general areas also covaried negatively with reward and positively with effort, suggesting an integration of these parameters within these areas. Additionally, the amygdala appeared to play a unique, domain-specific role in processing the value of rewards associated with cognitive effort. These results are the first to reveal the neurocomputational mechanisms underlying subjective cost–benefit valuation across different domains of effort and provide insight into the multidimensional nature of motivation. Neuroeconomic theories highlight that a key component of motivation is evaluating whether potential rewards are worth the amount of effort required to obtain them [1,2]. Behaviours are executed if they have sufficient “subjective value” (SV), which is based on how much a potential reward is discounted—or devalued—by the effort required to obtain that outcome [3]. A characteristic of these cost–benefit valuations is that they are inherently highly subjective and thus vary across individuals [4–6]. Some people are willing to invest a quantum of effort for a reward that others would not. However, not all types of effort are subjectively evaluated in the same manner. Some individuals may be willing to overcome physically demanding challenges but be averse to mental effort, while others might show the opposite profile. Understanding the mechanisms that underlie cost–benefit valuations across different domains of effort is crucial to understanding the variability in people’s motivation [7,8], but little is known of the neural or computational basis of these mechanisms. Current theories of value-processing suggest that the computation of SV occurs in a common, domain-general network of brain regions [9]. Single-cell and neuroimaging studies have implicated areas within the basal ganglia and parieto-prefrontal cortices in the computation of SV for rewards that are devalued by costs such as risk, delays, or probability [9,10]. Separately, research on effort-based decision making has implicated areas including the anterior cingulate cortex (ACC) (area 32’), dorsolateral prefrontal cortex (dlPFC) (areas 8/9), anterior insula (AI), intraparietal cortex (area 7), and several amygdala nuclei [11–16]. However, critical unanswered questions are whether these effort-sensitive areas compute the subjective value of discounted rewards associated with effort costs and whether these areas are differentially sensitive to the nature of those costs. To date, most research on effort-based decision making has either focused on the cognitive or physical domains in isolation [4,17–19]. The only previous study to have examined the neural mechanisms associated with different types of effort required participants to perform a cognitively or physically demanding task [20]. Importantly, however, participants in that study were not engaged in the choice of whether it was worthwhile to invest effort for reward. Thus, although this study was useful in examining how the brain motivates the exertion of different effort costs, the neural substrates that underlie the subjective valuation of reward—and the decision of whether to engage in an effortful action—remain unknown. Increasingly, these decision processes are being recognised as a critical component of motivated behaviour, with evidence that aberrant effort-based decision making may be a key element of motivational disorders such as apathy [18,19,21]. Here, we used the computation of SV as a key operation to understand cost–benefit decision making across the domains of cognitive and physical effort [9,22–24]. In contrast to classical accounts, recent research in animals suggests that the mechanisms that underpin cognitive and physical effort discounting might be separable. For example, animal studies of the amygdala have causally linked it to motivation and the devaluation of reward by effort costs [25,26]. Recently, however, a novel rodent decision-making task showed dissociable effects of amygdala and frontal lesions on cognitive effort–based decisions [27]. Specifically, amygdala and ACC inactivations caused changes to behaviour during a cognitive effort task [27] that were different to those in physical effort tasks [2,25,26]. Furthermore, amygdala inactivation influenced individual animals differently, suggesting that the amygdala may play a distinct role in subjectively valuing rewards associated with cognitive effort. Such findings suggest that the computation of SV in the context of effort may not be within a domain-general network of valuation areas, as is often argued [9]. To establish whether the SV of different effort costs are processed within domain-general or domain-specific brain systems, the current study directly examined whether the neural mechanisms underlying subjective reward valuation are sensitive to different types of effort. We first trained participants on two tasks that were closely matched on many properties that are known to influence the valuation of a reward (e. g., probability, duration prior to outcome) [28] but differed in whether cognitive or physical effort was required to obtain rewards. In each, we parametrically varied effort in one domain while holding the demands of the other constant. Then, while being scanned with functional magnetic resonance imaging (fMRI), participants chose between a fixed low-effort/low-reward “baseline” option and a variable higher-effort/higher-reward “offer. ” Central to our paradigm was the use of computational models to calculate the SV of each effort and reward combination relative to the baseline option for individual subjects, which allowed us to calculate subject-specific discounting parameters for each of the cognitive and physical effort tasks. Using model-based fMRI, we then identified regions in which blood oxygen level–dependent (BOLD) activity correlated with these parameters. This revealed that cognitive and physical effort discounting occurred in largely overlapping neural areas, but in addition, the right amygdala contributed uniquely to cognitive effort valuation. In the cognitive effort task [4], we employed a rapid serial visual presentation (RSVP) paradigm [29], in which participants fixated centrally while monitoring one of two target streams to the left and right of fixation for a target number “7” (Fig 1A). Each target stream was surrounded by three distractor streams. The target stream to be monitored was indicated at the beginning of the trial by a central arrow and, during the trial, participants had to simultaneously monitor the central stream for a number “3, ” which would be a cue to switch their attention to the opposite target stream. We parametrically varied the amount of cognitive effort over six levels by increasing the number of times attention had to be switched between streams from one to six. We previously confirmed that this task was able to manipulate perceived cognitive effort while controlling for physical demands and reinforcement rates [4]. In the physical effort task, participants exerted one of six different levels of force on a handheld dynamometer (Fig 1B). The effort levels for each participant were defined as proportions of their individually calibrated maximum voluntary contraction (MVC) (8%, 13%, 18%, 23%, 28%, and 33%), as determined at the beginning of the experiment. The duration of each of the cognitive and physical effort trials was identical (14 s), ensuring that participants’ choices were not due to temporal discounting [30,31]. Participants were first trained on each of the cognitive and physical effort tasks outside the scanner in counterbalanced order. They undertook an extensive training session of 60 trials for each task to familiarise themselves with the effort associated with each level in each domain and so that we could estimate performance measures for each task (see Materials and Methods). Participants were told that their reimbursement at the end of the study would be contingent on performance and that for each trial that they performed well, they would be awarded one credit, which would be later converted into a monetary amount. This training resulted in participants being rewarded on over 80% of trials, and a repeated-measures ANOVA revealed that, although there was a significant effect of effort (F (1. 7,57. 2) = 7. 48, p <. 005), neither the main effect of domain nor its interaction with effort were significant (p >. 05; S1 Fig). Importantly, this indicates that the reinforcement rates did not differ between tasks and ensured that subsequent effort-based decisions in the two domains could not be confounded by participants’ belief that they would be differentially successful at obtaining rewards across the two tasks. The critical choice phase occurred after the training phase, while participants were being scanned with fMRI (Fig 1C). During this phase, participants made cost–benefit decisions for the cognitive and physical effort tasks separately. On each trial, they were presented with a fixed low-effort/low-reward “baseline” option and a variable high-effort/high-reward “offer. ” The baseline option was an opportunity to perform the lowest level of effort for one credit, while the offer presented a higher number of credits (2,4, 6,8, or 10 credits) for having to invest a greater amount of effort (levels 2–5). Importantly, by providing participants with the identical range of reward options for both cognitive and physical effort, we could disentangle how cognitive and physical effort differentially devalued the identical rewards. In addition, in order to eliminate the effect of fatigue on participants’ decisions, they were not required to execute their choices within the scanner. Instead, they were instructed that they would be required to perform a random selection of ten of their choices at the conclusion of the experiment and that their remuneration would be based on these randomly selected trials. Because separate decisions were made for the cognitive and physical tasks, we were able to estimate the extent to which the same amount of reward was devalued within each domain for each participant. An important feature of our design was that we temporally separated the presentation of the offer from that of the response cue. Thus, participants did not know which button corresponded to the baseline or offer until the onset of the response prompt. This ensured that we could examine activity time-locked to a cue from which SV would be processed independently, with activity related to these events not confounded by preparatory motor activity. Using the modelling parameters derived above, we computed the SV for the effort and reward combinations on every trial and used the difference in value between the SV of the chosen offer and the value of the baseline as a parametric regressor modelled to the onset of the offer cue [37]. Many studies have shown that regions we hypothesised would be engaged by cost–benefit valuations are sensitive to the difference in the SV of two options rather than to the SV of an offer per se [31,37]. Thus, we fitted the SV difference on each trial within the cognitive domain as a parametric modulator time-locked to the onset of each cognitive offer and performed the corresponding analysis for offers in the physical domain. This allowed us to examine activity covarying with SV for the cognitive and physical domains separately. These parametric modulators were defined based on the discounting parameters estimated for each participant’s choice behaviour. We considered significant those voxels which survived whole brain–level, voxel-wise corrections for multiple comparisons (p < 0. 05, corrected for family-wise error [FWE]). We used model-based fMRI to determine whether shared or separate neurocomputational mechanisms underlie cost–benefit valuation in the cognitive and physical domains. Computational modelling revealed that individuals were differentially sensitive to cognitive and physical effort. Neuroimaging data showed that activity in several areas previously implicated in effort processing covaried with the subjective value of rewards independent of effort domain. This included the dACC, dmPFC, dlPFC, IPS, and anterior insula. Importantly, activity within many of these areas also covaried with absolute reward and effort levels, suggesting an integration of these parameters within these areas. However, in contrast to the view that SV is processed in an entirely domain-general manner, an ROI analysis revealed that the right amygdala appeared to process SV uniquely for rewards associated with cognitive and not physical costs. Importantly, none of these results could be explained by choice difficulty or perceived risk. Together, these data indicate that cost–benefit valuation in the human brain is underpinned mostly by a common, domain-independent mechanism but that the amygdala may play an important role in valuing rewards associated with cognitive effort. These results therefore suggest that the classical view of a domain-general set of brain regions for valuation cannot fully account for the subjective valuation of rewards associated with all effort costs [9]. To our knowledge, no study to date has examined the neural correlates of SV associated with cognitive versus physical effort in a single paradigm. The only study that has addressed the nature of cognitive and physical effort examined the processing of raw magnitudes of effort and reward without considering individuals’ subjective valuations and did not require subjects to make choices about whether the effort was worth exerting to obtain the reward [20]. Such an approach is common in the literature and assumes that rewards have a similar effect across individuals to exert the associated effort [11,13,43,44]. However, preferences vary depending on subject-specific cost–benefit valuations, and SVs potentially afford a more sensitive measure of capturing individual differences in motivation [9,22,23,45]. Furthermore, SV has been proposed as an important entity in understanding apathy in healthy individuals as well as those with clinical disorders of motivation [8,21,46]. Defining the neural and computational mechanisms that underlie the choice to exert effort for reward is therefore crucial to understanding the variability in motivated behaviour across individuals. In the present study, by parametrically varying effort across six levels in both domains, we were able to computationally model SVs for individual participants and therefore more closely examine the key computations that underpin choice behaviour and motivation. Our paradigm had several other advantages. First, the protocol involved manipulating effort in two separate domain-specific tasks, as opposed to requiring participants to exert a combination of both forms of effort to attain specific rewards in each trial [20]. We were therefore able to examine choice behaviour for identical rewards in each domain independently. Second, although many studies have examined the processing of effort and reward, the majority may have been confounded by motor execution for the choices or preparatory activity related to an upcoming effortful exertion. In the design used here, it was possible to investigate activity specifically related to decisions based on SV by temporally separating the choice process from the preparation or execution of the effortful act. Third, by controlling the temporal parameters of both the cognitive and physical effort tasks, it was possible to eliminate delay discounting as an explanation of choice behaviour [5,47,48]. Fourth, by using computational modelling approaches, we were able to examine activity that varied with SV. Finally, by ensuring that reinforcement rates were similar for the six levels of effort within and across domains, it was possible to ensure that probability discounting could not have contributed to our findings. Thus, the study reported here isolates the effect of SV on choice and motivation independently of many effects that can confound studies examining effort-based decision making. As such, we can effectively rule out the possibility that several regions that we identified were only related to the energisation of behaviour and not to motivation or the valuation of behaviour [49]. Our model comparisons indicated that individuals valued rewards differently when associated with cognitive and physical effort. This was demonstrated by the winning model, which specified separate discounting functions requiring separate discounting parameters for cognitive and physical effort. This conclusion was also supported by the more general pattern of the computational modelling results, which showed that the models assuming equal reward devaluation across cognitive and physical effort (i. e., those assuming a single discounting parameter) provided poorer fits than those that assumed separate discounting parameters. This finding that different functions best fitted cost–benefit valuations for cognitive and physical effort most likely reflects differential sensitivities to effort in the two domains. Our finding that a parabolic function best accounts for participants’ choice behaviour in the physical effort task is in keeping with previous observations [33]. In contrast, effort discounting in the cognitive domain has been much less studied [6], and it is likely that the specific shape of a discounting function will depend on the specific cognitive faculty being tested (e. g., attention versus working memory). However, the key point for the present study is that, in the tasks that we used, identical rewards were valued distinctly across both domains. Strikingly, despite rewards being devalued at different rates and in a mathematically distinct manner across the two domains, a largely overlapping network of regions was involved in processing the SV of rewards devalued by both the cognitive and physical effort cost. It is important to note that this finding does not rely on the generalisability of these specific functions to other cognitive or physical effort–based tasks. However, the fact that effort discounting in our task is best described by separate functions does considerably strengthen this result, as it implies that any differences between cognitive and physical effort cannot simply be a matter of scale (e. g., some participants finding one task more effortful than the other). Rather, it suggests a possible difference in the underlying mechanism between the two processes. Furthermore, the separate discounting functions render the imaging results more compelling by showing that the SVs computed from entirely different functions nevertheless engage overlapping brain regions. Regardless, a question that remains is whether the same pattern of results would be achieved in a cognitive and physical effort task that were best described by the identical discounting function. Exploratory analyses using a single function to model choice across both domains revealed a pattern of domain-general and domain-specific effects that were essentially similar to those of the primary analyses. However, it remains for future studies to verify the conclusions from our study in the case of cognitive and physical effort tasks that are best described by identical discounting functions. Interestingly, most of the domain-general areas that encoded subjective value also showed a significant negative effect of reward and a significant positive effect of effort. The findings that many domain-general areas that encode SV also encode raw reward and effort levels are not incompatible—indeed, one interpretation is that these regions integrate the reward and effort on offer into a value signal. Although many previous studies have examined the neural basis of processing SV [9], we believe this is one of the first demonstrations that regions of the brain can process a SV formed from costs that devalue rewards at different rates. Furthermore, although some of these domain-general regions may be involved in processing decision difficulty in certain contexts [50], this is not always the case [51], and none of the regions identified in the present study were found to encode choice difficulty across both the cognitive and physical domains. The key to elucidating the neural basis of cost–benefit decision making will be understanding how this domain-general network learns or forms a valuation of rewards associated with different forms of effort [15,22]. A central role of the dorsal ACC/dmPFC in value-based decision making and motivation is considered by some to be in signalling the value of a behaviour in comparison to alternatives [52,53]. The study reported here extends this notion by showing that this region not only processes the SV of an offer but also integrates effort and reward information independent of the nature of the effort cost [50,52,54]. In addition, single-unit studies have shown that dACC/dmPFC neurons signal the net value of rewards associated with effort, and the necessity of this region in cost–benefit valuation has been demonstrated by lesion studies that report that inactivation of medial prefrontal cortex impairs an animal’s ability to overcome effort costs [15,16,25,48,55]. Recently, several human studies have also shown this region to be important in calculating choice value for effortful rewards. Although the majority of these have been in the physical domain [11,13,14], a recent investigation reported a similar pattern for cognitive effort [56]. Neurons sensitive to reward information have been identified in the dlPFC [55,57–59], and the activity of lateral prefrontal areas in humans correlates with predicted SVs that guide decision making [60]. Lateral intraparietal neurons have been found to signal expected value [61], and parietal activity has been reported in tasks requiring value comparisons [62,63]. Lastly, insular activity is negatively correlated with the SV of rewards associated with higher effort [14,64], and dopaminergic responses, which play an important role in motivated decision making, exhibit greater variability in the insula with less willingness to expend effort for reward [65]. Our findings extend this body of data by showing that the process of subjective reward valuation occurs independent of the nature of effort costs, and suggest that it is underpinned by activity in a the dACC/dmPFC, dlPFC, IPS, and anterior insula. Do these regions of domain-independent areas comprise a network for subjective valuation? Tracer studies in macaque monkeys and neuroimaging studies in humans suggest that these domain-independent regions are monosynaptically connected. The upper bank of the dorsal anterior cingulate sulcus is connected to the anterior portions of the insula, several amygdala nuclei, and BA 9/46 in the lateral prefrontal cortex. Similar projections exist between each of these locations and the other domain-independent regions within this putative network [42,66–69]. In addition to the connectional anatomy, it has been noted that these same domain-independent regions are activated during a variety of different cognitive and motor control tasks [70,71]. It has been argued that this multiple-demand (MD) network is involved in flexibly controlling the cognitive processes required across a large number of tasks [70]. In this context, our results could be taken as support for the notion that this network is activated independent of the nature of the cost or associated behavioural domain. However, our findings also suggest a more nuanced interpretation of the functional properties of the MD network. In our study, activity in this network was influenced by the value of working and not by the demand alone. Moreover, as highlighted above, these areas contain single neurons that respond to reward valuations, and the BOLD signal in these regions has been shown to scale with subjective reward valuations in studies investigating temporal discounting or probabilistic reward-based decisions. Thus, a more refined account might be that the MD network is crucial for motivating behaviours across different domains of behaviour. Such a notion would explain why these regions are activated during many cognitive and motor tasks in which motivation must be sustained for successful performance [72]. Importantly, we found evidence of domain specificity for cognitive effort valuation, specifically in the right amygdala. The amygdala is known to play an important role in reward valuation, and single-unit recordings have demonstrated that neurons here encode the value associated with individual items [26,73–75]. Recent evidence points to the amygdala as playing a crucial role in effort-based decision making in rodents, with neurophysiological data showing that the amygdala plays an important role in valuing effort [40,41]. Recently, some have proposed that the amygdala is sensitive to different types of effort costs [27] and also highlighted the key role for this region in the flexible control of cognitive processes. However, drawing a definitive conclusion, especially in humans, requires comparisons across species and across tasks. Substantial differences exist between the paradigms used in valuation studies and include differences in reinforcement schedules, training intervals, reward magnitudes, and contrast effects. Furthermore, previous effort-based tasks have not tightly controlled the contributions from each domain to their manipulations of effort, thus making it difficult to compare the relative contributions of the two domains. Indeed, such discrepancies may even underlie varying amygdala involvement in cost–benefit decision-making tasks across cognitive and physical effort. In our study, we designed each of our closely matched tasks to hold all features constant except for the type of effort involved, which was maximised in each domain relative to the other. We were therefore able to provide more direct evidence that the human amygdala may be differentially involved in cognitive over physical effort valuation. Nevertheless, while our result is consistent with the preceding studies noting potentially dissociable roles of the basolateral amygdala for cognitive and physical effort–based decisions, the finding of amygdala domain specificity does deserve replication in future studies and would be even more compelling if it was demonstrable at a whole-brain level. Interestingly, previous studies have shown that the VS and vmPFC are engaged when processing value [20,39,76]. Here, we found no such activity for either cognitive effort, physical effort, or the conjunction. This was the case even after specifically probing these areas with regions of interest defined on the basis of previous studies. A key difference between this study and all previous studies implicating the VS and vmPFC in value processing is that previous tasks required effort to be exerted while participants were being scanned, and most of the effects may have been related to the execution of the effortful task rather than to the choice of whether the effort was worth exerting. This may suggest that the VS and vmPFC process value primarily when value may guide or motivate the execution of a behaviour that will be followed immediately by a rewarding outcome, rather than in the evaluation of whether resources should be allocated to a task at all. Rewards in real life are rarely obtained without effort. Our model-based fMRI approach revealed that effort discounting in the cognitive and physical domains is underpinned by largely shared neural substrates but that the amygdala uniquely contributes to cognitive effort valuation. Importantly, neither delay nor probability discounting can account for our results. It has been postulated that disorders of diminished motivation—such as apathy and abulia—which are manifest in multiple neurological and psychiatric conditions, may be characterised as a diminished willingness to exert effort for reward [46,77]. Our findings may therefore help us understand the neural basis for such disorders of motivation by providing an insight into their multidimensional nature and identifying potential neural foci that might be manipulated to modulate motivation [78]. This study was approved by the Central University Research Ethics Committee of the University of Oxford (MSD-IDREC-C1-2014-037). We recruited 38 young, healthy, right-handed participants. All participants had no history of neurological or psychiatric illness and were not taking regular medications. Four participants were excluded: 2 for failing to provide responses on a high proportion of trials while being scanned (over 9%), and a further 2 because of excessive head motion within the scanner (more than 5 mm of translation). The final group of 34 participants (23 females) had a mean age of 24 y (range 19–39). All participants were behaviourally trained on a cognitively effortful task and a physically effortful task prior to being scanned. These extensive training sessions were aimed at familiarising participants with the effort associated with all levels for both tasks. The training phase for each task began with 18 practice trials (3 per effort level) and was followed by a further 60 trials to reinforce behaviour (10 per effort level). Behavioural analyses of task performance were conducted on the latter 60 trials. After training, we scanned participants while they made economic decisions based on how much effort they would be willing to trade off for varying levels of reward. The order of training in the physical and cognitive effort tasks was counterbalanced across participants.

Title: Neurocomputational mechanisms underlying subjective valuation of effort costs Summary: Rewards are rarely obtained without the motivation to exert effort. In humans, effort can be perceived in both the cognitive and physical domains, yet little is known about how the brain evaluates whether it is worth exerting different types of effort in return for rewards. In this study, we used functional magnetic resonance imaging (fMRI) to determine the neural and computational basis of effort processing. We developed two novel tasks that were either cognitively or physically effortful and had participants indicate their preference for a low-effort/low-reward versus a higher-effort/higher-reward version of each. Our results showed distinct patterns of reward devaluation across the different domains of effort. Furthermore, regardless of the type of effort involved, motivation was subserved by a large network of overlapping brain areas across the parieto-prefrontal cortex and insula. However, we also found that the amygdala plays a unique role in motivating cognitively-but not physically-effortful behaviours. These data impact current neuroeconomic theories of value-based decision making by revealing the neurocomputational signatures that underlie the variability in individuals' motivation to exert different types of effort in return for reward.

lay_plos

en

Summarize: By giving us your feedback, you can help improve your www.NOAA.gov experience. This short, anonymous survey only takes just a few minutes to complete 11 questions. Thank you for your input! NOAA: Elusive El Niño arrives Forecasters predict it will stay weak, have little influence on weather and climate El Niño Arrives in 2015. This image shows the average sea surface temperature for February 2015 as measured by NOAA satellites. The large area of red (warmer than average) can be seen extending through the equatorial Pacific. (Credit: NOAA) The long-anticipated El Niño has finally arrived, according to forecasters with NOAA’s Climate Prediction Center. In their updated monthly outlook released today, forecasters issued an El Niño Advisory to declare the arrival of the ocean-atmospheric phenomenon marked by warmer-than-average sea surface temperatures in the central Pacific Ocean near the equator. Due to the weak strength of the El Niño, widespread or significant global weather pattern impacts are not anticipated. However, certain impacts often associated with El Niño may appear this spring in parts of the Northern Hemisphere, such as wetter-than-normal conditions along the U.S. Gulf Coast. “Based on the persistent observations of above-average sea surface temperatures across the western and central equatorial Pacific Ocean and consistent pattern of sea level pressure, we can now say that El Niño is here,” said Mike Halpert, deputy director, NOAA’s Climate Prediction Center, and ENSO forecaster. “Many climate prediction models show this weak El Niño continuing into summer.” Forecasters say it is likely (50 to 60 percent chance) that El Niño conditions will continue through the summer. The last El Niño, in 2009-2010, was a moderate to strong event. Other recent El Niño’s took place from 2002-2003 (moderate), 2004-2005 (weak), 2006-2007 (weak to moderate). The last very strong El Nino was 1997-1998 and was known for providing heavy rainfall in the West, especially California. As for this year, “this El Nino is likely too late and too weak to provide much relief for drought-stricken California,” added Halpert. NOAA scientists will continue to monitor the situation and will issue its next monthly update on April 9. NOAA’s mission is to understand and predict changes in the Earth's environment, from the depths of the ocean to the surface of the sun, and to conserve and manage our coastal and marine resources. Join us on Facebook, Twitter, Instagram and our other social media channels. WASHINGTON (AP) — A long anticipated El Nino has finally arrived. But for drought-struck California, it's too little, too late, meteorologists say. FILE - In this Feb. 24, 1998 file photo, a woman waits for a tow truck on the hood of her brother's pickup after a wall of mud plowed down Laguna Beach Canyon Road in Orange County, Calif. forcing her... (Associated Press) The National Weather Service on Thursday proclaimed the phenomenon is now in place. It's a warming of a certain patch of the central Pacific that changes weather patterns worldwide, associated with flooding in some places, droughts elsewhere, a generally warmer globe, and fewer Atlantic hurricanes. El Ninos are usually so important that economists even track them because of how they affect commodities. But this is a weak, weird and late version of El Nino, so don't expect too many places to feel its effects, said Mike Halpert, deputy director of the weather service's Climate Prediction Center. He said there may be a slight decrease in the number of Atlantic hurricanes this summer if the condition persists, but he also points out that 1992's devastating Hurricane Andrew occurred during an El Nino summer, so coastal residents shouldn't let their guard down. There's about a 50 to 60 percent chance the El Nino will continue through the summer, NOAA predicts. Ever since March 2014, the weather service has been saying an El Nino was just around the corner. But it didn't quite show up until now. Meteorologists said the key patch of the Pacific was warming but they didn't see the second technical part of its definition — certain changes in the atmosphere. Halpert said he didn't know why this El Nino didn't form as forecast, saying "something just didn't click this year." "What we've learned from this event is that our definition is very confusing and we need to work on it," Halpert said. Last year, some experts were hoping that El Nino would help the southwestern droughts because moderate-to-strong events bring more winter rain and snow to California — even flooding and mudslides during 1998's strong El Nino. But this El Nino arrives at the end of California's rainy season and is quite weak, Halpert said. "This is not the answer for California," Halpert said. The U.S. Southeast may see some above average rainfall, which is typical for an El Nino, Halpert said. This is the first El Nino since spring of 2010. Allan Clarke, a physical oceanography professor at Florida State University, said as far he's concerned, El Nino has been around awhile and the weather service didn't acknowledge it. But he agrees that this doesn't look like a strong one. That fits with the pattern the last 10 years, when El Nino's flip side, a cooling of the central Pacific called La Nina, has been more common. From 2005 to 2014, there have been twice as many months with a La Nina than with El Nino, weather records show. More than half of the time, the world has been in neither. ___ Online: Climate Prediction Center's El Nino page: http://1.usa.gov/1jSaUB3 ___ Seth Borenstein can be followed at http://twitter.com/borenbears Just when everyone had pretty much written it off, the El Niño event that has been nearly a year in the offing finally emerged in February and could last through the spring and summer, the National Oceanic and Atmospheric Administration announced Thursday. This isn’t the blockbuster, 1998 repeat El Niño many anticipated when the first hints of an impending event emerged about a year ago. This El Niño has just crept across the official threshold, so it won’t be a strong event. “We’re basically declaring El Niño,” NOAA forecaster Michelle L’Heureux said. “It’s unfortunate we can’t declare a weak El Niño.” In part because of its weakness, as well as its unusual timing, the El Niño isn’t expected to have much impact on U.S. weather patterns, nor bring much relief for drought-stricken California. But forecasters say it could nudge weather patterns in other areas of the globe, especially if it persists or intensifies, and could boost global temperatures—following a 2014 that was already the hottest year on record. “It does tilt the odds toward warmth,” L’Heureux said. The difference a year makes Forecasters with NOAA’s Climate Prediction Center and the International Research Institute for Climate and Society(IRI) at Columbia University first raised the alert early last year that an El Niño might be taking shape. They based it on a subsurface plume of warm water, called a Kelvin wave, surging from west to east across the tropical Pacific. (It was this large plume that drew comparisons to the monster El Niño of 1998, which caused deluges and flooding in many parts of the world and significantly amped up global temperatures. 1998 is still the only 20th century year among the top 10 warmest.) An El Niño is marked by unusually warm waters over the central and eastern parts of this basin. The CPC officially considers it an event when the sea surface temperatures in a key region of the ocean reach at least 0.5°C, or about 1°F, warmer than average. Multiple Kelvin waves have pulsed across the ocean basin in recent months and ocean temperatures have repeatedly been warm enough in that region to qualify as an El Niño. But ocean temperatures alone don’t define an El Niño; CPC forecasters also look for the corresponding shifts in atmospheric patterns, namely a weakening of the typical east-to-west trade winds over the region. Those altered winds can affect weather around the globe. That’s why they are watched so carefully month after month. A year after that first sign of an impending El Niño surged across the ocean, another Kelvin wave is making its way across the basin. Only this time, the ocean is already much warmer and most importantly, the atmosphere seems to have finally gotten the memo, with the trade winds weakening. The coupling between ocean and atmosphere isn’t following the usual script, and the typical shifts in rain patterns haven’t emerged. But L’Heureux noted the rarity of any response from the atmosphere at this time of year. In spring, she said, it is harder for the ocean and atmosphere “to essentially see each other.” “We’re fairly amazed,” she said. Spring and summer This late winter emergence of the El Niño means that the hallmark U.S. impacts—wet and cool conditions across the southern U.S.—won’t happen. “Over us [the impact] becomes very, very muted” in spring, L’Heureux said. Forecasters believe the current Kelvin wave and the already warmer ocean temperatures, signal that the El Niño is going to persist, which was another factor in officially declaring an event. The CPC forecasts a 50 to 60 percent chance that the El Niño will chug along through the spring and summer. If it does, it could tamp down the Atlantic hurricane season and juice the season in the eastern Pacific, as many said it did last summer, before the El Niño was official. That official designation has already spurred much debate in the climate community, since the ocean was warm enough through much of 2014 to qualify as an El Niño. “I’m sure it’s going to be discussed quite a bit,” L’Heureux said. But whether or not those warm oceans meant an El Niño was in place, they, along with warm waters in other ocean basins, helped elevate global surface temperatures in 2014, leading to the warmest year on record. Whether that could happen again in 2015 remains to be seen, though the ocean has a strong temperature memory and doesn’t respond to changes very quickly. So that warmth is likely to hang on, or even rise. “If the El Niño intensifies, it may have a greater impact on the global temperatures, as observed from past events,” Jessica Blunden, a climate scientist with ERT, Inc., at the NOAA’s National Climatic Data Center, said in an email. “But for now we are in a wait and see mode.” This article is reproduced with permission from Climate Central. The article was first published on March 5, 2015.

Summary: El Nino is here for the first time since 2010, according to the National Oceanic and Atmospheric Administration-but it's too late and too weak to be much use where it's most needed. It won't provide "much relief for drought-stricken California, as California's rainy season is winding down," Mike Halpert, deputy director of the NOAA's Climate Prediction Center, tells the LA Times, explaining that the Pacific Ocean weather pattern will only help drought-stricken areas if it persists into the next rainy season. Forecasters say this El Nino won't have much effect on US weather patterns at all, since it's arriving too late to create the usual wet, cool conditions, though it may bring temperatures up elsewhere in the world, reports Scientific American. The NOAA-which describes El Nino as an "ocean-atmospheric phenomenon marked by warmer-than-average sea surface temperatures in the central Pacific Ocean"-first spotted signs of the phenomenon a year ago, and Halpert tells the AP that experts aren't sure why it has taken so long to turn up. The agency says there is a 50% to 60% chance that this weak, late, and unusual El Nino might persist through the summer, which could lead to a decrease in the number of Atlantic hurricanes, though Halpert warns that 1992's Hurricane Andrew struck during an El Nino summer.

multi_news

en

Summarize: CHAPTER IV. OF SPEECH Originall Of Speech The Invention of Printing, though ingenious, compared with the invention of Letters, is no great matter. But who was the first that found the use of Letters, is not known. He that first brought them into Greece, men say was Cadmus, the sonne of Agenor, King of Phaenicia. A profitable Invention for continuing the memory of time past, and the conjunction of mankind, dispersed into so many, and distant regions of the Earth; and with all difficult, as proceeding from a watchfull observation of the divers motions of the Tongue, Palat, Lips, and other organs of Speech; whereby to make as many differences of characters, to remember them. But the most noble and profitable invention of all other, was that of Speech, consisting of Names or Apellations, and their Connexion; whereby men register their Thoughts; recall them when they are past; and also declare them one to another for mutuall utility and conversation; without which, there had been amongst men, neither Common-wealth, nor Society, nor Contract, nor Peace, no more than amongst Lyons, Bears, and Wolves. The first author of Speech was GOD himselfe, that instructed Adam how to name such creatures as he presented to his sight; For the Scripture goeth no further in this matter. But this was sufficient to direct him to adde more names, as the experience and use of the creatures should give him occasion; and to joyn them in such manner by degrees, as to make himselfe understood; and so by succession of time, so much language might be gotten, as he had found use for; though not so copious, as an Orator or Philosopher has need of. For I do not find any thing in the Scripture, out of which, directly or by consequence can be gathered, that Adam was taught the names of all Figures, Numbers, Measures, Colours, Sounds, Fancies, Relations; much less the names of Words and Speech, as Generall, Speciall, Affirmative, Negative, Interrogative, Optative, Infinitive, all which are usefull; and least of all, of Entity, Intentionality, Quiddity, and other significant words of the School. But all this language gotten, and augmented by Adam and his posterity, was again lost at the tower of Babel, when by the hand of God, every man was stricken for his rebellion, with an oblivion of his former language. And being hereby forced to disperse themselves into severall parts of the world, it must needs be, that the diversity of Tongues that now is, proceeded by degrees from them, in such manner, as need (the mother of all inventions) taught them; and in tract of time grew every where more copious. The Use Of Speech The generall use of Speech, is to transferre our Mentall Discourse, into Verbal; or the Trayne of our Thoughts, into a Trayne of Words; and that for two commodities; whereof one is, the Registring of the Consequences of our Thoughts; which being apt to slip out of our memory, and put us to a new labour, may again be recalled, by such words as they were marked by. So that the first use of names, is to serve for Markes, or Notes of remembrance. Another is, when many use the same words, to signifie (by their connexion and order,) one to another, what they conceive, or think of each matter; and also what they desire, feare, or have any other passion for, and for this use they are called Signes. Speciall uses of Speech are these; First, to Register, what by cogitation, wee find to be the cause of any thing, present or past; and what we find things present or past may produce, or effect: which in summe, is acquiring of Arts. Secondly, to shew to others that knowledge which we have attained; which is, to Counsell, and Teach one another. Thirdly, to make known to others our wills, and purposes, that we may have the mutuall help of one another. Fourthly, to please and delight our selves, and others, by playing with our words, for pleasure or ornament, innocently. Abuses Of Speech To these Uses, there are also foure correspondent Abuses. First, when men register their thoughts wrong, by the inconstancy of the signification of their words; by which they register for their conceptions, that which they never conceived; and so deceive themselves. Secondly, when they use words metaphorically; that is, in other sense than that they are ordained for; and thereby deceive others. Thirdly, when by words they declare that to be their will, which is not. Fourthly, when they use them to grieve one another: for seeing nature hath armed living creatures, some with teeth, some with horns, and some with hands, to grieve an enemy, it is but an abuse of Speech, to grieve him with the tongue, unlesse it be one whom wee are obliged to govern; and then it is not to grieve, but to correct and amend. The manner how Speech serveth to the remembrance of the consequence of causes and effects, consisteth in the imposing of Names, and the Connexion of them. Names Proper & Common Universall Of Names, some are Proper, and singular to one onely thing; as Peter, John, This Man, This Tree: and some are Common to many things; as Man, Horse, Tree; every of which though but one Name, is nevertheless the name of divers particular things; in respect of all which together, it is called an Universall; there being nothing in the world Universall but Names; for the things named, are every one of them Individual and Singular. One Universall name is imposed on many things, for their similitude in some quality, or other accident: And whereas a Proper Name bringeth to mind one thing onely; Universals recall any one of those many. And of Names Universall, some are of more, and some of lesse extent; the larger comprehending the lesse large: and some again of equall extent, comprehending each other reciprocally. As for example, the Name Body is of larger signification than the word Man, and conprehendeth it; and the names Man and Rationall, are of equall extent, comprehending mutually one another. But here wee must take notice, that by a Name is not alwayes understood, as in Grammar, one onely word; but sometimes by circumlocution many words together. For all these words, Hee That In His Actions Observeth The Lawes Of His Country, make but one Name, equivalent to this one word, Just. By this imposition of Names, some of larger, some of stricter signification, we turn the reckoning of the consequences of things imagined in the mind, into a reckoning of the consequences of Appellations. For example, a man that hath no use of Speech at all, (such, as is born and remains perfectly deafe and dumb,) if he set before his eyes a triangle, and by it two right angles, (such as are the corners of a square figure,) he may by meditation compare and find, that the three angles of that triangle, are equall to those two right angles that stand by it. But if another triangle be shewn him different in shape from the former, he cannot know without a new labour, whether the three angles of that also be equall to the same. But he that hath the use of words, when he observes, that such equality was consequent, not to the length of the sides, nor to any other particular thing in his triangle; but onely to this, that the sides were straight, and the angles three; and that that was all, for which he named it a Triangle; will boldly conclude Universally, that such equality of angles is in all triangles whatsoever; and register his invention in these generall termes, Every Triangle Hath Its Three Angles Equall To Two Right Angles. And thus the consequence found in one particular, comes to be registred and remembred, as a Universall rule; and discharges our mentall reckoning, of time and place; and delivers us from all labour of the mind, saving the first; and makes that which was found true Here, and Now, to be true in All Times and Places. But the use of words in registring our thoughts, is in nothing so evident as in Numbering. A naturall foole that could never learn by heart the order of numerall words, as One, Two, and Three, may observe every stroak of the Clock, and nod to it, or say one, one, one; but can never know what houre it strikes. And it seems, there was a time when those names of number were not in use; and men were fayn to apply their fingers of one or both hands, to those things they desired to keep account of; and that thence it proceeded, that now our numerall words are but ten, in any Nation, and in some but five, and then they begin again. And he that can tell ten, if he recite them out of order, will lose himselfe, and not know when he has done: Much lesse will he be able to add, and substract, and performe all other operations of Arithmetique. So that without words, there is no possibility of reckoning of Numbers; much lesse of Magnitudes, of Swiftnesse, of Force, and other things, the reckonings whereof are necessary to the being, or well-being of man-kind. When two Names are joyned together into a Consequence, or Affirmation; as thus, A Man Is A Living Creature; or thus, If He Be A Man, He Is A Living Creature, If the later name Living Creature, signifie all that the former name Man signifieth, then the affirmation, or consequence is True; otherwise False. For True and False are attributes of Speech, not of things. And where Speech in not, there is neither Truth nor Falshood. Errour there may be, as when wee expect that which shall not be; or suspect what has not been: but in neither case can a man be charged with Untruth. Seeing then that Truth consisteth in the right ordering of names in our affirmations, a man that seeketh precise Truth, had need to remember what every name he uses stands for; and to place it accordingly; or els he will find himselfe entangled in words, as a bird in lime-twiggs; the more he struggles, the more belimed. And therefore in Geometry, (which is the onely Science that it hath pleased God hitherto to bestow on mankind,) men begin at settling the significations of their words; which settling of significations, they call Definitions; and place them in the beginning of their reckoning. By this it appears how necessary it is for any man that aspires to true Knowledge, to examine the Definitions of former Authors; and either to correct them, where they are negligently set down; or to make them himselfe. For the errours of Definitions multiply themselves, according as the reckoning proceeds; and lead men into absurdities, which at last they see, but cannot avoyd, without reckoning anew from the beginning; in which lyes the foundation of their errours. From whence it happens, that they which trust to books, do as they that cast up many little summs into a greater, without considering whether those little summes were rightly cast up or not; and at last finding the errour visible, and not mistrusting their first grounds, know not which way to cleere themselves; but spend time in fluttering over their bookes; as birds that entring by the chimney, and finding themselves inclosed in a chamber, flitter at the false light of a glasse window, for want of wit to consider which way they came in. So that in the right Definition of Names, lyes the first use of Speech; which is the Acquisition of Science: And in wrong, or no Definitions' lyes the first abuse; from which proceed all false and senslesse Tenets; which make those men that take their instruction from the authority of books, and not from their own meditation, to be as much below the condition of ignorant men, as men endued with true Science are above it. For between true Science, and erroneous Doctrines, Ignorance is in the middle. Naturall sense and imagination, are not subject to absurdity. Nature it selfe cannot erre: and as men abound in copiousnesse of language; so they become more wise, or more mad than ordinary. Nor is it possible without Letters for any man to become either excellently wise, or (unless his memory be hurt by disease, or ill constitution of organs) excellently foolish. For words are wise mens counters, they do but reckon by them: but they are the mony of fooles, that value them by the authority of an Aristotle, a Cicero, or a Thomas, or any other Doctor whatsoever, if but a man. Subject To Names Subject To Names, is whatsoever can enter into, or be considered in an account; and be added one to another to make a summe; or substracted one from another, and leave a remainder. The Latines called Accounts of mony Rationes, and accounting, Ratiocinatio: and that which we in bills or books of account call Items, they called Nomina; that is, Names: and thence it seems to proceed, that they extended the word Ratio, to the faculty of Reckoning in all other things. The Greeks have but one word Logos, for both Speech and Reason; not that they thought there was no Speech without Reason; but no Reasoning without Speech: And the act of reasoning they called syllogisme; which signifieth summing up of the consequences of one saying to another. And because the same things may enter into account for divers accidents; their names are (to shew that diversity) diversly wrested, and diversified. This diversity of names may be reduced to foure generall heads. First, a thing may enter into account for Matter, or Body; as Living, Sensible, Rationall, Hot, Cold, Moved, Quiet; with all which names the word Matter, or Body is understood; all such, being names of Matter. Secondly, it may enter into account, or be considered, for some accident or quality, which we conceive to be in it; as for Being Moved, for Being So Long, for Being Hot, &c; and then, of the name of the thing it selfe, by a little change or wresting, wee make a name for that accident, which we consider; and for Living put into account Life; for Moved, Motion; for Hot, Heat; for Long, Length, and the like. And all such Names, are the names of the accidents and properties, by which one Matter, and Body is distinguished from another. These are called Names Abstract; Because Severed (not from Matter, but) from the account of Matter. Thirdly, we bring into account, the Properties of our own bodies, whereby we make such distinction: as when any thing is Seen by us, we reckon not the thing it selfe; but the Sight, the Colour, the Idea of it in the fancy: and when any thing is Heard, wee reckon it not; but the Hearing, or Sound onely, which is our fancy or conception of it by the Eare: and such are names of fancies. Fourthly, we bring into account, consider, and give names, to Names themselves, and to Speeches: For, Generall, Universall, Speciall, Oequivocall, are names of Names. And Affirmation, Interrogation, Commandement, Narration, Syllogisme, Sermon, Oration, and many other such, are names of Speeches. Use Of Names Positive And this is all the variety of Names Positive; which are put to mark somewhat which is in Nature, or may be feigned by the mind of man, as Bodies that are, or may be conceived to be; or of bodies, the Properties that are, or may be feigned to be; or Words and Speech. Negative Names With Their Uses There be also other Names, called Negative; which are notes to signifie that a word is not the name of the thing in question; as these words Nothing, No Man, Infinite, Indocible, Three Want Foure, and the like; which are nevertheless of use in reckoning, or in correcting of reckoning; and call to mind our past cogitations, though they be not names of any thing; because they make us refuse to admit of Names not rightly used. Words Insignificant All other names, are but insignificant sounds; and those of two sorts. One, when they are new, and yet their meaning not explained by Definition; whereof there have been aboundance coyned by Schoole-men, and pusled Philosophers. Another, when men make a name of two Names, whose significations are contradictory and inconsistent; as this name, an Incorporeall Body, or (which is all one) an Incorporeall Substance, and a great number more. For whensoever any affirmation is false, the two names of which it is composed, put together and made one, signifie nothing at all. For example if it be a false affirmation to say A Quadrangle Is Round, the word Round Quadrangle signifies nothing; but is a meere sound. So likewise if it be false, to say that vertue can be powred, or blown up and down; the words In-powred Vertue, In-blown Vertue, are as absurd and insignificant, as a Round Quadrangle. And therefore you shall hardly meet with a senselesse and insignificant word, that is not made up of some Latin or Greek names. A Frenchman seldome hears our Saviour called by the name of Parole, but by the name of Verbe often; yet Verbe and Parole differ no more, but that one is Latin, the other French. Understanding When a man upon the hearing of any Speech, hath those thoughts which the words of that Speech, and their connexion, were ordained and constituted to signifie; Then he is said to understand it; Understanding being nothing els, but conception caused by Speech. And therefore if Speech be peculiar to man (as for ought I know it is,) then is Understanding peculiar to him also. And therefore of absurd and false affirmations, in case they be universall, there can be no Understanding; though many think they understand, then, when they do but repeat the words softly, or con them in their mind. What kinds of Speeches signifie the Appetites, Aversions, and Passions of mans mind; and of their use and abuse, I shall speak when I have spoken of the Passions. Inconstant Names The names of such things as affect us, that is, which please, and displease us, because all men be not alike affected with the same thing, nor the same man at all times, are in the common discourses of men, of Inconstant signification. For seeing all names are imposed to signifie our conceptions; and all our affections are but conceptions; when we conceive the same things differently, we can hardly avoyd different naming of them. For though the nature of that we conceive, be the same; yet the diversity of our reception of it, in respect of different constitutions of body, and prejudices of opinion, gives everything a tincture of our different passions. And therefore in reasoning, a man bust take heed of words; which besides the signification of what we imagine of their nature, disposition, and interest of the speaker; such as are the names of Vertues, and Vices; For one man calleth Wisdome, what another calleth Feare; and one Cruelty, what another Justice; one Prodigality, what another Magnanimity; one Gravity, what another Stupidity, &c. And therefore such names can never be true grounds of any ratiocination. No more can Metaphors, and Tropes of speech: but these are less dangerous, because they profess their inconstancy; which the other do not.

Summary: Now it's time for the officers to try to thin the ranks of new recruits. Only the best and bravest for the British Air Service. The first intimidation factor comes from lupine tigeresques--yes, gigantic wolf tigers. We're not sure we would make it, but Deryn does. A bunch of other recruits don't stop running until they're out of there, though, which seems like a perfectly appropriate response to us. The next intimidation factor comes from another beastie: this time, it's a giant jellyfish thing, otherwise known as a Huxley ascender, a jellyfish that works like a giant balloon. The thought of going up in that thing thins the ranks even further, but when the flight captain asks for volunteers, Deryn steps up. After buckling into the harness, Deryn rises over London in the Huxley. At first, she's having a great time, but then the Huxley starts getting nervous, and Deryn sees why: a storm is coming. She doesn't want to throw out her panic flag for fear of losing face, but she knows she needs to get out of the air before that storm arrives.

booksum

en

Write a title and summarize: Cancer development is driven by series of events involving mutations, which may become fixed in a tumor via genetic drift and selection. This process usually includes a limited number of driver (advantageous) mutations and a greater number of passenger (neutral or mildly deleterious) mutations. We focus on a real-world leukemia model evolving on the background of a germline mutation. Severe congenital neutropenia (SCN) evolves to secondary myelodysplastic syndrome (sMDS) and/or secondary acute myeloid leukemia (sAML) in 30–40%. The majority of SCN cases are due to a germline ELANE mutation. Acquired mutations in CSF3R occur in >70% sMDS/sAML associated with SCN. Hypotheses underlying our model are: an ELANE mutation causes SCN; CSF3R mutations occur spontaneously at a low rate; in fetal life, hematopoietic stem and progenitor cells expands quickly, resulting in a high probability of several tens to several hundreds of cells with CSF3R truncation mutations; therapeutic granulocyte colony-stimulating factor (G-CSF) administration early in life exerts a strong selective pressure, providing mutants with a growth advantage. Applying population genetics theory, we propose a novel two-phase model of disease development from SCN to sMDS. In Phase 1, hematopoietic tissues expand and produce tens to hundreds of stem cells with the CSF3R truncation mutation. Phase 2 occurs postnatally through adult stages with bone marrow production of granulocyte precursors and positive selection of mutants due to chronic G-CSF therapy to reverse the severe neutropenia. We predict the existence of the pool of cells with the mutated truncated receptor before G-CSF treatment begins. The model does not require increase in mutation rate under G-CSF treatment and agrees with age distribution of sMDS onset and clinical sequencing data. Cancer development is driven by series of mutational events, which may become fixed in a hematologic or non-hematologic tumor via genetic drift. This process usually includes a limited number of driver (advantageous) mutations, and a greater number of passenger (neutral or mildly deleterious) mutations. Driver mutations for several hundred different cancers have been identified by sequencing and functional assays. The relationship between driver and passenger mutations has been investigated using mathematical models representing carcinogenesis in terms of a “tug-of war” between the former and the latter [1,2]. Another related problem is whether carcinogenesis is driven by acquisition of single point mutations or by saltatory changes amounting to major genome rearrangement events [3,4]. Mathematical modeling of interactions among multiple drivers has been described by Nowak and Durrett and their colleagues [5–7]. These frequently involve branching processes and related mathematical models [8]. Among stochastic models in hematology, an example is [9]. Hematopoiesis provide the best-characterized system for cell fate decision-making in both health and disease [10], as well as connections between stimuli such as inflammation and cancer [11]. Here, we model a disease evolving on the background of a germline mutation. The acquired driver mutation recurs during tissue expansion phase in fetal life and becomes selectively advantageous in early childhood, leading to development of malignancy. As a prominent example of such disease, we model the important hematologic disorder Severe Congenital Neutropenia (SCN), a monogenic inherited disorder, that acquires new mutations and evolves to secondary myelodysplastic syndrome (sMDS) or secondary acute myeloid leukemia (sAML). This model is similar to the “fish” graph of Tomasetti and Vogelstein [12]; however the latter is more comprehensive and involves multiple driver case. Here, we use tools of population genetics and population dynamics to model progression from SCN to sMDS and dissect the contributions of mutation, drift and selection at different stages of an individual’s life. More specifically, we consider: Accordingly, SCN is most commonly due to germline mutations in ELANE, which encodes the neutrophil elastase [13]. SCN is characterized by the near absence of circulating neutrophils, which renders the child, typically an infant, susceptible to recurrent life-threatening infections. The introduction in the 1990s of recombinant granulocyte colony-stimulating factor (G-CSF) to increase circulating neutrophils, markedly improved survival and quality of life for SCN patients [14]. SCN often transforms into sMDS or sAML [15,16]. Clinical studies have demonstrated a strong association between exposure to G-CSF and sMDS/AML [17–21]. Mutations in the distal domain of the Granulocyte Colony-Stimulating Factor Receptor (CSF3R) have been isolated from almost all SCN patients who developed sMDS/AML [22,23]. Clonal evolution over approximately 20 years was documented using next generation sequencing and quantification of CSF3R allele frequency variation in an SCN patient who developed sMDS/sAML [24]. Strikingly, out of four different mutations in CSF3R, one persisted into the leukemic clone but the other three were lost, supporting the assumption of different selective values in the presence of G-CSF that underlies our model. As clonal evolution is a central feature in cancer [25–28] and next generation sequencing has revealed complex genomic landscapes, SCN may provide a simpler real-world example to study cancer development. Two opposing paradigms have been proposed for cell fate decision making in blood cells: stochastic hematopoiesis (based on variability observed in cultured bone marrow cells as first suggested by McCulloch and Till [29]) and deterministic, or instructive, hematopoiesis (growth factor-driven production of specific blood cell types) [30,31]. In spite of substantial experimental findings, particularly recent single-cell measurements [32], the two opposing theories await a grand synthesis. Disease-accompanying dynamics have been variously modeled over the years as deterministic or stochastic[10]. SCN may also provide a simpler real-world example to study cell fate determination. Little is known about the molecular mechanism (s) by which SCN leads to myeloid malignancy and how important are the truncating mutations such as CSF3R D715 in this process. Notwithstanding the exact molecular mechanism by which the CSF3R truncation mutants lead to sMDS/AML, two pivotal questions concerning the population dynamics and population genetics of the mutant clones are: (i) whether the CSF3R truncation mutants are present before application of G-CSF, and (ii) whether G-CSF administration increases mutation rate in hematopoietic stem cells with ELANE mutation. If the answer to the first question is affirmative, then the presence of a small subpopulation of CSF3R truncation mutants among infants with SCN might be of prognostic value and a preventive therapy might be sought. Concerning the second question, determination whether G-CSF is mutagenic or provides a selective pressure may influence the degree G-CSF therapy is conducted, e. g. should it be more or less aggressive. To provide insight into the course of this disease and its clinical management, we propose a novel model of the emergence and fixation of CSF3R truncating mutations, which also follows the paradigm outlined earlier on. We note that the most common of these mutations associated with transition to sMDS is the CSF3R D715. However, at the resolution level of our model, we are not able to make more specific distinctions nor to consider coexistence or competition of more than one truncation mutant. The model assumes that the answer to question (i) is affirmative, but it is negative to question (ii). The model’s hypotheses are: (B) Effect of CSF3R (wild type vs. D715) on cell proliferation. Ba/F3 cells expressing either wild type (Type I) or mutant (D715) CSF3R were treated with increasing doses of recombinant human G-CSF (ng/ml) and proliferation was measured by the MTT assay performed in triplicates in a 96 well plate. The data are raw absorbance values at 600 nm and represent the three replicates plotted against increasing dose of G-CSF, fitted using least squares by Hill-type curves (Type I, blue, D715 red). For details of experimental procedures see the S1 Appendix. Fitting and statistical procedures are explained in the Methods. We show that hypotheses 2 and 3 are needed, by first building a proof-of-principle simple Moran process (a stochastic model used in population genetics) with no expansion, which fits the data only if it is started by a cell population including ⁓101-102 cells expressing a CSF3R truncation mutation. Then we show that this number of CSF3R truncation mutant cells can be produced in the late fetal period expansion of hematopoiesis in bone marrow. Existence of the pool of CSF3R truncation mutant cells before exposure to G-CSF can be discovered only by deep targeted sequencing. Then we follow up with a full-fledged comprehensive model, which accounts for the important detail of time change of the size of the hematopoietic system, but which confirms the conclusions of the proof-of-principle model. The results of the proof-of-principle modeling summarized in Table 1 suggest that it is feasible to build a more comprehensive model consistent with normal hematopoiesis as well as mutation and selection mechanisms modified by the age-dependent cellularity of the bone marrow and administration of pharmacological G-CSF. Here we presented a model of fixation of a CSF3R truncation mutant in the transition from an inherited neutropenia to sMDS: from the expansion phase in the prenatal hematopoietic tissues, to initiation of the G-CSF treatment, to expansion of the mutant, and to replacement of the normal bone marrow by the pre-leukemic mutants. By modifying the simple Moran model of population genetics, we provided an explanation for the evolution of sMDS in about 70% of cases in which CSF3R truncation mutant acts as an oncogenic driver. We first used a proof-of-concept two-stage model including the initial creation of the mutant clone before the selective agent G-CSF has been applied, followed by the period of selective pressure after initiation of treatment. We followed up with a more comprehensive model, which used the estimates of age-dependent productivity changes in hematopoietic stem cells, obtained based on telomere shortening estimates by the Abkowitz and Aviv groups [47,48]. Our model provides a real-world setting that may further illuminate principles of clonal hematopoiesis of indeterminate potential, first described as age-related clonal hematopoiesis. As recently summarized by [50], HSC clonality and association with malignancy begins with somatic genetic lesions in adult stem cells that accumulate and persist and that “given a large enough population (of HSC), every base pair in the genome will be mutated within at least one HSC”. Further, “these mutations provide the substrate for clonal selection”. The original and distinctive feature of our present model is to show that mutations occurring during the bone marrow expansion in the fetal period are likely to play a major role in creating this substrate. The expected times to fixation of the CSF3R truncation mutant (4–22 years) are consistent with the timing of the sMDS onset. According to data published from the European SCN Registry data, the average age at diagnosis of SCN with sMDS and CSF3R mutation is 13 ± 9 years [51]. The 70% fixation probability requires 11–60 “initial” cells harboring the mutation. We experimentally validated our mathematical model by measuring the growth advantage of the CSF3R D715-expressing cells and found a significant growth advantage (Fig 1A). Further validation will require next generation sequencing of specimens from these rare patients. Qiu et al. [52] recently reported that this truncation mutation also permits granulocytic precursors to avoid apoptosis. Our comprehensive model is based on the hypothesis that the rate of cell division after birth, when the rapid expansion of bone marrow slows down, is still very high. Hence, acquisition of new mutants during that phase is still substantial. However, selection is the force that leads the mutant-receptor cells to dominate. This also means that supply of new mutants in the expansion phase might not be necessary for the disease to emerge. However, it is likely that proliferation slows down by one or two orders of magnitude, depending on exact characteristics of subtypes of stem cells. Then in order to fit the data, somewhat higher selection coefficients are needed. In that case, the comprehensive model will behave approximately as the “proof of the concept” model, i. e. most of the mutant are supplied in the marrow expansion stage. An alternative hypothesis states that an inherited neutropenia induces a maladaptive increase in replicative stress and higher mutation rate in HSC that contributes to transformation to sMDS/AML [53]. However, measurements of the mutation burden in individual hematopoietic stem/progenitor cells (HSPCs) from SCN patients failed to support that. CD34+CD38- cells were sorted from blood or bone marrow samples and cultured for 3–4 weeks on irradiated stromal feeder cells. The exomes of the expanded HSPC clones were sequenced with unsorted hematopoietic cells from the same patient served as a normal control. The average number of somatic mutations per exome was 3. 6 ± 1. 2 for SCN, compared to 3. 9 ± 0. 4 for the healthy controls. Those patient-derived findings support our model. Our conclusions require that the mutation rate per site per cell division equals about 10−9, which is consistent with normal mutation rate in human genome. This latter issue warrants discussion since the somatic mutation rate in humans is about two orders of magnitude higher than the germline mutation rate, as suggested by [54]. However, a recent paper by Milholland et al. [55], argues that this former (somatic rate) is of the order of 10−9 per base per mitosis, while the former (germline rate) is of the order of 10−11 per base per mitosis (Fig 1B in that paper). Moreover, as seen in our Fig 2, using the 10−7 mutation rate [54] would only slightly change our conclusions. Two other mechanisms drive the expansion of the CSF3R truncation mutants, (i) the initial CSF3R truncation mutant cell clones arising in the expansion phase of fetal hematopoietic bone marrow and (ii) competitive advantage of the CSF3R truncation mutant harboring cells at later ages, hypothetically due to increased G-CSF pressure. “Mutator phenotype” does not need to be invoked in the SCN progression to sMDS. A characteristic feature of human cancers is their wide heterogeneity with respect to extent of involvement, genotype, and rate of progression and spread [56]. This variability contrasts markedly to induced animal tumors, which grow at a relatively uniform rate. sMDS/AML secondary to SCN is not an exception, with onset varying from 1 to 38 years of age. Previously, we constructed a stochastic model of the SNC→sMDS→sAML transition based on stochastic events [9]. It considered each new mutation to provide more selective advantage to the arising clone. This linear structure of mutation conferred desirable simplicity to modeling but was not necessarily realistic. In the framework of multitype branching processes and special processes such as Griffiths and Pakes branching infinite allele model [57,58], more complicated scenarios might be contemplated. Interestingly, the model of ref. [9] suggests that the spread in the age of onset of sAML is not due solely to stochastic nature of clone transitions, but requires a large variability in proliferative potential from one affected individual to another. Similar effect can be predicted in the Moran process. According to [38], the time course of the Moran process under mutant selective advantage can be split into three periods: (1) relatively long period from small number of mutant cells to a threshold, followed by (2) a much shorter period from the threshold to near-fixation of the mutant, and (3) a relatively long period to complete fixation. Accordingly, once the mutant count exceeds certain threshold, the process accelerates. This results in the spread of times to fixation depending at least as strongly on the selection coefficient as on the “intrinsic” randomness. This justifies the approach we took in this study, to concentrate on the effects of the selection coefficient. In addition, determination of the threshold may help establish a target for monitoring the progress of the disease. Gaining more insight will require a further study. While our model advances the understanding of multistep progression to cancer with a real-world condition and application to the clinic, other factors could be incorporated. These include: a correlation between G-CSF dosage for neutrophil recovery in SCN patients and the risk of malignant transformation and acquisition of an additional mutation, such as RUNX1, in the evolution to sAML. In the current report, we focus on a single aspect of the SCN-related leukemogenesis: expansion of CSF3R truncation mutant cells leading to the sMDS transformation. The model we present here provides potentially testable hypotheses (i) the CSF3R truncation mutants are present in 101-102 cells before G-CSF treatment is applied and (ii) a slight selective advantage of the CSF3R truncation mutant-harboring cells under G-CSF pressure is sufficient to lead to their expansion. The second hypothesis seems to be consistent with findings in ref [53]. Current dogma holds that clonal dynamics in relation to the development of sMDS/AML are highly heterogeneous and unpredictable. Our model supports the clinical value of more accurate disease surveillance with next generation sequencing and better timing of therapeutic interventions, such as stem cell transplantation.

Title: Mutation, drift and selection in single-driver hematologic malignancy: Example of secondary myelodysplastic syndrome following treatment of inherited neutropenia Summary: Cancer develops by multistep acquisition of mutations in a progenitor cell and its daughter cells. Severe congenital neutropenia (SCN) manifests itself through an inability to produce enough granulocytes to prevent infections. SCN commonly results from a germline ELANE mutation. Large doses of the blood growth factor granulocyte colony-stimulating factor (G-CSF) rescue granulocyte production. However, SCN frequently transforms to a myeloid malignancy, commonly associated with a somatic mutation in CSF3R, the gene encoding the G-CSF Receptor. We built a mathematical model of evolution for CSF3R mutation starting with bone marrow expansion at the fetal development stage and continuing with postnatal competition between normal and malignant bone marrow cells. We employ tools of probability theory such as multitype branching processes and Moran models modified to account for expansion of hematopoiesis during human development. With realistic coefficients, we obtain agreement with the age range at which malignancy arises in patients. In addition, our model predicts the existence of a pool of cells with mutated CSF3R before G-CSF treatment begins. Our findings may be clinically applied to intervene more effectively and selectively in SCN patients.

lay_plos

en

Summarize: BACKGROUND Intracorporeal suturing of tissue during surgery presents challenges to the surgeon in that the surgeon is called upon to manipulate one or more suturing instruments within the confines of an incision formed in the patient&#39;s body. In some cases, the surgeon will use his/her finger(s) to dissect tissue or separate tissue along tissue planes to form a space within the tissue that allows the surgeon to palpate and identify a desired target location for placement of a suture. Often, the space formed in the dissected tissue is opened until it is large enough to receive both the surgeon&#39;s finger(s) and the suturing instrument(s). The space provides access to the identified target location where it is desired to place the suture. However, the target location is often disposed inside the patient&#39;s body at an angle that is difficult to reach and can have a depth that precludes visualization of the target location. Delivering surgical instruments to the target location is challenging when the target location cannot be visualized by the surgeon. SUMMARY One aspect provides a suture fixation system including a suture assembly having an anchor, an introducer, and a delivery device. The introducer is attachable to a finger of a person and includes a platform attached to an exterior of the introducer and a zip line attached to the platform. The delivery device is movable along the zip line and configured to removably retain the anchor. The introducer allows the finger to identify a target landmark within a patient and the delivery device positions the anchor for insertion to the target landmark. BRIEF DESCRIPTION OF THE DRAWINGS The accompanying drawings are included to provide a further understanding of embodiments and are incorporated in and constitute a part of this specification. The drawings illustrate embodiments and together with the description serve to explain principles of embodiments. Other embodiments and many of the intended advantages of embodiments will be readily appreciated as they become better understood by reference to the following detailed description. The elements of the drawings are not necessarily to scale relative to each other. Like reference numerals designate corresponding similar parts. FIG. 1 is an exploded schematic view of one embodiment of a digital suture fixation system including an introducer and an anchor delivery device. FIG. 2 is a bottom view of the introducer illustrated in FIG. 1. FIG. 3 is a top view of the delivery device illustrated in FIG. 1. FIG. 4 is a cross-sectional view of the delivery device illustrated in FIG. 3. FIG. 5 is an end of view of the delivery device illustrated in FIG. 3. FIG. 6A is a side view of a finger wearing the introducer illustrated in FIG. 1. FIG. 6B is a side view of the delivery device illustrated in FIG. 3 shuttled along a zip line to the introducer illustrated in FIGS. 1 and 2. FIG. 6C is a side view of the system illustrated in FIG. 1 employed to deliver an anchor to tissue of a patient according to one embodiment. FIG. 6D is a schematic view of a suture line trailing away from the anchor that has been fixed into the tissue of the patient. FIG. 7 is an exploded perspective view of a digital suture fixation system including an introducer and an anchor delivery device according to one embodiment. FIG. 8A is an exploded side view of the system illustrated in FIG. 7. FIG. 8B is a schematic exploded view of a cable engaging with an anchor assembly of the system illustrated in FIG. 8A according to one embodiment. FIG. 9A is a side view of a finger wearing the system illustrated in FIG. 7. FIG. 9B is a side view of the delivery device illustrated in FIG. 7 delivered to a landmark inside of the patient&#39;s body. FIG. 9C is a side view of the system illustrated in FIG. 7 employed to deliver an anchor to the landmark inside of the patient&#39;s body. FIG. 9D is a side schematic view of a telescoping anchor housing. FIG. 10 is a perspective view of an optional position marker configured to be employed with the system illustrated in FIG. 7 according to one embodiment. FIG. 11 is a side plan view of a digital suture fixation system including a delivery device attached to an introducer band according to one embodiment. FIGS. 12A-12C are schematic cross-sectional views of the digital suture fixation system illustrated in FIG. 11 employed to throw a needle through tissue according to one embodiment. FIG. 13 is a perspective view of the introducer band illustrated in FIG. 11. FIG. 14 is a perspective view of another embodiment of an introducer band. FIG. 15 is a perspective view of another embodiment of an introducer band attached to the delivery device illustrated in FIG. 11. FIG. 16 is a perspective view of another embodiment of an introducer band attached to the delivery device illustrated in FIG. 11. FIG. 17 is a perspective view of another embodiment of an introducer band attached to the delivery device illustrated in FIG. 11. DETAILED DESCRIPTION In the following Detailed Description, reference is made to the accompanying drawings, which form a part hereof, and in which is shown by way of illustration specific embodiments in which the invention may be practiced. In this regard, directional terminology, such as “top,” “bottom,” “front,” “back,” “leading,” “trailing,” etc., is used with reference to the orientation of the Figure(s) being described. Because components of embodiments can be positioned in a number of different orientations, the directional terminology is used for purposes of illustration and is in no way limiting. It is to be understood that other embodiments may be utilized and structural or logical changes may be made without departing from the scope of the present invention. The following detailed description, therefore, is not to be taken in a limiting sense, and the scope of the present invention is defined by the appended claims. It is to be understood that the features of the various exemplary embodiments described herein may be combined with each other, unless specifically noted otherwise. Tissue includes soft tissue, which includes dermal tissue, sub-dermal tissue, ligaments, tendons, or membranes. As employed in this specification, the term “tissue” does not include bone. A digital suture fixation system is a system that allows suture line to be thrown through tissue and/or allows the placement of an anchor into the tissue with a hand or one or more fingers on the hand. A digital suture fixation system allows for the “finger tack” fixation of suture line and/or anchors into the tissue. Embodiments provide a finger guided suture fixation system that includes an introducer that is configured to be donned over a finger of a surgeon to allow the finger to palpate and identify a landmark within the patient, and a delivery device configured to insert an anchor at the identified landmark. As an example, the introducer is provided with a zip line that is sized to trail proximally behind the finger to a location outside of the patient&#39;s body. The delivery device is movable along the zip line and attachable to the introducer. In this manner, the surgeon is able to locate a target site of interest with his/her finger and pass the delivery device along the zip line to the finger until it is placed at or near the target site to allow the precise placement of the anchor even without visually seeing the target site. In this specification, “zip line” means a conduit, such as a cable, that provides a pathway from a location exterior a patient&#39;s body to a location intracorporeal the patient&#39;s body. FIG. 1 is a side view of one embodiment of a digital suture fixation system 150. System 150 includes an introducer 152 that is attachable to a finger F, a delivery device 154 that is attachable to introducer 152, and an anchor 156 that is removably retained in the delivery device 154. In one embodiment, introducer 152 includes a finger cot 160, a platform 162 attached to an exterior surface of finger cot 160, and a zip line 164 attached to platform 162. In one embodiment, delivery device 154 includes a car 170 configured to couple with and move along the zip line 164 and a shaft 174 that is configured to eject anchor 156 from car 170. The car 170 defines a port 172 sized to enclose anchor 156. In one embodiment, anchor 156 includes a barb portion 180 configured to engage with tissue and a suture line 182 trailing from barb portion 180. In one embodiment, the shaft 174 includes a distal end 190 that is attachable to the car 170, a proximal end 192 including a plunger 194, and a rod 196 that moves into and out of the shaft 174 in response to movement of the plunger 194. System 150 is adapted to deliver anchor 156 to a landmark within the patient, where the landmark is not necessarily visible to the surgeon. For example, the finger cot 160 allows the finger F to identify the desired landmark, the car 170 is attachable to the platform 162 (which is located near a distal end of the finger F) to ensure that the anchor 156 is directed to the landmark identified by the finger F, and the shaft 174 is employed to selectively eject the anchor 156 into the landmark. Although the landmark in FIG. 1 is illustrated as a ligament, system 150 is configured to allow the surgeon to palpate and identify any of a variety of intracorporeal landmarks. The systems disclosed in this specification are suited for the intracorporeal suturing of tissue during pelvic organ repair surgery, and in one embodiment are provided as sterile disposable surgical instruments that are discarded after the surgical procedure. To this end, the components of the systems are selected to be compatible with gas, steam, or radiation sterilization. FIG. 2 is a bottom view of introducer 152 showing zip line 164 trailing from a proximal end of introducer 152. In one embodiment, introducer 152 includes a window 200 formed in the finger cot 160 between platform 162 and a distal end of the finger cot 160. In one embodiment, the window 200 allows the finger F to directly contact tissue within a patient. In one embodiment, the window 200 allows a finger F inside of a glove (not shown) to identify a tissue landmark within a patient, where the glove is selected to provide the surgeon with a level of dexterity suited to sensing and discriminating different intracorporeal tissue landmarks. The platform 162 includes a retainer 204 that is configured to engage with the car 170 ( FIG. 1 ) to secure the car 170 to the introducer 152. In one embodiment, the retainer 204 is provided as a pair of opposing substantially spherical recesses that are sized to receive spring-loaded ball bearings provided on the car 170. Finger cot 160 is selected to be conformable to a distal end of the finger F, suitably elastic, and is suitably fabricated from plastic, metal, or combinations of plastic and metal (e.g., malleable metal thimbles covered with plastic as one example). Platform 162 is attached to finger cot 160 and is suitably formed from plastic, metal, or combinations of plastic and metal. Suitable suture line 182 materials include suture employed by surgeons in the treatment of pelvic organ prolapse, such as polypropylene suture, or the suture identified as Deklene, Deknatel brand suture, as available from Teleflex Medical, Mansfield, Mass., or suture available from Ethicon, a Johnson&amp;Johnson Company, located in Somerville, N.J. The zip line 164 is flexible and is suitably fabricated from a polymer strand, or a braided cable coated with plastic, as examples. In one embodiment, introducer 152 is integrated into a distal finger sleeve of a glove, which allows the introducer 152 to be more closely associated with the surgeon&#39;s hand. FIG. 3 is a top view of car 170, FIG. 4 is a cross-sectional view of car 170, and FIG. 5 is a proximal end view of car 170. In one embodiment, car 170 includes a proximal end 210 opposite a distal end 212, a platform dock 214 formed adjacent to distal end 212, a zip line channel 216 extending between end 210 and dock 214, and a suture channel 218 extending between end 210 and port 172. The platform dock 214 includes a lock 220 configured to couple with retainer 204 to secure car 170 to platform 162 ( FIG. 2 ). In one embodiment, the lock 220 includes spring-loaded ball bearings or another form of a biasing member configured to engage with recesses 204 formed on platform 162. The car 170 is configured to slide along the zip line 164 until lock 220 engages with retainer 204 to secure the car 170 to the platform 162. In one embodiment, threads 222 are formed within a proximal end of suture line channel 218 and are sized to receive a threaded distal end 190 of shaft 174 ( FIG. 1 ). In this manner, shaft 174 is configured to be removably attached to the car 170 such that rod 196 ( FIG. 1 ) is aligned with suture line channel 218 and the barb portion 180 of anchor 156. FIG. 5 is a proximal end view of car 170. In one embodiment, car 170 is substantially a circular cylinder, although other shapes and sizes that accommodate the intracorporeal delivery of the car 170 into the patient, as guided by the surgeon&#39;s preferences, are also acceptable. FIGS. 6A-6D are side views of system 150 employed to insert an anchor into tissue according to one embodiment. FIG. 6A is a side view of introducer 152 placed over the finger F such that the finger F is available to palpate tissue through the window 200. FIG. 6B is a side view of car 170 and shaft 174 of delivery device 154 moving along a zip line 164 for engagement with platform 162. It is to be understood that shaft 174 could be suitably attached to car 170 before car 170 is engaged with the zip line 164 or after the car 170 is engaged with the zip line 164. FIG. 6C is a side view of the car 170 engaged with the platform 162 and the shaft 174 connected to the car 170. In one embodiment, the barb portion 180 of the anchor 156 is retained within port 172 ( FIG. 1 ) and suture line 182 trails from the proximal end 210 of the car 170 ( FIG. 4 ). In this configuration, the shaft 174 is connected to the car 170, and the car 170 is connected to the platform 162, where the platform 162 and the car 170 are positioned adjacent to the window 200 and thus ready to deliver the barb portion 180 into the tissue (e.g., ligament) palpated by the finger F. In one embodiment, the surgeon uses the opposite hand (e.g., the hand to which introducer 152 is not attached) to activate the plunger 194, which drives the rod 196 ( FIG. 1 ) axially from the shaft 174 to eject the barb portion 180 of the anchor 156 axially from the car 170 and into the ligament, as illustrated in FIG. 6D. Although the plunger 194 is illustrated as a push-activated mechanical device in FIG. 6C, other embodiments of the plunger 194 provide a plunger that operates pneumatically or electro-mechanically. Other suitable activation mechanisms for moving rod 196 to deliver anchor 156 include pull activation, twist activation, or squeeze activation of shaft 174 to activate movement of rod 196. The anchor 156 is configured to penetrate tissue, including tough ligament tissue, and engage with the tissue after penetration. In one embodiment, the barb portion 180 is selectively deployed to expand from the anchor 156 only after the anchor penetrates into the tissue. In one embodiment, the barb portion 180 extends laterally from the anchor 156 and engages with the tissue as soon and the anchor penetrates into the tissue. FIG. 7 is a perspective view of another embodiment of a digital suture fixation system 250. In one embodiment, system 250 includes an introducer 252 that is attachable to a finger, a delivery device 254 attached to introducer 252, and an anchor (not shown) that is removably attachable to delivery device 254. In one embodiment, the introducer 252 is a band 252 that is attachable to the finger and the delivery device 254 and includes an anchor housing 256 attached to an exterior surface of the band 252. The delivery device 254 includes a shaft 258 having a distal end 260 that is configured to thread into a proximal end of the anchor housing 256. The anchor housing 256 is sized to retain an anchor (or an anchor and a suture line) and the shaft 258 is configured to deploy the anchor from the anchor housing 256. FIG. 8A is a side view of system 250. The anchor housing 256 includes a channel 270 that is sized to receive anchor 156 and suture line 182. In one embodiment, anchor housing 256 has a longitudinal length between about 0.75-1.5 inches, and band 252 is configured to allow housing 256 to slide/move longitudinally (laterally left and right in the orientation of FIG. 8A ). In this manner, the anchor housing 256 is sized to be positioned at a base segment of the finger (behind the distal-most joint of the finger) to allow the distal end of the finger freedom of movement. The anchor housing 256 is configured to move relative to the band 252 to a position adjacent to the distal end of the finger F to bring the anchor 156 near the desired landmark previously identified by the surgeon&#39;s finger F. In one embodiment, the band 252 is provided as adjustable band including a buckle or other adjustable form of attachment. Suitable materials for fabrication of the band 252 include plastics, metals, or combinations of plastics and metals. In one embodiment, the anchor housing 256 is molded from plastic attached to the band 252. In one embodiment, shaft 258 is similar to shaft 174 ( FIG. 1 ). FIG. 8B is an exploded schematic view of shaft 258 moved distally forward and ready for engagement with anchor 156. In one embodiment, shaft 258 includes an extensible post 272 that is configured to extend out of a distal end 260 of shaft 258 to engage with a bore 274 formed in anchor 156. In this manner, the post 272 is configured to drive the anchor 156 axially out of the channel 270 and into the tissue of the patient. FIGS. 9A-9C provides schematic views of system 250 employed to deliver an anchor into tissue. FIG. 9A is a schematic view of the band 252 attached to the finger F in a manner that locates the anchor housing 256 at the base of the finger F near the web of the thumb. The distal end of the finger F is unimpeded by the anchor housing 256 and is thus free to palpate the tissue. The shaft 258 trails behind the anchor housing 256 out of the patient&#39;s body for access by the other hand (e.g., the right hand in this example). The finger F is fully mobile (even if protected by a surgical glove) and able to palpate a desired tissue location for deployment of anchor 156. As illustrated in FIG. 9B, the anchor housing 256 is movable relative to the band 252 to position the distal end of the anchor housing 256 (retaining the anchor 156 ) next to the tissue landmark. In one embodiment, the shaft 258 is pushed in a proximal direction to displace the housing 256 proximally forward toward the tissue. The anchor housing 256 is not drawn to scale. In one embodiment, it is desirable to provide the anchor housing 256 in a low-profile format (e.g. a flat elliptical shape) that is configured to lay flat against the palm of a user&#39;s hand. For example, in one embodiment the anchor housing 256 has a lateral cross-sectional size that is similar to the size of the diameter of the shaft 258 such that the shaft 258 and the housing 256 appear as a single cable. FIG. 9C illustrates anchor 156 driven into the tissue by the post 272 ( FIG. 8B ) of the shaft 258. The suture line 182 is optional, and if provided, trails behind the anchor 156 through the anchor housing 256 and behind the hand of the surgeon. In one embodiment, the shaft 258 is rotated counterclockwise (one-quarter to one-half of a turn) to disengage the shaft 258 from the anchor 156. Thereafter, the surgeon retracts the finger F and the system 250 from the patient leaving the anchor 156 inserted into tissue and the suture line 182 trailing away from the anchor and out of the patient. The suture line 182 is tied off to reinforce or suture the pelvic floor of the patient. Alternatively, the suture line 182 serves as a conduit into the patient&#39;s body for delivery of support mesh intracorporeally to the inserted anchor 156. FIG. 9D is a side schematic view of a telescoping anchor housing 256 ′. The telescoping anchor housing 256 ′ has a proximal end 280 that nestles against a web of the hand and a distal end 282 that moves forward toward the distal end of the finger F when the shaft 258 is pressed into the proximal end 280 of the anchor housing 256 ′. The proximal end 280 contacts the webbing of the hand to allow the hand to drive the distal end 282 forcefully into the tissue to ensure that the anchor 156 penetrates tough tissue. Consistent with the above description, activation of the shaft 258 moves the post 272 in the axial forward direction to eject the anchor 156. In one embodiment, shaft 258 is attached to the proximal end 280 of the delivery device 256 ′, the shaft 258 is pushed distally, and separating segments of the telescoping delivery device 256 ′ axially expand to drive anchor 180 into the tissue. FIG. 10 is a perspective view of an optional position marker 290 configured for use with system 250. In one embodiment, position marker 290 includes a distal surface 292, a proximal surface 294, a slot 296 formed between the surfaces 292, 294, and a hole 298 formed in the proximal surface 294. In one embodiment, position marker 290 is provided as a stroke-length control and twist-release locator that is configured to be tacked into position by the anchor 156. For example, in one embodiment the hole 298 is sized to receive the distal end of anchor housing 256 ( FIG. 8A ) to allow accurate placement of the anchor 156 into the tissue. The position marker 290 functions to prevent inserting the anchor 156 too deeply into the tissue. The position marker 290 also functions to prevent twisting of the anchor 156 after placement of the anchor 156 to tissue. In one embodiment, position marker 290 includes another suture line 300 that is configured to trail out of the patient&#39;s body to a location that can be accessed by the surgeon for the subsequent delivery of support mesh into the patient to the location at which position marker 290 has been affixed. Suitable materials for fabrication of position marker 290 include plastic or radio-opaque material. FIG. 11 is a side plan view of a digital suture fixation system 350 including an introducer band 352 that allows the surgeon to use a finger to precisely place a delivery device 354 next to a tissue landmark. The introducer band 352 is attachable to the finger F and a suture assembly 356 is retained by a head 364 of the delivery device 354. This configuration allows the finger F to guide the head 364 of the delivery device 354 directly and precisely to an intracorporeal tissue landmark (i.e., a target) identified by the finger F. The surgeon inserts his/her finger into the band 352 to guide the delivery device 354 through the dissected tissue precisely to the landmark previously identified by the finger, which positions the head 364 for delivery of the suture assembly 356 to the tissue landmark. Delivery device 354 includes a shaft 360 coupled between a handle 362 and the delivery head 364. The introducer band 352 is attachable to the head 364. Handle 362 thus defines a proximal end of system 350 nearest a user of the system 350. With reference to FIGS. 11 and 12A, the needle 374 is stored within a proximal end portion 376 of the head 364 and the suture assembly 356 is stored within a distal end portion 378 of the head 364. The open space between the proximal end portion 376 of the head 364 and the distal end portion 378 of the head 364 is referred to as a throat. In one embodiment, the suture assembly 356 includes a suture line 380 connected to a capsule 382, and the capsule 382 is retained within distal end 378 of head 364. The needle 374 is adapted to move across the throat from the proximal end portion 376 of the head 364 to the distal end portion 378 of the head 364. The needle 374 is shaped to frictionally engage and mate with the capsule 382, remove the capsule 382 from distal end 378, and retract the capsule 382 into the proximal end portion 376 of head 364. In this manner, the suture line 380 is towed behind the capsule 382 and “thrown” through the tissue. For example, handle 362 includes an actuator 370 communicating with a rod 372 that is disposed within shaft 360. The throat formed in the head 364 is configured to be engaged over a mass of tissue. When actuator 370 is activated (for example with the surgeon&#39;s free hand exterior to the patient), the rod 372 moves through shaft 360 to extend the needle 374 stored within the proximal end portion 376 of head 364 axially outward through tissue and toward the distal end 378 of head 364. Thus, the needle 374 moves away from the user (who is holding handle 362 at the proximal end of system 350 ) and is thrust through the tissue toward distal end 378 of system 350. The needle 374 ultimately grasps the capsule 382, and the needle 374 and the capsule 382 are pulled back through the channel formed in the tissue by the needle 374. Retraction of the needle 374 pulls the suture line 380 through the tissue, to “throw” the suture line through the tissue. FIGS. 12A-12C are schematic cross-sectional views of digital suture fixation system 350 employed to throw needle 374 and capsule 382 /suture 380 through tissue. FIG. 12A is a schematic cross-sectional view of needle 374 partially extending from the proximal end portion 376 of head 364 after activation of actuator 370 ( FIG. 11 ). Capsule 382 is seated in a cavity formed in the distal end 378 of head 364. It is recommended that the surgeon direct a trailing end of suture 380 over distal end 378 of head 364 and back toward a proximal end of shaft 360 ( FIG. 11 ) for ease of managing the suture assembly during the procedure. To this end, in one embodiment the handle 362 is provided with a reel configured to receive the suture 380. For example, in one embodiment the suture 380 is retained on a suture cartridge, and the handle 362 is provided with a spindle configured to receive and retain the suture cartridge. FIG. 12B is a schematic cross-sectional view of head 364 illustrating the needle 374 moved across the throat of head 364 and engaged with capsule 382. It is to be understood that the throat would typically be placed over a mass of tissue that the surgeon desires to suture. The needle 374 is reversible and configured to retract capsule 382 back in a proximal direction into the needle exit port of the proximal end portion 376 of head 364. FIG. 12C is a schematic view of needle 374 and the capsule 382 partially retracted into the proximal end portion 376 of head 364. The needle 374 is retracted until the capsule 382 is parked inside the needle exit port of the proximal end portion 376 of head 364 and the suture 380 extends across the throat of head 364. System 350 is suited for the intracorporeal suturing of tissue during pelvic organ repair surgery, and in one embodiment is provided as a sterile disposable surgical instrument that is discarded after the surgical procedure. To this end, the components of system 350 are selected to be compatible with gas, steam, or radiation sterilization. FIG. 13 is a perspective view of the introducer band 352. In one embodiment, the introducer band 352 is a discontinuous band defined by a first ring segment 390 separated from a second ring segment 392 by a space 394 and includes a flange 396 that is configured to be removably attached to the head 364 of delivery device 354 ( FIG. 11 ). In one embodiment, the first and second ring segments 390, 392 are curved to define a substantially circular band sized to flexibly fit around a finger of a surgeon. The space 394 permits the ring segments 390, 392 to flex and adjust around differently sized fingers. The introducer band 352 is adapted to be placed over a finger of the surgeon to direct the head 364 of the delivery device 354 to a tissue landmark. The distal end of the finger of the surgeon is unencumbered and free to palpate tissue of the patient while the band 352 holds the delivery device 354 at the ready for placement of suture 380 and capsule 382. In one embodiment, the introducer band 352 is molded from plastic. In one embodiment, the introducer band 352 includes a metal core (such as aluminum) having a plastic (such as silicone) molded over the metal core. FIG. 14 is a perspective view of another embodiment of an introducer band 402. FIG. 14 is oriented such that the view is directed to the pad P of the finger F, and an outside surface of the index finger F is oriented in the up direction. That is to say, FIG. 14 is a depiction of a pad of a left hand index finger. In one embodiment, the introducer band 402 includes a base 404, a first pair of arms 406 that are configured to wrap a portion of the way around the finger F, a single arm 408 that is configured to wrap a portion of the way around the finger F in a direction opposite the first pair of arms 406, and a metal interface 410 attached to the base 404. In one embodiment, the metal interface 410 is a ferrous metal that is configured to magnetically couple with a magnet that is provided inside of the head 364 of the delivery device 354 ( FIG. 11 ). The introducer band 402 is malleable and configured to conform around a finger of the surgeon. In one example, the introducer band 402 is fabricated from a malleable sheet of metal that is over molded with a plastic coating, such as a core of 3003 series aluminum that is over molded with silicone. When the introducer band 402 is donned, the pad P of the finger F is exposed and available for palpating tissue to locate a desired landmark within a patient. Thereafter, the surgeon magnetically attaches the head 364 of the delivery device 354 ( FIG. 11 ) to the metal interface 410 of the introducer band 402, and using the finger F, digitally delivers the head 364 to the landmark. FIG. 15 is a perspective view of another embodiment of an introducer band 422 attached to the head 364 of the delivery device 354 ( FIG. 11 ). In one embodiment, the introducer band 422 includes a belt 424 having a buckle end 426, a free end 428, and a buckle 430 configured to selectively engage the free end 428 of the belt 424. In one embodiment, an exterior surface 432 of the belt 424 includes engagement recesses 434 that allow the buckle 430 to adjustably engage the belt 424 around a finger of the user. In one embodiment, the belt 424 is fabricated from plastic and the buckle 430 moves about a pin 436. During use, the surgeon will use a finger to palpate a desired landmark within a patient prior to donning the introducer band 422. Thereafter, the band 422 is attached to the finger to allow the finger to guide the head 364 of the delivery device 354 ( FIG. 11 ) directly to the identified landmark. In one embodiment, the introducer band 422 is attached to the surgeon&#39;s finger and the surgeon subsequently uses the finger to palpate a desired landmark within a patient. FIG. 16 is a perspective view of another embodiment of an introducer band 442 attached to the head 364 of the delivery device 354 ( FIG. 11 ). In one embodiment, the introducer band 442 includes a shell 444 that is sized to receive the head 364 and a belt 446 that slides between two opposed flanges 448, 450 to form a finger slot 451. In one embodiment, a belt stop 452 is provided that includes a post 454 that slides within an angled slot 456 to allow the selective adjustment of the belt 446 around the finger F. The belt stop 452 is configured to prevent the band 446 from sliding through the flange 450, which would undesirably result in the finger slot 451 expanding after it is had been sized to fit around the finger of the surgeon. FIG. 17 is a perspective view of another embodiment of an introducer band 462 attached to the head 364 of the delivery device 354 ( FIG. 11 ). In one embodiment, the introducer band 462 is integral with the head 364. An adjustable finger slot 463 is provided by a belt 464 that is formed to extend from a base of the delivery head 364 and terminate at an adjustable engagement slide 466. In one embodiment, the belt 464 includes a pressure platform 468 that allows the belt 464 to be adjusted by movement of one end 470 of the belt 464 relative to the engagement slide 466. In one embodiment, the engagement slide 466 is provided with a saw tooth pattern that is configured to mesh with saw teeth provided on the end 470 of the belt 464 to provide an adjustable and removable locking mechanism. Alternatively, the engagement slide 466 is provided with a hook-and-loop form of adjustable attachment. In one embodiment, the introducer band 462 is integrally formed as a complement of the delivery head 364. Embodiments of digital suture fixation systems have been described that include a digital introducer that is attachable to a finger to guide an anchor delivery device intracorporeally to a patient. The introducer is attachable to the finger in one of a variety of approaches, include attachment bands, magnetic attachment mechanisms, finger cots, attachment strands such as zip tie style strands, etc. The introducer is configured to allow the finger to palpate and identify a landmark within a patient and the delivery device is configured to insert an anchor or a suture attached to an anchor or capsule into the landmark. Thus, accurate placement of the anchor/suture is provided even if the landmark is not visible to the surgeon. Although specific embodiments have been illustrated and described herein, it will be appreciated by those of ordinary skill in the art that a variety of alternate and/or equivalent implementations may be substituted for the specific embodiments shown and described without departing from the scope of the present invention. This application is intended to cover any adaptations or variations of medical devices as discussed herein. Therefore, it is intended that this invention be limited only by the claims and the equivalents thereof. Embodiments: 1. A suture fixation system comprising: a suture assembly comprising an anchor; an introducer that is attachable to a finger of a person, the introducer comprising a platform attached to an exterior of the introducer and a zip line attached to the platform; and a delivery device movable along the zip line and configured to removably retain the anchor; wherein the introducer allows the finger to identify a target landmark within a patient and the delivery device is movable along the zip line and attachable to the platform to position the anchor for insertion to the target landmark. 2. The suture fixation system of embodiment 1, wherein the anchor is a tissue penetrating anchor comprising a tissue penetrating barb extending from a flange and the suture assembly comprises a suture line connected to the flange. 3. The suture fixation system of embodiment 1, wherein the target landmark is an intracorporeal landmark and the zip line extends from the intracorporeal landmark to a location outside of the patient. 4. The suture fixation system of embodiment 1, wherein the delivery device comprises a car defining a channel that is configured to couple to the zip line. 5. The suture fixation system of embodiment 4, wherein the car defines a port sized to enclose the anchor. 6. The suture fixation system of embodiment 5, wherein the delivery device comprises a cable having a distal end attachable to the car and a rod disposed in the cable. 7. The suture fixation system of embodiment 6, wherein the rod is movable within the cable to axially eject the anchor from the port. 8. The suture fixation system of embodiment 1, wherein the introducer comprises a finger cot attachable to a distal tip of the finger, the platform attached to an exterior of the finger cot. 9. The suture fixation system of embodiment 8, wherein the finger cot defines a window sized to allow the distal tip of the finger to touch the target landmark, the platform located proximal the window. 10. A digital suture fixation system comprising: a suture assembly comprising an anchor; an introducer that is attachable to a finger of a person and configured to allow a distal tip of the finger to identify an intracorporeal landmark within a patient; a delivery device separable from the introducer that is configured to retain the anchor; means for guiding the delivery device from a location exterior the patient to the introducer disposed at the intracorporeal landmark; and means for securing the delivery device to the introducer disposed at the intracorporeal landmark. 11. The digital suture fixation system of embodiment 10, wherein the introducer comprises a zip line that is configured to trail from the introducer placed at the intracorporeal landmark to the location exterior the patient. 12. The digital suture fixation system of embodiment 11, wherein the delivery device is a car that is movable along the zip line from the location exterior the patient to a platform attached to the introducer. 13. The digital suture fixation system of embodiment 10, further comprising: means for ejecting the anchor from the delivery device. 14. A digital suture fixation system comprising: a suture line coupled to an anchor; an introducer comprising a band attachable around a finger; a delivery device comprising an anchor housing attached to an exterior of the band such that a distal tip of the finger is exposed, the housing configured to enclose the anchor; and a cable having a distal end that is insertable into the anchor housing, a rod disposed in the cable and attachable to the anchor, and a proximal end having a trigger that communicates with the rod; wherein the delivery device is movable relative to the band and the rod is movable to eject the anchor from the anchor housing. 15. The digital suture fixation system of embodiment 14, further comprising: a position marker comprising a distal surface opposite a proximal surface, a slot formed in a side of the position marker between the distal surface and the proximal surface, and an access hole formed in the proximal surface; wherein the slot is configured to be engaged with a ligament of the patient and the access hole is configured to receive an anchor exit port of the anchor housing to align placement of the anchor with the landmark. 16. The digital suture fixation system of embodiment 14, wherein the distal end of the cable is configured to be rotated in a first direction into engagement with the anchor and rotated in a second direction different than the first direction out of engagement with the anchor. 17. The digital suture fixation system of embodiment 14, wherein the band is a stationary band attached around a proximal portion of the finger and the delivery device is movable in a distal direction toward the distal tip of the finger. 18. A digital suture fixation system comprising: a suture line coupled to a capsule; a delivery device comprising a handle having an actuator, a shaft coupled to the handle, and a head coupled to the shaft; and a band attached to the head, the band attachable to a finger to allow the finger to direct the head to an intracorporeal landmark; wherein the head comprises a proximal portion housing a needle and a distal end spaced apart from the proximal portion by a throat, the distal end defining a cavity sized to maintain the capsule, the actuator configured to move the needle across the throat to engage the capsule disposed in the cavity. 19. The digital suture fixation system of embodiment 18, wherein the band comprises a metal interface and the head comprises a magnet configured to couple the band to the head. 20. The digital suture fixation system of embodiment 18, wherein the band is length-adjustable to fit around the finger. 21. The digital suture fixation system of embodiment 20, wherein the band comprises a buckle and an exterior surface of the band includes engagement recesses that allow the buckle to selectively engage the band for adjustment of the band around the finger.

Summary: A method of placing a suture through tissue includes placing a band on a finger of a user, where the band is attached to a head of a suturing device, and employing the finger and the device in identifying an intracorporeal tissue landmark and placing the head of the suturing device at the intracorporeal tissue landmark. The method additionally includes engaging a throat of the head of the suturing device with the intracorporeal tissue landmark, and ejecting a needle out of a needle exit port and through the tissue. The needle exit port is located on a proximal portion of the head of the suturing device.

big_patent

en

Write a title and summarize: MicroRNAs (miRNAs) are thought to exert their functions by modulating the expression of hundreds of target genes and each to a small degree, but it remains unclear how small changes in hundreds of target genes are translated into the specific function of a miRNA. Here, we conducted an integrated analysis of transcriptome and translatome of primary B cells from mutant mice expressing miR-17~92 at three different levels to address this issue. We found that target genes exhibit differential sensitivity to miRNA suppression and that only a small fraction of target genes are actually suppressed by a given concentration of miRNA under physiological conditions. Transgenic expression and deletion of the same miRNA gene regulate largely distinct sets of target genes. miR-17~92 controls target gene expression mainly through translational repression and 5’UTR plays an important role in regulating target gene sensitivity to miRNA suppression. These findings provide molecular insights into a model in which miRNAs exert their specific functions through a small number of key target genes. MicroRNAs (miRNAs) are endogenously encoded single stranded RNAs of about 22 nucleotides (nts) in length. They suppress target gene expression by translational repression and promoting mRNA degradation. The relative contribution of these two modes of action to miRNA regulation of its target gene expression is a matter of ongoing debate [1–3]. It was initially thought that animal miRNAs repress the protein output of target genes without significantly effecting mRNA levels [4,5]. Subsequent genetic studies in C. elegans and zebrafish showed that miRNAs also promote the degradation of their target mRNAs [6,7]. To reveal the global effect of miRNA on target gene mRNA and protein levels, a series of genome-wide studies applied microarray, RNA-seq, proteomics, and ribosome profiling to mammalian cell lines transiently transfected with miRNA mimics or inhibitors or primary cells from miRNA mutant mice. Two early studies showed significant correlations between the mRNA and protein levels of miRNA target genes, as well as widespread target mRNA degradation [8,9]. This was followed up by a study concluding that mammalian miRNAs predominantly act to decrease target mRNA levels [10]. However, other studies that employed the same experimental approach, namely transient transfection of miRNA mimics or inhibitors into in vitro cultured mammalian cell lines, came to an opposite conclusion. These studies showed that miRNAs affect the expression of most target genes through translational inhibition [11,12]. Subsequent studies employing temporal dissection of miRNA action seemed to have resolved this discrepancy by showing that translational repression precedes target mRNA deadenylation and decay [13–18]. This order of events can be interpreted either as evidence that mRNA decay is a consequence of translational repression [17,19], or as reflection of the kinetic differences between these two mechanisms that operate independently from each other [20]. In line with the latter interpretation, analyses performed either in cultured cells or in vitro extracts showed that miRNA-mediated translational repression can occur in the absence of target mRNA deadenylation and decay [19,21–27]. Therefore, it remains an unanswered question whether mRNA degradation is always the end result of miRNA targeting and whether miRNA-mediated translational repression and target mRNA degradation are molecularly coupled under physiological conditions [1,28,29]. In contrast to the efforts to search for a unified mechanism of miRNA action, studies of individual miRNA-target mRNA interactions in miRNA mutant mice are painting a rather different picture. A recent survey of literature focused on studies in which target gene mRNA and protein levels were measured concurrently in primary cells and tissues from mutant mice with genetic ablation or transgenic expression of individual miRNA genes [2]. This survey analyzed a total of 159 miRNA-target mRNA interactions in 77 strains of miRNA mutant mice. Among them, 48% target genes are predominantly regulated by translational repression, 29% are regulated mainly by mRNA degradation, and 23% are regulated by both. This heterogeneity in miRNA mechanisms of action has been increasingly recognized as more and more miRNA mutant mice are generated and analyzed, but what determines the dominant mode of miRNA action remains unclear. An interesting finding of this survey is that most target genes identified in developing cells or tissues are regulated by mRNA degradation, whereas target genes identified in terminally differentiated cells tend to be regulated at the translational level. It is conceivable that mRNA degradation gets rid of target mRNA in a non-reversible manner and provides an efficient way for cell fate determination, while translational repression is immediate, transient and reversible, which is more suitable for differentiated cells to respond to environmental stimuli [2]. Indeed, previous studies have shown that miRNA regulation of target gene translation can occur in a rapid and reversible manner under various stress conditions [30,31]. These studies highlight the importance of cellular context in determining the dominant mode of miRNA action. The mode of action can also be miRNA-dependent. Transcriptome analysis of mouse liver showed that miR-122 and let-7 cause significant target mRNA degradation, whereas miR-21 has little impact on its target gene mRNA levels [32]. Another study of primary cells from miRNA mutant mice showed that miR-155 in B cells and miR-223 in neutrophils cause significant target mRNA degradation, while miR-150 in B cells and miR-21 in neutrophils have absolutely no effect on their target mRNA abundance [14]. Considering the cellular context- and miRNA-dependency, it is essential to investigate miRNA mechanisms of action in the cellular contexts where miRNA of interest performs its physiological or pathological functions. Another controversial issue in miRNA research is about how miRNAs achieve their specific functions. On one hand, bioinformatic analysis and experimental target gene identification using the recently established PAR-CLIP and HITS-CLIP methods often find hundreds of target genes for a miRNA [33–36]. Proteomic analysis of mammalian cell lines transiently transfected with miRNA mimics showed that a miRNA regulates the protein output of hundreds of target genes, and that the effect on each target gene is often moderate [8,9]. These studies led to the conclusion that miRNAs exert their functions by modulating the expression of hundreds of target genes and each to a small degree [37,38]. However, when the hundreds of target genes regulated by a miRNA are closely examined, they often fall into a broad spectrum of functional categories [36,39,40]. How small changes in hundreds of target genes with diverse functions are translated into specific phenotypic outcomes has been a conceptual conundrum. On the other hand, recent genetic studies demonstrated that mutation of miRNA binding sites in a single target gene can phenocopy miRNA deficiency in a cell context-dependent manner in both mice and worms [41–43]. These results provide strong support to the key target gene model, which postulates that the function of a miRNA is often mediated by a small number of key target genes in a given cellular context [44]. We speculated that the discrepancy between these two types of studies regarding how miRNAs exert their specific functions stems from the transient transfection approach, which may not recapitulate the actions of endogenous miRNAs under physiological conditions [2]. Recent studies showed that transient transfection of miRNA mimics into in vitro cultured cell lines led to increase of mature miRNAs to supraphysiological levels, appearance of high molecular weight RNA species, frequent mutation of guide strands of miRNA mimics, accumulation of unnatural passenger strands of miRNA mimics, and non-specific alterations in gene expression [45–47]. These findings call into question the physiological relevance of previous studies employing the transient transfection approach to investigate the functions and mechanisms of miRNAs. As increasing numbers of animals harboring gain- and loss-of function mutations for individual miRNA genes are being generated [2,48], primary cells from these miRNA mutant animals are better systems for studying miRNA mechanisms of action under physiological conditions. In this study, we investigated miRNA mechanism of action in lymphocytes by conducting an integrated analysis of the transcriptomes and translatomes of primary B cells from miR-17~92 transgenic and knockout mice. The miR-17~92 family consists of three miRNA clusters: miR-17~92, miR-106a~363, and miR-106b~25 (S1 Fig). Together, these three clusters contain 15 miRNA stem-loops that give rise to 13 distinct mature miRNAs. They fall into four miRNA subfamilies (miR-17, miR-18, miR-19, and miR-92 subfamilies), with members in each subfamily sharing the same seed sequence. Germline knockout of miR-17~92 family in mice is incompatible with life [49]. These miRNAs are essential for the development of lung, heart, central nervous system, fetal liver, and B lymphocytes [49]. B cell-specific deletion of the miR-17~92 family (CD19-Cre; miR-17~92fl/fl; miR-106a~363-/-; miR-106b~25-/-, termed TKO mice) severely impaired antibody responses, while B cell-specific miR-17~92 transgenic (TG) mice develop lymphomas with high penetrance [40]. This conditional transgene and knock-out strategy bypasses developmental defects caused by dysregulated miR-17~92 expression during the early stages of B cell development [50,51]. We have now performed a comprehensive molecular analysis of primary B cells expressing miR-17~92 miRNAs at three different levels (TKO, WT and TG). In this cellular context, we found that target genes exhibit differential sensitivity to miRNA suppression, and that only a small fraction of target genes are actually suppressed by a given concentration of miRNA. Absolute quantification of miRNA and miRNA binding site revealed there are more miRNA binding sites than miRNA molecules so that only a small fraction of binding sites are occupied by miRNA molecules at a given time. Moreover, miR-17~92 controls key target gene expression mainly through translational repression and 5’UTR plays an important role in regulating target gene sensitivity to miRNA suppression. These findings provide mechanistic insights into the functional specificity of miRNAs. We have previously identified 868 target genes harboring a total of 1139 miR-17~92 binding sites conserved in human and mouse (termed miR-17~92 targets) by PAR-CLIP analysis of B cells [40]. This list contains most of miR-17~92 target genes validated in previous studies. We investigated the effect of transgenic miR-17~92 expression and complete deletion of the miR-17~92 family on the mRNA levels of these target genes during B cell activation. We first generated a complete list of significantly expressed mRNAs and their absolute molecule numbers by RNA-seq analysis of WT B cells spiked with a known quantity of ERCC control (ERCC-RNA-seq, S2A and S3 Figs) [52]. This analysis showed that 8,000 (naïve B cells) to 11,000 (B cells activated for 25. 5h) genes are transcribed in B cells at greater than 0. 5 copy per cell (termed transcribed genes), with median copy numbers of 2. 6 (naïve), 10 (13. 5h), and 31 (25. 5h) (Fig 1A and S1 Table). This general transcriptional upregulation is essential for activation-induced cell growth and proliferation. Consistent with previous reports, the abundance of significantly expressed mRNAs spans three to four orders of magnitude (S3A Fig), with 1 RPKM roughly corresponding to 1 copy per cell (S3B Fig) [53,54]. The transcribed genes included 85% (743 in naïve B cells) to 90% (780 in 25. 5h activated B cells) of miR-17~92 target genes (termed transcribed targets). We next performed microarray analysis of TKO, WT and TG B cells before and after activation (S2B Fig), focusing on the transcribed targets (Fig 1B and 1C). The time frame used in this study covered both the induction and termination phases of major signaling pathways involved in B cell activation (S4A Fig). We confirmed that miR-17~92 expression in TG B cells was 3 fold higher than in WT B cells, and was completely absent in TKO B cells (S4B and S4C Fig). When miR-17~92 target genes were analyzed, neither transgenic miR-17~92 expression nor deletion of miR-17~92 family caused significant global changes in their mRNA levels throughout B cell activation (Fig 1B and 1C and S2 Table). Analysis of target genes regulated by individual members of the miR-17~92 cluster came to the same conclusion (S5A and S5B Fig). We next examined the effect of miR-17~92 on predicted target genes with the highest context++ scores based on the most recent TargetScan 7. 0 algorithm (S3 Table) [55]. We selected 128 top target genes for each miRNA subfamily in this cluster, and analyzed the mRNA levels of these transcribed in B cells at greater than 0. 5 copy per cell (S5C and S5D Fig). In a previous study, transfection of chemically synthesized miRNA mimics into HCT116 cells led to an average reduction of 19% in the mRNA levels of target genes with the same context scores [55]. During B cell activation, there was indeed an inverse correlation between the expression levels of miR-17~92 and these target gene mRNAs at all time points examined, but the average change in target mRNA levels was only 3. 7% in TG and 6. 6% in TKO B cells (S5C and S5D Fig). This rather modest global effect of miR-17~92 on the mRNA levels of its target genes is consistent with the results from previous studies performing transcriptome analysis of T cells, B lymphoma cells, and embryonic heart and tail bud with genetic ablation of either the whole miR-17~92 cluster or its individual members [51,56–58]. We speculate that these subtle changes in target gene mRNA levels may not explain the dramatic phenotypes observed in TG and TKO mice. Moreover, most of the small number of target genes that show greater than 1. 4-fold changes in mRNA levels have not been previously implicated in lymphoma development, cell survival and proliferation, and are unlikely to mediate the functions of miR-17~92 in B cells (S2 Table). Therefore, we investigated the possibility that miR-17~92 regulates the expression of functionally relevant target genes mainly at the protein level. We compiled a list of 63 miR-17~92 target genes, which were either validated in previous studies [59–64], or are novel but functionally relevant to B cell lymphoma development or B cell immune responses (S4 Table). Among these 63 targets, we were able to detect and quantify 47 by immunoblot, while the other 16 were discarded due to poor antibody quality (S6 Fig). Only 13 of the 47 target genes showed significant reduction in protein levels in TG B cells (S7A Fig), including several inhibitors of the PI3K (Pten and Phlpp2) and NF-κB (Tnfaip3/A20, Itch, Rnf11, Tax1bp1, Cyld, and Traf3) pathways previously implicated in miR-17~92-driven B cell lymphoma development [40,65], and five additional tumor suppressor genes (Hbp1, Stk38, Arid4b, Rbbp8 and Ikzf1) [66–69]. Among the other 34 targets, there were no significant changes in protein levels for 25 targets, time- or isoform-dependent changes for 3 targets, and increased protein levels for 6 targets in TG B cells (S7B and S7C Fig). We further examined the 13 target genes that exhibited reduced protein levels in TG B cells, focusing on the relative contribution of translational repression and mRNA degradation (Fig 1D). We validated the microarray data by qRT-PCR. All of them are regulated either exclusively or significantly at the protein level, except Hbp1, which is regulated mainly at the mRNA level (Fig 1D). We also measured the protein levels of 16 genes that control translation initiation and elongation in a global manner and completely lack miR-17~92 binding sites in their mRNAs [70]. As shown in S8 Fig, none of them was significantly downregulated in TG B cells. Taken together, these results demonstrated that the global impact of miR-17~92 on its target gene mRNA levels is subtle, that only a subset of functionally relevant target genes are suppressed by transgenic miR-17~92 expression, that miR-17~92-mediated suppression occurs predominantly at the protein level, and that this suppression is not caused by an altered translational environment in TG B cells. We next assessed the impact of miR-17~92 expression on target genes using ribosome profiling (S2C Fig). This technology directly captures genome-wide maps of protein synthesis (the translatome) by quantifying ribosome density on each mRNA with high resolution and depth, but does not measure post-translational changes in gene expression [71,72]. We quantified ribosome footprints of 8,271 mRNAs (termed translated genes) in TKO, WT and TG B cells after 25. 5h of activation, corresponding to more than 70% of transcribed genes in these cells (S5 Table). The ribosome footprint abundance spans six orders of magnitude (S9A Fig), which is at least two orders of magnitude broader than that of mRNA abundance (S3A Fig), in agreement with previous global gene expression analysis in mammalian cells [73]. We confirmed that ribosome footprint abundance changes highly correlated with protein abundance changes as determined by immunoblot, therefore excluding significant contribution from post-translational regulatory mechanisms such as miRNA-dependent nascent polypeptide destruction (S9B–S9E Fig) [74]. Among the 780 transcribed miR-17~92 targets, 641 were detected by significant numbers of ribosome footprints (termed translated targets) (S10A Fig). Notably, only 123 (19. 2% of translated targets) showed greater than 1. 4-fold reduction in ribosome footprint abundance in TG B cells (termed ribo-downregulated TG targets), while only 80 (12. 5% of translated targets) were de-repressed by 1. 4 fold or more in TKO B cells (termed ribo-upregulated TKO targets) (S10B and S10D Fig). When the median values of translation changes were compared with these of mRNA changes, translation changes were dominant at the global level, in both TG and TKO B cells (S10C and S10E Fig). Therefore, only a small fraction of target genes respond to changes in miR-17~92 expression levels and miR-17~92 regulates its target gene expression mainly at the translational level. We compared the list of target genes de-repressed by miR-17~92 family miRNA deletion (ribo-upregulated TKO targets) with those suppressed by transgenic miR-17~92 overexpression (ribo-downregulated TG targets). To our surprise, these two lists overlapped by only 8 genes, including four previously validated targets (CD69, Fbxw7, Egr2, and Caprin2) (Fig 2A) [75–80]. When ribosome profiling data of TKO, WT, and TG B cells were analyzed together, it became clear that ribo-upregulated TKO targets as a group showed significant reduction in ribosome density when miR-17~92 family miRNA expression increased from almost zero in TKO B cells to WT levels, but did not show further reduction when miRNA expression increased from WT to TG levels (Fig 2B and S6 Table). In the same analysis, the ribosome density of ribo-downregulated TG targets did not exhibit any significant changes between TKO and WT B cells, but showed significant reduction when miR-17~92 expression increased from WT to TG levels (Fig 2C and S6 Table). Translated genes lacking miR-17~92 binding sites were used as negative control, whose ribosome density showed no significant alterations in B cells expressing miR-17~92 at three different levels (Fig 2D). The differential responses of target genes to three different levels of miR-17~92 expression in TKO, WT and TG B cells were confirmed by immunoblot analysis of individual target genes (S11 Fig). We first examined TKO B cells for their expression of the 13 targets suppressed in TG B cells (S7A Fig). Six of them (Phlpp2, Rnf11, Arid4b, Tax1bp1, Cyld and Pten) showed significant de-repression in protein levels, but the degree of de-repression was relatively small (1. 2–1. 5 fold), while the expression of the other seven was not altered (S11A and S11B Fig). In contrast, among the 34 targets that were not suppressed in TG B cells (S7B and S7C Fig), 10 showed significant increase in ribosome footprint abundance in TKO B cells and belonged to ribo-upregulated TKO targets (Mink1, Phlda3, Fbxw7, Map3k3, Tmem127, Rapgef2, Dusp2, Rb1, Sos1 and Lats2) (S6 Table). This was further confirmed by immunoblot analysis of TKO B cells, which showed up to 3. 3-fold increases in protein levels of these genes (S11C and S11D Fig). When the relative protein levels of these 23 targets in TKO, WT, and TG B cells were plotted together, it became obvious that different targets exhibit different sensitivity to changes in miR-17~92 expression levels (Fig 2E). Ten targets (termed group 1 targets) were suppressed when miR-17~92 expression increased from TKO to WT levels, but showed little suppression in TG B cells. Seven targets (termed group 3 targets) were suppressed when miR-17~92 expression increased from WT to TG levels, but showed only marginal de-repression in TKO B cells. The other six targets (termed group 2 targets) showed suppression when miR-17~92 expression increased from WT to TG levels, and were de-repressed in TKO B cells (Fig 2E). In contrast to the significant changes in their protein levels, the mRNA levels for most of them remain the same in TKO, WT, and TG B cells, regardless of target groups (Fig 2F). We next performed reporter assays in wild type B cells to investigate whether miR-17~92 exerts its effect on these target genes through its cognate binding sites on target mRNAs. As shown in S12 Fig, mutation of miR-17~92 binding sites led to increased activity of a luciferase gene fused to target gene 3’UTRs, therefore demonstrating direct regulation of these target genes by miR-17~92 in B cells. Based on these results, we propose the following model of differential sensitivity of target genes to miRNA suppression. For a miRNA-target mRNA interaction, there is a threshold level and a saturation level of miRNA concentration (Fig 2G). Target gene expression is suppressed by miRNA in a dose-dependent manner when miRNA concentration is between these two levels. Below the threshold level, target gene expression cannot be suppressed by miRNA. Above the saturation level, target gene expression cannot be further suppressed by increasing concentration of miRNA. The maximal difference in target gene protein levels (termed amplitude) is reached when miRNA concentration increases from the threshold level to the saturation level. Different target genes exhibit different threshold level, saturation level, and amplitude in their responses to the same miRNA (or miRNA cluster) (Fig 2H). The differences in threshold and saturation levels underlie the different sensitivity of group 1,2, 3 target genes to changes in miR-17~92 expression levels, while the differences in amplitude explain the various degrees of suppression or de-repression in TG and TKO B cells, respectively (Fig 2E). A prediction of this model is that not all miRNA binding sites are occupied by miRNA. Therefore, it is likely that there are less miRNA molecules than miRNA binding sites in WT B cells. To test this, we determined the copy numbers of miR-17~92 miRNA molecules and miR-17~92 binding sites present in B cells during activation. The miRNA molecule numbers in WT B cells were determined by quantitative Northern blot analysis of WT B cells and TKO B cells spiked with graded amounts of chemically synthesized mature miR-17~92 family miRNAs (Fig 3A–3C and S7 Table). By combining the mRNA molecule numbers determined by ERCC-RNA-seq (S1A Fig) and conserved miR-17~92 binding sites determined by PAR-CLIP [40], we calculated the number of conserved miR-17~92 binding sites in a B cell (Fig 3D and S8 Table). Our calculation showed that each naïve B cell expresses 900–1,800 molecules of miR-17, miR-19, and miR-92 subfamily miRNAs, and 80 molecules of miR-18 subfamily miRNAs (Fig 3B and 3C and S7 Table). The ratios between conserved miR-17~92 binding sites and miRNA molecules range from 0. 5 (miR-92 subfamily) to 4. 6 (miR-18 subfamily) in naïve B cells (Fig 3E). Upon activation, both miR-17~92 miRNAs and their target mRNAs are up-regulated (Fig 3C and 3D), but the fold increase of the latter outpaces the former, thereby increasing the ratios between conserved binding sites and miRNA molecules to 2. 8 (miR-92 family) and 8. 7 (miR-18 family) in 25. 5h activated B cells (Fig 3E). Moreover, the PAR-CLIP analysis identified 2. 4-fold more non-conserved binding sites than conserved ones [40]. Previous studies showed that non-conserved binding sites can also be occupied by RISC [36]. Taking non-conserved binding sites into account, potential miR-17~92 binding sites outnumber miRNA molecules even further, by as much as 20-fold. These estimations are consistent with results from previous studies measuring the molecule numbers of miRNAs and their binding site numbers on target mRNAs in hepatocytes and stem cells [81,82]. Therefore, we conclude that only a fraction of potential binding sites are occupied by miR-17~92 miRNAs at any given time. We next investigated how miRNAs regulate target gene translation using polysome profiling (S2D Fig) [23,83]. While ribosome profiling measures ribosome footprint abundance, which is a sum of mRNA abundance and translation rate [72], polysome profiling directly measures the number of ribosome associated with a mRNA molecule, independent of mRNA expression level (S13 Fig) [84]. We first confirmed that miRNA gene mutations had little impact on the global polysome profile (S14 Fig). We then investigated the distribution of individual miRNAs and mRNAs in the sucrose gradient. miR-21, one of a few miRNAs enriched in monosome fractions [32,85], and highly abundant in B cells [86], was used as control. In contrast to miR-21, miR-17~92 miRNAs were mainly associated with light polysomes (Fig 4A and 4B). This suggests that miR-17~92 miRNAs are predominantly associated with target mRNAs undergoing slow translation. Next we measured the distribution of target mRNAs in the sucrose gradient. While the β-Actin mRNA (Actb) was enriched in heavy polysome fractions, mRNAs of all validated miR-17~92 target genes exhibited a bimodal distribution (Fig 4C). The first peak was located at fractions 10–11, corresponding to mRNAs associated with 3–4 ribosomes, while the second peak was located at fractions 14–16, corresponding to mRNAs associated with more than 7 ribosomes (Fig 4C). Our quantification of miR-17~92 family miRNA molecules and their potential binding sites on target mRNAs in B cells suggested that only a fraction of target mRNA molecules are occupied by these miRNAs (Fig 3E). In addition, the distribution of miR-17~92 family miRNAs largely overlapped with the first peak of their target mRNAs (Fig 4B and 4C). Taken together, these results suggest that target mRNAs are compartmentalized: target mRNAs in the first peak are associated with miR-17~92 family miRNAs and undergo slow translation, while target mRNAs in the second peak are largely free of miR-17~92 family miRNAs and undergo more active translation. Transgenic miR-17~92 expression shifted a fraction of target mRNAs from the second peak into the first peak (Fig 4C), thereby reducing the overall translation rate and protein output (S7A Fig). Consistent with the previous observations that miR-17~92 regulation of Hbp1 occurs mainly at the mRNA level (Fig 1D and S9E Fig), the distribution of the Hbp1 mRNA in the sucrose gradient showed little change (Fig 4C). We conducted the same analyses for another well-studied lymphocyte-specific miRNA, miR-155 [87], to see whether our observation is a general phenomenon. This included absolute quantification of miR-155 and its binding sites in WT B cells and ribosome profiling analysis of miR-155-deficient (155KO) B cells. Our results showed that there are 7-fold more conserved miR-155 binding sites than miR-155 molecules (S15A Fig), that miR-155 was enriched in light polysome fractions (S15B Fig), and that deletion of miR-155 caused a significant shift of mRNAs of previously validated target genes (Aicda, Sfpi1, Jarid2 and Peli1) from light to heavy polysomes (S15C Fig) [88–91]. To independently confirm these results, we took an un-biased approach to assess changes of target mRNA distribution in the sucrose gradient (Poly-RNA-seq, S16A Fig). We performed RNA-seq analysis of total RNA purified from polysome fractions 10–11 and 14–16, corresponding to the first and second peaks of target mRNA distribution in the sucrose gradient, and calculated the relative abundance of target mRNA of interest in these two peaks in B cells from mice of different genotypes. This analysis produced results consistent with polysome profiling analysis, showing that miR-17~92 target mRNAs were enriched in fractions 10–11 while depleted in fractions 14–16 in TG B cells, and miR-155 target mRNAs were depleted in fraction 10–11 while enriched in fractions 14–16 in miR-155 KO B cells (S16B and S16C Fig). Taken together, our polysome profiling analysis of individual target gene mRNAs demonstrated that miRNAs suppress target gene expression by reducing ribosome occupancy on a fraction of target mRNA molecules. We sought to understand what determines target gene sensitivity to miRNA-mediated translational repression. While the contribution of seed types and other cis-factors has been extensively investigated in the cellular contexts in which miRNAs predominantly act to decrease target mRNA levels [8,92], the factors that regulate miRNA-mediated translational repression remain largely unknown. We systematically investigated the length of 5’UTR, coding region (CDS) and 3’UTR, numbers of conserved miR-17~92 binding sites, enrichment of specific seed types, and locations of binding sites. We found mRNAs with miR-17~92 binding sites tend to have longer 5’UTR, CDS, and 3’UTR, but their length did not predict target gene sensitivity. None of the other features correlates with target gene sensitivity globally (S17 Fig). As our results showed that miR-17~92 suppresses target gene expression mainly through translational repression, we then focused on molecular features implicated in translational regulation [93]. Ribosome footprint distribution analysis showed that there were ribosome footprints in 5’UTRs of miR-17~92 target genes, though their abundance was lower than ribosome footprint abundance in CDS (S18 Fig). A close examination revealed a significant accumulation of ribosome footprints in 5’UTRs of ribo-upregulated TKO targets in WT B cells as compared to TKO B cells (Fig 5A). This suggested that miR-17~92 represses translation initiation of these target genes through their 5’UTRs (See discussion). Consistently, ribosome footprint abundance in 5’UTRs of ribo-downregulated TG targets was increased when miR-17~92 expression increased from WT to TG levels (Fig 5B), while other non-responsive target genes did not show significant changes in ribosome footprint abundance in their 5’UTRs in TKO, WT or TG B cells (Fig 5C). Moreover, local ribosome occupancy in 5’UTRs inversely correlated with overall ribosome density, which is a good indicator of translation rate and protein output. This suggests a role of ribosome hindrance in 5’UTR in suppressing translation initiation (Fig 5D). We searched the 5’UTRs of ribo-upregulated TKO targets for potential enrichment of specific sequence motifs but did not find any. Instead, we found high GC content in these 5’UTRs, and the position of the GC content peak correlated with the position of the ribosome footprint peak (Fig 5A and 5E). The translation efficiency of mammalian mRNAs is highly sensitive to GC content of 5’UTR, as high GC content often indicates the presence of secondary structures. A previous study showed that an increase in 5’UTR GC content from 52% to 62% led to a 2-fold decrease in translation efficiency [94]. In line with this, recent bioinformatic analyses implied that local structures in 5’UTRs contribute to efficient miRNA-mediated gene regulation via translational repression [19,95]. Moreover, our reporter assay experiments confirmed direct regulation of group 1 targets by miR-17~92 in wild type B cells, but the degree of de-repression in reporter activity caused by binding site mutation was often less than the degree of de-repression in target gene protein levels in TKO B cells (Fig 2E and S12 Fig). This suggests that cis-elements beyond miRNA binding sites in 3’UTRs contribute to the amplitude of target gene regulation. Taken together, we surmised that ribosome hindrance mediated by secondary structures in 5’UTRs contribute to target gene sensitivity to miRNA suppression at the translation initiation stage. We explored this idea further by focusing on CD69, the most sensitive target gene among the 24 validated by immunoblot (Fig 2E). CD69 has a relatively short 5’UTR (84nt), which harbors no internal ribosome entry sites (IRES) or 18s rRNA binding regions that may enhance cap-independent translation [97–99]. Instead, there are two sub-optimal start codons (AUC and GUG) and a potential hairpin [100,101] (Fig 6A and S19 Fig). Consistent with the global analysis of ribo-upregulated TKO targets (Fig 5A), there was an accumulation of ribosome footprints in CD69 5’UTR in WT B cells (Fig 6B). The ribosome footprint is 31 nt long, corresponding to the width of a single ribosome. Interestingly, the ribosome footprint overlaps with the two sub-optimal start codons and the 5’ arm of the putative hairpin, while its abundance shows positive correlation with miR-17~92 expression levels and negative correlation with CD69 expression (Figs 6B and 2E). We hypothesized that the two sub-optimal start codons and the hairpin work together to slow down translational initiation, thereby rendering CD69 mRNA sensitive to translational repression. Indeed, polysome profiling analysis confirmed that miR-17~92 represses CD69 expression at the translation level (Fig 6C), and deletion of the miR-17~92 family miRNAs led to a 4. 5-fold increase in cell surface expression of CD69 in TKO B cells, with only marginal effect on its mRNA level (Fig 6D). We investigated the functional contribution of CD69 5’UTR to its regulation by miR-17~92 using a modified form of the dual luciferase reporter psiCheck-2 (Fig 7A) [102]. In this plasmid (termed psiCheck-2-pd), the firefly luciferase gene (Fluc) controlled by the human thymidine kinase (TK) gene promoter is used as an internal reference for transfection efficiency. We placed the CD69 3’UTR downstream of the renilla luciferase gene (hRluc). The wild type CD69 3’UTR (wt) contains three binding sites for miR-17~92 miRNAs (one for miR-17 subfamily and two for miR-92 subfamily). We introduced 3nt mutations into these binding sites to abolish their interactions with miR-17~92 miRNAs to generate a mutated form of CD69 3’UTR (mut). A comparison of the renilla/firefly luciferase activity ratio (hRluc/Fluc) between psiCheck-2-pd containing wt and mut CD69 3’UTR should reveal the sensitivity of the renilla luciferase mRNA to miR-17~92-mediated suppression. To examine the role of CD69 5’UTR in regulating translation rate and sensitivity to miRNA suppression, we inserted CD69 5’UTR between the transcription start site of (TSS) of the SV40 promoter and the Kozak sequence of the renilla luciferase gene (Fig 7A). The β-Actin 5’UTR contains no obvious secondary structures, exhibited minimal accumulation of ribosome footprints in TKO, WT, and TG B cells (Fig 6B), and was used as a control. We performed dual-luciferase reporter assays in in vitro activated WT B cells to closely imitate the experimental conditions of ribosome profiling and polysome profiling (Fig 7B). As expected, the firefly luciferase activity remained as a constant (Fig 7C). The renilla luciferase reporter containing CD69 5’UTR showed a 4. 4 fold de-repression when miR-17~92 binding sites in its 3’UTR were mutated, very similar to the fold de-repression of the endogenous CD69 gene in TKO B cells (Figs 6D and 7C). Replacing CD69 5’UTR with β-Actin 5’UTR significantly reduced the sensitivity of the renilla luciferase reporter gene to miR-17~92 suppression (Fig 7C). qRT-PCR analysis of renilla and firefly luciferase mRNAs showed that the ratio between these two mRNAs was not affected by changes in 5’UTR or 3’UTR, excluding any substantial contributions from mRNA changes (Fig 7D). We next performed similar reporter assays in TG, WT, and TKO B cells, using the psiCheck-2-pd reporter with wild type CD69 5’UTR and 3’UTR. Consistent with CD69 expression in B cells of these three genotypes (Fig 2E), the expression of renilla luciferase was more sensitive to miR-17~92 depletion than overexpression (S20A Fig). To understand the functional contribution of the putative hairpin and two sub-optimal start codons in CD69 5’UTR to the sensitivity of CD69 mRNA to miR-17~92 suppression, we deleted the left arm of the hairpin (ΔHP) or mutated these two sub-optimal start codons (Mut-uORF), and performed reporter assays in WT B cells. Deletion of the left arm of the hairpin reduced the sensitivity of renilla luciferase to miR-17~92 suppression, but no significant effect was observed for mutating the two sub-optimal start codons (S20B Fig). Taken together, these results demonstrate that structural components in 5’UTR play an important role in regulating the sensitivity of target mRNA to translational repression by miRNAs. This study provides mechanistic insights into the functional specificity of miRNAs and the key target gene model, which postulates that miRNAs exert their specific functions by suppressing the expression of a small number of key target genes [44]. Our findings, together with previously published studies [41–43], suggest that key target genes emerge from a pool of hundreds of target genes via multiple mechanisms. That is, there are mechanisms that regulate miRNA binding to target mRNAs, the consequences of miRNA binding, and cellular responses to reduced target gene protein levels (S21 Fig). First, there are more binding sites than miRNA molecules and only a fraction of binding sites are occupied by miRNA-containing RISC complexes at any given time. Target mRNAs often associate with RNA-binding proteins (RBPs) and exhibit certain secondary and tertiary structures, which interfere with the recruitment of RISC and result in differential accessibility and affinity to miRNA [30,103–106]. When hundreds of target mRNA species compete for a limited amount of miRNA molecules, binding sites with easy accessibility and high affinity are preferentially occupied. Increasing the cellular concentration of miRNA molecules leads to saturation of the most favorable binding sites and occupation of additional binding sites with lower accessibility and affinity. Consistent with our view, a previous study demonstrated that target accessibility is a critical determinant of miRNA-mediated translational repression in the cellular context where miRNAs do not cause target mRNA degradation [107]. Therefore, the accessibility and affinity of binding sites, as well as the presence of competing target mRNA species, establish the threshold and saturation levels of miRNA for a given target mRNA (Fig 2G). Second, miRNA binding does not necessarily warrant functional consequence. There are mechanisms that determine whether miRNA binding leads to changes in target gene protein levels. This study shows that 5’UTR is a part of the mechanisms regulating target gene sensitivity to miRNA suppression at the translation initiation stage. Third, there are mechanisms that regulate cellular responses to changes in target gene protein levels. We speculate that changes in the protein levels of many target genes brought about by a miRNA are functionally inconsequential, as shown by many examples of genetic mutant mice with no observable phenotypes [108]. Nevertheless, there are a small number of target genes that are functionally sensitive to reduced protein levels in a given cellular context, as documented by the pathologies arising from haploinsufficiency [109–111]. These dosage sensitive target genes likely serve as critical mediators of miRNA functions and are the key target genes in that particular cellular context (S21 Fig). How many key targets are there to mediate the function of a miRNA in a given cellular context? Our global analysis of miR-17~92 target genes in primary B cells provide insights into this question. Among the 868 experimentally identified targets with conserved miR-17~92 binding sites [40], 780 are significantly transcribed and 641 are significantly translated. When the cutoff is set at 1. 4 fold change in ribosome footprint abundance, only 80 of them are suppressed by the WT levels of miR-17~92 and qualify as responsive targets, amounting to 9% of experimentally identified targets. As discussed above, it is likely that only a fraction of these 80 target genes are relevant for the function of miR-17~92 in B cells. Therefore, the number of key target genes is further reduced to a few percent of the 868 targets. For miRNA genes encoding a single mature miRNA, which often has 100–200 putative target genes, this would translate into only a few key targets for a given cellular context (S21 Fig). Consistent with this estimation, recent genetic studies showed that mutation of miRNA binding sites in a single target gene phenocopied defects caused by miRNA deficiency in a cell context-dependent manner, demonstrating that individual miRNA-target mRNA interactions can play critical roles in mediating the function of miRNAs in animals [41–43]. For most mRNAs, translation initiation occurs by a cap-dependent scanning mechanism, which requires the binding of the trimeric complex eIF4F (comprised of eIF4E, eIF4A, and eIF4G) to the m7G cap structure, followed by recruitment of the preinitiation complex (PIC) and scanning of PIC to the first AUG codon positioned within a good context [112] (S22A Fig). The secondary structures in their 5’UTRs play important roles in regulating translation initiation [113]. Scanning through these secondary structures require additional factors and ATP, and this requirement depends on the position and stability of secondary structures [114,115]. RNA helicases such as eIF4A are required for unwinding these secondary structures and for facilitating the scanning of PIC [116]. Recent studies suggested that miRNAs require eIF4As to regulate translation of their target mRNAs [19,117,118]. While two studies demonstrated miRNAs repress target gene translation by facilitating dissociation of eIF4As from target mRNAs [117,118], a third one proposed they repress target mRNAs by recruiting eIF4AII [19]. Even though the detailed molecular mechanisms by which eIF4As mediate miRNA function are contradictory in these reports, the requirement of eIF4As in miRNA function during PIC scanning is consistent with other studies that utilized reporter constructs whose translational initiation bypasses the PIC scanning process. These reporter genes were immune to miRNA-mediated repression, suggesting that miRNA repression takes place during PIC scanning [23,119]. It should also be noted that other studies demonstrated that miRISC and the CCR4-NOT complex can silence target mRNA in an eIF4A-independent manner, suggesting the eIF4A dependency can be context-specific [120]. Our study suggests that the most sensitive targets (such as ribo-upregulated TKO targets) contain more structured 5’UTRs. In the absence of miR-17~92 family miRNAs (in TKO B cells), eIF4As or other RNA helicases facilitate the unwinding of these secondary structures, allowing PIC to scan through and to initiate translation. In the presence of WT levels of miR-17~92 family miRNAs, RISC complexes are recruited to these target mRNAs through their cognate binding sites in the 3’UTRs, and dissociate RNA helicases from the 5’UTRs. This results in stabilization of secondary structures and accumulation of PIC (and ribosome footprints in ribosome profiling experiments) in the 5’UTRs, repression of translation initiation, and a reduction in protein output (S22B Fig). When miR-17~92 expression is further increased to the TG levels, less sensitive targets (such as ribo-downregulated TG targets) that do not respond to WT levels of miR-17~92 become responsive at this higher level. Our reporter assays demonstrate that specific structural components in 5’UTR indeed regulate miRNA-mediated translational repression, but the detailed molecular interactions between miRNA, 5’UTR, and the translation initiation machinery warrant future investigation. Our findings also provide a straightforward explanation for the recent observations that deletion and overexpression of the same miRNA gene can lead to unrelated phenotypes [121,122]. As a representative example, early studies have shown that overexpression of members of the miR-34 family miRNAs has potent tumor suppressor function downstream of p53 [121]. However, mice carrying target deletion of all miR-34 genes display normal p53 responses to a variety of cellular insults, including ionizing radiation and oncogenic stress [123]. Another study reported that mice deficient of all the six miRNAs in the miR-34/449 family exhibited postnatal mortality, infertility and strong respiratory dysfunction caused by defective mucociliary clearance, resulting from a significant decrease in cilia length and number [122]. Our study suggests that different functions of miR-34 family miRNAs in these overexpression and deletion studies can be explained by different sensitivity of target genes to miR-34 suppression. When these miRNAs are expressed at WT levels, target genes regulating cilia assembly (i. e. Cp110) are among the most sensitive and their expression is suppressed. Deletion of all miR-34/449 family genes results in de-repression of these genes and impaired cilia assembly [122]. When miR-34 family miRNAs are overexpressed at levels much higher than WT levels, another group of target genes, which are less sensitive and only respond to higher than WT levels of miR-34, are suppressed. This group contains positive regulators of cell cycle and DNA-damage responses (i. e. Cdk4, Ccne2, and Met), whose suppression bestows anti-tumor functions to miR-34 family miRNAs [121]. Therefore, different sensitivity of these two groups of target genes, one regulating cilia assembly and the other regulating cell cycle and DNA damage response, to miR-34 suppression underlies the different phenotypic consequences brought about by overexpression and deletion of this family of miRNAs. A recent study investigating real-time translation of single mRNA molecules in live mammalian cells revealed surprising heterogeneity in the translation of individual mRNAs from the same gene within the same cell, including rapid and reversible transitions between translationally active and inactive states [124]. The same study showed that the long form 5’UTR of the Emi1 gene, when placed upstream of a GFP reporter gene, caused a 40-fold reduction in the GFP protein level. While a great majority of GFP mRNAs containing the long form 5’UTR of the Emi1 gene were strongly translationally repressed, a small subset of these mRNAs still escaped repression and underwent robust translation. These results suggest that cis-elements in the long form 5’UTR of the Emi1 gene drastically shifted, but did not completely shut off, the GFP mRNAs from translationally active states into inactive states. This is quite similar to our polysome profiling analysis of miR-17~92 target genes in WT and TG B cells, which showed that transgenic miR-17~92 expression shifted only a fraction of its target mRNAs from rapid translation states into slow translation states. A previous study investigating the effect of endogenous Let-7 miRNA on a reporter target gene in HeLa cells came to similar conclusions [23]. The authors further proposed that the translationally repressed reporter mRNAs, as well as Let-7 miRNAs, are localized in processing bodies, a subcellular structure for mRNA storage or degradation. Considering our study together with these other studies, it is likely that miRNAs repress target gene expression by tipping the dynamic balance between translationally active and inactive states. Similar to the heterogeneity in the translation of individual mRNAs from the same gene within the same cell, emerging evidence suggests that mechanisms of miRNA action are also heterogeneous. A recent survey of studies investigating miRNA effect on functionally important target genes in 77 strains of miRNA mutant mice found that miRNA-target interaction can lead to translational repression, target mRNA degradation, or both [2]. It remains unclear what determines the relative contribution of these two modes of miRNA action to target gene suppression. Previous studies suggest that this could be both cellular context- and miRNA-dependent [1,2, 125]. In this study, we showed that most functional target genes of miR-17~92 are suppressed at the translational level, but some target genes are suppressed by mRNA degradation, either completely or partially. This target gene-dependency became more clear when we applied the same transcriptome and translatome analyses to miR-155-deficient B cells. Our unpublished results showed that in the same cellular context, miR-155 suppresses its target gene expression by translational repression, mRNA degradation, or both, and this is completely target-gene dependent. Future investigation is warranted to identify cellular factors, as well as cis-elements in both miRNAs and target mRNAs, that determine the molecular consequence of individual miRNA-target mRNA interactions. In summary, we conducted an integrated analysis of miR-17~92 family miRNAs, their target genes, and the functional consequences of these miRNA-target gene interactions in primary B cells expressing miR-17~92 family miRNAs at three different physiological levels. We present evidence showing that there are more binding sites than miRNA molecules, that target genes exhibit differential sensitivity to miRNA suppression, and that only a small fraction of target genes are actually suppressed by a given concentration of miRNA. Transgenic expression and deletion of the same miRNA gene regulate largely distinct sets of target genes. miR-17~92 regulates functional target gene expression mainly through translational repression in activated B cells and 5’UTR plays an important role in regulating target gene sensitivity to miRNA suppression. These findings provide mechanistic insights into the key target gene model in which the specific function of a miRNA is achieved by regulating a small number of key target genes. All mice were used in accordance with guidelines from the Institutional Animal Care and Use Committees of The Scripps Research Institute and Xiamen University. The generation of miR-17~92 Tg (Jax stock 008517), miR-17~92fl/fl (Jax stock 008458), miR-106a~363-/- mice (Jax stock 008461), miR-106b~25-/- mice (Jax stock 008460), CD19-Cre (Jax stock 006785) was previously reported [49,126,127]. MiR-17~92 Tg mice were crossed with CD19-Cre mice to generate miR-17~92 Tg/Tg; CD19Cre (TG) mice [40]. miR-17~92fl/fl mice were crossed with miR-106a~363-/- mice, miR-106b~25-/- mice and CD19-Cre mice to generate miR-17~92fl/fl; miR-106a~363-/-; miR-106b~25-/-; CD19-Cre (TKO) mice. miR-155-/- were obtained from The Jackson Laboratory (Jax stock 007745) [87]. Spleen and peripheral lymph nodes were collected from 2~3 month old TG, TKO and wild type (WT) mice. WT and TG B cells were purified by depleting cells positive for AA4. 1 (CD93), CD43 and CD5, while TKO B cells were purified by depleting cells positive for AA4. 1 (CD93), CD43 and CD9 using MACS LD columns (Miltenyi Biotec) following manufacturer’s instructions. Purified B cells were cultured at a density of 5x106 cells/ml for indicated amounts of time in B cell medium plus LPS (25μg/ml) and IL-4 (5ng/ml) in 37°C incubator, unless indicated otherwise. At the time of harvest, live cells were purified by Ficoll (GE Healthcare, 17-1440-02) to achieve a purity of >90% live cells and >98% B220+CD19+ B cells before further analysis. B cell medium was made of DMEM GlutaMAX (Gibco 10569) plus 10%v/v FCS, 1x non-essential amino acids (Corning, 25-025-CI), 10mM HEPES (Gibco, 15630), 50μM β-ME (Gibco, 21985), 1x Penn/Strep. P values were determined by using two-tailed Student’s t-test. Statistical significance is displayed as *P < 0. 05, **P < 0. 01 and ***P < 0. 001. Detailed procedures and analysis methods are present as a supplementary material. Please see “S1 Methods” Microarray, RNA-Seq, and ribosome profiling data are available at NCBI Gene Expression Omnibus through the accession numbers GSE56379, GSE83734, and GSE83684.

Title: Differential Sensitivity of Target Genes to Translational Repression by miR-17~92 Summary: MicroRNAs (miRNAs) are small RNAs encoded by our genome. Each miRNA binds hundreds of target mRNAs and performs specific functions. It is thought that miRNAs exert their function by reducing the expression of all these target genes and each to a small degree. However, these target genes often have very diverse functions. It has been unclear how small changes in hundreds of target genes with diverse functions are translated into the specific function of a miRNA. Here we take advantage of recent technical advances to globally examine the mRNA and protein levels of 868 target genes regulated by miR-17~92, the first oncogenic miRNA, in mutant mice with transgenic overexpression or deletion of this miRNA gene. We show that miR-17~92 regulates target gene expression mainly at the protein level, with little effect on mRNA. Surprisingly, only a small fraction of target genes respond to miR-17~92 expression changes. Further studies show that the sensitivity of target genes to miR-17~92 is determined by a non-coding region of target mRNA. Our findings demonstrate that not every target gene is equal, and suggest that the function of a miRNA is mediated by a small number of key target genes.

lay_plos

en

Summarize: Ryan Cruz Saldana, 3, was killed after he was hit by a car Friday. Support for the family has flooded social media using the hashtag #redballoonsforryan. (Photo courtesy of Alissa Circle) SOUTH PASADENA >> On Friday morning, 3-year-old Ryan Cruz Saldana was gleefully running through Disneyland, his curly mane of flaming red hair flowing behind him. On Friday evening, Jacqui and Dan Saldana were dealing with a tragedy no parent wants to fathom. Ryan, of South Pasadena, was hit and killed by a truck while playing outside his cousins’ house in Alta Loma. On Tuesday, Saldana’s fiery locks lit up social media, as tens of thousands of friends, family and strangers posted messages of love and support on Twitter, Instagram and Facebook with the now-viral hashtag #redballoonsforryan. Posts came from as far away as New York, Oklahoma and Canada, many from bloggers, celebrities, businesses and just regular people who didn’t know Ryan or his family. “Parents aren’t supposed to have to bury their children,” actress Sophie Bush posted on Twitter. Alissa Circle, 34, of Orange County, started the hashtag with a post on her blog, Diary of an Addict on Monday. She said the post went viral overnight and had so many views that her blog site crashed. She said she’s seen thousands of posts on social media from all over the world, which is exactly what she hoped for when she wrote the post. “I wanted there to be able to have a place where (Jacqui and Dan) could go and see where everyone was sharing.... It’s just so incredible,” Circle said. “When I wrote that, I was hoping that somebody would see it, anybody would see it, and would post a picture. I literally slept for five hours, and when I woke up the site was down. There were 4,000 pictures shared already on Instagram. It was just an incredible outpouring.” Circle, who met Jacqui Saldana through Saldana’s blog Baby Boy Bakery, said she chose red balloons as a symbol for Ryan because he loved red and loved balloons, and Saldana told her she wanted to release red balloons at Ryan’s funeral. Circle said the couple, both 29, have been touched by the support. “When I talked to Jacqui yesterday, they just said they couldn’t believe it and it’s making them strong, and they can feel the prayers and they can feel the love, and they are just so overwhelmed with gratitude that everyone is sharing Ryan’s story and they are keeping his memory alive,” Circle said. A Facebook page has been launched to encourage supporters to release red balloons on Sunday for Mother’s Day to support Jacqui Saldana. Groups have been organized at different locations across the country to participate in the event. “For Jacqui, she just needs the reassurance that she is still a mom, and she was a great mom,” Circle said. “This is just tragic that this happened at all, and then the fact that it happened the weekend before Mother’s Day.” Jason Verkler, 42, of Alta Loma, at whose house the incident occurred, said Jacqui Saldana was a dedicated mother who frequently posted pictures and stories about her son on her blog. Advertisement “Jacqui, she is the sweetest person there is, and she really kind of had a little community going with her blog, and of course everything was about Baby Boy Bakery. She started it after she had Ryan. All she did was for her son, that was it,” Verkler said. “She was petrified and scared to death of being a mom and turned out to be one of the best. All you have to do is look at her site... and see the photos of Ryan and her, you can just see what she put into being a mom and how happy the kid was.” Many who posted support for the family this week knew Ryan from his mother’s Instagram pictures and her blogs about motherhood. And the support has not only come in the form of social media. A GoFundMe page started for the family has raised more than $40,000 in less than two days. A motherhood ministry group Thrive Moms is also accepting donations to help the family at http://thrivemoms.com/blog/2014/5/6/redballoonsforryan. Dozens of online and brick-and-mortar retailers have announced that they plan to donate a portion of their profits to the Saldana family. Others have designed shirts, jewelry and works of art to sell and donate the profits. “It was just such a tragic event. Anybody that followed her Instagram knew that her son was her life and would see pictures of him all over the place and then to hear that... in an instant (that) was just gone I think that probably hit home to a lot of people, a lot of moms,” said Jessica Von Bluecher, owner of Los Angeles-based clothing and jewelry store The Oxford Trunk, which is donating proceeds to the family. “I’m a mom, it was just devastating. That’s every mom’s worst nightmare.” Verkler’s wife Tracey, 44, said Ryan was a happy kid who loved Ninja Turtles, Disneyland and UCLA football — where his uncle Tre Hale plays. Verkler said Ryan attended school in Pasadena, and both his parents work in Pasadena. “He was just the greatest little boy and just his hair, I used to say his horrible red hair because it was so long and curly. The kid had no fear, he was all boy,” Tracey Verkler said. “(He came) over to my house for tacos, and we were having a good time, and then that’s it — all of us were changed forever in a split second.” Circle said funeral arrangements have not yet been finalized but will be announced on social media. I wish I knew how to begin writing this. I’ve actually stopped and started over and over again. How do you find the right words? The hard truth is that there will never be the right words, this is not something that can be packaged up into a bow. There’s nothing beautiful, nothing serene. Yet ever bit of it is screaming of a need to find hope. A need to find peace. A cry out to know that God will write more of this story. That this will not define their story, but will define how they stand together united. A need to find God in the midst of tragedy. To know that His plan doesn’t always make sense to us. Many of you know my best friend Jacqui, who blogs at Baby Boy Bakery. We met almost 3 years ago and an instant friendship was born. She is one of the strongest, loving, most incredible people I know. And last year I was honored to stand next to her when she married her husband, Dan. Last Friday night, while playing out front of a family members home, Ryan was hit by a truck and went home to be with Jesus. It all happened so fast and he was simply in the wrong place at the wrong time. A simple excitement to grab the frisbee that had escaped into the road was met with a tragic loss. As I sit here writing this, I’m shaking and I haven’t stopped crying for the last 24 hours. I’m not even going to begin to share how unfair this all is or how much I hate watching my best friend go through this. No parent should ever have to bear the weight of loosing their child, especially not one that is 3 1/2. Even now, I sit here wanting to scream. I’ve begged God countless times to bring him back, to give him back to Jacqui and Dan. Today as I sat with Jacqui she gave me the honor of sharing her story. Not the whole story, but just a slice. A cracked window into a story that she needed to be told because she needs, they need, our support. They need us to rally They needs us to pray to share to love to remember… ….. Ryan. Let his loss not be in vain. I need your help friends. I know you may not know Jacqui, but she needs us now more than ever. Will you unite with me? Will you share her story? Will you offer her comfort? If you could take a moment, if you could take many moments… and not just pray for them, but join me in posting pictures of Ryan on your Facebook, your twitter, your Instagram feeds. Post them that the memory of him can live on. Post them to share in the love they had for their little boy. I know we can do this. I know we can pull together. Will you grab a picture from Jacqui’s Instagram feed, and post it to yours? Will you share words of encouragement and tag #RedBalloonsforRyan? Also be sure to tag Jacqui, @babyboybakery and Dan, @danno12 I promised her that Ryan would not be forgotten, we can make sure that doesn’t happen. We can use our voices for good. To tell a story, of a little boy who loved life and his family, who laughed often, who loved to snuggle his mommy and daddy. And to tell the story of two parents who are loving each other strongly and beautifully through this tragedy, through this unexplainable loss. With all that’s within me, and I know I’m probably not making sense anymore, please share. And please excuse me this week as I mourn the loss of a little boy who meant so much to me and my family. No mother should endure the loss of her child and no mother should have to share with her children that they’ve lost a best friend. While my kids have already shared that they know Ryan is dancing with Jesus in Heaven, they are deeply saddened and marked forever by this loss. I will do my best to come back to this space soon, but for now I just need some time, some moments of rest to gather my thoughts and my emotions. Posting here makes me feel as though life is moving forward and I’m not ready. I want it to stand still, I want it to rewind. I wish I could bring him back. I wish I could understand. Jacqui and Dan, I love you with all my heart and my soul! I’m so sorry that you’ve had to endure this and I promise you that Ryan will not be forgotten. He will NOT! We will remember him, we will tell his stories and we will love you both through all of this! Lord God, be with them…. Rest in Peace, Ryan Cruz Saldana 5.2.2014 GoFundMe has verified that the funds raised will go directly to the intended recipient. What does verified mean?

Summary: An outpouring of love has stunned the parents of a 3-year-old boy who was struck and killed by a car while playing frisbee, the Pasadena Star-News reports. Ryan Saldana died when he ran into the street in Alta Loma, Calif., on Friday, leaving his parents devastated. Then Alissa Circle, who knew the parents through blogging and their children's friendship, started a hashtag on her blog (#redballoonsforryan) so people could share thoughts and images of the boy with flaming red hair. She hoped "somebody would see it, anybody would see it and would post a picture," she says. "I literally slept for 5 hours and when I woke up the site was down, there were 4,000 pictures shared already on Instagram. It was just an incredible outpouring." Ryan's mom, Jacqui Saldana, "couldn't believe it and it's making them strong and they can feel the prayers and they can feel the love." Now a GoFundMe page is raising funds for the family, and a Facebook page is encouraging people to release red balloons for them on Mother's Day. "The one great thing is just really how many people are coming together," said a relative at whose house the accident happened. "It amazes me."

multi_news

en

Summarize: These crawls are part of an effort to archive pages as they are created and archive the pages that they refer to. That way, as the pages that are referenced are changed or taken from the web, a link to the version that was live when the page was written will be preserved.Then the Internet Archive hopes that references to these archived pages will be put in place of a link that would be otherwise be broken, or a companion link to allow people to see what was originally intended by a page's authors.The goal is to fix all broken links on the web. Crawls of supported "No More 404" sites. COLUMBUS, Ohio (AP) — The state can try again to put to death a condemned killer whose 2009 botched execution was called off after two hours, the Ohio Supreme Court said Wednesday. The court by a 4-3 vote rejected arguments by death row inmate Romell Broom, whose attorneys said giving the state prisons agency a second chance would amount to cruel and unusual punishment and double jeopardy. Prosecutors had argued double jeopardy doesn't apply because lethal drugs never entered Broom's veins while executioners unsuccessfully tried to hook up an IV. They also said a previously unsuccessful execution attempt doesn't affect the constitutionality of his death sentence. Justice Judith Ann Lanzinger sided with the state, saying the execution never began because the drugs were never administered. "Because Broom's life was never at risk since the drugs were not introduced, and because the state is committed to carrying out executions in a constitutional manner, we do not believe that it would shock the public's conscience to allow the state to carry out Broom's execution," Lanzinger wrote. The majority opinion said it was unclear why Broom's veins couldn't be accessed, a fact that brings the rejection of his appeal into question, Justice Judi French wrote in a dissent. "If the state cannot explain why the Broom execution went wrong, then the state cannot guarantee that the outcome will be different next time," French wrote. Broom was sentenced to die for raping and killing 14-year-old Tryna Middleton after abducting her in Cleveland in 1984 as she walked home from a Friday night football game with two friends. His 2009 execution was stopped by then-Gov. Ted Strickland after an execution team tried for two hours to find a suitable vein. Broom has said he was stuck with needles at least 18 times, with pain so intense he cried and screamed. An hour into the execution, the Department of Rehabilitation and Correction recruited a part-time prison doctor with no experience or training with executions to try — again, unsuccessfully — to find a vein. Broom's appeals in federal court were on hold while the state court heard the constitutional arguments. Broom, 59, has been back on death row since. No new execution date has been set. Requiring Broom to endure another execution attempt would double up his punishment by forcing him to relive the pain he's already been through, his attorneys, Adele Shank and Timothy Sweeney, argued in a court filing last year. During a June hearing, Chief Justice Maureen O'Connor asked Shank about a prison official's testimony that Broom may have caused the problems with his veins by taking an entire box of antihistamines the day before to dehydrate himself. Shank said she witnessed Broom drinking coffee the day of the procedure. Chris Schroeder, an assistant Cuyahoga County prosecutor, said the antihistamines allegation was not part of the state's argument. In 1947, Louisiana electrocuted 18-year-old Willie Francis by electric chair a year after an improperly prepared electric chair failed to work. The U.S. Supreme Court ruled 5-4 to allow the second execution to proceed, rejecting double jeopardy arguments. A state's administration of its criminal law isn't affected by due process rights, when "an accident, with no suggestion of malevolence, prevents the consummation of a sentence," the court ruled at the time. Ohio prosecutors said lower courts properly determined that any mistakes happened during Broom's execution preparations, not the actual procedure. Schroeder said the evidence shows that the state wasn't deliberately trying to hurt Broom and that nearly two dozen successful executions since 2009 mean such an event couldn't happen again. ___ Andrew Welsh-Huggins can be reached on Twitter at https://twitter.com/awhcolumbus. His work can be found at http://bigstory.ap.org/content/andrew-welsh-huggins

Summary: Ohio tried and failed once to execute Romell Broom, and now a court has given the state permission to try again. The state's Supreme Court on Wednesday rejected Broom's argument that a second attempt would amount to cruel and unusual punishment and a violation of double jeopardy, reports the AP. Prison officials stopped the 2009 execution attempt after about two hours because they couldn't find a suitable vein for the lethal drugs. The Columbus Dispatch sums up the decision: "It is the first time in recent Ohio history the state will be allowed a do-over in an execution." Broom raped and murdered a teenage girl in 1984. No word yet on when the execution will take place.

multi_news

en

Summarize: Anderson Cooper Blasts New Vince Vaughn Trailer Email This Anderson Cooper won't be seeing 'The Dilemma.' In a discussion with "I was sitting in a movie theater over the weekend and there was a preview of a movie, and in it, the actor said, 'That's so gay,' and I was shocked that not only that they put it in the movie, but that they thought that it was okay to put that in a preview for the movie to get people to go and see it," he told Ellen. UPDATE: Universal has agreed to remove the "so gay" line from the trailer. Full Story "I just find those words, those terms, we've got to do something to make those words unacceptable because those words are hurting kids. Someone else I talked to recently said that the words people use and the things people say about other kids online, it enters into their internal dialogue," he added. Hear Anderson @ 5:30 'The Dilemma' Trailer Anderson Cooper won't be seeing 'The Dilemma.'In a discussion with Ellen DeGeneres, Cooper took issue with the movie's trailer, in which Vince Vaughn's character uses the word "gay" in a derogatory fashion, although he never named the actor or the actual film."I was sitting in a movie theater over the weekend and there was a preview of a movie, and in it, the actor said, 'That's so gay,' and I was shocked that not only that they put it in the movie, but that they thought that it was okay to put that in a preview for the movie to get people to go and see it," he told Ellen."I just find those words, those terms, we've got to do something to make those words unacceptable because those words are hurting kids. Someone else I talked to recently said that the words people use and the things people say about other kids online, it enters into their internal dialogue," he added. "And when you're a kid, it can change the way you see yourself and the way you think about yourself, and the worth that you give to yourself. I think we need to really focus on what language we're using and how we're treating these kids," the CNN anchor continued.Universal Studios is reportedly caught off guard by the spate of criticism about the trailer. A studio insider tells Deadline Hollywood's Nikki Finke that the studio "showed the trailer to gay groups like GLAAD and gay executives here and gays in our marketing department and no one was offended and everyone had a positive response."But a representative of GLAAD tellsthat they were never on board."That is inaccurate," spokesman Richard Ferraro said in response to reports that the gay rights group approved. "GLAAD does not and did not support this trailer."Many celebrities, including Cooper and DeGeneres, have spoken out against bullying following the recent suicides of several gay teens. 3RD UPDATE: View The Dilemma‘s new trailer here. 2ND UPDATE 10:40 AM: In Hollywood, so the saying goes, you can know that someone is lying because their lips are moving. Universal has now told me twice this morning that it sent an advance copy of the trailer for director Ron Howard’s Vince Vaughn-starring comedy The Dilemma to the Gay & Lesbian Alliance Against Defamation for vetting, claiming the organization didn’t object to it. But GLAAD just issued a news release strenuously disputing that: “Last month, Universal shared a link to the trailer for the film The Dilemma with GLAAD. After reviewing, GLAAD called on Universal to remove the scene where the word ‘gay’ was used as a pejorative from the trailer. Today, after Anderson Cooper also spoke out against the scene, Universal confirmed to GLAAD that the offensive joke will be removed from promotional campaigns from this point forward, including in the trailer currently playing in movie theatres. “The use of the word ‘gay’ in this trailer as a slur is unnecessary and does nothing more than send a message of intolerance about our community to viewers,” said GLAAD President Jarrett Barrios.” Universal, however, told me it sent the trailer to GLAAD ”before it ever went anywhere and there was no comment about it at all”. But GLAAD counters that it did not support or give a positive response to the trailer. ”We’ve been working with Universal for some time to get them to remove it.” When the trailer debuted three weeks ago, complaints immediately came in to the studio and its marketing department. But Universal claims that’s when it called GLAAD again to “double check” there were no objections. The studio tells me that “only then did GLAAD say, ’This is probably questionable. It’s not a major offense at all. But it’s best not to use it in the campaign so it avoids any questions.’” Hmm. Given how long ago the trailer began airing, it does seem that Universal decided to remove it and substitute a new one later only because of Anderson Cooper’s televised complaint this week (see below). UPDATE 10:30 AM: Universal just issued this statement in response to my story: “The teaser trailer for The Dilemma was not intended to cause anyone discomfort. In light of growing claims that the introduction to the trailer is insensitive, it is being replaced. A full trailer, which has been in the works for some time, will post online later today.” EXCLUSIVE 8:45 AM: Universal has a dilemma on The Dilemma. The studio recently debuted the first official trailer for its forthcoming Imagine comedy starring Vince Vaughn and directed by Ron Howard, and the reaction in Hollywood was dismay and disappointment. Not because it looks like a stinker. But because it uses the term “gay” as an insult right in the first scene. “Ladies and Gentlemen, electric cars are so gay,” Vaughn’s character tells a packed conference room to indicate his ridicule. Immediately after Deadline posted the trailer (removed today by Universal), Industry insiders took to the comments section for a heated discussion over the appropriateness of showcasing this scene much less including it in the movie at all. Now outsiders like CNN’s Anderson Cooper (see below) are disapproving of it as well. Until now, Universal hasn’t made any change to the trailer. But I’ve just learned the studio finally is responding to the pressure and planning to alter it. However, studio executives still appear bewildered by the situation “because we showed the trailer to gay groups like GLAAD and gay executives here and gays in our marketing department and no one was offended and everyone had a positive response,” a Uni insider claims to me. However, on the Ellen DeGeneres talk show this week, CNN host Anderson Cooper was interviewed by satellite on the subject of school bullying, and he brought up the Dilemma trailer and criticized it: “I was sitting in a movie theater over the weekend and there was a preview of a movie, and in it, the actor said, ‘That’s so gay,’ and I was shocked that not only that they put it in the movie, but that they put that in the preview. They thought that it was okay to put that in a preview for the movie to get people to go and see it… We’ve got to do something to make those words unacceptable cause those words are hurting kids. “Someone else I talked to recently,” Anderson continued, “said that the words people use and the things people say about other kids online, it enters into their internal dialogue. And when you’re a kid, it can change the way you see yourself and the way you think about yourself, and the worth that you give to yourself. I think we need to really focus on what language we’re using and how we’re treating these kids.” Universal Pulls 'Gay' Movie Trailer Bowing to growing outrage from the likes of, Universal Pictures has decided to pull the trailer for the movie "" -- and replace it with a new one some time today... Universal tells TMZ.The trailer in question begins withtelling a room full of people, "Ladies and gentlemen, electric cars... are gay." Sources at Universal Pictures told Deadline Hollywood's Nikki Finke they showed the trailer to gay rights groups beforehand, including GLAAD, and didn't get any negative feedback.But after Anderson complained on "The Ellen DeGeneres Show," we're told the studio folded like a cheap suit.A rep for Universal Pictures tells TMZ, "The teaser trailer for 'The Dilemma' was not intended to cause anyone discomfort. In light of growing claims that the introduction to the trailer is insensitive, it is being replaced. A full trailer, which has been in the works for some time, will post online later today."Now if only they can make the movie seem funny.: GLAAD tells TMZ they called on Universal to remove the clip from the trailer last month. A rep tells TMZ, "The use of the word ‘gay’ in this trailer as a slur is unnecessary and does nothing more than send a message of intolerance about our community to viewers."

Summary: Universal Pictures is pulling a trailer for the new Vince Vaughn movie because of a scene that uses the word "gay" as a joke, TMZ reports. Anderson Cooper first expressed distaste for the preview of The Dilemma, in which Vaughn's character calls electric cars "gay"-then adds, "not homosexual gay, but my parents are chaperoning the dance gay." Cooper said he was "shocked that not only that they put it in the movie, but that they thought that it was okay to put that in a preview," PopEater reports. Universal said it had screened the trailer for gay rights groups, including GLAAD, and had received no objections, reports Deadline Hollywood. GLAAD, however, does not remember it that way. "That is inaccurate," says a spokesman for the group. "GLAAD does not and did not support this trailer." Click here for more.

multi_news

en

Summarize: By. Ruth Styles. She might be just 16 years old but Becca Caxton from Hull has big plans for her future - and for that of her family. Despite her tender years and lack of work, Becca is planning for life as a benefits mother - much to the horror of her mother Anita, 38. 'I think kids shouldn't have kids and I. told that to Becca before she got pregnant,' fumes Anita, 38, who has a part time role as a delivery driver for Iceland. Pregnant: Becca Caxton, 16, is pregnant and has dropped out of school to live on benefits. 'I don't think it is right. I. think they should both work, work until they're much older and can. provide and be responsible for a child.' Becca, however, says she wants to move out and plans to move into a council flat with boyfriend Sonny Smith, 17, when the baby arrives. 'I do feel bad for [moving out and getting benefits] but obviously I. need the money to provide for a baby so she's [Anita] just going to have to deal. with it,' says Becca. 'I don't care what people say about me being 16 and pregnant. because I wanted it and it's not their lives and anyone can look after a. baby - it's not hard to do.' Becca's hometown, Hull, has a teenage pregnancy rate 60 per cent higher than the national average - and the unemployment figures to match. Not only is the Yorkshire town home to the highest percentage of job seekers in the UK, the youth unemployment rate is above 25 per cent. Worried: Boyfriend Sonny says he wants to finish college and get a job to support his new family. Children: Becca's mother Anita, 38, says she is horrified by her daughter's choice and wants her to get a job. As a result, many teenagers, among them Becca's sister Charlotte, 19, and brother Michael, 18, have joined the dole queue and show little inclination to do anything else. 'Teenagers are a pain in the backside,' says their mother Anita,. 'because when there's nothing out there for them, they don't want to get. up, they don't want to do anything, they complain they're bored... They're the bane of my life they are!' Anita herself was on the dole until recently, only getting a job when faced with losing £120 a week in child benefits should Becca move out. Nevertheless, she has high hopes for her children and says she'd like them to do better, in particular Charlotte. 'It's quite annoying to think that you are 19-years-old and you can't do anything,' complains a furious Anita to a reluctant Charlotte. 'You could be a barrister. You could be a solicitor!' Unfortunately for Charlotte, she, like Becca, has little in the way of qualifications and failed to pass her English and maths GCSES. Boyfriend Sonny does have qualifications and has just started college but despite admitting to misgivings, says he will go along with Becca's plans for a benefits baby. Bad odds: Becca and Sonny live in Hull, one of the worst parts of the country for youth unemployment. Hard: Becca's sister Charlotte and brother Michael both sign on due to lack of job and learning opportunities. 'It was a real shock due to me being. really young and having just started college, so not really able to provide for. a baby,' says Sonny of the moment he discovered he would become a father. 'Thanks to the benefits system, it's going to be a lot easier.' Becca has no such qualms, with her only complaint being told she can't start claiming benefits on her own account until the baby is born. 'I was so happy,' she says of the moment her pregnancy was confirmed. 'I was just smiling in the doctors but I knew I wanted it. I can't wait to move out!' While Sonny has qualms about being on benefits and Anita has found a part time job, it seems the only member of the Caxton family reluctant to sign on is the youngest, 15-year-old Aaron. 'I'm not going to be signing on because. you don't learn anything from that,' he insists. 'I think everyone who signs on in. this house is ridiculous!' But Anita has other ideas. 'He's got learning difficulties to an. extent, he's deaf... I suppose if somebody saw him, they would say he. was going to end up on the social.' For Aaron's sake, you can't help but hope she's wrong. The Caxton family appear on Britain on Benefits: Life on the Dole, which airs tonight at 9pm on Channel 5

Summary: Becca Caxton, 16, from Hull is pregnant and plans to live on benefits. Says she doesn't care what people think and has dropped out of school. Can't claim until child is born, so living with mother Anita, 38. Although Anita has a job, the rest of the family is unemployed. Charlotte, 19, and Matthew, 18, both sign on while Aaron, 15, is at school. Anita says Aaron, who wants to be a footballer, is also likely sign on.

cnn_dailymail

en

Summarize: The Forest Service Lacks Clear Revenue-Generating Priorities and Flexibility The low priority assigned to increasing revenue results, in part, from the importance or emphasis given to other values and concerns, especially protecting resources and providing goods and services. Language in federal statutes implies that maximizing revenue should not be the overriding criterion in managing national forests. Moreover, increasingly, legislative and administrative decisions and judicial interpretations have required the Forest Service to give priority to non-revenue-generating uses over uses that can and have produced revenue. For example, the Endangered Species Act and other environmental and planning laws and their judicial interpretations limit the agency’s ability to generate revenue, requiring instead that priority be given to protecting species’ diversity and other natural resources, including clean water and clean air. In addition, both the Congress and the administration have increasingly set aside National Forest System lands for conservation—as wilderness, wild and scenic rivers, national monuments, and recreational areas. Only limited revenue-generating uses, such as timber sales and oil and gas leasing, are allowed in some of these areas. When the Forest Service can generate revenue, it is sometimes required to provide goods and services at less than their fair market value. For instance, the fee system for ski areas on national forests, developed by the ski industry and enacted into law in 1996, does not ensure that fees collected from ski areas reflect fair market value. Other legislative decisions not to charge fees for the use of most recreational sites and areas managed directly by the agency reflect a long-standing philosophy of free access to public lands. In addition, federal statutes and regulations have narrowly defined the instances in which the Forest Service can charge fees for noncommercial recreational activities, such as hunting and fishing by individuals on national forests, and the agency generally defers to state laws regulating these activities. As a result, forest managers do not charge individuals for hunting and fishing on their lands. Other legislative requirements that limit the generation of revenue from activities such as hardrock mining and livestock grazing reflect a desire to promote the economic stability of certain historic commodity uses. For example, the Mining Law of 1872 was enacted to promote the exploration and development of domestic mineral resources as well as the settlement of the western United States. Under the act’s provisions, the federal government receives no financial compensation for hardrock minerals, such as gold and silver, extracted from Forest Service and other federal lands. In contrast, the 11 western states that lease state-owned lands for mining purposes impose a royalty on minerals extracted from those lands. Similarly, the formula that the Forest Service uses to charge for grazing livestock on its lands keeps fees low to promote the economic stability of western livestock grazing operators with federal permits. In addition, revenue-retention and revenue-sharing provisions discourage efforts to control costs. For example, legislation allows the Forest Service to retain a portion of the revenue it generates from timber sales and requires the agency to share a portion of that revenue with states and counties, without deducting its costs. The costs to prepare and administer the sales are funded primarily from annual appropriations rather than from the revenue generated by the sales. As a result, neither the agency nor the states and counties have an incentive to control costs, and the Forest Service may be encouraged to sell timber at prices that would not always allow it to recover its costs. From fiscal year 1992 through fiscal year 1997, the Forest Service spent about $2.5 billion in appropriated funds and other moneys to prepare and administer timber sales but returned less than $600 million in timber sale revenue to the General Fund of the U.S. Treasury. When the Congress has given the Forest Service the authority to obtain fair market value for goods or to recover costs for services, the agency often has not done so. As a result, forgone revenue has cost taxpayers hundreds of millions of dollars, as the following examples from our prior work show. In June 1997, we reported that the sealed bid auction method is significantly and positively related to higher bid premiums on timber sales. However, the Forest Service used oral bids at single-bidder sales rather than sealed bids, resulting in an estimated decrease in timber sale receipts of $56 million from fiscal year 1992 through fiscal year 1996. In December 1996, we reported that, in many instances, the Forest Service has not obtained fair market fees for commercial activities on the national forests, including resort lodges, marinas, and guide services, or for special noncommercial uses, such as private recreational cabins and special group events. Fees for such activities are the second largest generator of revenue for the agency, after timber sales. The Forest Service’s fee system, which sets fees for most commercial uses other than ski operations, has not been updated for nearly 30 years and generally limits fees to less than 3 percent of a permittee’s gross revenue. In comparison, fees for similar commercial uses of nearby state-held lands averaged 5 to 15 percent of a permittee’s total revenue. In December 1996, we also reported that although the Forest Service has been authorized to recover the costs incurred in reviewing and processing all types of special-use permit applications since as far back as 1952, it has not done so. On the basis of information provided by the agency, we estimated that in 1994 the costs to review and process special-use permits were about $13 million. In April 1996, we reported that the Forest Service’s fees for rights-of-way for oil and gas pipelines, power lines, and communication lines frequently did not reflect fair market value. Agency officials estimated that in many cases—particularly in high-value areas near major cities—the Forest Service may have been charging as little as 10 percent of the fair market value. Given a Financial Incentive, the Forest Service Can and Will Increase Revenue The Forest Service’s failure to obtain fair market value for goods or recover costs for services when authorized by the Congress results, in part, because the agency lacks a financial incentive to do so. One incentive would be to allow the agency to retain and spend the revenue generated to address its unmet needs. For example, from the end of World War II through the late 1980s, the Forest Service emphasized timber production on national forests, in part, because a substantial portion of the receipts from timber sales are distributed into a number of funds and accounts that the agency uses to finance various activities on a sale area. Even now, many forest managers have the opportunity to increase their budgets by increasing timber sales. Conversely, before fiscal year 1996, the Land and Water Conservation Act of 1965, as amended, required that revenue raised through collections of recreational fees be deposited in a special U.S. Treasury account. The funds in this account could become available only through congressional appropriations and were generally treated as a part of, rather than a supplement to, the Forest Service’s regular appropriations. However, in fiscal year 1996, the Congress authorized the fee demonstration program to test recreational fees as a source of additional financial resources for the Forest Service and three other federal land management agencies. The demonstration program legislation allows these agencies to experiment with new or increased fees at up to 100 sites per agency. The Congress directed that at least 80 percent of the revenue collected under the program be spent at the unit collecting the fees. The remaining 20 percent can be spent at the discretion of each agency. In essence, the more revenue that a national forest can generate through new or increased fees, the more it will have to spend on improving conditions on the forest. By allowing the agency to retain the fees collected, the Congress created a powerful incentive for forest managers to emphasize fee collections. Gross revenue from recreational fees on the national forests increased from $10.0 million in fiscal year 1996 to $18.3 million in fiscal year 1997, or by 83 percent, and to $26.3 million in fiscal year 1998, or by 163 percent compared with fiscal year 1996. Five sites each generated over $1 million in fiscal year 1998 compared with only two sites in fiscal year 1997. Two sites—the Mount St. Helens National Volcanic Monument on the Gifford Pinchot National Forest in Washington State and the Enterprise Forest Project in Southern California—each generated over $2.3 million in fiscal year 1998. The legislation also provided an opportunity for the four federal land management agencies to be creative and innovative in developing and testing fees by giving them the flexibility to develop a wide range of fee proposals. As a result, the Forest Service has, among other things, developed new methods for collecting fees and has experimented with more businesslike practices, such as peak-period pricing. These practices can help address visitors’ and resource management needs and can lower operating costs. Observations on the Need for Legislative and Other Changes According to Forest Service officials, the agency is evaluating whether to issue regulations that would allow forest managers to charge fees to recover their costs to review and process special-use permit applications. The administration also plans to forward legislative proposals to the Congress in the near future that would allow the agency to retain and spend all of the revenue generated by fees for commercial filming and photography on the national forests. Other legislative changes being considered by the agency would allow it to retain and spend all or a portion of the (1) revenue generated by fees charged to recover the costs to review and process special-use permit applications and (2) fees collected for resort lodges, marinas, guide services, private recreational cabins, special group events, and other commercial and noncommercial activities on the national forests. On the basis of our work, we offer the following observations on the Forest Service’s ongoing efforts to secure alternative sources of revenue. First, sustained oversight by the Congress will be needed to ensure that the agency maximizes revenue under existing legislative authorities. For instance, according to Forest Service officials, the agency is evaluating whether to issue regulations to allow forest managers to charge fees to recover their costs to review and process special-use permit applications. However, the agency has been authorized by the Congress to recover these costs since 1952 and has twice in the past 12 years developed, but not finalized, draft regulations to implement the authority. According to Forest Service headquarters officials, both times, staff assigned to develop and publish the regulations were reassigned to other higher-priority tasks. As a result, the agency estimates that it forgoes $5 million to $7 million annually. Second, new legislation that would allow the Forest Service to retain and spend more of the revenue generated by fees would provide forest managers with additional incentive to emphasize fee collections. However, providing the agency with this authority at this time would involve risks and difficult trade-offs. In particular, the Forest Service would not be able to accurately account for how it spent the money and what it accomplished with it. While the agency has made progress in recent years, it is still far from achieving financial accountability and possibly a decade or more away from being fully accountable for its performance. Because of its serious long-standing financial management deficiencies and the problems it has encountered in implementing its new accounting system, we recently designated the Forest Service’s financial management as a high-risk area vulnerable to waste, fraud, abuse, and mismanagement. In addition, allowing the Forest Service to retain and spend revenue that is generally treated as a part of, rather than an addition to, its regular appropriations would be included under the limits on discretionary spending imposed by the Budget Enforcement Act, as amended. Allowing the agency to retain fee revenue—rather than depositing the money in the General Fund of the Treasury—would also reduce the Congress’s ability to use these funds for other priorities. Furthermore, while this fee revenue may be initially earmarked for the Forest Service, nothing would prevent the Congress from using the revenue to offset, rather than supplement, the agency’s regular appropriations. Finally, new legislation being proposed or considered by the Forest Service is limited to special-use fees and, as such, does not address other potential sources of revenue. For instance, in a July 1998 report, a team of Forest Service employees identified steps that the agency should take to improve the way it conducts its business. In addition to recreational and special-use fees, the team identified the minerals and geology program and the relicensing of hydroelectric sites on the national forests as the greatest opportunities for securing alternative sources of revenue. In addition, we have reported that enacting legislation to impose a royalty on hardrock minerals extracted from Forest Service and other federal lands could generate hundreds of millions of dollars in increased revenue. However, allowing the Forest Service to collect, retain, and spend more of the revenue generated by goods and services on the national forests would require difficult policy choices and trade-offs. For example, collecting recreational fees conflicts with the long-standing philosophy of free access to public lands. Imposing a royalty on hardrock minerals extracted from national forests conflicts with the desire to promote the economic stability of this historic commodity use. And allowing forest managers to retain and spend revenue from oil and gas leasing and production would give them a strong financial incentive to lease lands that they might otherwise set aside for resource protection or conservation. Therefore, if the Congress believes that increasing revenue from the sale or use of natural resources should be a mission priority for the Forest Service, it will need to work with the agency to identify legislative and other changes that are needed to clarify and modify the Congress’s intent and expectations for revenue generation relative to ecological, social, and other values and concerns. Mr. Chairman, this concludes our prepared statement. We will be pleased to respond to any questions that you or Members of the Subcommittee may have. The first copy of each GAO report and testimony is free. Additional copies are $2 each. Orders should be sent to the following address, accompanied by a check or money order made out to the Superintendent of Documents, when necessary. VISA and MasterCard credit cards are accepted, also. Orders for 100 or more copies to be mailed to a single address are discounted 25 percent. U.S. General Accounting Office P.O. Box 37050 Washington, DC 20013 Room 1100 700 4th St. NW (corner of 4th and G Sts. NW) U.S. General Accounting Office Washington, DC Orders may also be placed by calling (202) 512-6000 or by using fax number (202) 512-6061, or TDD (202) 512-2537. Each day, GAO issues a list of newly available reports and testimony. To receive facsimile copies of the daily list or any list from the past 30 days, please call (202) 512-6000 using a touchtone phone. A recorded menu will provide information on how to obtain these lists.

Summary: Pursuant to a congressional request, GAO discussed the barriers and opportunities for generating revenue on lands managed by the Forest Service. GAO noted that: (1) legislative and administrative decisions and judicial interpretations of statutory requirements have required the agency to shift its emphasis from uses that generate revenue, such as producing timber, to those that do not, such as protecting species and their habitats; (2) the Forest Service is required by law to continue providing certain goods and services at less than fair market value; (3) certain legislative provisions also serve as disincentives to either increasing revenue or decreasing costs; (4) because the costs are funded from annual appropriations rather than from the revenue generated, the agency does not have an incentive to control costs; (5) when Congress has provided the Forest Service with the authority to obtain fair market value for certain uses, or to recover costs for services, the agency often has not done so; (6) as a result, the Forest Service forgoes at least $50 million in revenue annually; (7) given a financial incentive and flexibility, the Forest Service can and will increase revenue; (8) for example, the recreational fee demonstration program, first authorized by Congress in fiscal year (FY) 1996, allows the agency to: (a) test new or increased fees at up to 100 sites; and (b) retain the revenue to help address unmet needs for visitor services, repairs and maintenance, and resource management; (9) by allowing the agency to retain the fees collected, Congress created an incentive for forest managers to emphasize fee collections; (10) gross revenue from recreational fees on the national forests increased from $10.0 million in FY 1996 to $26.3 million in FY 1998; (11) the administration plans to forward legislative proposals to Congress, and the Forest Service is considering other legislative changes that would allow the agency to collect, retain, and spend more fee revenue; (12) however, allowing forest managers to retain and spend all or a portion of the revenue they collect would involve risks and difficult trade-offs; (13) in particular, the Forest Service is still far from achieving financial and performance accountability and thus cannot accurately account for how it spends money and what it accomplishes with it; and (14) allowing the agency to collect, retain, and spend more of the revenue generated by goods and services on the national forests would also require difficult trade-offs or policy choices between increasing revenue and other values and concerns.

gov_report

en

Summarize: Vladimir Putin last night pointed to Russia’s nuclear arsenal and warned the West: ‘It’s best not to mess with us’ on Ukraine. In a menacing intervention, the Russian president denied Nato, British and American reports that Russian forces are operating in eastern Ukraine. And he warned the West against any attempt to support Ukraine in its efforts to defeat Russian separatists. Speaking at a pro-Kremlin youth camp near Moscow, he said: ‘Russia’s partners... should understand it’s best not to mess with us. Ukrainian servicemen use a brief lull in the conflict to make running repairs on their heavy armour. Mechanics have field-striped part of the engine and drive components to keep the vehicle running. Ukraine has appealed to the West for supplies of modern weaponry to help repel any Russian advance. ‘Thank God, I think no one is thinking of unleashing a large-scale conflict with Russia. I want to remind you that Russia is one of the leading nuclear powers.’ Mr Putin also launched an astonishing verbal assault on the Ukrainian government, comparing it to the Nazis and saying its actions in the east of the country ‘sadly reminds me of the events of the Second World War, when German fascist... occupiers surrounded our cities’. Russia is one of five countries which has nuclear weapons as a signatory to the Non-Proliferation Treaty. Mr Putin has the second largest stockpile of warheads in the world – 4,300 according to the latest estimates from the Federation of American Scientists. Of those, approximately 1,600 are long-range land and sea-based ballistic missiles. Nato believes that there are at least 1,000 Russian troops now actively engaged in the conflict. Ukrainian army fires during fighting between militants and Ukrainian forces in Donetsk region. Nato said that it believes that well more than 1,000 regular Russian troops are fighting in Ukraine. The US has an estimated 4,765, Britain has 225, France 300 and China 250. Of other counties thought to have nuclear weapons – India, Pakistan and Israel are thought to have fewer than 100 and North Korea fewer than ten. British intelligence believes Russia has made a significant incursion into Ukraine, involving at least 1,000 regular troops fighting alongside pro-Russian militias on the ground. British sources said Russia had supplied 100 battle tanks, 80 armoured personnel carriers, 500 anti-tank weapons and 100 artillery pieces to separatists. Residents of Mariupol dig trenches and make fortifications with sandbags as they help Ukrainian troops in organising their defence on the outskirts of the southern Ukrainian city of Mariupol. An Ukrainian soldier digs a trench on the outskirts of the southern Ukrainian city of Mariupol today. Nato chief Anders Fogh Rasmussen urged Russia to halt its 'illegal' military actions in Ukraine. Ukrainian servicemen repair a part of their MPC inside a military camp in Donetsk. A Ukrainian serviceman sits on a tank while speaking on the phone inside a military camp in Donetsk. Ukraine’s Ambassador at Large Oleksandr Scherba appealed to the West for military help. ‘We want the West to understand Ukraine is fighting Europe’s war,’ he said. ‘There is only one thing that separates your people driving to their jobs and a full relapse into a Cold War – and that is young Ukrainian volunteer soldiers.’ Government sources said David Cameron would press for tough new sanctions on Russia at a summit of EU leaders in Brussels today. But military intervention is not being contemplated. The crisis in Ukraine is also now set to dominate next week’s Nato summit in Newport, south Wales. A Ukrainian serviceman walks past a pile of shells stored inside a hole inside a military camp in Donetsk. Rest: Ukrainian servicemen rest at their military camp near the eastern Ukrainian city of Debalcevo, in Ukraine. Mr Putin today asked pro-Moscow rebels to open a 'humanitarian corridor' to allow Ukrainian soldier who remain hemmed in to the region to go home. Proof: Kiev said Putin's edict proved that separatists were under Kremlin control. Ukraine yesterday said it was seeking Nato membership – a request the military alliance said it would treat ‘respectfully’. Nato accused Russia of a ‘blatant violation’ of Ukraine’s sovereignty, saying the crisis ‘defies all diplomatic efforts for a peaceful solution’. On Thursday the alliance released satellite photos of Russian self-propelled artillery units moving inside Ukraine last week. Secretary-General Anders Fogh Rasmussen yesterday said that ‘despite hollow denials’, it was now clear that Russian forces had illegally crossed Ukraine’s border. Put to work: Prisoners-of-war, who are Ukrainian servicemen captured by pro-Russian separatists, clean a street in Snizhne in the Donetsk region. Held captive: Captured pro-Ukrainian fighter sits in a garage at the Novoazovsk border crossing point, in eastern Ukraine. Mercy: In a statement issued through the Kremlin today, the Russian president told the separatists to open up a 'humanitarian corridor' in eastern Ukraine to avoid the'senseless deaths' of trapped Ukrainian troops. German foreign minister Frank-Walter Steinmeier said: ‘All our hopes of de-escalation have been disappointed and the situation is showing signs that it is now out of control.’ Polish foreign minister Radoslaw Sikorski said: ‘If it looks like a war, sounds like a war and kills like a war, it is a war.’ Sweden’s foreign minister Carl Bildt warned: ‘This is the second invasion of Ukraine in a year. We have to call a spade a spade and stop playing around.’ Meanwhile, heavily armed pro-Russia separatists held firm control of the strategic coastal town of Novoazovsk yesterday. At least half a dozen tanks were seen in the town of about 12,000 people, bearing the flags of Novorossiya, the ‘state’ proclaimed by rebels in two eastern Ukraine regions. None of the tanks bore Russian markings, but ready-made meals seen nearby had markings showing they were Russian army issue. Digging in: Civilians dig trenches and make fortifications with sandbags as they assist Ukrainian troops in organising their defence on the outskirts of the southern Ukrainian city of Mariupol. Battle weary: Armed Ukrainian servicemen comb the area after being shot at by pro-Russian militants at their checkpoint near the small city of Dzerzhynsk, in the Donetsk region. Mercy: In a statement issued through the Kremlin today, Russian president Putin told the separatists to open up a 'humanitarian corridor' through which to release trapped enemy troops to 'avoid senseless deaths' A woman rides on the back of a truck holding a flag of Novorossiya, a union between the 'Donetsk People's Republic and 'Lugansk People's Republic'. If implemented, that plan would leave Kiev with no Black Sea coastline. 'Plain to see': He spoke as President Barack Obama said it was 'plain for the world to see' that Russian forces are now fighting inside Ukraine. This map shows how 'New Russia', now eastern Ukraine, was once part of the Russian Empire. The word 'Novorossiya' literally means 'New Russia' - an imperial-era term for southern Ukraine, when it was part of the Russian Empire. It is now a term used by Russia ultra-nationalists who want to re-conquer the area. The region was seized by imperial Russia at the end of the 18th century from the Ottoman Empire and remained under its control until the October Revolution and the collapse of the empire in November 1917. The term implies a giant semi-circle of Ukraine encompassing Kharkiv, Lugansk, Donetsk, Mykolaiv, Kherson, and Odessa. If implemented, that plan would leave Kiev with no Black Sea coastline

Summary: He said Russia's nuclear programme means 'nobody would think of conflict' He also tells rebels to release trapped enemy to 'avoid senseless deaths' He compares Ukraine's sieges of two cities to Nazis' siege of Leningrad. He referred to 'Novorossiya' - or 'New Russia' - as he praised rebel'success' Kiev said the edict proved that separatists were under Kremlin control. Ukrainian PM announced that country will seek to become member of Nato. Putin spoke as Obama said it is 'plain to see' Russian forces are in Ukraine.

cnn_dailymail

en

Summarize: CROSS REFERENCE TO RELATED APPLICATIONS [0001] This application claims priority to co-pending German Patent Application No. DE 10 2004 016269.7 entitled “Einrichtung zum Transport, zur Aufnahme und einzelnen Abgabe von flexiblen Verbrauchsartikeln in Kraftfahrzeugwerkstätten”, filed Apr. 2, 2004. FIELD OF THE INVENTION [0002] The present invention generally relates to an assembly for containing, protecting and dispensing flexible items for use in garages and the like. Furthermore, the invention relates to a box configured and designed to be used in the aforementioned assembly. [0003] In garages items have to be stored and have to be dispensed to a user as a mechanic. The items can be one or several of the group of articles of plastic foils used during or in the end of manufacturing of vehicles or in workshops in order to protect parts of the vehicle against contamination or dirt. In particular, the items are seat covers made of plastic foil, one-way floor carpets, steering wheel covers made of foil, bags for spare or replacement parts, foils for an interior sealing of the door of a vehicle, bags of plastic for receiving at least one tire and the like. Other items could be made of paper, cardboard, corrugated board or tissue and can be used for cleaning purposes. A plurality of items can be interconnected by means of detachable connections or by means of perforations of the base material building the items. Most commonly, the interconnected items are wound up on a core which is removed afterwards or on a bobbin to build a roll. The roll is stored in a box being designed and arranged for transportation, containing, protecting and dispensing said items. In case of said box having a fixed position in a garage, a holding device is provided which is mounted with a wall of the garage. The holding device aims to position the box in a dispensing position. BACKGROUND OF THE INVENTION [0004] U.S. Patent Application No. US 20030090181 A1 by the applicant discloses an assembly with a roll of articles which both in a transportation position and a dispensing position is protected by means of a box. The box is mounted to a wall by means of a holding device. The holding device includes two hook-shaped elements being arranged horizontally distant. The hook-shaped elements protrude from the holding device. The box comprises openings in the rearward wall wherein the distance of the openings corresponds to the distance of the hook-shaped elements. For connecting the holding device and the box the hook-shaped elements are received by the openings. Inside the box the hook-shaped elements engage with the rearward wall of the box. Both the weight of the box as well as the weight of the roll are supported by means of the hook-shaped elements and the rearward wall of the box. In order to avoid a rotation of the box with respect to an axis extending through the contact areas between the hook-shaped elements and the box, the box comprises a contacting area built by the rearward wall. Such contact area contacts a corresponding supporting area of the holding device. The cooperating contact area and supporting area serve for aligning the box with respect to the holding device. Furthermore, when dispensing articles from the box in a dispensing position, the aforementioned areas serve to produce reacting contact forces that counteract a rotation of the box during dispensing the items. [0005] British Patent Application No. GB 2 372 736 A discloses a holding device for containing and dispensing items wound up to a roll, wherein the items are plastic bags for supermarkets. The items are wound up on a stiff core. The core protrudes out of the roll. The core is guided by guideways of side arms of the holding device, wherein the guideways are inclined with respect to a vertical axis with an angle between 0° and 90°. The outer surface of the roll is supported by a plate. Due to frictional forces between plate and roll a free or an easy rotation of the roll is spoiled. SUMMARY OF THE INVENTION [0006] The present invention relates to an assembly including a holding device with an axle rotatably supporting a roll. Additionally, the holding device includes side arms extending approximately perpendicular to the axle. The side arms include guideways being inclined with respect to a vertical axis at an angle between 0° and approximately 90°. The guideways are adapted and configured for receiving the axle. Front walls of the box include openings, markers or the like being aligned with each other and being centered with respect to the front walls. The axle may be inserted through the front walls in the region of the openings and may be passed through the roll. The weight of the roll is divided into two components, wherein the first component is supported by a contact area between the box and the holding device or a wall of the garage and the second component is supported by means of the axle, so that in a dispensing position the box is secured against rotation. [0007] The maximum weight of a roll being supported with respect to a holding device by means of common assemblies, cp. document US 20030090181 A1, depends on the mechanical properties of the base material of the box, in particular cardboard. This is due to the fact that embodiments according to document US 20030090181 A1 base on the characteristic feature that the full weight of the roll is supported by the rearward wall of the box. In some cases the weight of the roll can exceed 15 kg. [0008] The novel assembly supports the weight of the roll not only by means of the rearward wall but also by means of the axle or guiding shaft, which is located in the hollow interior of the roll and which contacts the roll itself or a hollow bobbin or a core. According to an alternative embodiment of the present invention, a supporting element is interposed between the roll and the axle so that the roll is indirectly supported by means of the axle. [0009] The weight of the roll is divided into a first supporting component, which is orientated transverse to the guideway and which is directly supported by the guideway, and a second supporting component, which is oriented in the direction of the guideway and which is directly or indirectly supported by means of the contacting area of the box. The contacting areas between box and holding device are only subjected with the second supporting component which is smaller than the whole weight of the roll. Accordingly, the maximum force acting upon the box correlates with the second supporting component. The relation between the second supporting component and the weight and the first component is a choice of the design and depends on the angle of the guideways with respect to a vertical axis: in case that the guideway is approximately perpendicular to the contacting area of the holding device, (i.e. oriented in the horizontal direction), the second component is minimal and tends to 0, so that all the weight of the roll is supported by the guideways. With a change of the angle of the guideway versus the vertical axis the second component increases, so that also the contact force of the box in the contact areas of the holding device increases. The supporting force acting upon the walls of the box can be designed dependent on the angle of the guideway with respect to the vertical axis. [0010] In a similar manner dispensing forces caused by a user during dispensing items from the roll are divided into a first supporting component of the guideway and a second supporting component of the contact areas. If the guideways are oriented transverse to the pulling direction during dispensing the items pulling forces will mainly be supported by the guideway. When the pulling forces not being directed versus the axle, bending moments acting upon the box due to the pulling forces lead to a non-uniform distribution of force in the contact area of the box so that a counter-moment is produced which counteracts in undesired rotation of the box. [0011] One embodiment of the invention provides for a very simple assembly and replacement of a box: in a first step of assembly the axle is passed through the openings, the box and the roll. In a next step of assembly the axle is inserted into the guideways or is positioned in the beginning of the guideways. Due to the fact that the guideways are inclined by an angle between 0° and 90° with respect to a vertical axis, gravity moves the box, the axle and the roll along the guideways. The aforementioned motion is stopped automatically in an end position which is the dispensing position, wherein the contact area of the box abuts a supporting area of the holding device or the environment. Without any additional steps of adjusting or fine adjustments, without steps for securing and without additional fixing elements the box is positioned and fixed in the dispensing position. [0012] Furthermore, according to one embodiment of the invention one single holding device can be used for supporting boxes of different lengths and/or cross-sections without the need of any adjusting works. In order to decrease or increase the distance of the contact area of the box from the axle due to a change of the cross-section of different boxes the different boxes move a longer or shorter distance along the guideways until they reach their respective dispensing position. [0013] According to one embodiment of the invention the box is built in a multifunctional manner: during transportation the box serves as a protecting sheet, wherein the roll is protected against dirt and/or damages of the items. Additionally, it could be a problem to stack several rolls due to a circular cross-section. According to a specific embodiment of the invention the box can be built with flat walls increasing the ability of stacking several boxes. Furthermore, the box also protects the items against dirt and/or damages in the dispensing position. Additionally, the box can have a fancy design covering the roll of the items. Furthermore the box can be used for advertising or giving information about the items, the assembly of the box with the holding device, for the use of the box and/or for disposal of used items. [0014] The components of the embodiments of the invention can be produced in a very economic way. The box can be built of cardboard, corrugated board, paper and the like. Such materials have a low weight, can be produced with low costs and can be formed in a very simple way. In particular the box is made of a folded or upright tailored piece of cardboard, corrugated board and the like. Furthermore, a box produced of the aforementioned materials can be disposed in a very simple way and compatible to the environment. The holding device can be produced of well-known semi-finished products, in particular with a (guiding) axle made of metal or plastic and/or side arms built of sheet metal. [0015] According to the invention the feature axle covers every elongate elements extending through the roll and being designed and configured to support the roll. The axle may be fixed with respect to the box and/or the holding device or could be rotatably linked with at least one of the roll, the box and the holding device. [0016] According to another embodiment of the invention, the front walls of the box are to the greatest possible extent closed during transportation. The front walls include a weakening, a carving, a perforation, a fold and/or a marker that forms the opening in the dispensing position. A transfer of the box from the transportation position to the dispensing position can be achieved by mechanical operation of the weakening, the carving, the perforation, the fold or the marker, such that the openings are attained. The operation can be realized by hand or by means of the axle. Due to the fact that the front walls are closed as far as possible during transportation, any dirt and/or mechanical damages are avoided that could occur during transportation in case of the box had the openings. Only immediately before the use in the garages, the openings are formed. By means of insertion of the axle the openings can be closed at once so that any deterioration of the protecting function of the box in the area of the side walls and the opening is limited to a minimum. [0017] According to another embodiment of the invention, the front walls include supporting elements rotatably supporting the roll. These embodiments are suitable to incorporate the advantages of such supporting elements known from common embodiments as patent applications and patents US 20040016668 A1, U.S. Pat. No. 3,302,781, DE 101 19 821 A1, U.S. Pat. No. 3,565,307 and U.S. Pat. No. 5,971,150. Such supporting elements provide for an exact alignment of the roll and contribute to a decrease of frictional forces between the front walls of the box and the roll. [0018] It is also possible that the box comprises a dispensing chamber. The dispensing chamber is defined between the box and the roll. Additionally a receiving chamber is provided. The receiving chamber is defined by the hollow interior of the roll, recesses of supporting elements and the opening. The receiving chamber serves to receive the axle. Particles of dirt originating from the exterior of the box have to pass the openings and the receiving chamber in order to reach the dispensing chamber where they could contaminate the roll and the items. However, between the dispensing chamber and the receiving chamber transmission areas are located. The transmission areas are designed and arranged such that the particles are prevented from entering said dispensing chamber from said receiving chamber. This can for example be provided by the supporting elements having protrusions extending from the front walls into the hollow interior of the roll such that the transmission areas are built by the contact area or a small gap between the aforementioned protrusions and the roll or a bobbin of the roll. On the other hand the chambers and the transmission area may build a kind of labyrinth seal. Accordingly, this embodiment of the invention builds a system with “multiple chambers” for the protection against contamination. [0019] There are many different possible designs and choices of the material properties of the used components. According to one special embodiment of the invention, the material between the contact area and the openings as well as between the contact area and the places where the forces are introduced during dispensing of the items are sufficiently stiff. Otherwise dispensing of the items would lead to undesired deformations of the box. Those deformations could lead to a (small) rotation of the box with respect to the holding device which coincides with the deformation of the box. In case that the box has a square or rectangular cross-section, according to the invention the walls of the box remain approximately perpendicular in the corner areas adjacent to the contact areas during exertion of forces by a user. [0020] Furthermore, it is possible that the side arms of the holding device each include a plurality of guideways. The plurality of guideways is used to support boxes in different dispensing positions. Accordingly, different boxes can be positioned in different heights. This can be useful for users of different body heights. Alternatively or additionally it is possible to support a series of boxes by means of the same holding device. The series of boxes can be built by boxes of the same type, so that additional boxes are available for dispensing more items at the same time or for providing substitutes. It is also possible that the holding device is used for boxes of different lengths and/or sizes and cross-sections, so that for example items of different types and different sizes can be provided by the same assembly. In particular the holding device comprises two sheet metals comprising an L-shaped cross-section. One arm of the sheet metal can be mounted with the wall of the garage or a fitment of the garage, whereas the other arm builds the side arm containing the guideway(s). The distance of the two sheet metals correlates with the width of the box being received between the sheet metals. In particular there is a small gap between the sheet metals and the box in order to provide an easy motion of the box along the guideways. [0021] Alternatively it is possible that the holding device is built by a U-shaped sheet metal, wherein a middle or base arm of the U-shaped sheet metal builds the contact area of the holding device and the two side arms of the U-shaped sheet metal contain the guideways. The aforementioned sheet metals may be simple semi-finished products. [0022] Other features and advantages of the present invention will become apparent to one with skill in the art upon examination of the following drawings and the detailed description. It is intended that all such additional features and advantages be included herein within the scope of the present invention, as defined by the claims. BRIEF DESCRIPTION OF THE DRAWINGS [0023] The invention can be better understood with reference to the following drawings. The components in the drawings are not necessarily to scale, emphasis instead being placed upon clearly illustrating the principles of the present invention. In the drawings, like reference numerals designate corresponding parts throughout the several views. [0024] FIG. 1 is a perspective view of the novel transportation and dispenser box in a transportation condition. [0025] FIG. 2 is a view of the novel transportation and dispenser box of FIG. 1 in a dispensing position. [0026] FIG. 3 is a semi-sectional view of the unfolded portion of which a first exemplary embodiment of the novel transportation and dispenser box is to be formed. [0027] FIG. 4 is a view of a separate supporting wall having a plate-like design to be inserted into the box. [0028] FIG. 5 is a sectional view along line V-V of FIG. 2 with an upper outlet. [0029] FIG. 6 is a similar view as FIG. 6, but showing a lower outlet. [0030] FIG. 7 is a longitudinal sectional view showing a transportation and dispenser box with an opening, an axle and a roll wound up on a bobbin. [0031] FIG. 8 is a longitudinal sectional view showing a box with supporting elements and a roll supported by a holding device. [0032] FIG. 9 is a view of a novel assembly with a holding device supporting three boxes of different lengths and cross-sections. [0033] FIG. 10 is a perspective view of a holding device formed by a U-shaped sheet metal. [0034] FIG. 11 is a semi-sectional view taken transverse to the longitudinal direction of the box showing the interaction between the axle and the guideways. [0035] FIG. 12 shows another embodiment of a holding device. [0036] FIG. 13 shows an end region of a modified axle of the holding device according to FIG. 12. DETAILED DESCRIPTION [0037] Referring now in greater detail to the drawings, FIG. 1 illustrates a transportation and dispenser box 1 being made of a portion 2 of cardboard, corrugated board and the like. The transportation and dispenser box 1 includes a lower bottom wall 3, an upper bottom wall 4, a front vertical side wall 5, a rear vertical side wall 6 and two front walls 7 and 8. A perforation strip 9 is arranged in the upper half of the front vertical side wall 5, the perforated strip 9 being designed and arranged to be removed from the box 1 such that a slot 10 is formed as illustrated in FIG. 2. [0038] FIG. 2 illustrates the box 1 in the dispensing position and its ready-to-be-used position, respectively. The end of an elongated path of material or a sheet material 11 being formed by a plurality of items 12 being interconnected by perforations protrudes out of the box 1. For example, these items 12 may be seat covers made of plastic foil as they are commonly used to protect seats of an automobile during repairing and servicing the automobile in a garage to prevent soiling of the seats. These seat covers and this sheet material 11, respectively, have a certain width of approximately between 60 cm and 1 m. [0039] FIG. 3 explains the design of the portion 2 for forming the transportation and dispenser box according to FIGS. 1 and 2 by the portion 2 being unfold to be located in one plane. It is to be seen that the side walls 5 and 6 are connected to the lower bottom wall 3 by fold lines. The side walls 5 and 6 include lateral connection flaps 13 and 14 to be connected with the associated elements of the portion 2 in the upright position. The upper bottom wall 4 is connected to the side wall 6 by another fold line. The upper bottom wall 4 is connected to the closing flap 15 by a fold line such that the closing flap 15 is pivotable. [0040] Since the walls 3, 4, 5, 6 have the same height, it is imaginable that there is a square cross-section in the upright position of the box 1. Front walls 7 and 8 are connected to both sides of the lower bottom wall 3 by fold lines. A supporting wall 16 is connected to each front wall 7 and 8 by another fold line. A portion 17 is located in the supporting wall 16, the portion 17 forming a supporting element 18. Additionally, the supporting wall 16 in its outer region includes a protrusion 19. The lower bottom wall 3 includes a punched out element 20 being associated with the protrusion 19 and being engaged by the protrusion 19 in the upright position such that the front wall 7 and the supporting wall 16 are fixed in a parallel orientation at the end of the transportation and dispenser box. [0041] FIG. 4 shows a single plate-like supporting wall 24. For example, the supporting wall 24 is designed as a square section of corrugated cardboard including the opening 23 being located in the center region such that one supporting wall 24 is pushed upon the ends of each bush or bobbin 22 during insertion of the roll 21. The unit resulting therefrom is inserted into the upright transportation and dispenser box in a downward direction. It is to be understood that the front walls 7 and 8 do not include openings 23 when being used in combination with the supporting walls 24 when it is desired to realize the above described centering effect. However, it is also possible to arrange additional openings 23 in the front walls 7 and 8 to enlarge the width of the respective support of the bobbin 22 in the lateral supporting elements 18. When using rolls with flexible items being wound up to different diameters such a centering function is advantageous. If a roll with a very small diameter is used the bobbin 22 with the wound up items 11 would not be aligned in the box 1 in the position of the openings 23 so that insertion of axle 32 would be hindered. It is also possible to arrange additional openings 23 in the front walls 7 and 8 to enlarge the width of the respective support of the bobbin 22 in the lateral supporting elements 18. The use of such separate supporting walls 24 which may also be fixed in the upright position 2 provides for the advantage of the portion 2 not necessarily being made of double corrugated cardboard box. Instead, single corrugated cardboard box is sufficient since additional stiffening effects are attained due to the inserted supporting walls 24. The supporting walls 24 may also include an opening having a shape as it is to be seen from FIG. 3. [0042] The front walls 7, 8 each comprise openings 30. The openings 30 of respective front walls 7, 8 are aligned with each other and centered with respect to the front walls 7, 8. However, instead of openings 30 markers 31 can be provided. Other alternatives may comprise a weakening of the front walls 7, 8, carving, perforations or a fold at locations, where a user later forms the openings 30 in the front walls 7, 8 when transferring the box from a closed transportation position to the dispensing position. For double-sided walls built by front wall 7 and supporting wall 16 or supporting wall 24 markers 31 and the like may only be built in the exterior wall. [0043] It is to be seen from FIGS. 5 and 7 that the sheet material 11 is located in the interior of the transportation and dispenser box 1. The sheet material 11 is wound up to form a roll 21 being located on a bush or bobbin 22. It is to be seen from FIG. 7 that the bobbin 22 has a width being more than the width of the sheet material 11 and the roll 21 such that the bobbin 22 protrudes with respect to the roll 21 at both sides. Consequently, the roll 21 may be freely suspended on the bobbin 22 at both sides being supported at supporting elements 18. FIGS. 5 and 7 illustrate the roll 21 being supported by the supporting elements 18 to be suspended to be freely rotatable. The roll 21 does not contact the inner side of the bottom walls 3 and 4 and the side walls 5 and 6. Since the front walls 7 and 8 in combination with the supporting walls 16 also have a centering effect with respect to the bobbin 22, it is ensured that there is no frictional contact of the supporting walls 16 to the material of the sheet material 11 and of the roll 21, respectively. Thus, the roll 21 may be easily rotated when pulling the front end of the sheet material 11 through the slot 10. FIGS. 2 and 5 illustrate the roll 21 being supported in this way in the transportation and dispenser box 1 and exiting the box in an upper region. The perforation strip element 9 and the slot 10 are located in the middle portion of the upper half of the front side wall 5. It may be seen from FIG. 5 that the sheet material 11 is pulled out of the box 1 in an approximately tangential direction such that the end of the sheet material 11 exiting the box 1 through the slot 10 is directed by approximately 90°. When the sheet material 11 has a design such that it has a comparatively smooth outer surface and a comparatively rough inner surface, the rough surface is used in an advantageous way when contacting the lower edge of the slot 10 during separation of the perforated portions during removal of an item 12 from the elongated sheet material 11. [0044] The above described way of suspending the bobbin 22 to be freely rotatable in the supporting elements 18 is not only realized when a few items 12 have been removed from the sheet material 11. The bobbin 22 may already be freely rotatable when a complete roll 21 is inserted into such a transportation and dispenser box 1 and during transportation of the box 1. However, it is not disadvantageous to choose the size of the diameter of the roll 21 and the size of the square interior of the transportation and dispenser box 1 such that the roll 21 being elastic in a certain way initially contacts the inner walls of the box 1. However, there is no contact after having removed a few items 12 resulting in a reduction of the diameter of the roll 21. Such rolls 21 may include up to approximately 500 or more items 12 being interconnected by perforations. The number of items 12 depends on the wall thickness and potential longitudinal folds of the items 12 and from the size of the box 1. [0045] FIG. 6 illustrates the roll 21 being located in the transportation and dispenser box 1 in an opposite direction compared to FIG. 5, meaning a design in which the items 12 are removed in the lower region of the box 1. The slot 10 is located in the lower portion of half of the height of the side wall 5 to allow for tangential removal in combination with a deflection of the sheet material 11 by approximately 90° when exiting the box 1 through the slot 10. [0046] The supporting elements 18 may not only be realized by a separate supporting wall 16, as this is illustrated in FIG. 3. [0047] As to be seen from FIG. 7 an axle 32 is passed through openings 30 of the transportation and dispenser box 1 and through bobbin 22, so that end regions of axle 32 which build guiding elements 33 protrude out of the transportation and dispenser box 1. There is a play or backlash between the axle 32 and the interior of the hollow bobbin 22, so that the axle 32 is to be introduced in a simple manner. When providing markers 31, perforations or folds instead of the openings 30 a better protection during transportation is provided. However, when transferring the transportation and dispenser box to the dispensing position, it is necessary to form the openings 30 by thrusting through front walls 7, 8. [0048] According to the embodiment shown in FIG. 8 the transport and dispenser box 1 comprises supporting elements 18 a. The supporting elements 18 a are built by a part of a mold made of plastic and are located adjacent to front walls 7, 8. Additionally, the molds 34 can be fixed with respect to the front walls 7, 8. Each part of a mold 34 includes a hollow cylindrical protrusion 35. The protrusions 35 extend from the front walls 7, 8 into the interior of bobbin 22. The protrusions 35 build a rotatable support for the roll 21 and the bobbin 22. In assembled condition the force flow of the weight of the roll 21 passes from bobbin 22 over protrusion 35 via axle 32 to a holding device 36. [0049] FIGS. 8 and 9 show a first embodiment of a holding device 36. The holding device 36 includes two sheet metals 37, 38 with an angled cross-section comprising a base arm 39 and a side arm 40. The sheet metals 37, 38 have an L-shaped cross-section. The base arms of the sheet metals 37, 38 are screwed with a vertical wall of the garage. The side arms 40 are parallel with each other so that between the side arms 40 the transportation and dispenser box 1 may be received. At the same positions the side arms 40 comprise guiding slots 41 having the same orientation or contour, wherein the guiding slots 41 extend from the end region of side arms 40 being located opposite to the base arm 39. In the plane of side arm 40 the guiding slots 41 build an angle with a vertical axis (plane y-z, see FIG. 9 ), which is between 0° and 90°. The angle according to a specific embodiment is chosen to be between 30° and 60°, in particular between approximately 40° and 50°. The lower limitation of guiding slot 41 builds a guiding path 42 for the axle 32. [0050] For an assembly of the transportation and dispenser box 1 and the holding device 36 the guiding elements 33 of the axle 32 are inserted into the guiding slots 41 of the metal sheets 37, 38. Due to gravity the guiding elements 33 move along the guiding path 42 in a slanting motion. In the end regions extending outside the holding device the axle 32 includes stops 43 to limit a lateral displacement of axle 32 due to any movement of the transportation and dispenser box 1 or of the axle 32 in direction of axis x. The stops 34 can be built as protrusions or collars of axle 32. However, it is also possible that the stops 43 are built by separate parts being screwed, attached or pinned with or to the axle 32. [0051] Due to gravity the transportation and dispenser box 1 or due to additional forces of the user the transportation and dispenser box 1 and the axle 32 move along guiding path 42. In an end position the rearward wall 6 of the transportation and dispenser box 1 abuts wall 44 wherein wall 44 is built by a wall of the garage, a cupboard of the garage, the base arm 39 and the like. [0052] According to the embodiment shown in FIG. 9, the holding device 36 serves to support three transportation and dispenser boxes 1 of different lengths and/or different cross-sections. Correlating with the cross-section of the transportation and dispenser boxes the guiding elements 33 of different transportation and dispenser boxes 1 are moved different distances along the guiding slots 41. The holding device 36 includes a plurality of pairs of guiding slots 41 located in alignment with each other and in different heights. [0053] An alternative embodiment of the holding device 36 is shown in FIG. 10. The holding device 36 comprises a U-shaped horizontal cross-section. The holding device 36 includes a continuous middle arm 45, which is used for fixing the holding device 36 with respect to the surrounding walls. Furthermore, the holding device 36 includes two side arms 40 each having at least one guiding slot 41. The middle arm 45 includes a supporting area 46. In the end position the transportation and dispenser box abuts the supporting area 46 and serves to prevent any rotation of the transportation and dispenser box 1. [0054] FIG. 11 shows a semi-partial cross-sectional view of the embodiment according to FIG. 9. Contact area 47 of the rearward side wall 6 contacts supporting area 46 of wall 44 in its entirety or only in a partial region. [0055] As to be seen from FIG. 8, opening 30 builds an opening towards the receiving chamber 48, wherein the receiving chamber 48 is limited by bobbin 22 and protrusion 35. A transfer of particles of dirt from the environment into the receiving chamber 48 and from receiving chamber 48 to the roll 21 is only possible in case of the particles passing through the gap between protrusion 35 and bobbin 22. [0056] The embodiment of the holding device 36 according to FIG. 12 comprises two base arms 39 for a fixation of the holding device with respect to a wall of the garage. The side arms 40 inclined by an angle are built by a carrier or console, wherein the upper surface of the carrier or console builds the guiding path 42. For simplification only the axle 32 is shown, here with detachable stops 43. After detaching at least one stop 43, the axle 32 is passed through the openings 30 or markers 31 of the transportation and dispenser box 1 and through bobbin 22 with roll 21. The unit built by axle 32, transportation and dispenser box 1, roll 21, bobbin 22 is “hung up” or suspended by means of the carrier and the holding device. When inserted into the guiding path 42, the aforementioned unit automatically moves to reach the end position in which the unit is secured against rotation as explained with respect to FIG. 9. [0057] Instead of the detachable stops 43 both ends of axle 32 may also include a circumferential groove or slot 49. Also only one circumferential groove or slot 49 may be sufficient. Such an embodiment simplifies passing the axle 32 through the openings and the bobbin. [0058] Many variations and modifications may be made to the preferred embodiments of the invention without departing substantially from the spirit and principles of the invention. All such modifications and variations are intended to be included herein within the scope of the present invention, as defined by the following claims.

Summary: A box for supplying items to be used in garages includes a portion being made of cardboard, a plurality of side walls and of front walls. The items may be seat covers, steering wheel covers, floor carpets, trash bags, replacement parts bags, foils for sealing the interior of doors and bags for tires and the like. An axle is passed through openings of the transportation and dispenser box and through a roll of the items wound up on a bobbin. The box is mounted and fixed with the environment by means of a holding device. The holding device includes parallel side arms with guideways being inclined with respect to a vertical axis. For an assembly the axle is introduced into the guideways and moves by gravity along the guideways in a sliding motion. In a dispensing position, the contact area of the transportation and dispenser box abuts a corresponding supporting area of the holding device, so that the box is secured against rotation during pulling off the items from the transportation and dispenser box. Additional securing means are possible but not necessary.

big_patent

en

Summarize: One of Tiger Woods' front teeth was knocked out by a cameraman during a media scramble after his girlfriend Lindsey Vonn won another World Cup event in Italy on Monday. The golfer revealed the gap in his mouth as he congratulated the skier following her winning run in Cortina D'Ampezzo - her 63rd World Cup victory. He had hidden behind a skeleton-covered mask before surprising Vonn but it seems she was not the only one who didn't recognise the former world No 1, as the media promptly trampled him. Tiger Woods lost one of his two front teeth after a cameraman knocked it out on Monday. Woods hid behind shades, a hat and a scarf as he prepared to surprise his girlfriend. 'During a crush of photographers at the awards' podium at the World Cup event in Italy, a media member with a shoulder-mounted video camera pushed and surged towards the stage, turned and hit Tiger Woods in the mouth,' Woods' agent Mark Steinberg said. 'Woods's tooth was knocked out by the incident.' Vonn broke Annemarie Moser-Proell's 35-year-old record of 62 World Cup wins with a flawless run down the Olympia delle Tofane course, finishing 0.85 ahead of Anna Fenninger of Austria. Woods, who surprised Vonn after her win, covered his face with a mask on Monday. 'I'm so happy to have finished the weekend with win No. 63. My family and Tiger is here. It's a really, really special day,' Vonn said following her triumph. Vonn had been on track to shatter the record two years ago before a high-speed crash at the 2013 world championships in Schladming, Austria, when she tore two ligaments in her right knee. She attempted to return for Sochi but re-injured her knee in Val d'Isere, France, in December, 2013, requiring a second surgery. She is planning to compete through the 2018 Olympics in Pyeongchang, South Korea. After girlfriend Vonn made alpine skiing history, she embraced Woods at the finish line. Vonn became the most successful female in Alpine skiing World Cup history when she won the Super-G

Summary: Tiger Woods was about to surprise Lindsey Vonn in Italy on Monday when an over-eager camera operator hit him in the mouth with his equipment. Vonn had just claimed a record-breaking 63rd World Cup win. One of his front teeth was knocked out in the incident. Vonn, 30, has now won 63 World Cup titles - breaking Annemarie Moser-Proell's 35-year-old world record of 62 wins.

cnn_dailymail

en

Write a title and summarize: Brucellosis is endemic in the bovine population in India and causes a loss of US$ 3·4 billion to the livestock industry besides having a significant human health impact. We developed a stochastic simulation model to estimate the impact of three alternative vaccination strategies on the prevalence of Brucella infection in the bovine populations in India for the next two decades: (a) annual mass vaccination only for the replacement calves and (b) vaccination of both the adult and young population at the beginning of the program followed by an annual vaccination of the replacement calves and, (c) annual mass vaccination of replacements for a decade followed by a decade of a test and slaughter strategy. For all interventions, our results indicate that the prevalence of Brucella infection will drop below 2% in cattle and, below 3% in buffalo after 20 years of the implementation of a disease control program. For cattle, the Net Present Value (NPV) was found to be US $ 4·16 billion for intervention (a), US $ 8·31 billion for intervention (b) and, US $ 4·26 for intervention (c). For buffalo, the corresponding NPVs were US $ 8·77 billion, US $ 13·42 and, US $ 7·66, respectively. The benefit cost ratio (BCR) for the first, second and the third intervention for cattle were 7·98,10·62 and, 3·16, respectively. Corresponding BCR estimates for buffalo were 17·81,21·27 and, 3·79, respectively. These results suggest that all interventions will be cost-effective with the intervention (b), i. e. the vaccination of replacements with mass vaccination at the beginning of the program, being the most cost-effective choice. Further, sensitivity analysis revealed that all interventions will be cost-effective even at the 50% of the current prevalence estimates. The results advocate for the implementation of a disease control program for brucellosis in India. Brucellosis is an important zoonotic disease causing infertility, repeat breeding, retention of placenta and abortion in cattle. Humans in contact with animals usually get infected by coming in direct or indirect contact with reproductive secretions and excretions from infected animals. The disease is quite painful among humans and causes undulant fever, chills, fatigue, joint and muscle pain. If not treated, the disease can last for months and years and can cause orchitis, epididymis and endocarditis. Successful implementation of disease control programs have resulted in the eradication of brucellosis from domestic livestock in most of the developed countries [1]. However, the disease is still prevalent and classified as a neglected zoonosis in many parts of the developing world [2]. The disease is endemic in most of the production animals in India [3,4]. With the reported disease seroprevalence of 9. 3% in cattle [5] and 16·4% in buffalo populations [6], brucellosis is a serious economic concern for the cattle and buffalo industry [7]. Recent studies in India demonstrate that brucellosis in livestock populations results in a median loss of US$ 3·43 billion, with more than 95% of the losses occurring in the cattle and buffalo industry [7]. Brucellosis can be successfully controlled using appropriate intervention policies. Lack of resources to compensate farmers and a ban on cow slaughter in most parts of the country means that test and slaughter policy to control brucellosis cannot be implemented in India. There is no treatment for the disease in animals. Therefore, vaccination of cattle and buffalo population remains the sole alternative for the prevention and control of brucellosis in livestock populations in the country. However, information of benefits and costs of implementing intervention strategies to control the disease in India are largely unknown. This study aims to assess the costs and benefits of alternative control strategies for brucellosis in India. Initially, a stochastic simulation model was developed to project the course of Brucella infection for the national cattle and buffalo herd, over the next twenty years, under two different vaccination schemes. Subsequently, we performed a cost-benefit analysis to quantify the expected benefits of the proposed alternatives. We anticipate that this study would help policy makers to adopt the best available long-term intervention policy to prevent and control the occurrence of brucellosis in livestock and human populations in India. Firstly, we developed a stochastic simulation model to estimate the impact of alternative vaccination strategies on the prevalence of Brucella infection for the cattle and buffalo populations in India, for the next two decades. The considered alternatives were based on published literature [8–10]. For the first intervention, we assumed a planned annual livestock mass vaccination campaign using Brucella abortus S19 for the female bovine (cattle and buffalo) replacement calves. For the second intervention, we assumed that all the adult and young female bovine populations will be vaccinated at the beginning of the program, followed by an annual vaccination of only replacements. The third intervention considered the annual mass vaccination of replacements for a decade followed by a decade of a test and slaughter strategy. We quantified the expected benefits and gains of the proposed control programs and performed a benefit-cost analysis to calculate the overall net expected benefit for each intervention. To estimate the expected benefits from the alternative vaccination strategies, the following dynamic, synchronous, discrete time event stochastic simulation model was setup. First, animals were generated within herds. The time step (t) for this model was one year. At each time step, (a) the life stage (i. e. age) of each animal was determined by a dynamic component that is based on data about the age distribution and the age-specific replacement rate for the cattle and the buffalo populations; and (b) the infection stage for each animal was based on the expected prevalence of brucellosis for each species. Prevalence (P) was simulated at the herd level and animals within the same herd were assumed to attain the same risk of getting infected. For each herd, P was simulated for the first year and for each of next years it was based on the mean prevalence estimate of the previous year Pt-1. Animals that got infected were assumed to remain infected for life. Replacements and animals that were not infected were assumed to attain a yearly risk (YRt) of getting infected that depended on Pt-1 and the expected mean duration (D) of the disease in the infected animals: YRt=1−e−Pt−1 (1−Pt−1) D The model was allowed to run for a “burn-in” phase of 50 years and then each of the alternative interventions was considered: (a) annual mass vaccination only for the replacement calves and (b) vaccination of both the adult and young population at the beginning of the program followed by an annual vaccination of the replacement calves and (c) annual mass vaccination of replacements for a decade followed by a decade of a test and slaughter strategy. Vaccination was assumed to provide complete protection from infection although we allowed for a small rate of vaccination failures and we also considered different realistic vaccination coverage rates that in real life affect vaccine efficacy. At each time step, a number of parameters was recorded among which prevalence (P), replacement rate, the number of vaccinations and for the third scenario (i. e. vaccination of replacements followed by a test and cull strategy) the number of tested animals and the number of culled animals. Estimates were based on the summaries of 4000 simulations of all animals and herds that were run for 40 times, for each species and intervention. A detailed description of the data sources and the input parameters of the model follows. Input parameters and the corresponding distributions are also summarized in Table 1 [5–7,11–22]. For each intervention we evaluated the effect of varying input parameters on the expected benefits. Specifically, we assessed the impact of (a) reducing the initial prevalence of Brucella infection by fifty percent, (b) reducing the vaccination coverage to 50% and (c) having herds that are consistently unvaccinated (i. e. herds that were more likely to remain unvaccinated the next year). We also assessed the additional benefits of expanding the intervention strategies beyond the twenty year period. The interventions were considered for t = 20 years and at a discount rate (r) of 5%. Initially, we predicted the annual costs (Ct) and benefits (Bt) for each strategy and subsequently calculated the net present value (NPV) by applying the discount rate: NPV=∑t=1TBt−Ct (1+r) t Further, for each intervention the benefit cost ratio (BCR) was estimated as the discounted value of the incremental benefits divided by the discounted value of the incremental costs: BCR=∑t=1TBt (1+r) t∑t=1TCt (1+r) t The costs included vaccine costs, service costs of vaccination (transportation, cold chain, and veterinarian fee), animal identification costs (ear tagging), service costs for surveillance and diagnostics, and costs for health education program (Table 1). The averted losses were considered as benefits for implementing the control programs [27]. Based on our previous study [7], the losses occurring due to brucellosis per infected animal were estimated by dividing total losses for each species with the number of infected animals for that species (Table 1). Due to lack of data, the health and economic burden of human brucellosis could not be accounted into the overall benefits of the control programs. The analyses were conducted using R-statistical program (R statistical package version 2. 12. 0, R Development Core Team, http: //www. r-project. org) and we run Monte Carlo simulations for 10,000 iterations so as to determine confidence limits for these estimates. For each intervention, our results indicate that the prevalence of Brucella infection will drop below 2% in cattle after 20 years of the implementation of disease control program (Fig 1) for the cattle population. For buffaloes, a similar trend was observed. However, due to the higher initial prevalence of infection, it only drops below 3% after the twenty year implementation of all interventions (Fig 2). The NPV during the first 20 years of the program for cattle for scenario 1,2 and, 3 are presented in Table 2. For cattle, the NPV was found to be US $ 4·16 billion (95% CI: US $ 3·16; 5·39 billion) for the scenario 1, US $ 8·31 (6·40; 9·87) billion for the scenario 2 and, US $ 4·26 (3·26; 5·61) for the third scenario (Table 2). The results indicate that first 20 years of the programme will be cost-effective for all scenarios with the second intervention (vaccination of replacements with mass vaccination at the beginning of the program) being a significantly more cost-effective choice. The BCR for the first, second and the third intervention for cattle were 7·98 (6·29; 10·09), 10·62 (8·33; 12·5) and, 3·16 (2·66; 3·83), respectively. Similar results were obtained for buffaloes (Table 3). The NPV for the 50% prevalence estimates during the first 20 years of the program for cattle for scenario 1,2 and, 3 are presented in S1 Table. For cattle, NPV was found to be US $ 1·78 billion (95% CI: US $ 1·07; 2·79 billion) for the scenario 1, US $ 3·27 (2·18; 4·23) billion for scenario 2 and, US $ 0·87 (-0·24; 1·71) for scenario 3 (S1 Table). For buffaloes, the NPV for the 50% prevalence estimates was found to be US $ 3·69 billion (95% CI: US $ 2·74; 4·54 billion) for the scenario 1, US $ 5·96 (4·40; 7·27) billion for the scenario 2 and, US $ 2·09 (1·02; 3·20) for the third scenario (S2 Table). Further, sensitivity analysis revealed that for either species, disease prevalence will further reduce to less than 1% after 50 years of implementation for either intervention and will virtually lead to eradication of the disease after 100 years of the implementation programme. The long time to eradicate infection is based on the fact that we only considered realistic vaccination coverage rates. Our primary analysis, assumed a vaccination coverage of 70%. Reduction of the vaccination rate led to reduced NPV and BCR values. The same impact had the assumption that herds that were not covered were more likely to remain uncovered the next year. This is the first systematic analysis of a brucellosis control program interventions for bovine brucellosis in India. Bovine brucellosis is highly prevalent in India and causes significant losses to the livestock industries. The results suggest that all of the three approaches investigated for controlling the disease would be beneficial as the prevalence of Brucella infection will drop below 2% in cattle and 3% in buffalo after 20 years of the implementation of disease control program. All programs had positive NPVs and >1 BCRs indicating the benefits from all programs are higher than their respective costs. The best BCR was obtained in the second intervention, i. e. vaccination of both the adult and young population at the beginning of the program followed by an annual vaccination of the replacement calves. It leads to a significant drop in prevalence at the beginning of the program and hence the risk of transmitting the disease in the subsequent years is lower. This is thus the most cost-effective approach for control of brucellosis in India. Overall, the results advocate the implementation of a disease control program for brucellosis in India. The results of sensitivity analyses indicated that a positive effect for all interventions and a net benefit of billions of dollars for any intervention remains even after considering significantly reduced initial prevalence and vaccination coverage. This suggests that the control program would be beneficial even if some of the assumptions used in the model are changed, further supporting the implementation of a control program for the disease. It must be noted that we only considered economic benefits of the control programs for the livestock populations. The benefits such as disability-adjusted life years (DALYs) and social losses averted due to the control programs could not be accounted. Similarly, the extra costs due to increased livestock numbers (feed costs), or unintentional consequences (abortion due to vaccinating a female cow) were not estimated. However, we believe that this will not have a major impact on the results of the current study. Although the third approach–i. e. annual mass vaccination of replacements for a decade followed by a decade of a test and slaughter strategy–was also found to be cost-effective, it is less likely to be adopted in India because it is a Hindu majority country and Hindus consider cows to be sacred. As a result, cow slaughter is banned in most states of India. Thus it would be difficult to get community support for a strategy involving animal slaughter although it drastically reduces prevalence of the disease if implemented after a decade of vaccination. It will also be more expensive as it would involve testing of animals which would include sample collection, transport and laboratory testing. Also, there would be additional costs involved for culling infected animals. Therefore, this may not be the preferred strategy in the Indian situation. Moreover, in calculating losses for test and slaughter, we assumed that animals will be consumed after slaughter in accordance with the WHO guidelines [28]. However, it may not be feasible to do so or may increase the risk of spread of infection. Therefore, it would be more sensible to adopt a ‘test and euthanasia’ strategy in which the infected animals are euthanized and their carcasses burnt or buried and not consumed. This strategy is likely to have a greater acceptance among the community which is very essential for the success of any control program. However, this would increase the cost of the test and slaughter program as it will result in a complete loss of slaughtered animal instead of just a loss of 20% considered in the scenario. Thus the actual cost of the third scenario may be higher than we estimated. In this study, BCRs for three inventions for cattle were estimated to range from 3·16 to 10·62 and for buffaloes from 3·79 to 21·27. Similar estimates have been obtained in some other studies conducted around the world. The strategy of vaccinating 3–6 month old female bovine, male ovine and female ovine followed by compulsory slaughter after attaining the target prevalence have been advocated in Turkey [10], where BCR was estimated to be 2·26 [10]. A BCR of 3·2 has been estimated for control of brucellosis in Nigeria [29]. A national serological survey and risk based vaccination using S19 and an awareness program was found to have a BCR of 6·8 for control of brucellosis in Nepal [9]. Note that we only considered scenarios for control of the disease; eradication was not considered feasible in the current circumstances. The disease is highly prevalent and endemic in India; therefore, it would be unrealistic to achieve eradication. Further, India is a vast country with significant movement and intermixing of animals. Moreover, eradication would definitely require test and slaughter but religious and cultural beliefs would impede implementation of any such program due to limited community support. However, once the prevalence reduces below 2% after 20 years, there may be greater community support for eradication as well as test and slaughter/euthanasia as discussed before. Therefore, it would be wise to revisit this question sometime in the future. In this work realistic inputs of vaccination coverage aimed to also adjust for the reduced vaccine efficacy due to vaccine failure as well as problems associated with cold chains, which were not directly accounted for. Assumed vaccination rates ranged from 70% to 50% to cover different vaccine efficacies that have been used in previous studies [25,30]. Undoubtedly, real-time data of vaccine efficacy could further improve the predictive ability of our model. However, in our sensitivity analysis we considered the realistic fact that herds that were not covered once were more likely to remain uncovered due to issues associated with inability to reach them or farmers’ will to cooperate. However, even better NPV and BCR will be achieved if the vaccination coverage/efficacy is improved. It has been reported that 53. 6% of the bovine (cattle and buffalo) population receives foot and mouth disease (FMD) vaccination in India [31,32]. Therefore, our assumption of 50% vaccination coverage is quite realistic. However, there will be pockets of low (<10%) and high coverage (90%+) areas. Many factors such as poor infrastructure, lack of knowledge and veterinary personnel availability are responsible for poor adoption of vaccines in India [33]. A farmer’s perceptions such that vaccination could lead to decrease in milk yield, swelling and fever also decrease vaccine coverage [33]. Low community acceptance, vaccine stock outs at the local level and timeliness of vaccine also affect the vaccine coverage [34]. These factors could affect the benefits but could not be accounted in the current study. The advantage of using the S19 vaccine is that immunity induced is long-lasting and has been reported to be effective till fifth pregnancy [10,35]. However, there are a number of concerns with using this vaccine. The major concern is the common occurrence of the needle stick injuries and the accidental inoculation in veterinary personnel while participating in Brucella vaccination programs [36]. The rates of accidental exposure ranging from 6·7% to 46% have been reported [37]. The needle stick injuries have been reported to cause a low virulence human brucellosis [38]. To avoid needle stick injuries, research should be conducted in the use of a safety vaccinator as used for other vaccines such as Gudair® vaccination in Australia [39] and animals should be properly restrained before vaccination. Additionally, the S19 vaccine could interfere with the recommended diagnostic tests and may cause abortion in the pregnant animals [35,40]. Moreover, the vaccine cannot be used for male [41] or infected animals [42]. Therefore, there is a need for the development of a better vaccine that can differentiate infected from vaccinated animals (DIVA). RB51 vaccine can be used instead of S19 as it allows serological differentiation between naturally infected and vaccinated animals but it is not currently available in India and is considered to have a lower efficacy than S19. It is worth mentioning here that the cost and benefit analyses evaluated in this manuscript only pertain to the effect of the disease on the domestic animal population. The benefits to the human population would be over and above the benefits discussed here but were beyond the scope of this study. It is well known that humans get infected while handling infected animals. Therefore, various studies have shown that the disease is prevalent among occupational groups such as veterinary personnel, laboratory workers, livestock farmers and abattoir workers in India [43–45]. We have recently shown that the disease causes a loss of 177 601 (95% UI 152 695–214 764) DALYs at the rate of 0. 15 (95% UI 0. 13–0. 17) DALYs per thousand persons every year [46] and an annual median loss of Rs 627. 5 million (US $ 10. 46 million) in India [46]. Complete eradication of the disease will save these losses but further studies are required to investigate the real impact of the control strategies discussed in this manuscript on the human population.

Title: Cost-benefit analysis of intervention policies for prevention and control of brucellosis in India Summary: Brucellosis is an endemic zoonosis in India and recent studies demonstrate that the disease results in a median loss of US$ 3. 43 billion in livestock populations. Lack of resources to compensate farmers and a ban on cow slaughter means that test and slaughter policy to control brucellosis cannot be implemented in India. This is the first systematic analysis of a brucellosis control program interventions for bovine brucellosis in India. The cost-benefit analysis was successfully conducted and indicated benefits of implementing the intervention policies. For each intervention, our results indicate that the prevalence of Brucella infection will drop below 2% in cattle after 20 years of the implementation of disease control program although some strategies were better than others. The expected net present value (NPV) was found to range from US $ 4·16 to $ 8·31 billion for cattle and from $ 7·66 to $ 13·42 billion in buffalo for the three strategies investigated. The benefit cost ratio (BCR) ranged from 3·16 to 10·62 for cattle and from 3·79 to 21·27 for buffalo. The results advocate for the implementation of a disease control program and will help development of an official health policy for the control of brucellosis in India.

lay_plos

en

Summarize: Residents at housing flats in South London have criticised the building's segregated entrances policy, where one doorway is set aside for the rich and the other for its housing association tenants. London Mayor Boris Johnson recently faced calls to ban ‘poor doors’ in upmarket blocks of flats, which force people on low incomes to use different entrances. But developers in London are promising wealthy tenants they will not have to share their smart lobby entrances, courtyard gardens or secure parking with people living in flats classed as ‘affordable housing’. Scroll down for video. The entrance to the rich part of the housing development, where private tenants enter and exit. The 'poor door', located just around the corner, where housing association tenants must enter and exit. Social housing residents from a block of flats in Woolwich have spoken of feeling like'scum' after being kept apart from their wealthy neighbours. A resident named only as Donna told the Sunday Mirror she and her family must enter the flats. through the 'poor door' - an entrance without the concierge or. 24 hour service her wealthy neighbours enjoy around the corner. She said: 'I've never felt poorer in my life because of the way we're kept apart. 'I don't want my kids thinking they deserve to be treated differently. It's humiliating and wrong.' The. practice faces being banned in New York after a backlash and has sparked. a political row in the UK with Labour condemning the covert. ‘segregation’. The housing block in Woolwich where tenants are frustrated they are being segregated from wealthier neighbours. The problem stems from rules which are supposed to stop areas becoming ghettos for the very rich. When planning permission is granted, developers are often told to set aside a set number of units for affordable housing. From the outside, there is often no way of telling the more basic homes from the hi-spec apartments aimed at the super-rich. But behind the façade, less well-off tenants are forced to enter through different doors and use separate bicycle racks, bins and post boxes. Labour’s shadow housing minister Emma Reynolds told MailOnline: ‘I am strongly against this kind of segregation. There shouldn’t be separate doors for people living in affordable housing. ‘Many of the developers that I have been to haven’t had this distinction but I am deeply concerned that it is something happening in the UK.’

Summary: Developers, forced to set aside units. for affordable housing, create separate entrances to avoid flat sale. profits being affected by low income tenants. Woolwich block of flats has separate entrances for private and housing association tenants, sparking claims of new type of class segregation. Comes as London mayor Boris Johnson recently faced calls to stop the use of 'poor doors' in upmarket blocks of flats as New York moves to ban them.

cnn_dailymail

en

Summarize: Get your garlic, crosses and stakes ready: a bloodsucking vampire is on the loose. In this Nov. 30, 2012 photo villager Mico Matic, displays garlic that he carries in his pockets, in the village of Zarozje, near the Serbian town of Bajina Basta. Get your garlic, wooden crosses and... (Associated Press) In this Nov. 30, 2012 photo is a grave of a villager in the village of Zarozje, near the Serbian town of Bajina Basta. Get your garlic, wooden crosses and stakes ready: a bloodsucking vampire is on the... (Associated Press) In this Nov. 30, 2012 photo a woman walks on the road, in the village of Zarozje, near the Serbian town of Bajina Basta. Get your garlic, wooden crosses and stakes ready: a bloodsucking vampire is on... (Associated Press) In this Nov. 30, 2012 photo Milka Prokic is seen at twilight with a garland of garlic and a wooden stake, in the village of Zarozje, near the Serbian town of Bajina Basta. Get your garlic, wooden crosses... (Associated Press) Or so say villagers in the tiny western Serbian hamlet of Zarozje, nestled between lush green mountain slopes and spooky thick forests. They say rumors that a legendary vampire ghost has awakened are spreading fear _ and a potential tourist opportunity _ through the remote village. A local council warned villagers to put garlic in their pockets and place wooden crosses in their rooms to ward off vampires, although it appeared designed more to attract visitors to the impoverished region bordering Bosnia. Many of the villagers are aware that Sava Savanovic, Serbia's most famous vampire, is a fairy tale. Still, they say, better to take it seriously than risk succumbing to the vampire's fangs. "The story of Sava Savanovic is a legend, but strange things did occur in these parts back in the old days," said 55-year-old housewife Milka Prokic, holding a string of garlic in one hand and a large wooden stake in another, as an appropriately moody mist rose above the surrounding hills. "We have inherited this legend from our ancestors, and we keep it alive for the younger generations." Vampire legends have played a prominent part in the Balkans for centuries _ most prominently Dracula from Romania's Transylvania region. In the 18th century, the legends sometimes triggered mass hysteria and even public executions of those accused of being vampires. Sava Savanovic, described by the Zarozje villagers as Serbia's first vampire, reputedly drank the blood of those who came to the small shack in the dense oak tree forest to mill their grain on the clear mountain Rogatica river. The wooden mill collapsed a few months ago _ allegedly angering the vampire, who is now looking for a new place to hang his cape. Some locals claim they can hear steps cracking dry forest leaves and strange sounds coming from the rocky mountain peaks where the vampire was purportedly killed with a sharp stake that pierced his heart _ but managed to survive in spirit as a butterfly. "One should always remain calm, it's important not to frighten him, you shouldn't make fun of him," said villager Mico Matic, 56, whose house is not far from the collapsed mill. "He is just one of the neighbors, you do your best to be on friendly terms with him," he said with a wry smile, displaying garlic from both of his trouser pockets. Some locals say it's easy for strangers to laugh at them, but they truly believe. "Five people have recently died one after another in our small community, one hanging himself," said Miodrag Vujetic, a local municipal council member. "This is not by accident." Vujetic, however, said that "whatever is true about Sava," locals should use the legend to promote tourism. "If Romanians could profit on the Dracula legend with the tourists visiting Transylvania, why can't we do the same with Sava?" Richard Sugg, a lecturer in Renaissance Studies at the U.K.'s University of Durham and an expert on the vampire legends, said the fear could be very real. Stress can bring on nightmares, which makes people's feelings of dread even worse. "The tourists think it is fun _ and the Serbian locals think it's terrifying," he said. North Korean historical institute 'declares it has discovered unicorn lair belonging to founder of ancient kingdom’ In yet another outlandish claim to come out of North Korea historians have allegedly announced that they have unearthed a unicorn lair. A report released by the History Institute of the DPRK Academy of Social Sciences claims that archaeologists discovered the lair of the mythical animal just outside a temple in the capital Pyongyang. And, unsurprisingly, the lair - according to the report - means that Pyongyang was the focal point of an ancient, united Korea. Odd: The unicorn lair has apparently been discovered just outside Yongmyong temple on Moran Hill, in the capital Pyongyang OTHER UNUSUAL CLAIMS TO COME OUT OF NORTH KOREA At the women's World Cup of football in 2011 the North Koreans put their poor performance down to being struck by lightning. Five of their players later tested positive for steroids. Most of the more unusual claims stem from former leader Kim Jong-il and his biographer. According to the book he reportedly warned the public in North Korea that he could control the weather with his mood. He also claimed his birth had been prophesied and was heralded with a double rainbow and a new star in the heavens. Years late Kim was apparently very busy during university writing no fewer than 1,500 books in three years and composing six operas. But it wasn't just the arts he took a keen interest in. Apparently, in his first and only ever round of golf he shot 38-under with 11 holes in one. Satisfied with his performance, he reportedly immediately declared his retirement from the sport. In what appears to be a suggestion of superiority over nearby enemies South Korea, the report says: 'The discovery of the unicorn lair, associated with legend about King Tongmyong, proves that Pyongyang was a capital city of Ancient Korea as well as Koguryo Kingdom.' The dubious report, released by the state news agency, says the lair clearly belonged to King Tongmyong, founder of the ancient Korean kingdom Koguryo. It goes on to say: 'A rectangular rock carved with words "Unicorn Lair" stands in front of the lair. 'The carved words are believed to date back to the period of Koryo Kingdom (918-1392). 'The temple served as a relief palace for King Tongmyong, in which there is the lair of his unicorn.' Jo Hui Sung, director of the Institute, told KCNA, the state news agency, that the findings is in keeping with the country's history. He said: 'Korea’s history books deal with the unicorn, considered to be ridden by King Tongmyong, and its lair. 'The Sogyong (Pyongyang) chapter of the old book �?Koryo History’, said Ulmil Pavilion is on the top of Mt. Kumsu, with Yongmyong Temple, one of Pyongyang’s eight scenic spots, beneath it. 'The temple served as a relief palace for King Tongmyong, in which there is the lair of his unicorn.' The legend of unicorns is thought to have stemmed from European folklore, in which the animal resembles a white horse with a single horn. Until the 19th century the beast, considered a symbol of purity and grace, was still thought to exist - even by academics and theologians. But since then there has been little to suggest that there are lairs elsewhere in the world. Discovery: Archaeologists in North Korea have apparently discovered a unicorn lair in the heart of Pyongyang Bold claims: Former North Korean leader Kim Jong-il was at the centre of some other dubious claims before his death The unbelievable news does however follow a number of bizarre claims to come out of the country. It has been suggested, however, that the release of the story could be in retaliation against a spoof North Korea related story which tricked a newspaper in China.

Summary: North Korea not only has a sexy leader-it also lays claim to a bona fide unicorn lair, the Daily Mail reports. The very serious-sounding History Institute of the DPRK Academy of Social Sciences released a report about it, saying the unicorn's refuge was outside a temple in Pyongyang. Conveniently, the report added that the lair-which is associated with an ancient legend-proves Pyongyang once played a key role in a united Korea. How did they spot the lair? It has "a rectangular rock carved with words 'Unicorn Lair'" sitting outside, the report said. North Koreans aren't the only ones dipping into old stories: Villagers in the Serbian town of Zarozje say a vampire has been stalking the area since its home, a grain mill, fell over a few months ago, the AP reports. Locals seem divided about whether it's real or just an attempt to boost tourism in an impoverished area, but the legend of blood-sucking Sava Savanovic does date back centuries. "If Romanians could profit on the Dracula legend with the tourists visiting Transylvania, why can't we do the same with Sava?" says a local council member.

multi_news

en

Summarize: A Washington State woman whose story was told by Barack Obama last month as evidence the Affordable Care Act is helping Americans now says the insurance exchange made a mistake and she can’t afford a plan. Jessica Sanford was named by the president in a Rose Garden speech regarding Obamacare after she wrote a letter to the White House thanking them for helping her get health coverage. But last week the 48-year-old self-employed single mom got a letter saying she was given a lower insurance quote and higher tax credit by the state’s exchange than she actually qualified for due to a ‘system error.’ Still uninsured: Jessica Sanford of Washington State was named by President Obama as an Affordable Care Act success story but after a state's error was revealed, it turned out she couldn't get a plan after all. The letter was actually one of several. she’d received from Washington HealthPlanFinder, which is the state’s. Affordable Care Act exchange group. The first told her of an error regarding her tax credit. It had been miscalculated and would be lower than she expected. She. was disappointed in the uptick in cost for her insurance, but still. carried on with her plans to purchase insurance through the exchange at. $280 per month instead of the original quote of $198. But. the second letter informed her she’d get no tax credit at all. That. resulted in an even higher quote of $390 per month, which Sanford told. CNN she just couldn’t afford. There. was a cheaper, ‘bronze’ plan she could buy for $324 per month, but with. higher deductibles she couldn’t afford that either. Before the hammer fell: In a Rose Garden speech, just the pictured pregnant woman famously fell, Obama called Sanford's story, which she emailed to the White House, 'what the Affordable Care Act is all about' Let down: But after receiving several letters from her state exchange about errors regarding her tax credit, it became clear to Sanford that she couldn't afford to buy into the Affordable Care Act. Sanford apologized in the letter and said they were ‘disappointed to have discovered this issue.’ Meanwhile, it was just last month when Obama stood in the Rose Garden and proudly spoke of how the new health insurance exchanges. ‘I recently received a letter from a woman named Jessica Sanford in Washington State,’ President Obama told America in the October 21 speech. ‘Here's what she had to say:. I am a single mom, no child support, self-employed and I haven't had insurance in 15 years because it's too expensive.’ 'I wanted health insurance, wanted this to work. I want it to work for everybody': Sanford says as it stands she can't afford a health plan but blames the state, not the Affordable Care Act as a whole. I was crying the other day when I signed up, so much stress lifted.’ Sanford said she wept when she. believed she’d finally be able to afford insurance. And again when she. learned she actually couldn’t because of the state’s error. ‘I was embarrassed,’ Sanford told CNN. ‘I had a good cry.’ The. self-employed court reporter blames the state of Washington and its. exchange for the issue and says she regrets that Obama mentioned her. name. She voted for Obama twice and supports the Affordable Care Act but admits, ‘They screwed up.’ ‘Wow. You guys really screwed me over,’ Sanford wrote on the state exchange’s. Facebook page. ‘Now I have been priced out and will not be able to. afford the plans you offer. But, I get to pay $95 and up for not having. health insurance. I am so incredibly disappointed and saddened. You. majorly screwed up.’ Sanford who was once so ecstatic to finally be insured is now back to square one. ‘This is it. I'm not getting insurance,’ Sanford told CNN. ‘That's where it stands right now unless they fix it.’ Sanford told NWCN that she's disappointed in her situation and feels for those sharing in the frustration with her. 'I wanted health insurance, wanted this to work. I want it to work for everybody.'

Summary: 'I was ecstatic': Washington State woman Jessica Sanford was named by President Obama in a Rose Garden speech about affordable health care last month after she wrote a letter thanking the White House for helping her afford insurance. 'I had a good cry': But last week, Sanford received a letter from the state saying that her insurance rate had been miscalculated and she wouldn't be receiving a tax credit for buying a plan like she thought. 'They screwed up': Sanford says she still supports the affordable care act and blames the insurance exchange in her home state for the error but she won't be buying insurance at the rate she's now been offered. Sanford was originally quoted a plan of $198 per month but after the state's'system error' she was quoted $390.

cnn_dailymail

en

Summarize: Dal 23 al 26 maggio i cittadini dell'Unione Europea saranno chiamati a votare per il rinnovo del Parlamento europeo. Le elezioni europee in Italia si terranno domani 26 maggio dalle 7 alle 23, per eleggere i 73 rappresentanti che prenderanno posto in Europarlamento; la legge elettorale che indica come si vota alle europee è quella del 1979, in parte aggiornata nel 2009, con un sistema proporzionale puro, cinque circoscrizioni territoriali e una soglia di sbarramento al 4%. Tutti i partiti hanno presentato i programmi ufficiali: all'interno di questi documenti, gli schieramenti in campo hanno parlato dei temi che hanno intenzione di portare in Europarlamento qualora eletti. Sono molti gli ambiti comuni ai programmi, anche se chiaramente ogni lista e partito affronta le tematiche in modo diverso e con giudizi anche opposti. Andiamo dunque a vedere quali sono i temi caldi delle Elezioni Europee e cosa hanno da dire i principali partiti italiani in relazione a essi. Leggere i programmi dei partiti è il modo migliore per capire chi votare alle Elezioni Europee, ma in rete sono disponibili anche una serie di test utili per chi ha poco tempo e vuole capire quali sono gli schieramenti più affini alle proprie convinzioni. Per quanto riguarda l'aspetto economico, sono molti i punti di intersezione fra i programmi dei partiti per le elezioni europee 2019. L'argomento sembra trovare un punto di incontro fra centrodestra e centrosinistra. Infatti, sia Forza Italia che il Partito Democratico presentano delle proposte economiche concentrate sulla crescita e sugli investimenti. Ciò si deve poi tradurre, sottolineano entrambi, in livelli più alti di occupazione. Il tema è rilevante anche nel programma di +Europa: se il Pd parla di un'indennità europeo di disoccupazione, il partito di Emma Bonino avanza invece l'ipotesi di un sussidio per l'occupazione di tutti gli europei. Forza Italia lega la questione ad un cambio di mandato della BCE, in cui si trova d'accordo con il Movimento Cinque Stelle: per entrambi la Banca centrale europea non si deve preoccupare solamente del tasso di inflazione, ma anche di quello indicante l'occupazione. I partiti di Silvio Berlusconi e Luigi Di Maio si trovano sulla stessa linea riguardo al rifiuto dell'austerity, punto condiviso anche dai Fratelli di Italia di Giorgia Meloni. Questi tre gruppi politici, inoltre coincidono con il Pd nell'affermare l'importanza del Made in Italy e del sostegno alla manifattura italiana. In particolare, FI riconduce il tema alla competizione con il sottocosto cinese, definendolo un problema di cui l'Europa dovrebbe farsi carico. Pd e FI si trovano in sintonia anche nel difendere i fondi destinati alle politiche agricole comuni, per cui anche il M5S chiede venga stanziato più capitale, e nel collegare le politiche si sviluppo economico, specialmente in quest'ambito ma non solo, all'ecologia. Il riferimento alla green economy si trova anche nel progetto del M5S e in quello di +Europa. Anche la questione fiscale riesce a mettere d'accordo centrodestra e centrosinistra: FI e Pd si battono per un fisco più equo in Europa contro i giganti del web, che spesso riescono ad evitare di pagare le imposte nel Vecchio Continente. Tuttavia, se il Pd si concentra sul rifiuto del dumping fiscale, cioè un regime di tassazione più basso, FI si batte tradizionalmente perché ci siano meno tasse. In questa posizione viene seguito a ruota da Fratelli d'Italia e dalla Lega, che sebbene non abbia presentato ancora ufficialmente un programma, ha fatto della flat tax il proprio cavallo di battaglia per tutta la campagna elettorale. Lo stesso vale in tema di immigrazione. Sebbene non ci sia ancora un documento ufficiale che testimoni la lotta del Carroccio all'immigrazione irregolare in sede di Europarlamento, questo rimane il punto focale dei sovranisti europei, il gruppo politico con cui si è alleato Matteo Salvini. In questa posizione la Lega trova l'appoggio di FdI, che corre alle europee sullo slogan di "prima gli italiani" e chiede il controllo militare delle frontiere. Non solo, per il programma sostenuto da Meloni bisogna proteggere "la nostra identità di italiani ed europei" anche dall'interno, contro "il processo di islamizzazione in corso". FI presenta una posizione più moderata, proponendo una riforma del regolamento di Dublino e un sistema di asilo efficace, equo e solidale. La solidarietà è proprio il punto su cui il Pd punta le sue proposte in tema migratorio. Anche il partito di Nicola Zingaretti sostiene la necessità di rivedere i trattati di Dublino, per poi concentrare la questione sulla necessità di un nuovo rapporto fra Africa e Europa, in vista di una cooperazione più profonda possa sostenere lo sviluppo dei Paesi africani e sradicare la povertà. Ipotesi ratificata anche da FI, che propone un "piano Marshall per il continente africano" che sappia contenere le pressioni migratorie.

Summary: Le elezioni europee si terranno tra il 23 e il 26 maggio per il rinnovo del Parlamento Europeo. I programmi presentati dai principali partiti italiani presentano ambiti ricorrenti, nonostante le attitudini dei singoli in materia possono essere opposte. Vediamo quindi cosa si prefiggono di fare il Partito Democratico, il Movimento Cinque Stelle, Forza Italia, la Lega, Fratelli d'Italia e +Europa in materia di economia, immigrazione e politiche sociali.

fanpage

it

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Agriculture Security Assistance Act''. SEC. 2. FINDINGS. Congress finds that-- (1) some agricultural diseases pose a direct threat to human health; (2) economic sabotage, in the form of agroterrorism, is also a concern; (3) the United States has an $80,000,000,000 livestock industry; (4) an outbreak of an agricultural disease, whether naturally occurring or intentionally introduced, could-- (A) have a profound impact on the infrastructure, economy, and export markets of the United States; and (B) erode consumer confidence in the Federal Government and the safety of the food supply of the United States; (5) as with human health and bioterrorism preparedness, enhancing current monitoring and response mechanisms to deal with a deliberate act of agricultural terrorism would strengthen the ability of the United States to diagnose and respond quickly to any animal health crisis; (6)(A) activities to ensure the biosecurity of farms are an important tool in preventing-- (i) the intentional or accidental introduction of an agricultural disease; and (ii) the spread of an introduced agricultural disease into an outbreak; and (B) most surveys of producers indicate discouraging and dangerous trends in basic elements of farm security activities; (7)(A) a national response plan, developed by the Department of Agriculture and the Federal Emergency Management Agency, would determine how interdependent agricultural health and emergency management response functions will be coordinated to ensure an orderly, immediate, and unified response to all aspects of an outbreak of an agricultural disease; (B) the Department of Agriculture, in cooperation with State and industry partners, would implement the plan as needed; and (C) State and local partners would need assistance to implement their shares of the plan; (8) States and communities also require assistance to prepare and plan for agricultural disasters; (9)(A) rapid detection of an agricultural disease is imperative in containing the spread of the agricultural disease; and (B) potential delays and difficulty in detection may complicate decisions regarding appropriate control measures; and (10)(A) planning for a response to an outbreak of an agricultural disease will vary from State to State, reflecting-- (i) the level of awareness; (ii) the perception of risk; (iii) competing time demands; and (iv) the availability of resources; and (B) State response capability would be significantly enhanced if State agricultural and emergency management officials were to jointly develop a comprehensive agricultural disease response plan. SEC. 3. AGRICULTURE SECURITY ASSISTANCE. (a) In General.--Title VIII of the Homeland Security Act of 2002 (Public Law 107-296; 116 Stat. 2220) is amended by adding at the end the following: ``Subtitle J--Agriculture Security Assistance ``SEC. 899A. DEFINITIONS. ``In this subtitle: ``(1) Agricultural disease.--The term `agricultural disease' means an outbreak of a plant or animal disease, or a pest infestation, that requires prompt action in order to prevent injury or damage to people, plants, livestock, property, the economy, or the environment. ``(2) Agricultural disease emergency.--The term `agricultural disease emergency' means an outbreak of a plant or animal disease, or a pest infestation, that requires prompt action in order to prevent injury or damage to people, plants, livestock, property, the economy, or the environment, as determined by the Secretary of Agriculture under-- ``(A) section 415 of the Plant Protection Act (7 U.S.C. 7715); or ``(B) section 10407(b) of the Animal Health Protection Act (7 U.S.C. 8306(b)). ``(3) Agriculture.--The term `agriculture' includes-- ``(A) the science and practice of activities relating to food, feed, and fiber production, processing, marketing, distribution, use, and trade; ``(B) family and consumer science, nutrition, food science and engineering, agricultural economics, and other social sciences; and ``(C) forestry, wildlife science, fishery science, aquaculture, floraculture, veterinary medicine, and other environmental and natural resource sciences. ``(4) Agroterrorism.--The term `agroterrorism' means the commission of an agroterrorist act. ``(5) Agroterrorist act.--The term `agroterrorist act' means a criminal act consisting of causing or attempting to cause damage or harm to, or destruction or contamination of, a crop, livestock, farm or ranch equipment, a material, any other property associated with agriculture, or a person engaged in agricultural activity, that is committed with the intent-- ``(A) to intimidate or coerce a civilian population; or ``(B) to influence the policy of a government by intimidation or coercion. ``(6) Biosecurity.-- ``(A) In general.--The term `biosecurity' means protection from the risks posed by biological, chemical, or radiological agents to-- ``(i) plant or animal health; ``(ii) the agricultural economy; ``(iii) the environment; and ``(iv) human health. ``(B) Inclusions.--The term `biosecurity' includes the exclusion, eradication, and control of biological agents that cause agricultural diseases. ``SEC. 899B. RESPONSE PLANS. ``(a) In General.-- ``(1) State plans.--The Secretary of Agriculture, in consultation with the Director of the Federal Emergency Management Agency, shall assist States in developing and implementing State plans for responding to outbreaks of agricultural diseases. ``(2) Required elements.--Each State response plan shall include-- ``(A) identification of available authorities and resources within the State that are needed to respond to an outbreak of an agricultural disease; ``(B) identification of-- ``(i) potential risks and threats due to agricultural activity in the State; and ``(ii) the vulnerabilities to those risks and threats; ``(C) potential emergency management assistance compacts and other mutual aid agreements with neighboring States; and ``(D) identification of local and State legal statutes or precedents that may affect the implementation of a State response plan. ``(3) Regional and national response plans.--The Secretary of Agriculture shall work with States in developing regional and national response plans to carry out this subsection. ``(4) Authorization of appropriations.--There are authorized to be appropriated to carry out this subsection such sums as are necessary for fiscal year 2004 and each fiscal year thereafter. ``(b) Modeling and Statistical Analyses.-- ``(1) In general.--In consultation with the Steering Committee of the National Animal Health Emergency Management System and other stakeholders, the Secretary of Agriculture shall conduct a study-- ``(A) to determine the best use of epidemiologists, computer modelers, and statisticians as members of emergency response task forces that handle foreign or emerging agricultural disease emergencies; and ``(B) to identify the types of data that are not collected but that would be necessary for proper modeling and analysis of agricultural disease emergencies. ``(2) Report.--Not later than 180 days after the date of enactment of this subtitle, the Secretary of Agriculture shall submit a report that describes the results of the study to-- ``(A) the Secretary of Homeland Security; and ``(B) the heads of other appropriate governmental agencies involved in response planning for agricultural disease emergencies. ``(c) Geographic Information System Grants.-- ``(1) In general.--The Secretary of Agriculture, in consultation with the Secretary of Homeland Security and the Secretary of the Interior, shall establish a program to provide grants to States to develop capabilities to use geographic information systems and statistical models for epidemiological assessments in the event of agricultural disease emergencies. ``(2) Authorization of appropriations.--There are authorized to be appropriated to carry out this subsection-- ``(A) $2,500,000 for fiscal year 2004; and ``(B) such sums as are necessary for each fiscal year thereafter. ``(d) Grants To Facilitate Participation of State and Local Animal Health Care Officials.-- ``(1) In general.--The Secretary of Homeland Security, in coordination with the Secretary of Agriculture, shall establish a program to provide grants to communities to facilitate the participation of State and local animal health care officials in community emergency planning efforts. ``(2) Authorization of appropriations.--There is authorized to be appropriated to carry out this subsection $5,000,000 for fiscal year 2004. ``SEC. 899C. BIOSECURITY AWARENESS AND PROGRAMS. ``(a) In General.--The Secretary of Agriculture shall implement a public awareness campaign for farmers, ranchers, and other agricultural producers that emphasizes-- ``(1) the need for heightened biosecurity on farms; and ``(2) the reporting of agricultural disease anomalies. ``(b) On-Farm Biosecurity.-- ``(1) In general.--Not later than 240 days after the date of enactment of this subtitle, in consultation with associations of agricultural producers and taking into consideration research conducted under the National Agricultural Research, Extension, and Teaching Policy Act of 1977 (7 U.S.C. 3101 et seq.), the Secretary of Agriculture shall-- ``(A) develop guidelines-- ``(i) to improve monitoring of vehicles and materials entering or leaving farm or ranch operations; and ``(ii) to control human traffic entering or leaving farm or ranch operations; and ``(B) disseminate the guidelines to agricultural producers through agricultural education seminars and biosecurity training sessions. ``(2) Authorization of appropriations.-- ``(A) In general.--There are authorized to be appropriated to carry out this subsection-- ``(i) $5,000,000 for fiscal year 2004; and ``(ii) such sums as are necessary for each fiscal year thereafter. ``(B) Education program.--Of the amounts made available under subparagraph (A), the Secretary of Agriculture may use such sums as are necessary to establish in each State an education program to distribute the biosecurity guidelines developed under paragraph (1). ``(c) Biosecurity Grant Pilot Program.-- ``(1) In general.--Not later than 240 days after the date of enactment of this subtitle, the Secretary of Agriculture shall develop a pilot program to provide incentives, in the forms of grants or low-interest loans, each in an amount not to exceed $10,000, for agricultural producers to restructure farm and ranch operations (based on the biosecurity guidelines developed under subsection (b)(1))-- ``(A) to control access to farms or ranches by persons intending to commit an agroterrorist act; ``(B) to prevent the introduction and spread of agricultural diseases; and ``(C) to take other measures to ensure biosecurity. ``(2) Report.--Not later than 3 years after the date of enactment of this subtitle, the Secretary of Agriculture shall submit to the appropriate committees of Congress a report that-- ``(A) describes the implementation of the pilot program; and ``(B) makes recommendations on expansion of the pilot program. ``(3) Authorization of appropriations.--There are authorized to be appropriated to carry out this subsection-- ``(A) $5,000,000 for fiscal year 2004; and ``(B) such sums as are necessary for each of fiscal years 2005 through 2007.''. (b) Conforming Amendment.--The table of contents in section 1(b) of the Homeland Security Act of 2002 (Public Law 107-296; 116 Stat. 2135) is amended by adding at the end of the items relating to title VIII the following: ``Subtitle J--Agriculture Security Assistance ``Sec. 899A. Definitions. ``Sec. 899B. Response plans. ``Sec. 899C. Biosecurity awareness and programs.''.

Title: A bill to amend the Homeland Security Act of 2002 to assist States and communities in preparing for and responding to threats to the agriculture of the United States Summary: Agriculture Security Assistance Act - Amends the Homeland Security Act of 2002 to direct the Secretary of Agriculture to: (1) assist States to develop agricultural disease response plans, including regional and national plans; (2) conduct a related modeling and statistical analysis study; (3) provide State grants for epidemiological assessment use of geographic information and statistical analysis models in the event of agricultural disease emergencies; (4) implement a biosecurity awareness program for farmers and ranchers, including on-farm biosecurity guidelines and discretionary education programs; and (5) establish a farm and ranch biosecurity grant and loan pilot program.Authorizes the Secretary of Homeland Security to provide grants for State and local animal health care officials to participate in community emergency planning.

billsum

en

Summarize: Clad in white jodhpurs and blinking in the bright Spanish sunshine, Athina Onassis looked every inch the showjumper as the opening round of the Furusiyya FEI Nations Cup Jumping Finals got underway in Barcelona yesterday. Unfortunately, the heiress' bid for the Coca-Cola Trophy came to an early end, after she clocked up 12 faults and was placed 57th out of 63 riders. Onassis, 29, who is the only living descendant of Greek shipping tycoon Aristotle Onassis, was riding grey mare AD Camille Z during the event, which is one of the most prestigious in world showjumping. Excitement: Athina and husband Doda were competing in the Furusiyya FEI Nations Cup Jumping Final. Relaxed: Athina, who is famously reclusive, looked relaxed as she chatted to a friend in the ring. Her husband, the Brazilian rider Álvaro de Miranda Neto, 41, did better and with AD Nouvelle Europe Z, chalked up just two faults and managed a respectable 24th place. The winner of the Coca-Cola Trophy, however, was Canada's Eric Lamaze who managed an almost perfect round on his horse Fine Lady. Veteran Brazilian rider Pedro Veniss took second place with his horse Amemoi O Sandor, while France's Pénélope Leprovost and Sultane Des Ibis came third. While Onassis might not always get what she wants in her riding career, she has long called the shots in her own life, shrugging off her family's fame and living a quiet life in Brazil's largest city São Paulo with her husband instead. Walking the course: Athina, along with the other competitors, spent some time inspecting the course. Top tips: Onassis gets some advice from husband Doda, who eventually managed a 24th place finish. The only child of Christina Onassis, the late shipping tycoon's daughter, she inherited 55 per cent of his fortune - which is believed to be worth billions - on his death. Since then, Onassis has dedicated herself to carving out an equestrian career, although an injury last year proved a serious setback. Onassis, who competes for Greece, is rarely seen in public but has made an unusually large number of appearances in recent months, as her showjumping career hots up. Most recently, she was spotted competing in London at the Longines Global Champions Tour in August, alongside fellow famous riders, Jessica Springsteen and Sofia Abramovich. Although she and her husband, who is affectionately known as Doda, failed to put in an appearance at the launch party, she did manage a clear round in the ring on her bay mare, AD Rose du Valon. Nerves: Athina looked on intently as Doda took to the ring on his horse AD Nouvelle Europe Z. Not so good: Athina eventually took 57th place, with Canada's Eric Lamaze taking the Coca-Cola Trophy

Summary: The heiress, 29, was hoping to get her hands on the Coca-Cola Trophy. Unfortunately, she clocked up 12 faults and ended up in 57th place. The trophy was eventually won by Canada's Eric Lamaze and Fine Lady. She was competing at the Furusiyya FEI Nations Cup Jumping Finals. Husband Doda also took part in the competition and came 24th.

cnn_dailymail

en

Summarize: This is a division of application Ser. No. 07/834,345 filed Feb. 12, 1992 (now U.S. Pat. No. 5,342,945 issued Aug. 3, 1994), which is a division of application Ser. No. 07/210,520 filed Jun. 23, 1988 (now U.S. Pat. No. 5,091,576 issued Feb. 25, 1992), which is a continuation-in-part of application Ser. No. 07/066,227 filed Jun. 25, 1987 (now abandoned), which was a continuation-in-part of application Ser. No. 06/936,835 filed Dec. 2, 1986 (now abandoned). BACKGROUND OF THE INVENTION This invention was made with U.S. Government support under Grant NCDDG-CA37606, awarded by the National Cancer Institute. The U.S. Government has certain rights in this invention. FIELD OF THE INVENTION The present invention relates to anti-neoplastic and anti-psoriasis pharmaceutical compositions and methods of treatment and to insecticidal compositions and methods of controlling the growth of insects. In recent years a great deal of attention has been focused on the polyamines, e.g., spermidine, norspermidine, homospermidine, 1,4-diaminobutane (putrescine), and spermine. These studies have been directed largely at the biological properties of the polyamines probably because of the role they play in proliferative processes. It was shown early on that the polyamine levels in dividing cells, e.g., cancer cells, are much higher than in resting cells. See Janne et al, A. Biochim. Biophys. Acta. 473, 241 (1978); Fillingame et al, Proc. Natl. Acad. Sci. U.S.A. 72:4042 (1975); Metcalf et al, J. Am. Chem. Soc. 100:2551 (1978); Flink et al, Nature (London) 253:62 (1975); and Pegg et al, Polyamine Metabolism and Function, Am. J. Cell. Physiol. 243:212-221 (1982). Several lines of evidence indicate that polyamines, particularly spermidine, are required for cell proliferation: (i) they are found in greater amounts in growing than in non-growing tissues; (ii) prokaryotic and eukaryotic routants deficient in polyamine biosynthesis are auxotrophic for polyamines; and (iii) inhibitors specific for polyamine biosynthesis also inhibit cell growth. Despite this evidence, the precise biological role of polyamines in cell proliferation is uncertain. It has been suggested that polyamines, by virtue of their charged nature under physiological conditions and their conformational flexibility, might serve to stabilize macromolecules such as nucleic acids by anion neutralization. See Dkystra et al, Science, 149:48 (1965); Russell et al, Polyamines as Biochemical Markers of Normal and Malignant Growth (Raven, New York, 1978); Hirschfield et al, J. Bacteriol., 101:725 (1970); Morris et al, ibid, p. 731; Whitney et al, ibid, 134:214 (1978); Hafner et al, J. Biol. Chem., 254:12419 (1979); Cohn et al, J. Bacteriol. 134:208 (1978); Pohjatipelto et al, Nature (London), 293:475 (1981); Mamont et al, Biochem. Biophys. Res. Commun. 81:58 (1978); Bloomfield et al, Polyamines in Biology and Medicine (D. R. Morris and L. J. Morton, Eds.--Dekker, New York, 1981) pp. 183-205; Gosule et al, Nature, 259:333 (1976); Gabbay et al, Ann. N.Y. Acad. Sci., 171:810 (1970); Suwalsky et al, J. Mol. Biol., 42:363 (1969) and Liquori et al, J. Mol. Biol., 24:113 (1968). However, regardless of the reason for increased polyamine levels the phenomenon can be and has been exploited in chemotherapy. See Sjoerdsma et al, Butterworths Int. Med. Rev.: Clin. Pharmacol. Ther. 35:287 (1984); Israel et al, J. Med. Chem., 16:1 (1973); Morris et al, Polyamines in Biology and Medicine; Dekker, New York, p. 223 (1981) and Wang et al, Biochem. Biophys. Res. Commun., 94:85 (1980). It is an object of the present invention to provide novel anti-neoplastic, -vital and -retrovital compounds, pharmaceutical compositions and methods of treatment. SUMMARY OF THE INVENTION The foregoing and other objects are realized by the present invention, one embodiment of which is a pharmaceutical composition comprising an anti-neoplastic, anti-vital, anti-retroviral or anti-psoriasis effective amount of a compound, having one of the formulae: ##STR2## Wherein: R 1 and R 6 may be the same or different and are H, alkyl or aralkyl having from 1 to 12 carbon atoms, R 2 -R 5 may be the same or different and are H, R 1 or R 6 ; R 7 is H, alkyl, aryl or aralkyl having from 1 to 12 carbon atoms; m is an integer from 3 to 6, inclusive, n is an integer from 3 to 6, inclusive; and a pharmaceutically acceptable carrier therefor. An additional embodiment of the invention comprises a method of treating a human or non-human animal in need of anti-neoplastic, anti-vital, anti-retroviral or anti-psoriasis therapy comprising administering to the animal an anti-neoplastic, anti-vital, anti-retroviral or anti-psoriasis effective amount of a compound having one of the above formulae. A further embodiment of the invention comprises a compound having the formula: ##STR3## Wherein: R 1 -R 6 may be the same or different and are methyl, propyl, butyl, pentyl, benzyl or β, β, β-trifluoroethyl; m is an integer from 3 to 6, inclusive; n is an integer from 3 to 6, inclusive. A further embodiment of the invention comprises a compound having the formula: R.sub.1 --N.sup.1 H--(CH.sub.2).sub.3 --N.sup.2 H--(CH.sub.2).sub.3 --N.sup.3 H--(CH.sub.2).sub.4 --N.sup.4 H--(CH.sub.2).sub.3 --N.sup.5 H--(CH.sub.2).sub.3 --N.sup.6 H--R.sub.6 (II); Wherein: R 1 and R 6 may be the same or different and are alkyl or aralkyl having from 1 to 12 carbon atoms. A final embodiment of the invention comprises a compound having the formula: ##STR4## Wherein: R 1 and R 6 may be the same or different and are alkyl or aralkyl having from 1 to 12 carbon atoms; R 7 is H, alkyl, aralkyl or aryl having from 1 to 12 carbon atoms; n is an integer from 3 to 6, inclusive. DETAILED DESCRIPTION OF THE INVENTION In compounds of the invention, R 1 and R 6 are preferably methyl, ethyl, propyl, benzyl, etc., it being understood that the term &#34;aralkyl&#34; is intended to embrace any aromatic group the chemical and physical properties of which do not adversely affect the efficacy and safety of the compound for therapeutic applications. Preferred, however, are the hydrocarbyl aralkyl groups, i.e., comprised only of C and H atoms. R 2 -R 5 preferably are H, methyl, ethyl, propyl or benzyl. Compounds of formula (I) are preferably synthesized by first forming a sulfonamide of the polyamine at all of the amino nitrogens (1) to activate the primary amines for monoalkylation, and (2) to protect any secondary nitrogens from alkylation. Suitable sulfonating agents include alkyl, aryl and arylalkyl sulfonating agents of the general structure RSO 2 X wherein R is alkyl, aryl or arylalkyl and X is a leaving group, e.g., Cl -, Br -, etc. The sulfonation is accomplished by reacting the polyamine with 1.0 equivalent of sulfonating agent per nitrogen in the presence of a base, e.g., tertiary amine or a hydroxide. The reaction is best accomplished using aqueous sodium hydroxide as the base and p-toluenesulfonyl chloride (TsCl) as the sulfonating agent in a biphasic solvent system consisting of an organic solvent, e.g., methylene chloride and water. The sulfonating agent is added in methylene chloride to an aqueous solution of the amine and sodium hydroxide and the reaction proceeds according to the following equation, using spermine as the base compound: ##STR5## Wherein: Ts=p-toluenesulfonyl. After purification the sulfonamide is next alkylated. The alkylations involve formation of N-anions on the primary amino sulfonamides with a base such as NaH followed by reaction of the N-anion with an alkylating agent RX wherein R is as defined above and X is a leaving group such as I -, CI -, Br -, p--CH 3 C 6 H 4 SO 3 -, CH 3 SO 3 -. The alkylation can be carried out in a variety of dipolar aprotic solvents, preferably, N, N-dimethylformamide (DMF). The reaction proceeds according to the following equation: ##STR6## After alkylation of the sulfonamide, the sulfonyl protecting groups are next removed under reducing conditions. Although a variety of standard reducing conditions can be utilized (LiAlH 4, Li/NH 3, catalytic reduction), Na and NH 3 function optimally. The reduction proceeds according to the following equation: ##STR7## The compounds are isolated as the free amines and then may be converted to and utilized as the corresponding hydrochloride salts by treatment with concentrated HCl. However, they may also be used as salts with any pharmaceutically acceptable acid, e.g., HBr, CH 3 CO 2 H, CH 3 SO 3 H, etc. Compounds of formula (II) are preferably prepared by the mono-alkylation of tetratosyl spermine at each of the primary nitrogens by reagents such as N-alkyl-N-(3-chloropropyl)-p-toluenesulfonamide. Terminal alkylation of spermine is carried out using the conditions employed for preparing compound (I) according to the following scheme: ##STR8## The alkylating agent is formed by treatment of N-alkyl-p-toluenesulfonamide with excess 1,3 dichloropropane under the aforementioned conditions according to the following scheme: ##STR9## After purification of the dialkylated hexatosylated hexaamine, the sulfonyl protecting groups are removed reductively with sodium in liquid ammonia and THF as follows: ##STR10## The final product is isolated as the free amine and may be converted to the hydrochloride salt. Compounds of formula (III) may be prepared by reacting a tetraamine of formula (I) in which R 2 -R 5 =H and R 1,R 6 =alkyl or aralkyl with two equivalents of an aldehyde R 7 CHO, wherein R 7 =H, alkyl or aralkyl. Specifically, to N 1,N 4 -diethylspermine tetrahydrochloride is added aqueous NaOH and formalin (two equivalents) to generate the bis-hexahydropyrimidine as follows: ##STR11## The invention is illustrated by the following non-limiting examples. EXAMPLE 1 Preparation of N 1,N 4 -diethylspermine N 1,N 2,N 3,N 4 -Tetra-p-tosylspermine To spermine tetrahydrochloride (4.53 g, 13.0 mmol) and 10% aqueous NaOH (200 mL, 132 mmol) at 0° is added dropwise p-toluenesulfonyl chloride (9.98 g, 52.3 mmol) in CH 2 Cl 2 with rapid stirring. After 1 hr the mixture is allowed to warm to room temperature and to stir for 2 days. The organic phase is separated and washed with 0.5 N HCl, H 2 O, and brine, dried over Na 2 SO 4 and purified on silica gel (450 g, 3% MeOH/CHCl 3 ) to give 9.69 g, 91% yield of tetratosylspermine. NMR (CDCl 3 ) δ 7.2-7.9 (m, 16H), 5.34 (t, 2H, J=7), 2.9-3.3 (m, 12H), 2.43 (s, 12H), 1.5-2.0 (m, 8H). N 1,N 4 -Diethyl-N 1,N 2,N 3,N 4 -Tetra-p-tosylspermine To the tetratosylspermine prepared above (1.75 g, 2.14 mmol) in dry DMF (12 mL) was cautiously added 80% sodium hydride (0.25 g, 8.33 mmol) and then ethyl iodide (1.0 mL, 12.5 mmol). After heating under nitrogen (10 h, 55°), the mixture was quenched with ice water and extracted with chloroform (3×). The organic phase was washed with 5% Na 2 SO 3, 5% NaOH, 1N HCl, and water, then dried with Na 2 SO 4. Removal of DMF by flash distillation and purification of the crude product on silica gel (4% EtOH/CHCl 3 ) produced 1.63 g (87%) of the desired product. NMR (CDCl 3 ) δ 7.2-7.8 (m, 16H), 3.03-3.3 (m, 16H), 2.43 (s, 12H),1.5-2.1 (m, 8H), 1.08 (t, 6H, J=7). Anal. Calcd. for C 24 H 58 N 4 O 8 S 4 ; C, 57.64; H, 6.68; N, 6.40. Found: C, 57.69; H, 6.74; N, 6.20. N 1,N 4 -diethylspermine (DES) Into a solution of the N 1,N 4 -diethyl-N 1,N 2,N 3,N 4 -tetratosylspermine prepared above (2.78 g, 3.18 mmoles) in dry, distilled THF (200 mL) at -78° C. was condensed 300 mL NH 3, using a dry ice condenser. Sodium spheres (3.0 g, 0.13 mol) were then added in small portions and the reaction mixture was stirred at -78° C. for 4 h. The reaction mixture was allowed to warm to room temperature overnight and the NH 3 boiled off. Diethyl ether was added to the mixture. Ethanol was then cautiously added, then H 2 O was added to finally quench the reaction. The solvents were evaporated and the product extracted with diethyl ether and then chloroform. The extracts were dried over Na 2 SO 4, filtered and the extracts concentrated. The resultant liquid was distilled in a Kugelrohr apparatus (150° C., 0.1 mm). Concentrated hydrochloric acid was added to an ether/ethanol (1:1) solution of the distillate to form the hydrochloride salt, which was recrystallized from hot aqueous ethanol to give 790 mg (63%) DES. NMR (D 2 O) δ 1.4 (t, 6H); 1.9 (m, 4H); 2.25 (m, 4H); 3.25 (m, 16H); 4.80 (s, HOD, reference). The following protocols were followed to determine the IC 50 values for DES against cultured L1210 cells, Daudi cells and HL-60 cells. Cell Culture Murine L1210 leukemia cells, human Burkitt lymphoma cells (Daudi) and human promyelocytic leukemia cells (HL-60) were maintained in logarithmic growth as suspension cultures in RPMI-1640 medium containing 2% 4-(1-hydroxyethyl)-1-piperazineethanesulfonic acid/3-(N-morpholino)propanesulfonic acid, 100 μM aminoguanidine, and 10% fetal bovine serum. Cells were grown in 25 sq cm tissue culture flasks in a total volume of 10 mL under a humidified 5% CO 2 atmosphere at 37° C. The cells were treated while in logarithmic growth (L1210 cells 0.3×10 5 cells/mL; Daudi and HL-60 1×10 5 cells/mL) with the polyamine derivatives diluted in sterile water and filtered through a 0.2 micron filter immediately prior to use. Following a 48 h incubation with L1210 cells and a 72 h incubation with Daudi or HL-60 cells, L1210 cells were reseeded at 0.3×10 5 cells/mL, Daudi and HL-60 cells were reseeded at 1×10 5 cells/mL and all cells were incubated in the presence of the polyamine derivative for an additional 48 h or 72 h. Cell samples at the indicated time periods were removed for counting. Cell number was determined by electronic particle counting and confirmed periodically with hemocytometer measurements. Cell viability was assessed by trypan blue dye exclusion. The percentage of control growth was determined as follows: ##EQU1## The IC 50 is defined as the concentration of compound necessary to reduce cell growth to 50% of control growth. The results are set forth in Tables 1 and 2. TABLE 1______________________________________L1210 Cells 48 H 96 H IC.sub.50 IC.sub.50______________________________________DES 10 μM 0.10 μM______________________________________ TABLE 2______________________________________ Daudi Cells HL-60 Cells 72 H 144 H 72 H 144 H IC.sub.50 IC.sub.50 IC.sub.50 IC.sub.50______________________________________DES &gt;40 μM 0.5 μM 10 μM 0.3 μM______________________________________ Animal Studies The murine L1210 leukemia cells were maintained in DBA/2J mice. L1210 cells, from a single mouse which was injected i.p. with 10 6 cells 5 days earlier, were harvested and diluted with cold saline so that there were 10 5 or 10 6 cells in 0.25 cc. For each study, mice were injected i.p. with 10 6 L1210 cells or 10 5 L1210 cells (See Table 3) on day 0. The polyamine analogues were diluted in sterile saline within 24 h of use and the unused portion stored at 5° C. DES was administered by i.p. injection 15 mg/kg or 20 mg/kg every 8 h for 3 days (days 1-3), 4 days (days 1-4), or 6 days (days 1-6) (see Table 3). Mice which were treated with saline injections served as controls. The parameter used for treatment evaluation was mean survival time. (Percent increased life span, % ILS). ##EQU2## The murine Lewis lung carcinoma was maintained as s.c. tumor in C57B1/6 mice. The line was propagated every 14 days. A 2-4 mm fragment of s.c. donor tumor was implanted s.c. in the axillary region with a puncture in the inguinal region on day 0. DES was administered by i.p. injection 20 mg/kg every 8 h for 5 days beginning on day 5 (days 5-9). Equal numbers of mice treated with saline injections served as controls. The parameter used for treatment evaluation was mean survival time (% ILS). The parameters of the animal tests and results are set forth below in Tables 3 and 4. TABLE 3__________________________________________________________________________Evaluation of DES in DBA/2JMale Mice with L1210 Leukemia (i.p.)DES Dosing Schedule No. Animals Day of Death Mean Survival SD % ILS__________________________________________________________________________1).sup.a 15 mg/kg q12hr 6 14, 14, 14.5, 15, 14.9 ± 1.3 55 days 1-6 15, 17 Control 7 8.5, 9.5, 9.5, 9.5, 9.6 ± 0.5 0 10, 10, 102).sup.b 20 mg/kg q8hr 4 13.5, 14, 14, 14.5 14.1 ± 0.5 57 days 1-3 Control 4 8.5, 8.5, 9, 10 9.0 ± 0.5 03).sup.b 20 mg/kg q8hr 10 14, 14, 15, 15, 16, 16.7 ± 2.6 90 days 1-4 17, 18, 20, 21, 31 Control 9 8, 8, 9, 9, 9, 9, 9, 8.8 ± 0.4 0 9, 104).sup.a 15 mg/kg q8hr 8 8, 20, 22.5, 24.5 27.8 ± 19.5 302 days 1-6 28.5, 60.sup.d, 60.sup.d, 60.sup.d Control 6 8.5, 9.5, 10, 10, 10.5, 10.5 9.8 ± 0.7 0__________________________________________________________________________.sup.a) Mice injected with 10.sup.5 L1210 cells i.p. on day 0..sup.b) Mice injected with 10.sup.6 L1210 cells i.p. on day 0..sup.c) Death of animal not included in statistics... greater or less than Mean Survival 2x (S.D)..sup.d) Experiment ended at 60 days. Animal survival evaluated on this day, however, these animals were alive with no sign of tumor. TABLE 4______________________________________Evaluation of N.sup.1, N.sup.4 -Di-ethylspermine (DES) inC57Bl/6J Male Mice with Lewis Lung Carcinoma (s.c.)Dose Survival Values (Days)Drug (mg/kg) Schedule Mean ± S.D. % ILS______________________________________DES 20 (i.p.) Every 8 h, 43.7 ± 7.1 24 days 5-9Control -- -- 35.2 ± 2.6 0(Saline)______________________________________ The foregoing test results unequivocally establish the effectiveness of the composition of the invention as an anti-neoplastic agent. EXAMPLE 2 N-Ethyl-N-(3-chloropropyl)-p-toluenesulfonamide. To N-ethyl-p-toluenesulfonamide (5.01 g, 0.0251 mol) in DMF (50 mL) in a dry flask is added sodium hydride (80% in oil, 0.93 g, 0.031 mol). After gas evolution subsides, 1,3-dichloropropane (22.48 g, 0.199 mol ) is added. The mixture is heated at 53° C. for 10 h then cooled and poured into ice water (300 mL), which is extracted twice with ether. The combined extracts are washed with 1% sodium bisulfite, water (3×), and brine. Removal of solvent by rotary evaporation then Kugelrohr distillation gives crude product, which is chromatographed on silica gel (30% hexane/CHCl 3 ) to furnish 2.9 g product (42% ) NMR (CDCl 3 ) δ 1.15 (t, 3H), 1.9-2.2 (m, 2H), 2.44 (s, 3H), 3.11-3.35 (m, 4H), 3.6 (t, 2H), 7.3 (d, 2H), 7.74 (d, 2H). 3,7,11,16,20,24-Hexa(p-toluenesulfonyl) 3,7,11,16,20,24-hexaazahexacosane To tetra(p-toluenesulfonyl) spermine (1.82 g, 2.22 mmol) in dry DMF (10 mL) is added sodium hydride (80% in oil, 0.21 g, 7.0 mmol) and potassium iodide (53 mg, 0.32 mmol ). After 30 minutes, N-ethyl-N-(3-chloropropyl)-p-toluenesulfonamide (2.9 g, 10.5 mmol) in DMF (10 mL) is introduced and the mixture is stirred for 20 h at room temperature then heated at 40°-50° C. for 2 h. The cooled reaction mixture is poured into ice-cold 5% NaOH (100 mL), which is extracted with CHCl 3 (3×). A water wash, then solvent removal (rotovap then Kugelrohr distillation) yields crude hexatosylamide. Silica gel chromatography (1% EtOH/CHCl 3 ) affords 1.73 g of product (60%). NMR δ 1.08 (t, 6H), 1.45-2.10 (m, 12H), 2.34 (s, 10H), 2.96-3.37 (m, 24H), 7.2-7.8 (m, 24H). 1,20-Bis(N-ethylamino)-4,8,13,17-tetraazaeicosane. A solution of the preceding compound (0.79 g, 0.61 mmol) in distilled THF (45 mL) is added to a dry 500 mL 3-necked flask, equipped with a dry ice condenser and 2 stoppers. The solution is cooled to about -40° C., and ammonia gas (200 mL), after passing through NaOH, is condensed. Sodium spheres (0.99, 43 mmol), which are rinsed in hexane (2×) and cut in half, are added cautiously. After maintaining the cold temperature for 4-5 h, ammonia gas is allowed to evaporate under a stream of nitrogen. To the residue at 0° C. is carefully added excess, absolute ethanol, and the mixture is concentrated. Sodium hydroxide (10%, 15 mL) is then added, and extraction with chloroform (10×20 mL), while saturating the aqueous layer with salt, gives crude free amine. Bulb-to-bulb distillation, up to 160° C./0.005 mm, furnishes 0.216 g free hexaamine, which is dissolved in ethanol and treated with 0.5 mL concentrated HCl. After solvent removal, the solid is recrystallized from 17% aqueous ethanol (120 mL) and washed with cold, absolute EtOH (2×3 mL) to afford 0.131 g of crystalline product (35%). 300 MHz NMR (D 2 O) δ 1.31 (t, 6H), 1.74-1.84 (m, 4H), 2.05-2.19 (m, 8H), 3.07-3.25 (m, 24H). Anal. calcd. for C 20 H 54 Cl 6 N 6 : C, 40.62; H, 9.20; N 14.21. Found: C, 40.73; H, 9.22; N, 14.22. EXAMPLE 3 Bis(3-ethyl-1-hexahydropyrimidyl)-1,4-butane. To N 1,N 4 -diethylspermine·4HCl (36.1 mg, 0.0893 mmol) in 0.17 M NaOH (2.0 mL, 0.34 mmol) at 0° is added formalin (15 μL, 0.20 mmol). The solution is stirred at room temperature for 3 h, then 10% NaOH (4 mL) and brine (4 mL) are added. Extraction with CH 2 Cl 2 (4×25 mL) and drying the extracts with Na 2 SO 4 gives crude product. Column chromatography (silica gel, 2% concentrated NH 4 OH/CH 3 OH) furnishes 22 mg (88% yield) of the bis-hexahydropyrimidine. NMR (CDCl 3 ) δ 1.10 (t, 6H), 1.4-1.9 (m, 8H), 2.32-2.65 (m, 16H), 3.15 (s, 4H). EXAMPLE 4 The IC 50 values for several compounds according to the invention were determined as in Example 1 and 2. The results are set forth in Table 5. TABLE 5______________________________________L-1210 Cells [IC.sub.50 ]Compound 48 hrs. 96 hrs.______________________________________Formula I - R.sub.1 = R.sub.6 = methyl 60% CG 0.75 μM m = 3 100 μM n = 4 R.sub.2 = R.sub.3 = R.sub.4 = R.sub.5 = HFormula I - R.sub.1 = R.sub.6 = propyl 3 μM 0.2 μM m = 3 n = 4 R.sub.2 = R.sub.3 = R.sub.4 = R.sub.6 = HFormula I - R.sub.1 = R.sub.2 = R.sub.5 = R.sub.6 = 80% CG 5 μM ethyl R.sub.3 = R.sub.4 = H 25 μM m = 3 n = 4Formula I - R.sub.1 = R.sub.3 = R.sub.4 = R.sub.6 = 100 μM 3 μM ethyl R.sub.2 = R.sub.5 = H m = 3 n = 4Formula II - R.sub.1 = R.sub.6 = ethyl 50 μM 0.5 μM______________________________________ EXAMPLE 5 The % ILS value for various dosages of N 1,N 4 -diethylhomospermine were determined according to the procedure of Examples 1 and 2. The results are set forth in Table 6. TABLE 6______________________________________L1210 i.p. Leukemia in DBA/2J female micegiven 10.sup.5 cells on day 0. MeanDosing # Day of Survival + ILSNo. Schedule Animals Death S.D. (days) (%)______________________________________1. 2.5 mg/kg q8hr 5 20.5, 32 31.5 ± 16.6 242days 1-6 (i.p.) 23, 22, 60.sup.aControl 9.2 ± 0.32. 5 mg/kg q8hr 10 25, 9 × 60.sup.a 56.5 ± 11.1 524days 1-6 (i.p.)Control 9.1 ± 0.63. 10 mg/kg q12hr 6 31, 5 × 60.sup.a 55.2 ± 11.8 441days 1-6 (i.p.)Control 10.2 ± 1.14. 10 mg/kg once 5 12, 17, 20.8 ± 6.1 115daily days 24, 24, 27(1-6 (i.p.)Control 9.3 ± 0.45. 15 mg/kg once 5 21, 27, 45.6 ± 19.8 390daily days 3 × 60.sup.a(i.p.)Control 9.3 ± 0.3______________________________________.sup.a Experiment ended at 60 days. Animal survival evaluated on this day however, these animals were alive with no sign of tumor. Unexpectedly, and for reasons as not yet understood, the compounds of the invention have been found to be effective anti-vital, and most surprisingly, anti-retroviral agents. The development of compounds useful for the prophylaxis and therapy of vital disease has presented more difficult problems than those encountered in the search for drugs effective in disorders produced by other microorganisms. This is primarily because, in contrast to most other infectious agents, viruses are obligate intracellular parasites that require the active participation of the metabolic processes of the invaded cell. Thus, agents that may inhibit or cause the death of viruses are also very likely to injure the host cells that harbor them. Although the search for substances that might be of use in the management of viral infections has been long and intensive, very few agents have been found to have clinical applicability. Indeed, even these have exhibited very narrow activity, limited to one or only a few specific viruses. The retroviruses lave presented an even greater challenge due to their even more complex intracellular metabolic activity. The following examples illustrate the utilization of the compounds of the present invention as anti-retrovirus agents. EXAMPLE 6 Embryonic chicken fibroblasts were grown to near confluence in cell culture media. The fibroblasts were next exposed to avian sarcoma virus for five hours. The cells were next washed with buffer to remove excess virus. The virus infected cells were then treated with 10 μM or 100 μM, N 1,N 4 -diethylspermine, (DES), in culture media for 18 hours. The cell culture media was next removed and the cells were overlaid with soft agar growth media. The cells were then allowed to grow at 37° C. for 6-8 days. The culture plates were evaluated for foci (transformed cells) utilizing an inverted microscope. The results of these measurements are indicated below. TABLE 7______________________________________NUMBER OF FOCI AT 6-DAYS 8-DAYS______________________________________CONTROL (ASV + FIBROBLASTS) 300 300ASV + FIBROBLASTS + 10 μM DES 20 300ASV + FIBROBLASTS + 100 μM DES 0 110______________________________________ In a second experiment the virus was first treated with DES at 10 μM or 100 μM for three hours and then added to the fibroblast monolayer for 18 hours at 37° C. The excess virus was then removed by washing and the monolayer overlaid with soft agar culture media. The plates were allowed to incubate at 37° C. for 8 days and the plates were examined for foci. The results are indicated as follows. TABLE 8______________________________________ NUMBER OF FOCI AT 8 DAYS______________________________________ASV + FIBROBLASTS (CONTROL) 300ASV + FIBROBLASTS + 10 μM DES 200ASV + FIBROBLASTS + 100 μM DES 16______________________________________ Inasmuch as the compounds described herein are anti-proliferation agents, they are also useful as anti-psoriasis agents. The following example illustrates the transdermal penetration characteristics of the compounds of the invention. EXAMPLE 7 Hairless mice were sacrificed by cervical dislocation and their skin removed. The skin was denuded of fatty tissue and stretched over a drug diffusion cell. The diffusion cell contained a phosphate receptor phase at pH 7.4. The donor phase contained the drug DES dissolved in glycine buffer at pH 8.0 at a concentration of 10 mg/mL. Samples of the receptor phase (3 mL) were taken at 48 hours. After each sample was withdrawn, an equal volume of fresh receptor phase was added back. The samples removed from the diffusion cell were assayed for polyamine utilizing a liquid chromatography-C-18 reverse system. The samples were first acidified with perchloric acid and then reacted with dansyl chloride to produce the corresponding dansylated polyamines. The experiment revealed that DES did indeed cross the skin at the dermal barrier. For each of the utilities mentioned herein, the amount required of active agent and the frequency of its administration will vary with the identity of the agent concerned and with the nature and severity of the condition being treated and is of course ultimately at the discretion of the physician or veterinarian. In general, however, a suitable dose of agent will lie in the range of about 1 mg to about 200 mg per kilogram mammal body weight being treated. Administration by the parenteral route (intravenously, intradermally, intraperitoneally, intramuscularly or subcutaneously is preferred for a period of time of from 1 to 20 days. While it is possible for the agents to be administered as the raw substances it is preferable, in view of their potency, to present them as a pharmaceutical formulation. The formulations, both veterinary and for human use, of the present invention comprise the agent, together with one or more acceptable carriers therefor and optionally other therapeutic ingredients. The carrier(s) must be &#34;acceptable&#34; in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof. Desirably, the formulations should not include oxidizing agents and other substances with which the agents are known to be incompatible. The formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. All methods include the step of bringing into association the agent with the carrier which constitutes one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association the agent with the carrier(s) and then, if necessary, dividing the product into unit dosages thereof. Formulations suitable for parenteral administration conveniently comprise sterile aqueous preparations of the agents which are preferably isotonic with the blood of the recipient. Suitable such carrier solutions include phosphate buffered saline, saline, water, lactated ringers or dextrose (5% in water). Such formulations may be conveniently prepared By admixing the agent with water to produce a solution or suspension which is filled into a sterile container and sealed against bacterial contamination. Preferably sterile materials are used under aseptic manufacturing conditions to avoid the need for terminal sterilization. Such formulations may optionally contain one or more additional ingredients among which may be mentioned preservatives, such as methyl hydroxybenzoate, chlorocresol, metacresol, phenol and benzalkonium chloride. Such materials are of especial value when the formulations are presented in multi-dose containers. Buffers may also be included to provide a suitable pH value for the formulation and suitable materials include sodium phosphate and acetate. Sodium chloride or glycerin may be used to render a formulation isotonic with the blood. If desired, the formulation may be filled into the containers under an inert atmosphere such as nitrogen or may contain an antioxidant, and are conveniently presented in unit dose or multidose form, for example, in a sealed ampoule. It will be appreciated that while the agents described herein form acid addition salts and carboxy acid salts the biological activity thereof will reside in the agent itself. These salts may be used in human and in veterinary medicine and presented as pharmaceutical formulations in the manner and in the amounts (calculated as the base) described hereinabove, and it is then preferable that the acid moiety be pharmacologically and pharmaceutically acceptable to the recipient. Examples of such suitable acids include (a) mineral acids: hydrochloric, hydrobromic, phosphoric, metaphosphoric, and sulphuric acids; (b) organic acids: tartaric, acetic, citric, malic, lactic, fumaric, benzoic, glycollic, gluconic, gulonic, succinic and aryl-sulphonic, for example, p-toluenesulphonic acids. Surprisingly, the compounds of the invention have also demonstrated insecticidal properties. The compounds have been found to be particularly effective against mosquitoes. EXAMPLE 8 Mosquito eggs (1,000) were hatched at 25° C. in a cultured media consisting of well water (500 mL), baker&#39;s yeast (200 mg) and liver extract (300 mg). The eggs were maintained under these conditions for 4 to 5 days. The larvae were next transferred to test tubes containing 3 mL of culture media. Each test tube contained 10 mosquito larvae. In each experiment, 23 test tubes, each with 10 mosquitos in it, served as controls. The cidal activity of each of the polyamine analogues against the mosquito larvae was tested at, 1, 3, 10, and 30 ppm. Each compound was tested at each concentration in triplicate again in test tubes containing 10 mosquito larvae in 3 mL of culture media, maintained at 25° C. The control and test larvae were examined for insect death at 24 and 48 hour intervals. Table 9 includes representative examples of the cidal activity of the polyamine analogues against mosquito larvae. The data is reported as the LD 50 values for each compound, i.e., the concentration of polyamine required to kill 50% of the larvae. Furthermore, the data is reported at 48 and 96 hours. TABLE 9______________________________________Compound 48 Hr. LD.sub.50 96 Hr. LD.sub.50______________________________________N.sup.1,N.sup.4 -Diethyl spermine 2 ppm --N.sup.1,N.sup.4 -Diethyl homospermine 7 ppm 5 ppm______________________________________ The insecticidal compounds of the invention may be dissolved or dispersed in any suitable carrier medium adapted for spraying insecticides, e.g., water or other aqueous media and sprayed on an insect infested area or areas subject to potential infestation. The concentration of polyamines applied to an area would depend on the species of insect and its accessibility, however, solutions containing from 10 to 10,000 ppm per gallon broadcast over 100 ft 2.

Summary: A mosquito insecticidal composition and method for controlling the growth of mosquitos employing a mosquito insecticidally effective amount of a compound having one of the formulae: ##STR1## wherein: R 1 and R 6 may be the same or different and are alkyl having from 1 to 12 carbon atoms or hydrocarbyl aralkyl having up to 12 carbon atoms; R 2 -R 5 may be the same or different and are H, R 1 or R 6 ; R 7 is H, alkyl having from 1 to 12 carbon atoms, hydrocarbyl aryl or hydrocarbyl aralkyl each having up to 12 carbon atoms; m is an integer from 3 to 6, inclusive; n is an integer from 3 to 6, inclusive; or (IV) a salt thereof with an acid and a carrier therefor.

big_patent

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Digital Opportunity Investment Trust Act''. SEC. 2. ORGANIZATION. (a) In General.--There is established a nonprofit corporation to be known as the ``Digital Opportunity Investment Trust'' (referred to in this Act as the ``Trust'') which shall not be an agency or establishment of the United States Government. The Trust shall be subject to the provisions of this section, and, to the extent consistent with this section, to the District of Columbia Nonprofit Corporation Act (D.C. Code, section 29-501 et seq.). (b) Funding.-- (1) In general.--There is established in the Treasury a separate fund to be known as the ``Digital Opportunity Investment Trust Fund'' (referred to in this Act as the ``Trust Fund''). The Trust Fund shall contain such amounts as are transferred to the Trust Fund under paragraph (2) and any interest earned on the investment of amounts in the Trust Fund under section 4. (2) Transfer of funds.--The Secretary of the Treasury shall in each fiscal quarter through the last quarter of fiscal year 2028, transfer from the General Fund of the Treasury to the Trust Fund, an amount equal to 30 percent of the proceeds received by the Federal Government during the preceding fiscal quarter from any use (including any auction, sale, fee derived from, or other revenue generated from) of the electromagnetic spectrum conducted under section 309 (or any other section) of the Communications Act of 1934 (47 U.S.C. 309 (j)) (or any other provision of Federal law) after September 30, 2007. (c) Board of Directors; Functions, and Duties.-- (1) Board.-- (A) In general.--A board of directors of the Trust (referred to in this Act as the ``Board'') shall be established to oversee the administration of the Trust. Such Board shall consist of 9 members to be appointed by the President, by and with the advice and consent of the Senate, who-- (i) reflect representation from the public and private sectors; (ii) are not regular full-time employees of the Federal Government; (iii) are eminent in such fields as telecommunications including public television, information technology, labor and workforce development, education, cultural and civic affairs, or the arts and humanities; (iv) shall provide, as nearly as practicable, a broad representation of various regions of the United States, various professions and occupations, and various kinds of talent and experience appropriate to the functions and responsibilities of the Trust; and (v) shall be responsible for establishing the priorities and funding obligations of the Trust. (B) Initial members.--The initial members of the Board shall serve as incorporators of the Trust and shall take whatever actions are necessary to establish the Trust under the District of Columbia Nonprofit Corporation Act (D.C. Code, section 29-501 et seq.). (C) Recommendations.--The Majority Leader of the Senate, the Minority Leader of the Senate, the Speaker of the House of Representatives, and the Minority Leader of the House of Representatives shall jointly submit to the President recommendations of individuals, selected from nominations submitted to Congress from associations representing the fields of science and learning relative to the work of the Board, to serve as members of the Board. (D) Terms of appointment.-- (i) Date.--Members of the Board shall be appointed not later than 90 days after the date of enactment of this Act. (ii) Terms.-- (I) In general.--Except as provided in subclause (II), each member of the Board shall be appointed for a 6-year term with terms set to expire in non- Federal election years. (II) Staggered terms.--With respect to the initial members of the Board-- (aa) 3 members shall serve for a term of 6 years; (bb) 3 members shall serve for a term of 4 years; and (cc) 3 members shall serve for a term of 2 years. (iii) Vacancies.--A vacancy in the membership of the Board shall not affect the Board's powers, and shall be filled in the same manner as the original member was appointed. (E) Chair and vice-chair.-- (i) Selection.--The Board shall select, from among the members of the Board, an individual to serve for a 2-year term as Chair of the Board and an individual to serve for a 2-year term as vice-Chair of the Board. (ii) Consecutive terms.--An individual may not serve for more than 2 consecutive terms as Chair of the Board. (F) Meetings.-- (i) First meeting.--Not later than 30 days after the date on which all of the members of the Board have been confirmed by the Senate, the Chair of the Board shall call the first meeting of the Board. (ii) Quorum.--A majority of the members of the Board shall constitute a quorum, but a lesser number of members may hold hearings. (G) Board personnel matters.-- (i) Compensation.--Members of the Board shall not receive compensation, allowances, or benefits by reason of the members' service on the Board. (ii) Travel expenses.--The members of the Board shall be allowed travel expenses, including per diem in lieu of subsistence, at rates authorized for employees of agencies under subchapter I of chapter 57 of title 5, United States Code, while away from their homes or regular places of business in the performance of services for the Board. (H) Solicitation of advice.--The Board from time to time may solicit advice from-- (i) the Secretary of Health and Human Services; (ii) the Secretary of Commerce; (iii) the Secretary of Education; (iv) the Secretary of Agriculture; (v) the Secretary of Defense; (vi) the Secretary of Energy; (vii) the Secretary of Homeland Security; (viii) the Secretary of the Interior; (ix) the Secretary of Labor; (x) the Administrator of the National Aeronautics and Space Administration; (xi) the Director of the National Security Agency; (xii) the Director of the National Science Foundation; (xiii) the Director of the Office of Science and Technology Policy; (xiv) the Director of the National Endowment for the Arts; (xv) the Director of the National Endowment for the Humanities; (xvi) the Director of the Institute of Museum and Library Services; (xvii) the Librarian of Congress; and (xviii) the President and Chief Executive Officer of the Corporation for Public Broadcasting. (2) Director.--A majority of the members of the Board shall select a Director of the Trust who shall serve at the discretion of the Board and shall be responsible for instituting procedures to carry out the policies and priorities established by the Board, and for hiring all personnel of the Trust. The rate of compensation of the Director and personnel shall be fixed by the Board. (d) Trust Fund Uses.-- (1) Uses of funds.--To achieve the objectives of this Act, the Director of the Trust, after consultation with the Board, may use Trust funds-- (A) to support the digitization of collections and other significant holdings of the nation's universities, museums, libraries, public television stations, and other cultural institutions; (B) to support basic and applied research, including demonstrations of innovative learning and assessment systems as well as the components and tools needed to create them; (C) to use the research results developed under subparagraph (B) to create prototype applications designed to meet learning objectives in a variety of subject areas and designed for learners with many different educational needs, including-- (i) strengthening instruction in reading, science, mathematics, history, and the arts in elementary and secondary schools, community colleges, and other colleges and universities; (ii) providing the training needed for people now in the workplace to advance in a constantly changing work environment; and (iii) developing new applications for life- long learning in non-traditional learning environments such as libraries, museums, senior and community centers, and public television and radio; (D) to conduct assessments of legal, regulatory, and other issues that must be resolved to ensure rapid development and use of advanced learning technologies; and (E) to coordinate and disseminate information about initiatives throughout the Federal Government that focus on uses of technology in education and learning. (2) Contracts and grants.-- (A) In general.--In order to carry out the activities described in paragraph (1), the Director of the Trust, with the agreement of a majority of the members of the Board, may award contracts and grants to nonprofit public institutions (with or without private partners) and for-profit organizations and individuals. (B) Public domain.-- (i) In general.--The research and development properties and materials associated with a project in which a majority of the funding used to carry out the project is from a grant or contract under this Act shall be freely and nonexclusively available to the general public. (ii) Exemption.--The Director of the Trust may exempt specific projects from the requirement of clause (i) if the Director of the Trust and a majority of the members of the Board determine that the general public will benefit significantly in the long run due to the project not being freely and nonexclusively available to the general public. (C) Evaluation of proposals.--To the extent practicable, proposals for such contracts or grants shall be evaluated on the basis of comparative merit by panels of experts who represent diverse interests and perspectives, and who are appointed by the Director of the Trust from recommendations from the fields served and the Board of Directors. (3) Cooperation.--The Director of the Trust, after consultation with the Board, may cooperate with business, industry, philanthropy, noncommercial education broadcast, television and radio licensees and permittees, and local and national public service institutions, including in activities that seek to enhance the work of such public service institutions by seeking new ways to put telecommunications and information technologies to work in their areas of interest. SEC. 3. ACCOUNTABILITY AND REPORTING. (a) Report.-- (1) In general.--Not later than April 30 of each year, the Director of the Trust shall prepare a report for the preceding fiscal year that contains the information described in paragraph (2). (2) Contents.--A report under paragraph (1) shall include-- (A) a comprehensive and detailed report of the Trust's operations, activities, financial condition, and accomplishments, and such recommendations as the Director of the Trust determines appropriate; and (B) a comprehensive and detailed inventory of funds distributed from the Trust Fund during the fiscal year for which the report is being prepared. (3) Statement of the board.--Each report under paragraph (1) shall include a statement from the Board containing-- (A) a clear description of the plans and priorities of the Board for the subsequent 5-year period for expenditures from the Trust Fund; and (B) an estimate of the funds that will be available for such expenditures from the Trust Fund. (4) Submission to the president and congress.--A report under this subsection shall be submitted to the President and the appropriate committees of Congress. (b) Testimony.--The Chair of the Board, other members of the Board, and the Director and principal officers of the Trust shall testify before the appropriate committees of Congress, upon request of such committees, with respect to-- (1) a report prepared under subsection (a)(1); and (2) any other matter that such committees may determine appropriate. SEC. 4. INVESTMENT OF TRUST FUNDS. (a) In General.--The Secretary of the Treasury, after consultation with the Board, shall invest the funds of the Trust Fund in interest- bearing obligations of the United States or in obligations guaranteed as to both principal and interest by the United States. (b) Expenditures.-- (1) In general.--The Director of the Trust shall not undertake grant or contract activities under this Act until the Trust has received the interest or other proceeds from the investment of the Trust Funds for not less than 1 year's duration. Thereafter, upon Board approval of the annual budget of the Trust, the Director of the Trust may commence such grant or contract activities at the start of each fiscal year. (2) Obligation of funds.-- (A) In general.--Except as provided in subparagraph (B), in awarding grants or contracts or making other expenditures under this Act, the Director of the Trust shall not obligate funds from the Trust that exceed the proceeds received from the investment of the funds in the Trust Fund during the preceding fiscal year. (B) Carry over.--Funds from the Trust Fund that are available for obligation for a fiscal year that are not obligated for such fiscal year shall remain available for obligation for the succeeding fiscal year. SEC. 5. SPECIAL ACCOUNT FOR DISTRIBUTION TO PUBLIC TELEVISION STATIONS. (a) Reservation.--An amount equivalent to 21 percent of the interest derived from the investment proceeds referred to in section 2(b)(2) shall be reserved in a special account within the Trust Fund for distribution on a regular basis to those noncommercial educational television broadcast stations (as defined in section 397(6) of the Communications Act of 1934 (47 U.S.C. 397(6)) that are qualified to receive grants from the Corporation for Public Broadcasting pursuant to section 396(k)(6)(B) of such Act (47 U.S.C. 396(k)(6)(B)) and to the Public Broadcasting Service in partnership with such stations. (b) Responsibility for Distribution.--The Director of the Trust shall-- (1) through a special contract, designate the Corporation for Public Broadcasting as the sole agent responsible for the distribution of funds under this section; and (2) transfer the funds referred to in subsection (a) to the Corporation for Public Broadcasting on a regular basis. (c) Grants.--In making the distribution referred to in subsection (a), the Corporation for Public Broadcasting shall utilize a competitive grant application process that is governed by criteria that ensures that funds are directed to the creation of locally delivered digital education and learning services and ensures that a diversity of licensee types and geographic service areas are adequately served. The Corporation for Public Broadcasting shall develop such criteria in consultation with public television licensees, permitees, and representatives designated by their national organizations.

Title: A bill to provide for the establishment of a Digital Opportunity Investment Trust Summary: Digital Opportunity Investment Trust Act - Establishes the Digital Opportunity Investment Trust, which shall receive 30 percent of the proceeds received by the Federal Government each fiscal year quarter through FY 2028 from any use of the publicly owned electromagnetic spectrum after September 30, 2007. Establishes: (1) a Board to oversee administration of the Trust; and (2) a Director of the Trust. Sets forth authorized Trust uses. Obligates specified amounts for public television stations.

billsum

en

Write a title and summarize: The transcription factor nuclear factor kappa-B (NFκB) is a key regulator of pro-inflammatory and pro-proliferative processes. Accordingly, uncontrolled NFκB activity may contribute to the development of severe diseases when the regulatory system is impaired. Since NFκB can be triggered by a huge variety of inflammatory, pro-and anti-apoptotic stimuli, its activation underlies a complex and tightly regulated signaling network that also includes multi-layered negative feedback mechanisms. Detailed understanding of this complex signaling network is mandatory to identify sensitive parameters that may serve as targets for therapeutic interventions. While many details about canonical and non-canonical NFκB activation have been investigated, less is known about cellular IκBα pools that may tune the cellular NFκB levels. IκBα has so far exclusively been described to exist in two different forms within the cell: stably bound to NFκB or, very transiently, as unbound protein. We created a detailed mathematical model to quantitatively capture and analyze the time-resolved network behavior. By iterative refinement with numerous biological experiments, we yielded a highly identifiable model with superior predictive power which led to the hypothesis of an NFκB-lacking IκBα complex that contains stabilizing IKK subunits. We provide evidence that other but canonical pathways exist that may affect the cellular IκBα status. This additional IκBα: IKKγ complex revealed may serve as storage for the inhibitor to antagonize undesired NFκB activation under physiological and pathophysiological conditions. The nuclear transcription factor κB (NFκB) family consists of five DNA-binding proteins (p65, p50, p52, cRel, RelB) that differentially modulate gene transcription. Since NFκB activation is involved in many cellular processes including inflammation, proliferation, angiogenesis and anti-apoptosis, only transient expression of the responsive genes ensures proper function of living cells [1]. Impairment of the regulatory system may contribute to malignant transformation, invasion and metastasis [2]. Consequently, NFκB controls its own activity by initiating negative feedback mechanisms including transcriptional up-regulation of cellular inhibitors [3], [4]. Two independent pathways have been described to induce NFκB activation. While the non-canonical pathway determines the activity of p50: p52 heterodimers, the more prominent canonical pathway controls activation of p65: p50 subunits. In un-stimulated cells NFκB (p65: p50) resides inactively within the cytosol, bound to its inhibitor IκBα, which covers its nuclear localization signal [5]. Following canonical signal transduction, NFκB activation is triggered via the IκB kinase complex (IKK), which consists of two catalytic subunits, IKKα and IKKβ, as well as the regulatory subunit IKKγ. Site specific phosphorylation of IKKβ mediates downstream phosphorylation of IκBα at two Ser residues, serving as a signal for poly-ubiquitination and proteasomal degradation of the inhibitor. Liberated NFκB subsequently translocates into the nucleus to serve its function as a transcription factor which also – and most importantly – includes induction of negative feedback regulation via IκBα re-synthesis [6]. The network of interaction, however, leading to activation, inhibition or post-activational attenuation of NFκB is very complex and can be influenced by changes in signal transduction as well as through specific modifications of the molecules involved. Since dysregulation of NFκB plays a major role in the development of various diseases, a number of mathematical models have been implemented to analyze the non-linear dynamical behavior of this regulatory network [7], [8]. These models contributed to the analysis of the role of negative feedback loops [9]–[11], the description of the overall input-output behavior of the pathways [12]–[14], the understanding of the integration from multiple input signals [14], [15], as well as to the identification of sensitive parameters [16]. However, the pattern of NFκB-induced gene expression may significantly change depending on the cell type, the intracellular protein-protein interaction and the physiological context. Following this line, previous studies revealed canonical NFκB responses to dramatically change in cells being exposed to DNA-damaging agents, including ultraviolet-B (UVB) radiation. In particular, Interleukin-1 (IL-1) stimulation was shown to protect epithelial cells from death ligand-induced apoptosis via NFκB-dependent up-regulation of anti-apoptotic genes. When co-irradiated with UVB, instead, IL-1 driven and NFκB-dependent repression of anti-apoptotic genes caused enhancement of UVB-induced apoptosis [17]. As a prerequisite, nuclear persistence of NFκB was shown to be facilitated via UVB-induced inactivation of the catalytical subunit of Ser/Thr phosphatase PP2A, causing chronic IKKβ activation and subsequent phosphorylation and proteasomal degradation of resynthesized IκBα. Both modifications in concert were shown to drive the pro-apoptotic properties of a classical non-apoptotic protein [3], [18]. Using a systems biological approach we could show that not only PP2A inactivation but also global translational inhibition appeared to be involved in preventing IκBα recurrence. Above this, translational inhibition was shown to induce IκBα depletion in cells irradiated with UVB alone, indicating both mechanisms to individually mediate UVB-dependent responses [15], [19]. Similar to UVB, co-stimulation of cells with IL-1 and the tyrosine phosphatase inhibitor orthovanadate (OVA) induced tyrosine kinase cSrc-mediated inactivation of PP2A. Again here, chronic phosphorylation of IKKβ and consequently inhibition of IκBα recurrence provided for sustained NFκB activation [18]. In the present study we aimed to understand which additional regulatory mechanisms may exist to prevent unwanted NFκB activation under physiological conditions. We therefore analyzed OVA-dependent IκBα depletion as a tool to identify additional IκBα sources within the cell by iterative model refinement in combination with model inspired experimentation. The extended model predicted alternative non-canonical IκBα-degradation to occur without affecting NFκB activity. Respective experimental design finally revealed a yet unknown IκBα: IKKγ complex to exist, which might serve as a backup for negative feedback regulation of NFκB. Stimulation of cells from the epithelial cell line KB with IL-1 caused canonical degradation of the NFκB inhibitor IκBα via phosphorylation of the upstream kinase IKKβ at Ser177/181. Perfectly in line with the phosphorylation pattern of IKKβ, IκBα was completely degraded 30 min after IL-1 stimulation and became resynthesized after 2 h when phosphorylation of IKKβ started to descent (Fig. 1A). Co-treatment of cells with IL-1+OVA instead accelerated phosphorylation of IKKβ causing early phosphorylation and degradation of IκBα (Fig. 1B, 15 min). Strikingly, re-accumulation of IκBα was completely inhibited under these conditions even though the phosphorylation pattern of IKKβ at later time points (2 h; 4 h) remained largely unchanged compared to IL-1 treated cells (Fig. 1A). This strongly indicated that other OVA-driven mechanisms may superimpose IL-1-mediated canonical IκBα degradation at later time points. In accordance with this assumption we could detect partial, almost linear IκBα depletion at 4–8 h after OVA only treatment, following a much slower kinetics than canonical IL-1-driven IκBα degradation (Fig. 1C). Since IKKβ phosphorylation did not seem to play a major role in delayed OVA-dependent IκBα depletion we next examined whether transcriptional or translational inhibition might be involved. Performing RT-PCR analysis we revealed the IκBα mRNA level to remain completely unchanged, even up to 8 h after OVA treatment, while being up-regulated 1 h after canonical IL-1 treatment, as a positive control (Fig. 2A). Application of the transcription inhibitor actinomycin D (ActD) strongly implied transcriptional alterations not to be involved in OVA-induced IκBα depletion. While OVA treatment alone induced a moderate and incomplete reduction of the IκBα protein (Fig. 2B) but not the respective mRNA (Fig. 2C) over time, transcriptional inhibition by ActD caused pronounced inhibition of both the mRNA and the protein level of IκBα, respectively. Of note, co-application of OVA and ActD further enhanced depletion of IκBα protein without additively affecting the transcription level (compare Fig. 2B + 2C). Results indicated that OVA-induced IκBα depletion is facilitated at the protein level, independent of transcriptional regulation. An analogous IκBα protein pattern was obtained when inhibiting translation by addition of cycloheximide (CHX). While individual treatment with either CHX or OVA caused IκBα reduction over time, co-application of both substances additively enhanced loss of IκBα (Fig. 2D). These data strongly support the concept that OVA-mediated IκBα depletion is independent of translational inhibition but might be caused by activation of upstream signaling pathways apart from canonical NFκB signal transduction. Canonical NFκB activation is well known to involve Ser177/181 phosphorylation of IKKβ, followed by Ser32/36 phosphorylation of IκBα as a prerequisite for its proteasomal degradation. Stepwise documentation of canonical NFκB activation by Western-blot analysis and electro mobility shift assay (EMSA) revealed that OVA-induced IκBα depletion does not follow the canonical pattern. While IL-1-induced total IκBα degradation occurred as a fast process being completed after 15 min, OVA-induced subtotal IκBα depletion followed a much slower kinetics, and did not involve classical IKKβ phosphorylation (Fig. 3A). Illustrating canonical IκBα degradation by addition of the proteasome inhibitor MG132, which stabilizes phosphorylated IκBα, revealed only canonical IL-1 stimulation to cause an IκBα shift, while OVA treatment did not, but still caused IκBα depletion over time (Fig. 3B). Correspondingly, OVA depleted not only IκBα-wt but also the Ser32/36Ala mutant which lacks the IKKβ-dependent phosphorylation sites and can therefore not be degraded in the canonical fashion (Fig. 3C). Interestingly, EMSA revealed no significant nuclear translocation of NFκB to occur upon delayed OVA-induced IκBα depletion (Fig. 3D), indicating other than NFκB-bound IκBα pools to exist within un-stimulated cells. In order to identify this additional IκBα pool we integrated all experimental data into detailed dynamical modeling using ordinary differential equations. Based on our previous NFκB signaling model [15] we generated an extended mathematical model (variant M-1, Fig. 4A). Since OVA-mediated IκBα depletion appeared to be independent of both, transcriptional/translational inhibition and proteasomal degradation, we assumed proteases to be involved in this process. It is known that free as well as NFκB-bound IκBα can be degraded by proteases in a proteasome- as well as in a lysosome-independent manner [20], [21]. To monitor the role of OVA within the entire NFκB signaling network, we also included OVA-dependent Src phosphorylation - which subsequently leads to inactivation of PP2A and chronic IKKβ activation - into the model. This part of the signaling pathway, however, exclusively plays a role at early time points during IL-1 dependent canonical IκBα degradation [18]. Successful parameter fitting was performed based on a huge variety of experimental data comprising multiple stimulations: OVA−, ActD−, ActD+OVA, CHX+OVA-stimulation (Fig. 1–3), IL-1 + OVA-stimulation [18], as well as data describing IκBα depletion upon IL-1−, UVB−, IL-1+UVB−, CHX−, IL-1+UVB+MG132-stimulation collected before [15], [19]. All experimental data could be fitted well (Fig. S1). In particular, the good reproducibility of OVA experiments indicated that addition of an IκBα-degrading protease is sufficient to reproduce OVA-induced IκBα depletion without activating NFκB. The model thereby predicted a pool of free IκBα which is eliminated by a putatively OVA-activated protease, but leaves NFκB-bound IκBα almost unaffected. In the best fit scenario of knock down simulation studies depletion of free IκBα showed major relevance while the depletion of NFκB bound IκBα is negligible (Fig. 4B). Of note, OVA-induced PP2A inactivation is only important in IL-1 stimulated cells and is therefore also irrelevant for OVA only stimulation following a much slower kinetics. Still, the model predictions had to deal with two obstacles: Firstly, due to its immense instability only a very small pool of free IκBα seems to exist within the cell at all [22]. Secondly, proteolytic cleavage of IκBα at least by three major groups of proteases: caspases, calpains and cathepsins could be excluded by the use of specific inhibitors (Fig. 4C). To follow up the model based hypothesis of a stably existing IκBα form that is not bound to NFκB, we immuno-precipitated the NFκB p65 subunit from whole cell lysates and checked the levels of co-precipitated IκBα in un-stimulated versus OVA-treated cells. The amount of IκBα remained largely unchanged, whereas IκBα was absent in cells stimulated with IL-1, due to complete canonical degradation (Fig. 4D). These data strongly supported the assumption that only IκBα which is not bound to NFκB is depleted in an OVA-dependent fashion. To investigate whether depleted IκBα in fact is free or bound to other cellular components but NFκB, we conducted size exclusion chromatography. Indeed, IκBα appeared to exist in at least three different forms in un-stimulated cells. While only a minimal fraction seemed to refer to unbound IκBα eluting at a size of 44 kDa, surprisingly no complex exclusively consisting of IκBα and NFκB (p65: p50) seemed to exist. Instead, complexes of higher molecular weight containing IκBα, p65 and p50 (NFκB) showed up at sizes ranging between 300 kDa and 490 kDa, indicating to incorporate other proteins as well. In addition, different aggregates ranging between 100 kDa and 300 kDa in size appeared which did not contain any NFκB components, implying IκBα to also form complexes with other proteins (Fig. 4E). To investigate whether IKKs might be involved in stabilizing IκBα we knocked down the two catalytic subunits IKKα and IKKβ by RNA interference. While IKKα knock down had no effect on IκBα depletion, knock down of IKKβ seemed to enhance loss of IκBα, implying that binding to IKKβ stabilizes IκBα which is not bound to NFκB (Fig. 4F). The fact that model variant M-1, and a simple extension by adding a second (competing) IκBα complex formation (variant M-2, Fig. S3), respectively, could not fully explain the IKK knock down data (Fig. S2 and S4) argues for an additional IκBα-IKK interaction and calls for a more in depth analysis of the IκBα complexes. To stress whether IKK components play a role in IκBα complex formation we first generated model variant M-3 assuming that IKK is permanently bound to IκBα which lacks NFκB (Fig. 5A). According to the chosen model structure, binding of IKK to IκBα results in the formation of an IκBα: IKK as well as an NFκB: IκBα: IKK complex. As phosphorylated IKK (IKKp) initiates degradation of IκBα, the IKKp containing complexes are highly unstable and dissociate into free IKKp and free NFκB which translocates into the nucleus. The simulation results of this model variant revealed a very good reproducibility of all experimental data including the OVA+IKK knock down experiment (Fig. 5B). When exploring the model predicted steady state levels in the un-stimulated IKK knock down setting (Fig. S5), very low IKK yielded decreased formation of both IKK containing complexes IκBα: IKK and NFκB: IκBα: IKK. As a consequence elevated levels of free and NFκB-bound IκBα (NFκB: IκBα) were predicted. Consequently, constitutive degradation of NFκB: IκBα results in enhanced NFκB activation and further increased levels of free IκBα (Fig. S5A). Starting from these changed steady state levels in the IKK knock down setting - especially taking the increased level of free IκBα into account - the OVA-mediated degradation of IκBα could be reproduced accurately (Fig. S6). In this final model OVA mediated the degradation of an NFκB-free IκBα complex (IκBα: IKK), thus preventing activation of NFκB and IκBα mRNA synthesis (Fig. 5C and Fig. 5D). In summary, the mathematical model based analysis clearly proposes the existence of IKK containing IκBα complexes lacking NFκB, supporting the hypothesis that IKKβ stabilizes “unbound” IκBα. Size exclusion chromatography clearly revealed that the high molecular weight complexes (300–490 kDa) in un-stimulated cells consisted of at least IκBα, NFκB (p65: p50), and all three IKK components IKKα, IKKβ and IKKγ. Most importantly, IKKγ eluted together with IκBα at 100 kDa, perfectly matching the size of a heterodimeric complex (±94 kDa). Of note, additional complexes containing exclusively IKKβ and IKKγ (±140 kDa) but not IKKα appeared to be formed (Fig. 5E). Treatment with OVA for 8 h did not significantly change the composition of the high molecular weight complexes. In contrast, it caused pronounced depletion of IκBα from the IκBα: IKKγ complex, while IKKγ seems to randomly distribute over numerous fractions. This clearly indicates dissociation of this heterodimeric IκBα: IKKγ complex to precede IκBα depletion (Fig. 5F). The existence of an NFκB-lacking IκBα: IKKγ complex as well as the specific depletion of IκBα from this particular complex following OVA treatment was confirmed by co-immunoprecipitation. While in unstimulated cells reasonable amounts of IκBα but no NFκB were shown to bind to IKKγ, the level of IκBα decreased significantly upon treatment of cells with OVA for 8 h. No IκBα was found bound to IKKγ in IL-1 stimulated cells, due to complete canonical degradation (Fig. 5G). This is perfectly in line with simulation results derived from the final model variant M-3 suggesting that degradation of NFκB-free but IKK-bound IκBα is responsible for the partial IκBα depletion in response to OVA. To assess the functional relevance under physiological conditions, we investigated IκBα depletion in response to stimuli being capable to induce both, NFκB activation and apoptotic cell death [23], [24]. Treatment with the death ligands TRAIL and FasL, respectively, exclusively caused canonical IκBα degradation, being indicative by sparing the IκBα super-repressor variant from depletion. In contrast, irradiation of cells with UVB additionally resulted in IκBα depletion independent of the canonical pathway – represented by degradation of both, the endogenous and the super-repressor variant (Fig. 5H). These data strongly support the notion that other but canonical pathways exist that may affect the status of IκBα within the cell. Thus, we have uncovered an additional IκBα complex to exist in un-stimulated cells that might serve as storage to antagonize random or undesired NFκB activation and consequently ensures proper cellular function. In the past decades activation of NFκB has exclusively been attributed to either canonical or non-canonical signal transduction pathways. Both pathways are tightly regulated by a series of phosphorylation and ubiquitination events that cause nuclear translocation of distinct NFκB family members. Canonical signal transduction basically accumulates at two well described protein complexes, namely IKK and NFκB: IκBα. Accordingly, stimulation of cells with the pro-inflammatory cytokine IL-1 causes downstream activation of the IKK complex, in particular the catalytic subunit IKKβ, to mark IκBα for proteasomal degradation. Released NFκB in turn triggers resynthesis of its inhibitor in a negative regulatory feedback loop. Most recently, a number of ubiquitin ligases including TRAF molecules and the lubac complex have additionally been implemented in canonical NFκB activation [25], [26], while de-ubiquitinases like A20 and CYLD serve a well-known function in negative feedback regulation [27], [28]. In the present study we provide evidence that besides the well-known components of canonical NFκB signaling, alternative IκBα containing complexes exist within the cell that might indirectly contribute to NFκB regulation. Short term inhibition of IκBα resynthesis following IL-1+UVB and IL-1+OVA treatment, respectively, is due to abrogation of canonical negative feedback regulation via inhibition of PP2A leading to chronic IKKβ activation [3], [19]. At later time points, however, canonical feedback regulation seems to be superimposed by an IKKβ-independent OVA- driven mechanism that follows a slower kinetics and only causes partial IκBα depletion. A similar observation could previously be made in UVB-irradiated cells, showing slow and subtotal IκBα depletion resulting in only moderate and delayed NFκB activation [3]. In the present study OVA-induced delayed IκBα depletion appeared to follow a pattern different from canonical NFκB activation, because super-repressor variants of IκBα could be depleted as well. This implies IκBα depletion which does not follow the canonical pattern to serve an important, yet unknown function. Although a number of alternative ways to proteolytically cleave IκBα have been described in the literature [20], [21], [29], [30] inhibition of the major cellular protease families, could be ruled out. More recently an alternative proteasome independent mechanism called PIR has been described to enhance IκBα turnover in B-cells, however, PIR resulted in constitutive p50: cRel activation in those cells and may therefore play a different role [21], [31]. Still, integration of an OVA-activated protease into all our mathematical models that is able to deplete IκBα- different from the canonical mechanism - was shown to nicely reproduce the OVA induced IκBα degradation with slow activation kinetics determined by a small rate constant (M-3: kprot = 3. 76e−7 s−1, Table S1). Accordingly, significant degradation of IκBα occurs at later time points (4 h–8 h) and may involve PIR-like mechanisms. Reproducing OVA-induced IκBα depletion without NFκB activation in model variant M-1 predicted high levels, 31%, of free IκBα (0. 041 µM out of 0. 135 µM) to exist within the cell (Table S2), whereas only 10% to 15% of free IκBα is supposed to exist [32], [33]. Remarkably, inclusion of putative NFκB-lacking IκBα complexes nicely scaled down the level of free IκBα to 13% (M-2) and 8% (M-3) respectively which now is in very good accordance to the literature values, matches mathematical models of other groups [11], [22], [34], and could also be verified by size exclusion chromatography. According to previous studies that revealed IKKα and IKKβ to form high molecular complexes that contain IκBα as well as NFκB components [35], [36] model variant M-3 predicted IκBα to form both, stable IκBα: IKK as well as NFκB: IκBα: IKK complexes. With this final model the entire data of numerous experiments could be reproduced with a good fit quality. Finally formation of an IκBα: IKKγ complex could be verified experimentally by gel filtration analysis as well as co-immunoprecipitation. Expanding the scope of our previous model [15] by iterative model refinement revealed new insights into NFκB regulation and allowed to analyze the effect of an in silico knock down of the IKK complex on the OVA-mediated IκBα depletion. The model predicts that knocking down IKKβ enhances the level of an IκBα compound that can be degraded by the proposed protease. In vitro neither IκBα from the high molecular complex nor IKKβ: IKKγ bound IκBα seems to be depleted after OVA treatment. Thus knocking down IKKβ could result in decreased levels of NFκB: IκBα: IKK as well as IκBα: IKKβ: IKKγ and an elevated concentration of the IκBα: IKKγ complex. Due to larger amounts of IκBα: IKKγ, OVA-mediated degradation of this IκBα component would explain why IKKβ knock down enhances OVA-induced IκBα depletion. Additionally, a constant basic IKKβ-mediated IκBα turnover exists in unstimulated cells [19], yielding in continuous NFκB-dependent resynthesis of IκBα. In case of IKKβ knock down, this process is completely abrogated consequently causing subtle loss of IκBα over time exclusively dependent on the individual half life in treated versus untreated cells (see also Fig. 4F). Combining experimental methods and detailed dynamical modeling we could provide strong evidence for the existence of an NFκB-free, IKKγ containing IκBα complex presumably acting as a cellular backup pool to capture randomly released NFκB. Above this, our model introduces an IκBα degradation pathway that is independent from canonical processes but is likely to influence the cellular status of IκBα. Our final mathematical model (M-3) created here is able to reproduce a huge number of datasets comprising various intracellular proteins and a wide range of stimulation experiments to extensively reflect on the whole NFκB signaling network above individual top-down signaling pathways. Thus, our model can be used for further modeling approaches regarding NFκB regulation and may provide predictive potential for sensitive parameters that may serve as therapeutic targets in the future. The human epithelial carcinoma cell line KB (ATCC) was cultured in RPMI 1640,10% FCS. Recombinant human IL-1β (R&D Systems, Wiesbaden, Germany) was applied at 10 ng/ml and Na-Orthovanadate (Sigma, Munich, Germany) at 1 mM. Actinomycin D and cycloheximide (Sigma) were added to cells at 5 µg/ml, respectively. Specific protease inhibitors (Calbiochem, Darmstadt, Germany) were applied at 50 µM for the cathepsin inhibitor CATI-1,1 µM for calpastatin and 20 µM for the pan caspase inhibitor zVAD. Proteasomal inhibition was achieved by addition of 25 µM MG132 (Calbiochem). For Fas/CD95 receptor activation 0. 5 µg/ml of an agonistic antibody (Immunotech, Monrovia, CA, USA) was used. Recombinant human iz-TRAIL protein, N-terminally fused to an isoleucine-zipper motif in order to constitutively build the trimerized active form [37] was kindly provided by Dr. Henning Walczak, Centre for Cell Death, Cancer and Inflammation, UCL, London and added at 100 ng/ml. UVB irradiation (300 J/m2) was performed with TL12 fluorescent bulbs (290–320 nm, Philips). Cells were lysed in lysis buffer (50 mM Hepes, pH 7. 5; 150 mM NaCl; 10% glycerol; 1% Triton-X-100; 1. 5 mM MgCl2; 1 mM EGTA; 100 mM NaF; 10 mM pyrophosphate, 0. 01% NaN3 and Complete protease inhibitor cocktail; Roche, Mannheim, Germany) for 20 min on ice. Endogenous NFκB (p65) or IKKγ were immune-precipitated using specific antibodies (sc-372; sc-8330 Santa Cruz, Heidelberg, Germany) and A/G-plus agarose (Santa Cruz) over night. Precipitates were analyzed by Western-blotting using antibodies against NFκB (F6, sc-8008, Santa Cruz), IκBα (L35A5, Cell Signalling, Beverley, MA, USA) and IKKγ (IMG-324A, Imgenex, San Diego, CA, USA). For WB analysis cells were lysed by addition of hot (95°C) Laemmli buffer. 80 µg protein extracts were subjected to SDS-PAGE and Western-blot analyses using antibodies against IκBα, P-IKKβ-Ser177/181, IKKβ, p50 (L35A5,16A6,2C8, #3035, Cell Signaling), p65 (sc-8008, Santa Cruz), IKKα (556532, BD Biosciences), IKKγ (IMG-324A Imgenex, San Diego, CA, USA), and α-tubulin (DM1A, Neomarkers, Fremont, CA, USA), using West-Pico or West-Dura (Pierce, Thermo Scientific, Rockford, IL, USA) chemiluminescent substrates. Total RNA was extracted from cells using GIT-buffer (4 M guanidinthiocyanate, pH 4. 8; 0. 3 M NaOAc; 1% N-lauroylsarcosine; 0. 2% β-mercaptoethanol) followed by phenol/chloroform extraction utilizing Phase Lock Heavy tubes (Eppendorf AG, Hamburg, Germany). Six µg of total RNA was reverse transcribed with an AMV Reverse Transcriptase kit (Promega, Mannheim, Germany). The following primers were used in a 20 µl reaction utilizing the RedTaq polymerase system (Sigma): GAPDH: F: 5′-GCCTCCTGCACCACCAACTGC-3′; R: 5′-CCCTCCGACGCCTGCTTCAC-3′ IκBα: F: 5′-ACAGGAATTACAGGGTGCAGG-3′; R: 5′-GAGAAACTCCCTGCGATGAG-3′ For ectopic expression of IκBα -S32/36A 6,5×106 cells were transfected with 25 µg of the respective pcDNA3. 1-based construct by electroporation at 1200 µF and 250 V (EasyjecT-plus, Peqlab, Erlangen, Germany) in ice cold RPMI medium w/o FCS. Transfection efficacy ranged between 70 and 80%. 1×105 cells were transfected with 0. 5 pmol/µl siRNA knocking down IKKα: GCAGAAGAUUAUUGAUCUATT or IKKβ: UUCAGAGCUUCGAGAAGAATT (Eurofins MWG, Ebersberg, Germany) using Lipofectamin 2000 (Life Technologies, Darmstadt, Germany) according to the protocol. Cells were analyzed after 72 h. Following stimulation cells were harvested and nuclear proteins extracted as described before [38]. The NFκB consensus oligo nucleotide (sc-2505; Santa Cruz) was end-labeled using [γ32P] ATP and T4 polynucleotide kinase (MBI Fermentas, Ontario, Canada), followed by column-purification (QIAquick Nucleotide Removal Kit, Qiagen, Hilden, Germany). Binding reactions were carried out in a 20 µl volume containing 8 µg nuclear protein extract in 5× binding buffer (20 mM HEPES, pH 7. 5; 50 mM KCl; 2. 5 mM MgCl2; 20% (w/v) ficoll; 1 mM DTT), containing 1 µg poly[dIdC]; 2 µg BSA, and 70. 000 cpm of 32P-labeled NFκB consensus oligo nucleotide for 20 min at RT. Samples were separated on a 4% native PAGE at 150 V for 2. 5 h and detected by autoradiography. Cells were harvested in PBS+0. 01% sodium acide and disrupted by sonication. 10 mg protein extract was fractionated on an agarose bead column (GE, Healthcare, Frankfurt, Germany). Fractionated proteins were precipitated in 50% TCA, washed twice with acetone and applied to SDS-PAGE and subsequent Western-Blot analysis. Proteins of known size (thyroglobulin: 670 kDa, γ-globulin: 158 kDa, ovalbumin: 44 kDa, myoglobin: 17 kDa, cobalamin: 1. 3 kDa) were used as a standard. Western-Blots analyses are presented as mean ± SD of 3 independently performed experiments. Blots were evaluated densitometrically and the results normalized to the maximal measured value. A minimal relative standard deviation of 15% was always assumed. For statistical analysis student' s t-test was performed. The mathematical models created in this study are based on our previous ODE model [15] comprising the following components: IL-1-receptor (IL-1R), IL-1-receptor ligand complex (ILRc), free IκBα (IκBα), NFκB bound IκBα (NFκB: IκBα), nuclear IκBα (IκBαn), nuclear NFκB (NFκBn), IκBα mRNA (IκBαt), IKKβ (IKK), phosphorylated IKKβ (IKKp), Protein phosphatase 2A (PP2A). In our recent models IKK (and IKKp) is perceived as the IKK complex consisting of IKKα, IKKβ and IKKγ instead of IKKβ alone. First of all we extended the basic model [15] by our previously proposed mechanism of OVA prolonging the IL-1 mediated activity of NFκB [18]. OVA treatment causes phosphorylation of the tyrosine kinase cSrc which in turn phosphorylates and thereby inactivates PP2A: Terms adopted from the model of Witt et al. [15] are highlighted in bold font. PP2Ap represents phosphorylated PP2A. Without loss of generality the total amount of the kinase cSrc (SRC) can be assumed to be 1 (cf. an analogous reasoning for IKK in [19]). Considering mass conservation, (1-SRCp (t) ) then represents the Src kinase in its inactive (un-phosphorylated) state. The stimulus OVA is represented by the step function ova (t) having a value of 0 (absent) or 1 (present). The initial concentration of PP2A is set to 1 whereas PP2Ap is set to zero. In order to reach steady state conditions we started stimulation from steady state established after 240 hours of simulation of the un-stimulated system. Based on our recent results we assumed for the observed OVA mediated IκBα degradation the involvement of a protease prot that is activated by OVA. This assumption is included in all of our model variants by adding the following term: In this equation prot represents the active form of the assumed protease and (1-prot (t) ) the inactive state considering mass conservation. The total amount of prot is assumed to be 1 without loss of generality. In model variant M-1 this protease is able to degrade free and NFκB bound IκBα: Degradation of NFκB bound IκBα by the protease in model variant M-1 causes translocation of NFκB into the nucleus followed by the initiation of IκBα mRNA synthesis: The factor kv is used to compensate the different volumes of cytosol and nucleus (see Witt et al. [15]). ActD (t) represents a step function of the inhibitor of transcription actinomycin D (ActD) with a value of 1 (present) or 0 (absent). RNA polymerase II and basal transcription factors are known to be essential for transcription of genes [39], [40] whereas specific transcription factors function as enhancer or repressor. Thus we assumed in M-1 and M-2 a constitutive transcription rate for IκBα mRNA synthesis (ctransc) that is independent of NFκB and is also included in the NFκB model of Hoffmann et al. [9]. Model variant M-1 was fitted to time courses of NFκB, IKKβ -P, IκBα mRNA and/or IκBα respectively gained from the following stimulation experiments: The in silico knock down of IKK is realized by adding a factor named siIKK to the model variant and setting its value to 0. 93 which reduces the initial concentration of IKK to the experimentally determined 7% of IKKβ concentration measured in untreated cells: In all stimulation experiments distinct from the IKKβ knock down experiment the value of siIKK is set to zero. In model variant M-2 we included the proposed IκBα complex IκBα: Comp, consisting of IκBα and components Comp distinct from NFκB: In this model variant, the activated protease prot additionally degrades IκBα from the IκBα complex, IκBα: Comp. Since this complex is part of the measured cellular IκBα concentration the overall IκBα concentration in the model, IκBαobs, becomes: The final model, variant M-3, (Fig. 5A) was designed to investigate the possibility of IKK being part of the proposed IκBα: Comp complex. We therefore extended model variant M-2 by binding reactions of IκBα and IKK or IKKp and removed the component IκBα: Comp. In contrast to M-1 and M-2 we fitted the start concentration of IKK by adding the parameter IKKstart: In addition we assumed that IKK as well as phosphorylated IKK is able to bind IκBα in its free and bound form. In contrast to variants M-1 and M-2 a constitutive IκBα mRNA synthesis (ctransc) in M-3 is not necessarily required to reproduce all experimental data since fitting M-3 without ctransc to experimental data results only in a slight decrease of the fit quality (overall χ2 = 100. 6 compared to 98. 6). Thus parameter ctransc is not included in our final model M-3. This is in line with the models of Lipniacki et al. and Ashall et al. assuming that only nuclear NFκB initiates IκBα mRNA synthesis [11], [41]. Likewise, we did not integrate a constitutive degradation of IκBα in the NFκB: IκBα: IKK complex analogous to constitutive degradation of IκBα in NFκB: IκBα (c6a) since inclusion of this reaction did not improve fit quality. The entire ODE system of each model variant is shown in Text S1, S2, S3. For parameter estimation as well as for solving and analyzing the ordinary differential equation system we used the MATLAB (Mathworks) toolbox PottersWheel [42]. For optimization the χ2 value of the following objective function was minimized by using a trust region approach: The χ2-value depends on the estimated parameter values. Variable y represents the i-th measured value whereas f states the simulated state value at time point i and is dependent on the parameter values p. The factor σi represents the standard deviation. Besides the newly introduced parameters the fitted parameters of the previous model were also included in the parameter estimation with the same parameter boundaries (Table S1). Scaling parameters were included to take the lack of absolute values of the experimental data into account. Fit sequences were applied in the estimation process: the starting value of each parameter in a sequence was thereby calculated as The Factor p represents the fitted parameter value of the currently best fit of the fit sequence (PottersWheel F3 routine) and the variable ε determines the strength of disturbance where ε∼N (0, n). Four subsequent runs were performed with 100 fits each using n = 4,1, 0. 1,0. 01, respectively. In addition we performed an identifiability analysis of the final model M-3, using the top 10% of 300 fits with random starting conditions. Many parameters are well identifiable with a low relative standard Deviation (Table S1). Furthermore for some of the less identifiable parameters, linear or non-linear correlations with other parameters exist which indicate that combinations of these parameters are identifiable (Table S1). All models are provided as PottersWheel model datasets in the supplemental data.

Title: Identification of New IκBα Complexes by an Iterative Experimental and Mathematical Modeling Approach Summary: In unstimulated cells, the transcription factor NFκB resides in the cytosol bound to its inhibitor IκBα. Canonical activation of NFκB by numerous stimuli leads to proteasomal depletion of IκBα, thereby liberating NFκB to translocate into the nucleus to induce transcription of genes leading to proliferation, angiogenesis, metastasis, or chronic inflammation. Consequently, only transient activity needs to be warranted by immediate NFκB-dependent induction of negative regulatory mechanisms, including up-regulation of its inhibitor IκBα. Resynthesized IκBα consequently terminates NFκB activity by binding to its nuclear localization sequence. However, under physiological or pathophysiological conditions, random NFκB activation may occur, which needs to be avoided in order to guarantee proper cellular function. Using detailed dynamical modeling, we have now identified an additional IκBα containing complex to exist in un-stimulated cells which lacks NFκB but includes IKKγ (IκBα: IKKγ complex). This additional IκBα is not depleted from cells in the canonical fashion and may therefore serve as a cellular backup to avoid random NFκB activation.

lay_plos

en

Summarize: By. Lizzie Parry for MailOnline. A baby girl born with a 'back-to-front heart' endured two major operations to keep her alive, the first when she was just three hours old. Chloe Bennett was diagnosed with the congenital heart defect, while still in the womb. At her 20-week scan, her mother Stephanie Bennett was told her baby was suffering transposition of the great arteries (TGA). The potentially life-threatening illness means the major blood vessels in the heart are wired the wrong way, stopping the circulation of oxygen around the body. Baby Chloe Bennett was born with a congenital heart defect known as transposition of the great arteries. The condition means the major blood vessels are wired incorrectly, stopping the circulation of oxygen around the body. At just three hours old Chloe was taken into theatre for her first operation, where doctors inserted a balloon into her heart, helping her to breath. Her mother Stephanie Bennett, right, was told at her 20-week scan that her unborn daughter was suffering the heart defect, and would need major surgery. The 37-year-old was warned her unborn baby's only chance of survival would be surgery, and that she would struggle to breathe once out of the womb. Three hours after she was born, Chloe was taken into theatre for her first operation, designed to keep her breathing. Sixteen days later the newborn endured surgery once more, as surgeons worked to rewire her heart. Mrs Bennett and her husband Charlie, were finally allowed to take their new daughter home seven days after her major open heart surgery, despite warnings she could be in hospital for a month. Mrs Bennett, said: 'I can’t believe we are finally home after everything she has been through. 'At my 20-week scan I found out something was wrong with my baby’s heart. 'They said her heart was wired the wrong way and she wouldn’t be able to breathe on her own when she was born. 'I was so scared for her. In her first 16 days she had four general anesthetics and two major surgeries. 'But just one week after her open heart surgery, I was told I could take her home. 'It’s amazing when you see how well she is doing now, apart from the scar, you would never know what she has been through.' Three hours after Chloe was born on May 30, she underwent her first life-saving surgery, a balloon septostomy, under general anesthetic. Chloe's parents Stephanie and Charlie, then had to wait for 16 days until surgeons were ready to perform the second, life-saving operation on Chloe, rewiring her heart. Mrs Bennett, said: 'At my 20-week scan I found out something was wrong with my baby's heart. I was so scared for her. In her first 16 days she had four general anesthetics and two major surgeries' The mother-of-four, said: 'I only saw her for a number of seconds before she was whisked away from me. 'While I was having a blood transfusion, Chloe had her first surgery. Charlie didn’t know who to be with he was running between us both. 'They put a tube up through her belly button and inflated a balloon in her heart before removing it. 'This makes a hole through her heart which allowed her oxygen and blood to mix to keep her alive until her major surgery.' The family then faced a difficult 16 days waiting for Chloe to have her life-saving operation. Mrs Bennett, said: 'She had all sorts of tubes going into her body and down her throat. 'She was on a drip too to keep her blood and oxygen mixing to keep her alive. 'At one point I counted she had 45 holes in her body all at once. 'Because she was so small, her tiny veins collapsed a lot and so she had to have a cannula going into her head. 'She contracted necrotizing enterocolitis infection too so that put off her surgery date twice.' When Chloe was cleared of the potentially life-threatening infection, a third date was set but doctors warned her parents she might not make it. Mrs Bennett, said: 'Two days before it came Chloe looked terribly ill. 'Her oxygen levels had drastically dropped. I was so worried for her. Just seven days after her second operation, baby Chloe was allowed home to her parents and three older siblings, including sister Lola, pictured. Doctors had warned the family that Chloe could be in hospital for up to three weeks after her second operation. Chloe pictured with her parents Charlie and Stephanie, as well as her older brothers and sister. Mrs Bennett added: 'She is doing really well and her brothers and sister love having her around. She has got a massive scar... But apart from that, you would never be able to tell everything she has been through' 'The doctors knew they couldn’t leave her any longer for her surgery so the next day she had to have it. I was petrified.' On June 15, Chloe was put under general anesthetic to have her heart rewired. Her mother said: 'It was the longest day of my life. It was so scary waiting for her to come out of it. 'Her heart is so tiny it’s amazing how they can operate on something so intricate and no bigger than a small strawberry. 'But the surgeons were amazing and they managed to replug her. And my little Chloe was so tough she pulled through. 'After 48 hours I got to hold her in my arms again.' The family had been warned Chloe would have to stay in hospital for up to three weeks, while she recovered. But just seven days after her open heart surgery, doctors were told she was well enough to go home. Mrs Bennett, said: 'Even adults normally have to stay in hospital for weeks after this type of surgery but amazingly Chloe was strong enough to come home after just seven days. 'It was the best news ever. Now she is doing really well and her brothers and sister love having her around. 'Her stitches have all dissolved now but she has got a massive scar down the size of my index finger. 'But apart from that, you would never be able to tell everything she has been through. 'She never complains and is always smiling, she is the happiest baby.'

Summary: 20-week scan revealed Stephanie Bennett's baby had congenital heart defect. Her unborn child had transposition of the great arteries, causing her major blood vessels to be wired incorrectly, stopping the circulation of oxygen. Chloe Bennett was born on May 30, but struggled to breathe. At three hours old she was taken into theatre for her first operation. 16 days later surgeons performed a life-saving procedure to rewire her heart. Seven days later tiny Chloe was allowed home with her three older siblings. Mrs Bennett, said: 'Apart from her scar you would never know what she has been through... she is the happiest baby'

cnn_dailymail

en

Summarize: Amanda Knox has become engaged to a 27-year-old musician who wrote to her while she was in an Italian prison. The 27-year-old will reportedly marry Colin Sutherland, who Knox has known since middle school. But as their families celebrate in Washington, a legal back and forth continues in Italy as Knox and her co-defendant and ex-boyfriend Raffaele Sollecito fight back against their 2014 re-conviction by an Italian upper court for the murder of British student Meredith Kercher. Engaged! Amanda Knox (right) is reportedly engaged to her childhood friend, musician Colin Sutherland (left) The news of Knox's engagement was first reported in a Seattle Times column on Wednesday. Columnist Jonathan Martin writes that Knox confirmed the engagement to him via email buut said no more. The pair were engaged last week. No date has been set for the nuptials. Before her current love was revealed in September, Knox was known to be living in Seattle with her classical guitarist then-boyfriend James Terrano. A LinkedIn profile for Sutherland once listed his name as Thunderstrike after the Marvel comic-book character - says he studied French at Sarah Lawrence. Sutherland once lived in Brooklyn but has since moved back to Seattle, where he and Knox attended middle school. Sutherland once lived in Brooklyn but has since moved back to Seattle, where he and Knox attended middle school. Here, Knox is pictured with Sutherland in New York during a visit in July. Sealed with a kiss: Sutherland (again seen here with Knox during her visit to New York as they locked lips at Coney Island) and Knox reported were engaged last week. Childhood friend: Sutherland reportedly wrote to Knox as she sat in an Italian prison following her 2009 conviction. The pair have known each other since middle school. She was set to graduate from the University of Washington this past June with a degree in creative writing. She's now working at a Seattle bookstore and as a writer for the West Seattle Herald. Meanwhile, her case is headed back into the Italian courts once again following an initial conviction, an overturning of that conviction followed by her reconviction along with Sollecito. It seems unlikely Knox, who now lives in the U.S, will ever be returned to jail for the crime as she has repeatedly refused to return to Italy. If she is convicted again, Italy is likely to request to extradite her but her longstanding battle to prove her innocence has made her a cause célèbre in the U.S who may ignore political pressure to send her back. Sollecito and Knox were first found guilty of murder in November 2009. The previous man: Knox was last known before Sutherland to be dating classical guitarist James Terrano, who she reportedly lived with in Seattle, Washington. The killers' convictions were later quashed after experts said forensic evidence had been contaminated and they were released. Prosecutors then appealed that finding and the case was re-tried in March 2013. In January last year a court upheld the original verdict, but the pair remained at large as under Italy's legal system, any verdict reached after a second appeal but be ratified by the highest court. Since the last verdict, Sollecito, 30, has stayed in Italy. He was ordered to remain there after being found near the Italian border with Slovenia and Austria hours after being found guilty for the second time. He has since completed a degree in information technology. Back then: Knox was accused along with her then boyfriend Raffaele Sollecito (both at left) of brutally murdering Knox's roommate in Perugia, Italy Meredith Kercher, 21 (right) in 2007. Kercher, 21, was found dead on the floor of her bedroom. Some of her belongings were missing and Knox reported an apparent burglary to police. Detectives concluded the supposed break-in looked staged and Knox became the prime suspect. She then implicated Patrick Lumumba, a bar owner she worked for. The duo were arrested along with Sollecito. Mr Lumumba was later released when evidence pointed to Rudy Guede's involvement. Guede was then accused of committing the murder along with Sollecito and Knox. In October 2008 he was found guilty of sexually assaulting and murdering Kercher. Home for good: While it's highly unlikely that Knox would be extradited no matter what happens in court in March, her ex Raffaele Sollecito must face the music in his home country. Still at risk: Since the last verdict, Sollecito, 30, has stayed in Italy. He was ordered to remain there after being found near the Italian border with Slovenia and Austria hours after being found guilty for the second time. He has since completed a degree in information technology

Summary: Knox was engaged last week to musician Colin Sutherland, who she's known since middle school. No date has been set for the nuptials. Knox's last known boyfriend was also a musician--classical guitarist James Terrano, who she reportedly lived with in Seattle, Washington. The case surrounding the 2007 murder of British national Meredith Kercher is still not over. Knox and her ex and co-defendant Raffaele Sollecito's case will go before an Italian court again this March.

cnn_dailymail

en

Summarize: The ex-wife of a man accused of killing 6-year-old Etan Patz in 1979 testified Monday that she found a torn piece of a missing poster with the boy's image in a shoebox belonging to her husband, years after he told her he had strangled someone in New York. Daisy Rivera said that she came across the shoebox in the 1980s, when they were moving back into her parents' house. She says she noticed the photo of the boy and thought Pedro Hernandez had another child he never told her about. 'He explained to me that child had disappeared within the area where he worked at in New York City,' she said. 'And I asked him, disappeared how?' Daisy River, Pedro Hernandez's ex-wife, testified on Tuesday that he kept a small picture of Etan Patz from his missing poster. She said she found the picture in a shoe box after they moved to New Jersey in the 1980s. Patz disappeared on May 25, 1979 and was never seen again. Hernandez said he strangled the boy and put his body in the trash. He told her that he knew the family and that's why he had the photo. The image was part of Etan's missing poster. Before they were married, Hernandez told her in Spanish that he had strangled a 'gringo muchacho,' which means 'white guy' in English, who had offended him while working in New York, she testified. He didn't want to lie to her and he wanted forgiveness so he told her, she testified. But Hernandez didn't elaborate, and Rivera didn't ask about it, and she didn't tell police, she said. Rivera said Monday she didn't consider whether the photo was linked to the story he told her. Pedro Hernandez's lawyers say that he is mentally ill and that his statements to police that he killed Etan Patz are fiction. Daisy Rivera (pictured in 2012) said Hernandez told her in Spanish that he had strangled a 'gringo muchacho,' which means 'white guy' in English, who had offended him while working in New York. 'I never forgot that face,' she said. Hernandez was a teenage stock clerk at a convenience store a few blocks from where Etan was last seen on his way to school on May 25, 1979. He moved back to New Jersey shortly after and was never considered a suspect until 2012, when a relative called police with a tip. Hernandez confessed to choking the boy and tossing his body with curbside trash. He has since pleaded not guilty. His attorneys say his confession is fiction. The former husband and wife met when Rivera was 16, after Hernandez moved back to New Jersey from New York. They got married after she became pregnant and have two children together, Peter, now 31, and Natalie, now 30. They divorced more than two decades ago and had a contentious relationship, she testified. Hernandez's attorney, Alice Fontier, sought to show that Rivera was making up the story about the photo, because there was no record of her telling authorities about it when she was initially questioned. She also sought to show Rivera was not reliable, because she had been arrested on a charge of deceiving welfare authorities in an unrelated case. The incident was expunged from her record, she testified. Prosecutors have not said whether they have the photo. Etan's body has never been found. His case has stretched decades and continents, and spurred legislation to create better communication among law enforcement agencies to find missing children. The trial is expected to last three months

Summary: Daisy Rivera said she discovered the picture in a shoebox in the 1980s. She testified that Pedro Hernandez had also told her he strangled a 'gringo muchacho' - a white guy' Etan Patz, 6, vanished in 1979 from his Manhattan neighborhood and has never been found. Hernandez claims he strangled the boy and threw his body out with the curbside trash. Defense lawyers say Hernandez is mentally ill and that his confession is 'a fabrication'

cnn_dailymail

en

Summarize: CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 61/676,289, filed on Jul. 26, 2012, and U.S. Provisional Patent Application No. 61/790,719, filed on Mar. 15, 2013, and U.S. Provisional Patent Application No. 61/790,487, filed on Mar. 15, 2013, which are hereby incorporated by reference herein in their entireties, including but not limited to those portions that specifically appear hereinafter, the incorporation by reference being made with the following exception: In the event that any portion of the above-referenced applications is inconsistent with this application, this application supersedes said above-referenced applications. BACKGROUND Advances in technology have provided advances in imaging capabilities for medical use. One area that has enjoyed some of the most beneficial advances is that of endoscopic surgical procedures because of the advances in the components that make up an endoscope. The disclosure relates generally to electromagnetic sensing and sensors related to increasing dynamic range within frames of an enhanced video stream. The features and advantages of the disclosure will be set forth in the description which follows, and in part will be apparent from the description, or may be learned by the practice of the disclosure without undue experimentation. The features and advantages of the disclosure may be realized and obtained by means of the instruments and combinations particularly pointed out in the appended claims. BRIEF DESCRIPTION OF THE DRAWINGS Non-limiting and non-exhaustive implementations of the disclosure are described with reference to the following figures, wherein like reference numerals refer to like parts throughout the various views unless otherwise specified. Advantages of the disclosure will become better understood with regard to the following description and accompanying drawings where: FIG. 1 illustrates an embodiment of a frame sequence pattern in accordance with the principles and teachings of the disclosure; FIG. 2 illustrates an embodiment of a frame sequence pattern in accordance with the principles and teachings of the disclosure; FIG. 3 illustrates an embodiment of a frame sequence pattern in accordance with the principles and teachings of the disclosure; FIG. 4 illustrates an embodiment of a frame sequence pattern in accordance with the principles and teachings of the disclosure; FIG. 5 illustrates a schematic representation of an embodiment of a pixel in accordance with the principles and teaching of the disclosure; FIG. 6 illustrates a schematic representation of an embodiment of a shared pixel configuration in accordance with the principles and teaching of the disclosure; FIG. 7 illustrates a schematic representation of an embodiment of a shared pixel configuration in accordance with the principles and teaching of the disclosure; FIG. 8 illustrates a schematic representation of an embodiment of a pixel array having a plurality of pixels having differing sensitivities in accordance with the principles and teaching of the disclosure; FIG. 9 illustrates a graphical representation of the operation of a pixel array in accordance with the principles and teachings of the disclosure; FIG. 10 illustrates a graphical representation of the operation of a pixel array in accordance with the principles and teachings of the disclosure; FIG. 11 illustrates a graphical representation of the operation of a pixel array in accordance with the principles and teachings of the disclosure; FIG. 12 illustrates a graphical representation of the operation of a pixel array over time in accordance with the principles and teachings of the disclosure; FIG. 13 illustrates a graphical representation of the operation of a pixel array over time in accordance with the principles and teachings of the disclosure; FIG. 14 illustrates a graphical representation of the operation of a pixel array over time in accordance with the principles and teachings of the disclosure; FIG. 15 illustrates a graphical representation of the operation of a pixel array over time in accordance with the principles and teachings of the disclosure; FIG. 16 illustrates a graphical representation of the operation of a pixel array having a plurality of exposure sensitivities over time in accordance with the principles and teachings of the disclosure; FIG. 17 illustrates a flow chart of an embodiment of an image sensor in accordance with the principles and teachings of the disclosure; FIG. 18 illustrates a graphical representation of the exposure response of a sensor having a plurality of pixel sensitivities in accordance to the principles and teaching of the disclosure; FIG. 19 illustrates a graphical representation of fusion weighting on a long exposure signal in accordance to the principles and teaching of the disclosure; FIG. 20 illustrates a graphical representation of an embodiment of a transfer function for data compression in accordance to the principles and teaching of the disclosure; FIG. 21 illustrates a graphical representation of an embodiment for data compression in accordance to the principles and teaching of the disclosure; FIG. 22 illustrates an embodiment of a frame sequence pattern in accordance with the principles and teachings of the disclosure; FIG. 23 illustrates an embodiment of a frame sequence pattern in accordance with the principles and teachings of the disclosure; FIG. 24 illustrates an embodiment of a frame sequence pattern in accordance with the principles and teachings of the disclosure; FIG. 25 illustrates an embodiment of hardware in accordance with the principles and teachings of the disclosure; FIGS. 26A and 26B illustrate an implementation having a plurality of pixel arrays for producing a three dimensional image in accordance with the teachings and principles of the disclosure; FIGS. 27A and 27B illustrate a perspective view and a side view, respectively, of an implementation of an imaging sensor built on a plurality of substrates, wherein a plurality of pixel columns forming the pixel array are located on the first substrate and a plurality of circuit columns are located on a second substrate and showing an electrical connection and communication between one column of pixels to its associated or corresponding column of circuitry; and FIGS. 28A and 28B illustrate a perspective view and a side view, respectively, of an implementation of an imaging sensor having a plurality of pixel arrays for producing a three dimensional image, wherein the plurality of pixel arrays and the image sensor are built on a plurality of substrates. DETAILED DESCRIPTION The disclosure extends to methods, systems, and computer based products for digital imaging that may be primarily suited to medical applications. In the following description of the disclosure, reference may be made to the accompanying drawings, which form a part hereof, and in which is shown by way of illustration specific implementations in which the disclosure may be practiced. It may be understood that other implementations may be utilized and structural changes may be made without departing from the scope of the disclosure. As used herein, an emitter is a device that is capable of generating and emitting electromagnetic pulses. Various embodiments of emitters may be configured to emit pulses and have very specific frequencies or ranges of frequencies from within the entire electromagnetic spectrum. Pulses may comprise wavelengths from the visible and non-visible ranges. An emitter may be cycled on and off to produce a pulse or may produce a pulse with a shutter mechanism. An emitter may have variable power output levels or may be controlled with a secondary device such as an aperture or filter. An emitter may emit broad spectrum or full spectrum electromagnetic radiation that may produce pulses through color filtering or shuttering. An emitter may comprise a plurality of electromagnetic sources that act individually or in concert. Dynamic range (DR) may be one of the most important characteristics of digital camera systems such as those employed in endoscopy or other applications. It governs the ability of the system to capture scenes with broad ranges of luminosity. Too small a DR and details within low light areas of the scene may be lost in the noise when the response of the system may be adjusted to accommodate for the bright areas. Conversely, if the system is adjusted to bring out the low-light detail, information in the bright areas may be lost because the signal exceeds the saturation level. DR may be defined as the ratio between the highest allowed signal, S max, and the lowest resolvable signal. The latter may be conventionally equated to the overall read noise, σ R, which arises from the analog readout process within the sensor: DR = 20 ⁢ ⁢ log 10 ⁡ ( S max σ R ) Normally S max, may be dictated by the charge capacity (i.e., the full-well) of the pixel. Many methods of artificially extending the DR have been invented, which include, e.g., dual exposures within the same frame, multiple frames with different exposures, logarithmic response pixels, dual response pixels and others. Each of them has its own benefits, shortcomings and limitations. In the case of dual exposure methods, the DR extension may be equal to the exposure time ratio (T long /T Short ), therefore: DR = 20 ⁢ ⁢ log 10 ⁡ ( S max σ R · T long T short ) Such extensions of DR may be typically referred to as wide or high dynamic range (WDR, WiDy or HDR). In this system, the illumination of the scene may be provided by virtue of monochromatic fast light pulses, which may be synchronized to the frame captures by the image sensor. Each frame may receive a single wavelength of light or any combination of wavelengths, e.g., three. Since color modulation may be effected frame by frame, the sensor may be monochrome, which has a significant advantage for spatial resolution. The specific method of dual exposure described herein exploits the fact that the array may be monochrome in providing for the most granular and ideal spatial segmentation arrangement possible for two exposures; that of the checkerboard pattern. Ultimately a final video sequence of full color frames at a certain frame rate may be generated. This will inevitably be a lower rate than the capture rate, since different components may be being derived from different captures. Several possible checkerboard embodiments involve strobing each frame with one of three available monochromatic red, green and blue sources. Green information may be more valuable in regards to detail than blue and red, since the luminance perceived by the human eye peaks in the green region of the spectrum. For this reason, the popular Bayer pattern of color filters affords twice as many pixels to the detection of green light than either red or blue. For monochromatic frame sequencing then it may be advantageous to employ a repeating sequence of four frames, with two of the four being green, i.e., G-R-G-B. Green data may also be more important in regards to dynamic range since the rods in the human retina may be more sensitive at low light levels. Therefore, the dual exposure could be applied solely for the green frames. The most basic embodiment may configure half of the pixels to be short exposures on green frames and the other half may be configured as long exposures in the same way for every green frame. Referring now to FIG. 1, there is illustrated an advantageous embodiment that would alternate which particular subset of pixels 101 are configured as long exposures and which are configured as short exposures on successive green frames. This particular embodiment is illustrated in FIG. 1, in which the L and S subscripts indicate long and short exposures, respectively, with respect to green (G), red (R), and blue (B) frames, or other denoted color schemes in other figures. As illustrated in FIGS. 1 and 2, the short exposure pixels are indicated by 103 and the long exposure pixels are indicated by 105. Such an approach may offer an advantage for perceived resolution since the interpolated locations continually swap places with actual pixel samples for a given exposure, from frame to frame. It will be appreciated that other ways of utilizing pulsed monochromatic light sources may be possible. Co-pending U.S. patent application Ser. No. 13/952,518 entitled CONTINUOUS VIDEO IN A LIGHT DEFICIENT ENVIRONMENT is hereby incorporated by this reference into this disclosure as if fully set forth herein. One particularly advantageous way may be to provide pure luminance (Y) information by pulsing the red, green and blue sources at the same with the appropriate pulse energy proportions. The chrominance-red (Cr) and chrominance-blue (Cb) information can be provided on the alternate frames by adding sufficient luminance in each case to make all of the pulse energies positive. The image processing chain can extract the data in a true color space provided it knows the applied proportions. In such a circumstance, the dual exposure may be applied on the luminance frames where it may be most needed, as indicated in FIG. 2. The application of dual exposure sampling may not be limited to the green or luminance frames and should the circumstances in the scene warrant it, another embodiment may also have independent dual exposure ratios applied for the red and blue frames, as illustrated in FIG. 3. FIG. 4 shows the equivalent case for luminance-chrominance light pulsing. FIG. 5 shows a circuit diagram for a conventional unshared pixel 500 having the four transistors necessary to facilitate low-noise, correlated double sampling. There may be five service wires required to operate the pixel 500, as shown. It may be possible to share three of the four transistors between two or more neighboring pixels 500, which increases the available area for the photodiode. As pixel size may be reduced it becomes harder to maintain quantum efficiency since the photodiode occupies a smaller proportion of the area. Sharing may be an approach that may be commonly used by sensor manufacturers, particularly for small pixel devices. Another benefit afforded by transistor sharing may be a reduction in the average number of wires required per pixel. FIG. 6 depicts the unit cell for an array with conventional 2-way vertical sharing. Since three transistors may be shared, there may be five transistors total for two pixels, i.e. 2.5 transistors per pixel. In regards to wire routing, six wires in total may be needed per pixel pair. Four of them may be horizontally routed and two of them may be vertically routed, resulting in two per pixel edge in each dimension. This may be in contrast with the unshared case which has three horizontal and two vertical wires per pixel edge. The approach may be to pair up the pixels horizontally instead of vertically. This may be normally less favorable as regards wire routing simplicity, since the four horizontal wires now may be fit in a single pixel edge. See FIG. 7. There may be two significant benefits however, that outweigh this routing disadvantage. The first benefit may be that only half of the net circuitry may be required to service each column. This helps to reduce the overall chip area since the column circuitry may be a major consumer of chip space. As illustrated in FIG. 8, a single column circuit may serve four columns of pixels instead of two, which would be the case for vertical 2-way sharing. The second benefit may be that horizontal sharing provides two independent TX signals per row. This opens up the possibility of having two independent exposures within a single row, which alternates between odd and even columns, as shown in FIG. 8. The checkerboard arrangement of dual exposures may be made possible now by virtue of switching the TX 1 and TX 2 odd/even column associations, on alternate rows. FIG. 8 indicates how this may be done for one embodiment by inserting a “twist” in the TX 1 /TX 2 routing for every second row. This type of odd-even exposure pattern may be only applicable for the case of monochrome sensors. Color sensors have neighboring pixels with different color filters therefore odd/even exposure modulation would only be effective in changing the white balance and not in increasing the dynamic range. In other embodiments, the switching of the TX 1 /TX 2 assignments from row to row may be accomplished by virtue of two alternating flavors of row driver circuitry at the side of the array, or by crafting the TX 1 /TX 2 routing differently within the odd and even rows. Referring now to FIG. 9, there is depicted the general timing situation for a rolling shutter CMOS sensor with full-frame integration. In the figure, the diagonal lines represent the action of the read and reset pointer as it rolls through the rows of pixels. This period includes the time during which optical black or optically blind (OB) rows 902 (both front and back rows) may be read (e.g., during the read out frame 906 ), blanking time 908 and the time during which any other data that may not be physical pixel data may be issued (e.g., service line time). The philosophy of modulating the light color on a frame-by-frame basis may be so that the sensor may be monochrome and thus have higher resolution than, e.g., a Bayer based equivalent. The penalty may be that multiple frames may be read in order to produce a single full color image. This penalty may be nullified and the frame rate restored, however, if the sensor is able to be read out correspondingly faster. FIGS. 10 and 11 illustrate the timing for two alternative ways in which multiple sets of pixels in an array may integrate different degrees of light. The exposure modulation may be effected by virtue of two global TX pulses, GlobalTX 1 and GlobalTX 2. They effectively create two global shutters when combined with the light pulse edge(s). At the end of the integration period, the rolling pointer provides another TX pulse in order to transfer the signal for readout. For descriptive purposes, the case of two sets of pixels of different exposures in the checkerboard pattern (as described above), will mainly be emphasized. It should be noted however, that the scope of this disclosure is intended to cover cases with higher numbers of pixel types (i.e., exposures) and with alternative physical pixel type arrangements. The spatial pattern depends on the number of pixel sets, the pixel layout, the pixel array arrangement and the pixel array connections to the peripheral circuitry. To avoid confusion the rolling TX signals may be referred to here as TX 1 and TX 2, whereas the global TX signals may be called GlobalTX 1 and GlobalTX 2. Global pulses affect all attached pixels in the array at the same time. The non-global pulses may be applied via the rolling pointer. Those knowledgeable of CMOS image sensors should note that this method of global shutter does not suffer from the problems associated with global shutter when used with continuous illumination. In that case, the signals may be stored on the leaky floating diffusion nodes for significant periods of time, whereas for the two methods described herein with pulsed illumination, the benefit may be taken of the photodiode to store the photosignal. Note that pixels may be held in reset as long as their transfer (TX) and reset (RST) transistors may be held on (i.e., the high state in the Figures). In that state any current in the photodiode may be drained off to the supply. The integration period starts when the TX transistor turns off (low in the Figures). Now referring to FIG. 10, all pixels may be held in reset mode and may be therefore flushed, when GlobalTX 1, GlobalTX 2 and GlobalRST may be all high. When GlobalTX 2 goes low, all pixels in the array attached to TX 2 start to integrate. When the P 2 light pulse occurs, its corresponding photocharge may be integrated by the TX 2 pixels. However, because the GlobalRST and GlobalTX 1 signals may be still high, any photocharge created by the P 2 pulse in the TX 1 pixels may be just drained off. When GlobalTX 1 goes low, the TX 1 pixels start to integrate. At that point, the TX 2 pixels will have fully integrated the P 2 pulse and the TX 1 pixels, nothing. When the P 1 light pulse occurs, it may be integrated by both the TX 1 and the TX 2 pixels. Therefore at the end of the sequence, the TX 1 pixels will have a net photocharge resulting from only the P 1 light pulses whereas the TX 2 pixels will have integrated both light pulses. FIG. 11 may be a similar timing diagram, for an alternative dual illumination embodiment. Instead of instigating 2 separate discrete light pulses, a single light pulse stays on during the period that both TX transistors may be turned off. The integrated light may be proportional to the time between the TX falling edge and the light pulse falling edge, therefore different pixel responses may be achieved by staggering the GlobalTX 1 and GlobalTX 2 falling edges. For the example shown, the TX 1 pixels integrate ˜⅓ of the light generated by the light pulse whereas the TX 2 pixels integrate ˜⅔ of the total pulse energy. In a further embodiment, the dual illumination can be achieved with a mixture of the FIG. 10 and FIG. 11 timings. The GlobalTX 2 signal would return to its low state before the rising edge of the single light pulse, which would make the TX 2 pixels integrate the whole energy of the light pulse. The dual exposure in this case may be achieved by the different timings described with respect to FIGS. 10 and 11, where a greater number of illuminations can be achieved by increasing the number of light pulses during the same blanking time. FIG. 12 shows the internal timing of an embodiment of a minimal area custom sensor, for the purpose of endoscopic imaging in the presence of controlled, pulsed illumination. Each frame period may comprise four distinct phases, which may be optimized for monochrome light pulsing and multiple pixel illuminations. During phases 1 and 3, data may be issued from the sensor, which may be not signal samples from physical pixels. Rather they may be data concerned with the synchronization of the chip to the camera system and for data locking. These “service line” periods may also be used for internal and external monitoring and for the encoding of certain types of non-pixel data within the line. Such internal monitoring may include the sensor temperature, plus certain voltages and currents. External monitoring may include hand-piece button activity or, e.g., data from measurements of the angle of the endoscope. Phase 2 may be concerned with the sensor rolling readout (internal timing and synchronization) while phase 4 may be for the purpose of sensor configuration. During the configuration phase, the sensor output data lines may be reversed to accept incoming configuration commands. Therefore the camera controller may be synchronized to the phase 4 period. Phase 4 also doubles as the global shutter phase during which the operations depicted in FIGS. 10 and 11 may be performed. For this reason, phase 4 may be also synchronized with the light pulsing system. Note that the pulse widths and timing of the global signals (GlobalTX 1, GlobalTX 2 and GlobalRST) may be fully programmable and that phase 4 may be the only phase with variable length. This enables the available pulse time to be tuned in order to match the available light power, given the type of frame it is. Individual wavelength sources may vary significantly, e.g., in regards to maximum available light power, quantum efficiency and response time. What may be important may be that the final frame rate may be a suitable multiple of the average capture rate. Beyond that, any variation within the repeating pattern of frame types can be taken care of by the appropriate buffering within the image signal processing chain (ISP). FIG. 13 illustrates an example of a 4-frame cycle with four different frame lengths and the four different blanking times accepting four maximum-allowed light modulations. FIG. 14 shows the timing diagram for the frame sequence illustrated in FIG. 2, which may be based upon the Y-Cb-Y-Cr pattern. All three sources may be fired during the luminance frames, i.e. frames # 1 and # 3. Frames # 2 and # 4 may be able to provide the Cb and Cr information respectively with a single wavelength pulse, by virtue of a critically tuned admixture of luminance. Another approach to dynamic range enhancement may be provided by spatial binning of signals. An additional advantage of having a monochrome sensor may be that neighboring pixels may be binned together. Binning enables a greater reach of signal and thus greater DR, at the expense of spatial resolution. Precisely where the binning takes place, dictates the effectiveness of binning in extending the DR. Take for example binning of two adjacent pixels, (2-way binning). If the binning may be done in the digital domain, an additional factor 2 (6 dB) of signal may be realized. However there may be two analog samples, each contributing an equal amount of read noise which amounts to a factor √{square root over (2)} (3 dB) of noise enhancement. Therefore the binning of data from two pixels at a point later in the chain than the source of read-noise amounts to 3 dB of additional DR. However, if the binning may be performed in the charge domain, i.e., at the pixel level as described earlier, then the additional DR that may be realized may be 6 dB, since the addition of readout noise occurs after the summation of signal. The 2-way shared architecture described earlier provides for just such a means of 2-way binning in the charge domain. Simultaneous pulsing of the TX 1 and TX 2 signals results in both photo-signals being transferred to the shared floating diffusion at the same time. When each row may be subsequently read out, it has twice the charge range with the same noise, as compared to the un-binned case, and therefore 6 dB of extra DR. An embodiment may comprise dual exposure control. The key to optimal, effective operation of this type of dynamic range (DR) enhancement (i.e., dual exposure) may be continuous control over the exposure time ratio. In particular: first there should be no dynamic range extension at all, if the scene does not demand it, i.e., if the dynamic range of the scene may be below the intrinsic dynamic range of the pixel. Second, if the dynamic range of the scene may be greater than the pixel, the amount of added dynamic range should be just sufficient to provide for it with minimal margin. The reason for this may be that artificial dynamic range extension always comes at a price. For the method described in this disclosure, there may be a spatial resolution cost, which increases on a sliding scale with increasing exposure ratio. In the limit of maximal exposure ratio, the vast majority of the useful image content, for either high or low luminosity scene regions, comes from only one of the exposures. At that extreme, the resolution asymptotically approaches the equivalent of having 1/√{square root over (2)} times the number of pixels in x and y and then up-scaling by interpolation. At the other extreme, when the ratio may be unity, there may be no DR extension and no penalty. Generally, digital cameras that experience randomly varying illumination scenarios, such as camcorders, incorporate a means of continually adjusting the sensor operation conditions so as to always make the best use of the available DR. This process may be known as auto-exposure. There may be typically several variables that may be adjusted according to a pre-defined table, including, e.g., integration time (shutter), analog gain, digital gain, aperture etc. FIG. 15 is an example of a hypothetical table for a system that incorporates shutter time, analog gain and digital gain. The lighting itself may be normally beyond the control of the camera with the exception of flash illumination used for still capture. This disclosure may be specifically concerned with a camera system that has full control over the amount of pulsed red, green and blue illumination, frame by frame, for continuous video capture. In the case of such a pulsed illumination system, the scene illuminance may be under the control of the camera or imaging device. Therefore the overall light pulse energy effectively takes the place of the shutter. Since more photosignal results in higher SNR, the light energy may be increased until the desired digital signal level may be reached within the ISP chain, for a chosen percentile of the distribution of a selected central region of pixels. The analog gain may be held at its minimum setting which can be considered to be the gain at which the bottom of the distribution of pixel signal capacity (full well), may be just above the upper rail of the ADC, (with some contingency for sensor to sensor variation). The maximum light pulse energy may be limited by the duration of the available portion of the frame and by the maximum electromagnetic energy provided, e.g., by laser diode or LED current. Only when that limit may be reached may be any gain applied. For the R-G-B-G pulse sequence case, the best overall SNR may be obtained by monitoring and controlling the three frame types independently, (so as to maximize all photon fluxes) and attenuating two of the colors digitally in the ISP for white balance purposes. An alternative approach to white balance may be to modulate the relative R, G and B pulse energies. This approach has lower final signal over noise ratio (SNR), but it still eliminates the need for any digital white balance gains that may be greater than unity, which would enhance the perception of noise. For controlling the exposure time ratio (and thus the extent of the DR extension), WDR statistics may be gathered independently for the two flavors of pixel present in the checkerboard pattern. This may be optionally done independently for the red, green and blue frames too. Two corresponding histograms of black-corrected signal for a region of the image may be constructed. One of the histograms may be used, as mentioned earlier, to control the pulse energy level by comparing a chosen percentile (P L ) of the distribution to a target signal level (S L, e.g. 50% of the digital DR). The exposure time of these type- 1 pixels, T L may be held at maximum. The subscript L here denotes the long exposure. The other histogram may be used to monitor the DR of the scene by comparing another chosen percentile of the distribution, P S, where P S &gt;P L, and comparing that with a different signal level, S S, where S S &gt;S L. The subscript S denotes the short exposure. S S may be generally tuned close to the top of the digital DR. If P S &lt;S S, the exposure time for these type- 2 pixels, T S, may be also held at maximum. If P S &gt;S S, then T S may be lowered until P S =S S. See FIG. 16. There may be a predefined limit (E) as to how much the exposure time ratio may be allowed to increase, since at a certain point, the image quality degradation due to DR enhancement outweighs the benefit. The values of P L, P S, S L, S S and E may be tuned differently according to different applications and stored as factory presets. The exposure times T L and T S may be recorded for each frame type, for use by the WDR fusion process (discussed further below) and by the color fusion ISP stage. In the case that the red, green and blue pulse energies may be modulated for the purpose of white balance, the exposure times on the red and blue frames may be governed by the green frames which may be exclusively used to gather the WDR statistics. For the Y-Cb-Y-Cr illumination the three relative pulse energies may be held constant for a particular frame type. The WDR control may be applied for the luminance frames as a baseline with the option of also applying WDR independently on the chrominance frames. The histograms may be constructed on the raw black-corrected frame data as for the R-G-B-G scheme. Again the exposure times for each frame type may be recorded for WDR fusion and for color fusion. An embodiment may comprise wide dynamic range data being proceeded in the ISP. FIG. 17 shows the basic ISP arrangement for checkerboard WDR with the Y-Cb-Y-Cr pulsing scheme. It may be important that the WDR fusion comes after the dark frame subtraction so that the mean black offset has been adjusted to zero and the data may be signed. It may be also highly desirable to have had the FPN removed. The aim of the fusion process may be to combine for each frame, the data for the two separate exposures into single images, prior to color fusion. The first step involves separating the two components of the checkerboard pattern into two separate buffers and filling in the gaps by interpolation. There may be only one general kernel required since every empty pixel sees the same local environment, (except for pixels near the edges of the image). A suitable convolution kernel for filling in the checkerboard pattern by simple linear interpolation is: ( 0 1 4 0 1 4 0 1 4 0 1 4 0 ) Following interpolation there may be two samples for each pixel location. FIG. 18 shows the illuminance—signal relations for an exposure ratio of 4 which would yield 12 dB of additional DR. A gain may be applied to the short exposure sample, which may be equal to the exposure-time ratio, T L /T S. This requires the addition of one extra bit for each factor 2 of ratio. The fusion itself involves making a weighted sum of the two samples: x f = γ · ( T L T S ) · x S + ( 1 - γ ) ⁢ x L Where x S and x L may be the (signed) short and long exposure signals respectively. The γ factor may be a function of the long exposure signal, x L, and may be set according to two thresholds, τ 1 and τ 2. Below x L =τ 1, γ=0.0, above γ=τ 2, γ=1.0. Between the thresholds, various functional forms may be employed. See FIG. 19 in which linear and cubic example behaviors of γ between τ 1 and τ 2, may be drawn. The value of τ 2 may be set to the maximum possible value of x L, e.g., or something just below it. The purpose of the lower threshold, τ 1, may be to limit the influence of read noise from the short sample which has the gain factor T L /T S applied to it. It can be set to a conservatively high constant, to accommodate the maximum ratio E, but it may be more beneficial to have it vary linearly with T L /T S ; τ 1 = ( T L T S ) · η Following the stitching process, the image data occupies a greater number of bits of digital dynamic range than the original long and short samples did, therefore it needs to have its bit count reduced back to the ISP pipeline width prior to the next stage. If ISP pipeline width may be n bits, the fused image has m bits where (m−n) may be the base-2 logarithm of the exposure time ratio, rounded up to the next integer. The data may be first linearly scaled such that the maximum possible value maps to exactly 2 m −1. This can be accomplished e.g. by provision of a look-up table of multipliers, for the set of allowed exposure time ratios that lie between 1 and 2, to get to the next exact power of 2. This approach assumes the progression of allowed exposure time ratios within each power of 2-interval, may be always the same. To return to n bits, a piece-wise linear transfer function may be applied which emphasizes the data at the low end, see FIG. 20. This prevents interesting information at the low end being lost through compression. Alternatively, a smooth logarithmic transfer function can be applied to the data using a pre-defined look up table, similar to the gamma function. For this option the look up table needs to have sufficient entries to cover the maximum fused linear bit count (m max ). The fused data, already scaled to an exact power of 2 (i.e. m), would be further up-shifted to m max bits before applying the LUT. A simpler, albeit less versatile overall approach to fusion and compression, may be to divide the final DR into 2 sections, for example the bottom 60% and the top 40%, and to map the long and short samples respectively, linearly into them. In the input domain, the crossover would e.g. occur at the maximum value of X L. See FIG. 21. The provision of 2 or more exposure periods within the same frame within a pulsed illumination endoscopy system may also be exploited for the purpose of reducing the number of captured frames per final full-color image, from three to two. This has an obvious benefit for suppressing possible color motion artifacts that may be associated with such a system. For the monochromatic pulsing approach, red and blue data may be combined in the same frame, while providing a full resolution frame of green pixels as shown in FIG. 22. This may be accomplished by virtue of changing the light content at the same time that the short exposure pixels start to integrate their signal. See FIG. 23. This limits the available dynamic range for chrominance, but DR may be not as important for color information as it may be for luminance since the cone receptors in the human retina may be far less sensitive than the rods. It also has the consequence of reducing the spatial resolution for chrominance but that also may be not an issue since the eye has greater resolution for luminance and chrominance may be usually spatially filtered within ISPs to reduce noise. In fact WDR can be exercised for the luminance frames at the same time that the exposure time duality may be used to combine the other two channels in a single frame. An inherent property of the monochrome WDR array may be that the pixels that have the long integration time may be integrate a superset of the light seen by the short integration time pixels. For regular WiDy operation in the luminance frames, that may be desirable. For the chrominance frames it means that the pulsing may be controlled in conjunction with the exposure periods so as to e.g. provide λY+Cb from the start of the long exposure and switch to δY+Cr at the point that the short pixels may be turned on (both pixel types have their charges transferred at the same time). λ and δ may be two tunable factors that may be used to bring all pulse energies to positive values. During color reconstruction in the ISP, the two flavors of pixel would be separated into two buffers. The empty pixels would be filled in using e.g. linear interpolation. At this point, one buffer would contain a full image of δY+Cr data and the other; δY+Cr+λY+Cb. The δY+Cr buffer would be subtracted from the second buffer to give λY+Cb. Then the appropriate proportion of luminance data from the Y frames would be subtracted out for each. FIG. 24 depicts the timing of the light pulses with respect to the relevant sensor timing for the combined chrominance frame. Here, the proportion of mixed luminance may be critically tuned to reduce each chrominance situation to a single wavelength solution. Implementations of the disclosure may comprise or utilize a special purpose or general-purpose computer including computer hardware, such as, for example, one or more processors and system memory, as discussed in greater detail below. Implementations within the scope of the disclosure may also include physical and other computer-readable media for carrying or storing computer-executable instructions and/or data structures. Such computer-readable media can be any available media that can be accessed by a general purpose or special purpose computer system. Computer-readable media that store computer-executable instructions may be computer storage media (devices). Computer-readable media that carry computer-executable instructions may be transmission media. Thus, by way of example, and not limitation, implementations of the disclosure can comprise at least two distinctly different kinds of computer-readable media: computer storage media (devices) and transmission media. Computer storage media (devices) includes RAM, ROM, EEPROM, CD-ROM, solid state drives (“SSDs”) (e.g., based on RAM), Flash memory, phase-change memory (“PCM”), other types of memory, other optical disk storage, magnetic disk storage or other magnetic storage devices, or any other medium which can be used to store desired program code means in the form of computer-executable instructions or data structures and which can be accessed by a general purpose or special purpose computer. A “network” may be defined as one or more data links that enable the transport of electronic data between computer systems and/or modules and/or other electronic devices. In an implementation, a sensor and camera control unit may be networked in order to communicate with each other, and other components, connected over the network to which they may be connected. When information is transferred or provided over a network or another communications connection (either hardwired, wireless, or a combination of hardwired or wireless) to a computer, the computer properly views the connection as a transmission medium. Transmissions media can include a network and/or data links which can be used to carry desired program code means in the form of computer-executable instructions or data structures and which can be accessed by a general purpose or special purpose computer. Combinations of the above should also be included within the scope of computer-readable media. Further, upon reaching various computer system components, program code means in the form of computer-executable instructions or data structures that can be transferred automatically from transmission media to computer storage media (devices) (or vice versa). For example, computer-executable instructions or data structures received over a network or data link can be buffered in RAM within a network interface module (e.g., a “NIC”), and then eventually transferred to computer system RAM and/or to less volatile computer storage media (devices) at a computer system. RAM can also include solid state drives (SSDs or PCIx based real time memory tiered Storage, such as FusionIO). Thus, it should be understood that computer storage media (devices) can be included in computer system components that also (or even primarily) utilize transmission media. Computer-executable instructions comprise, for example, instructions and data which, when executed at a processor, cause a general purpose computer, special purpose computer, or special purpose processing device to perform a certain function or group of functions. The computer executable instructions may be, for example, binaries, intermediate format instructions such as assembly language, or even source code. Although the subject matter has been described in language specific to structural features and/or methodological acts, it is to be understood that the subject matter defined in the appended claims is not necessarily limited to the described features or acts described above. Rather, the described features and acts may be disclosed as example forms of implementing the claims. Those skilled in the art will appreciate that the disclosure may be practiced in network computing environments with many types of computer system configurations, including, personal computers, desktop computers, laptop computers, message processors, control units, camera control units, hand-held devices, hand pieces, multi-processor systems, microprocessor-based or programmable consumer electronics, network PCs, minicomputers, mainframe computers, mobile telephones, PDAs, tablets, pagers, routers, switches, various storage devices, and the like. It should be noted that any of the above mentioned computing devices may be provided by or located within a brick and mortar location. The disclosure may also be practiced in distributed system environments where local and remote computer systems, which may be linked (either by hardwired data links, wireless data links, or by a combination of hardwired and wireless data links) through a network, both perform tasks. In a distributed system environment, program modules may be located in both local and remote memory storage devices. Further, where appropriate, functions described herein can be performed in one or more of: hardware, software, firmware, digital components, or analog components. For example, one or more application specific integrated circuits (ASICs) or field programmable gate arrays can be programmed to carry out one or more of the systems and procedures described herein. Certain terms may be used throughout the following description and Claims to refer to particular system components. As one skilled in the art will appreciate, components may be referred to by different names. This document does not intend to distinguish between components that differ in name, but not function. FIG. 25 is a block diagram illustrating an example computing device 100. Computing device 100 may be used to perform various procedures, such as those discussed herein. Computing device 100 can function as a server, a client, or any other computing entity. Computing device can perform various monitoring functions as discussed herein, and can execute one or more application programs, such as the application programs described herein. Computing device 100 can be any of a wide variety of computing devices, such as a desktop computer, a notebook computer, a server computer, a handheld computer, camera control unit, tablet computer and the like. Computing device 100 includes one or more processor(s) 102, one or more memory device(s) 104, one or more interface(s) 106, one or more mass storage device(s) 108, one or more Input/Output (I/O) device(s) 110, and a display device 130 all of which may be coupled to a bus 112. Processor(s) 102 include one or more processors or controllers that execute instructions stored in memory device(s) 104 and/or mass storage device(s) 108. Processor(s) 102 may also include various types of computer-readable media, such as cache memory. Memory device(s) 104 include various computer-readable media, such as volatile memory (e.g., random access memory (RAM) 114 ) and/or nonvolatile memory (e.g., read-only memory (ROM) 116 ). Memory device(s) 104 may also include rewritable ROM, such as Flash memory. Mass storage device(s) 108 include various computer readable media, such as magnetic tapes, magnetic disks, optical disks, solid-state memory (e.g., Flash memory), and so forth. As shown in FIG. 25, a particular mass storage device is a hard disk drive 124. Various drives may also be included in mass storage device(s) 108 to enable reading from and/or writing to the various computer readable media. Mass storage device(s) 108 include removable media 126 and/or non-removable media. I/O device(s) 110 include various devices that allow data and/or other information to be input to or retrieved from computing device 100. Example I/O device(s) 110 include digital imaging devices, electromagnetic sensors and emitters, cursor control devices, keyboards, keypads, microphones, monitors or other display devices, speakers, printers, network interface cards, modems, lenses, CCDs or other image capture devices, and the like. Display device 130 includes any type of device capable of displaying information to one or more users of computing device 100. Examples of display device 130 include a monitor, display terminal, video projection device, and the like. Interface(s) 106 include various interfaces that allow computing device 100 to interact with other systems, devices, or computing environments. Example interface(s) 106 may include any number of different network interfaces 120, such as interfaces to local area networks (LANs), wide area networks (WANs), wireless networks, and the Internet. Other interface(s) include user interface 118 and peripheral device interface 122. The interface(s) 106 may also include one or more user interface elements 118. The interface(s) 106 may also include one or more peripheral interfaces such as interfaces for printers, pointing devices (mice, track pad, etc.), keyboards, and the like. Bus 112 allows processor(s) 102, memory device(s) 104, interface(s) 106, mass storage device(s) 108, and I/O device(s) 110 to communicate with one another, as well as other devices or components coupled to bus 112. Bus 112 represents one or more of several types of bus structures, such as a system bus, PCI bus, IEEE 1394 bus, USB bus, and so forth. For purposes of illustration, programs and other executable program components may be shown herein as discrete blocks, although it is understood that such programs and components may reside at various times in different storage components of computing device 100, and may be executed by processor(s) 102. Alternatively, the systems and procedures described herein can be implemented in hardware, or a combination of hardware, software, and/or firmware. For example, one or more application specific integrated circuits (ASICs) can be programmed to carry out one or more of the systems and procedures described herein. FIGS. 26A and 26B illustrate a perspective view and a side view, respectively, of an implementation of a monolithic sensor 2900 having a plurality of pixel arrays for producing a three dimensional image in accordance with the teachings and principles of the disclosure. Such an implementation may be desirable for three dimensional image capture, wherein the two pixel arrays 2902 and 2904 may be offset during use. In another implementation, a first pixel array 2902 and a second pixel array 2904 may be dedicated to receiving a predetermined range of wave lengths of electromagnetic radiation, wherein the first pixel array is dedicated to a different range of wave length electromagnetic radiation than the second pixel array. FIGS. 27A and 27B illustrate a perspective view and a side view, respectively, of an implementation of an imaging sensor 3000 built on a plurality of substrates. As illustrated, a plurality of pixel columns 3004 forming the pixel array are located on the first substrate 3002 and a plurality of circuit columns 3008 are located on a second substrate 3006. Also illustrated in the figure are the electrical connection and communication between one column of pixels to its associated or corresponding column of circuitry. In one implementation, an image sensor, which might otherwise be manufactured with its pixel array and supporting circuitry on a single, monolithic substrate/chip, may have the pixel array separated from all or a majority of the supporting circuitry. The disclosure may use at least two substrates/chips, which will be stacked together using three-dimensional stacking technology. The first 3002 of the two substrates/chips may be processed using an image CMOS process. The first substrate/chip 3002 may be comprised either of a pixel array exclusively or a pixel array surrounded by limited circuitry. The second or subsequent substrate/chip 3006 may be processed using any process, and does not have to be from an image CMOS process. The second substrate/chip 3006 may be, but is not limited to, a highly dense digital process in order to integrate a variety and number of functions in a very limited space or area on the substrate/chip, or a mixed-mode or analog process in order to integrate for example precise analog functions, or a RF process in order to implement wireless capability, or MEMS (Micro-Electro-Mechanical Systems) in order to integrate MEMS devices. The image CMOS substrate/chip 3002 may be stacked with the second or subsequent substrate/chip 3006 using any three-dimensional technique. The second substrate/chip 3006 may support most, or a majority, of the circuitry that would have otherwise been implemented in the first image CMOS chip 3002 (if implemented on a monolithic substrate/chip) as peripheral circuits and therefore have increased the overall system area while keeping the pixel array size constant and optimized to the fullest extent possible. The electrical connection between the two substrates/chips may be done through interconnects 3003 and 3005, which may be wirebonds, bump and/or TSV (Through Silicon Via). FIGS. 28A and 28B illustrate a perspective view and a side view, respectively, of an implementation of an imaging sensor 3100 having a plurality of pixel arrays for producing a three dimensional image. The three dimensional image sensor may be built on a plurality of substrates and may comprise the plurality of pixel arrays and other associated circuitry, wherein a plurality of pixel columns 3104 a forming the first pixel array and a plurality of pixel columns 3104 b forming a second pixel array are located on respective substrates 3102 a and 3102 b, respectively, and a plurality of circuit columns 3108 a and 3108 b are located on a separate substrate 3106. Also illustrated are the electrical connections and communications between columns of pixels to associated or corresponding column of circuitry. It will be appreciated that the teachings and principles of the disclosure may be used in a reusable device platform, a limited use device platform, a re-posable use device platform, or a single-use/disposable device platform without departing from the scope of the disclosure. It will be appreciated that in a re-usable device platform an end-user is responsible for cleaning and sterilization of the device. In a limited use device platform the device can be used for some specified amount of times before becoming inoperable. Typical new device is delivered sterile with additional uses requiring the end-user to clean and sterilize before additional uses. In a re-posable use device platform a third-party may reprocess the device (e.g., cleans, packages and sterilizes) a single-use device for additional uses at a lower cost than a new unit. In a single-use/disposable device platform a device is provided sterile to the operating room and used only once before being disposed of. Additionally, the teachings and principles of the disclosure may include any and all wavelengths of electromagnetic energy, including the visible and non-visible spectrums, such as infrared (IR), ultraviolet (UV), and X-ray. It will be appreciated that various features disclosed herein provide significant advantages and advancements in the art. The following embodiments may be exemplary of some of those features. In the foregoing Detailed Description of the Disclosure, various features of the disclosure may be grouped together in a single embodiment for the purpose of streamlining the disclosure. This method of disclosure is not to be interpreted as reflecting an intention that the claimed disclosure requires more features than may be expressly recited in each claim. Rather, inventive aspects lie in less than all features of a single foregoing disclosed embodiment. It is to be understood that the above-described arrangements may be only illustrative of the application of the principles of the disclosure. Numerous modifications and alternative arrangements may be devised by those skilled in the art without departing from the spirit and scope of the disclosure and the appended claims may be intended to cover such modifications and arrangements. Thus, while the disclosure has been shown in the drawings and described above with particularity and detail, it will be apparent to those of ordinary skill in the art that numerous modifications, including, but not limited to, variations in size, materials, shape, form, function and manner of operation, assembly and use may be made without departing from the principles and concepts set forth herein. Further, where appropriate, functions described herein can be performed in one or more of: hardware, software, firmware, digital components, or analog components. For example, one or more application specific integrated circuits (ASICs) can be programmed to carry out one or more of the systems and procedures described herein. Certain terms may be used throughout the following description and Claims to refer to particular system components. As one skilled in the art will appreciate, components may be referred to by different names. This document does not intend to distinguish between components that differ in name, but not function. The foregoing description has been presented for the purposes of illustration and description. It is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. Many modifications and variations may be possible in light of the above teaching. Further, it should be noted that any or all of the aforementioned alternate implementations may be used in any combination desired to form additional hybrid implementations of the disclosure. Further, although specific implementations of the disclosure have been described and illustrated, the disclosure is not to be limited to the specific forms or arrangements of parts so described and illustrated. The scope of the disclosure is to be defined by the claims appended hereto, any future claims submitted here and in different applications, and their equivalents.

Summary: A digital imaging method for use with an endoscope in ambient light deficient environments is disclosed. In an implementation, the method may include illuminating the environment with pulsed electromagnetic radiation and sensing differing exposures of reflected electromagnetic radiation with a pixel array of an image sensor. The method may further include receiving image data from the pixel array that corresponds to the differing exposures. The method may include creating exposed frames from the image data, where each frame corresponds with a different exposure. The method may further include emitting pulses of electromagnetic radiation during a blanking period. The method may further include creating a display frame from the exposed frames. The method may further include creating a stream of images by sequentially combining display frames taken using the differing exposures to provide increased dynamic range.

big_patent

en

Summarize: No Federal Entity Is Responsible for Expansion and Oversight of High- Containment Laboratories The number of biosafety level (BSL)-3 and BSL-4 laboratories (high- containment laboratories) began to rise in the late 1990s, accelerating after the anthrax attacks throughout the United States. The laboratories expanded across federal, state, academic, and private sectors. Information about their number, location, activities, and ownership is available for high-containment laboratories registered with CDC’s Division of Select Agent and Toxins (DSAT) or the U.S. Department of Agriculture’s (USDA) Animal and Plant Health Inspection Service (APHIS) as part of the Federal Select Agent Program. These entities register laboratories that work with select agents that have specific potential human, animal, or plant health risks. Other high-containment laboratories work with other pathogens that may also be dangerous but are not identified as “select agents” and therefore these laboratories are not required to register with DSAT or APHIS. We reported in 2009 that information about these non-select agent laboratories is not known. Our work has found that expansion of high-containment laboratories was not based on a government-wide coordinated strategy. The expansion was based on the perceptions of individual agencies about the capacity required for their individual missions and the high-containment laboratory activities needed to meet those missions, as well as the availability of congressionally approved funding. Decisions to fund the construction of high-containment laboratories were made by multiple federal agencies (e.g., Department of Health and Human Services (HHS), Department of Defense, USDA), in multiple budget cycles. Federal and state agencies, academia, and the private sector (such as drug companies) considered their individual requirements, but as we have previously reported a robust assessment of national needs was lacking. Since each agency or organization has a different mission, an assessment of needs, by definition, was at the discretion of the agency or organization. We have not found any national research agenda linking all these agencies, even at the federal level, that would allow for a national needs assessment, strategic plan, or coordinated oversight. As we last reported in 2013, after more than 12 years, we have not been able to find any detailed projections based on a government-wide strategic evaluation of research requirements based on public health or national security needs. Without this information, there is little assurance of having facilities with the right capacity to meet our national needs. This deficiency may be more critical today than 5 years ago when we first reported on this concern because current budget constraints make prioritization essential. National Standards for Designing, Constructing, Commissioning, Operating, and Maintaining High- Containment Laboratories Are Needed Our work on this issue has found a continued lack of national standards for designing, constructing, commissioning, and operating high- containment laboratories. These laboratories are expensive to build, operate, and maintain. For example, we noted in our 2009 report that the absence of national standards means that the laboratories may vary from place to place because of differences in local building requirements or standards for safe operations. In 2007, while investigating a power outage at one of its recently constructed BSL-4 laboratory, CDC determined that construction workers digging at an adjacent site had some time earlier cut a critical grounding cable buried outside the building. CDC facility managers had not noticed that cutting the grounding cable had compromised the electrical system of the facility that housed the BSL-4 laboratory. It became apparent that the building’s integrity as it related to the adjacent construction had not been adequately supervised. In 2009, CDC officials told us that standard procedures under local building codes did not require monitoring of the new BSL-4 facility’s electrical grounding. This incident highlighted the risk of relying on local building codes to ensure the safety of high-containment laboratories in the absence of national standards or testing procedures specific to those laboratories. Some guidance exists about designing, constructing, and operating high- containment laboratories. The Biosafety in Microbiological and Biomedical Laboratories guidance, often referred to as BMBL recommends various design, construction and operations standards, but our work has found it is not universally followed. of whether the suggested design, construction, and operations standards are achieved. As we have recommended, national standards would be valuable for not only new laboratory construction but also periodic upgrades. Such standards need not be constrained in a “one-size fits all” model but could help specify the levels of facility performance that should be achieved. Risks Associated with Expanding High- Containment Laboratories and Oversight Challenges Department of Health and Human Services (Washington, D.C., 2007), Biosafety in Microbiological and Biomedical Laboratories, 5th ed. HHS has developed and provided biosafety guidelines outlined in this manual. developed by the funding or regulatory agencies. In 2013, we reported that another challenge of this fragmented oversight is the potential duplication and overlap of inspection activities in the regulation of high- containment laboratories. We recommended that CDC and APHIS work with the internal inspectors for Department of Defense and Department of Homeland Security to coordinate inspections and ensure the application of consistent inspection standards. According to most experts that we have spoken to in the course of our work, a baseline risk is associated with any high-containment laboratory. Although technology and improved scientific practice guidance have reduced the risk in high-containment laboratories, the risk is not zero (as illustrated by the recent incidents and others during the past decade). According to CDC officials, the risks from accidental exposure or release can never be completely eliminated and even laboratories within sophisticated biological research programs—including those most extensively regulated—has and will continue to have safety failures. Many experts agree that as the number of high-containment laboratories has increased, so the overall risk of an accidental or deliberate release of a dangerous pathogen will also increase. Oversight is critical in improving biosafety and ensuring that high- containment laboratories comply with regulations. However, our work has found that aspects of the current oversight programs provided by DSAT and APHIS depend on entities’ monitoring themselves and reporting incidents to the regulators. For example, with respect to a certification that a select agent had been rendered sterile (that is, noninfectious), DSAT officials told us, citing the June 2014 updated guidance, that “the burden of validating non-viability and non-functionality remains on the individual or entity possessing the select agent, toxin, or regulated nucleic acid.” While DSAT does not approve each entity’s scientific procedure, DSAT strongly recommends that “an entity maintain information on file in support of the method used for rendering a select agent non-viable... so that the entity is able to demonstrate that the agent... is no longer subject to the select agent regulations.” Biosafety select agent regulations and oversight critically rely on laboratories promptly reporting any incidents that may expose employees or the public to infectious pathogens. Although laboratories have been reasonably conscientious about reporting such incidents, there is evidence that not all have been reported promptly. The June 2014 Incident at the CDC Laboratories and GAO’s Preliminary Observation The June 2014 incident in which live anthrax bacteria were transferred from a BSL-3 contained environment to lower-level (BSL-2) containment laboratories at CDC in Atlanta resulted in the potential exposure of tens of workers to the highly virulent Ames strain of anthrax. According to CDC’s report, on June 5, a laboratory scientist in the BSL-3 Bioterrorism Rapid Response and Advanced Technology (BRRAT) laboratory prepared protein extracts from eight bacterial select agents, including Bacillus anthracis, under high-containment (BSL-3) conditions.were being prepared for analysis by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, a relatively new technology that can be used for rapid bacterial species identification. Also, according to CDC officials that we spoke to this protein extraction procedure was being evaluated in a preliminary assessment of whether MALDI-TOF mass spectrometry could provide a cheaper and faster way to detect a range of pathogenic agents, including anthrax, compared to conventional methods and thus could be used by emergency response laboratories. According to CDC officials, the researchers intended to use the data collected in this experiment to submit a joint proposal to CDC’s Office of Public Health Preparedness and Response to fund further evaluation of the MALDI TOF method These samples because MALDI TOF is increasingly being used by clinical and hospital laboratories for infectious disease diagnostics. The protein extraction procedure was chemically based and intended to render the pathogens noninfectious, which alternative extraction procedures would have done using heat, radiation, or other chemical treatments that took longer. The procedure that was used to extract the proteins was not based on a standard operating procedure that had been documented as appropriate for all the pathogens in the experiment and reviewed by more senior scientific or management officials. Rather, the scientists used a procedure identified by the MALDI TOF equipment manufacturer that had not been tested for effectiveness, in particular, for rendering spore-forming organisms such as anthrax noninfectious. Following that procedure, the eight pathogens were exposed to chemical treatment for 10 minutes and then plated (spread on plates to test for sterility or noninfectious status) and incubated for 24 hours. According to CDC, on June 6, when no growth was observed on sterility plates after 24 hours, the remaining samples, which had been held in the chemical solution for 24 hours, were moved to CDC BSL-2 laboratories for testing using the MALDI TOF technology. Importantly, the plates containing the original sterility samples were left in the incubation chamber rather than destroyed as would normally occur because of technical problems with the autoclave that would have been used for destruction. According to CDC officials, on June 13, a laboratory scientist in the BRRAT laboratory observed unexpected growth on the anthrax sterility plate, possibly indicating that the sample was still infectious. (All the other pathogen protein samples showed no evidence of growth.) That scientist and a colleague immediately reported the discovery to the CDC Select Agent Responsible Official (RO) in accordance with the BRRAT Laboratory Incident Response Plan. That report triggered a response that immediately recovered the samples that had been sent to the BSL-2 laboratories and returned them to BSL-3 containment, and a response effort that lasted a number of days was implemented to identify any CDC employees who might have been affected by exposure to live anthrax spores. (The details of the subsequent actions and CDC’s lessons learned and proposed actions are described in CDC’s July 11, 2014, Report on Potential Exposure to Anthrax. That report indicates that none of the potentially affected employees experienced anthrax-related adverse medical symptoms.) Our preliminary analysis indicates that the BRRAT laboratory was using a MALDI-TOF MS method that had been designed for protein extraction but not for the inactivation of pathogens and that it did not have a standard operating procedure (SOP) or protocol on inactivation. We did not find a complete set of SOPs for removing agents from a BSL-3 laboratory in a safe manner. Further, neither the preparing (BRRAT BSL-3) laboratory nor the receiving laboratory (BRRAT BSL-2) laboratory conducted sterility testing. Moreover, the BRRAT laboratory did not have a kill curve based on multiple concentration levels. When we visited CDC on July 8, it became apparent to us, that a major cause of this incident was the implementation of an experiment to prepare protein extractions for testing using the MALDI TOF technology that was not based on a validated standard operating procedure. acknowledged that significant and relevant studies in the scientific literature about chemical procedures studied for preparing protein samples for use in the MALDI TOF technology, were successful in rendering tested pathogens noninfectious, except for anthrax. The literature clearly recommends an additional filtering step before concluding that the anthrax samples are not infectious. Our preliminary work indicates that this step was not followed for all the materials in this incident. Validating a procedure or method provides a defined level of statistical confidence in the results of the procedure or method. staff did not perform sterility testing on the suspension received in March 2004. CDC’s 2004 report further stated that “Research laboratory workers should assume that all inactivated B. anthracis suspension materials are infectious until inactivation is adequately confirmed [using BSL-2 laboratory procedures].” These recommendations are relevant to the June 2014 incident in Atlanta but were not followed. The laboratories receiving the protein extractions were BSL-2 laboratories, but the activities associated with testing with the MALDI TOF technology were conducted on open laboratory benches, not using biocontainment cabinets otherwise available in such laboratories. CDC’s July 11, 2014, Report on the Potential Exposure to Anthrax describes a number of actions that CDC plans to take within its responsibilities to avoid another incident like the one in June. However, we continue to believe that a national strategy is warranted that would evaluate the requirements for high-containment laboratories, set and maintain national standards for such laboratories’ construction and operation, and maintain a national strategy for the oversight of laboratories that conduct important research on highly infectious pathogens. This completes my formal statement, Chairman Murphy, Ranking Member DeGette and members of the committee. I am happy to answer any questions you may have. GAO Contact and Staff Acknowledgments For future contacts regarding this statement, please contact Nancy Kingsbury at (202) 512-2700 or at kingsburyn@gao.gov. Contact points for our Offices of Congressional Relations and Public Affairs may be found on the last page of this statement. Sushil Sharma, Ph.D., Dr.PH, Assistant Director; and Elaine L. Vaurio also made key contributions to this statement. Related GAO Products High-Containment Laboratories: Assessment of the Nation’s Need Is Missing. GAO-13-466R. Washington, D.C.: February 25, 2013. Biological Laboratories: Design and Implementation Considerations for Safety Reporting Systems. GAO-10-850. Washington, D.C.: September 10, 2010. High-Containment Laboratories: National Strategy for Oversight Is Needed. GAO-09-1045T. Washington, D.C.: September 22, 2009. High-Containment Laboratories: National Strategy for Oversight Is Needed. GAO-09-1036T. Washington, D.C.: September 22, 2009. High-Containment Laboratories: National Strategy for Oversight Is Needed. GAO-09-574. Washington, D.C.: September 21, 2009. Biological Research: Observations on DHS’s Analyses Concerning Whether FMD Research Can Be Done as Safely on the Mainland as on Plum Island. GAO-09-747. Washington, D.C.: July 30, 2009. High-Containment Biosafety Laboratories: DHS Lacks Evidence to Conclude That Foot-and-Mouth Disease Research Can Be Done Safely on the U.S. Mainland. GAO-08-821T. Washington, D.C.: May 22, 2008. High-Containment Biosafety Laboratories: Preliminary Observations on the Oversight of the Proliferation of BSL-3 and BSL-4 Laboratories in the United States. GAO-08-108T. Washington, D.C.: October 4, 2007. Biological Research Laboratories: Issues Associated with the Expansion of Laboratories Funded by the National Institute of Allergy and Infectious Diseases. GAO-07-333R. Washington, D.C.: February 22, 2007. Homeland Security: CDC’s Oversight of the Select Agent Program GAO-03-315R. Washington, D.C.: November 22, 2002. This is a work of the U.S. government and is not subject to copyright protection in the United States. The published product may be reproduced and distributed in its entirety without further permission from GAO. However, because this work may contain copyrighted images or other material, permission from the copyright holder may be necessary if you wish to reproduce this material separately.

Summary: Recent biosecurity incidents-such as the June 5, 2014, potential exposure of staff in Atlanta laboratories at the Centers for Disease Control and Prevention (CDC) to live spores of a strain of anthrax-highlight the importance of maintaining biosafety and biosecurity protocols at high-containment laboratories. This statement summarizes the results of GAO's past work on the oversight of high-containment laboratories, those designed for handling dangerous pathogens and emerging infectious diseases. Specifically, this statement addresses (1) the need for governmentwide strategic planning for the requirements for high-containment laboratories, including assessment of their risks; (2) the need for national standards for designing, constructing, commissioning, operating, and maintaining such laboratories; and (3) the oversight of biosafety and biosecurity at high-containment laboratories. In addition, it provides GAO's preliminary observations on the potential exposure of CDC staff to anthrax. For this preliminary work, GAO reviewed agency documents, including a report on the potential exposure, and scientific literature; and interviewed CDC officials. No federal entity is responsible for strategic planning and oversight of high-containment laboratories. Since the 1990s, the number of high-containment laboratories has risen; however, the expansion of high-containment laboratories was not based on a government-wide coordinated strategy. Instead, the expansion was based on the perceptions of individual agencies about the capacity required for their individual missions and the high-containment laboratory activities needed to meet those missions, as well as the availability of congressionally approved funding. Consequent to this mode of expansion, there was no research agenda linking all these agencies, even at the federal level, that would allow for a national needs assessment, strategic plan, or coordinated oversight. As GAO last reported in 2013, after more than 12 years, GAO has not been able to find any detailed projections based on a government-wide strategic evaluation of research requirements based on public health or national security needs. Without this information, there is little assurance of having facilities with the right capacity to meet the nation's needs. GAO's past work has found a continued lack of national standards for designing, constructing, commissioning, and operating high-containment laboratories. As noted in a 2009 report, the absence of national standards means that the laboratories may vary from place to place because of differences in local building requirements or standards for safe operations. Some guidance exists about designing, constructing, and operating high-containment laboratories. Specifically, the Biosafety in Microbiological and Biomedical Laboratories guidance recommends various design, construction, and operations standards, but GAO's work has found it is not universally followed. The guidance also does not recommend an assessment of whether the suggested design, construction, and operational standards are achieved. As GAO has reported, national standards are valuable not only in relation to new laboratory construction but also in ensuring compliance for periodic upgrades. No one agency is responsible for determining the aggregate or cumulative risks associated with the continued expansion of high-containment laboratories; according to experts and federal officials GAO interviewed for prior work, the oversight of these laboratories is fragmented and largely self-policing. On July 11, 2014, the Centers for Disease Control and Prevention (CDC) released a report on the potential exposure to anthrax that described a number of actions that CDC plans to take within its responsibilities to avoid another incident like the one in June. The incident in June was caused when a laboratory scientist inadvertently failed to sterilize plates containing samples of anthrax, derived with a new method, and transferred them to a facility with lower biosecurity protocols. This incident and the inherent risks of biosecurity highlight the need for a national strategy to evaluate the requirements for high-containment laboratories, set and maintain national standards for such laboratories' construction and operation, and maintain a national strategy for the oversight of laboratories that conduct important work on highly infectious pathogens.

gov_report

en

Summarize: BACKGROUND OF THE INVENTION 1. Field of the Invention This invention concerns a method and apparatus for applying a uniform substance coating to a food product which advantageously enables the product to retain a low moisture content for better storage and reduction of drying costs. The food product is advanced through a rotatable reel to agitate and expose the product to sprayed-on coatings in conjunction with circulating and heating air. 2. Description of the Prior Art A number of different food products are produced by commercial methods which require drying prior to storage. Moisture levels in the product must be kept low to prevent product degradation during the period from manufacture to ultimate consumption. Thus, in the case of many types of products such as breakfast cereals and snack foods which are conventionally prepared by extrusion cooking, the moisture content must be reduced prior to packaging and subsequent storage. It may be desirable to produce a product which is provided with a surface coating of a different substance. For example, the consumer may desire a breakfast cereal which has a sugar coating, flavored coating, or a snack food such as a puffed cheese-flavored item which has a salt coating. These materials have conventionally been added to the product in separate machines located downstream from the product dryer. The coatings have often been applied through what is known as a piccolo tube where the coating is dripped onto the product. These prior art machines and methods have had difficulty in achieving uniform product coatings and have had the further disadvantage that the product has a tendency to aggregate into clumps which are unsalable. Perhaps a more serious problem is the moisture added to the product during the coating process which may adversely affect the product by sealing in the added moisture when the moisture of the coating is absorbed by the dried product and the surface coating is dried. These processes have not adequately agitated the product during dripping of the coatings with the result that certain shapes, such as toroids (&#34;O&#39;s&#34;), are unevenly coated. SUMMARY OF THE INVENTION These and other problems are largely solved by the combined product coating and drying apparatus of the present invention and the associated method. The apparatus hereof advantageously provides for drying the product after coating it with a substance such as sugar flavored slurry or salt which is sprayed on and then dried during rotation of a product-conveying reel. The reel is rotatable and permits the circulation of drying air therethrough to yield a uniformly coated, dried product in a single operation and occupying a minimum of floor space. The apparatus hereof broadly includes a combined dryer and spray unit which includes an axially rotatable reel provided with a perforate sidewall. At least one spray station is located interiorly of the sidewall to direct a slurry containing the desired coating substance onto the product as it passes through the rotating reel. The product is presented as a tumbling bed which is agitated as it passes through the reel with drying air circulated therearound. The reel may be inclined to allow gravity to gradually cause the product to advance from an inlet to an outlet and then discharged. In preferred forms, a plurality of separate, longitudinally spaced spray zones are defined within the reel, each zone including at least one spray nozzle for directing a spray of coating substance onto the tumbling bed. A housing surrounds the reel and includes a heat exchanger for heating the air and a circulating fan for forcing air through the perforations in the sidewalls of the reel. The housing is advantageously configured to draw additional air through openings at each end of the reel whereby both fresh and recirculated air is introduced into the reel. A secondary discharge fan is associated with an outlet duct for removing moisture-laden air from the apparatus. The combination product coating and drying apparatus is preferably divided into a plurality of separate drying and spraying zones corresponding to perforate and imperforate regions of the reel sidewall. The drying zones include a plurality of perforations sized to permit the passage of air therethrough but not to permit the passage of product. Each spraying zone is preferably imperforate to reduce the loss of sprayed product coating through any perforations and to provide for thorough coating of the product with the sprayed substance. A nozzle is directed toward the bed of product in each spray zone to supply a pressurized spray of the desired coating substance in a liquid slurry so that all surfaces will be evenly coated, and to enable a series of thin coats to be applied, thereby avoiding excessive moisture absorption by the product. The final product moves out of the reel and onto a screen whereby the few oversized individual products and aggregations may be retained while normal product is discharged therethrough. The invention hereof advantageously includes a method of coating and drying a product by first introducing the product into a rotating reel having a plurality of perforations in its sidewall for the circulation of air therethrough. The reel is rotated to advance and agitate the product. Air is circulated through the reel to dry the product passing therethrough. Thereafter, at least one spray nozzle directs a coating substance onto the product during rotation of the reel and the coating substance is dried before it is discharged from the unit. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a right side elevational view of a combined product coating and drying apparatus in accordance with the present invention, showing the air circulation fan at the top of the housing of the apparatus, the exhaust flue and a product sizing screen at the rear of the apparatus; FIG. 2 is a front elevational view of the apparatus hereof, showing the reel drive unit and the product inlet chute; FIG. 3 is a rear elevational view of the apparatus hereof, showing the product sizing screen; FIG. 4 is a vertical cross-sectional view of the present invention taken longitudinally through the apparatus showing spray and drying zones defined by a rotatable reel, perforations in the sidewall of the reel, spray nozzle located interiorly of the reel, a heat exchanger for heating air circulated by the circulation fan and an exhaust fan shown schematically in communication with the exhaust flue; FIG. 5 is an enlarged vertical sectional of the present invention taken transversely through the apparatus showing the heat exchanger and air circulation path through the reel; FIG. 6 is a horizontal sectional view of the present invention taken below the roof of the housing to show the impeller of the circulation fan and the heat exchanger; FIG. 7 is an enlarged side elevational view in partial cross-section of the frame of the housing showing the pivotal mounting of the support member to the housing for adjusting the angle of inclination of the apparatus hereof; and FIG. 8 is an enlarged end elevational view in partial cross-section showing the mounting for the pivotal support between the frame and the support member. DESCRIPTION OF THE PREFERRED EMBODIMENT Referring now to the drawing, a combined product coating and drying apparatus 10 broadly includes a housing 12, rotatable reel 14, and drive mechanism 16 for rotating reel 14. A sizing screen 18 is connected to the reel 14 for rotation therewith, and an inlet chute 20 is located opposite the sizing screen 18 for introducing food product into the reel 14. An air circulation component 22 is located atop the housing 12 and a spray unit 24 is positioned for introducing a coating substance onto the food product moving along the reel 14. A series of support members 26 adjustably support the housing 12 for varying the angle of inclination of the reel 14. In the drawing, FIG. 5, arrows are used to show the direction of air flow through the apparatus 10. In greater detail, housing 12 includes a frame 28 which carries a plurality of doors 30 pivotally mounted on hinges 32. The doors 30 are snugly but releasably secured to the frame 28 by hasps 34. As seen in FIGS. 2 and 3, doors 3, doors 36, 37, and 38, 39 located adjacent inlet chute 20 and sizing screen 18 respectively are also mounted to frame 28 by holding clips for fitting closely to reel 14. The housing also includes a roof 40 and a floor 42, as shown in FIG. 5, which aid in defining air passageways for the circulation of drying air within the housing 12. Referring now to FIGS. 2 and 3 of the drawing, housing 12 carries a plurality of pillow blocks 44 carrying trunnion wheels 46. Trunnion wheels 46 engage respective trunnion rings 48 and 50 circumscribing reel 14. Trunnion wheel 52 is driven by chain 54 of drive mechanism 16 for rotating trunnion ring 48. Motor 55 drives chain 54 through a conventional sprocket engaged with the trunnion wheel 52. The rotational speed of the reel 14 may be varied by substituting a differently sized sprockets or by utilizing a variable speed electric motor 55. A shaft 59 interconnects trunnion wheel 52 with trunnion wheel 57 for driving trunnion ring 50, and a shaft 61 interconnects the two trunnion wheels 46. Frame 28 supports inlet chute 20 which includes a tube 56 for discharging food product interiorly of the reel 14 and a diversion duct 58 for shunting food product when the reel 14 is inoperative. A diversion plate (not shown) is located interior to the inlet chute 20 at the junction of the tube 56 and the duct 58 for diverting food product into either tube 56 or duct as desired. The inlet chute 20 is positioned upstream of the reel 14 to receive food product from an extruder, storage bin, dryer or other apparatus and convey the product through tube 56 into the reel 14. Reel 14, best viewed in FIG. 4, is constructed as an elongated cylinder having a longitudinal axis A--A&#39; extending between an inlet end 60, an opposed discharge end 62, and a cylindrical sidewall 64 which carries a plurality of spiral shaped vanes 66. The vanes are evenly spaced along the sidewall 64 adjacent inlet end 60 for moving the food product interiorly of the reel 14 when deposited by the inlet chute 20. As seen in FIG. 4, sidewall 64 presents a series of imperforate sections 68, 70, 72, 74 and 76 which alternate with perforate sections 78, 80, 82 and 84. Each perforate section includes a number of slits 86 in sidewall 64. Sizing screen 18 extends downstream from discharge end 62 and rotates with reel 14. Screen 18 is cylindrical and preferably of a diameter the same as reel 14. Screen 18 includes a number of holes 88 which are somewhat larger than the desired product size but small enough to retain aggregations of coated product. A plurality of spaced-apart retainers 90 which project radially inwardly of the wall of screen 18 in a spiral path. The vanes 66 and retainers 90 are oriented to spiral in opposite directions whereby vanes 66 serve to advance the product into the interior of the reel 14 and retainers 90 serve to retain the oversized aggregations on the screen 18 during rotation of the reel 14. Housing 12 is supported by three pairs of support members 26. Each support member includes a base 92 and an internally threaded post 94 engaged with threaded rod 96. The rods 96 each extend upwardly to a head 98 which lies in abutment with shelf 100, as best seen in FIGS. 7 and 8. Each shelf 100 is pivotally mounted on pin 102. Frame 28 also carries spray unit 24 for depositing a pressurized spray of coating material such as a sugar or salt slurry onto the food product passing therethrough. Spray unit 24 is oriented below axis A--A&#39; and offset toward the portion of the sidewall 64 moving upwardly during rotation, as seen in FIG. 5. Spray unit 24 includes a supply line 104 connected to a conduit 106 which supplies the sprayable substance to nozzles 108. The conduit 106 is of decreasing diameter downstream of each nozzle 108 to maintain proper and equal pressure at each nozzle 108 during spraying. Each nozzle 108 is positioned opposite an imperforate portion of the reel as shown in FIG. 4 to minimize spray loss through the slits 86. A pair of hangers 110, 112 support the spray unit 24 from a longitudinally extending rail 114. Housing 12 cooperates with reel 14 and air circulation unit 22 to provide for the circulation of drying air across the reel 14 and through the product passing therethrough. Air circulation unit 22 includes an electric motor 116 for driving a fan impeller 118. Air circulation unit 22 may be selected for the desired airflow from SQA plug fans manufactured by Chicago Airfoil. An exhaust flue 120 serves to remove moisture-laden air from the apparatus 10 and is provided with an exhaust fan 122 shown schematically in FIG. 4 to ensure positive airflow through the apparatus 10. The drying air is channeled through apparatus 10 along routes defined by the housing 12 and reel 14. A panel 124 extends longitudinally along housing 12 adjacent reel 14 and is provided with a flexible sealing member 126 which lies in engagement with the sidewall 64 of reel 14. Similarly, ledge 128 extends longitudinally along housing 12 adjacent reel 14 and is also provided with a flexible sealing member 126 lying in engagement with sidewall 64. A series of plates 130 extend horizontally across housing 12 both longitudinally and transversely but are provided with openings to permit air to move up through flue 120 and into air circulation unit 22. A heat exchanger 132 is located above plate 130 and oriented to receive air from air circulation unit 22. Heat exchanger includes a number of steam coils 134 and fins 136 so that air passing thereacross may be heated during circulation of steam through the coils 134. A channel extends downwardly between the side of the housing 12 and partition 138 whereby heated air is directed into chamber 140. Chamber 140 is enclosed at each end to prevent the escape of the heated air, and sealing ring 141 surrounds a shaft connecting trunnion wheels 46 in substantially airtight relationship. Lips 142 and 144 are provided with sealing members 126 in engagement with reel 14 whereby air is directed through the slits 86 of the perforate sections 78, 80, 82 and 84. A plenum 146 is defined between panel 124 and ledge 128 for receiving air moving through the reel 14 from chamber 140 and from openings in the inlet end 60 and discharge end 62 of the reel 14. Plenum 146 is also substantially enclosed at each end to provide sufficient negative air pressure whereby air passing through the food product from chamber 140 is drawn therein. Void 148 and void 150 have substantially no air movement because of the sealing effects of panel 124, ledge 128 and lips 142 and 144 but may be open at the ends thereof. The roof 40, floor 42 and sides and ends of the housing including doors 30, 36, 37, 38 and 39 are substantially airtight and enclose the housing 12 whereby the positive airflow created by circulating component 22 and exhaust fan 122 cause the air to flow in a substantially closed circuit through the housing except for air drawn in through openings in the inlet end 60 and discharge end 62 and exhausted through flue 120. In operation, food product 152 which has been processed through an extruder and also possibly a dryer is introduced into the reel 14 of the apparatus through inlet chute 20. The reel 14 is rotated by drive mechanism 16 whereby the trunnion wheels 52 and 57 rotate the reel 14 in a clockwise direction as viewed from inlet end 60 to outlet end 62 shown in FIG. 5. The speed of rotation is preferably between the ranges of 1 to 50 rpm, but may be more dependent on the product to be processed. As the reel 14 rotates, vanes 66 urge the product 152 forward into the interior of the reel 14 and cause it to tumble, thus exposing it to the air circulating through slits 86 as well as air entering through the inlet end 60. As the product advances beyond vanes 66, it is urged upwardly along sidewall 64 due to the rotation of the reel 14. The product 152 is presented as a tumbling bed as shown in FIG. 5. The reel 14 is adjustably inclined by turning rod 96 relative to post 94. The extent of the angle of inclination of the reel 14 (and thus longitudinal axis A--A&#39;), as well as the speed of rotation of the reel affect the residence time of the product 152 within the reel 14. Rotation of the reel 14 causes the product to move upwardly during rotation until it reaches a level of instability, then fall vertically to a new position of stability. Because the reel 14 is inclined, the product 152 will move longitudinally forward along the reel 14 during each fall. Air is circulated through the slits 86 in each of the perforate sections 78,80,82 and 84 of the sidewall 64 of the reel 14. As shown in FIG. 5, air is drawn upwardly through the slits 86 into plenum 146. A portion of the air in plenum 146 is exhausted through flue 120 while the remainder is drawn upwardly by the rotation of impeller 118 and moved between plates 130 and roof 40 past heat exchanger 132. Steam circulated within steam coils and supplied by an outside source heats the air supplied by impeller 118. Alternatively, according to the desires of the user and the availability of alternate energy sources, open gas-fired burners could be employed to directly heat the circulating air. The use of open burners would permit increased products rates. In addition, indirect heaters could be employed to hear air to be circulated through the heat exchanger, as local conditions dictate. The heated air then moves downwardly along partition 138 into chamber 140. The air is under pressure and is expelled through slits 86 into the tumbling bed of product 152. As the heated air passes through the product 152 it absorbs moisture. The air passing through the product 152 into the interior of the reel 14 is then drawn upwardly along with ambient air pulled in from each the inlet and discharge ends through slits 86 in the side of the reel 14 then opposite chamber 140 and into plenum 146. The food product is sprayed with a coating substance 154 in spray zones 156 defined by each spray nozzle 108 and the imperforate sections 68, 70 and 72 opposite the spray nozzles 108. As shown in FIG. 5, the food product 152 such as breakfast cereal may be exposed to spraying of a slurry including sugar and water whereby the cereal may be provided with a thin sugar coating. The agitation of the cereal prevents the individual flakes, spheres, &#34;O&#39;s&#34; or other shapes of individual product from sticking together. The product is tumbled by the action of the rotating reel 14 until it reaches the next adjacent perforate section 78, 80 or 82 where moisture in the product or applied during the spray may be removed and the coating dried. Through this method, successive applications of spray may be applied and then dried enabling a uniform coating of the product with a minimum of added moisture. It may be appreciated that a variety of different food products including for example puffed cheese snacks or dog food might be coated with seasonings or salt in hydrous slurry solutions in accordance with the same method. After the food product 152 traverses the length of the reel 14 it reaches sizing screen 18. A hopper, conveyor or bin may be placed beneath the sizing screen 18 to receive normal product which falls through the holes 88 therein. Oversized product is further agitated and retained on sizing screen 18 by the retainers 90 which prevent the oversized product from falling out the open end thereof. It has been determined that product received by the apparatus 10 hereof may have a moisture content of up to 2.9% by weight and still be discharged through the sizing screen 18 with a moisture content of 2.9% by weight which is satisfactory for storage. The slurry solution applied through spray unit 24 is preferably of a moisture content of 40% to 60% by weight, but may have a moisture content as high as about 80% solids and 20% water by weight. The present apparatus enables this high solid solution to be sprayed and dried on the product to yield an additional 150 kg or more of solid coating substance to be added by applying 180 kg of slurry containing the desired coating substance and removing the 30 kg of moisture. The angle of longitudinal axis A--A&#39; may be adjusted from the vertical to provide the desired residence time of the product in the apparatus 10 according to the type of base product and the type and moisture content of coating substance slurry which is applied. When applying sugar coating to cereal products, the residence time is ordinarily in the range of about 3 minutes to 20 minutes and preferably about 5 minutes. The temperature of the air circulated through the product when measured in chamber 140 just prior to passage through the food product 152 is in the range of 150° F. to 300° F. and preferably about 200° F., dependent upon the particular product and rate of production. The resulting product has been found to be uniformly coated even for difficult shapes such as toroids wherein the inner facing surface is evenly coated with the outer surface. Yet further, runs through the apparatus 10 have produced product having no aggregations of individual product, even with sticky product such as sugar-coated cereal. The ability to apply multiple thin coats has meant that the product entering the apparatus has not been dried to below target moisture level to compensate for the absorption of moisture ordinarily retained by the base product through conventional coating methods.

Summary: An apparatus for drying and coating a food product is provided which enables a uniform coating to be sprayed on the product without adversely affecting the product moisture content. The apparatus includes a reel which includes at least one and preferably a series of perforate zones in the sidewall for circulating air around the product during passage of the product therealong. Spray nozzles are arranged at intervals along the reel to deposit sugar, salt or other food coatings in slurry form on the food product. The reel rotates during coating and drying of the product to prevent aggregation of the individual food products and uneven coating, as well as providing for uniform drying of the coated product. The invention includes a method of drying and coating a food product including the steps of introducing the food product into a reel inlet, rotating the reel and circulating air therethrough, applying a coating to the product during rotation of the reel and drying the coating on the product before discharging the coated product from the dryer.

big_patent

en

Summarize: By. Lydia Warren. PUBLISHED:. 15:31 EST, 3 September 2013. |. UPDATED:. 15:34 EST, 3 September 2013. Prosecutors today vowed to appeal the 30-day sentence handed down to a high school teacher who repeatedly raped a 14-year-old student before she killed herself. The meager sentence given by Judge G. Todd Baugh to Stacey Rambold, 54, in a Billings, Montana court last month sparked protests and an online petition calling for the judge's resignation. 'Certainly I'm disappointed in this sentence, but I have a job to do, and my job right now is to figure out if this case can be appealed because of some legal error,' Scott Twito, the county attorney told NBC on Tuesday. Last Thursday, around 400 protesters headed to the the county courthouse to call for the resignation of the state district judge, while around 45,000 people have signed a petition demanding he resign. Meager sentence: Cherice Moralez, left, shot herself dead after she was raped by her teacher, Stacey Rambold, right. A judge has caused outraged by giving him just a 30-day sentence for his crimes. Controversial: Judge G. Todd Baugh sentence has sparked outrage and will be reviewed. Organizers have endorsed Baugh's description of himself as a 'blithering idiot' for having said the victim, Cherice Moralez, acted 'older than her chronological age' and was in control of the situation. 'We will no longer stand by while individuals speak about victims in this way,' Kate Olp, the petition organizer, said. Baugh has defended the 30-day sentence and said he did not intend to resign. The victim's mother told Today that the sentence left her 'horrified'. 'I don't believe in justice anymore. It was a joke,' she said. Victim: The judge said that Cherry, pictured, acted older than her age - comments which sparked outrage. Rambold was originally charged with three felony counts of sexual intercourse without consent in 2008 when officials at Billings Senior High School first became aware of the sexual relationship. Victim Cherice Moralez committed suicide. on February 6, 2010. She shot herself in her mother’s bed just three. weeks before her 17th birthday. According to her mother, Auliea. Hanlon, the pending trial of teacher Stacey Rambold - 49 when the rapes. were committed - and trauma of the abuse were'major factors' in her. daughter's death. Speaking. to MailOnline Mrs Hanlon said that her daughter had been 'in hell,' shunned by classmates and bullied following the revelations of the. abuse. Her death complicated the prosecution. of former teacher Rambold, now 54. Heartbroken: Her mother Auliea Hanlon listens during a protest last Thursday against the sentence. Prosecutors who had sought to put Rambold behind bars instead settled for a three-year deferred prosecution. According. to the terms of the agreement the case would be dismissed after this. term if Rambold pleaded guilty to one count of sexual intercourse. without consent and entered a three-stage sex offender treatment. program. But he was kicked out of the treatment program for missing meetings and having unsupervised visits with his nieces and nephews, who are minors. In April, he pleaded guilty to a single felony count. At his sentencing hearing last Monday, prosecutors asked the judge to put Rambold behind bars for 20 years, but Baugh said he didn't think the violations were serious enough. In a written explanation, the judge maintained that these violations were 'not significant'. Outrage: An estimated 400 people attended a protest rally against the sentence in Billings, Montana. Anger: Protesters have called for the judge's resignation but he has said he will not step down. He. stated: 'There were violations of the treatment program, but involved. no violence, no inappropriate sexual conduct, and no new criminal. activity. 'Defendant's old. treatment provider recommended that the Defendant still be assessed as a. low risk offender and treatable in the community. 'Knowing that the Defendant had enrolled. in another sexual offender treatment program, the Court is faced with. deciding if the Defendant should go to prison for relatively minor. infractions.' After Rambold's 30 days in jail, he will be on probation for 15 years and he must register as a sex offender. Speaking to MailOnline Cherry’s mother. said: ‘Rambold took away everything beautiful in my life and he just. gets to walk away. He confessed. He did it. ‘With this sentence the judge just lets everyone off – he lets the school off and he lets him off.’

Summary: Cherice Moralez, 14, shot herself after she was bullied by classmates when charges were brought against her. Montana teacher Stacey Rambold, 48. Rambold admitted to raping the teenager on several occasions in 2007. Judge G Todd Baugh gave. Rambold 30 days in jail because Rambold. had'suffered enough' and Cherry was 'in control' Protests held and nationwide petition launched calling for judge's removal.

cnn_dailymail

en

Write a title and summarize: Food choice and eating behavior affect health and longevity. Large-scale research efforts aim to understand the molecular and social/behavioral mechanisms of energy homeostasis, body weight, and food intake. Honey bees (Apis mellifera) could provide a model for these studies since individuals vary in food-related behavior and social factors can be controlled. Here, we examine a potential role of peripheral insulin receptor substrate (IRS) expression in honey bee foraging behavior. IRS is central to cellular nutrient sensing through transduction of insulin/insulin-like signals (IIS). By reducing peripheral IRS gene expression and IRS protein amount with the use of RNA interference (RNAi), we demonstrate that IRS influences foraging choice in two standard strains selected for different food-hoarding behavior. Compared with controls, IRS knockdowns bias their foraging effort toward protein (pollen) rather than toward carbohydrate (nectar) sources. Through control experiments, we establish that IRS does not influence the bees' sucrose sensory response, a modality that is generally associated with food-related behavior and specifically correlated with the foraging preference of honey bees. These results reveal a new affector pathway of honey bee social foraging, and suggest that IRS expressed in peripheral tissue can modulate an insect' s foraging choice between protein and carbohydrate sources. Multicellular animals have distinct energy demands but can modulate their growth and energy consumption in response to nutrient availability [1], [2]. This state of metabolic homeostasis is central to health and lifespan. Metabolic homeostasis is maintained by physiological feedback mechanisms that include the behavioral system [3]. The association between metabolic biology and behavior is of much interest since human food-choice and eating behavior contribute to many public health-issues such as obesity and diabetes [4]. In mammals, food-related behavior is influenced by several factors, including age [5], sex and reproductive physiology [6], genotype [7], sensory perception [8], [9], and environment or social setting [10]. Many of these factors interact in complex ways to affect behavior [11]–[13], and the underlying cause-effect relationships are challenging to test. However, similar relationships are found in highly manipulable insect models where metabolic biology shows considerable homology to mammalian systems [14]. Insect food-related behavior, as exemplified by individual foraging choice between a carbohydrate source (nectar) and a protein source (pollen), is studied in detail in honey bees (Apis mellifera) [15]–[17]. Honey bees are social insects organized in colonies with one reproductive queen and several thousands of largely sterile female helpers called workers [18]. Workers progress through an age-associated series of tasks that culminate in foraging activity when bees are 2–3 weeks old. As foragers, workers collect nectar, pollen, water and propolis, which are essential resources for colony growth and survival. Nectar and pollen are stored (hoarded) inside the nest and consumed as a function of colony needs. A worker can collect both nectar and pollen during a foraging trip, but she will often bias her collection toward one of these resources [19]. Bidirectional colony-level artificial selection for the amount of stored pollen (pollen-hoarding) resulted in high and low pollen-hoarding honey bees that are maintained as standard strains [17]. These strains are characterized by significantly different foraging behavior in workers: Similar to the wild type (unselected commercial stocks), high and low pollen-hoarding strain bees collect nectar, pollen or both during foraging trips, but high strain workers are more likely to collect pollen [16], [17], [20], [21]. Physiological, sensory and behavioral systems are tightly linked in animals [7], [8], [22], including insects [23]. As a likely consequence, bidirectional selection for pollen-hoarding affected not only foraging behavior, but also behavior-associated physiology such as circulating levels of vitellogenin (yolk protein precursor/behavioral affector molecule [15], [24]–[26]) and sensory systems (sucrose responsiveness [27]–[29]). Studies in wild-type honey bees have confirmed correlations as well as direct relationships between these traits [24], [29], [30]. Moreover, genome mapping has identified highly epistatic quantitative trait loci (QTL, pln1- pln4) that explain variation in honey bee foraging behavior and sucrose responsiveness [31]–[33]. The 95% confidence interval of the least gene-dense QTL, pln4, contains four genes. One is the insulin receptor substrate (IRS), which is an appealing positional candidate gene for regulation of honey bee behavioral physiology due to known interactions between the IIS pathway and food-related behavior [34], [35]. IRS genes encode for a conserved membrane-associated adaptor protein that is central to transduction of insulin/insulin-like signals (IIS) (reviewed by [36]). IIS pathways, including IRS proteins, are active in the central (neural) and peripheral (non-neural) tissues of eukaryotes and regulate metabolic responses to food-intake [2], [22], [37]. Central nervous system IIS (central IIS) can also coordinate eating behavior directly (reviewed by [38], [39]); e. g., following administration or natural secretion of insulin, elevated central IIS will change food-intake behavior [40]. In mammals, the increase in blood nutrient-levels after eating leads to enhanced synthesis and release of insulin from pancreatic β-cells, while insects release insulin-like peptides (ILPs) from neural cells [41]. The activity of pancreatic cells is further influenced by gastrointestinal hormones (incretins) and signals from the autonomic nervous system (reviewed by [42], [43]), whereas recent work in the fruit fly Drosophila melanogaster shows that humoral signals from peripheral fat body (insect functional homolog of mammalian liver and adipose tissue) can regulate ILP secretion in brain [44]. The Drosophila IRS homologue CHICO is crucial for IIS function in fly tissues including neural cells, and fly behavior is affected if central IIS is experimentally impaired [45]. Contrasting these and other findings about roles of central IIS in behavior, less is known on how behavior is influenced by peripheral IIS, i. e., signaling that is endogenous to peripheral tissues. Here, we use honey bees to test the prediction that perturbation of peripheral IIS can affect food-related behavior. Experimental workers were obtained from the standard strains of high and low pollen-hoarding bees, while wild type was used to test the general validity of methods and select results. Pollen-hoarding strain bees were preferred as experimental animals because the set of well-defined phenotypic differences between them allow treatment effects and their interactions with genotype to become more readily apparent ([15], [24] and Discussion). Perturbation of peripheral IIS was achieved by RNA interference (RNAi) -mediated gene knockdown of IRS in fat body. The results presented here show that food-related behavior can be influenced by changes in peripheral IIS: IRS RNAi, which reduced IRS expression levels in worker fat body but not in brain, biased bees to forage for the protein source, pollen. Our detailed analyses of genotype-specific behavioral patterns and established factors connected to variation in honey bee foraging behavior (vitellogenin gene expression, sucrose sensory sensitivity) point to distinct roles of IRS in regulation of worker foraging choice. Newly emerged (0–24 h old) adult workers from high and low pollen-hoarding strains were injected intra-abdominally [46], [47] with double-stranded RNA (dsRNA) against the only IRS-encoding gene in honey bees (GenBank XM_391985). This approach to RNAi targets honey bee fat body [30], [46], [48], [49] while being ineffective in brain [47], [50]. Knockdown was assessed relative to an established honey bee control procedure for non-specific effects of treatment or handling in RNAi experiments. This protocol requires injection of dsRNA toward a gene not found in the bee (a green fluorescent protein (GFP) encoding gene in vector, GenBank AF097553) [30], [48], [49]. The design was replicated twice by introducing workers into two separate host colonies. Using the IRS RNAi procedure above, IRS knockdown and control treatment groups were established for high and low pollen-hoarding strain bees. This experiment excluded wild-type bees, because their increased heterogeneity of genotype and behavior was anticipated to mask effects of a single gene, here IRS, on a complex quantitative trait like food-related behavior ([34], [48] and Discussion). All bees were marked and allowed to mature for 10 days in two host colonies. Subsequently, for five days, marked bees were captured as they returned from foraging trips and their foraging loads of pollen and nectar were quantified (n = 101 high vs. n = 168 low strain bees, further details in Materials and Methods) [32]. We identified ‘nectar load weight’ and the ‘proportion of pollen collected’ as behavioral traits that were significantly affected in the experiment. These variables were influenced by the RNAi treatment scheme (factorial ANOVA: treatment, F (2,214) = 5. 0528, p = 0. 0071) and by strain (factorial ANOVA: genotype, F (2,214) = 19. 3706, p<0. 0001). Host colony environment (factorial ANOVA: colony, F (1,214) = 1. 2328, p = 0. 2935) did not affect behavior, and no interaction between treatment and genotype was detected (F (2,214) = 1. 1618, p = 0. 3149). Post hoc tests on the behavioral data were performed separately for nectar load and the proportion of pollen collected, as nectar load explains part of the variance in the proportional load of pollen [25]. The effect of IRS RNAi on nectar load (Fisher' s LSD: p = 0. 0255) and the proportion of pollen collected (Fisher' s LSD: p = 0. 0447) were independently significant (Figure 5A and 5B). Further analysis showed that the behavioral response in worker nectar load weights after peripheral IRS RNAi remained suggestive also when the dataset was split by strain (Fisher' s LSD: p = 0. 0549, Figure 5A insert). These results indicated that reduced IRS expression in fat body affected the nectar loading behavior of the two strains similarly: nectar loads were reduced by peripheral IRS knockdown irrespective of genotype. Thereby, the data from both strains contributed additively to statistical power such that the significant effect of IRS RNAi on behavior was detected in the full dataset (Figure 5A). For the proportional load that was pollen, a similar pattern of post hoc significance showed that both strains contributed to the significant influence of IRS down-regulation on behavior. This effect was observed as a consistent bias of the strains' mean foraging effort toward the pollen protein source (Figure 5B). When the data were split by strain and each set analyzed separately, the effect remained suggestive within the high strain genotype (Fisher' s LSD: p = 0. 0771). In our experiment, IRS did not affect pollen loads per se (factorial ANOVA, treatment, F (1,270) = 0. 3699, p = 0. 5435, Figure 5C), but the strain effect was significant (factorial ANOVA: genotype, F (1,270) = 20. 94, p<0. 0001; Figure 5C insert). In addition, high strain bees demonstrated a trend toward increased pollen load sizes in response to IRS RNAi, while the opposite was true for low strain bees (Figure 5C insert). To understand the relationships between the strain-associated pattern of pollen loading, the more general (strain-independent) effect of IRS on nectar load sizes (Figure 5A), and the workers' overall food-loading behavior, we analyzed the total load masses of the bees. In this analysis, the pollen load was counted twice toward the foraging effort of each worker [30], [52]. This correction of total load mass to estimate individual effort is in general use [30], [52], and takes into account that aerodynamic power influences the pollen load and nectar load of workers differently: it is possible for a forager to carry a maximum load size of nectar that is approximately twice as heavy as the maximum load size of pollen she is capable of carrying [52]. Using the raw (uncorrected) weights of nectar and pollen did not influence conclusions (Fisher' s LSD test, uncorrected data, praw-values in italics, below). The main effects of IRS RNAi, strain genotype, and host environment did not affect the total foraging effort of the worker bees (factorial ANOVA: treatment, F (1,271) = 2. 9831, p = 0. 0852; genotype, F (1,271) = 2. 1811, p = 0. 1409; colony, F (1,271) = 0. 0164, p = 0. 8982). However, when contrasting the loading relationships of the two genotypes in a planned comparison (Fisher' s LSD test), we found that the average total load mass of high strain IRS knockdowns and controls was identical (Fisher' s LSD: p = 0. 7337, praw = 0. 5008), while low strain bees responded to IRS down-regulation with a significant decrease in their total load mass average (Fisher' s LSD, p = 0. 0130, praw = 0. 0154, Figure 5D). These results indicated that in response to IRS downregulation, increased pollen-loading (Figure 5C insert) counterbalanced reduced nectar loading in high strain bees (Figure 2A insert) while the low strain genotype collected less nectar without increasing pollen loads, leading to reduced total food-loading. The sucrose response is a general neural property related to foraging choice behavior in wild-type honey bees [53] and selected pollen-hoarding strains [20], [27], [54]. Thus, after detecting significant effects of IRS on foraging bias, we wanted to resolve if IRS knockdown influenced the workers' foraging choice by modulating the sucrose response system. To test this relationship, we quantified the effect of IRS RNAi on individual sucrose responsiveness measured as the gustatory response score (GRS) [20], [27], [28], [49], [53]. As before, knockdowns and controls were established and introduced into two host colonies. The experimental bees were retrieved after 11 days (n = 42−54), i. e., at a chronological age similar to the bees tested for foraging choice behavior. In the laboratory, the proboscis extension response (PER) was measured using a standard series of water and six increasing sucrose concentrations [27], [28]. Individual bees were assigned a GRS based on the number of elicited PER (0 = lowest score, not responding to gustatory stimulation; 7 = highest score, responding to water and all six sucrose concentrations). As shown before [20], [27], [28], we found that high strain workers were more responsive to sucrose compared with low strain bees (factorial ANOVA: genotype, F (1,185) = 13. 1205, p = 0. 0003; colony, F (1,185) = 0. 88636, p = 0. 3540). The sucrose response is a defining character difference between pollen-hoarding strains [16], [26], [54], and in our dataset the effect of genotype was significant in IRS knockdowns (Fisher' s LSD: p = 0. 0184) as well as controls (Fisher' s LSD, p = 0. 0001, Figure 6A). In contrast, IRS RNAi did not influence the bees' sucrose response (factorial ANOVA: treatment, F (1,185) = 0. 8823, p = 0. 3488). There was also no interaction between the treatment and genotype factors (F (1,185) = 0. 7861, p = 0. 3764). A validation test in wild type (n = 40−41, Figure 6B) supported that worker sucrose responsiveness is not strongly affected by reduced peripheral IRS expression (two-tailed Student' s t-test, T (1,79) = 1. 6928, p = 0. 0945). An influence of IRS expression on foraging choice but not the sucrose response system of worker bees, could point to a function of IRS in behavioral regulation that is separate from known roles of vitellogenin: Honey bee vitellogenin encodes a multifunctional yolk protein precursor [25]. The gene is expressed in fat body and affects worker sucrose responsiveness, foraging onset, foraging choice, and lifespan [30], [49], [55]. RNAi-mediated knockdown of vitellogenin increases sucrose responsiveness in wild-type bees, leading to higher GRS [49]. In our experiment however, GRS remained constant despite IRS RNAi. This finding led us to predict that when IRS is knocked down, vitellogenin expression remains unchanged. To test this hypothesis, we measured the amount of vitellogenin transcript in the fat body of IRS knockdowns and controls (selected strains, n = 18; wild type, n = 12). As established previously, the level of vitellogenin mRNA was significantly different between high and low pollen-hoarding strain bees (factorial ANOVA: strain, F (1,59) = 14. 3995, p = 0. 0004). Young (less than 15 day-old) high strain workers are characterized by elevated vitellogenin expression levels compared to same-aged low strain bees [15], [48]. In our experiment, this pattern was confirmed in the data from IRS knockdowns (Fisher' s LSD, p = 0. 0202) and controls (Fisher' s LSD, p = 0. 0003, Figure 6A). Moreover, and as predicted, IRS RNAi did not influence the amount of vitellogenin transcript overall (factorial ANOVA: treatment, F (1,59) = 0. 9660, p = 0. 3297). A planned comparison in each strain (Student' s t-test), however, indicated that low pollen-hoarding strain bees tend to reduce vitellogenin expression after IRS RNAi (T (1,31) = 1. 8274, p = 0. 0386, Figure 7A). This response was not paralleled in high strain workers (T (1,32) = 0. 1637, p = 0. 4355). Wild-type (Figure 7B) also did not show an effect of IRS RNAi on vitellogenin (two-tailed Student' s t-test, T (1,22) = −0. 1720, p = 0. 8650). Here, we show that IRS can affect the foraging decisions of an insect. Knockdown of peripheral IRS gene expression led 10–15 day-old worker honey bees of two standard genetic backgrounds to collect less nectar and to bias their foraging effort toward pollen. The effect of IRS on foraging behavior was subtle but significant. Modest influences are the common denominator of intrinsic behavioral affectors in worker bees, including the vitellogenin gene [30], the TOR (target of rapamycin) signaling pathway, and fat body adiposity [35, and references therein]. Worker behavioral traits, including food-related task performance, are complex quantitative genetic characters [31]–[34] that also are modulated by social environmental factors like the amount of larval brood and stored food-resources in colonies [19]. Many genes that influence honey bee behavior, therefore, may not have major effects [24]. Before obtaining behavioral data, we validated RNAi in 7 day-old bees (Figure 1, Figure 2, Figure 3, Figure 4). IRS mRNA and protein levels were measured in these workers and not in the bees from our behavioral experiment, because transcript abundance can be influenced (and thus confounded) by the considerable laboratory handling that is required for collection and quantification of honey bee foraging loads. Yet, RNAi can last up to 25 days in honey bee workers [30], [46], and more than 4 months in the flour beetle Tribolium castaneum [56]. In other insect species, such as aphids [57], [58] and termites [59], RNAi-mediated gene-silencing is not as long-lasting, but the transient effect is sufficient to induce enduring changes in life-history. Thus, the cumulative evidence from insect functional genomics, in combination with our treatment-specific results, strongly suggests that IRS RNAi persisted beyond the 7th day validation point. We used wild-type honey bees to validate the RNAi tool, and to show that connections between IRS and sucrose response, and between IRS and vitellogenin expression, could be generalized. Yet, only the standard stocks of high and low pollen-hoarding strains were used to test whether knockdown of peripheral IRS expression could influence foraging behavior. Honey bee foraging choice is a complex quantitative trait: it is governed by many genes and some loci are highly epistatic [34]. Effects on behavior might be undetectable if one gene in such networks is perturbed within a highly heterogeneous group of animals, like wild-type honey bees. Wild-type colonies differ in levels of pollen-hoarding, and wild-type workers show variation in food-related behavior [17], [25]. Within each of the standard pollen-hoarding strains, such variance is present but reduced, and the well-documented differences between the genotypes can be controlled for so treatment effects are more easily detected [48]. Therefore, we assumed that the effects of peripheral IRS RNAi were more likely to be revealed by using these two standard genetic backgrounds in our test of behavior. Artificial selection can result in spurious phenotypic associations, and it can be relevant to ask whether results from selected stocks can be generalized to unselected animals (wild type) [60]. Pollen-hoarding has affected a suite of traits in worker bees, including sucrose responsiveness (Figure 6), and vitellogenin expression (Figure 7), in addition to behavior [15], [17], [24], [27], [48]. The majority of these trait-associations are tested and verified to extend to wild type [16], [24], [25], [29]. Thus, it is likely that a set of worker traits including food-related behavior are pleiotropically regulated, and that the underlying gene network responded to artificial selection on pollen-hoarding [61]. This network can be represented in the pln1-pln4 QTL, where IRS is a positional candidate gene. The pln network has been mapped in different genetic sources of honey bees, which suggests that it is generally important for worker behavior [34]. Genetic background, however, affects both gene expression (as shown in Figure 1, Figure 2, and Figure 7) and behavior (as exemplified in Figure 5 and Figure 6), and thereby, our data on foraging behavior are not generalizable. Yet, the contributions from this study do not only draw from an ability to generalize to wild-type bees. Rather, the results serve as a first illustration of a role of peripheral IRS in behavioral control. We identify a behavioral outcome of IRS down-regulation that is independent of genotype: the increased preference for a protein source (pollen). However, we also reveal that the behavioral bias toward protein can be achieved through genotype-specific behavior. The strain selected for a high level of pollen-hoarding responded to reduced peripheral IRS expression by collecting smaller nectar loads and larger pollen loads than controls, resulting in a significant increase in the proportion of pollen collected. Overall, the total food load did not change. The strain selected for a low level of pollen-hoarding, on the other hand, did not compensate for reduced nectar loading by collecting more pollen. Thereby, the total food load declined. We propose that these behavioral responses can be explained if the foraging choice behavior of the worker honey bees is jointly influenced by fat body IRS and vitellogenin expression. Our explanation builds on three insights; that the total load mass of bees has an upper limit during foraging and therefore nectar vs. pollen loading is negatively correlated [52]; that vitellogenin expression encourages pollen loading [15], [25], [30], and, that vitellogenin protein may reduce IIS transduction [55], [61], [62]. Explicitly, workers decrease nectar loading in response to IRS down-regulation (Figure 5A), and in the presence of high vitellogenin levels available loading-capacity fills up with pollen (high strain, Figure 5, Figure 7A). The general pollen bias of high strain bees is consistent with this explanation, as the higher intrinsic vitellogenin level of this genotype would reduce IIS transduction and encourage pollen loading also in unmanipulated workers. In the low strain, conversely, lower intrinsic vitellogenin levels may normally encourage IIS transduction and nectar loading. And, when IRS is artificially suppressed in conjunction with low (and further declining) levels of vitellogenin expression (our experiment), reduced nectar loading is not counterbalanced by release of pollen foraging behavior. As a result, the total load mass declines (low strain, Figure 5, Figure 7A). Vitellogenin is a glyco-lipoprotein that may convey a general signal of fat body adiposity [63]. In Drosophila, central IIS can be regulated remotely by nutrient sensing in fat body cells, but increased nutrient availability is associated with increased IIS in the fly [44]. The inverse influence of nutrition (or vitellogenin action) on IIS in honey bees is under study but poorly understood [55], [61], [62]. Correlations in our data may add to this investigation: high strain bees have high vitellogenin transcript abundance and somewhat increased IRS mRNA levels compared with low strain bees (Figure 1A, Figure 7A). These relationships could imply that vitellogenin does not influence IIS by reducing IRS expression. It remains to be tested whether the elevated amount of IRS transcript in high strain bees is a compensatory response to reduced IIS transduction. Manipulation of IIS pathways can disrupt energy homeostasis and metabolism and produce extreme hyper- and hypoglycemic states leading to changes in food-related behavior [39], [64]. Could similar processes influence our results? In Drosophila, circulating blood sugar levels increase if ILP secretion is suppressed [65]. However, mutations in the fly IRS gene homologue chico lead to elevated lipid levels but the amount of circulating carbohydrate is unchanged [66]. Indeed, it has been suggested that ILPs may not be primary regulators of glucose homeostasis in insects: Adipokinetic hormone (AKH), an endocrine factor with functions similar to glucagons, may govern global carbohydrate levels instead [67]. Thus, if energy homeostasis is similarly controlled in honey bees and fruit fly, it is less probable that the behavioral changes we observe here result from non-physiological hyperglycemia. This conclusion is supported by general results from high and low pollen-hoarding strain bees, which do not differ in baseline blood glucose levels or in blood glucose response to diets of varying sugar concentration (Supplementary Figure 1 in Text S1). The genetic differences between the strains (which likely influence IIS processes [34]), thereby, may not confer measurable differences in glucose homeostasis. Many questions remain unanswered about how nutrients, vitellogenin, and IIS modulate physiology and behavior in honey bees. In this context, the work presented here represents the first successful gene knockdown of a central and conserved IIS pathway gene, and provides the first look at consequences for behavior. The honey bee is a study system in metabolic biology, sociobiology, behavioral biology, and neuroscience [50]. Thus, in addition to revealing a role of IRS in worker foraging behavior, our results provide tools for research on how life-histories are affected by metabolism, brain chemistry, and social behavior. Like eating behavior in mammals, foraging behavior in the honey bees is a complex syndrome influenced by genotype, physiological state, environment, and social needs. Much remains to be discovered about the behavioral physiology of food choice. This research is a priority as obesity-related disorders claim an increasing human health and economic toll. Our data are first to show that peripheral IRS expression can influence an insect' s foraging choice between protein and carbohydrate sources. This finding sets the stage for comparative work that can increase our knowledge on the biology of food-related behavior. Bees were maintained at the Honey Bee Research Laboratory at the Arizona State University Polytechnic Campus. Two high pollen-hoarding strain colonies, two low pollen-hoarding strain colonies, and two wild-type colonies were used as donors of experimental workers. To obtain the bees, queens were caged on a wax comb and allowed to lay eggs for 24 h inside the colony. Subsequently, the combs were removed and marked according to source before the brood was co-fostered in wild-type colonies. After 20 days, the combs were collected and put in an incubator where the bees emerged at 34°C and 80% relative humidity. The most recent honey bee genome assembly identifies XM_391985 as IRS. In a former genome release (version 3), IRS was identified as GB11037-RA, which differed from XM_391985 by the presence of an extra exon. We cloned IRS from total RNA isolated from several adult tissues (worker brains, fat bodies, and ovaries) to capture putative alternate splicing of the gene. Forward and reverse primer 5′ CACAACCGCAATCTCAGTC 3′; 5′ AACATAGTCGGCAGGTGGAC 3′, respectively, were used. Four independent clones from each tissue were sequenced. The data confirmed that XM_391985 is a correct sequence for IRS, and did not detect alternative splicing. To produce cDNA template for double stranded RNA (dsRNA) synthesis, a 700 bp fragment from the open reading frame of the IRS (XM_391985) mRNA sequence was cloned by forward and reverse primer 5′-TTTGCAGTCGTTGCTGGTA-3′; 5′-GCTTAAAGCCGGATAACGTG-3′, respectively, into pCR® 4-TOPO® vector using the TOPO TA cloning kit (Invitrogen). Cloning followed the instructions provided by the manufacturer. Several clones were verified by sequencing. For dsRNA synthesis, PCR primers with T7 promoter sequences (underlined) were used. The cloned cDNA fragment was used as a template for PCR, with 5′-TAATACGACTCACTATAGGGCGAGCGAACCGGTAGTCGTAAAG-3′ and 5′-TAATACGACTCACTATAGGGCGAGCAGTGATCAAACGTGGCTT-3′ as forward and reverse primer, respectively. The resulting product was 583 bp long. As control, green fluorescent protein (GFP) dsRNA was synthesized from AF097553 template, as previously described [46], [48], [49]. PCR products were excised from low melting temperature 1% agarose gels, purified using Qiaquick Gel Extraction Kit (Qiagen). The dsRNA was then made using AmpliScribe T7 transcription kit (Epicentre Biotechnologies) following the manufacturer' s protocol. dsRNA was purified using phenol: choloform extraction and run on a 1% agarose gel for verification of size and purity [58]. The final dsRNA concentration was adjusted to 10 µg/µl in nuclease free H2O. Newly emerged workers (high and low pollen-hoarding strains plus wild type) were randomly assigned treatments and marked with paint (Testors Enamel, Testor Corporation) to indicate treatment identity. Treated bees were injected intra-abdominally with either dsRNA against the IRS gene or, with green fluorescent protein (GFP) -derived dsRNA to establish a control, following general procedures for knockdown of gene expression in honey bee fat body [30], [46], [49]. The injection volume was 3 µl. After dsRNA injection, bees were introduced into two host colonies with a background population of about 5,000 wild-type bees. Fat bodies and brains were dissected from 7 day-old marked bees, and tissues flash-frozen in liquid nitrogen and stored at −80°C until use. RNA was extracted using RNeasy Mini Kit (Qiagen) including DNase treatment. For mRNA quantification between control and IRS knockdown workers; two step (real time) qRT-PCR was performed in triplicate using ABI Prism 7500 (Applied Biosystems), and the data were analyzed using the Delta-Delta CT [68] method with actin (GenBank: XM_623378) as housekeeper gene. This gene is stably expressed in different honey bee tissues, and provides a reference for studies of gene expression in the bee [69], [70]. By monitoring negative control samples (without reverse transcriptase) and melting curves, we could verify that the qRT-PCR assay was not confounded by DNA contamination or primer dimmers [71]. In situ hybridization was performed according to a modified protocol based on Osborne and Dearden [72] and optimized for honey bee fat body. Fat bodies were fixed in buffer (4% formaldehyde, 20 mM KH2PO4/K2HPO4, pH 6. 8,90 mM KCl, 30 mM NaCl, 4 mM MgCl2) [73] at 4°C overnight with shaking, then washed three times in PBS. The samples were dehydrated through a methanol series and stored in methanol at −20°C. Rehydration was accomplished with a methanol series and followed by PTw washes (PBS +0. 1% Tween-20). Fat bodies were digested with 20 µg/mL Proteinase K for 15 min, rinsed in PTw, and postfixed for 15 min in PTw with 4% formaldehyde. After rinsing five times in PTw, samples were transferred to 500 µl of hybridization buffer (50% deionized formamide, 5×SSC, 1 mg/ml yeast tRNA, 100 µg/ml salmon sperm DNA, 100 µg/ml heparin, 1xDenhardt' s Solution, 0. 1% Tween 20,5 mM EDTA) and prehybridised at 60°C for 2 h. Hybridization was conducted in a hybridization buffer with 2 ng/µl specific IRS RNA probe labeled with digoxigenin (DIG). To remove unbound probe, fat bodies were washed at 60°C in each of a series of pre-warmed wash solutions for 30 min in the order [74]: 75% hybridization buffer +25% 2×SSC, 50% hybridization buffer +50% 2×SSC, 25% hybridization buffer +75% 2×SSC, 100% 2×SSC, 0. 2×SSC. Then, the samples were washed at room temperature 10 min in the following solutions: 75% 0. 2×SSC +25% PTw, 50% 0. 2× SSC +50% PTw, 25% 0. 2× SSC +75% PTw, 100% PTw. The samples were blocked with 0. 1% sheep serum in PTw for 20 min at room temperature, followed by incubation with a 1∶ 2,000 dilution of Anti-DIG-alkaline phosphatase conjugated Fab fragments (Roche Molecular Biochemicals) in blocking buffer at 4°C overnight. Tissues were then washed three times in alkaline phosphatase buffer (1 h). The color reactions were developed by BM purple alkaline phosphatase substrate precipitating at 4°C overnight. Reactions were stopped by dilution in PTw. The color reactions were developed by BM purple AP substrate precipitating at 4°C overnight. Reactions were stopped by dilution in PTw. The samples were visualized on an upright microscope (Axio Imager A1, Carl Zeiss Microimaging) at 200× magnification and photographed (Axiocam MRc5, Zeiss Microimaging). Fat body and brain tissues were ground for 1 min in 150 µl and 50 µl extraction buffer, respectively (20 mM Tris, 150 mM NaCl and 5 mM EDTA) supplemented with protease inhibitor (Complete, Mini Protease Inhibitor Cocktail Tablets; Roche Applied Science) on ice. Samples were centrifuged at 6,000×g for 20 min, and the supernatant was transferred into a new tube. The total protein concentration in this fraction was quantified using Bradford reagent [75]. Aliquots of individual samples, each with 100 µg protein, were then subject to SDS-PAGE on 10% gels (Promega) and transferred onto PVDF membrane (Bio-Rad). Non-specific protein binding was blocked with 3% instant non-fat dry milk (BestChoice) overnight. Preabsorption was used to determine the specificity of the antibody toward IRS peptide antigen. Briefly, purified antibody (1. 5 µg/ml) and the antigen peptide (0. 2 µg/ml) were mixed in the blocking solution (3% Milk solution in 1XPBST) in a total volume of 15 ml, and incubated on a rocking platform for 1 h. Membranes were probed either with this preabsorption solution for 1 h, or with purified IRS antibody (1∶500) in 15 ml blocking solution for 1 h. These incubations were followed by 3 washes with 1XPBST at 10 min interval. Membrane-bound antigen-antibody complexes were visualized with horseradish peroxidase-conjugated goat anti-rabbit IgG (GE healthcare) at a dilution of 1∶1,000 and detected with Western Lightning Chemiluminescence reagent (PerkinElmer) on a Versa-Doc imaging system (Bio-Rad). IRS immunoreactivity identified a band of about 130 kDa, similar to the predicted molecular weight of honey bee IRS (129 kDa, Protein Calculator v3. 3, http: //www. scripps. edu/~cdputnam/protcalc. html). dsRNA injections took place over two days for both of two experimental colonies, following the procedures described above. For every colony replicate, we prepared 150 bees from each treatment group and pollen-hoarding strain. All bees were marked with paint to indicate treatment group identity (IRS RNAi or GFP control) before they were introduced into the nests. Each experimental colony had a background population of about 5,000 wild-type bees. The experimental bees were allowed to mature. When bees from both treatment groups and genotypes were observed returning from foraging trips (after 10 days), collection of foragers was initiated. Foragers were collected over a five-day period during peak foraging hours [30]. Pollen loads were removed from the left corbicula and weighed. We expelled the nectar from foragers' honey stomachs into pre-weighted capillary tubes to measure nectar load weight with a digital balance as described before [21], [53]. Sucrose concentration was measured using a digital refractometer (Misco). The same protocols for dsRNA injection (n = 100) and sample collection (above) were used to obtain treatment and control workers for the measure of gustatory responsiveness and vitellogenin transcript levels. The 11 day-old high and low strain bees were collected in the morning and placed individually in the cylindrical mesh cages. Each bee was chilled until it showed first signs of immobility. It was then mounted in a metal holder and fixed with two strips of adhesive tape between head and thorax and over the abdomen [76]. After 1 h, gustatory responsiveness was tested using the proboscis extension response (PER). The investigator was blind to the treatment identity of the bees. Each worker was tested by touching both antennae with a droplet of H2O followed by a concentration series of 0. 1,0. 3,1, 3,10,30% sucrose. The inter-stimulus interval was 5–7 min. The interval was variable with the number of individuals tested at one time, usually 40–60 bees per test. A bee was observed to ‘respond’ to stimulation by fully extending its proboscis when a drop of water or sucrose was touched in turn to each antenna. The sum of the responses elicited during the test series represented the gustatory response score (GRS) of the bee [54]. After ending the test, the bees were assessed for their response to honey. Bees that did not respond to honey were not used in the subsequent data analysis, because we could not exclude that these workers were in poor condition or dead. For the remaining bees, GRS ranged between 0 (response to honey, but no response to H2O and any of the sucrose solutions) and 7 (response to all solutions including H2O). For quantification of vitellogenin gene expression, mRNA was extracted from a parallel set of worker bees. As for IRS, qRT-PCR was used to quantify vitellogenin transcript levels in fat body tissue (details above on the qRT-PCR procedure). Forward and reverse primer was 5′-GTTGGAGAGCAACATGCAGA-3′; 5′-TCGATCCATTCCTTGATGGT-3′, respectively. The IRS gene expression data were log-transformed to approximate normality [70], [77]. The resulting values conformed to assumptions of ANOVA as assessed by normal probability plots of residuals was well as by Bartlett and Levene' s tests for the homogeneity of variances. A factorial ANOVA was used to validate the efficacy of RNAi. The behavioral data on nectar loads were square root transformed. A factorial ANOVA was used for initial exploration of the data on foraging behavior, which passed examination of normal probability plots on the residuals of the analysis, and also the homogeneity of variances tests (Bartlett, Levene). Yet, the variables for foraging load are not independent: when a worker collects more nectar her pollen loading-capacity is reduced, causing nectar and pollen load-weights to be negatively correlated. Thus, separate main effects ANOVA' s were used for the subsequent tests. Post hoc analyses were performed with the Fisher LSD test. Factorial ANOVA and Student' s t-test were used for the study of GRS scores and vitellogenin gene expression (log-transformed transcript levels), as the datasets conformed to assumptions of parametric tests (see above). One-tailed tests were used when appropriate, i. e., if an a prior expectation was established. All analyses were performed with STATISTICA 6. 0 (StatSoft).

Title: Down-Regulation of Honey Bee IRS Gene Biases Behavior toward Food Rich in Protein Summary: Food choice, food handling, and eating are aspects of food-related behavior that can become pathological, as seen in the public health problems of obesity and diabetes. Thus, the insight that molecules from the body can bind to brain cells and signal and change food-related behavior is of biomedical interest. One such molecule is insulin, which binds to cells via receptors attached to the insulin receptor substrate protein, IRS. Insulin-like systems are found in all multi-cellular animals, and receptors with IRS are found in many cell types, including fat and muscle where receptor-binding regulates glucose uptake. However, it is unknown whether signaling to these "peripheral" tissues, in contrast to brain, have behavioral consequences. We suppress the gene encoding for IRS protein in the fat tissue of honey bees, insects with advanced food-related behavior. In response, animals collected less carbohydrate-rich food (sugar-containing nectar) and biased their foraging toward pollen, a protein source. Sensory sensitivity to sugar influences honey bee foraging behavior, but we show that this sensitivity remained unaltered when the IRS gene was suppressed. This study identifies a new molecular pathway that may regulate food-hoarding in bee colonies and shows that food-related behavior can be influenced by insulin-like signaling to peripheral cells.

lay_plos

en

Write a title and summarize: Flubendazole, originally developed to treat infections with intestinal nematodes, has been shown to be efficacious in animal models of filarial infections. For treatment of filarial nematodes, systemic exposure is needed. For this purpose, an orally bioavailable amorphous solid dispersion (ASD) formulation of flubendazole was developed. As this formulation results in improved systemic absorption, the pharmacokinetic and toxicological profile of the flubendazole ASD formulation have been assessed to ensure human safety before clinical trials could be initiated. Safety pharmacology, toxicity and genotoxicity studies have been conducted with the flubendazole ASD formulation. In animals, flubendazole has good oral bioavailability from an ASD formulation ranging from 15% in dogs, 27% in rats to more than 100% in jirds. In in vivo toxicity studies with the ASD formulation, high systemic exposure to flubendazole and its main metabolites was reached. Flubendazole, up to high peak plasma concentrations, does not induce Cmax related effects in CNS or cardiovascular system. In repeated dose toxicity studies in rats and dogs, flubendazole-induced changes were observed in haematological, lymphoid and gastrointestinal systems and in testes. In dogs, the liver was an additional target organ. Upon treatment cessation, at least partial recovery was observed for these changes in dogs. In rats, the No Observed Adverse Effect Level (NOAEL) was 5 mg (as base) /kg body weight/day (mg eq. /kg/day) in males and 2. 5 mg eq. /kg/day in females. In dogs, the NOAEL was lower than 20 mg eq. /kg/day. Regarding genotoxicity, flubendazole was negative in the Ames test, but positive in the in vivo micronucleus test. Based on these results, in combination with previously described genotoxicity and reproductive toxicity data and the outcome of the preclinical efficacy studies, it was concluded that no flubendazole treatment regimen can be selected that would provide efficacy in humans at safe exposure. Onchocerciasis is a neglected tropical disease caused by the parasitic worm species Onchocerca volvulus, which spreads through bites from infected black flies. The presence of larvae in the skin causes several symptoms, including intolerable itching. Larvae can migrate to the eye and cause decreased vision and blindness. Adult worms live in nodules in the skin, can survive for 10–15 years and produce thousands of larvae per day. Current treatment of onchocerciasis relies on three drugs, albendazole, ivermectine and diethylcarbamazine, agents working primarily against microfilarial stages. In tropical medicine, there is a need for a macrofilaricidal drug that safely kills adult filarial worms. [1,2] Flubendazole, originally discovered and developed by researcher Dr. Paul Janssen and his team, was first approved for human use in 1980 to treat soil transmitted helminths (STH), also known as intestinal worms. This methylcarbamate benzimidazole anthelmintic has been shown to have a marked macrofilaricidal effect on many filarial species. [2] Oral flubendazole formulations commercialized for the treatment of STH (trademarks Flubenol, Fluvermal and others) are very poorly absorbed. For treatment of STH, flubendazole acts locally in the gut. In vivo activity of flubendazole against a variety of filariid species has been reported in animals and man after parenteral administration indicating systemic exposure is needed for the treatment of onchocerciasis. For this purpose, an orally bioavailable amorphous solid dispersion (ASD) formulation was developed. ASD is an approach to formulate poorly water-soluble drugs in the amorphous form, for the enhancement of dissolution rate and bioavailability. Because of the significantly higher systemic exposure anticipated from the ASD formulation, the safe evaluation of this formulation in clinical trials could not be supported by nonclinical safety studies performed for the marketed oral flubendazole formulation. In the nonclinical safety studies performed in support of flubendazole for STH, systemic exposure was very low. The set of nonclinical studies performed for the safety evaluation of the ASD formulation and their design including number of animals used, were based on international standards described in guidelines of the International Conference on Harmonisation (ICH) of Technical Requirements for Registration of Pharmaceuticals for Human Use. ICH guidelines promote safe and ethical development of pharmaceuticals and reducing the use of animals in accordance with the 3R (reduce/refine/replace) principles is part of their objectives. With the ASD formulation, two-week repeated dose toxicity studies followed by 1-month recovery were performed in rats and dogs as well as a cardiovascular safety study in dogs and a CNS safety study in rats. Flubendazole amorphous solid dispersion had been tested in an in vivo micronucleus test [1] and an explorative oral embryofetal developmental toxicity study in the rat [3]. Flubendazole was also tested in an in vivo micronucleus test in rats as a solution/suspension in polyethylene glycol 400 (PEG400) and hydroxypropyl-β-cyclodextrin. An Ames test was performed with flubendazole. The results of the evaluation of flubendazole and its main metabolites in the Ames test and the in vitro micronucleus test have been described [1]. This paper describes the results of these preclinical safety studies and their impact/implications for the potential use of this new orally bioavailable ASD formulation in humans, for the conduct of clinical trials and finally for the risk/benefit associated with the use of orally bioavailable flubendazole for the treatment of onchocerciasis in the field. After intravenous administration, flubendazole (FBZ) showed a low plasma clearance in rodents (rats and jirds) and high clearance in dogs (Table 1), a medium volume of distribution and a short half-life in the 3 species. After oral administration, the bioavailability is > 100% in jirds, 27% in rats and 15% in dogs assuming the same clearance after intravenous and oral administration. Two metabolites of flubendazole were measured in plasma: the hydrolyzed flubendazole (H-FBZ) and the reduced flubendazole (R-FBZ) as these 2 metabolites might be potentially active. (Table 2) The plasma exposure ratios between parent and H-FBZ were 0. 5 in jirds, 0. 9 in rats and 1. 7 in dogs. The plasma exposure ratios between parent and R-FBZ were 0. 04 in jirds, 0. 35 in rats and 2. 8 in dogs. Data available from the Dryad digital repository: https: //doi. org/10. 5061/dryad. 5vv774m [4] Flubendazole as currently formulated for the treatment of gastrointestinal parasites has poor systemic availability when given orally. Due to its poor bioavailability and solubility, the original oral formulation induces limited systemic or gastrointestinal toxicities and is negative in the bone marrow micronucleus tests. [1] Flubendazole has been shown to be highly efficacious in animal models of filarial infections when dosed subcutaneously. The clinical efficacy of flubendazole for treatment of onchocerciasis has also been reported after intramuscular administration of a suspension in humans. However, intramuscular administration resulted in serious injection site reactions. [5] Consequently, it is preferred to increase systemic availability of flubendazole by improved oral formulations. [6] Several orally bio-available formulations were developed. The oral ASD formulation was selected for preclinical development. As the new oral ASD formulation resulted in improved systemic absorption, preclinical development with this formulation did not only include extensive evaluation of efficacy and pharmacokinetics but also a re-evaluation of the toxicity of flubendazole including potential genotoxicity. It was anticipated that increased systemic exposure to flubendazole would result in toxicity related to the tubulin binding, the mechanism of action of flubendazole. Therefore, the purpose of the additional efficacy, pharmacokinetic and toxicity studies with the ASD formulation was to evaluate whether a treatment regimen could be identified that would result in an acceptable risk/benefit profile. In vivo oral toxicity studies with the ASD formulation described above, clearly show relevant systemic exposure to flubendazole and its main metabolites, reduced flubendazole and hydrolyzed flubendazole. (Tables 3,4, 12 and 18) In the rat and dog, the highest exposures reached at the end of 2-week repeated dosing (data in Tables 12 and 18) were multiple times higher when compared with systemic exposure in humans (less than 1 ng/ml Cmax in plasma) following treatment with the marketed flubendazole formulation at the usual dosage (100 mg once or twice a day for 3 days). [1] In the preclinical in vivo filarial efficacy studies described by MP Hübner et al., 100% efficacy could not be achieved with oral treatment. Highest efficacy achieved with oral treatment with the ASD formulation was 90% in the Litomosoides jird model at 15 mg eq. /kg/day for 10 days [7]. One hundred % efficacy was only observed with subcutaneous treatment in several models of infection at 10 mg/kg/day for 5 days. This subcutaneous treatment was associated with a Cmax of 50 ng/ml and an AUC0-24h of 1100 ng. h/ml, both on day 5 (data of Litomosoides sigmodontis study in female jirds [7]). Notwithstanding lower efficacy, oral treatment at 15 mg eq. /kg/day for 10 days was associated with much higher exposures. On day 10, Cmax was 3300 ng/ml and AUC0-24h was 20000 ng. h/ml (data of Litomosoides sigmodontis study in female jirds [7]). The pharmacokinetic profile after a single subcutaneous and a single oral dose was very different. After an oral dose at 15 mg eq. /kg, the plasma concentration decreased very rapidly, dropping below the limit of quantification after 72 hours while after a single subcutaneous injection at 10 mg/kg, sustained plasma levels were observed for at least 3 months [7]. These data indicate that prolonged exposure at low plasma concentration is probably more important for efficacy than reaching high plasma concentrations. Comparing exposures required for efficacy and those achieved in toxicity studies, we can conclude that the exposure in the oral toxicity studies with the ASD formulation, did not fully cover the exposure after oral treatment at 15 mg eq. /kg/day for 10 days in the Litomosoides jird model which was associated with 90% efficacy. However, when comparing with Cmax and AUC 0-24h of the subcutaneous treatment regimen associated with 100% efficacy in the Litomosoides jird model, exposures in the oral toxicity studies with the ASD formulation were higher. In the CNS safety study in rats and the cardiovascular safety study in dogs, a single dose up to 60 mg eq. /kg in the rat and 120 mg eq. /kg in the dog, did not result in relevant CNS findings in the rat or cardiovascular findings in the dog. In the rat, the dose of 60 mg eq. /day was associated with a peak exposure of 4330 ng/ml. (Table 4) In the dog, peak exposure was not determined but plasma concentrations measured 6. 5 hours after dosing demonstrated exposure to flubendazole and its main metabolites. Mean plasma concentration of flubendazole at 120 mg eq. /day 6. 5 hours after dosing was 186 ng/ml. (Table 3) This is however an underestimation of the peak exposure since Cmax at 50 mg eq. /kg/day b. i. d. in the 2-week repeated dose toxicity study in male dogs on day 1 was 1660 ng/ml. These data indicate that flubendazole up to high peak plasma concentrations, does not induce Cmax related effects in the central nervous system or cardiovascular system. In the 2-week repeated dose toxicity studies in rats and dogs, main flubendazole-related changes were observed in haematological and lymphoid systems, gastrointestinal system and testes. In the dog, the liver was an additional target organ of toxicity of flubendazole. (rat data in Tables 7,8, 9,10 and 11; dog data in Tables 14,15,16 and 17) Flubendazole-induced changes in haematological, lymphoid and gastrointestinal systems were considered the consequence of its binding to tubulin. Like many benzimidazoles, flubendazole binds to the tubulin protein to the same site as colchicine. This binding results in inhibition of the polymerization of tubulin and thus disruption of the mitotic spindle. [1] For colchicine it is described that disruption of the microtubular network results in arrest of mitosis in metaphase because chromosome separation depends on microtubular function, thus inhibiting cell division. The organ systems with the highest turnover rates such as bone marrow and the gastrointestinal tract are the most vulnerable and most readily affected. [8] These organ systems have also been described to be affected by treatment with other benzimidazoles which is in line with their similar mechanism of action (tubulin binding). [9,10] Dosing with other benzimidazoles like albendazole, mebendazole and oxfendazole in preclinical toxicity studies also resulted in testicular changes. [9,10] For oxfendazole, the mechanisms underlying the testicular toxicity are most probably disruption of the microtubules, and degeneration of the Sertoli cells. [11] Regarding the liver toxicity observed in dogs treated with the ASD-formulation of flubendazole, there is no obvious link with the binding to tubulin by flubendazole. These flubendazole-induced changes were at least partially reversible as shown in the dog 2-week toxicity study after 1-month recovery. From a quantitative point of view, flubendazole-related changes were observed in the rat 2-week toxicity study at the mid dose and above with the low dose, i. e. 5 mg eq. /kg/day for males and 2. 5 mg eq. /kg/day for females being the NOAEL (exposures associated with NOAEL in Table 12). In the dog 2-week toxicity study, flubendazole-related changes were observed at the low dose and the NOAEL could not be established. Since we do not know the NOAEL in the dog study, in case of clinical trials, careful evaluation for potential flubendazole-induced changes would be warranted by monitoring for gastrointestinal symptoms, haematology and clinical chemistry changes for potential effects on bone marrow and liver and by sperm evaluation for potential testicular toxicity. Contraception for males during 3 months after dosing should be recommended because of the risk of potential impact of testicular toxicity on offspring. Since the testicular toxicity is probably, at least partially, related to disruption of the microtubular network and hence potential disruption of chromosome separation, it can be associated with chromosomal damage. For DNA damage, it has been described that it can be transmitted from fathers to offspring [12]. Results of an explorative oral embryofetal developmental toxicity study in the rat have been published by M. Longo et al. [2] They also used a flubendazole-ASD formulation (developed and provided by Abbvie) at dose levels of flubendazole of 2,3. 46 and 6. 32 mg eq. /kg/day. Pregnant female Sprague-Dawley rats were dosed on gestational day (GD) 9. 5 and 10. 5 and embryos/fetuses were evaluated on GD 11. 5,12. 5 or 20. At 2 mg eq. /kg/day, flubendazole did not interfere with rat embryofetal development (Cmax = 389 ng/ml, AUC0-24h = 2190 ng. h/ml after single administration). From 3. 46 mg eq. /kg/day (Cmax = 546 ng/ml, AUC0-24h = 4830 ng. h/ml after single administration) onward, flubendazole markedly reduced embryonic development by GD 12. 5. On GD 20,80% of fetuses showed malformations. [2] Based on these results, flubendazole is considered a strong teratogen. Inclusion of women of childbearing potential should therefore, only be considered in well controlled clinical trials of limited size with appropriate contraceptive measures. Flubendazole is a potent aneugen in vitro. This aneugenicity is the consequence of the binding of flubendazole to the tubulin protein, inhibiting polymerization of tubulin and consequently causing mitotic spindle disruption. Spindle poisons all have the potential to induce polyploidy and aneugenicity. [1] The hydrolyzed metabolite of flubendazole is negative in the in vitro MNT, but the reduced metabolite (R- and S-forms) shows both aneugenic and clastogenic activity. Like flubendazole itself, both metabolites are negative in the Ames test. [1] The in vivo micronucleus test with the ASD formulation of flubendazole published by Tweats et al. also showed evidence of induced aneugenicity. [1] This is in line with the results of the in vivo micronucleus test with an aqueous solution/suspension of flubendazole in demineralised water containing polyethylene glycol 400, hydroxypropyl-β-cyclodextrin and HCl, described in this article. In this study, flubendazole induced structural and/or numerical chromosome aberrations in erythrocytes of rat bone marrow from a dose of 5 mg/kg/day onwards, at similar exposure levels as with the ASD formulation. (Table 20) [1] Aneugens are accepted as having threshold dose responses with a clear mode of action, which in the case of flubendazole would be inhibition of tubulin polymerization. [1] However, clastogens are not considered to have a threshold dose response and since the reduced metabolite of flubendazole shows clastogenic activity, a threshold approach cannot be applied for the positive effects in the in vivo micronucleus test. Because of the risk of carcinogenicity linked to the aneugenicity and clastogenicity, no clinical trials in healthy volunteers are allowed and the duration of clinical trials in patients should be limited to single dose only. However, the preclinical efficacy studies showed highest activity upon prolonged exposure after a subcutaneous administration. Such prolonged exposure to a compound with the formation of a potential clastogenic metabolite is associated with a risk for carcinogenicity. Based on the results of the preclinical toxicity and genotoxicity studies described and discussed in this article, it was concluded that the risk/benefit associated with the use of orally bioavailable flubendazole for the treatment of onchocerciasis in the field is unfavorable. Especially the clastogenicity of the reduced metabolite of flubendazole in combination with the need for exposure beyond one day for efficacy based on the preclinical efficacy studies described by MP Hübner et al. [7] resulted in risk (for carcinogenicity) which outweighed the benefit. All work was conducted in accredited laboratories and according to international guidelines. Safety pharmacology studies in animals were carried out by Charles River Laboratories France Safety Assessment SAS (previously WIL Research Europe-Lyon, France). The study design was in general compliance with the following animal health and welfare guidelines: Guide for the care and use of laboratory animals, 2011; Decree n° 2013–118 relating to the protection of animals used in scientific experiments described in the Journal Officiel de la République Française on 01 February 2013; Directive 2010/63/EU of the European Parliament and of the Council of 22 September 2010 on the protection of animals used for scientific purposes. The Test Facility is fully accredited by the Association for Assessment and Accreditation of Laboratory Animal Care International. Both rat and dog repeated dose toxicity studies were carried out by Charles River Laboratories Den Bosch B. V. (previously WIL Research Europe B. V., The Netherlands) according to their internal Standard Operating Procedures. The protocols were reviewed and agreed by the Animal Welfare Officer and the Ethical Committee (DEC 14–59) as required by the Dutch Act on Animal Experimentation (February 1997). The rat in vivo micronucleus study was performed in an AAALAC-approved laboratory of Johnson & Johnson In Belgium. Johnson & Johnson vivarium facilities meet inspection agency standards, and all animals are treated humanely and cared for in accordance with the European [13] and Belgian [14] guidelines, and with the principles of euthanasia as stated in the Report of the American Veterinary Medical Association Panel. [15] Flubendazole has a molecular weight of 313. 28, and a molecular formula of C16H12FN3O3. For the Ames assay, flubendazole was prepared as a solution in dimethyl sulfoxide (DMSO). For in vivo pharmacokinetic studies with intravenous administration, a solution of flubendazole was made in polyethylene glycol 400 (PEG400) with 20% of hydroxypropyl-β-cyclodextrin pH = 4. 2 for the rat. For the intravenous pharmacokinetic studies in the jird and the dog, a solution of flubendazole was made in 10 v/v % polyglycol/PEG400 ratio 1–1 and 35 v/v % hydroxypropyl-β-cyclodextrin at pH = 4. For oral pharmacokinetic studies and two-week repeated dose toxicity studies and safety pharmacology studies, the test article/drug product was an amorphous solid dispersion (ASD) powder with a potency of 94. 8 mg active ingredient flubendazole per g ASD powder. Because the active ingredient flubendazole only constituted 9. 48% of the ASD powder, dose levels were expressed as mg eq. /kg body weight meaning mg base/kg body weight. To calculate the amount of ASD powder equivalent to the mg base, conversion factor was as follows: 1 mg base = 10. 5 mg drug product. The test article was prepared as a suspension containing 0. 5% w/v Methocel A4M (Sigma-Aldrich) in Elix water. For the rat in vivo micronucleus test, an aqueous solution/suspension in demineralised water containing 10% polyethylene glycol 400,20% hydroxypropyl-β-cyclodextrin and HCl to pH 1. 5± 0. 1 was prepared. The pharmacokinetic studies were performed after single intravenous administration to determine key parameters such as plasma clearance, volume of distribution and half-life, and after single oral administration to determine exposure of flubendazole and its metabolites. The toxicokinetics of flubendazole and its metabolites, which is the determination of the exposure within the toxicology studies were also performed. In both studies, the plasma samples were analyzed individually for flubendazole, H-FBZ and R-FBZ using a qualified LC-MS/MS method. After preparation and addition of the internal standard, samples were precipitated with acetonitrile, mixed and centrifuged. The supernatant was evaporated to dryness under nitrogen flow at 50°C and reconstituted with a mixture of 0. 1% formic acid and acetonitrile (90/10, v/v). The extract was injected onto an Acquity UPLC BEH C18 column (50x2. 1 mm, 1. 7μm particles) (Waters, Milford, USA). The chromatographic system consisted of a Shimadzu SIL30ACMP autosampler and Shimadzu LC30 pumps (Shimadzu, Kyoto, Japan). The mobile phase was a mixture of 1% formic acid and acetonitrile with a flow rate of 0. 6 ml/min and a 2. 5-minute gradient going from 20 to 60% acetonitrile followed by a 1-minute step gradient to 98% acetonitrile. Mass spectrometric detection was performed on an API4000 triple quadrupole mass spectrometer (Sciex, Framingham, USA) with Turbo Ion Spray ionization operated in positive ion mode. Flubendazole, hydrolyzed flubendazole (H-FBZ) and reduced flubendazole (R-FBZ) were quantified against calibration samples and quality control samples, prepared in the same matrix as the study samples, by means of a qualified analytical method with the lowest limit of quantitation of 0. 2,0. 4 and 0. 2 ng/ml respectively and an upper limit of quantitation of 3000 ng/ml for all three analytes across the different studies. Flubendazole was administered intravenously by bolus at 1 and 2 mg/kg in male jirds and male rats, respectively or by a short infusion (15 minutes) in male dogs at 0. 5 mg/kg. Flubendazole was administered orally by gavage at 20 mg eq. /kg in male jirds and male rats and at 35 mg eq. /kg in male dogs. The jird and the rat were not fasted. The dogs were fasted overnight. 2h post dose, dogs were given their regular food. After intravenous administration, blood samples were collected at 0. 05,0. 25,0. 5,1, 3,7 hours after dosing in male jirds (bolus), at 0. 0117,0. 333,1, 2,4, 7 and 24 hours after dosing in male rats (bolus), at 0. 125,0. 25 (end of infusion), 0. 33,0. 42,0. 50,0. 75,1. 25,2. 25,4. 25,7. 25 and 24. 25 hours after the start of infusion in male dogs. After oral administration, blood samples were collected at 0. 5,1, 2,4, 7 and 24 hours in male jirds, rats and dogs. Plasma concentrations of flubendazole and its 2 metabolites were determined. Several pharmacokinetic parameters were determined: the maximum concentrations (Cmax), the time to reach the Cmax (tmax), the half-life (t1/2), the area under the curve from time zero to infinity (AUC0-inf), the clearance (CL) and the volume of distribution (at steady state Vdss or Vd) In the safety pharmacology studies, potential undesirable effects of flubendazole on physiological functions in relation to exposure in the therapeutic range and above were investigated. Organ systems evaluated were cardiovascular system, respiratory system (evaluation included in cardiovascular safety study) and central nervous system (CNS). Genotoxicity assessments were performed to detect if flubendazole induces genetic damage.

Title: Preclinical toxicity and pharmacokinetics of a new orally bioavailable flubendazole formulation and the impact for clinical trials and risk/benefit to patients Summary: This article describes pharmacokinetic profiles and results of safety pharmacology, toxicity and genotoxicity studies with an oral ASD formulation of flubendazole with improved bioavailability. Flubendazole administered as ASD formulation has good oral bioavailability in animals ranging from 15% to more than 100%. In in vivo toxicology studies, increased systemic exposure does not induce Cmax-related effects in CNS and cardiovascular systems. Increased exposure upon repeated dosing results in changes in haematological, lymphoid and gastrointestinal systems and in testes. In dogs, the liver was an additional target organ. These changes were at least partially reversible. Flubendazole is negative in the Ames test but positive in the in vivo micronucleus test. Because of the carcinogenic risk associated with this positive effect in the in vivo micronucleus test, exposure duration in patients should not exceed one day. Flubendazole-induced toxicity and associated risk is monitorable and controllable in patients if stringent precautions are applied in view of testicular toxicity and previously described teratogenicity. Considering both, treatment regimen needed for efficacy and outcome of toxicity and genotoxicity studies, it was concluded that the risk/benefit associated with the use of orally bioavailable flubendazole for the treatment of onchocerciasis in the field does not support further development.

lay_plos

en

Write a title and summarize: Complex traits such as obesity are manifestations of intricate interactions of multiple genetic factors. However, such relationships are difficult to identify. Thanks to the recent advance in high-throughput technology, a large amount of data has been collected for various complex traits, including obesity. These data often measure different biological aspects of the traits of interest, including genotypic variations at the DNA level and gene expression alterations at the RNA level. Integration of such heterogeneous data provides promising opportunities to understand the genetic components and possibly genetic architecture of complex traits. In this paper, we propose a machine learning based method, module-guided Random Forests (mgRF), to integrate genotypic and gene expression data to investigate genetic factors and molecular mechanism underlying complex traits. mgRF is an augmented Random Forests method enhanced by a network analysis for identifying multiple correlated variables of different types. We applied mgRF to genetic markers and gene expression data from a cohort of F2 female mouse intercross. mgRF outperformed several existing methods in our extensive comparison. Our new approach has an improved performance when combining both genotypic and gene expression data compared to using either one of the two types of data alone. The resulting predictive variables identified by mgRF provide information of perturbed pathways that are related to body weight. More importantly, the results uncovered intricate interactions among genetic markers and genes that have been overlooked if only one type of data was examined. Our results shed light on genetic mechanisms of obesity and our approach provides a promising complementary framework to the “genetics of gene expression” analysis for integrating genotypic and gene expression information for analyzing complex traits. Most complex traits such as obesity involve a diverse set of genes, intricate interplay among them and subtle interaction between genetic and environment factors. One of the first steps toward a systematic understanding of the genetic basis of a complex trait is the identification of causal genetic elements, e. g. genes, genetic markers and/or single nucleotide polymorphisms (SNPs), whose variations are responsible for the traits. The objective of this challenging task is two-fold: effectively identifying a subset of genetic elements out of a large pool of candidates whose patterns are characteristic of a trait of interest, and accurately predicting the phenotype with a model that accommodate interactions among selected genetic elements. Despite recent advances in high-throughput technologies that have produced an enormous amount of biological data, heterogeneous data types, non-linear relationships among genes and complex phenotypes have made this task difficult. Although conventional linkage analyses and association studies as well as the latest genome-wide association studies (GWAS) have produced a fruitful collection of genomic susceptibility loci for a variety of complex traits and diseases [1], [2], they have mainly been able to detect genetic elements of marginal effects while failed to respect epistatic interactions [3], [4]; as a result, they have a low power for predicting phenotypes [5]. As an intermediate between genotype and phenotype, gene expression has been proven to be a rich and valuable source of information complementary to genotype information for dissecting complex traits. On one extreme using gene expression data alone, classifiers or regressors have been built to predict disease types or stages with only a small number of disease-related genes [6]–[8]. By integrating information of genetics and gene expression, genetics of gene expression-based approaches [9]–[11] and network-based approaches [12]–[14] have been independently developed and applied to identify genes related to complex traits. Recently a few machine learning based methods have been proposed to integrate both genotype and gene expression data to not only identify relevant genes, but also predict phenotypes based on selected genes. Ruderfer et al. [15] adopted a SVM classifier to predict drug responses (i. e., sensitivity or resistance) in yeast. They showed that using both data of transcripts and genetic markers can improve prediction accuracy compared with using either transcripts or genetic markers alone. Based on the elastic net regularized regression [16], Chen et al. [17] developed Camelot to predict quantitative response (i. e. growth yield) of yeast to 94 drugs using genotype and gene expression data collected from drug-free conditions from yeast segregants. Compared with the work by Ruderfer et al. [15], Camelot was able to make accurate quantitative prediction on various drug treatments as opposed to dichotomic classes of drug response. Camelot also emphasized greatly on causal inference by incorporating a priori knowledge and adopting post statistic tests to select only handful genetic makers and expression transcripts as phenotype predictors. For example, for predicting the hydrogen peroxide response, only a single gene, DHH1, passed their pre-filtering criteria and was then used to construct the final prediction model. Although appropriate for downstream experimental validation as Camelot always make the most conservative choices, it remains unknown whether its filtering steps could indeed help improve prediction accuracy and whether it would otherwise prevent further novel discovery besides the factors known to have large marginal effects. Random Forests (RF) [18], an ensemble of classification or regression trees, has recently been successfully applied in various biological studies [19]–[23]. RF has many desirable characteristics that make it well suited for integrating both genotypic and gene expression information. It is well adapted for variable selection for high-dimensional data with competing prediction accuracy compared to the state-of-the-art machine learning techniques. RF is able to accommodate categorical (e. g. genotype) and continuous (e. g. gene expression) data. It can be used when the number of variables substantially exceeds the number of observations (e. g. thousands of SNP markers and probes of gene expression versus a few hundred samples of subject) [19]–[23]. Moreover, RF supports possible interactions among variables [4], which is critical for systems-biology studies where interplays between genetic (e. g. epistatically interacting SNPs) and gene expression (e. g. coactivator/corepressor) must be taken into consideration. While promising, however, conventional RF algorithms have several drawbacks that limit their success on large biological problems. Firstly, even though RF allows possible interactions among variables, it does not incorporate possible correlation among variables; even worse, with correlated variables, it suffers from biases introduced in measuring variable importance (VI) [24], [25], which can result in incorrect or misleading variable rankings. Secondly, RF' s prediction accuracy may decline significantly when the proportion of truly informative variables among all variables is small [26]. In this paper, we develop a new method, called module-guided Random Forests (mgRF), to integrate genotypic and gene expression information to understand and possibly dissect complex relationships among different genetic elements underlying complex traits. mgRF combines the method of conventional RF and a network-based analysis to remedy the two aforementioned drawbacks of conventional RF by exploiting structural relationships, extracted from the network analysis, among different types of variables. As a test and application, we applied mgRF to the data of genetic markers and gene expression from a cohort of F2 female mouse intercross to examine its performance and demonstrate its ability to identify genetic elements that contribute to mouse weight, many of which were missed by the conventional RF algorithm. mgRF outperformed the state-of-the-art methods that combine information from multiple biological sources with more accurate predictions. Furthermore, using mgRF we investigated the interactions among multiple genetic elements underlying mouse weight. Statistically significant interactions of SNP-to-SNP, gene-to-gene, and SNP-to-gene identified by mgRF revealed genetic elements and their significant association underlying mouse weight. The results demonstrated a great expectation of mgRF as a complementary framework to “genetics of gene expression” analysis for dissecting genetic mechanism of complex traits, such as obesity. In mgRF our main objectives are to capture intrinsic structures of variable (genetic element) correlation and/or interaction and to incorporate such information in the RF framework to predict a complex phenotype. The major steps of mgRF algorithm, outlined in Figure 1, consist of the identification of variable modules from a variable correlation network (Figures 1A and 1B) and an iterative RFs construction process (Figure 1C). In the first step we construct a correlation network and identify modules in the network to group highly-correlated variables, which may be in different types, using a network clustering method such as HQCut [27]–[29]. In the second step of mgRF, we iteratively construct a series of RFs guided by the previously identified network modules. Instead of randomly sampling variables in each node of regression tree, we adopt a two-stage candidate variable sampling procedure, where we first select a subset of modules and then choose one representative variable for each of the selected modules (right panels in Figure 1C) to correct the bias of variable importance while incorporating the variable association information. Except the first RF construction, we use a modified weighted sampling to improve the prediction accuracy by prioritizing informative variables among a large pool of variables. A key element of mgRF is to correct possible bias of variable importance measure and improve the performance of RF for high-dimensional data. This is done in part by introducing a module importance (MI) to each network module identified. Initially all MI and variable importance (VI) are set to 0 so that in the first iteration the sampling of modules and variables is un-weighted. After each iteration of RF, new MIs and VIs are re-estimated (not accumulated). The values of MIs and VIs can typically converge within a small number of iterations, where little change can be observed between the last and the second to the last estimations. The final output of mgRF is an ensemble of trees as a model for future analysis and its corrected VIs (cVIs) and MIs for variable and module ranking. Details and parameter selections of the mgRF algorithm are described in Materials and Methods. To investigate the benefits of integrating genotypic and gene expression data, we examined the performance of different models on the genotypic and gene expression data of a cohort of F2 mouse intercross in a three-way comparison: (1) using only data of genetic markers (genotype-only), (2) using only data of gene expression (expression-only), and (3) using both genotypic and expression data (combined). We first compared mgRF with group lasso [30], elastic net [16], SVR-RFE [8], and the conventional RF algorithm (see Text S1) in terms of the weight regression error (Root-Mean-Square Error or RMSE) in all three types of data using 10 trials of 10-fold cross-validation. The average cross-validation RMSEs of the methods compared are shown in Figure 2. mgRF achieved the smallest average error compared to all the other competing methods in all types of data. Since we assessed each model using the same training and test data in each fold of the cross-validation, we can compute the paired t-test of RMSEs to evaluate the significance of the results. As shown in Table S1, the RMSEs of all the other methods are significantly larger (p<2. 52×10−13) than that of mgRF. Furthermore, the running time of mgRF is slightly less than the conventional RF with better prediction accuracy (Table S2). It is noteworthy to mention that SVR-RFE, RF and mgRF outperformed the linear models, group lasso and elastic net, suggesting the benefits of incorporating non-linearity between variables and the mouse weight response. In particular, we examined the RMSEs of mouse weight using mgRF. The boxplot of prediction errors on the three data types are shown in Figure 3A. The combined data have the smallest error (RMSE = 3. 80 and R2 = 0. 604), followed by the expression-only data (RMSE = 4. 13, and R2 = 0. 534), while the genotypic-only data have the highest error rate (RMSE = 5. 62 and R2 = 0. 137). Thus using either the genotypic or gene expression data alone is less effective than using the combined data. Although the standard error of RMSEs of different trials (quartile bar in Figure 3A) is relatively large comparing to the difference of mean RMSE between with and without genotypic data, there is a substantial improvement in pairwise comparisons using the same training samples (Figures 3B to 3D). The two-dimensional co-ordinates of point in each of these plots indicate the RMSEs of mgRF trained with the same set of samples but with different data types. In Figures 3B and 3C, most of the points appear under the reference diagonal line, which confirms that both expression-only and combined data achieved better performance in a single fold than the genotype-only data (paired one-tail t-test p-value≤4. 7446×10−28 and ≤1. 7272×10−32, respectively). This was probably because in general the linkage signal of genetic markers is weak (LOD score <4), while gene expression is more closely related to the phenotype than genotypes. Furthermore, mgRF using both genotypic and gene expression data outperforms using expression-only data in more than 90% of the trials (Figure 3D, paired one-tail t-test p-value≤1. 691×10−19), showing that combining genotypic and gene expression data can indeed improve the prediction power and suggesting that information of gene expression plays a role in bridging the gap between genotype variations and complex traits. The mgRF method used corrected variable importance (cVI) and module importance (MI) to identify variables and groups of variables that influence the trait of body weight. MIs were computed for network modules identified by the HQcut algorithm [27], [29], [31]. To assess and illustrate mgRF' s ability for correcting the bias of variable importance, we evaluated different regression models regarding their abilities for recovering the true variable importance associated with the known data-generating pattern in a simulation study (see Text S2). mgRF was able to accurately recover the known pattern of variables' importance and the VI measure of mgRF was more stable than the other methods in all simulations, as discussed in Text S2. When applied to the mouse weight data from a cohort of 132 samples and compared with modules identified by topological overlap matrix based methods [12], [32], HQcut produced much smaller modules, allowing only highly-correlated variables to be clustered in a module (Figure S1). HQcut identified 146,1036 and 1187 network modules (see module structures in Table S3, S4, S5) in the genotype-only, expression-only and combined data, respectively. As expected, SNPs in one module were generally in linkage disequilibrium. Genes in one module were co-expressed and potentially functionally related. There were SNPs and genes assigned to the same module in the combined data set due to the large correlation values among those gene expression and SNPs. The top-ranked genetic markers and genes in the combined data largely overlapped with those identified by genotype-only and expression-only data types indicating the stability of mgRF in terms of variable ranking. Here we reported the top-ranked modules of genetic markers and genes in Table 1 and 2. Among these top-ranked SNPs (Table 1), rs3662726 (Chromosome 5,123 Mb) is near Gofm2 (gonadal fat mass 2) QTL which has been reported to confer increased fat mass in female mouse [33]. We also examined the LOD scores of SNPs using the traditional QTL mapping. Several “hotspot” QTLs on Chromosomes 1,3, 5,7, 10,15 and 19 were partially overlapped with the top-ranked markers by mgRF (Figure 4). Table S6 lists all the top-ranked SNPs. Note that several markers with low LOD scores were assigned relative high cVIs, suggesting that a SNP with low marginal effect can be identified by mgRF because of their interaction with other SNPs, which may contribute to the variation of body weight. It is important to note that there was little overlap among the 100 top-ranked genes from group lasso, elastic net, SVR-RFE, the conventional RF algorithm, and mgRF (Figure S2A). The lack of consensus indicated that these algorithms identified their own top-ranked genes based on different (unspecified) assumptions on the given data and target models to be learned. Introduction of such assumptions seemed to be inevitable because of the lack of sufficient knowledge of the problem at hand and different objectives that these methods were devised to achieve. Nevertheless, all these methods strived to select predictive variables (genetic factors). On top of finding individual predictive genetic factors, mgRF was particularly designed to identify such predictive genetic factors whose association might contribute more significantly than individual variables at the module level because it propagated the contribution of individual variables to highly correlated neighbors, rather than fully focusing on individual genes. Table S7 lists the top-ranked genes related to mouse weight from mgRF. Among these top-ranked genes (Table 2), monoacylglycerol O-acyltrasferase 1 (Mogat1, cVI = 11. 84) in module 189 has been previously identified to be located within Chromosome 1 obesity QTL interval near D1Mit215. Within this QTL interval on Chromosome 1, insulin-like growth factor binding protein 2 (Igfbp2, cVI = 10. 94) has expression levels in liver negatively correlated with mesenteric fat pad weights [34]. Igfbp2 (appeared in module 32) has also been shown to prevent diet-induced obesity and insulin resistance in mice on overexpression [35]. In particular, module 32 contained Cyp2c37 (cVI = 9. 65), C7orf24 (cVI = 7. 43) and Gpld1 (cVI = 6. 54), which were not among the top 100 ranked genes from any of the other methods compared, probably due to their correlation with Igfbp2. Raet1d (cVI = 9. 38) in module 189 was also not identified by the competing methods (Table S8) probably due to its correlation with Mogat1. Remarkably, Cyp2c37 has been previously recognized as being associated with fat mass [10] and Gpld1 had been shown to be associated with the level of adiponectin, a hormone secreted from adipose tissue which is negatively correlated with obesity [36]. It is viable to hypothesize that other genes identified by mgRF, which were neglected by the other methods, may potentially contribute to mouse weight variation. To further assess the biological significance of the genes identified by mgRF, we conducted a Gene Ontology (GO) enrichment analysis (see Materials and Methods) on the top-ranked genes from the methods that were compared. mgRF identified more enriched biological processes than the other methods (Table S9). In particular, genes identified by mgRF were enriched with many obesity-related processes, such as regulation of lipid storage (p = 7. 17×10−06), positive regulation of cholesterol storage (p = 1. 07×10−05), regulation of growth (p = 0. 000575), and cellular response to cholesterol (p = 0. 00396). In contrast, the enriched biological processes provided by the other methods were less significant and less biologically meaningful (Tables S5B to S5E). As an example, Figure 5 shows a sub-network of some top-ranked genes from mgRF to compare the variable importance measures in mgRF and the conventional RF. The size of nodes represents relative cVIs from mgRF in Figure 5A and represents relative VIs from conventional RF in Figure 5B. In the conventional RF algorithm, one variable, Igfbp2, has a larger importance than others. As a result, the importance of Igfbp2 overshadows several other correlated variables such as Fmo3, Cyp2c37, and Raet1d, which may in fact be equally important as Igfbp2. In mgRF, several genes with the highest cVI, such as Mogat1, MGC137458, and Igfbp2, which are known to be critical to body weight, were also hub nodes in the network with many edges. It was consistent with our previous studies on the importance of hub genes in the co-expression network [37]. Although the corrected variable importance (cVI) from mgRF quantifies the contribution of a genetic factor to the prediction power, it does not indicate whether the contribution is from the genetic factor alone or from its interaction between or association with other factors. One advantage of the RF method is its ability to incorporate variable interactions, which mgRF inherited. We devised a systematic statistical test (see Materials and Methods) to assess the significance of gene-to-gene, SNP-to-SNP, and SNP-to-gene interactions revealed by mgRF. To examine the biological relevance of genes identified in gene-to-gene interactions in the mouse weight data, we first tested the functional enrichment among 160 unique genes from the top 100 most significant pairs of interactions (Table S10). Interestingly, these genes were enriched with metabolic processes such as isoprenoid metabolic process (p = 0. 00675), drug metabolic process (p = 0. 00841), and terpenoid metabolic process (p = 0. 00117), indicating obesity-related interaction among the identified genes. In particular, the pair of Avpr1a and Igfbp2 is one of the most significant interactions (p = 4. 15×10−07), both of which are also among the most predictive genes. However, only 11 (∼7%) of the 160 unique genes from the significant gene-to-gene interactions were overlapped with the top 100 most predictive genes identified by cVI (Figure S2B). This suggested that our interaction test could indeed identify genes that were less significant when examined individually. For example, macrophage receptor with collagenous structure (Marco) was observed to interact with many other phenotype-related genes (e. g. Dhrs4, Cyp2d22, and Pdia5), even though its own cVI was relatively low. Among the top-ranked SNP-to-SNP interactions, we found significant interactions between SNPs on Chromosome 5 (123 Mb) and Chromosome 19 (51 Mb) (p = 3. 34×10−11), on Chromosome 2 (96 Mb) and Chromosome 9 (61 Mb) (p = 8. 97×10−7), and on Chromosome 1 (41 Mb) and Chromosome 15 (62 Mb) (p = 2. 94×10−06, Table S11). The most significant interaction was between p45558 (Chromosome 5,123 Mb) and p44890 (Chromosome 19,51 Mb). Cis-eQTLs analysis [12] indicated that Bmp2, a key regulator of adipogenesis, was a candidate gene of p45558, and Cyp2c40, known to be presented in Fatty acid metabolism, was a candidate gene of p44890. For SNP-to-gene interactions (Table S12), there was little overlapping between genes involved in SNP-to-gene interactions and genes involved in gene-to-gene interactions (Figure S2B). Of particular interest was the interaction between SNP p45334 (Chromosome 1,77 Mb) and gene Ehhadh, where Mogat1 is one of the candidate eQTL genes of p45334 and Ehhadh is annotated in the fatty acid metabolism pathway. We compared the top 50 unique SNPs involved in SNP-to-gene interactions with top SNPs ranked by cVIs. More than 20 of them were among the top-50 most predictive SNPs. On the other hand, only two genes involved in top 100 SNP-to-gene interactions were among the top 100 most predictive genes. We hypothesized that the most predictive SNPs did not interact with the most predictive genes because the information contained in these SNPs was redundant to these predictive genes, which usually were the expression traits of the corresponding predictive SNPs. In turn, by combining less predictive gene and marker profiles introduced extra information into the system and indeed improved the prediction accuracy. Genes involved in such interactions might reveal additional perturbed pathways underlying the trait of body weight. A systems biology approach is necessary to dissect complex traits, such as obesity, and understand relationships among various genetic factors. Combing heterogeneous data from multiple sources will become increasingly important to model a large quantity of data and interpret results. In this paper, we proposed a novel approach that integrates the method of Random Forests and a network analysis to incorporate genotypic and gene expression data for revealing genetic factors and their interaction or association that are characteristic of complex traits. To overcome the curse of dimensionality, mgRF enhanced conventional RF with the module structure of a correlation network and the weighted sampling procedure. As a result, it successfully identified a small subset of both predictive and biological meaningful genes and genetic markers out of thousands of candidates. Meanwhile, mgRF was able to model the complex associations and possibly interactions between heterogeneous variables, which lead to interesting findings that can shed some lights on solving the genetic multiplicity problem underlying complex traits. To rectify the bias in ranking correlated variables in conventional RF, simple but effective strategies such as grouping correlated variables prior to model fitting [38], [39] can be applied, where cluster centroids obtained from a hierarchical clustering could be used as supergenes to fit classification/regression models. Compared with Tolosi and Lengaue' s work [39], the major differences and novelty of mgRF are three folds. (1) We maintained the original feature space in RF models so that the importance of individual variables can be estimated. (2) Instead of using a simple hierarchical clustering, we adopted the network modeling method HQCut, which is able to automatically and accurately determine the number of modules (clusters) in the network. (3) We further utilized the learnt MI and VI to guide a weighted sampling of variables. Compared with other regression models, such as elastic net and support vector regressor (SVR), mgRF naturally handles different types of variables in that the splitting points of continuous (or ordinal) variables preserve the order information, which, however, is disregarded in categorical variables. On the contrary, elastic net and SVR treat categorical variables as continuous ones, consequently imposing ordered information, which is related to how the categories should be encoded. There is a popular variable importance measure, permutation VI [18], which measures the increase of out-of-bag prediction error with the variable to be measured being permutated. However, the permutation VI suffers from several shortcomings for large problems. It requires an excessive computation time, since each variable needs to be permuted dozens of times to ensure statistical stability. In addition, when the baseline prediction error is large, there is little chance for permutation to make a prediction worse, which leads to an uniformly low VI [25]. More critically, it is still subject to the bias of correlated variables [40], [41]. Even though this problem can be corrected [24], [42], [43], the incurred computation time of additional permutation for a solution will make the excessive computation cost prohibitive for large application. Using a BxH F2 mouse intercross data set, we showed that the proposed algorithm was effective on not only reducing prediction error, but also identifying a subset of genetic markers and genes that are associated with the trait of body weight. By integrating genotypic and gene expression data, mgRF achieved a lower prediction error compared to using either type of data alone. These results support the idea that gene expression plays an intermediate bridging role between genotypic variations and a phenotype. Genotypic data alone are insufficient for accurately predicting the body weight due to their relative weak effects, while gene expression data bridge the gap between genotypic variants and a phenotype as gene expression can be intermediate traits of multiple genetic markers. Besides the annotated body weight relevant genetic elements, such as QTL rs3662726, genes Mogat1, Igfbp2, and Cyp2c37, mgRF provided valuable hypotheses on putative, novel genetic elements and their interactions that are potentially important for body weight and obesity. In particular, the top-ranked SNPs and genes, which have similar levels of importance but are lack of known annotations, are excellent candidates for further validations. A key feature of mgRF is that it exploited splitting variables to incorporate non-linear interactions of variables into the model and to identify intriguing associations within and across two types of data. The proposed statistical test for variable associations aimed at extracting biological relevant markers and genes that might have been overlooked by individual variable importance ranking. The results of mgRF showed that several known obesity-related genes and loci were associate or even interacted with each other and genes that were strongly associated were indeed related to the traits of obesity and/or body weight, as these genes were enriched with biological processes on metabolisms. More importantly, the results revealed that many genetic elements, which have not been indicated previously to be associated with the traits, interacted with obesity-related genes and their associations may contribute more significantly to the traits than associations between genes that were known to be related to obesity. In addition, the results also included significant pairs of genes even though the predictive scores of individual genes whose predictive scores were insignificant. These results suggested that more obesity related genetic factors remain to be discovered and mgRF is potentially an enabling method for identifying genetic factors whose significance would not be appreciated unless their associations or interactions were taken into consideration. Another key advantage of RF is that at each splitting point, it only considers mtry (k) candidate variables for splitting, usually k<<m, where m is the number of variables. The time complexity of mgRF is the same as the conventional RF, in the order of. In practice, mgRF is usually more efficient than the conventional RF, thanks to the two-stage candidate variable sampling and the modified weighted sampling. In particular, the mtry (k) of mgRF is proportional to the number of modules instead of the actual number of variables. In our experiments, the average training time for mgRF was below 3 minutes for our C++ implementation on a desktop machine with an Intel Duo core 2. 53 GHz CPU and 4 G memory (see Table S2 for running time comparison). The most time consuming part of the mgRF framework is the network construction and module finding using HQCut, which took around 20 minutes on the same machine. For larger gene expression data, a common practice is to pre-filtering low variance genes to ∼10,000 most varying genes. For large SNPs data, to reduce the time of network construction and clustering, LD-pruning can be utilized to approximate the SNPs' module structure. Compared with conventional “genetics of gene expression” analysis, mgRF provided a complementary means to incorporate the knowledge of inherent structure of genetic elements. mgRF can also readily be applied to more than two types of data and can be efficient on large-scale applications as it can be easily parallelized to utilize the growing cloud computing environments. While mgRF includes statistical tests to identify significant pair-wise interactions among variables, there is amble room for identifying higher order interactions within the framework of variable importance. The BxH mouse weight dataset consists of both categorical and continuous variables: gene expressions of 7,441 most varying genes and genotypes of 1,065 genetic markers that exhibit variation between two parental strains. The problem can be formulated as a regression problem of predicting the body weights of 132 F2 intercrossed female mice using these two types of variables. The detailed information regarding the experiment and data collection is in Ghazalpour et al. [12]. Given a high-dimensional dataset with multiple types of variables, we adopted a previously developed network construction and clustering method HQCut [27]–[29] to identify the intrinsic structures of variables. HQCut is able to group variables into clusters, i. e. network modules, using a parameter-free spectral clustering-based method to optimize a network modularity function [44]. HQCut has been applied to analyze complex human disease such as Alzheimer' s disease [28], [37]. Pearson' s correlation was used to compute the correlation between two continuous variables (e. g. gene expression). The correlation between two categorical variables (e. g. genetic markers) was defined as their normalized Mutual Information. For the correlation between a categorical variable and a continuous variable, we first discretized continuous variable X into three categories, given bywhere μX is the mean and δX is the standard deviation of X. We then calculated the correlation of the discretized variable with the categorical variable using Mutual Information. Given the correlations of all pairs of variables, we constructed the correlation network using the same method described in [27]–[29]. For two variables to be connected in the network, their correlation needs to satisfy at least one of the following criteria: (1) the correlation is greater than 0. 5 and one of the variable is ranked among the top 5 most correlated variables of the other variable; (2) the correlation is greater than 0. 8 and one of the variables is ranked among the top 50 most correlated variables of the other. These two criteria ensure a sparse weighted network structure while maintaining both local (via rank-based threshold) and global (via value-based threshold) properties [29]. Since different types of variables might have correlation values in different scale, the ranking threshold is independent of each pair of data types. For example, if genotypic and gene expression data are provided, above criteria will be separately applied on SNP-to-SNP, gene-to-gene, and SNP-to-gene (or the other direction) respectively. HQcut is then applied to identify the optimal partitioning that cluster genes into non-overlapping modules and automatically determine the number of modules based on the modularity function [44]. The basic building blocks of RF for regression problems are the regression trees [45], which recursively partitioning the dataset into two subsets based on a specific variable among all variables to minimize the squared loss. RF is an ensemble of regression trees, where each tree is built using a set of bootstrap samples, which is a subset of the original sample. At each splitting (or internal) node of a tree only mtry (k) small randomly selected variables (or attributes) are evaluated. The overall prediction of a forest is the majority vote or the average over the predictions from all individual trees. In a bagging iteration, approximately one third of the observations are not used. These unused observations, the so-called out-of-bag (OOB) sample, can be used to estimate the generalization error. In general, three parameters are needed to be determined in the conventional RF algorithm and mgRF: ntrees (n), the number of trees in the forest, mtry (k), the number of candidate variables that each node considers to find the best split, and nodesize (s), the minimum size of sample in a node where no further splitting is needed. Since a large ntrees usually stabilizes variable importance measures, we set it to a large number (ntrees = 1000) in our experiments. We set mtry = m/3, one third of the number of variables as recommended for regression problems. We set nodesize to 3 as opposed to the recommended 5 because the sample size of our datasets is usually small (<200). Our preliminary experiments have shown that the RF and mgRF are insensitive to parameter choices. To reduce previously mentioned bias on the variable importance and to incorporate priori knowledge of variables' structure, we adopted a two-stage candidate variable sampling procedure: we first selected a subset of modules, each of which captured a set of correlated variables, and then chose one representative variable from each module to form the candidate splitting variables for each node in RF. Given the module structure of a correlation network, we sampled a subset of modules as candidate modules, from which candidate splitting variables are selected in the second stage. By using the two-stage candidate variable sampling, we could significantly reduce the number of variables to be evaluated in each split as the number of modules was typically much smaller than the best mtry parameter in the original RF. We further defined the module importance (MI) of a module mi to be the sum of VIs of its member variables,. MI of a particular module summarized the contribution of all its member variables. We further defined the corrected variable importance (cVI) to estimate the importance of individual variables. The cVI was defined as a weighted sum of VIs of all its connected neighbors within the same module. where M (vi) is the module that vi belongs to and cij is the measure of correlation between variables vi and vj. We further enhanced mgRF by recursively building a series of RFs, where the selection of candidate splitting variables was not only guided by the module structure as in the two-stage candidate variable sampling procedure, but also guided by MIs and VIs that generated from previous RF. Except the first RF, where both modules and variables were uniformly chosen, the construction of successive RFs follows a modified weighted sampling scheme, which combined both uniform and weighted sampling, to favor informative variables. Take the sampling of modules as an example, given a set S of weighted modules, a subset S1 of size N1 was randomly chosen from S without replacement, where the probability of selecting S1 was proportional to the weights. We then uniformly selected N2 modules from S1 to form a smaller set S2, which was the set of final candidate modules. The same procedure was applied to selecting variables from each module. The choices of N1 and N2 depended on the data analyzed. In principle, N1 should be large enough to cover truly relevant objects (i. e. informative variables) and N2 should be small enough to allow diversity of splitting variables. In the current study we set N1 = N/3, where N is the size of modules (or variables in one module) and performed weighted sampling based on MIs (or VIs) for module (or variable) sampling. In module sampling, we set, where |M| was the number of modules, because we assumed that there should be multiple latent factors contributing to the trait variable. In variable sampling we let N2 = 1 as previously discussed to ensure the unbiased property of MI. Note that the variable sampling was weighted on VIs instead of cVIs during each run of RFs. In other words, we only corrected VIs generated in the last iteration because VIs of variables within a module are good estimation of their relative importance, which is sufficient for sampling a representative variable from a given module. We downloaded the latest MGI mouse Gene Ontology annotations from Gene Ontology consortium [46]. Given the 7,441 most varying genes as the background, and a list of genes to be test, each GO biological processes term was assigned a p-value to quantify the significance of gene-term enrichment using the Fisher' s exact test. Regression trees are well suited for modeling non-linear effects such as epistatic interactions because of its conditional splitting method used. We expect that some variables in a regression tree are more likely to be split on when the tree has already been split on a corresponding interacting variable. We derived a simple but effective statistical test to assess the significance of such interactions based on the Fisher' s exact test. In particular, given two variables u and v, we counted the number of times they appeared in an ensemble of N trees as n and m, respectively. Under the null hypothesis of u and v being independent, the number of times, k, that they both appears in the same tree should follow the hypergeometric distribution, where C (x, y) is a binomial coefficient that choosing y from x. The p-value from the test is computed by summing over the probability of right-tail extremes, where k is set to (k, min (m, n) ). Note that our definition is slightly different from the one implemented in the conventional RF [18] for classification, where a test based on the Gini importance is applied. In our test, we used the counts of variables being chosen to cope with continuous traits. In our experiment, we used N = 6000 to achieve a stable ranking of interactions.

Title: Integrative Analysis Using Module-Guided Random Forests Reveals Correlated Genetic Factors Related to Mouse Weight Summary: Obesity has become a perilous global epidemic that can lead to complex diseases, such as diabetes and cardiovascular diseases. Much effort has been devoted to the studies of the genetic mechanisms that pillow the manifestation of obesity. Although a large quantity of experimental data has been accumulated lately using high-throughput techniques, our understanding of genetic mechanisms of obesity is still limited. The proposed method is motivated to address three critical issues that have impeded the existing methods. The first is the curse of dimensionality in selecting a subset of genetic elements related to the traits of interest from a large number of candidates. The second is genetic multiplicity underlying non-Mendelian traits, in which multiple genes are in interplay. The third issue is the integration of data from multiple sources in light of genetic multiplicity and curse of dimensionality. Here, we propose a new method, which augments the Random Forests method with a network-based analysis, to integrate genotypic and gene expression information and identify correlated multiple genetic elements underlying mouse weight. Our results shed light on complex genetic interactions underlying obesity, which can form viable hypotheses worthy of further investigation.

lay_plos

en

Summarize: ACT V. SCENE I. The King of Navarre's park. [Enter HOLOFERNES, SIR NATHANIEL, and DULL.] HOLOFERNES. Satis quod sufficit. NATHANIEL. I praise God for you, sir: your reasons at dinner have been sharp and sententious; pleasant without scurrility, witty without affection, audacious without impudency, learned without opinion, and strange without heresy. I did converse this quondam day with a companion of the king's who is intituled, nominated, or called, Don Adriano de Armado. HOLOFERNES. Novi hominem tanquam te: his humour is lofty, his discourse peremptory, his tongue filed, his eye ambitious, his gait majestical and his general behaviour vain, ridiculous, and thrasonical. He is too picked, too spruce, too affected, too odd, as it were, too peregrinate, as I may call it. NATHANIEL. A most singular and choice epithet. [Draws out his table-book.] HOLOFERNES. He draweth out the thread of his verbosity finer than the staple of his argument. I abhor such fanatical phantasimes, such insociable and point-devise companions; such rackers of orthography, as to speak dout, fine, when he should say doubt; det when he should pronounce debt,--d, e, b, t, not d, e, t: he clepeth a calf, cauf; half, hauf; neighbour vocatur nebour, neigh abbreviated ne. This is abhominable, which he would call abominable,--it insinuateth me of insanie: anne intelligis, domine? to make frantic, lunatic. NATHANIEL. Laus Deo, bone intelligo. HOLOFERNES. Bone? bone for bene: Priscian a little scratch'd; 'twill serve. [Enter ARMADO, MOTH, and COSTARD.] NATHANIEL. Videsne quis venit? HOLOFERNES. Video, et gaudeo. ARMADO. [To MOTH] Chirrah! HOLOFERNES. Quare chirrah, not sirrah? ARMADO. Men of peace, well encountered. HOLOFERNES. Most military sir, salutation. MOTH. [Aside to COSTARD.] They have been at a great feast of languages and stolen the scraps. COSTARD. O! they have lived long on the alms-basket of words. I marvel thy master hath not eaten thee for a word, for thou are not so long by the head as honorificabilitudinitatibus; thou art easier swallowed than a flap-dragon. MOTH. Peace! the peal begins. ARMADO. [To HOLOFERNES.] Monsieur, are you not lettered? MOTH. Yes, yes; he teaches boys the hornbook. What is a, b, spelt backward with the horn on his head? HOLOFERNES. Ba, pueritia, with a horn added. MOTH. Ba! most silly sheep with a horn. You hear his learning. HOLOFERNES. Quis, quis, thou consonant? MOTH. The third of the five vowels, if you repeat them; or the fifth, if I. HOLOFERNES. I will repeat them,--a, e, i,-- MOTH. The sheep; the other two concludes it,--o, u. ARMADO. Now, by the salt wave of the Mediterraneum, a sweet touch, a quick venue of wit! snip, snap, quick and home! It rejoiceth my intellect: true wit! MOTH. Offered by a child to an old man; which is wit-old. HOLOFERNES. What is the figure? What is the figure? MOTH. Horns. HOLOFERNES. Thou disputes like an infant; go, whip thy gig. MOTH. Lend me your horn to make one, and I will whip about your infamy circum circa. A gig of a cuckold's horn. COSTARD. An I had but one penny in the world, thou shouldst have it to buy gingerbread. Hold, there is the very remuneration I had of thy master, thou half-penny purse of wit, thou pigeon-egg of discretion. O! an the heavens were so pleased that thou wert but my bastard, what a joyful father wouldst thou make me. Go to; thou hast it ad dunghill, at the fingers' ends, as they say. HOLOFERNES. O, I smell false Latin! 'dunghill' for unguem. ARMADO. Arts-man, praeambula; we will be singled from the barbarous. Do you not educate youth at the charge-house on the top of the mountain? HOLOFERNES. Or mons, the hill. ARMADO. At your sweet pleasure, for the mountain. HOLOFERNES. I do, sans question. ARMADO. Sir, it is the King's most sweet pleasure and affection to congratulate the princess at her pavilion, in the posteriors of this day, which the rude multitude call the afternoon. HOLOFERNES. The posterior of the day, most generous sir, is liable, congruent, and measurable, for the afternoon. The word is well culled, chose, sweet, and apt, I do assure you, sir; I do assure. ARMADO. Sir, the King is a noble gentleman, and my familiar, I do assure ye, very good friend. For what is inward between us, let it pass: I do beseech thee, remember thy courtsy; I beseech thee, apparel thy head: and among other importunate and most serious designs, and of great import indeed, too, but let that pass: for I must tell thee it will please his Grace, by the world, sometime to lean upon my poor shoulder, and with his royal finger thus dally with my excrement, with my mustachio: but, sweet heart, let that pass. By the world, I recount no fable: some certain special honours it pleaseth his greatness to impart to Armado, a soldier, a man of travel, that hath seen the world: but let that pass. The very all of all is, but, sweet heart, I do implore secrecy, that the King would have me present the princess, sweet chuck, with some delightful ostentation, or show, or pageant, or antic, or firework. Now, understanding that the curate and your sweet self are good at such eruptions and sudden breaking-out of mirth, as it were, I have acquainted you withal, to the end to crave your assistance. HOLOFERNES. Sir, you shall present before her the Nine Worthies. Sir Nathaniel, as concerning some entertainment of time, some show in the posterior of this day, to be rendered by our assistance, the King's command, and this most gallant, illustrate, and learned gentleman, before the princess, I say none so fit as to present the Nine Worthies. NATHANIEL. Where will you find men worthy enough to present them? HOLOFERNES. Joshua, yourself; myself, Alexander; this gallant gentleman, Judas Maccabaeus; this swain, because of his great limb or joint, shall pass Pompey the Great; the page, Hercules,-- ARMADO. Pardon, sir; error: he is not quantity enough for that Worthy's thumb; he is not so big as the end of his club. HOLOFERNES. Shall I have audience? He shall present Hercules in minority: his enter and exit shall be strangling a snake; and I will have an apology for that purpose. MOTH. An excellent device! So, if any of the audience hiss, you may cry 'Well done, Hercules; now thou crushest the snake!' That is the way to make an offence gracious, though few have the grace to do it. ARMADO. For the rest of the Worthies?-- HOLOFERNES. I will play three myself. MOTH. Thrice-worthy gentleman! ARMADO. Shall I tell you a thing? HOLOFERNES. We attend. ARMADO. We will have, if this fadge not, an antic. I beseech you, follow. HOLOFERNES. Via, goodman Dull! Thou has spoken no word all this while. DULL. Nor understood none neither, sir. HOLOFERNES. Allons! we will employ thee. DULL. I'll make one in a dance, or so, or I will play on the tabor to the Worthies, and let them dance the hay. HOLOFERNES. Most dull, honest Dull! To our sport, away. [Exeunt.]

Summary: In this short scene, Armado asks Holofernes and Nathaniel to help him prepare "some delightful ostentation, or show, or pageant, or antic, or firework" with which to amuse the French company, explaining that the King requested it. Holofernes suggests they enact the Masque of "The Nine Worthies" and offers to play three of the roles himself; the rest of the characters will be played by Costard, Dull, Armado, Moth, and Nathaniel.

booksum

en

Summarize: Background Section 107 of the Persian Gulf War Veterans’ Benefits Act required VA to conduct a study to evaluate the health status of spouses and children of Persian Gulf War veterans. Under the study, VA was directed to provide diagnostic testing and medical examinations to any individual who (1) is the spouse or child of a veteran listed in VA’s Persian Gulf War Veterans’ Registry who is suffering from an illness or disorder; (2) is apparently suffering from, or may have suffered from, an illness or disorder (including a birth defect, miscarriage, or stillbirth) that cannot be disassociated from the veteran’s service in the Southwest Asia theater of operations; and (3) in the case of a spouse, has granted VA permission to include relevant medical data in the Registry. These tests and examinations were to be used to determine the nature and extent of the association, if any, between the illness or disorder of the spouse or child and the illness of the veteran. The Congress authorized VA to use contractors to provide the medical examinations and specified that the amount spent for the program may not exceed $2 million. The entire $2 million was designated for examinations; the program administrative costs are to be covered by each coordinating medical center’s operating budget. The act does not authorize funding for the treatment of family members of Persian Gulf veterans or reimbursement of participants for travel, lodging, or lost wages. The act stipulated that the program was to be carried out from November 1, 1994, through September 30, 1996. Program implementation was delayed until April 1996 because of a disagreement between VA and members of the Senate over the appropriate approach for establishing the program. VA proposed doing research, via the National Health Survey of Persian Gulf Veterans, which was designed to gather information on the incidence and nature of health problems occurring in Persian Gulf veterans and their families. The survey includes the examination of randomly selected Persian Gulf spouses and children as well as a control group, for comparison, of nondeployed Persian Gulf-era veterans and their families. (See app. II for a description of the National Health Survey of Persian Gulf Veterans.) However, in a November 1995 letter, the Ranking Minority Member of the Senate Committee on Veterans’ Affairs and the Senate Minority Leader notified VA that its approach would not meet the mandate expressed in section 107 of the act. The letter stated that VA was expected to provide spouses and children the opportunity to seek medical examinations for conditions that family members believe are related to Persian Gulf service and to enter the examination information in the Persian Gulf Registry. The letter further stated that, while the survey was viewed as an important epidemiological study for which the Congress expressed approval by enactment of section 109 of the act, it would not meet the mandate of section 107 of the act. In response to these concerns, the Secretary of Veterans Affairs indicated in a February 1996 letter to the Ranking Minority Member of the Senate Committee on Veterans’ Affairs that the Veterans Health Administration (VHA) would proceed immediately to provide voluntary examinations to Persian Gulf family members. VA initiated the Persian Gulf Spouse and Children Examination Program in April 1996 when it began accepting requests for clinical examinations. On October 9, 1996, the Veterans’ Health Care Eligibility Reform Act of 1996 (P.L. 104-262) extended the program through December 31, 1998. The program is administered through VHA’s Office of Public Health and Environmental Hazards and is implemented through coordinating VA medical centers established in each of VA’s 22 Veterans Integrated Service Networks (VISN). The program is offered at 36 of VA’s 172 medical centers. (See fig. 1 for a map showing locations of the VISNs and the 36 coordinating medical centers). Coordinating medical centers are responsible for establishing contracts, usually with their university-affiliated medical schools, for the examination of Persian Gulf spouses and children using standard medical protocols and guidelines developed by VA. Persian Gulf Dependents’ Examination Program Has Had Implementation Problems The Persian Gulf Spouse and Children Examination Program has faced implementation problems that, to this point, have limited the program’s effectiveness. To inform potential participants about the program, VA headquarters initiated national, broad-based outreach efforts with coordinating medical centers providing for local outreach. As of January 1998, VA coordinating medical centers have received 2,802 requests for examinations, but only 31 percent (872) of requested examinations have been completed. Factors contributing to the low completion rate include the lengthy and cumbersome process for scheduling examinations, which we found takes an average of 15 weeks from the time applicants first apply to the time examinations are completed. Also, examination sites are not easily accessible for some participants because only 36 of VA’s 172 medical centers participate in the program, and the law does not allow for VA to reimburse participants for costs such as travel and lodging. In addition, as of January 1998, no examinations had been conducted in 3 of the 16 coordinating medical centers we contacted because those centers had not negotiated contracts with affiliated medical schools or other providers. Problems also existed with obtaining additional diagnostic testing in some locations. Effectiveness of Outreach Efforts Is Difficult to Assess VA headquarters initiated national outreach through notices about the program in the Persian Gulf Review (a quarterly newsletter sent to about 67,000 Persian Gulf veterans in the Registry), public service television announcements, nationally broadcast television interviews with VA officials about Persian Gulf issues, and announcements on the Internet. The Office of Public Affairs, through its regional structure, provided coordinating VA medical centers with press releases about the program. All 172 VA medical centers received basic information about the Persian Gulf Spouse and Children Examination Program. Also, one nationwide teleconference, available to all VA medical centers, was held at the start of the program to encourage centers to inform veterans about the availability of free examinations for the family members of Persian Gulf veterans. According to a VA program official, local outreach was the responsibility of the 36 coordinating VA medical centers. Outreach efforts at the medical centers we contacted ranged from direct mailings to veterans on the Persian Gulf Registry to relying only on national outreach efforts. For example, the Tampa and Seattle medical centers contacted all veterans who had received Persian Gulf Registry examinations at their centers by letter or telephone. Some medical centers sent brochures to Persian Gulf veterans, and Persian Gulf coordinators visited reserve units and service organizations and informed them about the program. However, the Denver and Salt Lake City medical centers relied on national outreach efforts to provide program information. Without information on how participants learned of the program or knowledge of the potential universe of Persian Gulf spouses and children who believe their illnesses or disorders may be related to a family member’s service in the Gulf, it is difficult to assess the effectiveness of national or local outreach efforts. However, VA estimated that, on the basis of the $2 million authorized for the program, it could provide about 4,500 examinations, based on an average cost of $400 per examination, and have a reserve of $200,000 to cover the cost of additional diagnostic tests. Examinations were offered on a first come, first served basis. As of January 1998, coordinating medical centers reported they had received 2,802 requests for examinations. By January 1998, about 7 percent ($148,916) had been expended from the $2 million allocated for the program. Obstacles to Participation Eight hundred seventy-two examinations of spouses and children, 31 percent of examinations requested, had been completed as of January 1998. Forty-one percent of family members who requested examinations did not report for appointments, refused examinations, or had not yet responded to requests to schedule examinations, as shown in table 1. Several factors contribute to the low completion rate for requested examinations. For example, obtaining an examination requires several steps in a lengthy and cumbersome process. Individuals cannot contact a VA medical center to request an examination. Instead, requests for examinations are made by calling (toll free) the Persian Gulf War Veterans’ Helpline. Next, Helpline staff forward requests to VA headquarters, which checks the VA and DOD Persian Gulf registries or the DOD Persian Gulf Deployment Listing to see if the veteran served in the Persian Gulf. VA headquarters then refers requests to one of the 36 coordinating VA medical centers to further establish eligibility. The medical center contacts the individual requesting the examination and asks him or her to provide a marriage certificate (for a spouse) or a birth certificate (for a child). Finally, the medical center sends the validated request to the affiliated medical school or provider, whose representative schedules an examination appointment with the requester. Our analysis showed that the process from requesting an examination to completion of the examination takes an average of over 15 weeks. According to a VA program official, the process for scheduling examinations was established as an efficient way to control, verify, and forward requests to the nearest coordinating medical center. Because the Persian Gulf Helpline already existed and operated 24 hours a day, it offered a means to monitor the number of requests received nationally. Also, Helpline staff were knowledgeable about a range of Persian Gulf issues and services available for veterans. Verification of veterans’ service in the Persian Gulf is centrally administered because VA headquarters staff have access to the VA and DOD Persian Gulf registries and the Persian Gulf Deployment Listing. Verification of the child or spousal relationship is assigned to medical center staff who also provide a local VA contact and forward verified requests to examination providers to schedule appointments. Another major deterrent to obtaining examinations is the distance to examination sites or the accessibility of sites. VA implemented the program through 36 of its 172 medical centers. VA’s Office of Public Health and Environmental Hazards issued a directive through the Chief Network VISN Office for each network to identify at least one medical center to participate in the program. All VISNs identified at least one coordinating medical center, 12 networks established two coordinating centers, and one VISN established three coordinating medical centers. A VA official stated that medical center decisions to participate in the program were based on the demographics of the Persian Gulf veteran population and the medical centers’ ability to obtain contracts with their affiliated medical schools. Our analysis of the median distance between requesters’ residences and the designated coordinating medical center showed that 48 requesters from Arizona were required to travel a median distance of 326 miles to the Albuquerque medical center to receive an examination. Our analysis also showed that 44 requesters from North Dakota, South Dakota, and Minnesota traveled a median distance of 219 miles for an examination in Minneapolis. According to a Washington, D.C., medical center official, family members considered the Georgetown University site to be inconvenient because it is not easily accessible by public transportation. Additional deterrents to obtaining examinations are lost income when taking time off from work and lack of reimbursement for travel and overnight lodging expenses. According to VA headquarters officials, enabling legislation would be necessary for VA to pay these expenses. Contracting Difficulties in Some Areas Resulted in Examinations Not Being Available VA decided to contract with affiliated medical schools where possible because established working relationships facilitated starting a program that had already been delayed. Program officials told us they were being flexible in also allowing medical centers to enter into agreements with managed care organizations or local physicians to examine family members in the absence of contracts with an affiliated medical school. However, no examinations were provided by 3 of the 16 coordinating medical centers we contacted—Augusta, Dayton, and Philadelphia—because they had not entered into agreements with their affiliated medical schools or other health care providers. Because Philadelphia was the only medical center participating in the program in VISN 4, no examinations had been given, as of January 1998, to the 88 family members who had requested examinations in the network. (See app. III for a table of coordinating medical centers and their affiliated medical schools.) VA headquarters officials were not aware that two of the three centers had not provided any examinations until we inquired about the program’s status in January 1998. Because of turnover in key medical center positions, including program coordinators, VA officials indicated that they were unaware of the status of some requests for examinations. Also, VA did not require monthly activity reports from coordinating medical centers until October 1997—1-1/2 years after the start of the program. In addition, the headquarters program office lacks the capacity to validate information reported by medical center staff and has no line authority over field units that implement the program. In the December 1997 activity report, six of the coordinating medical centers had not submitted their information to headquarters. As a result, VA headquarters did not know the status of the program in terms of the number of applicants contacted, number of examinations given, and the number of coordinating medical centers that had active programs. After our inquiries, coordinating medical centers without active contracts with their affiliated medical schools were attempting to establish contracts with managed care organizations or private physicians, or were providing examinations in-house. For example, the Minneapolis VA medical center plans to provide examinations to women by using VA medical center staff from the Women’s Clinic and to children by contracting with a local pediatrician. Additionally, the San Diego medical center contracted with a doctor with pediatric experience to conduct all of its examinations at a VA outpatient clinic. Women applicants receive additional tests from a VA nurse practitioner. Medical schools affiliated with the Denver and Minneapolis VA medical centers did not renew their contracts with VA because the volume of examinations was lower than expected and they were not paid in a timely manner. Other affiliated medical schools that still have contracts made similar complaints. For example, the Denver medical center told its affiliated medical school to anticipate conducting 200 examinations. However, only 54 requests for examinations were received, and the affiliated medical school ultimately performed only 16 examinations. In January 1998, the medical school received payment for 10 completed examinations that had been initially submitted for payment 9 months earlier in April 1997. We found that payment delays are caused, in part, because code sheets, which capture medical information for entry into the registry database, are rejected by VA’s Austin, Texas, processing center when they are not properly completed. VA headquarters’ guidance for establishing contracts stipulates that payment should be made only after satisfactory completion and submission to VA of all forms and code sheets. Staff from VA medical centers and affiliated medical schools complained that code sheets were difficult and time consuming to complete and lacked clear instructions. In addition, VA attempted to enter data into the registry using scannable code sheets. However, at one point, the program experienced a 100-percent rejection rate for code sheets because of problems with the scanning system. As a result, VA staff had to spend additional time correcting rejected code sheets. VA has since resorted to manually inputting the data. According to VA medical center officials, additional reasons for delayed payment include affiliated medical schools completing paperwork incorrectly, submitting untimely bills, and billing the wrong party. As of January 1998, of the 872 examinations completed, 541 examinations had been approved for payment. Few Participants Receive Referrals for Additional Diagnostic Testing To conduct the examinations for spouses and children, VA developed a protocol that defines the standard tests and medical information collected during examinations. VA officials characterized the examination as a basic but complete physical. Adults receive diagnostic laboratory tests including blood count, blood chemistries, urinalysis, and, for women, a Pap smear. Children receive a physical examination and a medical history, including details on the development of symptoms. The children’s protocol does not require routine diagnostic testing. Examination results are conveyed to family members with a form letter from the examining physician. If physicians determine that a referral to a medical specialist for additional diagnostic testing would be helpful to understanding a patient’s symptoms, VA headquarters must give written approval if total examination and additional diagnostic testing costs exceed $400. At the locations we visited, examination costs ranged from $140 to $473. VA headquarters officials told us they approved all requests received for referrals to medical specialists—about 20. But officials at the Houston medical center said that although their examining physician requested only two referrals, she wanted to refer about 20 percent of those examined (47 patients) for additional diagnostic tests. However, these officials did not ask for additional referrals because they believed resources were constrained and the approval process would take additional time and require participants to make another trip to the medical school. On the other hand, the medical school affiliated with the Minneapolis medical center performed additional diagnostic tests without requesting approval. This strained the contractual relationship with the medical center because the medical school was not reimbursed for these additional tests. Conclusions After more than 1-1/2 years of operation, VA has yet to fully implement the program to provide medical examinations to spouses and children of Persian Gulf veterans. Only 872 of the 2,802 requested examinations have been completed as of January 1998. Although a program of clinical examinations may not resolve issues related to whether illnesses among Persian Gulf family members are related to illnesses of veterans, the clinical examination approach provides Persian Gulf family members an opportunity to visit with a physician and to receive a free medical examination. Standardized examinations also give VA a health surveillance tool for cataloging prominent symptoms among Persian Gulf family members. The Persian Gulf Spouse and Children Program is scheduled to expire in December 1998. At the current rate of examinations, it is not likely that significant numbers of additional examinations will be completed by that date. If the Congress gives Persian Gulf family members the opportunity to be examined beyond December 1998, VA will need to seek ways to reduce barriers to participation, ensure that the necessary health care providers are available to provide examinations, and improve its capacity to monitor program implementation. Recommendations If the Congress gives Persian Gulf family members the opportunity to be examined beyond December 1998, we recommend that the Secretary-designate of Veterans Affairs direct the Under Secretary for Health to simplify the process for requesting and scheduling examinations, offer examinations in more locations and seek approval to reimburse participants who are required to travel long distances to receive examinations, and enhance the capacity of the Office of Public Health and Environmental Hazards to monitor program implementation by field personnel. Agency Comments We provided a draft of this report to VA for comment, but VA did not provide comments in time to be included in this report. However, VA provided technical comments on March 19, 1998, which we incorporated where appropriate. As arranged with your offices, unless you publicly announce its contents earlier, we plan no further distribution of this report until 30 days after the date of this letter. At that time we will send copies of this report to the Secretary-designate of Veterans Affairs and interested congressional committees. We will also make copies available to others upon request. Please contact me on (202) 512-7101 if you or your staff have any questions concerning this report. Major contributors included George Poindexter, Brian Eddington, Jean Harker, Mike Gorin, and Alan Wernz. Scope and Methodology We obtained information for our review by visiting 8 of the 36 coordinating VA medical centers for the Persian Gulf Spouse and Children Examination Program in Chicago, Denver, East Orange, Houston, Minneapolis, Salt Lake City, Seattle, and Washington, D.C. We also contacted by telephone eight additional coordinating medical centers—Augusta, Birmingham, Dayton, Honolulu, Palo Alto, Philadelphia, San Diego, and Tampa. We selected these sites on the basis of their geographic mix, volume of examinations, and recommendations from VA and the Senate Committee on Veterans’ Affairs. In some instances, medical school or clinic representatives were present during our visits. We telephoned some medical school representatives who were not present during site visits to obtain their views on the program and its implementation. Because of time constraints, we did not contact individual veterans or their family members. We interviewed officials at VA headquarters and the VA payment center located in Denver and also contacted the Office of Public Affairs concerning its outreach efforts. We reviewed reports on the status of contractual agreements, the number of examinations scheduled and completed, and the amount of funds disbursed for examinations. We analyzed data from VA’s Austin data center (all 321 completed code sheets) and corresponding data from the Persian Gulf War Veterans’ Helpline (requests for examinations that included the date the veteran or family member called) to determine the average length of time required to schedule and obtain an examination. We also analyzed data from the Persian Gulf Helpline to determine the distance to the nearest coordinating medical center for selected areas. We did not verify the accuracy of data received from either the Austin data center or the Persian Gulf Helpline. As agreed with your staffs, we did not evaluate the appropriateness of the survey instruments or medical evaluations used in the program. National Health Survey of Persian Gulf Veterans Initiated in July 1994, the National Health Survey of Persian Gulf Veterans is an epidemiological research study designed to estimate the prevalence of various symptoms and other health outcomes for Persian Gulf veterans and their families. The study is being conducted in three phases. In phase I, a questionnaire was mailed to each of 30,000 veterans (15,000 Persian Gulf veterans and 15,000 non-Persian Gulf veterans). In phase II, a sample of 8,000 nonrespondents was randomly selected for follow-up telephone calls to assess potential nonrespondent bias and to supplement the mailed survey data. In addition, during phase II, selected self-reported data collected during phase I was validated through records reviews for 2,000 veterans from each group. VA has completed the first two phases of this survey. In phase III, the same 2,000 veteran respondents and family members from each group will be invited to participate in a physical examination under a uniform comprehensive clinical examination protocol. VA is currently identifying 15 of its medical centers to examine veterans and family members over an 18-month period. The medical centers will be selected in a way that ensures a medical center will be within 3 to 4 hours driving time of the majority of the families sampled. Veterans will be examined at VA medical centers. The requested budget also permits up to half of the spouses and all of the children to be examined at affiliated medical schools. Veterans and spouses will be paid $200 per adult examination and $100 per child examination to compensate them for their time and inconvenience. Mileage or airfare, per diem, and lodging costs will be paid for families who live far enough away to require overnight stays. According to a VA official, these payments are allowable costs as part of this research project. The estimated report date for the survey is December 2000. Coordinating Medical Centers and Affiliated Medical Schools as of December 1997 Spouse: Evans Medical Foundation, Boston Medical Center Children: Child Health Foundation of Boston Spouse: Syracuse VA Medical Center Children: SUNY Health Science Center New Jersey University of Medicine and Dentistry No affiliated medical school contract No affiliated medical school contract University of Puerto Rico School of Medicine University of Tennessee Medical Group The Wilson Group, Vanderbilt University No affiliated medical school contract Wayne State University Medical School No affiliated medical school contract University of Missouri Health Science Center (continued) The first copy of each GAO report and testimony is free. Additional copies are $2 each. Orders should be sent to the following address, accompanied by a check or money order made out to the Superintendent of Documents, when necessary. VISA and MasterCard credit cards are accepted, also. Orders for 100 or more copies to be mailed to a single address are discounted 25 percent. U.S. General Accounting Office P.O. Box 37050 Washington, DC 20013 Room 1100 700 4th St. NW (corner of 4th and G Sts. NW) U.S. General Accounting Office Washington, DC Orders may also be placed by calling (202) 512-6000 or by using fax number (202) 512-6061, or TDD (202) 512-2537. Each day, GAO issues a list of newly available reports and testimony. To receive facsimile copies of the daily list or any list from the past 30 days, please call (202) 512-6000 using a touchtone phone. A recorded menu will provide information on how to obtain these lists.

Summary: Pursuant to a congressional request, GAO reviewed the Department of Veterans Affairs' (VA) implementation of the Persian Gulf Spouse and Children Examination Program, focusing on: (1) outreach efforts; (2) obstacles to family members' participation; and (3) contracting issues. GAO noted that: (1) the Persian Gulf Spouse and Children Examination Program has faced numerous implementation problems that have limited its effectiveness in providing medical examinations; (2) to inform Persian Gulf veterans and their family members about the program, VA approached outreach in two ways--with a national campaign supplemented by local efforts at coordinating VA medical centers; (3) GAO found that some medical centers made efforts to contact Persian Gulf veterans and their families, while others relied on headquarters' outreach efforts; (4) however, GAO could not assess the effectiveness of these efforts because of a lack of information on the potential number of Persian Gulf family members who believe their illnesses are related to a family member's service in the Gulf War; (5) although as of January 1998 coordinating medical centers had received 2,802 requests for examinations, VA has completed only 872; (6) forty-one percent of applicants either failed to report for appointments, refused examinations, or had not yet answered requests to schedule examinations; (7) program participants face a lengthy and cumbersome scheduling process carried out through VA offices other than the local VA medical centers; (8) GAO's analysis showed that it takes an average of over 15 weeks for a participant to get an examination; (9) in addition, because VA chose to administer the program through only 36 of its 172 medical centers, examination sites are not always easily accessible to participants; (10) three of the 16 coordinating medical centers GAO contacted have not conducted any examinations because they have not contracted with their affiliated medical schools or other providers; (11) VA headquarters officials were unaware that examinations had not been conducted in two of the centers because of turnover in key center positions, and because VA did not start requiring monthly activity reports, which give the cumulative status of examination requests, from coordinating medical centers until October 1997; (12) GAO found that payment delays are caused in part by contractors incorrectly completing required paperwork, which staff from VA medical centers and affiliated medical schools told GAO is time consuming to complete and lacks clear instructions; and (13) although VA reserved $200,000 of authorized funds to cover the costs of tests, medical center officials told GAO they would have requested more referrals but believed resources were limited and the approval process would require additional time and travel for participants.

gov_report

en

Summarize: CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims the benefit of provisional patent application Ser. No. 61/270,252, filed in 2009 Jun. 3 by the present inventors BACKGROUND [0002] 1. Prior Art [0003] The following is a tabulation of some prior art that presently appears relevant: [0000] U.S. Patents Patent Number Kind Code Issue Date Patentee 7,326,152 B2 2008 Feb. 5 Gates 3,730,587 A 1973 May 1 Bloxham 5,211,607 A 1993 May 18 Fermaglish 3,049,350 A 1962 Aug. 14 Walker 4,844,452 A 1989 Jul. 4 Tomosky 4,569,532 A 1986 Feb. 11 Mirkarimi [0004] 2. Background of the Invention [0005] At birth, an infant&#39;s body and brain is not fully developed. The corpus callosum is a neurological passageway communicating information between the left and right brain hemispheres. This allows the body to use both eyes, both ears, both hands and both feet in conjunction, as well as storing and retrieving information. Myelin, a fatty substance in the brain helps neurons send and return information to the brain, brain stem and spinal cord. Neuroscience research has shown that the parts of the brain that control movement also control cognition and emotion. Early infant physical development can improve this cerebral connection and its transmission of information. Gross motor skills including but not limiting: memory, muscle tone, strength, and hand/eye coordination can be improved through a repetitive, cross lateral movement, such as crawling at an early age. Therefore, if an infant/user spends much of its early age crawling or learning to crawl, it is equally improving its brain function/development rate. [0006] A variety of infant walkers have been proposed—for example, in U.S. Pat. Nos. 7,326,152 (2008) to Gates, and 3,730,587 (1973) to Bloxham, and 5,211,607 (1993) to Fermaglish. Although these walkers allow the infant/user to move on their feet in revolutions around a central-positioned structural column, they are not, however designed to harness an infant/user from the torso, allowing the infant/user to “crawl” on both knees and both hands, bypassing an earlier stage of the infants&#39; age which can be integral to early childhood development. [0007] Many infant walkers (not including U.S. Pat. No. 3,730,587) may restrict the vision of the infants lower limbs do to a device obstruction such as a tray or even the supporting means itself, resulting in a lesser development of hand/eye coordination. In addition to visual obstructions, such infant walkers with height settings are not elasticized, permitting the infant to bounce and build up the much needed physical strength to later walk independently. Because of these aforementioned restrictions, the infant may become “comfortable” sitting in the walker seat until it is not even attempting to walk preventing the intended developmental purpose. [0008] U.S. Pat. No. 4,569,532 (1986) to Mirkarimi enables an infant that already has proper strength to crawl, to roam freely near unobstructed locations such as a stairway, causing a dangerous environment for the infant. If an infant has not yet built sufficient strength to crawl, the infant will have the task of carrying the weight of the device thereof; resulting in additional strength needed to utilize the device, but nevertheless all the crawling and walking aids suffer from a number of disadvantages: [0009] (a) By not allowing infant/user to suspend in a “crawling” position with a padded harness around infants torso, walkers prevent the infant from moving on both hands and both knees in a locomotive, cross-lateral manner. This prevents walkers from improving trunk muscles and coordination of all four limbs. [0010] (b) Walkers with stationary seating, that is, walkers that do not allow the infant to bounce up and down can promote the infant to just sit in the seat making movement of their legs less desirable. [0011] (c) Prior walkers that do allow the infant to suspend in walking position have many more required parts to complete the intended function of device due to weight balance needed to support the infant, resulting in a higher cost of materials and manufacturing. [0012] (d) Prior walkers are not designed to be as freely adjustable as the present embodiment. This lack of adjustment restricts the infant to a specific height making the device less accommodating to the variable heights, lengths, and weight of each respective infant/user. [0013] (e) Walkers that restrict the vision of the infant/user&#39;s legs can prevent the him/her from recognizing that it can control it&#39;s legs to move about freely. [0014] (f) Prior walkers with central-positioned structures that are not detachable from center column to base, making it less portable. [0015] (g) Prior walkers with central-positioned structures do not have a guide wheel that rolls on a plate on top of center column requiring additional means of function to support weight of infant. SUMMARY [0016] The present invention overcomes the above mentioned drawbacks and limitations by providing a crawling aid to assist the infant in crawling, enabling both sides of the brain to function in concert improving the corpus callosum at a much earlier and important brain development age. In addition, the present embodiment allows for an attachment to support the infant around the crotch and waist to then allow the infant/user to walk/jump in revolutions around the center column. ADVANTAGES [0017] While the infant is held up by a padded harness holding its torso in a conventional “crawling” position, the infant is able to crawl around the base and column in revolutions exploring its surroundings, simultaneously visualizing its locomotive movements-improving its grasp of motor development and binocular vision. For example, if the supervising user assisting the infant in the crawling apparatus, places a toy just out of reach of the infant, the infant can attempt to move to the toy. The infant will later realize that she can control all of her limbs and start to bounce until she performs a locomotive act of crawling. While the infant is moving, she can see the toy and her eyes will begin to focus and improve binocular vision. while the infant is also able to “bounce” building up much needed muscles for a later walking development stage. By being elastically suspended in the cushioned harness over the padded floor, the infants carrying weight is reduced making it easier for the infant to push off the padded floor in an attempt to crawl. When the infant is not in the apparatus, she may remember the position she was in when in using the apparatus, and attempt to crawl on her own. [0018] A pivot arm is connected to the top of a bearing assembly. The bearing assembly is situated on the top-center of a plate. A guide wheel is connected to bottom of pivot arm to roll on top of outer end of plate, which supports the bearing assembly by carrying a portion of infant/user weight around the center column. This aids the infant/user by reducing the load weight of their body so the infant/user can move with ease, while not obstructing the vision of the infant/user. The present embodiment can allow any height of harness within elasticized cord limitations by locking said cord to desired length. [0019] In addition to assisting the infant in crawling, the present embodiment can also attach a jumper seat. The jumper seat has cords attached to top of seat in both front and rear of jumper. The upper portion of jumper cords are connected to a fixed cord support embodiment with means of connecting to adjustable cord. On one side of the cord support is a handle that is used to lift jumper seat to attach to adjustable cord. [0020] By using this device, the infant, at a much earlier age than that of walkers can improve numerous areas of early childhood development such as gross/fine motor skills, binocular vision, muscle strength and space/depth perception. The attachable jumper seat allows the infant to bounce up and down and walk around the device. There are no obstructions to prevent infant from seeing its left and right legs moving in concert. The Infant and also move laterally because of a bearing assembly placed above the pivot arm bearing assembly on outer end of pivot arm, the infant can turn its body in a full 360 degree radius allowing both clockwise and counterclockwise rotating travel. The infant can utilize this invention from-when it&#39;s old enough to lift it&#39;s head-to when the infant is able to walk on its own, making the life of this device far longer than most walker apparatuses readily available. DRAWINGS Figures [0021] For a more in depth understanding of present invention reference should be made to the detailed description of preferred and alternative embodiments and associated drawings wherein: [0022] FIG. 1 is a perspective view of a portable infant development station in one embodiment of present invention. [0023] FIG. 2 is a side view of the infant development apparatus shown in FIG. 1 in assembled state of present invention. [0024] FIG. 3 is a side view of the development apparatus from its base, up to it&#39;s guide wheel and pivot arm. [0025] FIG. 4 is a top view of the bottom half of the invention showing the lower column, vertical, and support legs with locking knob. [0026] FIG. 5 is a perspective view of FIG. 4 with addition of center column showing how the lower column receives the center column with and locked in place with threaded locking knobs. [0027] FIG. 6 is a top view of the top half of the invention showing the pivot arm bracket with caster wheel attached to the bearing housing assembly attached to guide plate and center column of. [0028] FIG. 7 is a top view of FIG. 6 showing the pivot arm locked in place with pivot arm bearing assembly of present invention. [0029] FIG. 8 is a perspective view of the pivot arm and locking pin with pivot arm bearing assembly connected to eyebolt. [0030] FIG. 8 a is a perspective view of an additional pivot arm that raises the height of the elasticized cord embodiment for jumper attachment. [0031] FIG. 9 is a perspective view of the elasticized cord embodiment including upper and lower cord housings and their associated means of attachment. [0032] FIG. 10 is a perspective view of the crawling harness and its connecting handles. [0033] FIG. 11 is a perspective view of the jumper harness and harness support embodiment. [0034] FIG. 11 a is a perspective of the harness support connectivity of present jumper embodiment. [0035] FIG. 12 is a top view of the padded flooring showing how the pieces interconnect around radius of center column. [0036] FIG. 12 a is an exploded view of an individual piece of padded flooring (and how center of piece covers sub plate if sub plate is used). [0037] FIG. 13 is a perspective view of alternate base embodiment showing the development apparatus with base and connected swiveling support bars, and locking pins. DETAILED DESCRIPTION OF THE INVENTION [0038] Referring more specifically to FIGS. 3, 4, and 5 wherein support legs 410 are preferably straight and made of metal, plastic or wood. Support legs 410 can be circular, square, oval or any other shape that is structurally suitable to withhold the present invention. Support legs 410 are fixedly attached to vertical legs 410 a to make a 45 degree angle at the inner portion wherein vertical legs 410 a are preferably welded to lower column 402. A lower column base 402 a is fixedly attached to lower column 402 for additional support. Threaded holes 403 are preferably placed inline between any two of the vertical legs 410 a wherein adjustable knob 404 removably screws into threaded holes 403. [0039] A column 13 is preferably made of metal, plastic or wood material with a circular, square or oval shape. At the lower end of column 13 is a reduced column 401 made of same material that inserts into lower column base 402 wherein adjustable knob 404 pushes into reduced column to removably lock column 13 in place. [0040] Referring more specifically to FIGS. 3, 6, and 7 wherein upper guide plate 14 is fixedly attached to upper end of column 13 preferably by weldment and is made same material as column 13 with a circular, square or oval shape used to support a pivot arm bracket 16, guide wheel 35, and bearing assembly of preferred embodiment. [0041] The Pivot arm bracket 16 is hingedly bolted to the upper bearing housing 15. Upper bearing housing 15 is connected to lower bearing housing 21 using a bolt 22 wherein upper bearing housing 15 pivots in revolution on conventional bearings 31. Lower bearing housing 21 is fixedly bolted to upper guide plate 14 using conventional nuts and bolts 30. [0042] A guide wheel housing embodiment 33 is fixedly bolted to pivot arm bracket 16 using conventional nuts and bolts through throughholes 34 to outer end walls of the pivot arm bracket 16 wherein guide wheel 35 will roll on top of the upper guide plate 14 to support the weight of the infant user as it rotates. [0043] Referring more specifically to FIGS. 6, 8, 8 a and 9 wherein a pivot arm 17 is removably connected at the outer end of the pivot arm bracket 16 and is made of metal, plastic or wood in a circular, square or oval shape. The connecting end 37 of pivot arm 17 is reduced in dimensions to be received by outer end of pivot arm bracket 16 and is held in place by a locking pin 38 through throughholes 36 in both pivot arm 17 and pivot arm bracket 16. The pivot arm 17 is detached for storage or portability. FIG. 8 a is an additional pivot arm comprising a vertical riser 17 a, then extending outwardly at outer end of straight portion 17 b. A pivot arm swivel 41 is placed on top of outer end of pivot arm 17, although, pivot arm swivel 41 can also be placed on inside of pivot arm 17. An eyebolt 40 or preferred embodiment with means of connecting multiple attachments extrudes through pivot arm 17 through a throughhole and connects to top of pivot arm swivel 41 and held in place by a locknut 41 a. [0044] Referring more specifically to FIGS. 8, 8 a, 9 and 10 wherein Upper cord housing 18 is removably connected to eyebolt 40 wherein upper cord housing 18 is preferably a sphere or prism shaped embodiment with means of attaching to eyebolt 40 using a hook 61. [0045] An elasticized cord comprising two sides 51 and 62 connected to upper cord housing 18 wherein stationary side 51 is fixedly held in place by a clamp 60 at upper end of upper stationary cord opening 59 suspending downward to lower cord housing 20 through lower stationary cord opening 55 onto lower groove of pulley assembly 54. Adjustable end of elasticized cord 62 extends upwardly through upper adjustable cord opening 56 to upper cord housing 18 wherein stationary cord opening 58 wherein opening gradually reduces downward to a lesser opening 63 enabling adjustable end of elasticized cord 62 to lock in place after obtaining desired length. A handle embodiment 57 is connected to adjustable end of elasticized cord 62 by a clamp to allow ease of use when adjusting, and locking elasticized cord onto upper cord housing lock 63. [0046] A harness 71 shown in FIG. 10 is preferably made of fabric such as fleece, cotton, canvas, spandex, or any other desired material may be used. At polar ends of harness are harness handles 70 of triangular shape preferably formed of hard plastic or metal embodiment used to removably attach to the lower elasticized cord housing hook 53 shown in FIG. 9. Harness 71 will comfortably wrap infant torso allowing him/her to suspend at desired height so that infant hands and knees are positioned on the padded flooring 150 shown in FIG. 12. [0047] Referring to FIGS. 11 a - 11 b wherein support embodiment is made of a metal, plastic, or wood suitable to withhold the weight requirement to support infant/user. A support ring 341 is bolted to upper end of jumper support housing 340 a from upper end of support handle 343 a. The ends of support handle 343 a are threaded and insert through throughholes 345 of jumper support housing 340 a and fixedly locked in place by threaded lock nuts 343 b. A support hanger opening 340 b is shaped to receive support hanger 342, wherein center of support hanger 342 is fixedly bolted to inside of jumper support housing 340 a by a hanger bolt 344 a and hanger nut 344 b. At each end of support hanger 342 is a groove shaped to receive jumper ropes 302 wherein each end removably slides into grooves to support jumper seat 300. [0048] The padded jumper seat 300 is preferably made of polyester, canvas, wool or any washable material. The jumper cords 302 are fixedly connected to jumper seat 300 by a cord support 301 that receives jumper ropes 302 at upper end and are preferably sewn or stitched together, then rope housing 301 is sewn or stitched to jumper seat 300. [0049] Referring to FIG. 12 a - 12 b Padded flooring 150 preferably made of a washable foam or any other soft, bouncy, and washable material. Padded flooring 150 may also preferably contain miscellaneous designs with different color schemes prints. Each piece of floor padding 150 removably interconnects to adjoining ends 93 to cover support legs 410 extending floor to desired shape, preferably circular, hexagonal, or square. Floor padding 150 will preferably have a cutout on bottom of inner edge 91 to match shape of vertical legs 410 a and lower column 402 in order to place padded flooring 150 on top of support legs 410 to create a low profile flooring. [0050] Referring to FIG. 13 is an alternate embodiment of the base support means from the lower end, comprising a sub plate 10 with support bars 12 wherein both are preferably made of metal, plastic or wood material with a circular, square or oval shape that can be locked in place to stabilize the apparatus. The support bars 12 will preferably extend out to length of desired floor padding allowing a structurally sound sub floor. The support bars 12 hingedly connect 12 a to stabilizer bracket 11 from inner end of support bars 12, below sub plate, using preferably standard bolts through throughholes wherein support bars 12 pivot upwardly from inner end of support bars 12. When in the down position stabilizer bars 12 are locked in place by a locking pin 100 at the outer end of the stabilizer bracket 11 through throughholes 11 a. [0051] Connected to the sub plate 10 is a column 13 preferably made of metal, plastic or wood material with a circular, square or oval shape that is attached to the center of sub plate 10 at the lower end preferably by weldment with the upper guide plate 14 attached to the upper end of column 13. [0052] As shown particularly in FIG. 5 that by loosening the threaded locking knobs 404 and removing the column 13 to detach upper portion of present invention, the device can be stored in a reduced dimension and easily transported to desired destinations.

Summary: This invention relates generally to a portable child development station. More specifically, an infant crawling and walking aid. The invention is collapsible and can be stored in smaller confines. When the invention is set up, it is structurally sound and safe with detachable variations allowing assistance in crawling as well as walking by suspending the infant with variable height adjustments to accommodate infant. The invention is collapsible for storing in smaller confines.

big_patent

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Informed Choice Act''. SEC. 2. GRANTS FOR PURCHASE OF ULTRASOUND EQUIPMENT. (a) In General.--The Secretary of Health and Human Services may make grants for the purchase of ultrasound equipment. Such ultrasound equipment shall be used by the recipients of such grants to provide, under the direction and supervision of a licensed medical physician, free ultrasound examinations to pregnant women needing such services. (b) Eligibility Requirements.--An entity may receive a grant under subsection (a) only if the entity meets the following conditions: (1) The entity is a nonprofit private organization that is approved by the Internal Revenue Service as a tax-exempt entity under section 501(c)(3) of the Internal Revenue Code of 1986. (2) The entity operates as a community based pregnancy help medical clinic, as defined in subsection (f). (3) The entity provides medical services to pregnant women under the guidance and supervision of a physician who serves as the medical director of the clinic and is duly licensed to practice medicine in the State in which the entity is located. (4) The entity is legally qualified to provide such medical services to pregnant women and is in compliance with all Federal, State, and local requirements for the provision of such services. (5) The entity agrees to comply with the following medical procedures: (A) Each pregnant woman upon whom the ultrasound equipment is used will be shown the visual image of the fetus from the ultrasound examination and will be given a general anatomical and physiological description of the characteristics of the fetus. (B) Each pregnant women will be given, according to the best medical judgment of the physician performing the ultrasound examination or the physician's agent performing such exam, the approximate age of the embryo or fetus considering the number of weeks elapsed from the probable time of the conception of the embryo or fetus, based upon the information provided by the client as to the time of her last menstrual period, her medical history, a physical examination, or appropriate laboratory tests. (C) Each pregnant woman will be given information on abortion and alternatives to abortion such as childbirth and adoption and information concerning public and private agencies that will assist in those alternatives. (D) The entity will obtain and maintain medical malpractice insurance in an amount not less than $1,000,000, and such insurance will cover all activities relating to the use of the ultrasound machine purchased with the grant under subsection (a). (6) The entity does not receive more than 30 percent of its gross annual revenue from a single source or donor. (c) Limitation on Individual Grant Amount.--No grant under subsection (a) may be made in an amount that exceeds an amount equal to 50 percent of the purchase price cost of the ultrasound machine involved, or $20,000, whichever is less. (d) Application for Grant.--A grant may be made under subsection (a) only if an application for the grant is submitted to the Secretary and the application is in such form, is made in such manner, and contains such agreements, assurances, and information as the Secretary determines to be necessary to carry out this section. (e) Annual Report to Secretary.--A grant may be made under subsection (a) only if the applicant for the grant agrees to report on an annual basis to the Secretary, in such form and manner as the Secretary may require, on the ongoing compliance of the applicant with the eligibility conditions established in subsection (b). (f) Definitions.--For purposes of this Act: (1) The term ``community based pregnancy help medical clinic'' means a facility that-- (A) provides free medical services to pregnant women under the supervision and direction of a licensed physician who serves as the medical director for such clinic; and (B) does not charge for any services rendered to its clients, whether or not such services are for pregnancy or nonpregnancy related matters. (2) The term ``Secretary'' means the Secretary of Health and Human Services. (g) Authorization of Appropriations.--For the purpose of carrying out this section, there are authorized to be appropriated $3,000,000 for fiscal year 2006, and such sums as may be necessary for each of the fiscal years 2007 through 2009.

Title: A bill to authorize the Secretary of Health and Human Services to make grants to nonprofit tax-exempt organizations for the purchase of ultrasound equipment to provide free examinations to women needing such services, and for other purposes Summary: Informed Choice Act - Allows the Secretary of Health and Human Services to make grants to nonprofit community based pregnancy help medical clinics for the purchase of ultrasound equipment. Requires each grantee to: (1) provide free ultrasound examinations to pregnant women; (2) show the visual image of the fetus from the ultrasound examination to each pregnant woman with a general anatomical and physiological description of the fetus; (3) give each pregnant woman the approximate age of the embryo or fetus; (4) provide information on abortion and alternatives to abortion, such as childbirth and adoption, and information concerning public and private agencies that will assist in those alternatives; and (5) obtain medical malpractice insurance. Limits each grant to the lesser of 50 percent of the purchase price of the ultrasound machine involved or $20,000.

billsum

en

Summarize: A U.S. government lawyer has reportedly conceded that tens of thousands of long-missing emails belonging to former IRS official Lois Lerner – messages the Obama administration has claimed were lost in a 2011 computer crash – were safely backed up along with the computer records of every other federal employee, claims conservative group Judicial Watch. The documents are key to a congressional investigation into a political targeting scheme Lerner allegedly masterminded, which involved singling out conservative nonprofits for especially intrusive scrutiny – based on words in their names like 'tea party' or 'patriots' – when they applied for tax-exempt charitable status. Judicial Watch president Tom Fitton, whose group is suing the IRS over its failure to provide the records to Congress, said Monday that the revelation came on Friday from an attorney who works in Attorney General Eric Holder's Justice Department. 'All the focus on missing hard drives has been a diversion,' he said. 'The Obama administration has known all along where the email records could be – but dishonestly withheld this information. You can bet we are going to ask the court for immediate assistance in cutting through this massive obstruction of justice.' SCROLL DOWN FOR VIDEO. An irate Judicial Watch president Tom Fitton said Monday that after 15 months of wrangling, the federal government has conceded that all of former IRS official Lois Lerner's emails are backed up somewhere. Lerner, the IRS Director of Exempt Organizations when the so-called 'tea party targeting' scandal developed, retired from government service in 2013 and is receiving her full pension. 'The Department of Justice attorney told the Judicial Watch attorney on Friday.' Fitton said during a Monday afternoon Fox News broadcast, 'that it turns out the federal government backs up all computer records in case something terrible happens in Washington and there is a catastrophe, so the government can continue operating.' The catch, he added, is that the DOJ attorney also claimed 'it would be too hard to go and get Lois Lerner's emails from that backup system.' The Justice Department is representing the federal government in the lawsuit. 'So everything we've been hearing about scratched hard drives, about missing emails of Lois Lerner, [and] other IRS officials, other officials in the Obama administration,' Fitton told Fox, 'it's all been a pack of malarkey.' 'They could get these records, but they don't want to. And they haven't told anyone about it, frankly, until we were able to get it out of them on Friday.' 'And there's no such thing as Lois Lerner's missing e-mails,' he insisted. 'It's all been a big lie. They've been lying to the courts, to the American people and to Congress.' IRS Commissioner John Koskinen and White House Press Secretary Josh Earnest have been particularly insistent that Lerner's emails were gone forever. Koskinen told a congressional panel on June 20 that Lerner's hard drive 'was recycled then destroyed' because 'it was determined that it was dysfunctional and that, with experts, no emails could be retrieved.' Hours later during a White House briefing, Earnest was asked why two years of Lerner's emails were missing. 'Well, because there was – the computer crashed,' he responded. 'And what we've seen is a demonstrated effort by this administration and by the IRS to try to cooperate with legitimate questions that have been posed by [Congress] on this.' The FBI is running a parallel investigation into whether Lerner or anyone else in the Treasury Department broke federal laws by targeting conservative groups for political retribution, or by covering it up when Congress began to subpoena records from the administration. Jenny Beth Martin, co-founder of Tea Party Patriots, one of the groups the IRS hamstrung for years, said Monday that the latest revelations are 'part of a continuing pattern of dishonesty and thuggery we've seen from this administration.' 'When the government launches intimidation campaigns against private citizens simply because they may not agree with the government – and then lies about evidence being "lost" – it should outrage all Americans.' IRS Commissioner John Koskinen has appeared in several Republican-dominated congressional hearings, insisting that Lerner's emails are gone for good and her faulty hard drive was'recycled' 'Everything we've been hearing about scratched hard drives, about missing emails... it's all been a pack of malarkey,' Fitton said Monday. Federal Judge Emmet Sullivan demanded two weeks ago that IRS officials sign sworn statements describing efforts that were made to recover the Lerner emails. None of the affidavits sent to his court so far has mentioned anything about an all-encompassing backup system where the records might still be awaiting discovery. 'We want to know why they hadn't told the court about this backup system,' Fitton said Monday on Fox. 'If this backup system is working, Lois Lerner's emails are there. There are half a dozen other IRS officials whose emails have supposedly disappeared as well. And we've heard from other agencies, like over in the HHS over Obamacare, emails disappearing there.' 'We've been led to believe that once they disappear they can't be found again,' he said, 'when in fact they back up everything, as most people suspected [and] now the government has confirmed.' Fitton's group plans to ask Judge Sullivan to rule that the Obama administration has gone out of its way to avoid turning over documents that it knew were readily available. If the IRS has been withholding evidence from the courts, it's also been withholding it from Congress. What about the backups? White House spokesman Josh Earnest said on June 20 that Lerner's computer 'crashed' and claimed the Obama administration had tried to 'cooperate with legitimate questions' 'Judicial Watch will press its concerns on Monday, August 25, before U.S. Magistrate Judge John Facciola,' Fitton said late Monday in a statement. Sullivan has appointed Facciola, an expert in the courtroom 'discovery' of electronic records, to manage the back-and-forth between the administration and Fitton's attorneys about missing records. Some of that wrangling concerns exactly what happened after Lerner reported that her hard drive had malfunctioned. An IRS information technology official wrote Friday in a sworn statement that while tech experts allegedly sent the device for testing and data recovery, no one thought to examine her government-issued Blackberry to see if copies of her emails could be saved. There is 'no record of any attempt by any IRS IT employee to recover data from any Blackberry device assigned to Lois Lerner in response to the congressional investigations or this litigation,' the IT expert, Stephen Manning, wrote

Summary: A conservative group suing the IRS for a former official's emails tied to a political targeting scandal says the DOJ now concedes the records exist. Judicial Watch's lawsuit initially led the federal government to claim a hard-disk 'crash' destroyed tens of thousands of Lois Lerner's emails forever. Lerner led the IRS department accused of singling out right-wing groups for intrusive scrutiny when they applied for tax-exempt status. 'They could get these records but they don't want to,' said Judicial Watch president Tom Fitton. New court records also show that after Lerner's hard drive crashed, the IRS never tried to recover data from her government-issued Blackberry. This first paragraph ofthis article has been updated to further clarify that the claims made by the U.S. government lawyer relating to the missing emails come from conservative group Judicial Watch.

cnn_dailymail

en

Summarize: BACKGROUND OF THE INVENTION Millions of syringes are used daily throughout the United States relative to injecting humans as well as animals with various types of solutions and medications. Syringes for humans are also used in large quantities by victims of diabetes and a very high percentage of such victims require the injection of Insulin. It is possible for such victims to have such injections occur at home rather than in a doctor&#39;s office but many individual victims are incapable of psychologically overcoming the hesitancy of injecting themselves with a hypodermic needle. To overcome the foregoing situation and particularly to provide syringe-injecting devices which can be operated by victims themselves to effect their own injections by themselves, a number of instruments have been developed to support needle-type syringes and by means of springs or otherwise cause an instantanous projection of the needle of the syringe into their own flesh. One example comprises U.S. Pat. No. 3,677,246, dated July 18, 1972, to Stein and also British Pat. No. 780008, dated July 31, 1957, to Palmer. In said U.S. patent, a spring effects ejection of the contents of the syringe after insertion of the needle and in said British patent, a manually operated plunger effects such projection of the contents of the syringe following insertion of the needle. A number of developments also have provided mechanism in which a supporting frame for a syringe has a handle similar to a pistol grip and operation of trigger-like members causes movement of the plunger of the syringes to effect ejection of the contents of the syringe. Typical examples of such devices comprise U.S. Pat. No. 3,160,156, dated Dec. 8, 1964, to Tyler; U.S. Pat. No. 3,353,537, dated Nov. 21, 1967, to Knox et al.; Austrian Pat. No. 212,625, dated Dec. 27, 1960, to Hauptner; and Swiss Pat. No. 449,180, dated Nov. 8, 1966, to Sanz. SUMMARY OF THE INVENTION It is one of the principal objects of the present invention to provide a hand-held type of syringe injecting device which by means of a manually operated fluid cylinder and piston unit initially releases a sear to permit a spring to project the needle of a syringe into flesh, and under positive manual control, the projection of the syringe is immediately followed by pressure automatically being applied against the knob of the syringe piston to effect ejection of the contents thereof through said needle. It is another object of the invention to employ a collapsible bulb in the handle of the device which comprises the means for projecting the body of said aforementioned piston of the cylinder and piston unit to actuate the piston of the syringe to effect such ejection of the contents thereof. It is a further object of the invention to provide a slide mounted in guide means adjacent the forward end of the frame of the device, said slide securely supporting the barrel of a hypodermic syringe, and a second slide mounted in guide means rearwardly of said first mentioned slide is actuated by the aforementioned cylinder and piston unit to initially release said aforementioned sear and also cause an upwardly extending finger on said slide to contact the knob end of the syringe piston to cause ejection of the contents of the syringe. Still another object of the invention is to provide a frame preferably molded from synthetic resin and having a pistol-type handle projecting from the rearward portion thereof, said handle being hollow to contain said aforementioned collapsible bulb which is depressed manually by means of a pivoted, finger-engaging lever operable through an opening in one side of said handle to engage said bulb and progressively compress it in a manner to positively eject only a desired quanity of the contents of the syringe into flesh, the same being accomplished while the syringe is in ready view of the operator. Still another object of the invention is to provide various refinements and details which render the structure and operation of the device highly effective and fool-proof. Details of the foregoing objects and of the invention, are set forth in the following specification and illustrated in the drawings comprising a part thereof. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a side elevation, partly in vertical section, illustrating details of the hypodermic syringe device comprising the present invention and showing the parts thereof in initial position. FIG. 2 is a fragmentary view similar to FIG. 2 but omitting the handle structure to decrease the size of the figure and showing the forward, injected position of the syringe following the release of the sear and constituting the initial operation of the device. FIG. 3 is a view similar to FIG. 2 but illustrating the piston of the syringe in injected position due to being pushed by a member of the device which is motivated by a slide actuated by a piston and cylinder unit immediately above the handle. FIG. 4 is a fragmentary vertical sectional view of part of the mechanism shown in FIG. 1 as seen on the line 4--4 thereof. FIG. 5 is another vertical sectional view of part of the device as shown in FIG. 1 as seen on the line 5--5 thereof. FIG. 6 is a fragmentary plan view, partly in transverse section showing the detail of the mechanism shown in FIG. 1 as seen on the line 6--6 thereof. FIG. 7 is a side elevation of a syringe-operating projecting member of the type used in the embodiment shown in FIG. 6 as viewed generally along the lines 7--7 thereof. FIG. 8 is a fragmentary plan view similar to FIG. 6 but showing details of another embodiment of the mechanism. FIG. 9 is a fragmentary side elevation of the mechanism shown in FIG. 8 as seen along the line 9--9 thereof. FIG. 10 is a fragmentary side elevation of the sear mechanism and illustrating the same in full lines in its initial position and, in phantom, showing the same in released position. FIG. 11 is a fragmentary view similar to FIG. 10 but showing in full lines the actuating piston in process of engaging the sear and, in phantom, showing the means by which the piston clears the sear in order to restore itself to initial operating position similar to that shown in full lines in FIG. 10. FIG. 12 is a forward vertical elevation of the sear per se as shown in FIG. 11 on line 12--12 thereof. FIG. 13 is an enlarged fragmentary vertical sectional view taken on the line 13--13 of FIG. 12. DETAILED DESCRIPTION Referring to FIGS. 1-3, it will be seen that the device comprises a unitary handle frame 10 comprising a normally horizontal frame member 12 having a forward end 14 and depending from the rearward end of the frame 12 is a handle which is molded integrally with the horizontal frame 12, said handle being hollow. The front side 18 of the handle is provided with a slot-like opening which receive a lever-type, manually operable actuator 20, an inner extention of the actuator 20 having a suitable hole therein to receive a transverse pivot pin 22 which extends between the opposite walls of the handle 16. The handle frame 10 including the horizontal frame member 12 and handle 16 readily can be molded from suitable plastic which preferably is of a rigid nature. A first guide frame 24 has downwardly extending projections 26 and 28 with holes therein to receive transversely extending support pins 30 which extend between opposite sidewalls of the horizontal frame member 12, thereby fixedly securing the first guide frame 24 to the horizontal frame member 12. The first guide frame 24 slidably supports a syringe slide 32 comprising a channel which receives a typical hypodermic syringe 34 which has a forward pair of snap fingers 36 which secure the forward end of the syringe 34 upon the slide 32. The rearward end of said slide has a block 38 which is provided with two pairs of upstanding fingers 40 which are slotted as shown in FIG. 1 to receive oppositely extending wings 42 on the rearend of the barrel of the hypodermic syringe 34, this arrangement cooperating with the snap fingers 36 to securely but removably attach the barrel of syringe 34 to the slide 32. Referring to FIGS. 4 and 5, it will be seen that the slide 32 has a longitudinally extending portion which, in cross section, is in the form of a tee 44, the vertical portion of which operates in a slot 46 which limits the extent of movement of the slide 32 relative to the first guide frame 24. Projections 26 and 28 respectively have hooks or eyelets 48 to which the opposite ends of tension spring 50 are connected, said spring being operable to instantly project the slide 32 and the syringe 34 carried thereby forwardly to project the syringe needle 52 into flesh which is to receive the contents of the syringe 34. For purposes of positioning the device relative to the flesh which is to be injected, the forward end 14 of the frame member 12 has an angular shoe 54 thereon which is slotted as shown in FIGS. 4 and 5. Said shoe has a horizontal elongated extention 56 which is secured to the upper edge of the frame member 12 such as by small screws 58. The frame member 12 also supports injecting mechanism comprising a fluid-operated unit 60 comprising a fixedly supported cylinder 62 and a piston plunger 64 having a disc-like head 66 on the forward end of said plunger; a slide guide 68 immediately above the cylinder 62; and a second slide 70 which, on the forward end thereof has a slotted, depending projection 72 which is engaged by disc-like head 66 and, on the rearward end thereof has an upstanding pusher member 74, the upper end of which is engageable with the knob end 76 of syringe plunger 78. From FIG. 5, it will be seen that the opposite sides of the second slide 70 have outwardly extending guide ribs 80 which are received in complementary grooves in the walls of the channel comprising slide guide 68. The forward end of the second slide 70 is slotted back to the line 82 in FIG. 1 which is the inner end of said slot. In one embodiment of the invention, the slide 70 is shown in plan view in FIG. 6. In this embodiment, it will be seen that there are a plurality of sets of openings 84 and 86 which respectively receive a locating lug 88 on pusher member 74 and pairs of snap fingers 90 shown in FIG. 7 which are received within the openings 84 in the slide 70. Any other suitable means desired may be employed to secure the base of the pusher member 74 to the slide member 70 and it will be seen that two sets of the openings 84 and 86 are provided in order that the pusher member 74 may selectively be disposed therein and thereby provide adjustability in the movement of the second slide 70 with respect to the plunger 78 of the syringe 34. A second embodiment of the slide 70 is shown in FIGS. 8 and 9 and in which said slide is provided with a series of projections 92 which provide therebetween a series of recesses 94 which selectively receive the lower complementary end of a second embodiment of pusher member 96 and thereby adjust the effective movement of the slide 70 with respect to the plunger 78 of syringe 34. As referred to above, the handle 16 is hollow to receive a flexible bulb 98 which is filled with a suitable fluid, preferably of a liguid nature and said bulb is connected to one end of a flexible conduit 100 and the opposite end of the conduit is connected to the rearend of cylinder 62 as clearly shown in FIGS. 1-3. Fluid is forced from the flexible bulb 90 by operation of the actuating lever 20. As the operator pivots the actuater 20 about its pivot pin 22, the member 20 can be moved to the phantom position thereof shown in FIG. 1 and in doing so very largely depresses the bulb 98 and forces fluid therefrom against the rear end of the piston plunger 64, thereby forcing the head 66 thereof forwardly to accomplish the double function of (1) releasing the sear 102 from engagement with the block 38 by means of a movement such as illustrated diagrammatically in FIG. 10, and (2) continued forward movement of the head 66 by piston plunger 64 pushes the slide 70 forwardly until the pusher members 74 or 96 engage the button 76 on the rear end of hyprodermic syringe plunger 78 and thereby effect forward movement thereof to cause ejection of the contents of the syringe 34 through the needle 52. As referred to above, the initial movement of the slide 70 brings the head 66 of piston plunger 64 into engagement with a depending leg 104, as shown in FIG. 10 which causes the sear 102 to pivot about transverse pivot pin 106 which extends between opposite sides of the frame member 12, as shown in FIG. 5, and thereby moves the sear 102 clockwise, thus disengaging the hook-like terminal end 108 of the sear from notch 110 in the lower face of block 38. When this occurs, spring 50 immediately contracts instantaneously and projects the syringe 34 forwardly and thus drives the needle 52 into the flesh which is to receive the contents of the syringe 34. Continued pressure upon the flexible bulb 98 projects the piston plunger 64 and head 66 thereof forwardly, during which time the articulated sear 102 and depending leg 104 are restored to the full line positions shown in FIGS. 10 and 11, while the head 66 of plunger 64 continues to move forwardly and thereby cause pusher member 74 or 96 to move the syringe plunger 78 in discharging direction within the syringe 34, as described above. During this operation, it can be visualized particularly from FIG. 1 that the movement of the slide 70 is under positive control by the operator and immediately upon stopping movement of the actuator, the forward movement of the slide 70 correspondingly is stopped, whereby ejection of accurate quanties of the contents of the syringe 34 may be effected by observing the scale normally formed upon the walls of the cylinder of the syringe 34. After a desired quanity of the contents of the syringe 34 have been ejected through the needle 52, the device may be restored to initial condition either by manually engaging the pusher members 74 or 96 and moving the same rearwardly which forces fluid from the cylinder 62, back through the conduit 100 into the bulb 98 or, providing the inherent nature of the material from which the bulb 98 is formed is capable of effecting self restoration of the bulb 98 to its fully extended position, complete release of the actuator 20 by the operator will permit the bulb 98 to assume its normal extended position and thereby remove fluid from the cylinder 62 by suction, thus also moving the piston plunger 64 rearwardly. However, the pusher members 74 or 96 will have to be restored manually to the rearward, initial position thereof. During the time in which the piston plunger 64 is moving the slide 70 forwardly, after the head 66 of plunger 64 has moved forwardly beyond the depending leg 104, said depending leg extends into the longitudinal slot 112. However, when it is necessary to restore the piston plunger 64 and head 66 to the initial starting position thereof such as shown in FIGS. 1 and 2, it becomes necessary to move the head 66 rearwardly of the depending leg 104 and this is accomplished by having the sear 102 and leg 104 commoningly mounted upon pivot pin 106 and employing a spring 114 which has oppositely extending legs and a loop intermediately between the same which receives the pivot pin 106. The legs of the spring 114 operate normally to maintain the sear 102 in its latching position. However, the depending leg 104 is free to move counterclockwise to the phantom position thereof for example shown in FIG. 11 and thereby permit the head 66 of piston plungers 64 to move beneath the lower extremity of the leg 104. In order that the leg 104 will move the sear 102 from engagement with the notch 110 in block 38, it will be seen from FIG. 13 that there is a hook-like extention 116 on the upper end of the leg 104, the tip of which engages the upper surface of sear 102, whereby upon clockwise movement of leg 104, depression of the sear 102 will be effected to cause it to release notch 100 in block 38. From the foregoing, it will be seen that the present invention provides a fullproof and durable device for effecting self-injection of the contents of a hypodermic syringe into the operators own flesh by causing initial movement of the actuator 20 to effect release of the sear 102 and thereby cause instantaneous injection of the needle 52 of the syringe 34 into the flesh of the operator, another human body, or an animal body. Then, simpliy by continuing to move the actuator 20 counterclockwise as viewed in FIG. 1, the second slide 70, by means of pusher members 74 or 96, effect discharge of the contents of the syringe 34 through the needle 52. All of this occurs without serious trauma or pain to the individual who is receiving the injection, as far as the physical operation of the device is concerned. It may be that the substance within the syringe 34 may cause some trauma upon being injected into flesh and the elimination of this by the device comprising the invention is not possible. The foregoing description illustrates preferred embodiments of the invention. However, the concepts employed may, based upon such description, be employed in other embodiments without departing from the scope of the invention. Accordingly, the following claims are intended to protect the invention broadly, as well as in the specific forms shown herein.

Summary: A hand-held instrument having a handle somewhat resembling a pistol grip depending from a horizontal frame having a slide on the forward end thereof to which a conventional hypodermic syringe is connected and including a tension spring connected to the rearward end of said slide for purposes of instantly injecting the needle of the syringe into flesh. The slide is held in its rearward, cocked position by a sear and the sear is released by means of the piston of a piston and cylinder unit, the piston being operated initially to release the sear from the syringe slide to effect injecting movement thereof. A flexible bulb is supported within the handle and a finger-engageable lever engages the bulb to force fluid against the piston to cause release of the sear and continued compression of the bulb operates a finger guided for movement against the outer end of the plunger of the syringe and forces the same in discharging direction immediately after the needle of the syringe has been injected into flesh.

big_patent

en

Summarize: The riots that left whole neighbourhoods up and down the country in a state of ruin last August were the worst civil disturbances for a generation. But reading crime figures released yesterday, it is almost as if the five days of widespread looting and violence never took place. Nearly half of the areas worst-affected by the riots saw crime fall during that month, according to Home Office statistics. In Croydon, where a 144-year-old furniture shop was one of dozens of buildings burned to the ground and a photo of a woman jumping from a first-floor inferno became one of the defining images of the riots, police recorded just seven disorder offences (as well as 423 other disorder-related offences). Defining image: A woman jumps from a burning building in Croydon during last summer's riots. Police in the ravaged London borough recorded just seven public disorder offences. The disparity comes down to the way officers recorded the avalanche of offences committed during the unrest. Some forces classified hundreds of feral thugs rampaging through different streets in the same city as just one incident of public disorder. Similarly, mass looting in which one person broke into a shop only to be followed by dozens more was recorded as a single offence. And not one force reported the offence of rioting, officially defined as '12 or more people who are present together use or threaten unlawful violence for a common purpose'. In a statement, the Home Office said: 'It is important to understand the basis of crime recording to appreciate the impact of the disorder incidents on crime statistics. 'Police record crimes according to the number of specific victims, rather than the number of offenders.' But Trevor Reeves, the owner of the 144-year-old Reeves Furniture Store in Croydon that was destroyed in an arson attack, slammed the police's method of recording crime as 'crazy'. 'You would expect a great big blip in the crime statistics after those five days of rioting,' he told the Telegraph. 'It is crazy to put down something like looting as one crime and is unnecessary. The whole world saw what was happening and to record it like this will just make them look ridiculous.' National shame: The disparity comes down to the methods used by police officers to record the avalanche of offences committed during the unrest. Croydon burning: The 144-year-old Reeves Furniture Store in flames after an arson attack. Police forces classified hundreds of feral thugs rampaging through different streets as just one incident of public disorder. Police in the London borough of Southwark recorded just one public disorder offence despite five days of unrest and 314 other offences. Officers in Manchester also said crime fell during August, despite recording 11 public disorder offences and 386 related crimes. A total of 184 incidents of violent disorder and 5,112 connected offences were recorded by police forces across England. Despite this, nine of the 15 worst affected councils recorded more crime in August 2010 than a year later. The figures did show that knifepoint robberies rose by 10 per cent last year and that one victim is held up by a knife-carrying criminal every 35 minutes. On the rise: The number of robberies committed at knife-point rose by 10 per cent in the year to September 2011, new figures show (picture posed by models) Senior officers have warned the attacks are carried out by muggers determined to steal smartphones and cash. Separate figures show a double digit rise in the number of pickpocket thefts – the biggest increase for nearly a decade. Across England and Wales, robbery rose by 4 per cent in the year to September 2011 compared with the previous 12 months. There were 15,313 knifepoint robberies in the same period – up 10 per cent from the 13,971 offences a year earlier, the crime statistics showed. Around half of all robberies took place in London and the most common items stolen were smartphones, bags and cash. The Metropolitan Police recorded a 13 per cent rise in robberies in the capital and West Midlands Police recorded a 10 per cent increase. Policing minister Nick Herbert said there are areas of concern and crime remains too high. Former Met commissioner Lord Stevens, who is chairing a commission into the future of policing set up by Labour, said the rise in crimes against the person was ‘a bit alarming’. He said: ‘I’m not surprised. It’s really worrying. We’ve got to get on top of them really quickly or you could run out of control.’ The British Crime Survey, based on a poll of more than 40,000 victims, suggested a 5 per cent rise in burglary, and a 7 per cent increase in car theft. Pickpocket thefts rose by 12 per cent. to nearly 600,000, while garden shed break-ins fuelled a 15 per cent. rise in other thefts of personal property. However, overall recorded crime fell fractionally. The number recorded was down by 4 per cent to 4.1million. Chief. Constable Jon Murphy, from the Association of Chief Police Officers,. said: ‘While incidents in violence against the person fell, a continued. cause for concern was the increase in pickpocketing, robbery and robbery. with knives.’ ‘This has. been driven by a rise in robberies of personal property and police will. want to focus on tackling these offences and offering crime-prevention. advice.’ Meanwhile, the number of murders and other killings rose by 5 per cent in the year to March 2011, said the Home Office. That. is a rise of 28 – taking the total number of violent deaths to 636, up. from 608 in 2009/10. The latter includes the 12 victims of the Cumbrian. shootings in June 2010 by Derrick Bird. Ministers. are set to introduce a ‘tough’ law meaning automatic jail for anyone. caught carrying a knife with the intention of using it to commit a. crime. Currently just one. in five of those caught carrying a knife is given a jail term. The rest. are handed community sentences, fines or other punishments. Policing. minister Nick Herbert said: ‘Today’s crime figures cannot be used to. show there is a long-term change in either direction. There are areas of. concern and, as we have consistently said, crime remains too high. ‘We know good policing makes a difference.’ This article has been amended to report the number of disorder-related offences recorded in the areas worst-hit by the riots as well as the number of disorder offences. The reference to official crime statistics being "airbrushed" has been removed from the headline. Justice Secretary Ken Clarke has introduced a number of measures to reduce the prison population. Ken Clarke (right) has come under constant attack over his money-saving plans to reduce the prison population by 3,000 by putting fewer offenders behind bars. He stunned the Tory conference in 2010 by announcing he wanted to scrap prison term of less than six months in favour of community sentences. That policy was heavily criticised last month after it emerged a quarter of criminals break their non-custodial punishments. Last year, the Justice Secretary caused outrage by suggesting that some rapes were more serious than others as he attempted to defend proposed shorter jail terms for some rapists. Then last May it was revealed that less than a third of convicted muggers and car thieves end up in jail. Furthermore, just over half of drug dealers go to prison – and only 43 per cent of those who have sex with a child under 13 are put behind bars. The row within the Tory Party itself about the Justice Secretary's approach re-emerged in October when Home Secretary Theresa May and Boris Johnson urged him to extend minimum jail terms to under-18s. However, he dismissed their call. A month later, it emerged that youth courts are jailing just one in four teenage muggers. Most young criminals are facing nothing harsher than rehabilitation, fines or community service. Even during the 'crackdown' over August's riots, the average sentence was well below two years

Summary: Police in Croydon, one of the worst-hit areas, recorded 7 disorder offences (as well as 423 other disorder-related crimes) Nine of 15 most affected areas said crime was down on a year earlier. Not one force records rioting as an offence. Figures also show knife-point robbery leapt by 10% in one year. Around half of all robberies took place in London. Common items stolen are smartphones, bags and cash.

cnn_dailymail

en

Summarize: BACKGROUND OF THE INVENTION It is well-known that patients in hospitals often develop deep vein thrombosis or blood clots in the leg veins over extended periods of hospital stay. This is particularly prevalent in elderly weak patients and those undergoing major surgery. It has been known that this condition can be controlled or alleviated by applying intermittent pressure to the patient&#39;s legs to assist in blood circulation. Many devices have been proposed, such as compression boots and other inflation tube devices. The prior boots had the disadvantage of being very cumbersome and substantially restricting the movement of the patient. To overcome this, it has been proposed by others to use an elastic stocking with an internal panel creating a pocket within the stocking for receiving an inflatable pulsating bladder. Such a device is schematically shown in cross-section by FIG. 1, wherein dotted lines are used to show both the stretchable outer stocking layer and the inner panel. In the prior art pulsatile elastic stocking of FIG. 1, the stocking had to be sufficiently stretchable for easy donning and yet be sufficiently inelastic at an upper limit to provide sufficient compressive forces against the leg when the bladder was inflated. These competing functions made it difficult to provide the precise stretch-ability in the elastic stocking such that a stocking could fit a substantial range of patient leg sizes and shapes. SUMMARY OF THE INVENTION This invention provides an improvement to the elastic pulsatile stocking shown in the prior art of FIG. 1. The improvement over the prior art is shown schematically in FIG. 2 where a highly elastic stocking has a substantially inelastic outer panel that encases only a portion of the stocking&#39;s circumference. Thus, a bladder cavity is defined between the inelastic outer panel and the inner highly elastic stocking, and this inelastic panel restricts circumferential stretching of a stocking portion within the inelastic panel, but does not restrict stretching of remaining portions of the stocking. Preferably the inelastic panel has a slide fastener for temporarily opening it to insert an inflatable bladder, and provide unrestricted circumferential stretching of the stocking during donning and removing from a patient&#39;s leg. The inelastic panel has internal pockets for retaining the bladder in proper position. The bladder also has an internal shape defining panel to cause an inflated bladder to more readily conform to the shape of the leg&#39;shin area. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a schematic sectional view of a pulsatile elastic stocking proposed by others; FIG. 2 is an improvement to the prior art stocking of FIG. 1, in which an inelastic outer panel is shown; FIG. 3 is a side elevational view of the pulsatile elastic stocking of this invention with an internal bladder connected to a pulsating pressure source; FIG. 4 is a top plan view of an inflatable bladder for this pulsatile elastic stocking; FIG. 5 is a sectional view taken along line 5--5 of FIG. 4 showing the bladder in a nearly deflated condition; and FIG. 6 is a sectional view similar to that of FIG. 5, but showing the bladder in inflated condition. DETAILED DESCRIPTION In the pulsatile elastic stocking proposed by others, shown in FIG. 1, an outer elastic stocking has an inner panel 1 secured to the stocking at approximately diametrically opposed seam areas 2 and 3. This creates a bladder pocket 4. Since the stocking is outside the bladder, it has to perform two competing functions. First it must be stretchable enough for easy donning and removal, and yet be sufficiently unstretchable to produce an inward compressive force against a bladder (not shown) to exert a pressure against a patient&#39;s leg. Thus, the elastic stocking of FIG. 1 has very limited elasticity in a circumferential direction. For instance, such stocking generally had an upper limit of elongation in a circumferential direction of less than 150%. This limited elasticity rendered the stocking usable over a very limited range of leg sizes and shapes. This invention makes an improvement in the stocking shown in FIG. 1, by providing a highly elastic inner tubular member, such as a stocking, having the capability of elongating in a circumferential direction in an amount of at least 150%. The highly elastic stocking of a porous air breathable material is capable of elongation in a circumferential direction of from 150% to 500%. A stocking capable of elongating a circumferential direction of approximately 300% has been shown to work exceedingly well for present invention. The highly elastic stocking of this invention also had the capability of substantial elongation in a longitudinal direction. For instance, the pulsatile stocking of this invention can stretch from 150% to 600% in the longitudinal direction, and a stocking capable of 400% longitudinal stretch words exceptionally well. By contrast, the stocking of the prior art FIG. 1 design, stretched only approximately 110% in the longitudinal direction because of the compressive demands on such stocking for holding the inflatable bladder. The highly elastic stocking of FIG. 2 is preferably of the anti-embolism type used in hospitals for static compression of the patient&#39;s leg. Such stockings are marketed under the trademark CARE stocking. Such stockings are highly elastic and firmly grip the leg. They usually have a different knit construction in the ankle area to provide a tighter grip around the ankel then around the calf section to prevent pooling of blood in the ankle area. U.S. Pat. No. 3,975,929 and 3,983,870 describe typical anti-embolism stockings. Combined with the highly elastic stocking of FIG. 2 is an outer inelastic panel 5. This inelastic panel 5 encases a major portion of the elastic stocking and is secured to such stocking at longitudinal seams 6 and 7. Thus, the stocking encased within inelastic panel 5 has restricted stretchability after it is on the patient, because of the inelasticity of panel 5. However, an unencased portion 8 representing less than 1/2 of the stocking&#39;s unstretched circumference is free to circumferentially expand with patient leg movement to provide increased comfort to the patient. It has been found that the stocking and inelastic panel work very well when a portion of the circumference in the range of 15% of the unstretched stocking&#39;s circumference is not encased within the panel. Preferably, the inelastic panel 5 has an openable seam shown schematically as numeral 9 in FIG. 2. FIG. 3 shows the highly elastic stocking 10 which has a calf portion 11 and a foot portion 12. If desired, a toe inspection hole 13 can be provided in the stocking. Fitting over an upper portion of the stocking is inelastic panel 5 which is preferably of a substantially nonstretchable cloth. Inelastic panel 5 is secured to an outer surface of stocking 10 by a stitched seam 7. A bladder 12 fits within a bladder cavity inelastic panel 5 and highly elastic stocking 10. Bladder 12 is held in position by a pair of pockets 14 and 14a at opposite ends of panel 5. These pockets are formed by separate small rectangular fabric segments stitched along three sides to panel 5. Sides 15 and 16 remained unstitched to provide an opening for bladder 12. Alternatively, the bladder retaining pockets could have end portions of panel 5 that are longitudinally folded inwardly and then these end portions sewn to remaining portions of panel 5 to form pockets. Such construction would eliminate the need for separately cutting rectangular pieces. If desired, the pockets could be sewn into the stocking 10 itself rather than on the panel 5. It is preferable to provide an opening means such as a slide fastener 9. A pressure contact fastening means, such as snaps, on hook and loop fasteners marketed under the name VELCRO could also be used. Such opening means provide easy access for insertion and removal of the bladder, and also provides less restriction of stocking stretching during donning and removal from a patient&#39;s leg. Once the device has been assembled on the patient as shown in FIG. 3, a bladder port 17 is connected to a pulsating air pressure source 18 by means of a tube 19. FIGS. 4, 5, and 6 show the construction of the internal bladder 12 which is formed by two superimposed thermoplastic panels heat sealed about their periphery. A port 17 is sealed to an upper panel to provide flow communication with an interior of the bladder. An important feature of the bladder configuration is an interior shape defining panel 18 encased between upper panel 19 and lower panel 20. As shown in its deflated condition, panel 18 is sealed to upper panel 19 at 21 and 22 near the peripheral seals of the upper and lower panels. The center section of shape defining panel 18 is heat sealed to a central section of lower panel 20 at 23. Thus, a central area of the bladder has three compartments 24, 25, and 26. When the bladder is inflated, shape retaining panel causes a central portion of the bladder to assume the cross-sectional shape shown in FIG. 6. The heat seal at 23 causes the lower panel of the bladder to be pulled into a recessed configuration shown at 27. Thus, the bladder more closely follows the contour of the shin area of the patient&#39;s leg. The chambers 24 and 26 provide for even pressure on opposite sides of the shin. This configuration also helps prevent shifting of the bladder to a side of the leg. So the bladder can inflate as shown in FIG. 6, shape retaining panel 18 is unsealed to either the top or bottom panels at its end 28 and 29. Therefore, all of the chambers 24, 25, and 26 are interconnected and maintained at a common pressure through an opening or vent across the shape retaining panel. It has been found that the bladder works very well when formed of a thermoplastic material, such as polyvinylchloride. In the foregoing drawings and specification, a specific example has been used to describe the invention. However, it is understood by those skilled in the art that certain modifications can be made to this example without departing from the spirit and scope of the invention.

Summary: A device for applying intermittent compression to a body member, such as a leg, of a patient is disclosed. This device has a highly elastic stocking of the antiembolism type with an inelastic external panel secured to a portion of the stocking&#39;s circumference to provide a bladder cavity and restrict circumferential stretching of only a portion of the stocking. The inelastic panel has an openable structure, and internal bladder retaining pockets. An inflatable bladder includes an inner shaping panel causing the bladder to more readily conform to the shin area of the leg.

big_patent

en

Write a title and summarize: Histones package DNA and regulate epigenetic states. For the latter, probably the most important histone is H3. Mammals have three near-identical H3 isoforms: canonical H3. 1 and H3. 2, and the replication-independent variant H3. 3. This variant can accumulate in slowly dividing somatic cells, replacing canonical H3. Some replication-independent histones, through their ability to incorporate outside S-phase, are functionally important in the very slowly dividing mammalian germ line. Much remains to be learned of H3. 3 functions in germ cell development. Histone H3. 3 presents a unique genetic paradigm in that two conventional intron-containing genes encode the identical protein. Here, we present a comprehensive analysis of the developmental effects of null mutations in each of these genes. H3f3a mutants were viable to adulthood. Females were fertile, while males were subfertile with dysmorphic spermatozoa. H3f3b mutants were growth-deficient, dying at birth. H3f3b heterozygotes were also growth-deficient, with males being sterile because of arrest of round spermatids. This sterility was not accompanied by abnormalities in sex chromosome inactivation in meiosis I. Conditional ablation of H3f3b at the beginning of folliculogenesis resulted in zygote cleavage failure, establishing H3f3b as a maternal-effect gene, and revealing a requirement for H3. 3 in the first mitosis. Simultaneous ablation of H3f3a and H3f3b in folliculogenesis resulted in early primary oocyte death, demonstrating a crucial role for H3. 3 in oogenesis. These findings reveal a heavy reliance on H3. 3 for growth, gametogenesis, and fertilization, identifying developmental processes that are particularly susceptible to H3. 3 deficiency. They also reveal partial redundancy in function of H3f3a and H3f3b, with the latter gene being generally the most important. The core histones H2A, H2B, H3 and H4, package DNA into nucleosomes and modify higher-order chromatin structure. H3 in mammals is represented by three near-identical 135 amino acid isoforms: canonical H3. 1 and H3. 2, and the variant H3. 3. Chromatin incorporation is replication-coupled for the canonical forms, and is replication-independent for H3. 3 [1–4]. H3. 3 plays fundamental roles in regulating genome function and stability. It can accumulate in terminally differentiated or non-dividing cells, and can become the predominant H3 isoform [3,5]. Through the chaperone HIRA (histone cell cycle regulation defective homolog A (S. cerevisiae) ), H3. 3 is deposited at active genes and regulatory regions, forming more accessible nucleosomes [3,4, 6–8], and underlies the formation of epigenetic bivalent domains at the promoter regions of poised genes in embryonic stem (ES) cells [8,9]. Through the chaperones ATRX (alpha thalassemia/mental retardation syndrome X-linked) and DAXX (Fas death domain-associated protein), H3. 3 is deposited at repetitive regions such as telomeres and centromeres, serving genome stabilization functions [10–12]. H3. 3 is required for heterochromatin formation in mammalian preimplantation-stage embryos [13,14], and has been reported to preferentially localize to the heterochromatic XY-body in meiosis-I, where it could serve functions related to meiotic sex chromosome inactivation (MSCI) [15]. Finally, specific amino acid substitutions in H3. 3 drive cancer [16,17], underscoring the fundamental importance of H3. 3 in regulating epigenetic states. Canonical histones are encoded by numerous clustered intronless genes, while histone variants are typically encoded by one intron-containing gene. H3. 3 presents a unique genetic paradigm in that the identical protein is encoded by two intron-containing unlinked genes, H3f3a, and H3f3b (histone 3, family 3A and -B). We will refer to the encoded proteins as H3. 3A and H3. 3B, respectively. The two genes have divergent regulatory and intervening regions, suggesting some qualitatively different functional roles. The presence of two H3. 3-encoding genes, and their genomic arrangement, is highly conserved in mammals and birds [18]. Here, we have investigated the developmental effects of null mutations of H3f3a and H3f3b in the mouse (Mus musculus), each mutated by the same experimental strategy, and in the identical mouse strain—129S1/SvImJ (129S1). H3f3a mutants were viable to adulthood. By contrast, H3f3b mutants were growth deficient, and inviable at birth. Failures in gametogenesis and fertilization were seen, with the defects severer on ablation of H3f3b. Our results demonstrate important functions of H3. 3 in growth, viability, and fertility, and reveal stages of gametogenesis and fertilization that are adversely affected by H3. 3 deficiency in the mouse. H3f3a+/- heterozygous young were produced by mating ES cell chimaeras to strain 129S1 Cre-deleter females [19] (see Materials and Methods). H3f3a+/- females and males were overtly normal and fertile. Timed matings were obtained from H3f3a+/- ♀ × H3f3a+/- ♂ intercrosses so that newborns could be monitored. In 14 litters in which 65 pups were born, only four dead pups were seen: two of these dead pups were H3f3a-/-. All remaining young survived to adulthood, except two H3f3a-/- runts that were culled. From all timed pregnancies, and other intercrosses, 29,84 and 46 animals surviving to adulthood were H3f3a-/- mutant, H3f3a+/- and H3f3a+/+ (WT), respectively—not significantly different from a 1: 2: 1 ratio (P>0. 05, chi-squared test). H3f3a-/- females were of normal size. By contrast, H3f3a-/- males were slightly smaller than H3f3a+/- and WT males at 3 wk and 6 wk (Fig. 1A). H3f3a-/- mutants of both sexes were overtly normal in behaviour and appearance. H3f3b+/- young were bred by mating ES cell chimaeras to strain 129S1 Cre-deleter females (see Materials and Methods). These young often appeared smaller than WT sibs at weaning, but developed into robust adults. H3f3b+/- females were fertile on mating with WT 129S1 males. From these matings, altricial and weaned H3f3b-/+ young were significantly smaller than WT littermates, revealing haploinsufficiency for H3f3b (Fig. 1B). H3f3b-/- mutants could not be bred in intercrosses because H3f3b-/+ males were sterile, with small testes (Fig. 1C). To produce H3f3b-/- zygotes, we again made use of the 129S1 Cre-deleter line. The cre cds in this line is X-linked (Xcre). Floxed alleles are always mutated on sperm entry into Cre-containing oocytes when XXcre females are used [19]. Two sequential matings were performed. First, H3f3b-/+, XXcre females were bred in H3f3bc/c, XX ♀ × WT, XcreY ♂ matings—these females were converted to the H3f3b-/+ genotype early in development because of the presence of Xcre. Second, H3f3b-/+, XXcre ♀ × H3f3bc/c, XY ♂ matings were performed to obtain timed pregnancies. The paternal H3f3bc allele was converted to H3f3b- in the zygote in these matings. Therefore, a 1: 1 ratio of H3f3b-/- to H3f3b+/- zygotes was expected. Results of fetal recovery are shown (Table 1). Overall, 37 H3f3b-/- and 69 H3f3b+/- fetuses were obtained, different from a 1: 1 ratio. Thirty-six deciduae were counted in these pregnancies, these being implantation sites in which development did not proceed beyond the early implantation stage. It is possible that most of these deciduae represented failures in H3f3b-/- development, accounting for the fetal deficit. This failure was not associated with sex chromosome constitution or to the presence of Xcre (Table 1). Twenty four percent (9/37) of H3f3b-/- fetuses at 13½-18½ dpc were dead or severely abnormal (Table 1). Live 18½ dpc H3f3b-/- fetuses, two days before birth, had no gross abnormalities (Fig. 1D). However, no live H3f3b-/- pups were seen in newborn litters. Thirty two H3f3b+/- animals were born, 29 of which survived to weaning. A single H3f3b-/- dead pup was found on the day of birth. These results strongly suggest that all H3f3b-/- pups died at birth, then were consumed by the mothers. The immediate death of pups at birth is usually associated with respiratory failure [20]. Examining 18½ dpc H3f3b-/- fetuses histologically revealed no gross pathology in any tissues, including the lungs (S1 Fig.). To confirm that H3f3b-/- fetuses could not survive parturition, fetuses were delivered by Caesarean at 19½ dpc. From 5 pregnancies, of 11 H3f3b+/- fetuses delivered, all initiated normal respiration within a few minutes, remaining oxygenated or ‘pink’, and mobile. By contrast, all 6 H3f3b-/- fetuses delivered failed to initiate respiration after initially gulping. Within a few minutes they were immobile, and ‘blue’ (Fig. 1E). They were also smaller than H3f3b+/- littermates (Fig. 1F). H3f3a-/- mutants contain residual H3. 3B, while H3f3b-/- mutants contain residual H3. 3A. These amounts of residual H3. 3 were determined in immunoblots in the brain, kidney, liver and lung of 18½ dpc fetuses, and in the trunk of 13½ dpc fetuses (Fig. 2). In both mutants, H3. 3 was detected in all organs, consistent with H3. 3A and H3. 3B being essentially ubiquitous in the developing fetus. Given that H3f3b-/- mutants had the severer phenotype, we expected to see relatively less residual H3. 3 in these animals. However, the only clear difference between the two mutants was in the brain, where H3f3b-/- animals had relatively higher residual H3. 3A (Fig. 2). Three H3f3a-/- males were fertility-tested alongside three WT littermates within the first three months after reaching adulthood. Each male was caged for one week with two nulliparous 8–10 wk outbred Swiss females, this being repeated over several weeks. For H3f3a-/- males, 7 pregnancies from 34 female exposures resulted, less than the frequency for WT males—16 pregnancies from 28 exposures (P<0. 001, Fisher’s exact test). Also, litters sired by H3f3a-/- males were small: WT, 10. 63 ± 2. 55 (16); H3f3a-/-, 6. 14 ± 4. 85 (7) [mean ± s. d. (n) ] (P<0. 01, t-test). These three littermate pairs, and two additional pairs, were then fertility-tested at 6–10 months of age. Over this period, each male was caged with two Swiss females. All WT males consistently sired large litters, while three H3f3a-/- males sired no litters, and two H3f3a-/- males sired the occasional small litter. At the end of this period, the ability of H3f3a-/- males to copulate was tested. Vaginal plugs, at ½ days post coitum (dpc), were readily obtained when H3f3a-/- males were mated with nulliparous Swiss females. Oviducts were flushed at 1½ dpc. H3f3a-/- males fertilized substantially fewer ova than WT littermates, indicating that the subfertility was caused by a defect in spermatogenesis (Table 2). The reproductive tracts were overtly normal, except the vasa deferentia appeared to be devoid of sperm. Representative histological sections of the testes and caudae epididymides are shown (Fig. 3 A–E). A substantial production of sperm was seen in H3f3a-/- males, although some sloughed germ cells were present in the caudae, indicating developmental failure of some spermatids (Fig. 3D, E). Sperm isolated from the caudae showed reduced motility, failing to efficiently swim out in media. The large majority of spermatozoa possessed tail defects, with some possessing head defects (Figs. 3F, 4). These data are consistent with a requirement for H3. 3A in spermiogenesis. H3f3b heterozygous males derived from chimaeras mated to Cre-deleter females, or from the H3f3b+/- ♀ × WT ♂ backcross, were sterile. Their testes were less than one third of normal weight, indicative of failed spermatogenesis (Fig. 1C). Histological analysis revealed a reduction of round spermatids and very few elongating spermatids in the lumen of seminiferous tubules (Fig. 3G, H). The caudae epididymides were devoid of sperm, and often contained sloughed germ cells (Fig. 3I). H3. 3 has been reported to preferentially localize to the XY-body, where it may play a role in MSCI [15]. Therefore, we thought there may a level of MSCI failure in H3f3b-/+ males. MSCI acts as a checkpoint. Its failure is associated with autosomal asynapsis, leads to pachytene apoptosis with no progression of spermatocytes beyond meiosis-I [21,22]. The presence of pachytene spermatocytes with XY-bodies, and round spermatids in H3f3b-/+ sterile males (Fig. 3H), indicates that there is no serious failure of MSCI. Yet, we decided to investigate autosomal synapsis in H3f3b-/+ males more directly. First, we examined the localization of γH2A. X (H2A histone family, member X) in mid- to late-pachytene spermatocytes of H3f3b-/+ males, when autosomes should be fully synapsed. These stages were marked by positive staining for H1FNT (H1 histone family, member N, testis-specific) [23]. All H3f3b-/+ H1FNT-positive cells examined (>50) displayed discrete localization of γH2A. X to the presumptive XY-body, with no labelling evident outside this region, indicating that autosomal synapsis and MSCI proceeded normally (Fig. 5A–D). Complete autosomal synapsis in H3f3b-/+ males was confirmed in double-staining for SYCP3 and SYCP1 (synaptonemal complex proteins 3 and 1). SYCP3 marks chromosomal axial elements that have assembled in meiosis-I, and is present before and during synapsis, while SYCP1 marks synapsed chromatin. All spreads with 20 discrete SYCP3-positive axial elements examined (>30) were equivalently positive for SYCP1, demonstrating complete synapsis. The unsynapsed sex chromosomes remained SYCP1-negative (Fig. 5E–H). Finally, no increase in apoptosis was seen in spermatocytes or round spermatids by TUNEL staining (S2 Fig.). Overall, these data strongly suggest that meiosis-I is essentially normal in H3f3b-/+ spermatocytes. Thus, the failure in spermatogenesis is localized to round spermatids, which appear to arrest through mechanisms that do not involve apoptosis. These data suggest a crucial role for H3. 3B in early spermiogenesis, one that is relatively more important than for H3. 3A. In H3f3a mutants, spermiogenesis was also abnormal, but did lead to the formation of sperm. RNA in situ hybridization analysis has shown that the expression of H3f3b is restricted to primary spermatocytes, while the expression of H3f3a is ubiquitous across spermatogenic cell types [24]. It therefore appears that the requirement for H3. 3B in spermiogenesis is fulfilled by translation in meiosis-I. The difference in severity of phenotype was not reflected in the relative amount of RNA, as we measured more H3f3a than H3f3b RNA in pachytene spermatocytes (Fig. 6A). Also, the amounts of H3. 3 detected in pachytene spermatocytes and round spermatids of H3f3a-/- and H3f3b+/- males were not discernibly different to WT (Fig. 6B). H3f3a-/- females were of normal fertility. Of eight 6 wk females caged with WT 129S1 males, seven gave birth within 10 wk. Litter size was 4. 86 ± 1. 86 (7) [mean ± s. d. (n) ], not significantly different to that obtained with H3f3a+/- females in intercrosses; 5. 54 ± 2. 54 (14) (P>0. 05, t-test). H3f3a-/- females raised their young normally. Three H3f3a-/- second-generation female young, bred in H3f3a-/- ♀ × H3f3a-/- ♂ matings, were also fertile: when mated to a WT outbred Swiss male, each had three sequential litters no more that one month apart, and with no fewer than five pups in any litter. All pups were raised normally. These results show that H3. 3A is dispensable in the female germ line, and for fertilization and development. To determine the requirement for H3. 3B in folliculogenesis, we used the Zp3 (zona pellucida protein 3) promoter-cre cds transgenic mouse line, Tg (Zp3-cre), which excises floxed sequences at primordial follicle activation [25,26]. We bred a Tg (Zp3-cre) congenic line in strain 129S1 to perform all the experiments described. H3f3bc/c, 0/0 ♀ × H3f3bc/c, 0/Tg (Zp3-cre) ♂ matings produced control H3f3bc/c, 0/0, and experimental H3f3bc/c, 0/Tg (Zp3-cre) females. These females were mated with WT males to obtain timed pregnancies. Less H3f3bc/c, 0/Tg (Zp3-cre) or experimental females became pregnant, and in these, fetal recovery was very low—only 6% in successful matings, relative to control females (Table 3). A few females were allowed to give birth, and pups were viable to adulthood. No deciduae were observed in any of the pregnant or non-pregnant plugged experimental females, indicating that there was a failure in ovulation, fertilization, or cleavage. Ova were scored at ½ dpc. The number obtained in control and experimental female matings was equivalent. However, fewer ova in experimental females were fertilized (Table 3). Zygotes, with visible pronuclei, were cultured overnight to 1½ dpc: only 10% of experimental pronuclear zygotes could cleave. Cleavage failure was also observed in vivo, when oviducts of experimental females were flushed at 1½ dpc (Table 3). Experimental zygotes that failed to cleave are shown (Fig. 7A). To gain insight into the cause of cleavage failure in H3f3b-/- zygotes, we studied aspects of chromatin structure using immunofluorescence. A hallmark of late prophase and mitosis is the serine phosphorylation of histone H3 (H3Sph). The deposition dynamics of this mark are highly conserved, suggestive of important roles in mitosis. Indeed, it has been recently shown that H3S10ph is required for proper chromosome condensation in budding yeast (Saccharomyces cerevisiae) [27]. H3f3b-/- zygotes did not accumulate this mark, even after overnight culture, indicating that they failed to progress to late prophase (Fig. 8). Staining for H3K9me3, being specific for the maternal pronucleus [28,29], revealed that the paternal pronucleus was often similar in size or smaller than the maternal, instead of being consistently larger, as in controls (Fig. 8). We also typically observed small and dispersed nucleolar precursor bodies (NPBs) in the maternal pronuclei of H3f3b-/- zygotes—evident under DAPI staining. Control H3f3bc/c zygotes typically contained one large NPB in each pronucleus (Fig. 8). Similarly, the central regions of intense DAPI staining in the paternal pronuclei of H3f3b-/- zygotes could be related to a reduction in the development of NPBs: normally, intense DAPI staining is concentrated at the periphery of NPBs, corresponding to constitutive heterochromatin [29,30]. DNA replication was examined in H3f3b-/- zygotes using Edu incorporation, concomitant with H3K9me3 immunofluorescence so that the maternal and paternal pronuclei could be definitively discerned. Three classes of H3f3b-/- zygote were seen in respect to relative pronuclear size and DNA synthesis: (1) paternal larger than the maternal, robust replication in both—3 of 21 zygotes, (2) paternal similar to the maternal, reduced replication in at least the paternal—8 of 21 zygotes, and (3) paternal smaller than the maternal, replication in only the maternal—10 of 21 zygotes (Fig. 8). Thus, all mutant zygotes appeared to have smaller NPBs, while most showed reductions in DNA replication. The developmental potential of H3f3a and H3f3b mutant oocytes as described above, indicates that H3f3b is either the predominant source, or the only source, of H3. 3 during folliculogenesis. To distinguish between these possibilities, we first examined the relative amounts of H3f3a and H3f3b RNA in ovulated unfertilized oocytes by quantitative real-time PCR. Both RNAs are present, with the amount of H3f3b RNA being double that of H3f3a (Fig. 6A). Next, we assessed the developmental potential of double-conditional experimental H3f3ac/c, H3f3bc/c, 0/Tg (Zp3-cre) oocytes, in which H3. 3A and H3. 3B should be eliminated soon after primary oocyte activation. Presumptive double-mutant primary oocytes were inviable. Experimental females at 4 wk had very small ovaries, with no apparent oocyte growth. A similar phenotype was seen in 10 wk experimental females (Fig. 7B). Primordial follicles, of ~11 μm in diameter, and very early-stage primary oocytes, were of normal appearance. By contrast, nearly all primary oocytes developing a second layer of follicle cells were degenerating, reaching a maximum of ~50 μm in diameter (Fig. 7C). Very few larger primordial oocytes were seen, except for a rare early-stage antral follicle. This result indicates that H3f3a and H3f3b are both sources of H3. 3 during folliculogenesis, and clearly shows that H3. 3 is absolutely required. Despite the inviability of double-mutant primary oocytes, they had undergone a significant development of the zona pellucida, indicating that the genes encoding the zona glycoproteins were being actively transcribed up to the stage of oocyte death (Fig. 7C). We have assessed the contribution to viability and fertility of the two unlinked genes encoding the histone variant H3. 3 in mice. The findings provide implications for the relative importance of each gene. H3f3a and H3f3b mutants could develop to late gestation, demonstrating no absolute requirement for either gene up to this stage. H3f3a is strongly ubiquitously expressed during development [31,32], and the present study indicates this is also true for H3f3b. Both genes have CpG-island promoters, consistent with housekeeper expression. Given the wide expression profile of each gene, a level of functional redundancy is likely. The co-ablation of H3f3a and H3f3b RNA in zygotes by morpholinos resulted in morula-stage arrest, revealing functional importance of H3. 3 at this early stage [33]. It remains of interest to determine the developmental potential of double-mutant animals in our experimental system. Double-mutants may survive the preimplantation period because of the presence of maternal H3f3a and H3f3b RNAs. Also, mouse ES cells in which H3. 3 is depleted are viable, and are able to differentiate into all three germ layers in teratomas [9]. The presence of two H3. 3-encoding genes appears to be important, given its conservation in at least mammals and birds [18]. This gene doubling may be necessary to satisfy the high demand for this protein in DNA packaging and other downstream functions, akin to the multiplicity of canonical H3. 1- and H3. 2-encoding genes. Sequences outside the cds of H3f3a and H3f3b are nevertheless highly divergent. From the present results, H3f3b is generally functionally more important than H3f3a, given H3f3b mutants were more severely affected than H3f3a mutants. This was seen in fetal and postnatal growth, perinatal survivability, spermiogenesis, and zygote development. However, this conclusion assumes that there is no compensatory regulation between the two genes. This cannot be examined at the protein level in WT animals, as H3. 3A and H3. 3B cannot be distinguished. Surprisingly, H3f3a and H3f3b mutants contained similar amounts of residual H3. 3 in a range of tissues examined, except brain, where the residual H3. 3A was higher. These findings indicate that differences in expression of the two genes at the sub-organ tissue-specific level are the most important determinants of the relative functional importance of H3. 3A and H3. 3B. Differences in tissue-specificity of expression is suggested in the recent findings that paediatric brain tumors, and giant cell tumors of bone, contain driver amino acid substitution mutations in H3F3A, while chondroblastomas contain driver mutations in H3F3B [16,17]. A detailed investigation of the tissue-specific expression of each of these genes in development would be of interest. Approximately one half of H3f3b mutants appeared to die at the implantation or early postimplantation stage. The other half developed to fetal stages, with the majority reaching birth. One possible explanation for this developmental bipotentiality is chromosomal instability. A higher level of aneuploidy was reported in H3f3b mutant primary embryo fibroblasts [34], therefore there could exist a potential for aneuploidy at the preimplantation stage. Most aneuploid blastocysts die at implantation, or shortly thereafter [35]. The failure of H3f3b mutants to initiate respiration at birth was not accompanied by any lung histopathology, but there could be lung surfactant or neural deficits that lead to immediate respiratory failure [20]. The defects induced by H3. 3B deficiency in the germ line were striking. The constitutive loss of one H3f3b allele led to the arrest of round spermatids, and sterility. By contrast, the loss of both H3f3a alleles resulted in dysmorphic spermatozoa, and subfertility. This difference in severity occurred despite our lack of evidence that H3f3b is expressed at a higher level than H3f3a, or is the major source of H3. 3, in pachytene spermatocytes and round spermatids. This raises the possibility that there could be qualitative differences in the distribution of H3. 3A and H3. 3B in spermatogenic cells. Differential expression of the two genes during the prolonged meiotic cycle could lead to regional and functional differences in the incorporation of each protein into chromatin, depending on what sites are vacant for incorporation, and when. The phenotypes described here in H3f3a and H3f3b mutants differ substantially from phenotypes described in other studies. A hypomorphic gene-trap mutation in H3f3a led to very high mortality by weaning [36]. In explaining our milder phenotype, genetic background is an unlikely explanation, as both H3f3a mutations were propagated in a ‘Steel’ substrain of strain 129 [37]. Environmental influences are a possible explanation: the survivability of H3f3a mutants to weaning was increased when litter size was reduced [36]. Finally, the H3f3a retroviral gene-trap mutation was reported to produce up to ~20% normal levels of full length H3f3a RNA [36]. Therefore, retroviral sequences could have resulted in a deregulation of residual H3. 3A that was detrimental to viability. In contrast to the situation for H3f3a, our H3f3b mutants were considerably more affected than those previously described [34,38]. In this earlier study, a normal frequency of H3f3b mutants was obtained at midgestation, although most were substantially growth retarded. Despite this prominent defect, many mutants survived parturition and developed to adulthood. No growth deficit was seen in postnatal H3f3b heterozygous or mutant animals [34]. By marked contrast, our H3f3b mutants could not survive beyond birth, and a significant number died even before this stage. Further, we saw marked reductions in growth in perinatal and postnatal heterozygous and mutant animals. The greater phenotypic severity associated with our H3f3b mutation was also seen in the male germ line. We saw a near-uniform arrest of round spermatids in heterozygous males. By contrast, previously reported heterozygous males were fertile [34]. Indeed, the phenotypic severity in our heterozygous animals exceeded even that seen in recently described H3f3b mutants, where appreciable progression through spermiogenesis was observed. These mutants were sterile due to the production of sperm with motility and head defects [38]. Other differences were apparent. We saw no increase in apoptosis by TUNEL staining in seminiferous tubules of heterozygotes, while an increase was seen in mutants [38]. Reduced protamine loading was reported in mutants, and this could be a major contributor to the defective head formation in mature sperm [38]. This phenotype was similar to that seen in our H3f3a mutant males, therefore there could be a similar mechanistic basis. However, in our H3f3b heterozygous males, other explanations are required, as the stage of arrest precedes the phase of histone displacement. In round spermatids, there is a large increase in transcriptional activity [39,40], and defects in this transcriptional activation could lead to their arrest. The simplest explanation for the differences in effect of the two H3f3b mutations is genetic background. Ours was kept in strain 129S1, while the other was kept in strain C57BL/6 [38]. A caveat in interpreting the present, and previous, results is that the H3f3b mutations were constitutive. H3. 3B deficiency in Sertoli cells, which support spermatogenesis, could exacerbate the germ cell defects observed. H3. 3B deficiency in folliculogenesis led to some fertilization failure, and zygotic arrest, demonstrating that H3f3b is a maternal effect gene. Loss of maternal Hira, a H3. 3 chaperone, leads to zygote failure in flies (Drosophila melanogaster). After sperm entry, H3. 3 fails to incorporate into paternal chromatin, leading to failed decondensation of sperm chromatin [41]. A similar effect has recently been described in mouse, where depletion of HIRA in folliculogenesis using the Tg (Zp3. cre) transgene resulted in zygote arrest. The loss of HIRA led to a failure of paternal pronucleus formation. Also, the loss of DNA replication and ribosomal RNA transcription in paternal and maternal chromatin was observed, and either one of these deficiencies can lead to zygote arrest [42]. The phenotype in our H3. 3B-deficient mutant oocytes was similar to, but less severe than, the HIRA-deficient phenotype, and could be explained by the presence of residual H3. 3A. Our phenotype was variable, ranging from reduced, to overtly normal, paternal pronuclear expansion. Only a small number of mutant zygotes showed robust DNA replication in both pronuclei. If these represent the few zygotes able to cleave, then incomplete DNA replication could be the predominant cause of failed entry into first mitosis. Another possible explanation is a deficiency of H3Sph, given the importance of H3. 3 in DNA packaging in the zygote, and the probable requirement for H3Sph in chromosome condensation at the end of prophase [27]. This could be investigated by determining the developmental potential of H3. 3B-deficient zygotes supplemented with mutant H3. 3 lacking relevant serines. H3. 3 incorporation has also been recently shown to be required for pronuclear pore formation [43] and it is possible that a defect in this assembly could explain the mitosis failure. An important requirement for H3. 3 during the early phase of oocyte growth was seen in the developmental failure of H3f3a, H3f3b double-mutant primary oocytes. Given that HIRA-deficient oogonia can develop and be ovulated, this result clearly demonstrates a requirement for other H3. 3 chaperones, possibly DAXX and ATRX, in regulating folliculogenesis. Conditional mutagenesis of these chaperones during folliculogenesis could be informative. The death of H3. 3-deficient primary oocytes could be related to the lack of incorporation by a chaperone aside from HIRA, or to the combined lack of incorporation by two or more chaperones. This study provides insight into the relative importance of the two genes encoding H3. 3 for development and fertility in the mouse, and provides a basis for further investigations into the various biological roles of this basic building block of chromatin. The mouse lines carrying Cre/loxP conditional mutant alleles of H3f3a and H3f3b, termed H3f3ac and H3f3bc, have been described [32]. The Cre-deleter line used to derive mice carrying constitutive mutant alleles, termed H3f3a- and H3f3b-, was 129S1/Sv-Hprttm1 (cre) Mnn/J (Jackson Laboratory, stock no. 004302). Testes and ovaries from adult mice were fixed in Bouin’s fixative. Sections were embedded in paraffin and stained by Periodic-Acid Schiff (PAS). Fetuses at 18½ dpc were decapitated, transferred to 20 mL of Bouin’s fixative, rocked slowly for 3 days, then washed in four changes of 70% (v/v) ethanol over 2 days. Sections were stained with haematoxylin and eosin. Spreads of mature sperm were made by squeezing the cauda epididymis with the back of curved forceps for release into 0. 3 mL of medium M2 [44]. Most of the droplet was transferred to a tube with a wide-bore yellow tip, then an equal volume of 10% phosphate buffered formalin added, and gently mixed. After fixation (15 min, RT), a small drop of the sperm suspension was smeared onto a slide, air-dried, and stained with haematoxylin and eosin. Spermatocyte spreads from 18–22 days post partum mice and immunofluorescence (IF) were performed as described [45], with the following modifications: both testes of an 18–22 days post partum (dpp) male were transferred to 2 mL of Dulbecco’s phosphate buffered saline (without calcium and magnesium, with 5. 6 mM glucose and 0. 4 mg/mL bovine serum albumin), in a petri dish, the tunicae removed, and cut into small pieces with scissors. The pieces were transferred to 3 mL of 0. 25% trypsin-EDTA (Gibco, 25200) in a polystyrene tube (Falcon, 352054), incubated (37°C, 20 min), and triturated vigorously with a transfer pipette (30 sec). The crude suspension was passed through a cell strainer (Falcon, 352350) into 1 mL of fetal bovine serum in a 15 mL centrifuge tube, and mixed. The spermatocytes were pelleted (250 × g, 4 min), the pellet resuspended in 3 mL of medium M2, and the tube placed on ice. Protease inhibitors (Sigma Aldrich, P8340) were added to all of the solutions. To prepare the spreads, 50 μL of the sperm suspension was combined with 0. 1 mL of medium M2, and pelleted (500 × g, 2 min). The supernatant was removed, and the pellet resuspended in 40 μL of alkaline sucrose solution [45]. Two drops of this suspension were then dispensed from a yellow tip into ~0. 1 mL of the 1% (w/v) paraformaldehyde fixative solution, this being previously dispensed within a rectangle of ~1. 5 cm2 drawn on a SuperFrost slide with a PAP pen. Spermatocytes were allowed to settle onto the slides in a humidified chamber (2 h, RT). Protease inhibitors were added to all solutions, except the fixative solution. After removing from the chamber, slides were rinsed in water, then in 0. 004% (v/v) Photo-Flo 200 (Kodak, 14634510) in water, and air-dried. Slides were stored at -20°C until hybridization with Abs. Imaging was performed with a Imager. M1 microscope and AxioCam MRm camera (Carl Zeiss). Primary Abs used, dilution factor: anti-γH2A. X, rabbit mcAb, 400× (Cell Signaling, 9718); anti-H1FNT, guinea pig pcAb, 250× (kindly provided by Mary Ann Handel); anti-SYCP3, mouse mcAb, 100× (Abcam, 97672); anti-SYCP1, rabbit pcAb, 200× (Abcam, 15090). Secondary Abs used, dilution factor: anti-rabbit IgG, goat, 1000×, AlexaFluor 488; anti-guinea pig IgG, goat, 1000×, AlexaFluor 594; anti-mouse IgG, goat, 1000×, AlexaFluor 488; anti-rabbit IgG, goat, 1000×, AlexaFluor 594 (Life Technologies, A-11008, A-11076, A-11001 and A-11012, respectively). Pachytene spermatocytes (larger 4c cells) and round spermatids (smaller 1c cells) were purified by flow cytometry as described [46]: testis suspensions were obtained as described above, except that DNAseI (Sigma Aldrich, D4527) was added to the trypsin digest at 5 U/mL, and the cell pellet resuspended in 1. 5 mL of medium M2 containing 1 U/mL of DNAseI. The final suspension was incubated with Hoechst 33342 (Life Technologies, H3570) for gating on larger pachytene spermatocytes (4c) and smaller round spermatids (1c), and propidium iodide (Life Technologies, P3566) for gating on live cells (S3 Fig.). Cells were sorted into 0. 3 mL of medium M2 in 1. 5 mL centrifuge tubes using an Influx cell sorter (Becton Dickinson), then pelleted (2,500 rpm, 3 min), the supernatant removed, and stored at -80°C. RNA was isolated using TRI Reagent (Life Technologies, AM9738) according to the instructions. Pachytene spermatocytes (200,000) were purified from WT prepubertal 129S1 males by flow cytometry as described above. Oocytes (200) were obtained from WT superovulated prepubertal 129S1 females. The zona pellucida was removed using acid tyrode’s solution [47] before lysis in TRI Reagent. Two random-primed reverse transcription (RT) reactions were performed with SuperScript III Reverse Transcriptase (Life Technologies, 18080). For each RT, triplicate PCR reactions (20 μL, 10 ng cDNA) were performed using GoTaq qPCR Master Mix (Promega, A6001) to yield six Ct values. Equipment used was the 7500 Real-Time PCR System (Applied Biosystems). These values were converted to the relative amount of RNA by multiplying the fold increase in product per cycle—equivalent to amplification efficiency, to the power of ∆Ct. Amplification efficiencies for each transcript were pre-determined in standard curves. Each value was normalized to the mean obtained for the Rsp7 (ribosomal protein S7) housekeeper RNA. Primers, 5′-3′: H3f3a, GCAG CTAT TGGT GCTT TGC (JRM-1227), ATGT TTCC CCTC ATAG TGGA CTC (JRM-1228), amplicon 173 bp; H3f3b, GGAG ATCG CCCA GGAT TTC (JRM-1231), ATGC CATA AAAA CCGC TTCA AC (JRM-1232), amplicon 215 bp; Rps7, TGGT CTTC ATTG CTCA GAGG AGG (JRM-609), TGCC ATCC AGTT TCAC ACGG (JRM-610), amplicon 177 bp. Immunoblotting was performed as described [48]. Tissues were homogenized by trituration with a 19 G needle and syringe in RIPA buffer. Primary Abs used, dilution factor: anti-H3. 3, rabbit pcAb, 1000× (Millipore, 09–838); anti-H3 (panH3), rabbit pcAb, 2000× (Abcam, 1791); anti-TUBB (β-tubulin), rabbit mcAb, 1000× (Cell Signaling, 2128); anti-GAPD (glyceraldehyde-3-phosphate dehydrogenase), rabbit mcAb, 1000× (Cell Signaling, 5174). Secondary Abs used, dilution factor: anti-rabbit IgG, goat, horseradish peroxidase conjugate, 15000× (Millipore, 12–348). The light cycle in the mouse colony was 0630–1830 h. Zygotes were collected at ~1200 h on the day of obtaining a vaginal plug, when usually they were at the mid-pronuclear stage. They were cultured for ~2 h for pronuclei to become more prominent before fixation. For H3S10ph immunofluorescence, WT zygotes were not fixed until at least two in the batch had undergone pronuclear envelope breakdown, indicating entry into mitosis. Immunofluorescence was performed as described [30], except goat serum was used in blocking, and fixation and permeabilization solutions contained 0. 2% (w/v) and 0. 1% (w/v) BSA, respectively, to prevent zygote sticking. Fixation, permeabilization, washing and secondary Ab incubation steps were performed in volumes of 0. 1–0. 15 mL in 12-well staining dishes (ProSciTech, H421–12), while blocking and primary Ab incubations were carried out in 10 μL drops under paraffin oil. In mounting, zygotes were transferred to a 1 μL drop of Fluorescence Mounting Medium (Dako, S3023) on a SuperFrost slide, coverslipped, and sealed with nail polish. 5-ethynyl-2′-deoxyuridine (Edu) incorporation and detection was carried out using a Click-iT Edu Imaging Kit (Life Technologies, C10339): freshly isolated zygotes with pronuclei were cultured in 20 μM Edu in medium KSOM-GAA [49] (2 h) prior to fixation. H3K9me3 primary and secondary Ab incubations were carried out immediately before Edu detection. Primary Abs, dilution factor: anti-H3K9me3, rabbit pcAb, 1000× (Abcam, 8898); anti-H3S10ph, rabbit mcAb, 1000× (Cell Signaling, 3377). Secondary Ab, dilution factor: anti-rabbit IgG, goat, 1500×, AlexaFluor 488 (Life Technologies, A-11008). The third wash after secondary Ab staining (10 min, RT) contained DAPI at 1 μg/mL, then zygotes were rinsed in DAPI-free wash solution (1 min) before mounting. Tail tips were digested in 0. 1 mL of 50 mM Tris-HCl pH 8. 0,0. 5% (v/v) Triton X-100,20 mM EDTA, 400 μg/mL proteinase K, (55°C, overnight). An aliquot was diluted 20× in water, then heat inactivated (70°C, 10 min). This template solution was diluted 10× in the final PCR reaction, performed using MyTaq Red DNA polymerase (Bioline, 21108). Primers: H3f3a, CTGG TTTT GGCT GTTT TATC GCTC GG (WT primer, JRM-1272), GCTA TTGC TTTA TTTG TAAC CATT ATAA GCTG C (mutant/conditional, JRM-1461), and AGGG CGCA CTCT TGCG AGC (common, JRM-1276); triplex reaction, amplicons WT—362, and mutant/conditional—205 bp. H3f3b, CTCA CCGC TACA GGTA GGC (WT primer, JRM-1465), GCTA TTGC TTTA TTTG TAAC CATT ATAA GCTG C (mutant/conditional, JRM-1461), TCTC CCTC ACCA ATCT CTGG (common, JRM-1466); triplex reaction, amplicons WT—211, mutant/conditional—357. Xcre, specific for the cre cds, TGCT GTTT CACT GGTT ATGC GGCG (JRM-391), TGCC TTCT CTAC ACCT GCGG TGCT (JRM-392); amplicon 304 bp. Y chromosome, nos. 211 and 212 [50]. This work was approved by the Animal Ethics Committee of the Murdoch Children’s Research Institute, approval no. A692.

Title: Contribution of the Two Genes Encoding Histone Variant H3.3 to Viability and Fertility in Mice Summary: Histones package DNA and regulate chromosome activity. Histone H3 is particularly important in this regard. The H3. 3 isoform is unique, among H3 histones, in being able to incorporate into chromosomes independent of DNA replication. Thus, in slowly- or non-dividing somatic cells, H3. 3 histone can take on the bulk of H3 functions. The developing germ line is very slowly dividing, and undergoes large-scale changes in chromosome activity. H3. 3 is therefore likely to be very important in regulating these processes. Here, we have studied the effects of null mutations in each of the two genes encoding H3. 3. We demonstrate that H3. 3 is very important in germ cell development, regulating oogenesis, spermatogenesis, and fertilization. Also, we reveal H3. 3 to be important in somatic growth. Each of the two genes is required to varying extents in regulating these processes.

lay_plos

en

Summarize: Media playback is unsupported on your device Media caption Reporter John Sweeney spent eight days in North Korea for the programme The BBC says an edition of Panorama filmed secretly during a study trip to North Korea is due to be broadcast as planned, despite claims students may have been put in danger. Three BBC journalists accompanied 10 London School of Economics students and spent eight days in the country. The university and its students' union have demanded the corporation withdraw the programme. But the BBC said the film was strongly in the public interest. Alex Peters-Day, of the LSE students' union, said the programme should be dropped because students were lied to and could not give informed consent. But BBC head of news programmes Ceri Thomas said the North Korean government was the only party the corporation had deceived. He said the students had been informed of the risks on three separate occasions and authorisation for the trip had gone "right to the top" within the BBC. "We think the risks as we explained them to the students were justified... but had we had any suggestion that lives were at risk... we wouldn't have gone anywhere near this," he said. Media playback is unsupported on your device Media caption Alex Peters-Day, LSE students' union: "Students were lied to, they weren't able to give their consent" "Our assessment was that, at most, the likelihood was deportation, but we explained to the students that the risks might go beyond that - might include arrest, detention and the possibility of not being allowed back into the country." Nine of the students were aged 21-28 and one was 18, he said. The programme, North Korea Undercover, is set to be broadcast amid rising tensions in the region caused by the secretive state testing a nuclear device and missile technology. The BBC said the trip was organised by the wife of Panorama reporter John Sweeney. The couple spent eight days inside the country for the programme, along with a cameraman. Mr Thomas said she had organised a similar trip for students a year earlier and the latest visit would have gone ahead even if Panorama had not been involved. 'Student welfare' The LSE has complained that the students were not told there was an undercover team of three or that they were filming a high-profile documentary. Analysis Academic research is highly globalised, running across conflict zones and political divisions. When modern wars sweep through a country, there can still be rearguards of scholars protecting the remains of centuries before, such as the ancient manuscripts rescued this year in Timbuktu, in Mali. But while diplomats can claim diplomatic status and journalists can hold up a press card, there is no separately defined protected status for academics. They can only rely on a kind of informal neutral status. But there are plenty of blurred boundaries. Not least because knowledge can quite literally be explosive. Overseas students in the UK have to be vetted before they can take "sensitive subjects" on a specified list, designed to stop students being used to obtain technology for nuclear or biological warfare. Mr Thomas acknowledged the students had initially been told there was one journalist but that, when they were in Beijing before flying into Pyongyang, they were told there would be three journalists. He said three of the students had since asked "that their images be taken out" and that they would be "pixellated or blobbed". But the "public interest arguments" for making and showing the programme were "overwhelming", he added. Students' union general secretary Ms Peters-Day - who was not on the trip - told the BBC News Channel: "One of the students made it absolutely clear that she was not made aware of what happened. "For us, this is a matter of student welfare - students were lied to, they weren't able to give their consent." She added: "I think the trip was organised by the BBC as potentially a ruse for them to get into North Korea and that's disgraceful. "They've used students essentially as a human shield in this situation." 'Damaged reputation' Sir Peter Sutherland, chairman of the LSE's board of governors, said the programme created "unacceptable risks" for the school's reputation and the students involved. "The BBC unscrupulously used a number of students as human cover for a filming operation without fully informing all of them what was happening," he said. "If academics cannot go to any part of the world on the basis of trust in terms of what they say they are doing and what they are about, this undermines the integrity of the institution." Meanwhile Universities UK, the umbrella body for UK universities, said it regretted "the BBC's approach in this matter". Panorama reporter John Sweeney said the majority of the students he had travelled with supported the programme. "What the LSE is saying we dispute," he told BBC Radio 4's Broadcasting House programme. Dennis Rodman' at New York Friars Club on March 15, 2013 in New York City. NBA legend Dennis Rodman is going back to North Korea. The Worm showed up at a charity gala tonight at the Fontainebleau Miami Beach, and announced he is heading back to impoverished nation whose supreme leader is threatening a nuclear holocaust. “I’m going back August 1,” the former rebounder told Gossip Extra exclusively. “We have no plans really, as far as what we're going to do over there, but we’ll just hang and have some fun!” For the whole story, visit Gossip Extra. The BBC has insisted it will broadcast a Panorama documentary about North Korea, despite protests from the London School of Economics (LSE) that journalist John Sweeney put its staff working abroad at risk by posing as a student from the institution to gain access to the communist state. Tony Hall, the BBC director general, has rejected a request from the LSE chairman, Peter Sutherland, to shelve the documentary, North Korea Uncovered, due to be broadcast on BBC1 on Monday night. Hall, who has already had to defuse a row over the anti-Thatcher song Ding Dong! The Witch Is Dead less than two weeks after taking over at the BBC, responded to a letter from Sutherland on Saturday. He is understood to have said the documentary would go ahead as there was a clear public interest in reporting on the escalating situation in North Korea. Hall is also understood to have said that the BBC had considered the risks involved and made sure the students on the trip were able to make an informed decision about the potential danger. However, the LSE disputed whether the students gave their informed consent, claiming they had been deliberately misled by the BBC, and challenged the corporation's risk assessment. "It is LSE's view that the students were not given enough information to enable informed consent, yet were given enough to put them in serious danger if the subterfuge had been uncovered prior to their departure from North Korea," the university said in an email sent to all staff and students on Saturday. Foreign journalists can not get visas to enter North Korea but overseas academics and students can. Sweeney spent eight days in the country in March with the LSE group on a trip ostensibly arranged by the Grimshaw Club – the student society of the university's international relations department. The LSE said it first became aware of the true nature of his visit last Tuesday during a meeting with BBC staff. The university said North Korean authorities alleged that Sweeney had described himself on his visa application as an "LSE student, PhD in history" and gave as his address a room number that is used by a member of its academic staff. Students on the trip reported that their North Korean guides repeatedly referred to Sweeney as "professor" and he went along with this, according to the LSE. Sweeney graduated from the LSE in 1980 with a BSc in government and if he has a PhD, it is not from there, according to the university. The LSE said students on the trip were not told before setting off that Sweeney and two other BBC journalists travelling with them would be using the visit to film an undercover documentary. The university identified the two other BBC journalists as Alexander Niakaris and Tomiko Sweeney, John Sweeney's wife, who was involved in organising the trip. In advance of leaving London, before they had paid for the trip, the students were told on two occasions – individually and later as a group – that an undercover journalist would be accompanying them to North Korea and if this was discovered they could face arrest, detention and deportation, and would be unlikely to be able to return to the country, according to a senior BBC source. In Beijing, they were told of Sweeney's identity and that two other BBC journalists were accompanying him, including a cameraman, the insider said. They were not told more for their own benefit in case the ruse was discovered, the source added. The BBC plans to pixelate faces or use other techniques to ensure none of the students can be identified in the Panorama documentary. Ceri Thomas, BBC News head of programmes, defended the corporation's actions on Radio 4's The World This Weekendon Sunday, saying the Panorama film was "an important piece of public interest journalism". "The material fact is that [the LSE students on the trip] were made fully aware of what the risks were if this journalist were to be discovered. The only people we deceived were the North Korean government," he added. "This is a country hidden from view and central to current events." George Gaskell, pro-director of the LSE and professor of social psychology, told The World This Weekend the university had received complaints from three of the 10 students after they returned home. "The BBC has admitted the group was deliberately misled about the involvement of the BBC. The line that was used was that a journalist would join the visit," Gaskell said. "We were told the BBC had undertaken a risk assessment and it had been at the highest level. We clearly have a different view on what is acceptable risk. I think it's potentially extremely dangerous." Gaskell added that the BBC's actions posed less danger to the students who went on the North Korea trip than to his LSE academic colleagues working in other parts of the world. "Some are in Africa, some in China. They may find themselves at considerable risk." Sweeney accused the LSE of putting out statements that were "factually inaccurate". He said he had spoken to the students who were on the North Korea trip since their return and the majority did not believe they had been misled. The BBC and Sweeney's actions have divided opinion in the media. Mark Seddon, the New York bureau chief for al-Jazeera English and a former Tribune editor, criticised Sweeney, asking what protection he or the BBC could have given the LSE students if his true purpose had been uncovered. "The BBC's defence of the editorial decision behind this is woeful," he said. Ray Snoddy, the former FT and Times editor and ex-presenter of BBC News feedback show NewsWatch, tweeted: "Extraordinary to hear BBC executive say on Radio 4 that the North Korean Panorama undercover filming was worth putting lives at risk for." Jason Wong, one of five student representatives on the LSE's court of governors, said he would be seeking a meeting of the university's governing body after the start of the summer term later this month to revoke Sweeney's alumni status. "He is as unwelcomed to be associated with the LSE as Saif al-Islam Gaddafi."

Summary: On the heels of a child abuse scandal, the BBC finds itself embroiled in another controversy-this time over covert reporting in North Korea. The London School of Economics says the media organization "deliberately misled" and endangered 10 of its students during a trip to the country that included a trio of undercover reporters. The leading university wants the BBC to cancel the resulting documentary, set to air today, and offer an apology. But the BBC says students were informed multiple times that there would be a journalist among them, while the program is firmly in the public interest and won't be canceled. "The only people we deceived" were those in "the North Korean government," said the BBC's news chief, who noted that students were informed of risks including "arrest, detention, and the possibility of not being allowed back into the country." Still, the BBC later clarified that the details of the documentary hadn't been revealed to students for their own safety, in case of questioning, the New York Times reports. The students ranged in age from 21 to 28, the BBC reports, and their identities will be hidden in the documentary using techniques like pixelation, the Guardian adds. Meanwhile, Dennis Rodman, whose previous visit to the country was tied to an HBO documentary, says he's headed back, the Miami Herald reports.

multi_news

en

Summarize: This application is a continuation-in-part of our pending application Ser. No. 09/020,471, filed Feb. 9, 1998, now U.S. Pat. No. 5,911,951, which application claims priority from U.S. Provisional Application Ser. No. 60/037,528, filed Feb. 10, 1997. The disclosures of both of these applications are incorporated herein by reference. FIELD OF THE INVENTION This invention relates to sterilization processes and more specifically to sterilization processes which are particularly suited for biological materials, such as organ replacements, and which methods exhibit efficacy against difficult-to-kill bacteria and bacterial spores. BACKGROUND OF THE INVENTION Sterilization techniques are widely used and important in industries such as food processing and health care. Saturated steam at temperatures above 110° C. has frequently been used to destroy microorganisms, such as microbial spores. Certain articles, particularly those used for health care, cannot withstand the temperatures and moisture of steam sterilization, and oftentimes such articles are also considered not to be suitable for sterilization by ionizing radiation. As a result, gaseous sterilants have been developed which function at relatively low temperatures and thus offer an attractive alternative. One of the most commonly used gaseous sterilants is ethylene oxide, which is used for medical product sterilization and for other sterilization processes. However, in certain instances, the presence of residual ethylene oxide, even in small quantities, is considered to be detrimental, and accordingly improved sterilization processes, particularly for sterilization of medical products, have continued to be sought. SUMMARY OF THE INVENTION It has now been found that sterilization of items, including biological tissue, replacement organs and synthetic prosthetic materials, including polymers and metals, can be effectively carried out by treatment with a coupling agent, e.g. a water-soluble carbodiimide, that is capable of creating amide linkages between amines and carboxylic acids; such treatment has been proven to be bactericidal. Sterilization treatment is carried out at a temperature above ambient, and although it may employ an optional coupling enhancer, such is not felt necessary. Treatment may be carried out using an organic solution of an appropriate coupling agent or using an aqueous buffered solution that may optionally contain isopropyl alcohol or the like, but the presence of such an alcohol is not necessary to achieve effective sterilization. The residuals from such treatment are nontoxic, biocompatible, and water-soluble; they can generally be easily be washed off the tissue before implantation in a human body. Surprisingly, biological tissue which has been effectively sterilized using a water-soluble carbodiimide may exhibit enhanced resistance to degeneration and/or calcification following its implantation within a living body. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS The term “coupling agent” is herein used to refer to a chemical reagent that facilitates the formation of amide bonds. Such bonds may be formed between reactive amines and reactive carboxyls on enzymes and proteins as well as between the reactive carboxyl or amine moieties located on and within bioprosthetic tissue. Those having skill in peptide synthesis and related arts will be familiar with some such reagents, e.g. water-soluble carbodiimides and succinimides; there are other known coupling agents that are soluble in organic solvents. When penetration of such coupling agents into the cells of microorganisms occurs, it results in sterilization, destroying bacteria, spores and possibly viruses and other infectious agents by internal cross-linking. When biological tissue is to be treated, the coupling agent chosen is preferably one that is water-soluble so the treatment can be effected in aqueous solution at a physiological pH. When other materials that are resistant to organic solvents are to be sterilized, e.g. synthetic polymeric materials, organic solutions of appropriately soluble coupling agents may be used. Any suitable carbodiimide can be used as the coupling agent; however, the preferred water-soluble coupling agent is 1-ethyl-3(3-dimethyl aminopropyl)carbodiimide hydro-chloride (EDC). Other water-soluble carbodiimides include 1-Cyclohexyl-3(2-morpholinoethyl)carbodiimide, N,N′-Carbonyldiimidazole, Woodward&#39;s Reagent K, and mixtures of such carbodiimides. A list of such cross-linking coupling agents can be found in the book: Bioconjugate Techniques by Greg T. Hermanson published by Academic Press 1996, the relevant disclosure of which is incorporated herein by reference. When biological tissue is being treated, the water-soluble coupling agent EDC is preferably used. As indicated above, an optional enhancer, e.g. N-hydroxysulfosuccinimide (sulfo-NHS), might be included at a concentration between 0.5 mM and about 30 mM when EDC is used as the coupling agent; however, such is not considered necessary for effective sterilization. The sterilization treatment is considered to be temperature-dependent, with a relatively low temperature of about 35-40° C. being preferred because of its lack of potential adverse effect upon the material being treated. The concentration of the coupling agent can be varied within a reasonable range, and treatment with higher concentrations of the coupling agent has been found to achieve sterilization within a shorter time of treatment. Although lower concentrations, e.g. 5-15 mM, may be effectively used, particularly when higher temperatures are employed, the coupling agent is preferably used in a concentration between about 25 millimolar (mM) and about 150 mM, more preferably between about 35 mM and about 100 mM, and most preferably at between about 50 mM and about 75 mM, in order to be certain of destroying all commonly encountered bacteria and spores within a reasonable duration of treatment. Higher concentrations of coupling agent, so long as compatible with the material being sterilized, will generally reduce the duration of treatment needed. It has been found that effective sterilization is achieved when such treatment is carried out at a suitable temperature above ambient, e.g. at a temperature of at least about 35° C., for a minimum number of concentration-duration units, i.e. a multiple of coupling agent concentration and duration of exposure. By arbitrarily basing such units upon millimoles of the coupling agent and hours of sterilization treatment, it has been found that at a temperature of about 35-40° C., a minimum number of units equal to at least about 450 millimole hours should be employed. For example, effective sterilization may be achieved at a coupling agent concentration of about 50 mM for about 9-10 hours or alternatively at a concentration of about 25 mM for about 20-24 hours. At a concentration of about 120 mM, treatment at about 40° C. for about 6 hours should achieve sterilization. Although even higher concentrations, e.g. 150 mM, might be used, they are considered to be generally unnecessary and likely impractical from an economic standpoint. Moreover, by raising the temperature, e.g. to about 50-55° C., treatment for at least about 100-150 millimole hours should suffice, e.g. 3 hours with a concentration of 50 mM or 10 hours at 10 mM. Obviously, longer durations can be employed, and for purposes of safety, it may be desirable to employ such sterilization treatment for about 25-50% longer than the above-stated minimum that should achieve sterilization under normal conditions. For purposes of this application, a particular sterilization treatment is deemed to be effective when it will effect a reduction of about 10 6 (6 log) when about 10 6 spores and/or microorganisms are inoculated in the test sample. This should assure that there will be no survivors in actual practice because biological tissue or other material that is being subjected to a sterilization treatment will not reasonably contain a level of microorganism contamination even approaching this magnitude. This treatment not only achieves sterilization without risk of damage to biological tissue that is to be implanted, but it may also make some contribution to stability of certain fixed biological tissue, e.g. the resistance of such biological tissue to degenerate and/or calcify within a living body may be enhanced. Reaction conditions for the sterilization treatment may vary somewhat depending on the specific coupling agent employed. Sterilization treatment is frequently carried out using a water-soluble carbodiimide in an aqueous buffer solution selected from among buffers that are well known to those of ordinary skill in this art as being suitable buffers for use in the physiological pH range. Examples of suitable buffers include, but are not limited to, N-2-hydroxyethylpiperazine-N′-ethanesulfonic acid (HEPES), Tris(hydroxymethyl)aminomethane, 3-(N-morpholino)propanesulfonic acid (MOPS), N-Tris(hydroxymethyl)methyl-2-aminoethane sulfonic acid, N-Tris(hydroxymethyl)methylglycine, and the like. The pH and concentration of buffer in an aqueous solution also may vary depending upon the coupling agent employed. The buffer concentration and pH are chosen to provide an effective sterilization environment while being the least harmful to bioprosthetic or other material being treated. For example, with EDC as the coupling agent for sterilizing biological tissue, the pH of the aqueous solution employed is about 6.0 to about 7.0 and the temperature is usually maintained between about 35° C. and 40° C. As mentioned above, higher temperatures may be used so long as they are compatible with the materials being sterilized; however, temperatures above about 55° C. are not generally used, for example, with medical devices made of bioprosthetic tissue. Preferably, sterilization is carried out at about 40° C. or above. For sterilizing polymeric or metallic materials, temperatures slightly higher than 55° C., i.e. about 75° C., may be used so long as they are not harmful to the material being sterilized, and use of such higher temperatures may shorten the necessary duration of treatment. All sterilization treatment solutions are preferably filtered through 0.45 μm or smaller filters before use to eliminate possible contamination. The optional inclusion in such solution of a small volume % of a C 2 to C 4 alkanol or an equivalent alcohol may permit sterilization at a lower temperature and/or with a lower percentage of coupling agent; however, isopropanol or the like may have an adverse effect upon certain tissue, in which case such sterilization should be carried out in the absence of an alkanol. This sterilization treatment method is considered useful for a wide variety of prosthetic and bioprosthetic materials; however, it is considered to be particularly useful for sterilizing replacement organ components, such as heart valves, which have been made from animal tissue that has been suitably fixed. By suitably fixed is meant having been subjected to cross-linking (“fixing”), as by glutaraldehyde treatment or by a comparable process such as described in U.S. Pat. Nos. 5,447,536 and 5,733,339 so as to raise the shrinkage temperature thereof. Other fixation techniques, e.g. polyepoxide crosslinking or photo-oxidation may also be used. In some instances, it may be important that, if biological tissue is being fixed, it has been at least minimally fixed; otherwise, the chemical action of the coupling agent might be diverted. It may be desirable to first rinse the material with cold saline prior to sterilization as a preparation therefor, because sterilization is usually a final step before use or packaging. The material being sterilized is usually maintained in contact with the sterilization solution for about 6 to 48 hours, and such treatment has been shown to effectively inactivate even hard-to-kill bacteria and spores, thus proving the process to be potently bactericidal. It is common in the industry to “quarantine” such sterilized products for 1 to 2 weeks, during which time the bioindicator results of sterilization will be received. The product is then considered ready for packaging or temporary storage. Thereafter, it is ready for immediate use following one or more sterile rinses to remove any remaining unreacted reagents and by-products. This sterilization treatment has not been shown to adversely affect bioprosthetic tissue, as by possibly lowering the shrinkage temperature of such sterilized material or by lowering its resistance to proteolytic degradation by collagenase or by proteases; on the contrary, in some instances, it may increase shrinkage temperature and/or surprisingly increase resistance of biological tissue to calcification. The present invention is further described by the examples that follow. These examples are not to be construed as limiting in any way either the spirit or the scope of the present invention. Devices to be implanted in the human body are required to be sterilized in a manner to effectively destroy all microorganisms. Due to the unique applications of liquid chemicals for use in sterilization processes, it is necessary to be vigilant in detecting, screening and testing microorganisms which could pose significant resistance to the sterilization process. Examples of reference microorganisms which have previously demonstrated high resistance to liquid chemical sterilants are: the spores of Bacillus subtilis, Clostridium sporogenes, Bacillus pumilus, Chaetonium globosom and Microascus cinereus and representative vegetative cells, such as Mycobacterium chelonae, Methylbactrium extorquens, and Trichosporon aquatile. Of the foregoing, the most resistant may be the spores of Bacillus subtilis. The coupling agent used in the following examples is 1-ethyl-3(3-dimethyl aminopropyl)carbodiimide hydrochloride (EDC), and when used, the optional enhancer is either N-hydroxysulfosuccinimide (sulfo-NHS) or hydroxysuccinimide (NHS), which are all commercially available. Peptone water is prepared by dissolving 1 g of Bacto Peptone in 1 liter of de-ionized water. The solution is then filtered into sterile bottles using sterile 0.2 micron filters. All agents are solubilized in 10 mM HEPES buffer containing 0.85% of sodium chloride, pH 6.5 (HEPES buffer). Concentrations are expressed as mM (number of millimoles of chemical for each liter of solution), or as % (grams per 100 ml of solution). Temperatures are in ° C. (degrees Celsius), with room temperature being about 20-25°. Porcine aortic roots are fixed by cross-linking according to the method described in U.S. Pat. No. 5,447,536. After fixation, the valves are stored in 10 mM HEPES, 0.85% NaCl, 20% isopropyl alcohol, pH 7.4, at 4° C. The sterility tests described in the following examples are in most cases conducted in the presence of bioprosthetic heart valve tissue; when such tissue is not present, the solutions are simply filtered through a 0.45 micron filter attached to a funnel (filter funnel). The filters are then rinsed with peptone water to eliminate residual chemicals on the membrane that may prevent growth of the organisms tested. Such membrane filters are then incubated on TSA plates at about 32° to 33° C., e.g. 32.5° C. When an aortic valve is inoculated with microorganisms for test purposes and then submitted to sterilization, the solution is filtered as described above. The aortic valve tissue is then washed for 20 minutes in a reciprocating shaker in the presence of peptone water containing Tween 80 in order to extract all indigenous spores or microorganisms from the tissue. This solution is filtered and then incubated as described above. All microbiological testing is performed in a biological laminar flow hood to prevent contamination. The shrinkage temperature and the proteolytic (collagenase and protease) degradation tests are conducted as previously described in the &#39;536 patent. Resistance to calcification is assessed by subdermal implantation of sterilized leaflets and aortic wall coupons in young rats, as also described in the &#39;536 U.S. patent. EXAMPLE 1 Mycobacterium Chelonae ATCC 35752 (˜10 5 ) was inoculated in sterile cups. A 10 mM HEPES, 0.85% NaCl, pH 6.5 solution containing 10 mM EDC and 1 mM Sulfo-NHS in the presence or absence of 20% isopropyl alcohol was maintained in contact with the bacteria in the cups for various periods of time (treatment duration). The cups were maintained at room temperature, and the solutions were then filtered. The filters were then incubated at about 32-33° C. for up to 6 weeks (incubation duration) using either Trypticase Soy Agar (TSA) plates or Trypticase Soy Broth (TSB). All inoculations were done in duplicate. RESULTS Treatment Incubation Duration Duration 1 Day 1 Week 3 Week 4 Week 6 Week NO ISOPROPYL ALCOHOL 0 hour +,+ +,+ +,+ +,+ +,+ 12 hours +,+ +,+ +,+ +,+ +,+ 24 hours −,− +,+ +,+ +,+ +,+ 48 hours −,− −,− −,− −,+ −,+ 72 hours −,− −,− −,− −,− −,+ TSA,TSB TSA,TSB TSA,TSB TSA,TSB TSA,TSB (+) Indicates growth while (−) indicates no growth. 20% ISOPROPYL ALCOHOL 0 hour −,− −,− +,+ +,+ +,+ 12 hours −,− −,− −,− −,− −,− 24 hours −,− −,− −,− −,− −,− 48 hours −,− −,− −,− −,− −,− 72 hours −,− −,− −,− −,− −,− TSA,TSB TSA,TSB TSA,TSB TSA,TSB TSA,TSB (+) Indicates growth while (−) indicates no growth or complete kill. The results indicate that, in the presence of 20% isopropyl alcohol, room temperature treatment with EDC plus Sulfo-NHS kills all Mycobacterium chelonae within 12 hours of sterilization treatment. EXAMPLE 2 A sterilization process similar to Example 1 is carried out using Bacillus Subtilis spores (˜10 6 ) inoculated in sterile cups some of which contain cross-linked heart valves that had been fixed by a process according to U.S. Pat. No. 5,447,536. A 10 mM HEPES, 0.85% NaCl, pH 6.5 solution containing 20 mM EDC and 1 mM Sulfo-NHS in the presence of 20% isopropyl alcohol was added for various periods of time (treatment duration). The cups and the heart valves were maintained at 40° C. for the term of the treatment. The solutions were then filtered and the filters incubated for up to 7 days (incubation duration) at about 32-33° C. using Trypticase Soy Agar (TSA) plates. All inoculations were done in duplicate. RESULTS Incubation Duration Treatment Duration 1 Day 7 Days WITHOUT VALVES 24 hours − − 48 hours − − 72 hours − − WITH VALVES 48 hours − − 72 hours − − (+) indicates growth, while (−) indicates no growth or complete kill. The results demonstrate that the spores of Bacillus subtilis are inactivated with this method of sterilization in the absence or presence of porcine aortic valve tissue. EXAMPLE 3 In the experiments described above, a coupling enhancer (Sulfo-NHS) was added to EDC during the sterilization process. The following experiment was designed to test the efficacy of EDC in the presence or absence of an enhancer. A sterilization test process was carried out employing about 5.7 to 6.6×10 5 Bacillus subtilis ATCC 9372 spores, inoculating them in sterile cups for 10 minutes. A solution of 10 mM HEPES, 0.85% NaCl, 20% isopropyl alcohol, pH 6.5 was then added to each of the cups, which solution contained 20 mM EDC and either 1 mM Sulfo-NHS or 1 mM NHS or no enhancer. Incubation was carried out for 72 hours (treatment duration) with the cups at about 40° C., and the solutions from the cups were then filtered. The filters were rinsed with a 0.1% peptone water solution to eliminate any residual EDC and/or enhancer and were then incubated on Trypticase Soy Agar (TSA) plates. All inoculations were done in duplicate, and the results are set forth in Table A. TABLE A NUMBER OF COLONY FORMING UNITS (SURVIVORS) ENHANCER CONDITIONS SAMPLES sulfo-NHS NHS NONE CONTROLS negative 1 0 0 0 2 0 0 0 positive 1 5.7 × 10 5 6.1 × 10 5 6.6 × 10 5 2 5.7 × 10 5 6.5 × 10 5 −6.0 × 10 5 TESTS 1 0 0 0 2 0 0 0 The results demonstrate that EDC and isopropanol, either in the presence or absence of an enhancer such as sulfo-NHS or NHS, is a potent bactericide against the spores of Bacillus subtilis. EXAMPLE 4 The following experiment was designed to test the effect of EDC concentration, of temperature and of duration of incubation on the inactivation of spores of Bacillus subtilis. The EDC concentrations tested were 5, 12.5 and 20 mM; the temperatures were 25, 32.5 and 40° C. for 4, 24 and 44 hours of incubation. The tests were carried out under the conditions as hereinafter set forth in Table B using aqueous solutions that were 10 mM HEPES at a pH of 6.5 and contained 0.85% NaCl and 20% IPA so as to be comparable to Examples 2 and 3. Spores of Bacillus subtilis (about 2.5×10 5 per sample) were inoculated on tissue that had been cross-linked using the fixation method described in the &#39;536 patent. The spores were allowed to contact the tissue for 10 minutes, after which time 50 ml of a solution of EDC at one of the concentrations indicated above was added to each cup containing the tissue plus the spores, and incubation was carried out at the respective temperatures and for the respective lengths of time. After such incubation for either 4, 24 or 44 hours, the solutions were filtered to recover the spores, and these were incubated on TSA plates for 2 weeks at 32 to 33° C. The tissue samples were washed with a solution containing a surfactant to fully extract the spores from the tissue, and the resulting solutions were filtered. After washing with 0.1% peptone water, the filters were incubated on TSA plates for 2 weeks at 32 to 33° C. in order to determine the number of survivors on or in the tissue. The colonies were enumerated for both the EDC solutions and the tissue wash solutions, and the results (numbers of colony forming units) were added. The positive and negative controls were shown to be valid for the test. The experimental results are presented in Table B. TABLE B CON- EDC TEMP. TIME SURVIVORS LOG DITION (mM) ° C. (hrs) # CFUs REDUCTION 1 5 25 4 135000.27 2 5 25 44 1300 2.3 3 5 32.5 24 208 3.0 4 5 40 4 1100 2.4 5 5 40 44 21 4.1 6 12.5 25 24 225 3.0 7 12.5 32.5 4 5900 1.6 8 12.5 32.5 24 57 3.6 9 12.5 32.5 24 34 3.9 10 12.5 32.5 24 94 3.4 11 12.5 32.5 24 44 3.7 12 12.5 32.5 44 33 3.9 13 12.5 40 24 27 4.0 14 20 25 4 31400 0.9 15 20 25 44 16 4.2 16 20 32.5 24 24 4.0 17 20 40 4 5 4.7 18 20 40 44 0 5.4 The results demonstrate that the bactericidal activity of EDC is dependent on the concentration of EDC, the temperature of incubation and the duration of incubation. In addition, it can be seen that EDC at 20 mM concentration kills all the spores on cross-linked tissue at some time between 4 and 44 hours at 40° C. because a logarithmetic reduction of about 4.7 was obtained after 4 hours of incubation at 40° C., and because no survivors were present after 44 hours of incubation. Moreover, the fact that s logarithmetic reduction of about 4 was achieved at 40° C. after 44 hours of incubation, in the presence of only 5 mM EDC, indicates that EDC in the presence of 20% IPA is a potent bactericidal agent. EXAMPLE 4A The following experiment was carried out to assess the effectiveness of a coupling agent, such as EDC, in the absence of isopropyl alcohol or an equivalent alkanol. Bacillus subtilis ( niger ) spores at levels of 1.5×10 6 were inoculated in sterile cups for approximately 10 minutes. Solutions (50 ml) of 25, 37.5 and 50 mM EDC in 10 mM TRIS, 0.85% NaCl, pH 6.5, which contain no isopropyl alcohol, were prewarmed to 40° C. and then rapidly added to the cups. The cups were incubated at 40° C. for 0.5, 1, 6, 24 and 48 hours; then, the solutions were diluted and filtered in order to collect microorganisms. Next, the filters were rinsed with a 0.1% peptone water solution to eliminate any residual EDC and then incubated on TSA plates for up to 14 days. The plates were examined every day for growth, with the colony forming units (CFUs) being counted, and resulting D values were calculated. Such D values represent the duration (in minutes) of incubation to decrease the level of spores by one log, i.e. eliminating 90% of the spores population. The results for D values for treatment with 25, 37.5 and 50 mM EDC were respectively found to be 203, 106 and 86 minutes. From this data, the incubation duration necessary to achieve 6 log reduction (or effective inactivation of 1×10 6 spores) is calculated as 24 hours, 11 hours and 9 hours, respectively. The results show that sterilization efficacy increases as a function of EDC concentration and also that complete inactivation of the spores of Bacillus subtilis can be achieved in the absence of isopropyl alcohol at 40° C. given longer duration of incubation and higher EDC concentrations. For safety reasons, it may be desirable to employ a duration of incubation for sterilization under such conditions that is about 10-35% higher than the hours given above to insure complete inactivation of all microorganisms present. EXAMPLE 4B An experiment similar to that of Example 2 is carried out using EDC as a coupling agent in the absence of isopropyl alcohol and sulfo-NHS. Bacillus subtilis ( niger ) spores at levels of about 10 6 are inoculated in sterile cups, some of which contain cross-linked porcine aortic valve tissue, for approximately 10 minutes. Solutions (50 ml) of 25, 50 and 70 mM EDC in 10 mM TRIS, 0.85% NaCl, pH 6.5, are prewarmed to 40° C., respectively added to the cups, and incubated at 40° C. for 1 to 3 days. The solutions are then diluted and filtered in order to collect microorganisms. The valve tissue is washed for 20 minutes in a reciprocating shaker in the presence of peptone water containing polyethylenesorbitan monooleate (Tween 80) in order to extract all spores of microorganisms from the tissue; the peptone water solution is added to the corresponding filter. Next, the filters are rinsed with a 0.1% peptone water solution to eliminate any residual EDC and incubated on TSA plates for 14 days. The plates are examined every day for growth, counting the colony forming units (CFUs). The results show that effective sterilization occurs within 24 hours under these conditions whether in the presence or the absence of porcine tissue, thus demonstrating that treatment with 25, 50 or 70 mM EDC at 40° C. effectively inactivates 1×10 6 spores after 24 hours in the absence of isopropyl alcohol. EXAMPLE 4C An experiment similar to that of Example 4A is carried out using slightly higher concentrations of EDC and including porcine aortic root tissue. Bacillus subtilis ( niger ) spores at levels of 1.5×10 6 are inoculated for approximately 10 minutes in sterile cups each containing root tissue. Solutions (50 ml) of 50, 75 and 100 mM EDC in 10 mM TRIS, 0.85% NaCl, pH 6.5 are prewarmed to 40° C. and then rapidly added to the tissues in the cups. The cups containing the tissue are incubated at 40° C. for 6, 9, 12, 24 and 48 hours; then, the solutions are diluted and filtered in order to collect microorganisms. The valve tissue is washed for 20 minutes in a reciprocating shaker in the presence of peptone water containing Tween 80 in order to extract all spores of microorganisms from the tissue. The solutions from the shakers are filtered through the respective filters to which the original solutions were applied. The filters are rinsed with a 0.1% peptone water solution and incubated on TSA plates for up to 14 days. The plates are examined daily for growth. The results demonstrate that treatment with 75 and 100 mM EDC at 40° C. effectively inactivates these spores after 6 hours, while only partial kill is achieved by treatment with 50 mM EDC. However, after 9 hours, effective sterilization resulting in complete inactivation of the spores of Bacillus subtilis is achieved by incubation with all 3 EDC concentrations at 40° C. EXAMPLE 4D An experiment similar to that of Example 4A was carried out using a higher temperature of 55 °. Bacillus subtilis ( niger ) spores at levels of 1.32×10 6 (Log 10 =6.12) were inoculated for approximately 10 minutes in sterile cups. Solutions (50 ml) of 5 and 50 mM EDC in 10 mM TRIS, 0.85% NaCl, pH 6.5 were prewarmed to 55° C. and then rapidly added to the cups. The cups were incubated at 55° C. for 1 and 10 hours; the solutions were then diluted and filtered in order to collect microorganisms. The filters were rinsed with a 0.1% peptone water solution and incubated on TSA plates for up to 14 days. The plates are examined daily for growth. The results demonstrate that treatment with 50 mM EDC at 55° C. effectively inactivated these spores after 10 hours, while a log reduction of 3.04 was achieved by treatment with 50 mM EDC at 55° C. for only one hour. This can be extrapolated to achieving complete kill in 2-3 hours. Treatment with 5 mM EDC for 1 hour resulted in a log reduction in the spores of Bacillus subtilis of 0.512; whereas the 10-hour treatment at 55° C. resulted in a log reduction of 4.46. Although this cannot be extrapolated to complete kill over a greater length of time because of the low level of EDC remaining after 10 hours, it is expected that sterilization treatment using a concentration at least about 15 mM EDC at 55° C. for 10 hours would result in complete kill. EXAMPLE 5 An experiment was also designed to test the bactericidal activity of the EDC treatment using two sequential inoculations of at least 1×10 6 spores of Bacillus subtilis per sample. In the first step, 1.43×10 6 spores (Log 10 =6.2) were inoculated in triplicate for 10 minutes onto 45 porcine valves which had been cross-linked using a method as described in the above-mentioned patent and patent application. Solutions of 25 mM EDC in 10 mM HEPES, 0.85% NaCl, 20% isopropyl alcohol, at pH 6.5 were poured into the cups containing the valve samples. After 2, 4, 6, and 8 hours of incubation at 40° C., the total surviving spores from 12 samples (solution plus tissue) were counted. After 8 hours of incubation, an additional 1.2×10 6 (Log 10 =6.1) spores were added to the remaining 33 samples. Summarizing, these remaining 33 samples were thus inoculated at t=0 with 1.43×10 6 spores and at t=8 with 1.2×10 6 spores. After various durations of incubation (see Table C for details), the surviving spores in solution and on the valve tissue were removed by filtering and incubated on TSA plates as described above. The positive and negative controls were determined to be valid for the test. The results are presented in Table C which follows. The results demonstrate that a 6.2 log reduction (no survivors) of Bacillus subtilis spores is achieved within 6 hours of incubation with EDC in the presence of isopropanol and that another 6.1 log reduction is achieved within 6 hours after rechallenge. Complete sterilization of the tissue valve samples and the solution was achieved in this manner. TABLE C Incubation Mean of Three Samples Duration Total Total Hours Survivors # Survivors LOG @ 40° C. CFUs Log 10 Reduction 0 1.43 × 10 6 6.2 0 2 58 1.7 4.5 4 4 0.5 5.6 6 0 0 6.2 8 0 0 6.2 8 1.2 × 10 6 6.1 n/a Rechallenge 11 300 2.5 3.7 14 0 0 6.1 20 0 0 6.1 24 0 0 6.1 28 to 56 0 0 6.1 EXAMPLE 6 The foregoing experiments have generally shown that the sterilization effect of EDC plus a lower alkanol could be equally demonstrated by testing biological tissue which had inoculated with bacteria or by simply testing similar amounts of bacteria which have been inoculated into sterile cups. In view of the foregoing verification, it was decided to test the effectiveness of the sterilization process against other bacteria using sterile cups. Added to each of the cups is 20 ml of 10 mM HEPES, 0.85%, Nacl, 20% isopropanol, pH 6.5, containing 25 mM EDC without any coupling enhancer, before the cups are placed in a incubator at about 38° C. When the solution temperature reached about 38° C., approximately 10 5 -10 6 organisms were inoculated into the solution. The tests were carried out in triplicate. The following four isolated were tested in the form of sporous suspensions: Clostridium sporogenes ATCC 3584, Bacillus pumilus ATCC 27142, Chaetonium globosom ATCC 6205, and Microacus cinereus ATCC 16594. The following three isolates were tested as vegetative cells: Mycobacterium chelonae ATCC 35752, Methylbacterium extorquens ATCC 43645 and Trichosporon aquatile ATCC 22310. The inoculated systems were allowed to incubate for 1 hour, for 5 hours or for 24 hours, and the solutions were then filtered through a 0.45 micron filter. After rinsing, the filter was placed on a TSA plate as described in Example 1. Negative and positive controls indicate that the tests were valid. The results are set forth in Table D which follows wherein the number of CFUs in the inoculum is expressed as its log to the base 10, e.g. 3.4×10 5 =5.5: TABLE D INOCULUM Log REDUCTION ORGANISM Log 10 1 Hour 5 Hours 24 Hours SPORES Clostridium sporogenes 4.6 2.12 3.02 — 3.65 — — 3.65 Bacillus pumilus 5.45 3.68 4.41 — 5.22 — — 5.22 Chaetonium globosum ˜4.7 — (72 hrs.)* (96 hrs.)* VEGETATIVE CELLS Methylobacterium 6.94 6.94 6.94 — extorquens Trichosporon aquatile 4.3 4.3 4.3 — Mycobacterium chelonae 5.15 5.15 — — *no growth was observed after stated hours of incubation of plates. The results indicate that, after one hour of incubation, all vegetative cells had been effectively inactivated. The more resistant spores of certain bacteria were inactivated in a time-dependent manner within 24 hours of incubation with sterilant. The tests show that, against forms of representative bacteria, EDC in the presence of isopropanol is a very good sterilant showing time-dependent inactivation of spores at about 38° C. EXAMPLE 7 To determine any potentially adverse effect this sterilization may have on shrinkage temperature of the tissue, porcine aortic valves, which had been cross-linked using the method described above in the pending &#39;076 patent application by treatment with EDC in the presence of either sulfo-NHS or NHS as a coupling enhancer, were sterilized using 25 mM EDC in 10 mM HEPES, 0.85% NaCl, 20% isopropyl alcohol, pH 6.5, at 40° C. for 24 hours. This duration of incubation has been shown in Table C to twice achieve a logarithmetic reduction of spores of Bacillus subtilis of about 6 in the sequential testing. The leaflets were dissected and the thermal denaturation temperature was determined for each as described in the &#39;536 patent. The results are presented in Table E and demonstrate that this sterilization method has no adverse effect on the shrinkage temperature of the tissue regardless of which fixation process had been used. TABLE E DENATURATION TEMPERATURE (° C.) NHS sulfo- sulfo-NHS SAMPLES NHS STERILIZED NHS STERILIZED LEAFLETS 85.6 ± 0.2 85.0 ± 0.2 87.5 ± 0.3 87.0 ± 0.2 It can be seen from Table E that the shrinkage temperature does not change after sterilization. To determine any effect this sterilization may have on susceptibility of the tissue to proteolytic degradation, porcine aortic valves similarly cross-linked using the method described in the pending patent application in the presence of either sulfo-NHS or NHS as coupling enhancer were sterilized, using 25 mM EDC in 10 M HEPES, 0.85% NaCl, 20% isopropyl alcohol, pH 6.5, at 40° C. for 24 hours. Aortic valve leaflets and aortic wall coupons were dissected, and they were then submitted to standard collagenase and protease degradation testing. Such testing is described in detail in the previously mentioned patent and patent application. The results of collagenase digestion testing are expressed as nanomoles of amine released per mg of dry tissue and are presented in Table F. TABLE F AMINES RELEASED (nmol/mg dry tissue) NHS sulfo- sulfo-NHS SAMPLES NHS STERILIZED NHS STERILIZED LEAFLETS 12.0 ± 0.3 12.4 ± 1.2 14.5 ± 1.5 14.9 ± 1.3 AORTIC 12.3 ± 0.6 10.9 ± 0.5 13.1 ± 0.8 10.0 ± 0.5 WALL The results are presented as means±SEM of six samples. There is no significant difference for the leaflets before and after sterilization, p=0.718 and p=0.994 for NHS and sulfo-NHS respectively. For the aortic wall coupons, there is a significant difference which indicates that they exhibit greater resistance to collagenase after sterilization, i.e., p=0.046 and p=0.0099 for NHS and sulfo-NHS, respectively. Thus, not only is the resistance to collagenase digestion not adversely affected by this EDC sterilization, in some instances, it may be improved. For comparison, previous experiments conducted under similar conditions showed that the level of amines released from fresh tissue were approximately 2150 and 430 nanomoles/mg of tissue for leaflets and aortic wall coupons, respectively. The results of protease digestion testing are presented in Table G; results for glutaraldehyde-fixed tissue are also shown for comparison purposes. They indicate that there is no significant difference as a result of this sterilization of tissue cross-linked according to the method described in the &#39;076 patent application when either NHS or sulfo-NHS is used as a coupling enhancer; the results obtained following the use of EDC for sterilization for either leaflets on aortic wall coupons show no adverse effect and a resistance equal to that of glutaraldehyde fixation. TABLE G GLULTARALDE- NHS sulfo-NHS SAMPLES HYDE-FIXED NHS STERILIZED sulfo-NHS STERILIZED LEAFLETS 31.6 ± 5.7 28.1 ± 1.7 32.3 ± 1.3 29.5 ± 2.6 31.9 ± 2.2 AORTIC WALL 74.5 ± 1.2 73.8 ± 1.0 75.1 ± 0.9 75.1 ± 0.9 75.6 ± 2.2 To determine the effect this sterilization may have on resistance to calcification, samples of (a) glutaraldehyde-fixed porcine aortic valve leaflets and of (b) porcine aortic valve leaflets cross-linked according to the method of the &#39;076 patent application, which were sterilized using EDC in the presence of isopropanol as described above for the shrinkage temperature experiment, were implanted subdermally in young rats for four weeks. The samples were then retrieved, and quantitative calcium analysis was conducted using Atomic Absorption Spectrophotometry. The results are presented as means±SEM of six samples per condition in the following Table H. TABLE H Glutaraldehyde- NHS before NHS after sulfo-NHS sulfo-NHS fixed ster. ster. before ster. after ster. SAMPLES (n = 4) (n = 6) (n = 6) (n = 6) (n = 6) LEAFLETS 195 ± 8.9 23.7 ± 11.4 2.9 ± 1.4 25.2 ± 10.9 0.9 ± 0.1 AORTIC WALL 66.8 ± 4.5 53.2 ± 4.7 35.4 ± 6.1 54.2 ± 1.5 43.6 ± 3.5 The results demonstrate that the sterilization method using EDC at 25 mM in the presence of 20% isopropyl alcohol at 40° C. has no adverse effect on the resistance of the porcine aortic valve tissue to calcification. Moreover, it surprisingly shows that the sterilized samples are more resistant to calcification than the samples that were not sterilized. In addition, all the samples cross-linked according to the above-identified patent application are significantly less calcified than samples that had been cross-linked according to the standard glutaraldehyde method. The results indicate that a solution of EDC in the presence of 20% isopropyl alcohol at about 40° C., with or without NHS or sulfo-NHS, is a powerful bactericide against spores of Bacillus Subtilis and other bacteria. Vegetative cells of Mycobacterium Chelonae were effectively inactivated at room temperature by EDC+Sulfo-NHS in the presence of 20% isopropyl alcohol, and subsequent tests with a variety of other vegetative cells showed that 25 mM EDC in 20% isopropanol is an effective sterilant for biological tissue. It is believed that treatment with a coupling agent in the presence of isopropyl alcohol or an equivalent alkanol and at slightly elevated temperature, and optionally with a coupling enhancer, has a potent bactericidal effect and is excellently suited for treatment of tissue valves, and is also considered suitable for sterilizing polymers, metals and the like. In addition, not only are the denaturation temperature and the resistance to proteolytic degradation of tissue valves not adversely affected by such sterilization treatment of 12 hours or more, but surprisingly, samples which have been sterilized using this process appear to be significantly more resistant to calcification, the leading cause of tissue valve failure. Compared to tissue fixed by the standard glutaraldehyde method, sterilization of heart valve tissue using the present method results in an unexpected increase in calcification resistance which should be quite important commercially. Although the invention has been described with regard to certain preferred embodiments which constitute the best mode presently known by the inventors for carrying out the invention, it should be understood that changes and modifications that would be obvious to one having the ordinary skill in this art may be made without departing from the scope of the invention which is set forth in the claims appended hereto. For example, although the invention has been described with regard to the sterilization of porcine aortic valves and the like, it may also be used to sterilize polymeric or metal heart valve components or other components for implantation within the human body. The disclosures of all U.S. patents to which reference was made hereinbefore are expressly incorporated by reference. Particular features of the invention are set forth in the claims which follow.

Summary: Heart valves or other components for replacement of heart or other bodily organs and tissue prostheses or synthetic prosthetic materials are effectively sterilized by treatment with a carbodiimide coupling agent known to create amide linkages between amines and carboxylic acids. Such treatment has been shown to be bactericidal when carried out using an effective concentration of such a carbodiimide at a temperature of at least about 35° C. for a sufficient period of time, e.g. treatment for about 9 hours at a concentration of at least about 50 mM. The sterilization treatment preferably employs EDC as a water-soluble coupling agent. Such sterilization treatment of biological tissue that has previously been fixed by subjection to stabilizing cross-linking is preferably carried out in a buffered aqueous solution and leaves no residuals other than ones which are nontoxic and biocompatible; moreover, it does not affect the desirable characteristics of resistance to thermal denaturation and to digestion by proteolytic enzymes, which are a product of such prior fixing, and may actually increase the resistance of such fixed biological tissue to degeneration and calcification.

big_patent

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Wild Sky Wilderness Act of 2002''. SEC. 2. FINDINGS AND STATEMENT OF POLICY. (a) Findings.--Congress finds the following: (1) Americans cherish the continued existence of diverse wilderness ecosystems and wildlife found on their Federal lands and share a strong sense of moral responsibility to protect their wilderness heritage as an enduring resource to cherish, protect, and bequeath undisturbed to future generations of Americans. (2) The values an area of wilderness offer to this and future generations of Americans are greatly enhanced to the degree that the area is diverse in topography, elevation, life zones and ecosystems, and to the extent that it offers a wide range of outdoor recreational and educational opportunities accessible in all seasons of the year. (3) Large blocks of wildlands embracing a wide range of ecosystems and topography, including low-elevation forests, have seldom remained undisturbed due to many decades of development. (4) Certain wildlands on the western slope of the Cascade Range in the Skykomish River valley of the State of Washington offer an outstanding representation of the original character of the forested landscape, ranging from high alpine meadows and extremely rugged peaks to low-elevation mature and old-growth forests, including groves with some of the largest and most spectacular trees in Washington, with diameters of eight feet and larger. (5) These diverse, thickly forested mountain slopes and valleys of mature and old-growth trees in the Skykomish River valley harbor nearly the full complement of the original wildlife and fish species found by settlers of the 19th century, including mountain goats, bald eagles, black bear, pine marten, black-tailed deer, as well as rare and endangered wildlife such as northern spotted owls and goshawks, Chinook and Coho salmon, and steelhead and bull trout. (6) An ecologically and topographical diverse wilderness area in the Skykomish River valley accessible in all seasons of the year will be enjoyable to users of various kinds, such as hikers, horse riders, hunters, anglers, and educational groups, but also to the many who cherish clean water and clean air, fish and wildlife (including endangered species such as wild salmon), and pristine mountain and riverside scenery. (b) Statement of Policy.--Congess hereby declares that it is the policy of the United States: (1) to better serve the diverse wilderness and environmental education needs of the people of the State of Washington and its burgeoning metropolitan regions by granting wilderness protection to certain lower elevation wildlands in the Skykomish River valley of the State of Washington; and (2) to protect additional lands adjacent to the Henry M. Jackson Wilderness designated by the Washington Wilderness Act of 1984 (Public Law 98-339), in further tribute to the ecologically enlightened vision of the distinguished Senator from the State of Washington and former Chairman of the Senate Committee on Energy and Natural Resources (formerly the Senate Interior and Insular Affairs Committee). SEC. 3. ADDITIONS TO THE NATIONAL WILDERNESS PRESERVATION SYSTEM. (a) Additions.--The following Federal lands in the State of Washington are hereby designated as wilderness and, therefore, as components of the National Wilderness Preservation System: (1) Certain lands which comprise approximately 106,000 acres, as generally depicted on a map entitled ``Wild Sky Wilderness Proposal'', dated August 2002, which shall be known as the Wild Sky Wilderness. (b) Maps and Legal Descriptions.--As soon as practicable after the date of enactment of this Act, the Secretary of Agriculture shall file a map and a legal description for the wilderness area designated under this Act with the Committee on Energy and Natural Resources of the United States Senate and the Committee on Resources of the United States House of Representatives. The map and description shall have the same force and effect as if included in this Act, except that the Secretary of Agriculture may correct clerical and typographical errors in the legal description and map. The map and legal description shall be on file and available for public inspection in the office of the Chief of the Forest Service, Department of Agriculture. SEC. 4. ADMINISTRATIVE PROVISIONS. (a) In General.--Subject to valid existing rights, lands designated as wilderness by this Act shall be managed by the Secretary of Agriculture in accordance with the Wilderness Act (16 U.S.C. 1131 et seq.) and this Act, except that, with respect to any wilderness areas designated by this Act, any reference in the Wilderness Act to the effective date of the Wilderness Act shall be deemed to be a reference to the date of enactment of this Act. (b) New Trails.-- (1) The Secretary of Agriculture shall consult with interested parties and shall establish a hiking trail plan designed to develop a system of hiking trails within or adjacent to or to provide access to the wilderness designated by this Act in a manner consistent with the Wilderness Act, Public Law 88-577 (16 U.S.C. 1131 et seq.). (2) Within two years after the date of enactment of this Act, the Secretary of Agriculture shall complete a report on the implementation of the hiking trail plan required under this Act. This report shall include the identification of priority hiking trails for development. (c) Repeater Site.--Within the Wild Sky Wilderness designated under this Act, the Secretary of Agriculture may use helicopter access to construct and maintain a joint Forest Service and Snohomish County repeater site, in compliance with a Forest Service approved communications site plan, for the purposes of improving communication for safety, health, and emergency services. (d) Float Plane Access.--As provided by section 4(d)(1) of the Wilderness Act (16 U.S.C. 1133(d)(1)), the use of floatplanes on Lake Isabel, where such use has already become established, shall be permitted to continue subject to such reasonable restrictions as the Secretary of Agriculture determines desirable. SEC. 5. AUTHORIZATION FOR LAND ACQUISITION. (a) In General.--The Secretary of Agriculture may acquire lands and interests therein, by purchase, donation, or exchange, and shall give priority consideration to those lands identified as ``Priority Acquisition Lands'' on the map described in section 3(a)(1). The boundaries of the Snoqualmie National Forest and the Wild Sky Wilderness shall be adjusted to encompass any lands acquired pursuant to this section. (b) Access.--Consistent with section 5(a) of the Wilderness Act (Public Law 88-577; 16 U.S.C. 1134(a)), the Secretary of Agriculture shall assure adequate access to private inholdings within the Wild Sky Wilderness. (c) Appraisal.--Valuation of private lands shall be determined without reference to any restrictions on access or use which arise out of designation as a wilderness area as a result of this Act. SEC. 6. LAND EXCHANGES. The Secretary of Agriculture shall exchange lands and interests in lands, as generally depicted on a map entitled Chelan County Public Utility District Exchange and dated May 22, 2002, with the Chelan County Public Utility District in accordance with the following provisions: (1) If the Chelan County Public Utility District, within ninety days after the date of enactment of this Act, offers to the Secretary of Agriculture approximately 371.8 acres within the Snoqualmie National Forest in the State of Washington, the Secretary shall accept such lands. (2) Upon acceptance of title by the Secretary of Agriculture to such lands and interests therein, the Secretary of Agriculture shall convey to the Chelan County Public Utility District a permanent easement, including helicopter access, consistent with such levels as used as of date of enactment, to maintain an existing snowtel site on 1.82 acres on the Wenatchee National Forest in the State of Washington. (3) The exchange directed by this Act shall be consummated if Chelan County Public Utility District conveys title acceptable to the Secretary and provided there is no hazardous material on the site, which is objectionable to the Secretary. (4) In the event Chelan County Public Utility District determines there is no longer a need to maintain a snowtel site to monitor the snow pack for calculating expected runoff into the Lake Chelan hydroelectric project and the hydroelectric projects in the Columbia River Basin, the Secretary shall be notified in writing and the easement shall be extinguished and all rights conveyed by this exchange shall revert to the United States.

Title: To enhance ecosystem protection and the range of outdoor opportunities protected by statute in the Skykomish River valley of the State of Washington by designating certain lower-elevation Federal lands as wilderness, and for other purposes Summary: Wild Sky Wilderness Act of 2002 - Designates certain lands in the Skykomish River valley, Washington, as the Wild Sky Wilderness, to be managed by the Secretary of Agriculture.Directs the Secretary to establish a hiking trail plan. Authorizes the use of helicopter access to construct and maintain a joint Forest Service and Snohomish County repeater site, in compliance with a Forest Service approved communications site plan, to improve communication for safety, health, and emergency services. Authorizes the use of floatplanes on Lake Isabel where such use has already become established.Authorizes the Secretary to acquire specified priority acquisition lands by purchase, donation, or exchange. Directs that the boundaries of the Snoqualmie National Forest and the Wild Sky Wilderness be adjusted to encompass any lands so acquired. Directs the Secretary to assure adequate access to private in-holdings within the Wild Sky Wilderness. States that valuation of private lands shall be determined without reference to any restrictions on access or use which arise out of designation as a wilderness area.Requires the Secretary to exchange specified lands with the Chelan County Public Utility District if the District offers to the Secretary lands within the Snoqualmie National Forest, Washington, in exchange for a permanent easement, including helicopter access, consistent with such levels as used as of the date of this Act's enactment, to maintain an existing snowtel site on land within the Wenatchee National Forest, Washington.Sets forth conditions for consummation of the exchange and for reversion to the United States if the District no longer needs to maintain a snowtel site.

billsum

en

Summarize: This invention was made with United States Government support awarded by the National Institutes of Health (NIH), Grant No. DK-14881. The United States Government has certain rights in this invention. This application is a continuation of application Ser. No. 08/435,230 filed May 5, 1995, now abandoned, which in turn is a divisional of application Ser. No. 08/148,203 filed Nov. 3, 1993, now U.S. Pat. No. 5,552,392. BACKGROUND OF THE INVENTION This invention relates to biologically active vitamin D compounds. More specifically, the invention relates to (20S) vitamin D compounds, to a general process for their preparation, and to their use in treating osteoporosis. With the discovery of 1α,25-dihydroxyvitamin D 3, as the active form of the vitamin has come an intense investigation of analogs of this hormonal form of vitamin D with the intent of finding analogs that have selective activity. By now, several compounds have been discovered which carry out the differentiative role of 1,25-dihydroxyvitamin D 3 while having little or no calcium activity. Additionally, other compounds have been found that have minimal activities in the mobilization of calcium from bone while having significant activities in stimulating intestinal calcium transport. Modification of the vitamin D side chain by lengthening it at the 24-carbon has resulted in loss of calcium activity and either an enhancement or undisturbed differentiative activity. Placing the 24-methyl of 1α,25-dihydroxyvitamin D 2 in the epi-configuration appears to diminish activity in the mobilization of calcium from bone. On the other hand, increased hydrophobicity on the 26- and 27-carbons seems to increase the total activity of the vitamin D compounds provided the 25-hydroxyl is present. Several of these known compounds exhibit highly potent activity in vivo or in vitro, and possess advantageous activity profiles. Thus, some of these compounds are in use, or have been proposed for use, in the treatment of a variety of diseases such as renal osteodystrophy, vitamin D-resistant rickets, osteoporosis, psoriasis, and certain malignancies. It is well known that females at the time of menopause suffer a marked loss of bone mass giving rise ultimately to osteopenia, which in turn gives rise to spontaneous crush fractures of the vertebrae and fractures of the long bones. This disease is generally known as postmenopausal osteoporosis and presents a major medical problem, both in the United States and most other countries where the life-span of females reaches ages of at least 60 and 70 years. Generally, the disease, which is often accompanied by bone pain and decreased physical activity, is diagnosed by one or two vertebral crush fractures with evidence of diminished bone mass. It is known that this disease is accompanied by diminished ability to absorb calcium, decreased levels of sex hormones, especially estrogen and androgen, and a negative calcium balance. Similar symptoms of bone loss characterize senile osteoporosis and steroid-induced osteoporosis, the latter being a recognized result of long term glucocorticoid (cortico-steroid) therapy for certain disease states. Methods for treating the disease have varied considerably but to date no totally satisfactory treatment is yet known. A conventional treatment is to administer a calcium supplement to the patient. However, calcium supplementation by itself has not been successful in preventing or curing the disease. Another conventional treatment is the injection of sex hormones, especially estrogen, which has been reported to be effective in preventing the rapid loss of bone mass experienced in postmenopausal women. This technique, however, has been complicated by the fact of its possible carcinogenicity. Other treatments for which variable results have been reported, have included a combination of vitamin D in large doses, calcium and fluoride. The primary problem with this approach is that fluoride induces structurally unsound bone, called woven bone, and in addition, produces a number of side effects such as increased incidence of fractures and gastrointestinal reaction to the large amounts of fluoride administered. Another suggested method is to block bone resorption by injecting calcitonin or providing phosphonates. U. S. Pat. No. 4,225,596 suggests the use of various metabolites of vitamin D 3 for increasing calcium absorption and retention within the body of mammals displaying evidence of or having a physiological tendency toward loss of bone mass. The metabolites specifically named in that patent, i.e., 1α-hydroxyvitamin D 3, 1α-hydroxyvitamin D 2 1α,25-dihydroxyvitamin D 3, 1α,25-dihydroxyvitamin D 2 and 1,24,25-trihydroxyvitamin D 3, although capable of the activity described and claimed in that patent are also characterized by the disadvantage of causing hypercalcemia especially if used with the conventional calcium supplement treatment. Therefore, use of these compounds to treat osteoporosis has not been widely accepted. U. S. Pat. Nos. 3,833,622 and 3,901,928 respectively suggest using the hydrate of 25-hydroxyvitamin D 3 and 1α-hydroxyvitamin D 3 for treatment of osteoporosis in a general expression of utility for those compounds. It is well known both of those compounds express traditional vitamin D-like activity, including the danger of hypercalcemia. U.S. Pat. No. 4,588,716 also suggests the use of 1α,25-dihydroxy-24-epi-vitamin D 2 to treat bone disorders characterized by the loss of bone mass, such as osteoporosis. This compound expresses some of the vitamin D-like characteristics affecting calcium metabolism such as increasing intestinal calcium transport and stimulating the mineralization of new bone. It also has the advantage of minimal effectiveness in mobilizing calcium from bone. The 24-epi compound may be administered alone or in combination with a bone mobilization inducing compound such as a hormone or vitamin D compound such as 1α-hydroxyvitamin D 3 or D 2 or 1α,25-dihydroxyvitamin D 3 or D 2. U. S. Pat. No. 5,194,431 discloses the use of 24-cyclopropane vitamin D 2 compounds in treating osteoporosis. Also, U.S. Pat. No. 4,851,401 discloses the use of cyclopentano 1,25-dihydroxyvitamin D 3 compounds in the treatment of osteoporosis and related diseases. In an ongoing effort to develop a treatment for osteoporosis, the carbon 20 position of the side-chain was investigated to determine its potential. Altering the order of substituents or the substitution pattern on carbon 20 could result in a change of minimum energy position for conformations around the C 17 -C 20 bond, and consequently, in a change of side-chain orientation with respect to the ring system. Orientation of the side-chain with respect to the ring system and configuration on the C 20 may have important consequences for biological properties of cholestane derivatives, in particular vitamin D compounds. It is well documented that binding of 1α,25-dihydroxyvitamin D 3 (1, Scheme 1) involves active centers in the ring A and triene system as well as in the side-chain. Altering the &#34;normal configuration&#34; around C 17 -C 20 bond in vitamin D could change the distance between active centers within the molecule, and thus result in a change in activity of such compounds. SUMMARY OF THE INVENTION The present invention provides (20S) vitamin D compounds exhibiting a desired, and highly advantageous, pattern of biological activity. These compounds are characterized by a marked intestinal calcium transport activity, almost equal to that of 1α,25-dihydroxyvitamin D 3, while exhibiting much higher activity than 1α,25-dihydroxyvitamin D 3 in their ability to mobilize calcium from bone. Hence, these compounds are highly specific in their calcemic activity. Their preferential activity on intestinal calcium transport and markedly high calcium mobilizing activity in bone allows the in vivo administration of these compounds for the treatment of metabolic bone diseases where bone turnover is a major concern. Because of their preferential calcemic activity, these compounds would be preferred therapeutic agents for the treatment of diseases, such as low bone turn over osteoporosis, and hypoparathyroidism. Structurally, the key feature of the compounds having these desirable biological attributes is that they are analogs of 1,25-dihydroxyvitamin D 3 in which the methyl group normally attached to the side-chain at carbon 20 is in the epi configuration. This &#34;unnatural&#34; configuration about carbon 20 represents an exchange of the methyl and hydrogen radicals from the &#34;natural&#34; C-20 configuration. Thus, the compounds of this type are characterized by the following general structure: ##STR1## where the stereochemical center at carbon 20 in the side chain has the S configuration, X 1 may be hydrogen or a hydroxy-protecting group, X 2 may be hydrogen, hydroxy, or protected hydroxy, and where Z is selected from the group consisting of Y, --OY, --CH 2 OY, --C.tbd.CY and --CH═CHY, where the double bond may have the cis or trans stereochemical configuration, and where Y is selected from the group consisting of hydrogen, methyl, --CR 5 O and a radical of the structure ##STR2## where m and n, independently, represent the integers from 0 to 5, where R 1 is selected from the group consisting of hydrogen, hydroxy, protected-hydroxy, fluoro, trifluoromethyl, and C 1-5 -alkyl, which may be straight chain or branched and, optionally, bear a hydroxy or protected-hydroxy substituent, and where each of R 2, R 3 and R 4, independently, is selected from the group consisting of hydrogen, fluoro, trifluoromethyl and C 1-5 alkyl, which may be straight-chain or branched, and optionally bear a hydroxy or protected-hydroxy substituent, and where R 1 and R 2, taken together, represent an oxo group, or an alkylidene group, ═CR 2 R 3, or the group --(CH 2 ) p --, where p is an integer from 2 to 5, and where R 3 and R 4, taken together, represent an oxo group, or the group --(CH 2 ) q --, where q is an integer from 2 to 5, and where R 5 represents hydrogen, hydroxy, protected-hydroxy, or C 1-5 alkyl. The present invention, therefore, provides compounds showing preferential activity on intestinal calcium transport and increased calcium mobilizing activity in bone, and are useful for the treatment of hypoparathyroidism as well as metabolic bone disease, such as low bone turn over osteoporosis, where bone turnover is a major concern. More specifically, the preferred compound is (20S) 1α,25-dihydroxyvitamin D 3. This invention also provides novel intermediate compounds formed during the synthesis of the end products. Some of the intermediate compounds are characterized by the following general structure: ##STR3## where the stereochemical center at carbon 20 in the side chain has the S configuration, X 3 may be hydrogen or a hydroxy-protecting group, and Z is as previously defined herein. Other key intermediates are characterized by the following general structure: ##STR4## where the stereochemical center at carbon 20 in the side chain has the S configuration, X 4 and X 5, which may be the same or different, is hydrogen, hydroxy, or oxygen, and Z is as previously defined herein. In another aspect of the invention, it has now been found that the loss of bone mass, which is characteristic of osteoporosis may be effectively treated by the administration of a (20S) vitamin D compound in sufficient amounts to increase bone mass. More specifically, a method of treating low bone turn over osteoporosis comprises the administration of an effective amount of a (20S) vitamin D compound, preferably (20S) 1α,25-dihydroxyvitamin D 3. The above compounds may be administered alone or in combination with other pharmaceutically acceptable agents. Dosages of from not less than about 0.5 μg/day to not more than about 50 μg/day of the individual compound per se, or in combinations, are generally effective. This method has the distinct advantage that it will restore bone mass due to the preferential calcemic activity of these compounds. Further, these compounds advantageously will not cause hypercalcemia even if the compound is administered continuously on a daily basis, as long as the appropriate compound dosages are used, it being understood that the dosage levels will be adjusted dependent on the response of the subject as monitored by methods known to those skilled in the art. The above method, involving the administration of the indicated dosages of (20S) vitamin D compounds such as (20S) 1α,25-dihydroxyvitamin D 3 is effective in restoring or maintaining bone mass, and thus provides a novel method for the treatment or prevention of various forms of osteoporosis, in particular low bone turn over osteoporosis. It will be evident that the method will find ready application for the prevention or treatment of disease states other than those named, such as hypoparathyroidism. DETAILED DESCRIPTION OF THE INVENTION As used in the description and in the claims, the term hydroxy-protecting group signifies any group commonly used for the temporary protection of hydroxy functions, such as for example, alkoxycarbonyl, acyl, alkylsilyl, and alkoxyalkyl groups, and a protected hydroxy group is a hydroxy function derivatized by such a protecting group. Alkoxycarbonyl protecting groups are groupings such as methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, isopropoxycarbonyl, butoxycarbonyl, ixobutoxycarbonyl, tert-butoxycarbonyl, benzyloxycarbonyl or allyloxycarbonyl. The term `acyl` signifies an alkanoyl group of 1 to 6 carbons, in all of its isomeric forms, or a carboxyalkanoyl group of 1 to 6 carbons, such as an oxalyl, amlonyl, succinyl, glutaryl group, or a aromatic acyl group such as benzoyl, or a halo, nitro or alkyl substituted benzoyl group. The word `alkyl` as used in the description or the claims, denotes a straight-chain or branched hydrocarbon radical of 1 to 10 carbons, in all its isomeric forms. Alkoxyalkyl protecting groups are groupings such as methoxymethyl, ethoxyethyl, methoxyethoxymethyl, or tetrahydrofuranyl and tetrahydropyranyl. Preferred alkylsilyl protecting groups are trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, and analogous alkylated silyl radicals. The vitamin D compounds useful in the present treatment are (20S) vitamin D compounds, preferably (20S) 1α,25-dihydroxyvitamin D 3. The above compounds may be administered alone or in combination with other pharmaceutically acceptable agents. The vitamin D compounds or combinations thereof can be readily administered as sterile parenteral solutions by injection or intravenously, or by alimentary canal in the form of oral dosages, or transdermally, or by suppository. Doses of from about 0.5 micrograms to about 50 micrograms per day of the compounds per se, or in combination with other 1α-hydroxylated vitamin D compounds, the proportions of each of the compounds in the combination being dependent upon the particular disease state being addressed and the degree of bone mineralization and/or bone mobilization desired, are generally effective to practice the present invention. In all cases sufficient amounts of the compound should be used to restore bone mass. Amounts in excess of about 50 micrograms per day or the combination of that compound with other 1α-hydroxylated vitamin D compounds, are generally unnecessary to achieve the desired results, may result in hypercalcemia, and may not be an economically sound practice. In practice the higher doses are used where therapeutic treatment of a disease state is the desired end while the lower doses are generally used for prophylactic purposes, it being understood that the specific dosage administered in any given case will be adjusted in accordance with the specific compounds being administered, the disease to be treated, the condition of the subject and the other relevant medical facts that may modify the activity of the drug or the response of the subject, as is well known by those skilled in the art. For example, to be effective, the (20S) 1α,25-dihydroxyvitamin D 3 compound is preferably administered in a dosage range of 0.5-50 μg/day. In general, either a single daily dose or divided daily dosages may be employed, as is well known in the art. Dosage forms of the various compounds can be prepared by combining them with non-toxic pharmaceutically acceptable carriers to make either immediate release or slow release formulations, as is well known in the art. Such carriers may be either solid or liquid such as, for example, corn starch, lactose, sucrose, peanut oil, olive oil, sesame oil and propylene glycol. If a solid carrier is used the dosage form of the compounds may be tablets, capsules, powders, troches or lozenges. If a liquid carrier is used, soft gelatin capsules, or syrup or liquid suspensions, emulsions or solutions may be the dosage form. The dosage forms may also contain adjuvants, such as preserving, stabilizing, wetting or emulsifying agents, solution promoters, etc. They may also contain other therapeutically valuable substances. The present invention is more specifically described by the following examples, which are meant to be illustrative only of the process of synthesis and of the compounds, both end products and intermediates, obtainable thereby. In these examples, specific compounds identified by Arabic numerals (e.g. compounds 1, 2, 3,... etc.) refer to the structures so numbered in the process schematics. Additionally examples are provided which are illustrative of the distinctive biological characteristics of the new compounds, such characteristics serving as a basis for the application of these compounds in the treatment of metabolic bone disease. CHEMISTRY The synthetic route to (20S) 1α,25-dihydroxyvitamin D 3 2a, which includes (20S) 25-hydroxycholesterol acetate 7a, (20S) vitamin D 3 derivative 10a and 3,5-cyclo-9,10-seco-derivatives 11a and 11b as key intermediates was chosen. (20S) 25-hydroxycholesterol acetate 8 was synthesized by the method involving alkylation of pregnenoic esters, allowing for stereoselective synthesis of the (20R), Wicha et al, J. Chem. Soc., Perkin 1, 1978, 1282, or the (20S), Wicha et al, Synth. Commun., 1989, 19, 63, series. Ester 4 readily available from commercial androstane derivative 3, Wicha et al, Synth. Commun., 1977, 7, 215-222, was treated with lithium diisopropylamide and then with methyl iodide to give the methyl derivative 5 in virtually quantitative yield and with at least 95% diastereoisomeric selectivity. Ester 5 was reduced with lithium aluminiumhydride; the corresponding alcohol 6a was converted to the tosyl derivative 6b which was subjected to reaction with the lithium derivative of 3-methyl-1-butyn-3-yl 2-tetrahydropyranyl ether, Barton et al, J. Chem. Soc., (C), 1970, 1584 and Uskokovic et al, Helv. Chim. Acta, 1974, 57, 768, to give compound 7a with 8-carbon side-chain. Acetylenic bond in 7a was saturated under usual conditions and the product 7b was solvolized in glacial acetic acid to give the intermediate 8. Bromination-dehydrobromination of compound 8 followed by treatment of the crude product with PTSA in dioxane and chromatography on a silica gel column, Uskokovic et al, J. Org. Chem., 1981, 46, 1030, afforded pure acetoxy diene 9a in a 47% yield. The respective alcohol 9b was subjected to photolysis using a medium-pressure UV lamp equipped with a Vycor filter. The reaction was monitored with HPLC and was stopped at the ca. 50% of conversion of the starting diene. The crude product was heated in ethanol at 75° C. for 6 h and then chromatographed on a silica gel column. A mixture of diene 9b and triene 10a was obtained which could not be separated into components. This mixture was treated with tosyl chloride to give a mixture of the corresponding 3-tosylates which were reacted with methanol in the presence of sodium hydrogen carbonate, Sheves et al, J. Am. Chem. Soc., 1975, 97, 6249. Careful chromatography of the reaction product afforded the 3,5-cyclo-6-methoxy derivative 11a. The intermediate 11a was transformed into the target compound 2a using the methodology of Paaren et al, J. Org. Chem., 1980, 45, 3253; DeLuca et al U.S. Pat. No. 4,555,364; and Kutner et al, J. Org. Chem., 1988, 53, 3454. Hydroxylation of compound 11a with seleninum dioxide gave a mixture of 1β-hydroxy derivative 11b and α,β-unsaturated ketone 11c, which was separated by chromatography. Solvolysis in acetetic acid of compound 11b allowed to recover the triene system and, finally, the ester group in 2b was hydrolyzed to the (20S) vitamin D 3 analogue 2a which was purified by HPLC. EXPERIMENTAL Melting points were determined on a Thomas Hoover capillary melting point apparatus and are uncorrected. Spectra were recorded using the following instruments: 1 H NMR-Brucker AM 400 or AM 500, as indicated (for deuteriumchloroform solutions with tetramethylsilane as an integral standard), UV--Perkin-Elmer Lambda 3B uv/vis (for ethanol solutions), mass and high resolution mass--Kartos MS-50Ts (70 eV). All reactions involving dienes or trienes were carried out under argon. Organic solutions were dried over anhydrous sodium sulfate and solvents were evaporated on a rotary evaporator. Column chromatography was performed using silica gel, Merck, 60, 230-400 mesh and preparative layer chromatography (PLC) using precoated silica gel plates, 20×20×0.025 cm, Merck. For high pressure liquid chromatography (HPLC) Waters Associated 6VK instrument equipped with Zorbax silica column (6.2 mm×20 cm) was used. Ethyl 6β-methoxy-3α,5-cyclo-5α-pregnan-21-oate (4) A mixture of ethyl 6β-methoxy-3α,5-cyclo-5α-pregn-17 (20)-en-21-oate (7.15 g), Wicha et al, J. Org. Che., 1990, 55, 3484, platinum oxide (0.30 g) and ethanol (60 ml) was stirred under hydrogen for 16 h. Usual workup gave saturated ester 4 (7.20 g, 100%), an oil; 3 ), 1.03(3H, s, C 19 --H), 0.65(3H, s, C 18 --H) overlapping). 0.43(1H, dd, J 1 =8.0, J 2 =5.3 Hz, cyclopropane H High resolution mass spec. for C 24 H 38 O 3 calcd.: 374.2821(M + ); found 374.2818, 359.2583(M + --CH 3,43%), 342.2546(M + --CH 3 OH, 100%), 329.2470(M + -C 2 H 5 O, 16%), 319.2280(M + --C 4 H 9, 77%). (20R) Ethyl 6β-methoxy-24,25-bisnor-3α,5-cyclo-5α-cholan-22-oate (5) To a mixture of diisopropyl amine (0.91 ml, 6.5 mmol) and THF (10 ml), stirred under argon, n-butyllithium (1.6M in hexane, 4.0 ml, 6.5 mmol) was added at -20° C. After 30 min the reaction mixture was cooled to -78° C. and a solution of ester 4 (1.60 g, 4.3 mmol) in THF (7 ml) was added during 20 min. After a further 40 min., methyl iodide (0.81 ml, 13.0 mmol) in hexamethylphosphoramide (4 ml) was added during 20 min. After 6 h the cooling bath was removed and the reaction mixture was set aside for 16 h. Usual workup and drying of the crude product in high vacuum afforded compound 5 (1.69 g, 100% yield) which was used for the next step without purification; of the (20S) isomer appeared at 1.00 ppm, integrating for less than 5%; High resolution mass spec. for C 25 H 40 O 3 calcd.: 388.2977(M + ); found: 388.2972(64%), 373.2733(M + -CH 3, 53%), 356.2751(M + -CH 3 OH, 100%), 333.2430(M + -C 4 H 9, 88%). (20R) 22-Hydroxy-6β-methoxy-23,24-bisnor-3α,5-cyclo-5α-cholane (6a) A mixture of ester 5 (1.34 g), lithiumaluminium hydride (0.5 g) and ether (20 ml) was heated under reflux for 1 h. The reagent excess was decomposed with saturated aqueous Na 2 SO 4 and the product was isolated in the usual way. Alcohol 6a was obtained (1.17 g, 98% yield); a sample was purified by PLC (hexane--ethyl acetate, 8:3); 1 H NMR (500) δ3.73(1H, dd, J 22a,22b =10.6, J 22a,20a), 3.48(1H, dd, J 22b,22a =10.7, J 22b,20 =7 Hz, C 22 --Hb),), 0.65(1H, dd, J 1 =J 2 =4.3 Hz) and 0.43(1H, dd, J 1 =7.9,). sub.2 =5.1 Hz, cyclopropane H High resolution mass spec. for C 23 H 38 O 2 calcd.: 346.2860(M + ); found: 346.2860; 331.2623(M + --CH 3, 72%), 314.2613(M + --CH 3 OH, 89%); 291.2319(M + -C 4 H 9, 100%). (20R) 22-Tosyloxy-6β-methoxy-23,24-bisnor-3α,5-cyclo-5α-cholane (6b) The reaction was performed according to the general procedure developed by Partridge et al, Helv. Chim. Acta, 1974, 57, 768, using the reagents as follows: alcohol 6a (1.21 g) in pyridine (1.4 ml) and tosyl chloride (0.9 g) in pyridine (1.4 ml). Tosylate 6b (1.61 g, 92% yield) was obtained; 1 H NMR (500) δ7.79(2H, d, J=8.2 Hz) and 7.34(2H, d, J=8.1 Hz,). 0.44(1H, dd, J 1 =7.9, J 2 =5.2 Hz, cyclopropane Hub.21 --H High resolution mass spec. for C 30 H 44 O 4 S calcd.: 500.2969 (M + ); found: 500.2960(41%), 485.2740(M + --CH 3, 32%), 445.2400(M + -C 4 H 9, 57%). (20S) 6β-Methoxy-25-(tetrahydropyranyl-2-oxy)-3α,5-cyclo-5α-choles t-23-yne (7a) To a stirred under argon solution of 3-methyl-1-butyn-3-yl 2-tetrahydropyranyl ether (1.68 g. 6.1 mmol) Barton et al, J. Chem. Soc., (C), 1970, 1584, (1.68 g, 6.1 mmol) in anhydrous dioxane (45 ml), n-butyllithium (1.6M in hexane, 3.8 ml, 6.1 mmol) was added at 5° C. The mixture was stirred at 5° C. for 1.5 h and then at room temperature for 1.5 h whereupon tosylate 6b (0.61 g, 1.22 mmol) in dioxane (10 ml) was added. The mixture was heated under reflux for 72 h, cooled and poured into water containing an excess of ammonium chloride. The product was extracted with ethyl acetate. The extract was washed with water and with brine. The solvent was evaporated and the residue (0.95 g) was dried in high vacuum for 16 h to give the crude product 7a (0.77 g). A sample was purified by PLC (hexane--ethyl acetate, 20:1); ). 0.50-0.45(1H, m, cyclopropane H Hz, C 21 --H-H High resolution mass spec. for C 33 H 52 O 3 calcd.: 496.3916(M + ); found: 496.3620(2.5%). (20S) 6β-Methoxy-25-(tetrahydropyranyl-2-oxy)-3α,5-cyclo-5α-cholestane (7b) A mixture of the crude acetylene derivative 7a (0.38 g), 5% palladium on activated carbon (0.05 mg), NaHCO 3 (0.60 mg) and dioxane (20 ml) was stirred under hydrogen for 24 h. The solid was filtered off and the solvent was removed to give saturated product 7b (0.38 g). A sample was prepared by preparative TLC (hexane--ethyl acetate, 4:1). ), 0.66-0.64(1H, m, cyclopropane H), 0.43(1H, dd, J 1 =8, J 2 =5.1)., cyclopropane H High resolution mass spec. for C 33 H 56 O 3 calcd.: 500.4229 (M + ); found: 500.4234 (4%). (20S) 3β,25-Hydroxycholest-5-ene 3-acetate (8) A solution of the crude methoxy derivative 7b (0.38 g) in acetic acid (30 ml) was stirred at 70° C. for 2 h, cooled and set aside for 16 h. Acetic acid was evaporated on a rotary evaporator, the residue was taken in ethyl acetate (60 ml), washed with aqueous NaHCO 3 and with brine. Solvent was evaporated and the residue (0.34 g) was chromatographed on silica gel (40 g, hexane--ethyl acetate, 5:1) to give acetate 8 (0.16 g, 69% yield from tosylate 6b); ). 0.77(3H, s, C 18 --H), 0.84(3H, d, J=6.6 Hz, C 21 --H Mass spec. m/z 384(M + --CH 3 CO 2 H; high resolution mass spec. for C 27 H 44 O(M + --CH 3 CO 2 H) calcd.: 384.3392; found: 384.3389(100%), 366.3273(M + --CH 3 CO 2 H--H 2 O, 17%) (20S) 3β,25-Dihydroxycholesta-5,7-diene 3-acetate (9a) A mixture of ene 8 (0.16 g), powderized NaHCO 3 (0.18 g), 1,3-dibromo-5,5-dimethylhydantoin (0.08 g) and hexane (5 ml) was stirred at the reflux temperature for 25 min. After cooling, the solid was filtered off under argon and washed with hot hexane. Combined filtrates were evaporated. To the residue xylene (10 ml) and collidine (1 ml) were added, the mixture was heated under reflux for 1.5 h, cooled and poured into water. The product was extracted with ether (3+20 ml). Combined extracts were washed consecutively with cold 5% HCl (twice), water, aqueous NaHCO 3 and brine. Bulk of the solvent was evaporated. The residue containing the initially used xylene was diluted with toluene (50 ml) and ethanol (50 ml) and evaporated. Remaining thick oil was dried in high vacuum and then it was dissolved in dioxane (10 ml) containing p-toluenesulphonic acid (10 mg). The solution was kept at 55° C. for 4 h whereupon it was diluted with ethyl acetate (30 ml). The product was isolated in the usual way and chromatographed on silica gel (24 g, hexane--ethyl acetate, 4:1). Fractions containing 5,7-diene were collected to give the title compound 9a (0.075 g, 47% yield); λ max 240, 249, 260 and 272 nm; 1 H NMR (500) δ5.57(1H, dd, J 6,7 =6, J 6,4a =2 Hz,). 0.52(3H, s, C 18 --Hsub.21 --HC 27 --Hub.3 --H, C 6 --H Mass spec. m/z 442(M +, 5%), 424(M + -H 2 O, 7%), 382(M + -CH 3 CO 2 H, 100%), 364(M + -CH 3 CO 2 H--H 2 O, 3%). (20S) 25-Hydroxy-6ξ-methoxy-3α,5β-cyclo-9,10-secocholesta-7E,10(19)-diene (11a) A solution of acetate 9a (75 mg) in ethanol (10 ml) containing 5% aqueous NaOH (1 ml) was set aside for 24 h and then the solvent was evaporated in vacuo. The residue was taken in ethyl acetate (30 ml) and washed consecutively with 5% HCl, water, and saturated aqueous NaHCO 3. Evaporation of the solvent gave (20S) 3b,25-dihydroxycholesta-5,7-diene 9b (74 mg) which was used for the next step without purification; λmax 240, 249, 260 and 272 nm; high resolution mass spec. for C 27 H 44 O 2 calcd.: 400.3341(M + ); found: 400.3334(100%), 398.3162(M + -H 2 O, 11%), 385.3101(M + --CH 3, 14%), 380.3086, 24%), 367.3013(M + --CH 3 --H 2 O, 67%). A solution of this product 9b in benzene--ether (2:8, 120 ml), cooled in ice-water bath, was irradiated with a Hanovia 608A36 medium-pressure UV lamp equipped with a Vycor filter. After 15 min the solvent was evaporated and the residue was dissolved in ethanol (20 ml) and heated at 75° C. for 6 h. The solvent was removed and the residue was chromatographed on silica gel (8 g, hexane--ethyl acetate, 4:1) to give a mixture of seco-triene 10a and unchanged diene 9b (60 mg); TLC, hexane-ethyl acetate, 1:1, R f =0.36. To a solution of the above described alcohols (9b and 10a, 60 mg) in pyridine (0.5 ml), tosyl chloride (60 mg) was added at 0° C. and the reaction mixture was stirred at 0°-5° C., for 16 h and then at room temperature for 2 h. Usual workup gave a mixture of the corresponding tosylates (65 mg) which was dried in high vacuum and then dissolved in anhydrous methanol (30 ml) containing sodium hydrogen carbonate (0.5 g). The mixture was set aside at 37° C. for 16 h whereupon it was stirred at 55° C. for 2 h. The product was recovered in the usual way and chromatographed on SiO 2 (5 g, hexane--ethyl acetate, 5:1). Appropriate fractions were collected to give &#34;cyclovitamin&#34; 11a (4.6 mg, 6.3% yield from acetoxy diene 9a); ), 4.99(1H, d, J 7,6 =9.2 Hz, C 7 --H), 4.88(1H, br s, C 19 ). 0.53(3H, s, C 18 --Hclopropane H4.6 Hz, cyclopropane H High resolution mass spec. for C 28 H 46 O 2 calcd.: 414.3497(M + ); found: 414.3510(15%), 382.3242(M + --CH 3 OH, 31%), 364.3113(M + --CH 3 OH--H 2 O, 13%). (20S) 1α,25-Dihydroxy-6ξ-methoxy-3α,562 -cyclo-9,10-secocholesta-7E, 10(19)-diene (11b) and (20S) 25-hydroxy-6ξ-methoxy-1-oxo-3α,5β-cyclo-9,10-secocholesta-7E,10(19)-diene (11c) The described procedure, Paaren et al, J. Org. Chem., 1980, 45, 3253; DeLuca et al U.S. Pat. No. 4,555,364; and Kutner et al, J. Org. Chem., 1988, 53, 3454, for hydroxylation of cyclovitamin was used. A mixture of selenium dioxide (Aldrich, 99.999%) (6 mg,), t-butylhydroperoxide (Aldrich, 3M in 2,2,4-trimethylpentane, 93 μL) and methylene chloride (1.7 ml) were stirred at room temperature for 30 min and then pyridine (10 μL) was added. After a few minutes methyledene derivative 11a (4.6 mg) in methylene chloride (1 ml) was added. The mixture was stirred for 1.5 h whereupon 10% aqueous NaOH was added, stirring was continued for 10 min and the mixture was diluted with methylene chloride (10 ml). Phases were separated and the organic phase was washed with 10% NaOH and brine. Evaporation of the solvent gave a residue (7 mg) which was chromatographed on silica gel (1.5 g, hexane--ethyl acetate, 5:1, 20 ml and then hexane--ethyl acetate, 4:1) to give (in order of elution): 1. 1-oxo-derivative 11c (1 mg), λ max =242 nm. ); 0.48(3H, s, C 18 --Hclopropane Hpane H--H9 --Ha High resolution mass spec. for C 28 H 44 O 3 calcd.: 428.3290(M + ); found: 428.3308(24%), 410.3213(M + --H 2 O, 35%), 398.3135(M + --CH 2 O, 14%), 396.3028(M + --CH 3 OH, 50%). 2. 1β-Hydroxy-derivative 11b (2 mg) which was used immediately for the next step; mass spec.: m/z 430(M +, 10%), 412(M + --H 2 O, 10%), 398(M + --CH 3 OH, 20%), 380(M + --CH 3 OH--H 2 O, 45%). (20S) 1α,25-Dihydroxyvitamin D 3 1-acetate (2b) A solution of the 3,5-cyclo derivative 11b (2 mg) in acetic acid (15 ml) was stirred at 55° C. for 20 min whereupon acetic acid was evaporated in vacuo. The reside was dried in high vacuum to give a mixture of trienes 2b and its 5E isomer (2 mg) in a ratio ca. 2:1 by HPLC (4.5% iso-propanol in hexane), retention times 10.4 and 13.6 min, respectively contaminated with ca. 10% of compounds with retention times 10 and 12 min, presumably the corresponding 1β-hydroxy-derivatives. The above described mixture (2b and the isomer) was dissolved in ethyl acetate (0.1 ml) and treated with a solution of maleic anhydride (2 mg) in ethyl acetate (0.2 ml). After 45 min (HPLC indicated practically complete consumption of the E-isomer), the mixture was diluted with ethyl acetate (15 ml) and washed with saturated NaHCO 3 and brine. The solvent was evaporated to give isomerically pure 2b (6 mg); a sample was purified by HPLC; λ max 264 nm; high resolution mass spec. for C 29 H 46 O 4 calcd.: 458.3396(M + ); found: 458.3399(6%), 398.3185(M + --CH 3 CO 2 H, 36%), 380.3093(M + --CH 3 CO 2 H--H 2 O, 29%), 365.2844(M + --CH 3 CO 2 H--H 2 O--CH 3, 12%). (20S) 1α,25-Dihydroxyvitamin D 3 (2a) A solution of acetate 2b (6 mg) in ether (2 ml) and methanol (1 ml) was treated with K 2 CO 3 (50 mg) at room temperature for 4 h. The mixture was diluted with ethyl acetate (15 ml) washed with water and evaporated to give residue (1 mg) which was purified by HPLC (hexane-isopropanol, 95:5) to give the title compound 2a (500 μg, amorphous solid); λ max 264 nm; ), 0.57(3H, s, C 18 --H); high resolution mass spec. for C 27 H 44 O 3 calcd.: 416.3290(M + ); found: 416.3306(7%), 398.3210(M + --H 2 O, 21%), 383.2972(M + -H 2 O--CH 3, 4%), 380.3071(M + -2H 2 O, 13%). Scheme 1 ##STR5## Biological Activity Rats were maintained on a normal calcium and normal phosphorus diet for one week (0.47% Ca, 0.3% P), then switched to a -Ca diet for the duration of the experiment (0.02% Ca). Vitamin D compounds were suspended in mixtures of ethanol and propylene glycol (5%:95%) and were administered daily for 7 days intraperitoneally. After 7 days the rats were killed and the duodena were used for determination of intestinal calcium transport by the everted intestinal sac technique (Martin &amp; DeLuca, 1967) and serum calcium (bone calcium mobilization). The tests were made against the 1,25-dihydroxyvitamin D 3 standard and are reported in Table 1. TABLE 1______________________________________INTESTINAL CALCIUM TRANSPORT ANDBONE CALCIUM MOBILIZING ACTIVITIESOF (20S) 1α,25-DIHYDROXYVITAMIN D.sub.3 Amount Serum Ca (μg/day/7 S/M (Mean +/- SEM)Compound days) (Mean +/- SEM) (mg %)______________________________________D 0 4.7 +/- 0.31 4.2 +/- 0.091,25-(OH).sub.2 D.sub.3.025 8.6 +/- 0.56 4.7 +/- 0.10.075 10.1 +/- 0.36 5.9 +/- 0.13(20S) 1,25-(OH).sub.2 D.sub.3.013 7.0 +/- 0.44 4.7 +/- 0.22.025 7.6 +/- 0.58 6.3 +/- 0.09.075 8.5 +/- 0.71 7.9 +/- 0.35______________________________________ The results show that the (20S) 1,25-dihydroxyvitamin D 3 compound is slightly less active than 1,25-dihydroxyvitamn D 3 in intestinal calcium transport. However, the (20S) 1,25-dihydroxyvitamin D 3 compound has highly significant calcium mobilizing activity. The amount of bone calcium mobilizing activity is considerably greater than 1,25-dihydroxyvitamin D 3. These compounds therefore, by showing activity on intestinal calcium transport and increased calcium mobilizing activity in bone suggest that they are preferred agents for the treatment of a disease such as low bone turn over osteoporosis, as well as hypoparathyroidism. For treatment purposes, the compounds of this invention may be formulated for pharmaceutical applications as a solution in innocuous solvents, or as an emulsion, suspension or dispersion in suitable solvents or carriers, or as pills, tablets or capsules together with solid carriers, according to conventional methods known in the art. Any such formulations may also contain other pharmaceutically-acceptable and non-toxic excipients such as stabilizers, anti-oxidants, binders, coloring agents or emulsifying or taste-modifying agents. The compounds may be administered orally, parenterally or transdermally. The compounds are advantageously administered by injection or by intravenous infusion of suitable sterile solutions, or in the form of liquid or solid doses via the alimentary canal, or in the form of creams, ointments, patches, or similar vehicles suitable for transdermal applications. Doses of from 0.5 μg to 50 μg per day of the compounds are appropriate for treatment purposes, such doses being adjusted according to the disease to be treated, its severity and the response of the subject, as is well understood in the art. Since the (20S) compounds exhibit specificity of action, each may be suitably administered alone, in situations where only bone mobilization stimulation is desired, or together with graded doses of another active vitamin D compound--e.g. 1α-hydroxyvitamin D 2 or D 3, or 1α,25-dihydroxyvitamin D 3 --in situations where some degree of additional calcium transport stimulation is found to be advantageous. Various modes of carrying out the invention are contemplated as being within the scope of the following claims particularly pointing out and distinctly claiming the subject matter regarded as the invention.

Summary: Vitamin D 3 analogs in which the methyl group normally attached to the side chain at carbon 20 has been exchanged with the hydrogen atom to form the 20-epi configuration. The compounds are characterized by a marked intestinal calcium transport activity while exhibiting much higher activity than 1α,25-dihydroxyvitamin D 3 in their ability to mobilize calcium from bone. Because of their preferential calemic activity, these compounds would be useful for the treatment of diseases such as hypoparathyroidism or where bone formation is desired, such as low bone turn over osteoporosis. This disclosure is also directed toward 20-epi-3,5-cyclovitamin D compounds useful as intermediates in a process for preparing 20-epi-vitamin D 3 analogs.

big_patent

en

Summarize: He may be worth $19bn and widely considered the crown prince of the internet era, but Mark Zuckerberg has been branded a scrooge in Rome when it comes to tipping. Lunching out with his new wife, Priscilla Chan, on their honeymoon, the Facebook co-founder Zuckerberg ran up a not-so-massive bill of €32 (£25) at the restaurant Nonna Betta this week, neglecting to add any tip at all, according to reports. The story was broken by Italian daily Corriere della Sera, which ran the headline "Zuckerberg in Rome – a €32 bill and no tip", adding that Chan had been nicknamed 'Chansaccodesoldi' on the internet, which roughly translates as "She's got a sack of cash". The couple stuck to antipasti of deep-fried artichoke and just one dish of seabass, artichoke and tomato ravioli, washed down with water and a pot of tea. The restaurant's owner, Umberto Pavoncello, defended Zuckerberg from the barbs, claiming the billionaire was "in a hurry". "They were really in love, eating from the same plate of ravioli," he said. After recognising him, Pavoncello went up to Zuckerberg and "I said, in English, 'But are you...?' and he replied, 'Yes.'" "I am seriously considering renaming the fiori di zucca – deep-fried courgette flowers – on the menu as fiori di Zuckerberg." There have been a number of theories explaining Facebook's lackluster IPO performance. Perhaps it's the social network's dependence on advertising or just a general sense that no company can live up to the colossal hype generated by Facebook. Personally, I see Facebook's mobile offerings as its primary weakness. The world is going mobile and if Facebook remains something you use at your desktop, it will quickly become irrelevant. To head off this threat, it seems like Facebook is once again starting the process of building the mythical "Facebook phone" to deliver its services to the mobile masses. This is a really bad idea. Facebook's latest smartphone aspirations were reported by the New York Times. Evidently, the company is poaching some of Apple's hardware engineers and scaling up efforts to build a phone. Presumably, the phone would come with a big 'ol Facebook button that would instantly launch the service. Facebook would be the default messaging, imaging, sharing and perhaps even voice platform. To be sure, there is something to be said for the simplicity of a Facebook button, and yet, this strategy is doomed to fail for the following reasons: Making Phones is Hard PCMag's lead mobile analyst, Sascha Segan, is fond of telling me that building phones is hard. Although they are mobile computers at their core, phones are mobile computers that must be self-powered with internal radios operating on multiple frequencies (3G, LTE, Wi-Fi, Bluetooth) with increasingly powerful CPUs running operating systems that are constantly being updated. Plus, they have to fit in the palm of your hand. (Although the surprising popularity of the gigantic Galaxy Note certainly challenges that claim.) Regardless, I think this much is clear: phone manufacturing is not a Facebook core competency. Making Money on Phones is Harder The margins on all hardware products are low, but on smartphones, they are almost nonexistent. Apple doesn't need to make a lot of money on the hardware because it can collect a carrier subsidy and every iPhone sold is really a cash register for its iTunes store. Samsung can rely on years of manufacturing experience and global scale. Facebook doesn't have any of those things. U.S. Carriers Will Hate It The market is a little different overseas, but in the U.S., carriers are going to hate the Facebook phone. They are already worried that Facebook messaging could replace texting. Even with a mandatory data plan, the Facebook phone will be a loss leader for carriers. It takes the carriers nearly a year to approve a new handset for use on their networks, and I'll bet it will take the Facebook phone even longer. Think about how many times a Facebook app could be updated in that time. Users Don't Want It I'm sure there is a group of die-hard Facebook users who would jump at the chance to make their Facebook account the center of their mobile communication experience, but I think they are a minority. Most users like the idea of paying for mobile service and then having the flexibility to use multiple apps and services on the device. Will the Facebook phone support Twitter? Can I use Hipstamatic or do I have to use Instagram? People will only carry one phone, and they will want it to be one that is social network agnostic. The bottom line is Facebook's mobile problem isn't about hardware, it is about software. Facebook's mobile apps kind of suck. They don't surface the communication you want and, at least on Android, they crash a lot. Thing is, writing code is exactly what Facebook should be able to do well. Rally the developers, buy a couple of cases of Red Bull, pull a weekend hackathon to solve the problem three different ways, and start beta testing. Solving the problem with hardware will take months of planning and lots of coordinating with a manufacturer, the FCC, and the carriers. Then, Facebook will have to figure out how to get the phones on store shelves. The company doesn't know how to do any of that. Why does Facebook persist in going down this road? The Times quotes an anonymous employee saying: "Mark [Zuckerberg] is worried that if he doesn't create a mobile phone in the near future that Facebook will simply become an app on other mobile platforms." To which I say, what is wrong with that? It made Instagram a $1 billion company with 13 employees. That is how you compete. Build better apps, and Facebook can continue to dominate the platform. The company just needs to focus on building killer apps for iOS, Android, and Windows Phone and concentrate on dominating the OpenGraph. For Facebook, hardware is a distraction. Follow me on Twitter! http://twitter.com/dancosta More Dan Costa: • Moovit Helps 300M People Catch Their Bus Every Day • Adobe's Scott Belsky on the 'Creative Professional' Evolution • Tech Addiction Nation • The Ups and Downs of Quantifying Your Life • We Are Already Living in the Future • more For the top stories in tech, follow us on Twitter at @PCMag.

Summary: Facebook has enough problems these days, from that lackluster IPO to rumors that Mark Zuckerberg is a lousy honeymoon tipper. And now comes yet another report that Facebook is trying to make a smartphone? At PC Magazine, Dan Costa has some advice: Don't do it. Facebook does indeed have weak mobile offerings, but the company should fix this problem with better software-its strong suit-not hardware. Building a smartphone is technically difficult, and then there's the hassle of dealing with carriers and the FCC to consider. While a minority of Facebook loyalists might sign on, Costa thinks most people would shy away from a phone that might limit their flexibility. "Will the Facebook phone support Twitter? Can I use Hipstamatic or do I have to use Instagram?" he writes. "People will only carry one phone, and they will want it to be one that is social network agnostic." Forget the hardware, Facebook. If your mobile apps are weak, build better apps instead. Read Costa's full column here.

multi_news

en

Write a title and summarize: Douglas FraserBusiness/economy editor, Scotland Events at Holyrood have sparked some discussion of whether Scotland's reputation is at risk, or merely that of some of its politicians. It's impossible to know. Brands and reputation are intangible assets, and notoriously hard to pin down. In the law of defamation, a reputation is judged against the "estimation of a right-thinking member of society generally". Some claim to be able to put a value on reputation. Brand consultants make a good living out of doing so. While Apple sits atop global brands, followed by Amazon, Google, Microsoft and Samsung, Scotland's strongest commercial contender is Johnnie Walker, making it just inside Interbrand's world top 100. What about nations, though? Whose nation is best? Many places have their own way of voicing the Scottish brag: 'wha's like us?' (The traditional response: 'Damn few, and they're a' deid.') We learned this week that 16 nations can claim to answer that question: 'We are - only better, and we have survey evidence to prove it'. This is the Anholt-Ipsos survey of 50 nations, asking how they rate on a number of metrics. The Scottish government takes a close interest to find out how it's faring, as the nation's international reputation is one of the outcomes on which Scottish ministers measure themselves. For six pulses of the survey over the past decade, it seems that Scotland's reputation as the place for tourism, investment mixed with immigration, culture, governance, people and exports is holding up, but not quite keeping pace with others. The survey results released last week show it slipping one place, to number 17 out 50. The survey showed Scotland scored best as a tourist destination, and was in the top 20 for five of the six categories of reputation. That at least suggests consistency is one of its strengths. It fell into a lower ranking only for its exports. Stereotypes and scenery How is this measured? A weighted survey of more than 20,000 people across 18 nations. Neither knowledge nor expertise seem to be required. It's probably harder to get firm opinions about Panama, Botswana, Qatar or Taiwan, so they start with that disadvantage. For its size, Scotland punches well above its weight simply for being known, even if it's often for stereotypes, its scenery, whisky, Nessie and Auld Lang Syne. It is larger nations which do better in this reckoning. Last year's survey found Germany came top for the fourth time in a row. We're told that "global citizens have positive feelings about buying German products, the employability of the German people, and the appeal of investing in German businesses, placing Germany first in all three categories for 2020". The UK moved up from fourth to second place, while Canada remained in third. Japan moved up to fourth, France dropped to fifth, its lowest ranking so far. Italy and Switzerland moved up one place each to sixth and seventh positions. Australia moved from 10th to 8th slot, the highest position it has reached, and Sweden remained at number nine. Reputation Top Trumps Being big and well-known, with desirable consumer products, is no guarantee of a strong reputation: the US last year dropped, on this count, from number six to 10. Americans previously held the top spot on seven occasions since 2009, but they have taken a dive in their global reputation. Maybe it was just coincidence that this followed the 2016 presidential election. China also suffered a decline down the rankings last year, from 23rd to 35th place. What was going right for the UK, for it to move up to second position behind Germany? After being third or fourth for several years, it scored strongly for its exports, attitudes to immigration and investment, and it enjoyed an improved perceptions of its governance, culture, people, and tourism. (Please don't complain to me if you disagree: instead, take your evidence to the 20,000 people questioned. This is, you'll note, about their perceptions rather than evidenced reality.) Failure to qualify The survey, carried out every two years, also tracks Scots' view of themselves. Over a decade and six surveys, Scots view of their country fell below number one only in 2016, when it was beaten by the UK and Canada. Hmm... what might have been happening between 2014 and 2016 to explain that? Answer that one according to your political taste. Regaining that top spot in 2018, it was confirmed in the most recent, 2020 survey. The one area in which Scots take a particularly dim view of themselves and their country is that of 'excellence in sport'.

Title: Scotland's reputation ranked in international survey Summary: Scotland is included in a survey of 50 countries, measuring how their reputations compare. Improvement is one of the targets for Scottish government ministers. The measures have held steady, but slipped one place on the league table, while the UK has improved to second place, and the US's reputation has slumped. The survey results, published by the Scottish government last week, also measure what Scots think of their own country. There's only one count on which Scots rate themselves badly.

xlsum_en

en

Summarize: CHAPTER XV Sweet is the breath of vernal shower, The bees' collected treasures sweet, Sweet music's melting fall, but sweeter yet The still, small voice of gratitude. GRAY On the following day, the arrival of her friend revived the drooping Emily, and La Vallee became once more the scene of social kindness and of elegant hospitality. Illness and the terror she had suffered had stolen from Blanche much of her sprightliness, but all her affectionate simplicity remained, and, though she appeared less blooming, she was not less engaging than before. The unfortunate adventure on the Pyrenees had made the Count very anxious to reach home, and, after little more than a week's stay at La Vallee, Emily prepared to set out with her friends for Languedoc, assigning the care of her house, during her absence, to Theresa. On the evening, preceding her departure, this old servant brought again the ring of Valancourt, and, with tears, entreated her mistress to receive it, for that she had neither seen, or heard of M. Valancourt, since the night when he delivered it to her. As she said this, her countenance expressed more alarm, than she dared to utter; but Emily, checking her own propensity to fear, considered, that he had probably returned to the residence of his brother, and, again refusing to accept the ring, bade Theresa preserve it, till she saw him, which, with extreme reluctance, she promised to do. On the following day, Count De Villefort, with Emily and the Lady Blanche, left La Vallee, and, on the ensuing evening, arrived at the Chateau-le-Blanc, where the Countess, Henri, and M. Du Pont, whom Emily was surprised to find there, received them with much joy and congratulation. She was concerned to observe, that the Count still encouraged the hopes of his friend, whose countenance declared, that his affection had suffered no abatement from absence; and was much distressed, when, on the second evening after her arrival, the Count, having withdrawn her from the Lady Blanche, with whom she was walking, renewed the subject of M. Du Pont's hopes. The mildness, with which she listened to his intercessions at first, deceiving him, as to her sentiments, he began to believe, that, her affection for Valancourt being overcome, she was, at length, disposed to think favourably of M. Du Pont; and, when she afterwards convinced him of his mistake, he ventured, in the earnestness of his wish to promote what he considered to be the happiness of two persons, whom he so much esteemed, gently to remonstrate with her, on thus suffering an ill-placed affection to poison the happiness of her most valuable years. Observing her silence and the deep dejection of her countenance, he concluded with saying, 'I will not say more now, but I will still believe, my dear Mademoiselle St. Aubert, that you will not always reject a person, so truly estimable as my friend Du Pont.' He spared her the pain of replying, by leaving her; and she strolled on, somewhat displeased with the Count for having persevered to plead for a suit, which she had repeatedly rejected, and lost amidst the melancholy recollections, which this topic had revived, till she had insensibly reached the borders of the woods, that screened the monastery of St. Clair, when, perceiving how far she had wandered, she determined to extend her walk a little farther, and to enquire about the abbess and some of her friends among the nuns. Though the evening was now drawing to a close, she accepted the invitation of the friar, who opened the gate, and, anxious to meet some of her old acquaintances, proceeded towards the convent parlour. As she crossed the lawn, that sloped from the front of the monastery towards the sea, she was struck with the picture of repose, exhibited by some monks, sitting in the cloisters, which extended under the brow of the woods, that crowned this eminence; where, as they meditated, at this twilight hour, holy subjects, they sometimes suffered their attention to be relieved by the scene before them, nor thought it profane to look at nature, now that it had exchanged the brilliant colours of day for the sober hue of evening. Before the cloisters, however, spread an ancient chesnut, whose ample branches were designed to screen the full magnificence of a scene, that might tempt the wish to worldly pleasures; but still, beneath the dark and spreading foliage, gleamed a wide extent of ocean, and many a passing sail; while, to the right and left, thick woods were seen stretching along the winding shores. So much as this had been admitted, perhaps, to give to the secluded votary an image of the dangers and vicissitudes of life, and to console him, now that he had renounced its pleasures, by the certainty of having escaped its evils. As Emily walked pensively along, considering how much suffering she might have escaped, had she become a votaress of the order, and remained in this retirement from the time of her father's death, the vesper-bell struck up, and the monks retired slowly toward the chapel, while she, pursuing her way, entered the great hall, where an unusual silence seemed to reign. The parlour too, which opened from it, she found vacant, but, as the evening bell was sounding, she believed the nuns had withdrawn into the chapel, and sat down to rest, for a moment, before she returned to the chateau, where, however, the increasing gloom made her now anxious to be. Not many minutes had elapsed, before a nun, entering in haste, enquired for the abbess, and was retiring, without recollecting Emily, when she made herself known, and then learned, that a mass was going to be performed for the soul of sister Agnes, who had been declining, for some time, and who was now believed to be dying. Of her sufferings the sister gave a melancholy account, and of the horrors, into which she had frequently started, but which had now yielded to a dejection so gloomy, that neither the prayers, in which she was joined by the sisterhood, or the assurances of her confessor, had power to recall her from it, or to cheer her mind even with a momentary gleam of comfort. To this relation Emily listened with extreme concern, and, recollecting the frenzied manners and the expressions of horror, which she had herself witnessed of Agnes, together with the history, that sister Frances had communicated, her compassion was heightened to a very painful degree. As the evening was already far advanced, Emily did not now desire to see her, or to join in the mass, and, after leaving many kind remembrances with the nun, for her old friends, she quitted the monastery, and returned over the cliffs towards the chateau, meditating upon what she had just heard, till, at length she forced her mind upon less interesting subjects. The wind was high, and as she drew near the chateau, she often paused to listen to its awful sound, as it swept over the billows, that beat below, or groaned along the surrounding woods; and, while she rested on a cliff at a short distance from the chateau, and looked upon the wide waters, seen dimly beneath the last shade of twilight, she thought of the following address: TO THE WINDS Viewless, through heaven's vast vault your course ye steer, Unknown from whence ye come, or whither go! Mysterious pow'rs! I hear ye murmur low, Till swells your loud gust on my startled ear, And, awful! seems to say--some God is near! I love to list your midnight voices float In the dread storm, that o'er the ocean rolls, And, while their charm the angry wave controuls, Mix with its sullen roar, and sink remote. Then, rising in the pause, a sweeter note, The dirge of spirits, who your deeds bewail, A sweeter note oft swells while sleeps the gale! But soon, ye sightless pow'rs! your rest is o'er, Solemn and slow, ye rise upon the air, Speak in the shrouds, and bid the sea-boy fear, And the faint-warbled dirge--is heard no more! Oh! then I deprecate your awful reign! The loud lament yet bear not on your breath! Bear not the crash of bark far on the main, Bear not the cry of men, who cry in vain, The crew's dread chorus sinking into death! Oh! give not these, ye pow'rs! I ask alone, As rapt I climb these dark romantic steeps, The elemental war, the billow's moan; I ask the still, sweet tear, that listening Fancy weeps!

Summary: Man, the Count de Villeforte is really laying it on thick trying to convince Em to go for Du Pont. Stop trying to make fetch happen, Count. After hanging out at La Vallee for a while, the Count invites Em back to Chateau-le-Blanc. Yes, these rich people really do bounce back and forth between each other's homes a lot. Once there, Em naturally goes straight on over to her fave place: the convent. It's a bit chaotic at the nunnery. Sister Agnes is apparently on death's door. Em doesn't particularly want to see Sister Agnes dying, so she heads back home. Em stops to write a little ditty about the winds by the chateau. Getting back into a poetic state of mind, are we?

booksum

en

Write a title and summarize: "Le Monde Eco & entreprise" du 26 juin 2012. DR Le climat est-il en train de changer dans les entreprises? Dans le cas - très médiatisé - de France Télécom, cela semble être le cas. "Avant 2009, quand, au cours d'un bilan de compétences, on évoquait le souhait de changer de poste, on nous invitait à partir. Aujourd'hui, c'est terminé. Les mesures prises ont apaisé le climat social", affirme Ghislaine Coinaud, élue CGT. Le sondage réalisé par Michael Page International, à l'occasion de la remise du Trophée du capital humain (en partenariat avec Le Monde), confirme ce regain de confiance des salariés à l'égard de leur société. Un résultat surprenant, alors que depuis des années on évoque largement le "désengagement" des employés et que le contexte de crise n'est généralement pas propice aux petites attentions envers le personnel. Voici quatre pistes d'explications... et de solutions. LES RISQUES PSYCHOSOCIAUX "Les risques psychosociaux ont amené les DRH à s'intéresser de plus en plus au ressenti des salariés, explique Hubert Landier, vice-président de l'Institut international de l'audit social. Ils ont renforcé le management de proximité et constaté que la compétitivité et la performance passent par la dimension humaine." A France Télécom-Orange, la confiance revient. Selon le dernier baromètre social du groupe, 88 % des salariés estiment que la qualité de vie au travail est identique ou meilleure que dans les autres entreprises, ceux qui la jugent plus mauvaise sont passés, eux, de 16 % en 2010 à 6 % fin 2011. "Le rétablissement d'un climat apaisé a ranimé l'engagement des collaborateurs et assuré une meilleure performance économique : 20 000 jours de travail ont été récupérés sur un an grâce à la réduction de l'absentéisme, affirme Bruno Mettling, le DRH du groupe. D'avril 2011 à avril 2012, le nombre total de journées d'absence a reculé de 4 %, et celui du nombre de jours d'absence pour maladie de 7 %." En 2008, après une longue période de diagnostic destinée à faire remonter les attentes des salariés (qualité du travail, parcours professionnel, rémunération, management), la politique des ressources humaines a été réorientée sur les conditions de travail, la formation du management pour tenir compte des moyens disponibles. Les objectifs ont été réduits.

Title: Entreprises: le fragile retour de la confiance des salariés Summary: Pour lutter contre le désengagement des salariés et les risques psychosociaux, de plus en plus de grandes entreprises ont changé de cap. Le cas le plus spectaculaire est celui de France Télécom qui, après le traumatisme de 2008, a pris des mesures et réduit l'absentéisme de 20 000 jours en un an. La persistance de la crise pourrait remettre en cause ces progrès.

mlsum_fr

fr

Summarize: CROSS REFERENCE TO RELATED APPLICATION This application is a continuation in part of U.S. patent application Ser. No. 08/843,745, filed Apr. 21, 1997 entitled ACOUSTIC RESPIRATORY THERAPY APPARATUS. BACKGROUND OF THE INVENTION 1. Field of the Invention This invention generally relates to respiratory devices and more particularly to a vibrating device and method which assists in breaking up and dislodging accumulated fluids and solids generated in a user&#39;s lungs. 2. Description of the Related Art People who have lung diseases such as cystic fibrosis, bronchiactasis and chronic bronchitis have a difficult time breaking up, dislodging, and expelling mucus and phlegm which develops in the lungs. The presence of this material in the lungs and bronchial and tracheal passages provides an excellent media for growth of bacteria. For treatment of the condition, rotation of antibiotics is used to treat the bacterial infections that result. Postural drainage with induced vibration, percussive therapy and/or the use of a mechanical device such as a flutter valve are often used to help the patient dislodge this mucus material. Such percussive devices are disclosed in U.S. Pat. Nos. 5,018,517 and 5,451,190 to Liardet. This device is self powered, as are other flutter valve devices available and in use today. That is, the patient exhales into the device which sets up vibrations which feed back through the patient&#39;s air ways to break up and dislodge the phlegm. However, this activity is energy consumptive and very draining to the patient. Often, because of a debilitating condition from the effects of pneumonia, for example, the patient has great difficulty blowing into these self powered mechanical devices with sufficient force to achieve any substantive success at dislodging accumulated phlegm. An active vibratory device is disclosed in U.S. Pat. No. 4,813,403 to Endo. This device comprises an oscillator for generating an electrical signal at a frequency optimally effective for the patient, an audio amplifier, and a transducer connected, through a closed gas volume, to a vibratory diaphragm which is placed against the patient&#39;s body, typically the patient&#39;s chest or back. The vibration is then transferred from the transducer, through the closed gas volume, to the diaphragm, then to the surface of the patient&#39;s body to treat such problems as shoulder discomfort, arthritis, asthmatic spasms and improve blood circulation. The major disadvantage with this approach when the lungs are the target is that by placing the unit on a user&#39;s back or chest, the intervening body tissue may substantially attenuate the vibration before it reaches the target area of the lungs and bronchial tubes. Therefore there is an urgent need for a device that can efficiently and effectively transmit acoustic vibrations to the sites of phlegm buildup in the patient&#39;s lungs. There is also a need for a device which does not exhaust the patient&#39;s energy during device operation so that this energy can be reserved for effective expulsion of dislodged phlegm. SUMMARY OF THE INVENTION The method and apparatus in accordance with the present invention meets the above identified needs. It is thus an object of the invention to provide a powered apparatus for directly assisting a patient in breaking up phlegm and mucus plugs in the patient&#39;s lungs and bronchial tubes. It is another object of the invention to provide a powered acoustical apparatus that the patient may adjust to achieve optimal breakup of phlegm and mucus plugs. It is another object of the invention to provide a powered acoustical apparatus that a patient may utilize to achieve optimal breakup of phlegm and mucus plugs without generating bothersome sound levels to persons in close proximity to the patient. It is a still further object of the invention to provide a method for optimal loosening and breakup of phlegm and mucus plugs in a patient&#39;s airways and lungs. It is a still further object of the invention to provide an active acoustical apparatus that can automatically generate an acoustic waveform that approximates the frequency spectrum of a patient&#39;s breathing sounds to optimize breakup of phlegm and mucus plugs in the patient&#39;s airways. It is another object of the invention to provide a powered apparatus which a patient can use while breathing in a normal manner and which automatically optimizes transmission of acoustic vibrations directly into a patient&#39;s airways based on monitoring of at least one physical parameter indicative of one or more body functions. These and other objects and features of the invention are achieved by utilizing an electrically powered apparatus which produces an acoustic signal and directs the signal directly into a patient&#39;s airways. The acoustic signal may comprise a continuous tonal spectrum or noise spectrum, an intermittent acoustic spectrum, or series of sound pulses. The apparatus comprises a housing, a power supply, an acoustic generator preferably including a variable frequency oscillator and an audio amplifier in the housing connected to the power supply, an audio transducer such as a speaker connected to the amplifier and facing a biologic barrier such as an elastic diaphragm in the housing forming a portion of a sonic coupling air chamber in the housing, and a mouthpiece at one end of the housing connected to the air chamber. The mouthpiece is adapted to be held in a user&#39;s mouth while breathing during operation of the apparatus. When the user closes his or her mouth around the mouthpiece of the apparatus, the mouthpiece forms a passage which directly couples the air chamber into the user&#39;s airways including the user&#39;s, i.e., patient&#39;s, bronchial tubes and lungs. The housing also has a breathing passage or series of ports preferably formed around and alongside the mouthpiece, or alternatively formed by a plurality of small holes through the peripheral wall of the air chamber in the housing. These passages permit the user&#39;s breath to exit the sonic coupling air chamber. The user draws fresh air for each breath into his or her lungs during operation of the apparatus through these breathing passages. The breathing passages may be formed by one or more tubes or tubular passages coaxially extending alongside the central passage through the mouthpiece. These breathing passages may be integrally formed in the mouthpiece by a short annular sleeve formed around the central passage through the mouthpiece. The breathing passages have a total cross sectional area that is much smaller than the central passage through the air chamber and mouthpiece into the user&#39;s mouth, bronchial tubes and lungs. However, the breathing passage or passages cross sectional area is large enough to permit the user to breath at a normal rate without undue restriction. The method in accordance with the present invention of loosening phlegm and mucus plugs in a patient&#39;s airways and lungs basically comprises the steps of: generating an acoustic waveform such as a sequence of sonic pulses in an acoustic signal generator; directing the waveform directly into the patient&#39;s airways while the patient breathes in and out; sensing a signal representative of the patient&#39;s respiration such as the sound of the patient&#39;s breathing; feeding the representative signal back to the acoustic signal generator; and adjusting a portion of the waveform generated by the acoustic signal generator to the representative signal to thereby approximate at least a portion of the sound of the patient&#39;s breathing. More generally, the method of the invention comprises the steps of: sensing a parameter representative of a patient&#39;s breathing efficiency such as breathing sounds or blood oxygen levels; generating an acoustic waveform in an acoustic generator; directing the waveform into the patient&#39;s airways while the patient breathes in and out; and adjusting the generated acoustic waveform to optimize the effect on the sensed parameter. In the case of sensing the sound of a patient&#39;s breathing, the step of adjusting preferably may include matching at least a portion of the frequency spectrum of the sensed sounds of the patient&#39;s breathing in the acoustic generator such that the generated waveform closely corresponds to the sensed frequencies. The first embodiment of the present invention is entirely manually adjusted. To operate the apparatus of the first embodiment of the invention, the user inserts the mouthpiece of the apparatus into his or her mouth and breathes normally, inhaling and exhaling through the breathing passages. The user turns on the apparatus and the transducer produces an acoustic waveform which may be a continuous waveform or a series of sonic pulses which are directed through the sonic air coupling chamber into the user&#39;s lungs through the central aperture in the mouthpiece. The apparatus includes controls for the user to vary the continuous or intermittent mode of operation, the amplitude, repetition rate, frequency and the frequency mixture of the transmitted sound waveform so that the user can manually select the particular optimum combination for his or her condition. Another, second embodiment of the apparatus in accordance with the present invention further includes an automatic mode of operation, which utilizes an acoustic feedback circuit to the acoustic generator transmitting the sound pulses or sound spectra that is designed to optimize one or more monitored parameters. The feedback circuit includes a sensor for detecting and monitoring a parameter such as the pitch or frequency spectrum of sounds produced by the patient when exhaling and inhaling between active pulse emissions, when operating in the pulse mode. Blood oxygen level is another exemplary monitored parameter which is particularly suited for use when the apparatus is operated in the continuous waveform generating mode. The feedback circuit preferably automatically compensates or adjusts the waveform, e.g., amplitude, frequency, frequency spectrum and/or repetition rate produced by the acoustic generator of the apparatus to optimize the effect on the parameter being monitored. This second embodiment may be switched by the user between manual and automatic modes of operation. This embodiment preferably utilizes an analog to digital converter (ADC) coupled to a microprocessor or digital signal processor (DSP) to provide the feedback signal from the user&#39;s monitored parameter to automatically adjust the generated waveform in order to optimize the monitored parameter. One example involves monitoring the sound of the user&#39;s breathing. In this case, the transducer itself may be used, in between the pulses in pulse mode, as a listening sensor (microphone) to pick up and amplify the user&#39;s breathing sounds between periods of operation. When a digital signal processor is used, the transducer itself may be used even during waveform transmission, to listen to the user&#39;s breathing sounds by canceling out the transmitted waveform using digital sampling techniques. Alternatively, a separate microphone may be provided. The optimum result is provided, in the case of monitoring the sound of the patient&#39;s breathing, when the frequency spectrum produced by the apparatus substantially matches the spectrum of the user&#39;s breathing or wheezing sounds. In the case where blood oxygen level is monitored, the optimum is provided when the monitored oxygen level is maximized. In this case, the DSP may include generation of a predetermined or preprogrammed sequence of frequency spectrums to be generated and tested to systematically determine where the maximum benefit on oxygen level is obtained. Another example of a monitored parameter may be an ultrasonic monitor which senses an ultrasonic signature of a mucus plug. When a person has mucus plugs that restrict air passage, often an ultrasonic signature is produced by the patient&#39;s breathing around this plug. The presence of this ultrasonic signature can be used to trigger generation of an acoustic waveform search pattern. As the frequency of the acoustic waveform generated pattern approaches and then matches the resonance frequency of the mucus plug, the ultrasonic signature of the plug will change. This change is detected and signals to the acoustic generator that the resonant frequency, i.e. optimal frequency for mucus plug loosening, has been reached. The acoustic generator then reproduces the resonant frequency waveform to further loosen the mucus plug The apparatus in accordance with the present invention may be operated for as long as needed by the user. The user need only remove the mouthpiece while coughing to expel phlegm and mucus loosened by the vibrations of the generated waveform or sound pulses transmitted directly into the user&#39;s lungs. Another unique feature of the present invention is that it is sound damped, i.e., virtually all of the sound produced by the acoustic transducer is directed through the air chamber into the user&#39;s bronchial tubes and lungs and not out through the walls of the apparatus. Therefore a user may utilize the apparatus in a crowded environment without disturbing others in the immediate vicinity. The cavity behind the acoustic transducer is filled with an absorptive material which dissipates resonances in the cavity behind the transducer and absorbs energy from the rear of the transducer to improve forward transmission efficiency. The apparatus of the invention may be either battery powered by conventional batteries or may be powered from normal house current. The power supply in the apparatus may also include rechargeable batteries for use while traveling. These and other features and advantages will become more apparent from a reading of the following detailed description when taken in conjunction with the drawing figures. BRIEF DESCRIPTION OF THE DRAWING FIG. 1 is a perspective view of a first embodiment of the apparatus in accordance with the present invention. FIG. 2 is a sectional view of the apparatus in accordance with the present invention shown in FIG. 1. FIG. 3A is an end view of the mouthpiece of the apparatus in accordance with the invention shown in FIG. 1. FIG. 3B is an end view of an alternative mouthpiece of the apparatus shown in FIG. 1. FIG. 4 is a perspective view of a second embodiment of the apparatus in accordance with the present invention. FIG. 5 is a schematic block diagram of the electrical circuit of the apparatus shown in FIG. 4. DETAILED DESCRIPTION OF THE INVENTION Referring to FIG. 1, a first embodiment of an apparatus 10 in accordance with the present invention is shown in a perspective view. The apparatus 10 comprises a generally cylindrical housing 12 that has a bottom or base tubular portion 14 and a generally tubular cap portion 16. The cap portion 16 has a tubular side wall 18 and preferably a generally funnel shaped end wall 20 having a central aperture 22 therethrough connected to a preferably semi-rigid mouthpiece 24 designed to be held in the user&#39;s mouth between the teeth. The mouthpiece 24 preferably includes a peripheral sleeve 25 forming a plurality of breathing passages 26 extending alongside the body of the mouthpiece 24. An end view of the mouthpiece 24 is shown in FIG. 3A. The peripheral sleeve 25 is spaced from the body of the mouthpiece 24 by axially extending ribs 27. These ribs 27 divide the annulus formed between the body of the mouthpiece 24 and the peripheral sleeve 25 into the plurality of tubular passages 26 which extend alongside the body of the mouthpiece 24 a sufficient distance, about an inch, so that the user does not cover their end openings with his or her lips. The breathing passages 26 allow the user to breath fresh air normally in and out through the mouth during operation of the apparatus 10. Although the passages are not required since the user can breathe through his or her nose, the passages are preferred since often a user may have constricted sinuses, a stuffy nose, etc. The width of the passages 26 shown in the FIGS. 1, 2, and 3A are shown exaggerated for clarity. In reality, the width is much narrower. The passages 26 have a total cross sectional area that is small compared to the area of the central aperture 22 through the mouthpiece 24 so that the sound transmitted through the central aperture 22 into the user&#39;s airways is not diverted out through the breathing passages 26. An alternative arrangement of the tubular passages 26 in the mouthpiece 24&#39; is shown in FIG. 3B. In this embodiment, the breathing passages 26&#39; are comprised of actual short tubes 29 extending axially alongside the body of the mouthpiece 24. These tubes 29 are banded together around the body of the mouthpiece 24 and may be removed and replaced as may be required for cleaning. The bottom or base portion 24 of the apparatus 10 contains an acoustic generator which comprises a battery power supply 2$, a circuit board 30 containing an audio oscillator circuit 32 and an audio amplifier circuit 34 thereon, and supports an acoustic transducer 36 connected to the output of the audio amplifier 34. The transducer 36 is essentially a conventional speaker. As more fully described with reference to the second embodiment below, the transducer 36 may be a combination speaker/microphone which operates as a conventional speaker when electrically driven and as a microphone when acoustically driven by the patient&#39;s breathing sounds. An on/off/mode switch 38, volume control 40, frequency control 42, and a repetition rate control 44 are preferably accessible through apertures in a disk shaped bottom plate 46 closing the bottom or base of the tubular portion 14. These four switches shown are exemplary and may be replaced by a different combination of switches with the functions designated by button sequences or combinations. For example, there may be only three buttons or switches 38, 40 and 462 In this case button 38 alone could turn the apparatus on or off and pressing switch 38 twice in succession could switch between pulse and continuous modes. Both switches 38 and 40 depressed together could increase the volume. Switch 40 alone could decrease the volume. Both switches 38 and 42 depressed together could increase the frequency and depressing switch 42 alone could decrease the frequency. Switches 40 and 42 depressed simultaneously could change repetition rate. Two switches may also be used. In this case, pressing both together once could turn the unit on. Pressing both together twice could switch between continuous and pulse modes. Pressing both together and holding for a predetermined period of time could turn the apparatus off. Pressing and holding one of the switches would increase the volume. Pressing and holding the other switch would increase the frequency. Pressing and holding the first switch again could decrease the volume, pressing both simultaneously could change to the repetition rate adjust mode and so on. Other combinations readily apparent to those skilled of the art may also be utilized and may easily be facilitated. The configuration shown is merely an illustrative example. The base tubular portion 14 and the cap portion 16 are preferably telescopically mated together with a replaceable elastic diaphragm 48 captured therebetween, i.e., captured by the telescoping ends of the tubular portions 14 and 16. The purpose of the diaphragm 48 is primarily to prevent biological contaminants from reaching the transducer cone 37 and the electrical components in the lower portion 14 of the housing 12. Accordingly, the diaphragm 48 may be either reusable or disposable. Alternatively, the cap portion 16 and diaphragm 48 may be integrally made as a single disposable unit. The cap portion 16, the diaphragm 48 over the cone 37 of the transducer 36, and the mouthpiece 24 together define an acoustic coupling chamber 27 which couples the transducer 36 to the user&#39;s airways when the mouthpiece 24 is held in a user&#39;s mouth. When the diaphragm 48 is provided as a separate piece, the diaphragm 40 is preferably stretched over the bottom end of the cap portion 16 during housing assembly and then the cap portion 16 is slipped over the open transducer end of the bottom portion 14. In this way, when the apparatus 10 is disassembled for cleaning after use, the cap portion 26, diaphragm 48, and mouthpiece 24 can be removed as an assembly. The component parts may then be cleaned and/or sterilized and the diaphragm 48 replaced as may be necessary. Alternatively, the diaphragm 48 may be first installed over the cone 37 of the transducer 36 on the bottom portion 14 and/or the cap portion 16 may alternatively be sized to fit within the open end of the bottom portion 14. The cap portion 16 and base portion 14 may be also be constructed to be mated in any other conventional manner. The diaphragm 48 may optionally be an annular disk of thin elastic material with a relatively rigid rim which fits snugly within either the cap portion 16 or within the bottom portion 14. The diaphragm 42 may also be designed to slip over one of the portions 14 or 16 with a semi rigid rim snap fitting within an external groove or internal groove in one of the portions (not shown). In any event, the diaphragm 48 is placed so as to shield the transducer cone 37 from any contaminants that may be exhaled by the user of the apparatus 10 of the invention but still transmit sound vibrations therethrough from the transducer 36 into the acoustic chamber 27 of the cap portion 16 and into the user&#39;s airways. The mouthpiece 24 may be a separate piece physically attached to the exterior of the cap portion 16. In this case, the ribs 27 may frictionally grip or be adhesively bonded to the end wall 20 around the aperture 22. Alternatively, the cap portion 16 and the mouthpiece 24 may be formed as a one piece molded structure. In this instance, the inside surface of the cap portion 16 and mouthpiece 24, together with the cone of the transducer 36, define the coupling chamber 27. The mouthpiece 24 as shown in FIGS. 1, 2, and 3A may be either separately formed or may be integrally molded into the cap portion 16. Since the diaphragm 48 is elastic, supple and flexible, its presence is virtually transparent to the sound transmission from the transducer 36 through the sonic coupling chamber 27 into the patient&#39;s airways during use. The transducer 36 is preferably sized so that the outer diameter of the cone 37 is approximately the same as the internal diameter of the tubular bottom portion 14. The transducer 36 nests in the tubular bottom portion 14 and the cone faces the cap portion 16 and the diaphragm 48. The transducer preferably is of a compact, high efficiency design so as to minimize power drain. The space behind and around the rear of the transducer cone 37 in the base portion 14 of the housing 12 is preferably filled with a sound absorptive material 39. This sound dampening material 39 may be a fibrous batting such as cotton, etc. The purpose of this material 39 is to prevent substantive sound transmission outside of the base portion 14 of the housing 12 except forward through the sonic coupling chamber 27 and through the aperture 22 in the mouthpiece 24 into the patient&#39;s airways and lungs. Thus the material 39 dissipates resonances in the cavity behind the transducer cone and absorbs energy from the rear to increase forward sound transmission efficiency. However, the presence of this absorptive damping material has an adverse affect on power consumption. The amplifier output must be increased in order to overcome the drag on the cone 37. It is believed that the power output of the transducer 36 during operation as a speaker should thus preferably be within a range of around 5 to 7 watts in order to maintain efficiency and effectiveness of pulse delivery. A patient breaths fresh air through the passages 26 around the aperture 22 while holding the mouthpiece 24 in his or her mouth. The continuous acoustic waveform or sound pulses emitted by the transducer 36 are focused through the aperture 22 directly into the patient&#39;s airways. Simultaneously, the patient breathes normally through the passages 26 which open to the air external to the chamber 27. Sound is substantially prevented from escaping the housing 12 when the continuous acoustic waveform or sonic pulses are being produced primarily because of the size of the passages 26 and the presence of the damping material 39 behind the transducer 36. Each of the mouthpiece passages 26 has an effective diameter that is much smaller than the predominant wavelengths of the sounds being generated by the transducer 36, on the order of less than 0.5 inch. For example, the wavelength of a 60 hertz sound is 18 feet. The wavelength of a 1000 hertz sound is 1.09 feet, and 10,000 hertz is 0.1 foot. The effective passage diameter for each passage is preferably on the order of 0.050 inches to 0.075 inches, or 0.004 feet, which is preferably at least an order of magnitude smaller than the wavelength of the sound being transmitted. The most effective frequencies of interest are believed to be less than 10,000 hertz. The apparatus 10 in accordance with the invention may, however, have any frequency range. A range between 10 hertz and 10,000 hertz is presently preferred. Users will most likely utilize frequencies between 20 to 300 hertz, as these are the frequencies most often associated with phlegm vibration. For most frequencies of interest, the effective diameter of the breathing passages 26 is thus at least one to two orders of magnitude smaller than the wavelengths of the sounds produced. Since these passages 26 are substantially smaller than the wavelengths of interest, little sound pressure will be lost from the chamber 27 even when their combined effect is considered. However, these passages are important because they permit the user to breath substantially normally while using the apparatus 10. The passages 26 may be located anywhere in or around the walls of the sonic coupling chamber 27. For example, they may alternatively be located in the side wall 18, the end wall 20, or around the mouthpiece 24. The mouthpiece 24 shown in FIGS. 1, 2, and 3A is preferred in the present invention. The size of the passages 26 may also be larger than described above, if other means of preventing substantial loss of acoustic pressure waves is provided. For example, the passages 26 may be partially covered by an integral baffle arrangement molded or otherwise formed within the mouthpiece 24 or the cap portion 16. Other sonic guide and focusing structures may also be provided within cap portion 16 to enhance the sonic pressure pulse transmission into the user&#39;s airways and lungs. As stated above, the space behind the transducer cone 37 is substantially filled with sound damping material 39. The presence of this absorptive material and the lack of holes in the tubular wall of the base portion 14 to equalize pressure requires that net power delivered to the transducer 36 must be increased due to the drag this closed space provides on the transducer cone 37. However, this drag is small compared to the advantage of preventing unwanted noise projection outside of the housing 12. In addition, the damping material 39 increases the forward sound transmission efficiency. Thus, in operation, a person sitting or standing next to the user will barely detect any sound from the apparatus 10 while it is being used. The space between the diaphragm 49 and the transducer 36 is a closed space. However, because the diaphragm 48 is very flexible and resilient, made of preferably a very elastic material such as latex or synthetic rubber, little acoustic attenuation results and the sound pulses effectively are transmitted through the diaphragm unimpeded from the transducer 36 through the coupling chamber 27. The cylindrical wall 18 of the cap portion 16 may optionally be shortened such that it is almost flush with the diaphragm 48. The shape of the end wall 20 may also be other than the funnel shape as shown. A second embodiment 10 of the present invention is shown in FIGS. 4 and 5. This embodiment illustrates one alternative shape variant. The apparatus 100 comprises a hollow housing 12 that has a bottom or base portion 104 and a cap portion 106. The cap portion 106 has a tubular side wall 108 and a funnel shaped end wall 120 having a central aperture 122 and a semi-rigid mouthpiece 124 formed around the aperture 122 designed to be held in the user&#39;s mouth between the teeth. The bottom or base portion 104 has a generally rectangular box portion containing a battery power supply 128 and an acoustic generator comprising a circuit board 130 containing an audio oscillator circuit 132, an audio in amplifier circuit 133, an audio amplifier circuit 134, an analog to digital converter 135, and a digital signal processor 136. The audio amplifiers 133 and 134 are connected to an audio transducer 138. An on/off/mode switch 140, volume control 142, and frequency control 144 are accessible through apertures in the wall 148 of the base portion 104. A repetition rate control 146 is actuated by pressing switches 142 and 144 simultaneously. The audio oscillator/waveform generator circuit 132 generates an acoustic waveform which may be continuous or broken into sonic pulse signals which are in turn fed to the audio amplifier 134 and then to the transducer 138 which generates the actual sounds. The mating ends of the base portion 104 and the tubular cap portion 106 are preferably telescopically joined together as in the first embodiment described above. A replaceable elastic diaphragm 150 is preferably captured between the telescoping ends of the tubular portions 104 and 106. The purpose of the diaphragm 150 is again to act as a biological shield primarily to prevent contaminants from reaching components in the lower tubular portion 104 of the housing 102. Accordingly, the diaphragm 150 may be reusable or disposable. Alternatively, the diaphragm 150 may be integrally formed with the cap portion 106 so as to be disposable as a unit. The cap portion 106, the cone of the transducer 138, and the mouthpiece 124 together define an acoustic coupling chamber 127 which couples the transducer 138 to the user&#39;s airways when the apparatus 100 is placed in a user&#39;s mouth. In the embodiment shown in FIGS. 4 and 5, the diaphragm 150 is preferably stretched over the bottom end of the cap portion 106 and then the cap portion 106 is slipped over the open transducer end of the bottom portion 104. In this way, when the apparatus is disassembled after use, the cap portion 106, diaphragm 150, and mouthpiece 124 are removed as an assembly. The component parts may then be disassembled, cleaned or sterilized, or replaced as in the first embodiment discussed above. Alternatively, the diaphragm 150 may be first installed on the bottom portion 104 and/or the cap portion 106 may alternatively be sized to fit within the open end of the bottom portion 104. The diaphragm 150 may optionally be an annular disk of thin elastic material with a relatively rigid rim which fits snugly within either the cap portion or the bottom portion 104. In any event, the diaphragm 148 is placed so as to shield the transducer cone from any contaminants that may be exhaled by the user of the apparatus of the invention but still transmit sound vibrations therethrough into the cap portion 106. Preferably the mouthpiece 126 is integrally formed with the cap portion 106 as a one piece molded structure. In this instance, the cap portion 106 and mouthpiece 126, together with the cone of the transducer 136, define the coupling chamber 127. Since the diaphragm 150 is elastic, supple and flexible, its presence is virtually transparent to the sound transmission from the transducer 136 through the sonic coupling chamber 127 into the patient&#39;s airways during use. The mouthpiece 126, the cap portion 106 and the diaphragm 150 may be manufactured as a disposable self contained unit rather than being separable into its component parts. The transducer 138 is preferably sized so that the outer diameter of the vibrating cone is approximately the same as the internal diameter of the tubular cap portion 106. The transducer 136 preferably nests in the tubular bottom portion 104 and the cone faces the cap portion 106 and the diaphragm 150 as in the first embodiment. The transducer 138 preferably is of a compact, high efficiency design so as to minimize power drain. The power output of the transducer in this embodiment is generally similar to that of the first embodiment. Thus the effective power output should preferably be in the range of 5 to 7 watts for the same reasons. This power limitation may optionally be designed into the amplifier circuitry to preclude inadvertent over stimulation of sensitive lung tissues. The bottom portion 104 differs from the first embodiment primarily in that it includes a closed rectangular part to house the power supply 128 and printed circuit board 130. This rectangular part of the bottom portion 104 may be a clam shell design that snaps closed. The front part of the bottom portion 104 is shaped to closely enclose the transducer 138. The portion 104 behind the transducer cone is again filled with a sound absorbing material such as cotton batting or foam as in the first embodiment 10. This configuration eliminates or reduces substantially the sound transmitted outside the apparatus 100 during operation of the device. Consequently, power to the transducer or other acoustic transducer 136 must be increased as discussed above to compensate for the power lost in overcoming the damping effect of this closed and at least partially filled volume behind the transducer cone. The space between the diaphragm 150 and the front face of the transducer 136 is also a closed space. However, because the diaphragm 150 is very flexible and resilient, made of preferably a very elastic material such as latex or synthetic rubber, little acoustic attenuation results and the sound pulses effectively are transmitted by the transducer cone through the diaphragm unimpeded from the transducer 136 through the coupling chamber 127. Again, one major advantage of this second embodiment is that the apparatus 100 is very quiet to operate and may be operated by a patient in close proximity to other people without substantially interfering with their activities. The funnel shaped tubular side wall of the cap portion 106 is solid and smoothly curves into the mouthpiece 124. In order for the user to breathe through the sonic coupling chamber 127 while using the apparatus 100 in accordance with this embodiment of the present invention, one or more passages is formed by a segmented annular sleeve 152 supported by and integral with the mouthpiece 124. This sleeve 152 forms a plurality of coaxial passages 154 around the mouthpiece 124 as in the first embodiment which together form a large enough passage to the outside environment for the patient to breath through. Each of the passages 154 has a width of between 1/16 to about 1/8 inch. Each passage 154 width is much smaller than the wavelength of the sounds being generated by the transducer 136. Since the widths are substantially smaller than the acoustic wavelengths of interest, little sound pressure will be lost from the chamber 127 even when their combined effect is considered. The bottom portion 104 differs from the first embodiment 10 in that not only does it have a closed volume behind the transducer 138, the transducer 138 preferably operates as a microphone between active pulses, i.e., between transmitted bursts of sound. The transducer 138 acts as a microphone to produce electrical signals representative of the patient&#39;s breathing sounds and feeds these signals to the amplifier circuit 200 shown in FIG. 5. It has been found that when a patient&#39;s lungs are stimulated with a sound spectrum that substantially corresponds to the sound of the patient&#39;s wheezing, the phlegm causing the wheezing sound is specifically targeted and loosened. It appears that the wheeze sound may be substantially the resonant frequencies of the phlegm and mucus plugs. Consequently, if the resonant frequencies can be sensed and duplicated or targeted, dislodging the phlegm and mucus plugs almost immediately ensues. Therefore, this second embodiment 100 of the apparatus of the invention includes an automatic tone generation/adjustment feature. In addition to having the manually variable pitch and duration controls as described above with reference to the first embodiment, this second embodiment 100 includes a feedback function which senses a parameter indicative of a user&#39;s breathing efficiency and uses the sensed parameter to automatically adjust the output acoustic waveform to optimize the device&#39;s affect on the monitored parameter. The monitored parameter, in the illustrated second embodiment, is preferably the sound produced by the user during breathing. This second embodiment 100 includes an audio in amplifier 133 connected to the transducer 138 which receives and amplifies sound signals received from the transducer 138, for example, in the pulse mode, when the transducer is between pulses, i.e. when the transducer 138 is &#34;listening&#34;. The audio amplifier 133 is connected to the ADC 135 which is in turn connected to the DSP 136. The DSP 136 is connected through the off/on/mode switch 140 to the acoustic waveform generator 132. Alternatively, the DSP l36 may be used to digitally directly generate the acoustic waveform. In this instance it may be connected directly to the audio amplifier 134 as shown by the dashed line 168 in FIG. 5. The DSP 136 may be utilized to detect the sound of a patient&#39;s breathing even during transmission of the acoustic waveform to the user via digital sampling techniques to cancel out the transmitted waveform, which unmasks the user&#39;s breathing sounds. During or between pulses, and preferably whenever the apparatus 100 is on but not generating an acoustic waveform, the transducer 138 senses the patient&#39;s breathing sounds. The DSP 136 processes these sound signals and produces a feedback signal to the oscillator/pulse generator 132 to produce an output sonic waveform that closely matches in frequencies the respiration sound from the patient. This automatic frequency adjustment or matching may be turned on and off by the user/patient preferably via operation of the switch The apparatus 100 may alternatively utilize a separate microphone 162, as shown dotted in FIG. 5, rather than the transducer 130. In addition, the embodiment 100 may include detection of separate parameters which may have a bearing on the success of the therapeutic apparatus of the present invention. For example, the input amplifier 133 or the signal processor 136 may be connected to an external parameter sensor such as a blood oxygen sensor 164 or an ultrasonic sensor 166. In the former instance, the volume, pitch and/or frequency spectrum output of the transducer 138 may be optimized to achieve maximum blood oxygen levels. In this case, the frequencies and pulse durations produced by the apparatus 100 would be varied by the signal processor 136 in a predetermined pattern or sequence until the optimum level of oxygen is sensed. Similarly, if an ultrasonic sensor is utilized, the sensor 166 may be utilized to first identify any signatures of mucus plugs present in the user&#39;s lungs via &#34;listening&#34; to the user&#39;s breathing sounds; second, initiating generation of a predetermined &#34;hunting&#34; sequence of acoustic waveforms and then third, monitoring the mucus plug signatures to detect a change in the signature during the hunting sequence. Such a change in mucus plug signature is believed to occur when the generated waveform closely matches to the resonant frequency or frequencies of the mucus plug. Finally, the sensed change in ultrasound signature is used to cause the acoustic generator to stop the predetermined sequence and reproduce the waveform that caused the signature change until the plug is loosened and the user coughs up the mucus plug. This hunting process may then be repeated until no further ultrasonic signatures or signature changes are detected. The major advantage of this second embodiment is that it can automatically &#34;zero in&#34; on the resonant frequencies of the obstructions to efficient breathing and thereby optimize efficient loosening of mucus plugs and phlegm. Further, the apparatus 100 is very quiet to operate and may be operated without the patient consciously monitoring and manipulating its operation. In addition, it may be operated by the patient in close proximity to other people without substantially interfering with their activities. The embodiments 10 and 100 may be constructed otherwise than as specifically disclosed above and shown with a reference to examples of preferred embodiments of the invention. Many changes, alterations and modifications may be made without departing from the scope of the invention. For example, the apparatus 10 is shown in a generally cylindrical housing. Other shapes may be utilized as well such as the combination shown in FIG. 4. The housing may also be telescopically expandable to provide an optimum coupling volume in a particular application or the housing may have an oval cross section or other cross sectional shape. A telescopically adjustable cap portion 16 with respect to base portion 14 would permit the sonic coupling chamber 27 to be tuned to various resonant frequencies in order to achieve optimum sonic pressure pulse delivery to the patient. The mouthpiece 24, end wall 22 and side wall 18 may be molded as an integral single unit. The bottom portion 14 may be much more compactly arranged and all components may be packaged with a rechargeable power supply rather than a battery pack or line cord. Also, the base portion 14 may include an integral pistol grip or other ergonomically desirable shape for the user to grasp during use. Accordingly, the invention is intended to encompass all such variations as will be readily apparent to those skilled in the art and is not limited to the embodiment shown and described above.

Summary: An active respiratory therapeutic device and method for actively loosening and breaking up mucus plugs and phlegm in a user&#39;s trachea and bronchial passages and lungs while a user is breathing normally through the device comprises a housing containing a base portion and a cap portion forming at least a portion of a sonic coupling chamber adapted to be held in a patient&#39;s mouth during normal breathing activity. The cap portion also includes breathing passages out of the chamber so that the user can breath normally through device during operation. The base portion contains an acoustic generator behind a sanitary flexible diaphragm separating the portions. The acoustic generator produces an audio waveform which may be controlled by the user or automatically controlled by a feedback signal to optimize a sensed parameter indicative of the user&#39;s breathing efficiency such as the sound of the user&#39;s exhaled breath, blood oxygen levels, or ultrasonic signature changes of mucus plugs. This feedback signal senses a patient parameter and automatically adjust the operating frequency spectrum and/or pulse rate of the device to optimally affect the monitored parameter such as the user&#39;s breathing efficiency. The method of the invention basically comprises determining a resonant frequency of a mucus plug, generating an acoustic waveform including the resonant frequency and directing the waveform into a user&#39;s airways to loosen the plug while the user breathes through his or her airways.

big_patent

en

Summarize: XVII. One Night Never did the sun go down with a brighter glory on the quiet corner in Soho, than one memorable evening when the Doctor and his daughter sat under the plane-tree together. Never did the moon rise with a milder radiance over great London, than on that night when it found them still seated under the tree, and shone upon their faces through its leaves. Lucie was to be married to-morrow. She had reserved this last evening for her father, and they sat alone under the plane-tree. "You are happy, my dear father?" "Quite, my child." They had said little, though they had been there a long time. When it was yet light enough to work and read, she had neither engaged herself in her usual work, nor had she read to him. She had employed herself in both ways, at his side under the tree, many and many a time; but, this time was not quite like any other, and nothing could make it so. "And I am very happy to-night, dear father. I am deeply happy in the love that Heaven has so blessed--my love for Charles, and Charles's love for me. But, if my life were not to be still consecrated to you, or if my marriage were so arranged as that it would part us, even by the length of a few of these streets, I should be more unhappy and self-reproachful now than I can tell you. Even as it is--" Even as it was, she could not command her voice. In the sad moonlight, she clasped him by the neck, and laid her face upon his breast. In the moonlight which is always sad, as the light of the sun itself is--as the light called human life is--at its coming and its going. "Dearest dear! Can you tell me, this last time, that you feel quite, quite sure, no new affections of mine, and no new duties of mine, will ever interpose between us? _I_ know it well, but do you know it? In your own heart, do you feel quite certain?" Her father answered, with a cheerful firmness of conviction he could scarcely have assumed, "Quite sure, my darling! More than that," he added, as he tenderly kissed her: "my future is far brighter, Lucie, seen through your marriage, than it could have been--nay, than it ever was--without it." "If I could hope _that_, my father!--" "Believe it, love! Indeed it is so. Consider how natural and how plain it is, my dear, that it should be so. You, devoted and young, cannot fully appreciate the anxiety I have felt that your life should not be wasted--" She moved her hand towards his lips, but he took it in his, and repeated the word. "--wasted, my child--should not be wasted, struck aside from the natural order of things--for my sake. Your unselfishness cannot entirely comprehend how much my mind has gone on this; but, only ask yourself, how could my happiness be perfect, while yours was incomplete?" "If I had never seen Charles, my father, I should have been quite happy with you." He smiled at her unconscious admission that she would have been unhappy without Charles, having seen him; and replied: "My child, you did see him, and it is Charles. If it had not been Charles, it would have been another. Or, if it had been no other, I should have been the cause, and then the dark part of my life would have cast its shadow beyond myself, and would have fallen on you." It was the first time, except at the trial, of her ever hearing him refer to the period of his suffering. It gave her a strange and new sensation while his words were in her ears; and she remembered it long afterwards. "See!" said the Doctor of Beauvais, raising his hand towards the moon. "I have looked at her from my prison-window, when I could not bear her light. I have looked at her when it has been such torture to me to think of her shining upon what I had lost, that I have beaten my head against my prison-walls. I have looked at her, in a state so dull and lethargic, that I have thought of nothing but the number of horizontal lines I could draw across her at the full, and the number of perpendicular lines with which I could intersect them." He added in his inward and pondering manner, as he looked at the moon, "It was twenty either way, I remember, and the twentieth was difficult to squeeze in." The strange thrill with which she heard him go back to that time, deepened as he dwelt upon it; but, there was nothing to shock her in the manner of his reference. He only seemed to contrast his present cheerfulness and felicity with the dire endurance that was over. "I have looked at her, speculating thousands of times upon the unborn child from whom I had been rent. Whether it was alive. Whether it had been born alive, or the poor mother's shock had killed it. Whether it was a son who would some day avenge his father. (There was a time in my imprisonment, when my desire for vengeance was unbearable.) Whether it was a son who would never know his father's story; who might even live to weigh the possibility of his father's having disappeared of his own will and act. Whether it was a daughter who would grow to be a woman." She drew closer to him, and kissed his cheek and his hand. "I have pictured my daughter, to myself, as perfectly forgetful of me--rather, altogether ignorant of me, and unconscious of me. I have cast up the years of her age, year after year. I have seen her married to a man who knew nothing of my fate. I have altogether perished from the remembrance of the living, and in the next generation my place was a blank." "My father! Even to hear that you had such thoughts of a daughter who never existed, strikes to my heart as if I had been that child." "You, Lucie? It is out of the Consolation and restoration you have brought to me, that these remembrances arise, and pass between us and the moon on this last night.--What did I say just now?" "She knew nothing of you. She cared nothing for you." "So! But on other moonlight nights, when the sadness and the silence have touched me in a different way--have affected me with something as like a sorrowful sense of peace, as any emotion that had pain for its foundations could--I have imagined her as coming to me in my cell, and leading me out into the freedom beyond the fortress. I have seen her image in the moonlight often, as I now see you; except that I never held her in my arms; it stood between the little grated window and the door. But, you understand that that was not the child I am speaking of?" "The figure was not; the--the--image; the fancy?" "No. That was another thing. It stood before my disturbed sense of sight, but it never moved. The phantom that my mind pursued, was another and more real child. Of her outward appearance I know no more than that she was like her mother. The other had that likeness too--as you have--but was not the same. Can you follow me, Lucie? Hardly, I think? I doubt you must have been a solitary prisoner to understand these perplexed distinctions." His collected and calm manner could not prevent her blood from running cold, as he thus tried to anatomise his old condition. "In that more peaceful state, I have imagined her, in the moonlight, coming to me and taking me out to show me that the home of her married life was full of her loving remembrance of her lost father. My picture was in her room, and I was in her prayers. Her life was active, cheerful, useful; but my poor history pervaded it all." "I was that child, my father, I was not half so good, but in my love that was I." "And she showed me her children," said the Doctor of Beauvais, "and they had heard of me, and had been taught to pity me. When they passed a prison of the State, they kept far from its frowning walls, and looked up at its bars, and spoke in whispers. She could never deliver me; I imagined that she always brought me back after showing me such things. But then, blessed with the relief of tears, I fell upon my knees, and blessed her." "I am that child, I hope, my father. O my dear, my dear, will you bless me as fervently to-morrow?" "Lucie, I recall these old troubles in the reason that I have to-night for loving you better than words can tell, and thanking God for my great happiness. My thoughts, when they were wildest, never rose near the happiness that I have known with you, and that we have before us." He embraced her, solemnly commended her to Heaven, and humbly thanked Heaven for having bestowed her on him. By-and-bye, they went into the house. There was no one bidden to the marriage but Mr. Lorry; there was even to be no bridesmaid but the gaunt Miss Pross. The marriage was to make no change in their place of residence; they had been able to extend it, by taking to themselves the upper rooms formerly belonging to the apocryphal invisible lodger, and they desired nothing more. Doctor Manette was very cheerful at the little supper. They were only three at table, and Miss Pross made the third. He regretted that Charles was not there; was more than half disposed to object to the loving little plot that kept him away; and drank to him affectionately. So, the time came for him to bid Lucie good night, and they separated. But, in the stillness of the third hour of the morning, Lucie came downstairs again, and stole into his room; not free from unshaped fears, beforehand. All things, however, were in their places; all was quiet; and he lay asleep, his white hair picturesque on the untroubled pillow, and his hands lying quiet on the coverlet. She put her needless candle in the shadow at a distance, crept up to his bed, and put her lips to his; then, leaned over him, and looked at him. Into his handsome face, the bitter waters of captivity had worn; but, he covered up their tracks with a determination so strong, that he held the mastery of them even in his sleep. A more remarkable face in its quiet, resolute, and guarded struggle with an unseen assailant, was not to be beheld in all the wide dominions of sleep, that night. She timidly laid her hand on his dear breast, and put up a prayer that she might ever be as true to him as her love aspired to be, and as his sorrows deserved. Then, she withdrew her hand, and kissed his lips once more, and went away. So, the sunrise came, and the shadows of the leaves of the plane-tree moved upon his face, as softly as her lips had moved in praying for him. XVIII. Nine Days The marriage-day was shining brightly, and they were ready outside the closed door of the Doctor's room, where he was speaking with Charles Darnay. They were ready to go to church; the beautiful bride, Mr. Lorry, and Miss Pross--to whom the event, through a gradual process of reconcilement to the inevitable, would have been one of absolute bliss, but for the yet lingering consideration that her brother Solomon should have been the bridegroom. "And so," said Mr. Lorry, who could not sufficiently admire the bride, and who had been moving round her to take in every point of her quiet, pretty dress; "and so it was for this, my sweet Lucie, that I brought you across the Channel, such a baby! Lord bless me! How little I thought what I was doing! How lightly I valued the obligation I was conferring on my friend Mr. Charles!" "You didn't mean it," remarked the matter-of-fact Miss Pross, "and therefore how could you know it? Nonsense!" "Really? Well; but don't cry," said the gentle Mr. Lorry. "I am not crying," said Miss Pross; "_you_ are." "I, my Pross?" (By this time, Mr. Lorry dared to be pleasant with her, on occasion.) "You were, just now; I saw you do it, and I don't wonder at it. Such a present of plate as you have made 'em, is enough to bring tears into anybody's eyes. There's not a fork or a spoon in the collection," said Miss Pross, "that I didn't cry over, last night after the box came, till I couldn't see it." "I am highly gratified," said Mr. Lorry, "though, upon my honour, I had no intention of rendering those trifling articles of remembrance invisible to any one. Dear me! This is an occasion that makes a man speculate on all he has lost. Dear, dear, dear! To think that there might have been a Mrs. Lorry, any time these fifty years almost!" "Not at all!" From Miss Pross. "You think there never might have been a Mrs. Lorry?" asked the gentleman of that name. "Pooh!" rejoined Miss Pross; "you were a bachelor in your cradle." "Well!" observed Mr. Lorry, beamingly adjusting his little wig, "that seems probable, too." "And you were cut out for a bachelor," pursued Miss Pross, "before you were put in your cradle." "Then, I think," said Mr. Lorry, "that I was very unhandsomely dealt with, and that I ought to have had a voice in the selection of my pattern. Enough! Now, my dear Lucie," drawing his arm soothingly round her waist, "I hear them moving in the next room, and Miss Pross and I, as two formal folks of business, are anxious not to lose the final opportunity of saying something to you that you wish to hear. You leave your good father, my dear, in hands as earnest and as loving as your own; he shall be taken every conceivable care of; during the next fortnight, while you are in Warwickshire and thereabouts, even Tellson's shall go to the wall (comparatively speaking) before him. And when, at the fortnight's end, he comes to join you and your beloved husband, on your other fortnight's trip in Wales, you shall say that we have sent him to you in the best health and in the happiest frame. Now, I hear Somebody's step coming to the door. Let me kiss my dear girl with an old-fashioned bachelor blessing, before Somebody comes to claim his own." For a moment, he held the fair face from him to look at the well-remembered expression on the forehead, and then laid the bright golden hair against his little brown wig, with a genuine tenderness and delicacy which, if such things be old-fashioned, were as old as Adam. The door of the Doctor's room opened, and he came out with Charles Darnay. He was so deadly pale--which had not been the case when they went in together--that no vestige of colour was to be seen in his face. But, in the composure of his manner he was unaltered, except that to the shrewd glance of Mr. Lorry it disclosed some shadowy indication that the old air of avoidance and dread had lately passed over him, like a cold wind. He gave his arm to his daughter, and took her down-stairs to the chariot which Mr. Lorry had hired in honour of the day. The rest followed in another carriage, and soon, in a neighbouring church, where no strange eyes looked on, Charles Darnay and Lucie Manette were happily married. Besides the glancing tears that shone among the smiles of the little group when it was done, some diamonds, very bright and sparkling, glanced on the bride's hand, which were newly released from the dark obscurity of one of Mr. Lorry's pockets. They returned home to breakfast, and all went well, and in due course the golden hair that had mingled with the poor shoemaker's white locks in the Paris garret, were mingled with them again in the morning sunlight, on the threshold of the door at parting. It was a hard parting, though it was not for long. But her father cheered her, and said at last, gently disengaging himself from her enfolding arms, "Take her, Charles! She is yours!" And her agitated hand waved to them from a chaise window, and she was gone. The corner being out of the way of the idle and curious, and the preparations having been very simple and few, the Doctor, Mr. Lorry, and Miss Pross, were left quite alone. It was when they turned into the welcome shade of the cool old hall, that Mr. Lorry observed a great change to have come over the Doctor; as if the golden arm uplifted there, had struck him a poisoned blow. He had naturally repressed much, and some revulsion might have been expected in him when the occasion for repression was gone. But, it was the old scared lost look that troubled Mr. Lorry; and through his absent manner of clasping his head and drearily wandering away into his own room when they got up-stairs, Mr. Lorry was reminded of Defarge the wine-shop keeper, and the starlight ride. "I think," he whispered to Miss Pross, after anxious consideration, "I think we had best not speak to him just now, or at all disturb him. I must look in at Tellson's; so I will go there at once and come back presently. Then, we will take him a ride into the country, and dine there, and all will be well." It was easier for Mr. Lorry to look in at Tellson's, than to look out of Tellson's. He was detained two hours. When he came back, he ascended the old staircase alone, having asked no question of the servant; going thus into the Doctor's rooms, he was stopped by a low sound of knocking. "Good God!" he said, with a start. "What's that?" Miss Pross, with a terrified face, was at his ear. "O me, O me! All is lost!" cried she, wringing her hands. "What is to be told to Ladybird? He doesn't know me, and is making shoes!" Mr. Lorry said what he could to calm her, and went himself into the Doctor's room. The bench was turned towards the light, as it had been when he had seen the shoemaker at his work before, and his head was bent down, and he was very busy. "Doctor Manette. My dear friend, Doctor Manette!" The Doctor looked at him for a moment--half inquiringly, half as if he were angry at being spoken to--and bent over his work again. He had laid aside his coat and waistcoat; his shirt was open at the throat, as it used to be when he did that work; and even the old haggard, faded surface of face had come back to him. He worked hard--impatiently--as if in some sense of having been interrupted. Mr. Lorry glanced at the work in his hand, and observed that it was a shoe of the old size and shape. He took up another that was lying by him, and asked what it was. "A young lady's walking shoe," he muttered, without looking up. "It ought to have been finished long ago. Let it be." "But, Doctor Manette. Look at me!" He obeyed, in the old mechanically submissive manner, without pausing in his work. "You know me, my dear friend? Think again. This is not your proper occupation. Think, dear friend!" Nothing would induce him to speak more. He looked up, for an instant at a time, when he was requested to do so; but, no persuasion would extract a word from him. He worked, and worked, and worked, in silence, and words fell on him as they would have fallen on an echoless wall, or on the air. The only ray of hope that Mr. Lorry could discover, was, that he sometimes furtively looked up without being asked. In that, there seemed a faint expression of curiosity or perplexity--as though he were trying to reconcile some doubts in his mind. Two things at once impressed themselves on Mr. Lorry, as important above all others; the first, that this must be kept secret from Lucie; the second, that it must be kept secret from all who knew him. In conjunction with Miss Pross, he took immediate steps towards the latter precaution, by giving out that the Doctor was not well, and required a few days of complete rest. In aid of the kind deception to be practised on his daughter, Miss Pross was to write, describing his having been called away professionally, and referring to an imaginary letter of two or three hurried lines in his own hand, represented to have been addressed to her by the same post. These measures, advisable to be taken in any case, Mr. Lorry took in the hope of his coming to himself. If that should happen soon, he kept another course in reserve; which was, to have a certain opinion that he thought the best, on the Doctor's case. In the hope of his recovery, and of resort to this third course being thereby rendered practicable, Mr. Lorry resolved to watch him attentively, with as little appearance as possible of doing so. He therefore made arrangements to absent himself from Tellson's for the first time in his life, and took his post by the window in the same room. He was not long in discovering that it was worse than useless to speak to him, since, on being pressed, he became worried. He abandoned that attempt on the first day, and resolved merely to keep himself always before him, as a silent protest against the delusion into which he had fallen, or was falling. He remained, therefore, in his seat near the window, reading and writing, and expressing in as many pleasant and natural ways as he could think of, that it was a free place. Doctor Manette took what was given him to eat and drink, and worked on, that first day, until it was too dark to see--worked on, half an hour after Mr. Lorry could not have seen, for his life, to read or write. When he put his tools aside as useless, until morning, Mr. Lorry rose and said to him: "Will you go out?" He looked down at the floor on either side of him in the old manner, looked up in the old manner, and repeated in the old low voice: "Out?" "Yes; for a walk with me. Why not?" He made no effort to say why not, and said not a word more. But, Mr. Lorry thought he saw, as he leaned forward on his bench in the dusk, with his elbows on his knees and his head in his hands, that he was in some misty way asking himself, "Why not?" The sagacity of the man of business perceived an advantage here, and determined to hold it. Miss Pross and he divided the night into two watches, and observed him at intervals from the adjoining room. He paced up and down for a long time before he lay down; but, when he did finally lay himself down, he fell asleep. In the morning, he was up betimes, and went straight to his bench and to work. On this second day, Mr. Lorry saluted him cheerfully by his name, and spoke to him on topics that had been of late familiar to them. He returned no reply, but it was evident that he heard what was said, and that he thought about it, however confusedly. This encouraged Mr. Lorry to have Miss Pross in with her work, several times during the day; at those times, they quietly spoke of Lucie, and of her father then present, precisely in the usual manner, and as if there were nothing amiss. This was done without any demonstrative accompaniment, not long enough, or often enough to harass him; and it lightened Mr. Lorry's friendly heart to believe that he looked up oftener, and that he appeared to be stirred by some perception of inconsistencies surrounding him. When it fell dark again, Mr. Lorry asked him as before: "Dear Doctor, will you go out?" As before, he repeated, "Out?" "Yes; for a walk with me. Why not?" This time, Mr. Lorry feigned to go out when he could extract no answer from him, and, after remaining absent for an hour, returned. In the meanwhile, the Doctor had removed to the seat in the window, and had sat there looking down at the plane-tree; but, on Mr. Lorry's return, he slipped away to his bench. The time went very slowly on, and Mr. Lorry's hope darkened, and his heart grew heavier again, and grew yet heavier and heavier every day. The third day came and went, the fourth, the fifth. Five days, six days, seven days, eight days, nine days. With a hope ever darkening, and with a heart always growing heavier and heavier, Mr. Lorry passed through this anxious time. The secret was well kept, and Lucie was unconscious and happy; but he could not fail to observe that the shoemaker, whose hand had been a little out at first, was growing dreadfully skilful, and that he had never been so intent on his work, and that his hands had never been so nimble and expert, as in the dusk of the ninth evening. XIX. An Opinion Worn out by anxious watching, Mr. Lorry fell asleep at his post. On the tenth morning of his suspense, he was startled by the shining of the sun into the room where a heavy slumber had overtaken him when it was dark night. He rubbed his eyes and roused himself; but he doubted, when he had done so, whether he was not still asleep. For, going to the door of the Doctor's room and looking in, he perceived that the shoemaker's bench and tools were put aside again, and that the Doctor himself sat reading at the window. He was in his usual morning dress, and his face (which Mr. Lorry could distinctly see), though still very pale, was calmly studious and attentive. Even when he had satisfied himself that he was awake, Mr. Lorry felt giddily uncertain for some few moments whether the late shoemaking might not be a disturbed dream of his own; for, did not his eyes show him his friend before him in his accustomed clothing and aspect, and employed as usual; and was there any sign within their range, that the change of which he had so strong an impression had actually happened? It was but the inquiry of his first confusion and astonishment, the answer being obvious. If the impression were not produced by a real corresponding and sufficient cause, how came he, Jarvis Lorry, there? How came he to have fallen asleep, in his clothes, on the sofa in Doctor Manette's consulting-room, and to be debating these points outside the Doctor's bedroom door in the early morning? Within a few minutes, Miss Pross stood whispering at his side. If he had had any particle of doubt left, her talk would of necessity have resolved it; but he was by that time clear-headed, and had none. He advised that they should let the time go by until the regular breakfast-hour, and should then meet the Doctor as if nothing unusual had occurred. If he appeared to be in his customary state of mind, Mr. Lorry would then cautiously proceed to seek direction and guidance from the opinion he had been, in his anxiety, so anxious to obtain. Miss Pross, submitting herself to his judgment, the scheme was worked out with care. Having abundance of time for his usual methodical toilette, Mr. Lorry presented himself at the breakfast-hour in his usual white linen, and with his usual neat leg. The Doctor was summoned in the usual way, and came to breakfast. So far as it was possible to comprehend him without overstepping those delicate and gradual approaches which Mr. Lorry felt to be the only safe advance, he at first supposed that his daughter's marriage had taken place yesterday. An incidental allusion, purposely thrown out, to the day of the week, and the day of the month, set him thinking and counting, and evidently made him uneasy. In all other respects, however, he was so composedly himself, that Mr. Lorry determined to have the aid he sought. And that aid was his own. Therefore, when the breakfast was done and cleared away, and he and the Doctor were left together, Mr. Lorry said, feelingly: "My dear Manette, I am anxious to have your opinion, in confidence, on a very curious case in which I am deeply interested; that is to say, it is very curious to me; perhaps, to your better information it may be less so." Glancing at his hands, which were discoloured by his late work, the Doctor looked troubled, and listened attentively. He had already glanced at his hands more than once. "Doctor Manette," said Mr. Lorry, touching him affectionately on the arm, "the case is the case of a particularly dear friend of mine. Pray give your mind to it, and advise me well for his sake--and above all, for his daughter's--his daughter's, my dear Manette." "If I understand," said the Doctor, in a subdued tone, "some mental shock--?" "Yes!" "Be explicit," said the Doctor. "Spare no detail." Mr. Lorry saw that they understood one another, and proceeded. "My dear Manette, it is the case of an old and a prolonged shock, of great acuteness and severity to the affections, the feelings, the--the--as you express it--the mind. The mind. It is the case of a shock under which the sufferer was borne down, one cannot say for how long, because I believe he cannot calculate the time himself, and there are no other means of getting at it. It is the case of a shock from which the sufferer recovered, by a process that he cannot trace himself--as I once heard him publicly relate in a striking manner. It is the case of a shock from which he has recovered, so completely, as to be a highly intelligent man, capable of close application of mind, and great exertion of body, and of constantly making fresh additions to his stock of knowledge, which was already very large. But, unfortunately, there has been," he paused and took a deep breath--"a slight relapse." The Doctor, in a low voice, asked, "Of how long duration?" "Nine days and nights." "How did it show itself? I infer," glancing at his hands again, "in the resumption of some old pursuit connected with the shock?" "That is the fact." "Now, did you ever see him," asked the Doctor, distinctly and collectedly, though in the same low voice, "engaged in that pursuit originally?" "Once." "And when the relapse fell on him, was he in most respects--or in all respects--as he was then?" "I think in all respects." "You spoke of his daughter. Does his daughter know of the relapse?" "No. It has been kept from her, and I hope will always be kept from her. It is known only to myself, and to one other who may be trusted." The Doctor grasped his hand, and murmured, "That was very kind. That was very thoughtful!" Mr. Lorry grasped his hand in return, and neither of the two spoke for a little while. "Now, my dear Manette," said Mr. Lorry, at length, in his most considerate and most affectionate way, "I am a mere man of business, and unfit to cope with such intricate and difficult matters. I do not possess the kind of information necessary; I do not possess the kind of intelligence; I want guiding. There is no man in this world on whom I could so rely for right guidance, as on you. Tell me, how does this relapse come about? Is there danger of another? Could a repetition of it be prevented? How should a repetition of it be treated? How does it come about at all? What can I do for my friend? No man ever can have been more desirous in his heart to serve a friend, than I am to serve mine, if I knew how. "But I don't know how to originate, in such a case. If your sagacity, knowledge, and experience, could put me on the right track, I might be able to do so much; unenlightened and undirected, I can do so little. Pray discuss it with me; pray enable me to see it a little more clearly, and teach me how to be a little more useful." Doctor Manette sat meditating after these earnest words were spoken, and Mr. Lorry did not press him. "I think it probable," said the Doctor, breaking silence with an effort, "that the relapse you have described, my dear friend, was not quite unforeseen by its subject." "Was it dreaded by him?" Mr. Lorry ventured to ask. "Very much." He said it with an involuntary shudder. "You have no idea how such an apprehension weighs on the sufferer's mind, and how difficult--how almost impossible--it is, for him to force himself to utter a word upon the topic that oppresses him." "Would he," asked Mr. Lorry, "be sensibly relieved if he could prevail upon himself to impart that secret brooding to any one, when it is on him?" "I think so. But it is, as I have told you, next to impossible. I even believe it--in some cases--to be quite impossible." "Now," said Mr. Lorry, gently laying his hand on the Doctor's arm again, after a short silence on both sides, "to what would you refer this attack?" "I believe," returned Doctor Manette, "that there had been a strong and extraordinary revival of the train of thought and remembrance that was the first cause of the malady. Some intense associations of a most distressing nature were vividly recalled, I think. It is probable that there had long been a dread lurking in his mind, that those associations would be recalled--say, under certain circumstances--say, on a particular occasion. He tried to prepare himself in vain; perhaps the effort to prepare himself made him less able to bear it." "Would he remember what took place in the relapse?" asked Mr. Lorry, with natural hesitation. The Doctor looked desolately round the room, shook his head, and answered, in a low voice, "Not at all." "Now, as to the future," hinted Mr. Lorry. "As to the future," said the Doctor, recovering firmness, "I should have great hope. As it pleased Heaven in its mercy to restore him so soon, I should have great hope. He, yielding under the pressure of a complicated something, long dreaded and long vaguely foreseen and contended against, and recovering after the cloud had burst and passed, I should hope that the worst was over." "Well, well! That's good comfort. I am thankful!" said Mr. Lorry. "I am thankful!" repeated the Doctor, bending his head with reverence. "There are two other points," said Mr. Lorry, "on which I am anxious to be instructed. I may go on?" "You cannot do your friend a better service." The Doctor gave him his hand. "To the first, then. He is of a studious habit, and unusually energetic; he applies himself with great ardour to the acquisition of professional knowledge, to the conducting of experiments, to many things. Now, does he do too much?" "I think not. It may be the character of his mind, to be always in singular need of occupation. That may be, in part, natural to it; in part, the result of affliction. The less it was occupied with healthy things, the more it would be in danger of turning in the unhealthy direction. He may have observed himself, and made the discovery." "You are sure that he is not under too great a strain?" "I think I am quite sure of it." "My dear Manette, if he were overworked now--" "My dear Lorry, I doubt if that could easily be. There has been a violent stress in one direction, and it needs a counterweight." "Excuse me, as a persistent man of business. Assuming for a moment, that he _was_ overworked; it would show itself in some renewal of this disorder?" "I do not think so. I do not think," said Doctor Manette with the firmness of self-conviction, "that anything but the one train of association would renew it. I think that, henceforth, nothing but some extraordinary jarring of that chord could renew it. After what has happened, and after his recovery, I find it difficult to imagine any such violent sounding of that string again. I trust, and I almost believe, that the circumstances likely to renew it are exhausted." He spoke with the diffidence of a man who knew how slight a thing would overset the delicate organisation of the mind, and yet with the confidence of a man who had slowly won his assurance out of personal endurance and distress. It was not for his friend to abate that confidence. He professed himself more relieved and encouraged than he really was, and approached his second and last point. He felt it to be the most difficult of all; but, remembering his old Sunday morning conversation with Miss Pross, and remembering what he had seen in the last nine days, he knew that he must face it. "The occupation resumed under the influence of this passing affliction so happily recovered from," said Mr. Lorry, clearing his throat, "we will call--Blacksmith's work, Blacksmith's work. We will say, to put a case and for the sake of illustration, that he had been used, in his bad time, to work at a little forge. We will say that he was unexpectedly found at his forge again. Is it not a pity that he should keep it by him?" The Doctor shaded his forehead with his hand, and beat his foot nervously on the ground. "He has always kept it by him," said Mr. Lorry, with an anxious look at his friend. "Now, would it not be better that he should let it go?" Still, the Doctor, with shaded forehead, beat his foot nervously on the ground. "You do not find it easy to advise me?" said Mr. Lorry. "I quite understand it to be a nice question. And yet I think--" And there he shook his head, and stopped. "You see," said Doctor Manette, turning to him after an uneasy pause, "it is very hard to explain, consistently, the innermost workings of this poor man's mind. He once yearned so frightfully for that occupation, and it was so welcome when it came; no doubt it relieved his pain so much, by substituting the perplexity of the fingers for the perplexity of the brain, and by substituting, as he became more practised, the ingenuity of the hands, for the ingenuity of the mental torture; that he has never been able to bear the thought of putting it quite out of his reach. Even now, when I believe he is more hopeful of himself than he has ever been, and even speaks of himself with a kind of confidence, the idea that he might need that old employment, and not find it, gives him a sudden sense of terror, like that which one may fancy strikes to the heart of a lost child." He looked like his illustration, as he raised his eyes to Mr. Lorry's face. "But may not--mind! I ask for information, as a plodding man of business who only deals with such material objects as guineas, shillings, and bank-notes--may not the retention of the thing involve the retention of the idea? If the thing were gone, my dear Manette, might not the fear go with it? In short, is it not a concession to the misgiving, to keep the forge?" There was another silence. "You see, too," said the Doctor, tremulously, "it is such an old companion." "I would not keep it," said Mr. Lorry, shaking his head; for he gained in firmness as he saw the Doctor disquieted. "I would recommend him to sacrifice it. I only want your authority. I am sure it does no good. Come! Give me your authority, like a dear good man. For his daughter's sake, my dear Manette!" Very strange to see what a struggle there was within him! "In her name, then, let it be done; I sanction it. But, I would not take it away while he was present. Let it be removed when he is not there; let him miss his old companion after an absence." Mr. Lorry readily engaged for that, and the conference was ended. They passed the day in the country, and the Doctor was quite restored. On the three following days he remained perfectly well, and on the fourteenth day he went away to join Lucie and her husband. The precaution that had been taken to account for his silence, Mr. Lorry had previously explained to him, and he had written to Lucie in accordance with it, and she had no suspicions. On the night of the day on which he left the house, Mr. Lorry went into his room with a chopper, saw, chisel, and hammer, attended by Miss Pross carrying a light. There, with closed doors, and in a mysterious and guilty manner, Mr. Lorry hacked the shoemaker's bench to pieces, while Miss Pross held the candle as if she were assisting at a murder--for which, indeed, in her grimness, she was no unsuitable figure. The burning of the body (previously reduced to pieces convenient for the purpose) was commenced without delay in the kitchen fire; and the tools, shoes, and leather, were buried in the garden. So wicked do destruction and secrecy appear to honest minds, that Mr. Lorry and Miss Pross, while engaged in the commission of their deed and in the removal of its traces, almost felt, and almost looked, like accomplices in a horrible crime.

Summary: On the eve of Lucie's wedding, she and her father discuss the forthcoming events and Lucie assures her father that her love for Darnay will not interfere with their relationship. He tells her that when he was in prison he would think about the child he had never known, and wondered what her fate would be. He is grateful for the happiness she has brought into his life. As arranged, on the morning of the wedding, Darnay and the Doctor have their private discussion. Lucie and Darnay depart on their two-week honeymoon. Dr. Manette is subdued and Mr. Lorry and Miss Pross take care of him. Mr. Lorry says that he has some important business to take care of, but he will return soon. However, the Doctor suffers a relapse that lasts for ten days. After this time he acts as if nothing has happened and Mr. Lorry suggests that they should dispose of his bench and tools, and the Doctor agrees saying that he does not expect to have any further relapses. The Doctor leaves to join Lucie and Darnay on their trip.

booksum

en

Summarize: Introduction The Department of Defense (DOD) is in the process of realigning and closing military installations. An initial major round of installation realignments and closures occurred in 1988, subsequent rounds followed in 1991 and 1993, and another round is scheduled for 1995. Congress has expressed concern that environmental cleanup issues related to past activities at these installations are significantly affecting DOD’s ability to transfer these properties to local communities. This report focuses on that issue; however, other factors—disagreements between federal agencies, local community interests, and others over reuse plans, as well as revised laws and regulations designed to improve the property disposition process—have also affected property transfers. We have reported separately on these issues for bases closed in the 1988 and 1991 roundsand are reviewing 1993 closing bases now. Background For decades, DOD activities and industrial facilities generated, stored, recycled, and disposed of hazardous waste, which often contaminated nearby soil and groundwater. In many instances, these problems predate existing environmental laws and regulations. Hazardous waste contamination can significantly contribute to serious illness or death or pose a hazard to the environment and is extremely expensive to clean up. Types of hazardous waste found at most DOD installations include solvents and corrosives; paint strippers and thinners; metals, such as lead, cadmium, and chromium; and unexploded ordnance. Contamination usually results from disposal, leaks, or spills. Cleanup goals and strategies are usually site specific and depend upon the cleanup standards, exposure potential, affected population, and nature and extent of contamination. All of these determine the threat to human health and the environment. Cleanup efforts at closing installations are carried out primarily by contractors. DOD gives the highest priority for cleanup to installations on the Environmental Protection Agency’s (EPA) National Priorities List (NPL), a register of the nation’s worst known hazardous waste sites, and to those scheduled to realign and close. Military Installation Closures in 1988, 1991, and 1993 The Defense Authorization Amendments and Base Closure and Realignment Act (P.L. 100-526), enacted on October 24, 1988, established a bipartisan commission to make recommendations to Congress and the Secretary of Defense on base closures and realignments and specified the conditions and authorities to implement these actions. The Defense Base Closure and Realignment Act of 1990 (Part A of title XXIX of P.L. 101-510) also created an independent commission that would meet during calendar years 1991, 1993, and 1995 to review additional installations DOD recommended for realignment and closure. DOD is carrying out the approved installation closures and realignments and is reviewing installations to recommend for realignment and closure for the 1995 round. Figure 1.1 summarizes DOD information on installations and activities designated for closure and realignment in 1988, 1991, and 1993. We have reported separately on the recommendations and processes for each of these rounds. Environmental Cleanup Requirements Federal property that is no longer needed is not automatically sold. The Federal Property and Administrative Services Act of 1949 requires a screening process to determine if property can be transferred to another government or nonprofit agency. DOD first screens excess property for possible use by other DOD agencies and then by other federal agencies. If no federal agency needs the property, it is declared surplus to the federal government and is made available to nonfederal parties, including state agencies, local agencies, agencies caring for homeless people, public benefit agencies, or the general public. Also, federal agencies, including DOD, must comply with environmental laws and regulations when disposing of real property. Pertinent environmental laws include the following: The Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA) (42 U.S.C. 9601), also known as Superfund, authorizes the federal government to respond to spills and other releases or threatened releases of hazardous substances, as well as to leaking hazardous waste dumps. CERCLA provides the framework for responding to contamination problems. It requires that the government warrant that all remedial action necessary to protect human health and the environment has been taken before property is transferred by the United States to any other person or entity, such as communities or private parties. The Resource Conservation and Recovery Act of 1976 (RCRA) (42 U.S.C. 6901) was enacted to ensure that solid wastes are managed in an environmentally sound manner. The Federal Facilities Compliance Act (42 U.S.C. 6901 note) amended RCRA and provides that federal facilities may be subject to federal, state, and local penalties for environmental violations. It also establishes specific requirements for waste generated by the Department of Energy and DOD. The National Environmental Policy Act of 1969 (42 U.S.C. 4321) governs the environmental assessments and impact statement preparation for the disposal and reuse of base closure and realignment installations. CERCLA and RCRA govern much of the environmental and closure-related activities at base realignment and closure, or BRAC, installations. In compliance with CERCLA, EPA reviews DOD information to determine if the installation should be included on the NPL. The CERCLA process consists of several stages and may apply to any waste source and site containing hazardous substances at BRAC installations. (See app. I.) EPA does not have authority to delegate CERCLA enforcement to the states. However, CERCLA does call for substantial involvement by each state in initiating, developing, and selecting remedial actions to be taken. RCRA is designed to ensure that solid waste is managed in an environmentally sound manner and establishes a framework for managing hazardous waste. All BRAC installations are subject to RCRA because of practices that generated, stored, treated, or disposed of hazardous waste. RCRA, as amended in 1992 by the Federal Facilities Compliance Act, directed EPA to conduct annual inspections of federal facilities. RCRA allows EPA to authorize states to conduct equivalent state programs; in these cases, they have the primary responsibility for implementing corrective actions at a base that is designated as a treatment, storage, or disposal facility. States with an authorized hazardous waste program may inspect a federal facility to enforce compliance with state hazardous waste programs. DOD Environmental Cleanup Efforts DOD established the Installation Restoration Program in 1975 to study and clean up contaminated sites. In 1984, this program was made part of the Defense Environmental Restoration Program, and Congress provided funding through the Defense Environmental Restoration Account (DERA). In the 1990 base closure law (P.L 101-510), Congress began providing separate cleanup funding for closing and realigning installations under the BRAC account. In May 1993, DOD created the Under Secretary of Defense (Environmental Security) position to oversee cleanup and other environmental efforts. In July 1993, the administration expressed concern that closing military installations had been cumbersome and slow, with environmental cleanup and other processes taking many years to complete. At that time, it announced a five-part program to help accelerate cleanup and community reuse of closing installations. Objectives, Scope, and Methodology The former Chairman, Subcommittee on Environment, Energy and Natural Resources, House Committee on Government Operations, and Representative George Miller, California, requested us to review DOD’s environmental cleanup efforts at installations being closed under the BRAC process. Specifically, they asked us to review issues related to the (1) cleanup cost, transferability, and reuse of property by nonfederal users and (2) progress, difficulties, and plans to address the problems. We performed work at the Office of Secretary of Defense, military services headquarters, and EPA. To determine costs being estimated for the program, we reviewed DOD’s BRAC budget data, including justification documents submitted to Congress in February 1994. In addition, we observed BRAC cleanup plan (BCP) training sessions held in San Francisco, California, in November 1993. Later, we analyzed cost information in 79 plans prepared by installations with property to be transferred to nonfederal users. (See app. III.) We also visited closing installations and environmental cleanup design and construction management commands to determine how cost data is developed by each of the services. (See app. II.) To determine transferability and reuse, we reviewed BRAC and environmental laws, DOD and EPA headquarters policies and guidance to the military services, and environmental cleanup and reuse programs at BRAC installations. We also reviewed data developed by the services to identify uncontaminated property that would be available for quick transfer. We identified progress and plans to address problems during discussions with DOD and EPA headquarters, DOD design and construction management, and closing base officials, as well with EPA regional officials. In addition, we observed training sessions on DOD’s Fast Track Cleanup program, reviewed data in installations’ BCPs, and visited a number of these installations. Furthermore, we attended meetings of the Defense Environmental Restoration Task Force in Austin, Texas; Philadelphia, Pennsylvania; and Charleston, South Carolina. We also attended several public hearings during visits to installations, including the California Military Base Reuse Task Force, installations’ cleanup advisory board meetings, and a hearing on cleanup remedy selection. We visited the California Environmental Protection Agency, Sacramento, California, and discussed specific issues with environmental officials of other states. As requested, we did not obtain written agency comments. However, we discussed the report’s contents with DOD and EPA officials and incorporated their comments where appropriate. We performed the review between February 1994 and January 1995 in accordance with generally accepted government auditing standards. Significant Cost, Funding Priority, and Reuse Issues Need to Be Addressed Congress, DOD, and EPA have taken actions over the past several years to address a number of important matters relevant to resolving environmental cleanup issues at bases that are being closed and realigned. However, problems still remain with determining accurate cleanup costs, timing appropriations with cleanup needs, prioritizing available cleanup funds, and protecting the government’s interests when leasing or transferring property. Cleanup Cost Estimates Are Likely to Continue Increasing As reported in its fiscal year 1995 BRAC budget justification document, DOD’s total estimate for cleaning up environmental problems at 123 closing and realigning installations and activities was about $4 billion. However, more recent data developed by DOD in April 1994 shows that estimates for just 84 installations totaled about $5.4 billion, and costs are likely to go beyond that amount as more complete data becomes available. BRAC Budget Estimates for Cleanup Will Continue to Increase The BRAC accounts were established to be the exclusive source of funds for environmental restoration projects related to base closures. The intent was to preclude the cleanup actions from competing with other sources of funding for environmental cleanup such as the DERA. DOD’s BRAC budget estimates for cleanup cover 6-year periods; thus, the estimate for the 1988 round spans fiscal years 1990 through 1995; the estimate for the 1991 round spans fiscal years 1992 through 1997; and the 1993 round spans fiscal years 1994 through 1999. BRAC budget justification documents are to address the total financial impact of realignment and closure actions. DOD’s estimate in the fiscal year 1995 budget for the 1988 and 1991 rounds increased from the fiscal year 1993 estimate by about $400 million, to about $2.2 billion. In addition, the 1995 budget estimate included about $1.8 billion for the 1993 round, raising the total estimate for the first three rounds to almost $4.0 billion for 123 installations and supporting activities. This estimate represents the total BRAC budget through fiscal year 1999. According to DOD, these estimates increased because they were based on preliminary information, and costs depend on the type of contaminants detected, conditions found, and the cleanup technologies selected. More Recent Information Increases Estimates More recent information developed by DOD in cleanup plans on 84 of the 123 installations shows an estimate of about $5.4 billion. This estimate is likely to increase as more bases are added and all costs are captured. In September 1993, as part of its Fast Track Cleanup program to accelerate cleanup and reuse of BRAC installations, DOD required installations with property that could be transferred for nonfederal use to develop comprehensive BRAC cleanup plans and to submit these plans by April 1994. The military services forwarded 79 such plans, covering 84 installations, and the estimated cleanup costs in these plans totaled nearly $5.4 billion. (See app. III.) This is about $1.6 billion more than the fiscal year 1995 BRAC budget estimates for these same 84 installations, as summarized in table 2.1. DOD officials told us that the cleanup plans required more comprehensive cost estimates than the BRAC budget estimates. They said that total environmental programs at closing and realigning bases go beyond those costs identified in the BRAC budgets. For example, some cleanup plans for Army installations needed DERA funds in addition to BRAC funds. Also, both the Army and Navy plans identified funding needed for environmental compliance and for the preservation of natural and cultural resources. Also, BRAC budget estimates cover only the 6-year period that bases are allowed to close. However, the average cleanup can take much longer. The cleanup plans include 14 installations from the 1988 round of closures that estimated they will need $536 million after the 6-year period. (See app. IV.) For example, the BRAC budget estimate for the Army’s Jefferson Proving Ground, Indiana, was about $11 million. The cleanup plan estimated it would cost $233 million, including $789,000 prior to 1989, $16.1 million in BRAC and other funding between 1990 and 1995, and $216.1 million in DERA funding after the 6-year period. The cleanup plan shows that this $216.1-million figure assumed no change in how the base was being used, and if another reuse option was selected, the total estimated cost for this one base could be $2 billion per year for fiscal years 1996 to 1999. Although the cleanup plans provide a more complete view of environmental costs at closing bases, they did not generally capture complete costs. In some cases, long-term monitoring costs may go on for many years beyond the base cleanup plan estimates. For example, Pease Air Force Base, New Hampshire, reported no costs beyond fiscal year 1999, but officials estimated it will cost $300,000 a year to monitor the groundwater for an indefinite period beyond 1999. Similarly, Norton Air Force Base, California, officials estimated long-term remedial operations will cost $38.9 million through 2010, but the Air Force’s estimate only included monitoring costs through fiscal year 1999. Furthermore, the cleanup plan estimates did not include some sites that have yet to be investigated at the 84 installations. At its Charleston, South Carolina, complex, consisting of a station, shipyard, and fleet industrial supply center, the Navy is presently investigating 39 waste management sites and has identified 330 potential areas of concern that require further study. Assessments are currently being performed of 118 of the potential areas. The remaining sites were recently identified during a site inspection, and the appropriate investigation approaches are being formulated. The Army Materials Technology Laboratory, Massachusetts, was recently added to the NPL, requiring the Army to address surface water contamination cleanup previously not planned or budgeted. EPA is currently assessing the Army’s Jefferson Proving Ground for possible addition to the NPL, and other installations could be considered for NPL status in the future. The Congressional Budget Office reported in January 1995 on unanticipated cost growth that has occurred for installations scheduled to close. It observed that cost estimates increased for 34 of 49 installations being closed because (1) DOD discovered additional sites and contaminants on its installations and (2) new technologies that could reduce costs have been slow in coming and gaining acceptance. They also said that stricter cleanup standards than planned could significantly add to the costs. As part of our review on DOD’s Future Years Defense Program, we reported in July 1994 that DOD’s environmental costs may be significantly understated. Substantial Unobligated Amounts in BRAC Environmental Accounts Of the nearly $4 billion identified for environmental cleanup through fiscal year 1999 in the 1995 BRAC budget estimate, $1.8 billion had been appropriated through fiscal year 1994. By June 1994, only about 55 percent of $1.8 billion had been obligated, and about $813 million was unobligated. However, by September 30, 1994, about $334 million remained unobligated, as shown in table 2.2. BRAC funds are available to be obligated during the 6-year period bases have to close. According to DOD officials, however, the services’ perception is that funds should be obligated in the year appropriated, and high unobligated balances are seen by the services as a failure to execute their programs. For example, in October 1992, the Army increased the BRAC 1991 account for Fort Ord, California, by $11.8 million for environmental restoration, stating that the Army had to obligate its current funds to receive additional 1991 funds DOD had withheld. Between February and September 1993, $10.8 million was obligated for an existing contract with provisions that the work would be fully defined and priced later. In explaining the high levels of unobligated balances, DOD said that it (1) was probably overly optimistic in the funds requested, (2) did not have all the necessary expertise to better estimate requirements and timing, and (3) experienced slow obligation rates by the installations. DOD officials told us that the unobligated balances improved between June and September 1994 because the services entered into cost-reimbursable contracts for the total design and actual cleanup of installations, instead of contracting separately for design and cleanup. As indefinite delivery/indefinite quantity cost-reimbursable contracts, they are higher risk to the government and will require closer oversight of the contractor’s operations. High Priority Cleanup Funding Appears Unwarranted for Many Installations DOD gives the highest priority to cleaning up installations on EPA’s NPL and installations scheduled to close and realign. For BRAC installations in the 79 BRAC cleanup plans, the cost of cleanup for non-NPL installations is about $3.4 billion, compared to $2.0 billion for NPL installations. BRAC installations are given a high priority to facilitate the transfer of property to nonfederal use as soon as possible. However, most BRAC property will stay under federal ownership. Also, until 1992, CERCLA required cleanup before property could be transferred to nonfederal owners, but a 1992 amendment allows for the transfer of property before cleanup is finished under certain stipulations. Furthermore, a 1994 law allows for long-term leases to nonfederal users before cleanup is complete. We reported that DOD will not be able to efficiently institute cleanup efforts until it and EPA evaluate the large number of sites currently on the NPL and at BRAC installations and determine which should be designated as high priority. High Priority Cleanup Accelerates DOD’s Funding Needs In 1990, Congress designated the BRAC appropriations account to be the exclusive source of funding for environmental restoration at BRAC installations. Congress established this separate cleanup funding because it was concerned that the higher priority being given to closing and realigning installations would exhaust all DERA funding. In the same act, Congress directed that DOD restore any property excess to its needs as a result of closure or realignment as soon as possible. High priority funding was necessary for these installations because CERCLA requires environmental cleanup to be completed before nonfederal ownership transfer and reuse can occur. Giving all closing and realigning installations the same status as NPL installations has significantly increased the number of priority installations and accelerated the funding DOD needs for high priority cleanup. Of the 84 installations identified in the cleanup plans, 21 are for NPL installations and receive priority cleanup funding consideration regardless of whether they close or realign. (See app. III.) Cleanup estimates in these 21 installations’ plans totaled $2.0 billion. However, the other 63 installations would not have been given high priority status if they were not closing or realigning. Estimated cleanup costs in plans for these installations amounted to $3.4 billion, or 63 percent of the nearly $5.4-billion total estimate. (See table 2.3.) For example, the Long Beach Naval Station and Hospital, California, are not on the NPL. However, these installations add an estimated $221 million to DOD’s priority requirements. Were these non-NPL bases not closing or realigning, they would likely receive funds only for essential cleanup and compliance activities. For example, non-NPL installations would likely receive funds to remove underground storage tanks to meet deadlines in the law, but asbestos and lead-based paint surveys not subject to a deadline might be deferred to later years. Army headquarters officials told us there had never been much DERA funding available to clean up non-NPL installations, but funds became available once an installation was identified for closure. Environmental officials at Fort Ord, California, said that before their installation was on the NPL, they had trouble competing for DERA cleanup funding. DOD officials told us that cleanup priority funding was needed for non-NPL installations because (1) BRAC funding is tied to the 6-year period allowed for bases to close, (2) legal mandates established by state law or the courts exist at some bases, and (3) communities are expecting their installations to be cleaned up as soon as possible. Property Can Be Transferred to Other Federal Agencies Before Cleanup Is Complete CERCLA allows DOD to transfer property to another service or federal agency before completing cleanup. However, the proper arrangements for cleanup must be made, and DOD’s potential liability is significant. As we reported in November 1994, DOD is retaining most of the property or transferring it to other federal agencies. It is retaining about 156,700 acres, or 63 percent of the 250,100 acres on installations from the 1988 and 1991 rounds. Some of this property is being retained because of extensive unexploded ordnance contamination. For example, at the Army’s Jefferson Proving Ground, Indiana, due to long-term hazardous waste contamination and the potential that unexploded ordnance could be found all over the installation, it is impossible to dispose of all the property. The Army was considering retaining all or part of it under a caretaker program. However, the U.S. Department of Interior’s Fish and Wildlife Service requested that most of the installation’s property be added to a national wildlife refuge. Even though these installations will not have to be cleaned up before the property is transferred, DOD and the receiving agency must agree on what remedial action will be taken. Consequently, DOD is still held responsible for the cleanup, which ultimately could involve substantial costs. According to DOD officials, DOD is responsible for cleaning up past contamination, regardless of when it is identified, and meeting the requirements of any new federal or state cleanup standards and laws. For example, at the Hamilton Army Airfield, California, ownership of a landfill on property once auctioned to a private developer has reverted to the Army. Due to the presence of contamination, the Army will now pay to contain landfill contaminants and treat the groundwater. Property Can Be Transferred to Nonfederal Users Before Cleanup Is Finished About 93,400 (37 percent) of the 250,100 acres at closing 1988 and 1991 installations will potentially be available for transfer to nonfederal users. CERCLA had prohibited DOD property transfers to nonfederal ownership until the necessary cleanup action had been taken, but the Community Environmental Response Facilitation Act (CERFA) amended CERCLA in 1992 to expedite transfer. Under the act, remedial action is considered to have been taken if (1) the construction and installation of an approved remedial design has been completed and (2) the remedy has been demonstrated to EPA to be operating properly and successfully. Thereafter, any long-term pumping and treating or operation and monitoring after the demonstration does not preclude transferring the property. Although the CERFA amendment could eventually facilitate the transfer and reuse of property under CERCLA, most sites at BRAC installations are in the early investigation and study stages and have not reached the point where remedies are in place. An EPA headquarters official, after checking with EPA regions, told us that data is not being collected, but it is unlikely that much property has been transferred so far where remedies are in place and operating successfully. Long-Term Leases Allow Reuse Before Cleanup In general, DOD may only lease property that is under its control, not currently needed for public use, and not excess property. A limited exception was available for property found to be excess as a result of closure or realignment, where a military service determined that leasing would facilitate economic reuse. However, leases were subject to limitations, including a term not to exceed 5 years and DOD’s right to revoke the lease at will. As part of the National Defense Authorization Act for Fiscal Year 1994 (P.L. 103-160), Congress authorized the military services to lease property to facilitate state or local economic reuse without limiting the length of a lease. As of January 1995, the Air Force has used the provision to enter into six leases, ranging from 25 to 70 years, for airports and other uses, as shown in table 2.4. The other services had leasing actions in process. Although leasing property allows its reuse before cleanup has been completed, DOD is still liable for environmental cleanup costs. Thus, leasing still leaves the question of how the government should be protected from liability for hazardous waste that results from the current tenant’s operations. Even though DOD conducts extensive environmental surveys and includes numerous provisions in its leases to limit its liability, DOD nonetheless remains a responsible party under CERCLA. For example, between 1976 and 1986, the Navy leased most of its Hunters Point Annex—a deactivated Navy shipyard listed for closure on the 1991 round—to a commercial business, which subleased many of the buildings to other businesses. The activities conducted were primarily commercial ship repair, and the lessee was later sued by the city of San Francisco for the alleged illegal disposal of large amounts of hazardous waste. The Navy remained the owner of the property and, according to the Navy environmental coordinator, has included these sites in its BRAC cleanup program. Other issues affecting leases are (1) the time and effort required to complete the environmental documents and processes necessary to satisfy federal and state laws and DOD policies and (2) the obligation of the services to monitor and manage the property and environmental requirements. Conclusions Although various actions have been taken in recent years, Congress, DOD, and local communities still face a number of difficult issues related to (1) obtaining accurate cost estimates for completing cleanup efforts at closing and realigning bases, (2) determining the proper timing of appropriations to meet cleanup needs, (3) determining whether, in view of limited resources and changes in law, all closing and realigning bases should be given priority funding, and (4) facilitating the transfer of property to federal and nonfederal users while ensuring the government’s and DOD’s interests are protected. In particular, we believe high priority funding for environmental cleanup at closing and realigning installations needs to be reevaluated because most property will stay under federal ownership, and property that will be available for nonfederal ownership transfer can now be leased or reused before it is entirely clean. It appears that DOD could be more selective and designate priority funding for NPL installations and other sites where cleanup is required for nonfederal reuse. This might reduce DOD’s requirements for accelerated funding for nonpriority sites and spread these costs into more appropriate future budget years. Also, although property remaining as federal lands does not have to be cleaned up before transfer, DOD appears to be retaining much of the responsibility for cleanup. Accordingly, DOD needs to include these potential unfunded liabilities in its total environmental program cost estimate. Recommendations We recommend that the Secretary of Defense develop a total environmental program cost estimate of the financial impact of realignment and closure actions that reflects a more complete description of the costs as identified in the installations’ BRAC cleanup plans, including estimates for compliance, preservation of natural and cultural resources, and long-term costs associated with cleanup and monitoring; and unfunded liabilities where property is being retained by the federal government and cleanup will be deferred. We also recommend that the Secretary of Defense approve sites for high priority environmental funding only when cleanup or compliance is required or cost-effective for nonfederal reuse to occur. Cleanup Progress Is Limited, and Technology and Management Improvements Are Needed Most sites at closing and realigning installations are still being investigated and studied. Thus, the full extent of cleanup actions required may not be known for years. Also, installations may not be cleaned up by the time they close, and major groundwater, landfill, and unexploded ordnance sites will remain contaminated unless new technology is developed. Dissatisfied with the slow pace of cleanup that had occurred, DOD designed the Fast Track Cleanup program in 1993. Although the program has made some progress, it could be improved in such ways as adding performance measures to gauge progress. Cleanup Is in the Early Stages of the Process, and New and Better Technology Is Needed DOD’s guidance for preparing cleanup plans called for installations to account for all sites requiring restoration and to summarize their environmental compliance programs. For example, installations identified cleanup requirements, such as fuels, solvents, unexploded ordnance, and other contaminants in training and maintenance areas, landfills, burn pits, fuel stations, wastewater treatment areas, and at other sites. They reported on programs to remove asbestos, radon, and lead-based paint from buildings and other structures as well as inventories of underground storage tanks that held fuel, waste petroleum, and other products. The 84 installations included in the cleanup plans reported that most environmental cleanup work was still in the early stages. For example, 49 of the installations combined many contaminated sites into “operable units” for more effective cleanup management. They reported that work on 165 of 239 units, or 69 percent, was in the earliest phases—remedial investigation and feasibility study. The plans estimated that 129 of the 165 units would not complete this phase until fiscal years 1995 to 1998. Most of the work at the remaining installations was still in the remedial investigation and feasibility study phases as well. According to DOD officials, technology exists for the cleanup of many sites, but it needs to be made more efficient and cost-effective. We reported that the CERCLA progress is sluggish because the study and evaluation process is lengthy, cleanups are complex, existing technology takes a long time, and the average cleanup can require about 10 years. Contaminated groundwater, landfills, and unexploded ordnance were identified in many installations’ cleanup plans. (See app. III.) Some large contaminated sites cannot be cleaned up because either knowledge and expertise does not exist or has technology or cost limitations. At these sites, interim cleanup actions are being used, and the sites will remain contaminated unless new removal technology is developed. Remedies to contain contamination require significant long-term operation, maintenance, and monitoring efforts as well as further cleanup actions if contamination recurs. A 1990 EPA study showed that containment remedies may initially be less expensive to construct, but the required operation and maintenance and the potential for failure increase their cost in the long run. Containment at BRAC installations for major groundwater, landfill, and unexploded ordnance sites will likely require cleanup efforts over many years. Cleanup of Groundwater Is a Problem at Most BRAC Installations Decontaminating polluted groundwater, an issue identified in 51 of the 79 cleanup plans, is costly, difficult, and sometimes impossible. Once contamination is detected, the uneven flow of groundwater and the redistribution of the contaminants make cleanup difficult. According to EPA, the technical challenges of eliminating groundwater contamination are complex and efforts to speed up the process have been expensive and achieved limited success. For example, one of the most commonly used groundwater cleanup technologies is “pump and treat,” where contaminated water is pumped to the surface for treatment. However, this technology can cost millions of dollars, take decades, and still leave groundwater contaminated. Pump-and-treat systems were in place or planned for at least 24 of the installations identified in appendix III. Figure 3.1 shows an example of a pump-and-treat remediation project. Pump-and-treat systems may need to be tested over several years to determine their effectiveness. For example, at two installations we visited, Norton and George Air Force Bases in California, pilot systems were in place, but officials said they were operating at about one-half of the capacity because the groundwater did not flow as expected. They said the number of wells for these systems will need to be increased for sufficient water to flow, and even if successful the systems may need to operate for 30 years or more. At Norton Air Force Base, groundwater contamination extends from the central base area, toward the southwest in the direction of groundwater flow beneath the base, and continues beyond the base boundary. There are several community water wells near the base within the anticipated path of the contaminants. Furthermore, the pump-and-treat technology does not work on some contaminants, according to EPA. These contaminants include certain organic compounds, such as chlorinated solvents, polychlorinated biphenyls (PCBs), creosote, and some pesticides. They are difficult to locate and remove and may continue to contaminate groundwater for hundreds of years, despite best efforts to clean them up. Landfills Must Be Cleaned up at Most BRAC Installations Contaminated landfills were identified in 67 of 79 cleanup plans for closing and realigning installations and may pose some major environmental threats, particularly for groundwater. (See app. III.) Although small landfills can be removed and eliminated, it is not practical to remove all waste and contamination from larger ones. National standards do not exist for cleaning up most contaminants in soil, so DOD, EPA, and state regulators negotiate standards for each site. Large landfills are often treated by placing a protective cap over the site to contain the waste and prevent further contamination of the soil, groundwater, and atmosphere. The groundwater conditions around the landfill must also be assessed to determine whether contamination exists, and, if necessary, identify the cleanup measures. Figure 3.2 shows a landfill excavation and a soil removal project. Landfills that close where waste has not been removed are also subject to EPA requirements for maintenance and groundwater monitoring 30 years after the landfill is closed. These requirements were established because of the potential for environmental problems after closure. EPA or the state must determine that closed facilities have complied with all regulatory requirements. If not, the facilities must be brought into compliance. More Cost-Effective Technology Needed to Clean up Unexploded Ordnance Unexploded ordnance is ordnance that has failed to function as designed, has been abandoned or discarded, and is still capable of exploding and causing injury. It results from operations conducted at weapons test and training ranges and contains explosive, petroleum, metal, and other compounds that may contribute to soil and water contamination. If unexploded ordnance is buried below 3 feet, current technology may not be able to detect it, and it can migrate to the surface over time. Consequently, surface cleanup may need to be repeated. Unexploded ordnance and related waste were identified at 25 closing installations, including some installations where the contaminated areas are so large that cleanup technology is not affordable. For example, unexploded ordnance is potentially present on about 51,000 acres of the Army’s Jefferson Proving Ground, Indiana; 7,200 acres of the Army’s Fort Ord, California; and an unspecified amount of property at the Navy’s Mare Island Shipyard, California. Current removal technology is labor intensive, costly, and unreliable. Figure 3.3 shows a portion of a munitions firing range that contains unexploded ordnance. According to Army ordnance and other officials, new and more cost-effective technology needs to be developed for cleaning up the unexploded ordnance. A study at the Army’s Jefferson Proving Ground, which has extensive quantities, types, and dispersion of unexploded ordnance, found that the cleanup effort would be labor intensive. For example, the work would require using metal detectors for the majority of land, mapping the unexploded ordnance, handling or removing it, and disposing of it. Because the installation potentially has 51,000 contaminated acres and is heavily forested, current cleanup technology is not practical or affordable. Although the cleanup plan included $216 million in estimated costs, the plan noted that costs could run to $2 billion a year for several years, and officials said other estimates for cleanup have ranged from $5 billion to $8 billion in total, depending on how the property is to be reused. Figure 3.4 shows an example of buried unexploded ordnance. The closure of military installations and extent of unexploded ordnance have intensified the need for DOD and EPA headquarters and states to address many unresolved issues related to unexploded ordnance. These issues concern costs and cleanup requirements, when unexploded ordnance becomes a hazardous material, when DOD turns over control to EPA and states, and which laws apply to cleanup. The 1992 Federal Facilities Compliance Act amending RCRA required EPA to propose, after consulting with the Secretary of Defense and appropriate state officials, regulations identifying when military munitions become hazardous waste and providing for its safe transportation and storage. The deadline for the proposed regulations was October 1994. EPA officials told us in January 1995 they missed that deadline and now plan to propose the guidelines in July 1995. Developing New Technology Will Take Time Containing and cleaning up contamination depends on developing new, affordable technologies, but these technologies will take time to develop. We recently reported that the process of choosing a new technology involves many decisionmakers, technical expertise, and competing interests. The pressure to meet cleanup milestones also influences the technology evaluation process and the solutions accepted. The reasons why new technologies are not adopted faster include the following: Conflicting priorities prevent the approval of innovative approaches for cleanup. Field officials may associate the newer technologies with unacceptable levels of risk. On-site contractors may favor particular technologies on the basis of their own experiences and investments. In May 1993 testimony, DOD recognized that its environmental program could be improved by directing cleanup efforts to meet potential users’ needs. DOD said it intended to (1) target environmental technology to high payback areas, (2) apply research and demonstration funds to real environmental needs, and (3) get support from regulators, states, and the public for testing and fielding innovative technologies. Subsequently, in 1994, DOD began looking at technologies with high potential and ranking them according to potential benefits and feasibility. DOD officials said they plan to begin demonstrating technologies and offer them to EPA and state regulators for validation in 1995. Fast Track Cleanup Program Is Being Implemented but Needs Additional Development DOD established the Fast Track Cleanup program in July 1993 to accelerate the environmental cleanup at closing installations. The program was initiated under the five-part program the administration designed to expedite the environmental cleanup and economic recovery of communities affected by installation closures. Progress in the Fast Track Cleanup program’s five key elements has been as follows: Environmental impact statements depend on communities submitting reuse plans, and most of these plans have not been developed. Restrictive indemnification language has been clarified. Uncontaminated parcels from the 1988 and 1991 closing installations have been identified for transfer, but not as much uncontaminated property has been identified as hoped. Teams have been established at closing bases to make decisions and develop the cleanup plans, but decisions are still made above the base level, and bases’ cleanup plans can be improved. Community cleanup advisory boards that involve the public in the cleanup program have been established, but can be improved. The program is not fully implemented, and it is too early to comprehensively judge its effectiveness. However, DOD has made some progress in implementing certain elements of the program, but further development is necessary. Completing Environmental Impact Statements The Fast Track Cleanup strategy paper stated that the process for preparing an environmental impact statement typically takes 28 to 48 months. The Fast Track Cleanup program requires the military services to complete the environmental impact statement within 12 months of a community submitting its final reuse plan. However, community reuse plans are not completed for many of the installations submitting cleanup plans. According to service officials, they anticipate being able to complete the statements within the 12 months allowed once reuse plans are received. Law Covering Indemnification Clarified The Fast Track Cleanup program concluded that indemnification language in DOD’s 1993 appropriations act unintentionally caused DOD to slow down granting interim leases. DOD’s authorization and appropriations acts for 1993 contained different provisions regarding the government’s liability for the transfer of contaminated property. DOD viewed the provisions of the appropriations act as exposing the government to costly claims because of sweeping DOD indemnification language in the law. In response, DOD stopped entering into any leases or transferring property for fear of future claims. Congress subsequently repealed the appropriations language and let the authorization language stand, which limited DOD’s liability to past problems. DOD has proceeded with efforts to lease and transfer property. Limited Uncontaminated and Desirable Property Identified for Nonfederal Transfer An issue that arose early in the BRAC process was whether property could be transferred to parties outside the federal government without the entire installation being cleaned up. Subsequently, Congress enacted CERFA in 1992, which allowed an installation to be divided into parcels that could be considered separately for transfer. CERFA directs federal agencies to identify uncontaminated parcels based on the specific requirements set forth in CERFA. For parcels that are on a NPL installation, EPA must concur with the results. For parcels on non-NPL installations, appropriate state officials must concur. The deadline for identifying all parcels on BRAC 1988 and 1991 installations, including EPA or state concurrence, was April 19, 1994. DOD officials told us that CERFA did not work as expected. Although considerable resources have been spent, the anticipated numbers of uncontaminated parcels available for quick transfer and reuse have not been identified. Furthermore, they said that data was not readily available, but they believed little of the uncontaminated property that was identified had been transferred. They also said the developed land on the installations is often the most desirable for immediate reuse, but this property tends to be contaminated. However, DOD officials commented that one benefit of the CERFA process has been that DOD identified the condition of the property at these installations, and this information will be extremely useful in leasing and later transferring contaminated property. DOD records showed that of about 250,100 acres at 1988 and 1991 closing installations, the services identified about 121,200 acres as uncontaminated; however, the regulators only concurred that 34,499 acres were uncontaminated. Table 3.1 shows uncontaminated acreage at closing 1988 and 1991 installations that did receive regulatory concurrence. The regulators did not agree that many parcels were uncontaminated because activities related to compliance—asbestos removal, lead-based paint surveys, and resolution of issues related to petroleum—were not completed. Also, state regulators were not willing to concur because of concerns about the state’s potential liability. At Fort Wingate, New Mexico, the Army identified 17,353 of 21,812 total acres as uncontaminated, but the state regulator did not concur on any acreage. Likewise, the Air Force identified 1,323 of 3,216 acres at Bergstrom Air Force Base, Texas, as uncontaminated, but the state regulator did not concur. Of the 34,499 uncontaminated acres, about one-half is on property the federal government is retaining and one-half is on property available for transfer to nonfederal users. However, according to DOD, the uncontaminated property is usually undeveloped, remotely located, or linked to contaminated parcels and cannot be used separately. For example, about 7,000 of the uncontaminated acres at Fort Ord are considered unusable because, according to DOD officials, the acreage is in an undeveloped part of the installation that has no access to a usable water supply. Also, at George Air Force Base, environmental officials said much of the property identified as uncontaminated surrounds the runways and cannot be separated from the flightline. Installation Cleanup Teams in Place but Not Empowered The Fast Track Cleanup program concluded environmental decisions were taking too long to make and required each installation to establish a team consisting of EPA, DOD, and state representatives that would be empowered to make decisions quickly. Officials at some closing installations we visited told us they already had teams but were not empowered to make decisions at the local level. EPA issued draft guidance on empowerment to its installation-level team members in March 1994, but did not mandate that it be followed. According to EPA officials in January 1995, EPA has delegated to the regions the necessary authority to make decisions, and the regions have established procedures to ensure that management approval is redelegated or provided to the installations’ cleanup teams in a timely manner. The Air Force also issued guidance on empowerment to its installation-level team members in April 1994. This guidance delegated some key decision-making authority to mid-level managers, but not to the installation team members as originally envisioned. Various DOD and EPA officials told us that their agencies try to avoid legal problems by reviewing and approving decisions made at the local level, and states do the same thing. According to Navy officials, in one case, the state representative for environmental cleanup at the Marine Corps Air Station Tustin, California, decided in a local meeting on a particular action because the state environmental agency had approved a similar remedy at the Presidio of San Francisco, California. However, the state overruled the installation representative. Cleanup Plans Not Fully Developed DOD provided guidance and training on the development of BRAC cleanup plans. The plans were to provide a comprehensive and consolidated strategy for expedited environmental cleanup at all BRAC installations. DOD stated that the cleanup plans should support the BRAC budget submission. The cleanup plans developed to date are not of the quality described in the guidance document. DOD officials told us, for example, that sections in some plans were incomplete and had not been thoroughly reviewed, and data was viewed as somewhat unreliable. A contractor’s review of 77 BRAC cleanup plans in June 1994 identified a lack of uniformity in the plans due to (1) different levels of progress among installations based on the year the installation was designated for closure, (2) short time frames for completing the plans, and (3) various installation interpretations of guidance for the plans. At installations we visited while cleanup plans were being compiled—Norton Air Force Base, the Jefferson Proving Ground, and the Army Materials Technology Laboratory—officials said that they did not have time to develop complete plans for expediting cleanup and meet reporting deadlines, so they reported (1) existing information in the cleanup plan format directed by DOD or (2) the information had to be developed and would be provided later. DOD officials recognized that the time available for the services to develop cleanup plans was not sufficient and now view the April 1994 plans as a first effort. They are considering possible improvements in developing the BRAC cleanup plans, but have not established milestones for the services to submit more complete plans. Community Cleanup Advisory Boards Still Being Formed DOD guidance for the Fast Track Cleanup program directed the military services to improve public involvement in the environmental cleanup process. For each installation with property to be transferred or with sufficient community interest, DOD requires the formation of cleanup advisory boards comprised of members of the local community and jointly chaired by a military service representative and a member of the community. DOD’s guidance said these advisory boards are key to installations being responsive to community concerns. DOD’s goal of having fully functioning cleanup advisory boards in place may take time. These advisory boards at closing installations are in the early stages of development. According to the contractor’s review of 77 cleanup plans, about one-third of the installations had not yet formed cleanup advisory boards. Also, at installations with boards, only about half of the boards participated in developing the BRAC cleanup plans. Furthermore, we reported that EPA, in a similar effort to establish advisory boards, had not been able to earn the public’s trust due to differing interests, even with the best intentions and community relations outreach. On the basis of our observations at some of the BRAC community advisory board meetings we attended and in discussions with DOD officials, it appears that DOD may face similar difficulties. Performance Measures Not Developed for Fast Track Cleanup DOD officials recognized that the Fast Track Cleanup program lacked a baseline and performance measures. As a result, they have begun developing measures for the program, but have not set a target date for completing this effort. As of December 1994, just two measures of effectiveness were being considered: (1) the percentage of closing bases with a completed environmental impact analysis and (2) the percentage of property at closing bases that could be made available for reuse. These measures do not seem to adequately address performance. The first measure addresses an element that is not considered a problem. The second measure does not precisely measure environmental cleanup actions if leases are used. Also, these two measures do not address program elements concerned with timely decisions being made on installations’ cleanup, the number of installations with fully developed and effectively implemented cleanup plans, and the extent and effectiveness of public involvement in the cleanup process. Conclusions Most sites at closing and realigning installations are in the early stages of the cleanup process. Cleanup is costly, difficult, and sometimes impossible, and technology does not exist or has serious limitations when it comes to cleaning up massive amounts of contaminated groundwater, large landfills, or extensive areas with unexploded ordnance. Furthermore, new technology will take time to develop. The Fast Track Cleanup program is being implemented and has helped the cleanup process, but some elements of the program need further development. For example, CERFA has not produced the expected results. Expectations that installation cleanup teams could be empowered to make decisions were probably unrealistic, as was the deadline for installations to develop base cleanup plans. There is a need to establish standards that will allow DOD to assess the various measures taken to speed up the cleanup process. Recommendation We recommend that the Secretary of Defense establish Fast Track Cleanup program standards that will allow DOD to assess the steps taken to accelerate the cleanup process at BRAC installations.

Summary: Pursuant to a congressional request, GAO reviewed the environmental cleanup of Department of Defense (DOD) facilities slated for closing, focusing on: (1) the cleanup cost, transferability, and reuse of property by nonfederal users; and (2) DOD progress, difficulties, and plans to address the problems. GAO found that: (1) despite DOD actions to resolve environmental cleanup issues at bases slated for closure or realignment, problems remain with determining accurate cleanup costs, timing appropriations with cleanup needs, prioritizing available cleanup funds, and protecting the government's interests when leasing or transferring property; (2) cleanup costs will probably exceed the current DOD estimate of $5.4 billion because of additional cleanup needs and longer cleanup periods; (3) DOD could postpone clean up of some bases until after closure, since they will remain federal property or be under long-term lease to nonfederal users; (4) cleanup progress has been limited, since DOD is still studying the most contaminated sites; (5) the full extent of DOD cleanup actions may not be known for years; (6) some bases may not be cleaned up by the time they close, partly due to the need to develop new technology to cleanup groundwater, landfills, and unexploded ordnance sites; and (7) DOD has developed a fast track cleanup program to accelerate base cleanups, but it needs to improve program implementation.

gov_report

en

Summarize: What was once politically unthinkable has become a bipartisan venture. Mr. Obama is making common cause with Republicans and Democrats who have come to the conclusion that the United States has given excessive sentences to many nonviolent offenders at an enormous moral and financial cost. This week, Mr. Obama commuted the sentences of 46 such prisoners and gave a speech calling for legislation revamping sentencing rules by the end of the year. He came to the Federal Correctional Institution El Reno, about 30 miles west of Oklahoma City, for a firsthand look at what he is focused on. Accompanied by aides, correctional officials and a phalanx of Secret Service agents, Mr. Obama passed through multiple layers of metal gates and fences topped by concertina wire gleaming in the Oklahoma sun to enter the facility and talk with some of the nonviolent drug offenders who he argues should not be serving such long sentences. El Reno, a medium-security prison with a minimum-security satellite camp that together house 1,300 men, was locked down for the visit. The campus of two-story brick buildings separated by neatly trimmed grass remained eerily silent and empty, with no one in sight other than a few security officers peering through binoculars from a rooftop. Rather than bursting at the seams, it had the antiseptic feel of an abandoned military base, except for the cattle being raised on the property. The president was brought to Cell Block B, which had been emptied for the occasion, its usual occupants moved to other buildings. The only inmates Mr. Obama saw during his visit were six nonviolent drug offenders who were selected to have a 45-minute conversation with him at a round table. It was recorded for a Vice documentary on criminal justice to be shown on HBO in the fall. President Barack Obama, alongside Ronald Warlick (L), a correctional officer, tours a cell block at the El Reno Federal Correctional Institution in El Reno, Oklahoma, July 16, 2015. Getty I could have wound up in prison, Obama tells inmates A visit to a federal prison caps a week in which the president reached out personally to inmates and ex-cons and pressed for sentencing reform. EL RENO, Okla. — Instead of the White House, but for the grace of God, Barack Obama could have landed in this sprawling prison compound in central Oklahoma. That’s the introspective version of the message the president has stressed during a week of events pushing for criminal justice reform. Mandatory minimum sentences and other harsh drug laws are responsible for prison overcrowding and punishments that don’t fit the crime, he has said. Story Continued Below Both publicly and privately, Obama acknowledges that his mischievous, sometimes marijuana-fueled adolescence in Hawaii might have brought about a very different adulthood had it taken place somewhere else. “That’s what strikes me — there but for the grace of God,” he said, standing in the middle of Cell Block B, which houses a special drug rehab program. “And that is something that we all have to think about.” Obama’s visit to a federal prison — the first by a sitting president — capped a week of efforts to swing the pendulum away from the “tough on crime” drug laws of the 1990s. It included the announcement that he commuted the sentences of 46 nonviolent drug offenders on Monday and a call to action — and Congress — at the NAACP convention in Philadelphia on Tuesday to change sentencing laws, better prepare prisoners to re-enter society and reform the juvenile justice system that starts the cycle of crime and prison for so many American youth — disproportionately black youth. In a meeting with ex-cons on Tuesday and during a roundtable with inmates here on Thursday, Obama said he was struck by the fact that societal inequities mean that some misbehaving kids end up behind bars instead of in front of a principal’s desk. “When they describe their youth, these are young people who made mistakes that aren’t that different from the mistakes I made, and the mistakes that a lot of you guys made,” Obama said after talking to six nonviolent drug offenders. “The difference is that they did not have the kind of support structures, the second chances, the resources that would allow them to survive those mistakes.” Obama has only rarely shared with the public how he views flashpoint moments through his own racial identity. One occurred when the death of a black teenager at the hands of a self-appointed neighborhood watchman in Florida ignited a bitter national debate on guns and racism; Obama observed, “If I had a son, he’d look like Trayvon.” On another occasion he added: “Another way of saying that is Trayvon Martin could have been me 35 years ago.” This week, in some inmates condemned to a cycle of poverty and prison, Obama made it clear that he also sees himself. In recent months, a coalition from across the political spectrum has emerged in favor of moving away from mandatory sentences that have bloated prisons with minor offenders, and that made it difficult for them to get a job and return to society upon release. The 2.3 million people currently imprisoned is a five-fold increase over 30 years ago, and an estimated one-third of all Americans have a criminal record. Republicans and Democrats in Congress are approaching a compromise on criminal justice reform, spurred in part by racial unrest sparked by police violence in places like Baltimore and Ferguson, Missouri. Obama’s focus on criminal justice reform this week wound up being interrupted by other news, including the conclusion of negotiations over Iran’s nuclear program. And the novel prison tour, with its photos of the president examining cells in a cavernous block, was overshadowed on cable television by Thursday’s shootings of Marines in Chattanooga, Tennessee. But the week’s efforts did provide an opportunity for the president to face, in an intimate way, people whose lives turned out the way his might have, under worse circumstances. “It was good to put a name and a face to a lot of the stories that we hear,” said White House spokesman Eric Schultz, speaking to reporters after the president’s prison tour. “These are the stories that move him, in addition to the sort of macro political science that suggests the need for reform.” On Tuesday, before his NAACP speech, Obama met with El Sawyer, 37, and three other former prisoners who’ve turned their lives around since their release. In contrast to the other offenders Obama has highlighted this week, Sawyer did commit a violent crime. He started dealing drugs when he was 12, and after dozens of arrests and juvenile lockup, he started an eight-year sentence at 17 for shooting a man in a drug turf dispute. But unlike almost everyone else Sawyer meets, he said in an interview, Obama did not act wary or nervous around him, nor did he lecture or sound “matter of fact.” Sawyer recalled the president telling him that they weren’t so different: “The only difference was the environment I grew up in.” “There was people that was around him that literally would check him, because he couldn’t disrespect them or step out of line,” said Sawyer, who now works on films to help other people returning from jail, with funding from the Department of Justice. Obama also showed an unusual level of personal empathy in the letters he wrote to the inmates whose sentences he commuted earlier in the week. “It will not be easy, and you will confront many who doubt that people with criminal records can change. Perhaps even you are unsure how you will adjust to your new circumstances,” he wrote, concluding : “I believe in your ability to prove the doubters wrong.” Sawyer said Obama’s visit to the prison was an important gesture, signaling that inmates and ex-cons “are still Americans.”

Summary: President Obama became the first sitting president to visit a prison today, and Politico notes that the milestone had him reflecting on his own past. After all, he was a black youth who smoked pot and tried cocaine. "That's what strikes me-there but for the grace of God," he said at the federal facility in El Reno, Oklahoma. "And that is something that we all have to think about." Obama met with nonviolent drug offenders in the prison and was struck by their stories. "When they describe their youth, these are young people who made mistakes that aren't that different from the mistakes I made, and the mistakes that a lot of you guys made," Obama said afterward. "The difference is that they did not have the kind of support structures, the second chances, the resources that would allow them to survive those mistakes." Obama's visit is part of his push to reform the criminal justice system, notes the New York Times, and it follows his decision to commute the sentences of 46 prisoners who got long sentences for nonviolent drug offenses. Americans tend to think it's normal that so many young people get locked up, said Obama. "It's not normal. It's not what happens in other countries. What is normal is teenagers doing stupid things. What is normal is young people making mistakes."

multi_news

en

Summarize: A California man could face 20 years in prison for running a revenge porn site and orchestrating a scheme for victims to pay to have their images removed after being convicted Monday. Kevin Bollaert, 28, was found guilty of 27 counts of identity theft and extortion for operating ugotposted.com, where anonymous users posted nude photos, often of women and often without their consent. Accompanying most of the photos were victims' names, residences and identifying information such as links to social media accounts, authorities stated. Convicted: Kevin Bollaert, 28, faces up to 20 years after being found guilty of extortion and identity theft for running a scheme for victims to pay to have their images removed from his revenge porn site. He also ran changemyreputation.com, where victims could pay fees of up to $350 to scrub their images and data from Bollaert's other site. California state law regarding identity theft prohibits the posting of personal information like names and addresses, 'for any unlawful purpose, including with the intent to annoy or harass. Authorities believe the conviction is the first against a revenge porn website operator, coming ahead of the trial of Hunter Moore, called 'the most hated man on the Internet' for running isanyoneup.com. Bollaert notably was not charged under the state's new law criminalizing revenge porn, which was signed after he reportedly shut down ugotposted.com. Prosecutors claimed that visitors to Bollaert's site posted more than 10,000 nude photos between 2012 and 2013. They also explained Bollaert made tens of thousands of dollars after victims visited changemyreputation.com and paid between $300 and $350 to get photos removed. Ruined: In spite of the thousands of emails he got begging to have photos taken down, Bollaert told investigators his life had been ruined by the site. Investigators found that Bollaert received thousands of distressed emails from victims, one who said she was'scared for my life' and another who said she'd been 'getting nonstop harassing messages.' The criminal complaint named more than two dozen people as victims, one of whom claimed she was thrown out of her home after her family found out nude photos had been posted of her. 'It ruined my life and I'm still going through it,' she testified. 'I lost my family. They think that I brought shame on them. My reputation is ruined.' Bollaert's lawyer, Emily Rose-Weber, had argued that while the website may have been immoral, he did not break the law by allowing others to use the site to post photos. 'It's gross, it's offensive, but it's not illegal,' she said. Mashable reported that Bollaert, in an interview with agents from the California Department of Justice's eCrime Unit, explained the site was 'just like ruining my life.' 'Yeah, I realize like this is not a good situation,' Bollaert said according to the complaint. 'I feel bad about the whole thing and like I just don't want to do it anymore.' 'I mean I know a lot of people are getting screwed over like on the site. Like their lives are getting ruined,' he said

Summary: Kevin Bollaert was found guilty of 27 counts of identity theft and extortion. He operated ugotposted.com, where anonymous users posted nudes without the subject's consent. Bollaert earned tens of thousands from running changemyreputation.com, where victims would pay fees of $300 to $350 to have their photos removed. Hunter Moore, another alleged revenge porn site operator, faces similar felony charges for his site isanyoneup.com.

cnn_dailymail

en

Summarize: Lena Dunham was not the Internet's first pick to write the screenplay about a Syrian refugee. (Photo: Evan Agostini, Evan Agostini/Invision/AP) Steven Spielberg is no stranger to stories of war and refugees, having made "Schindler's List" and the HBO miniseries "Band of Brothers." J.J. Abrams directed the pilot episode of "Lost," which took place in the immediate aftermath of a plane crash. So it would seem the movie adaptation of "A Hope More Powerful Than the Sea: One Refugee's Incredible Story of Love, Loss, and Survival," was safe in their hands. But the internet is not pleased with their choice of screenwriter: Lena Dunham. Twitter quickly registered its displeasure after The Hollywood Reporter and Variety announced that the creator of "Girls" and "Camping" had been chosen to adapt Melissa Fleming's book, which tells the story of Doaa Al Zamel, a young Syrian mother who survived two days in open water holding her children afloat after the rickety boat carrying them to Europe was rammed by a fishing boat piloted by hostile Egyptians. @arabized appealed to two actors of color, Riz Ahmed and Mindy Kaling, to use their influence to stop the project from moving forward with Dunham involved: "Can you guys please please voice a complaint? I don’t want Lena to tell my family’s story as a Syrian." @rizmc@mindykaling can you guys please please voice a complaint. 💔 I don’t want Lena to tell my family’s story as a Syrian. — Arabized (@arabized) October 29, 2018 "What makes her think she can speak accurately about the refugee experience?" asked @CatOuellette. "Please stop this while you’re ahead of a disaster." What makes her think she can speak accurately about the refugee experience? Please stop this while you’re ahead of a disaster. pic.twitter.com/NgyYquwDRY — Catherine Ouellette (@CatOuellette) October 29, 2018 "Not the person who needs to be this voice, yikes," said @katarinahit. Not the person who needs to be this voice, yikes. — Katarina Hit (@katarinahit) October 29, 2018 "Because clearly there’s no one who knows that demographic better than a spoiled, talentless, young, rich white girl," @keithmontesano chimed in. "Yikes." Because clearly there’s no one who knows that demographic better than a spoiled, talentless, young, rich white girl. Yikes. — Keith Montesano (@keithmontesano) October 29, 2018 Some predicted the project will be a trainwreck. "Willing to bet this...will not go well," @psyourewrong speculated. Willing to bet this...will not go well. pic.twitter.com/jAD3VC9D2Z — P.S. You’re Wrong: A Pop Culture Podcast (@psyourewrong) October 29, 2018 "There’s not one supportive comment here!" @Popculjunkie observed after reading through the replies to the Variety tweet. "She’s the worst." Lol there’s not one supportive comment here! She’s the worst. — janinnie (@Popculjunkie) October 29, 2018 Some other folks couldn't quite put their displeasure into words, so they resorted to using lots of gifs. @samnoaches turned to Steve Carell's character from "The Office" to express the inherent awkwardness. Whereas @mexcellentt went with "SNL"-era Amy Poehler. Dunham, 32, did get some pats on the back Monday – though not because of her latest writing gig. During a guest appearance on Dax Shepard's "Armchair Expert" podcast, she revealed that she was six months sober after becoming dependent on the anti-nxiety drug Klonopin. She said that she had no trouble getting the drug and that she upped her dose after receiving a PTSD diagnosis. The actress has been open about her past sexual trauma and her struggles after she underwent a complete hysterectomy to end the chronic pain brought on by endemetriosis, a condition that occurs when uterine tissue grows outside the womb. "It stopped being, 'I take one when I fly,' and it started being like, 'I take one when I’m awake,' " she recalled of the period when she became dependent on the medication. But she wasn't prepared for the withdrawal symptoms when she gave up Klonopin. "Nobody I know who are prescribed these medications is told, 'By the way, when you try and get off this, it’s going to be like the most hellacious acid trip you’ve ever had where you’re (expletive) clutching the walls and the hair is blowing off your head and you can’t believe you found yourself in this situation,' " she told Shepard. Six months into life without anti-anxiety meds, Dunham says her brain is still adjusting. "I still feel like my brain is recalibrating itself to experience anxiety,” she observed. "I just feel, literally, on-my-knees grateful every day." Read or Share this story: https://www.usatoday.com/story/life/movies/2018/10/29/lena-dunham-slammed-twitter-plans-adapt-syrian-refugee-story/1809056002/ Lena Dunham says she’s six months sober after quitting the anti-anxiety medication Klonopin. The actress opened up about her decision to get sober during an appearance on Dax Shepard‘s podcast Armchair Expert. “I’ve been sober for six months,” she said. “My particular passion was Klonopin.” Dunham, 32, said she started taking the medication after her anxiety became so intense that it held her back from daily activities and hindered her work. “I was having crazy anxiety and having to show up for things that I didn’t feel equipped to show up for,” she explained. “But I know I need to do it, and when I take a Klonopin, I can do it.” She said the drug made her “feel like the person I was supposed to be.” “It was like suddenly I felt like the part of me that I knew was there was freed up to do her thing,” she continued. Klonopin is a type of Benzodiazepine used to treat symptoms of anxiety, panic disorders and seizures. RELATED: Lena Dunham Had Her Left Ovary Removed: ‘It Got Worse and Worse’ Over the years, Dunham said she started taking Klonopin most frequently. “It stopped being ‘I take one when I fly,’ to ‘I take one when I’m awake.’ “ “I didn’t have any trouble getting a doctor to tell me, ‘No you have serious anxiety issues, you should be taking this. This is how you should be existing,’ ” she said. She said she had increased her dosage after being diagnosed with post-traumatic stress disorder. “I was diagnosed with pretty serious PTSD. I have a few sexual traumas in my past and then I had all these surgeries and then I had my hysterectomy after a period of really extreme pain,” she said. “It stopped feeling like I had panic attacks and it started feeling like I was a living panic attack. The only thing that was notable was the parts of the day where I didn’t feel like I was going to barf and faint.” RELATED: Lena Dunham Had a Full Hysterectomy to Remove Her Uterus and Cervix and End Endometriosis Pain Dunham said that while she knew the Klonopin she was taking wasn’t making her feel better, she was scared of what going off the drug would feel like. “If I look back, there were a solid three years where I was, to put it lightly, misusing benzos, even though it was all quote unquote doctor prescribed,” she said. Hutton Supancic/Getty She said that while she’s had her “fair share of opioid experiences” due to her health issues, she didn’t realize the just how hard quitting would be. “Nobody I know who are prescribed these medications is told, ‘By the way, when you try and get off this, it’s going to be like the most hellacious acid trip you’ve ever had where you’re f—– clutching the walls and the hair is blowing off your head and you can’t believe you found yourself in this situation,’ ” she said. “Now the literal smell of the inside of pill bottles makes me want to throw up.” Six months later, Dunham said she is still getting used to her new normal. “I still feel like my brain is recalibrating itself to experience anxiety,” she explained. “I just feel literally on my knees grateful every day.” Thank you to SquareSpace Quip, and Robinhood for sponsoring this week's episode. Create a beautiful website with SquareSpace - go to squarespace.com/dax for a free trial and when you’re ready to launch, use the offer code "dax" to save 10% off your first purchase of a website or domain. You’ve heard us obsess over my MeUndies and all the amazing colors and prints they offer, to get your 15% off your first pair, free shipping, and a 100% satisfaction guarantee, go to MeUndies.com/dax. Quip was designed to make brushing your teeth more simple, affordable and enjoyable. Quip starts at just $25 and if you go to getquip.com/dax right now, you get your first refill pack for free with a Quip electric toothbrush. Robinhood is an investing app that lets you buy and sell stocks, ETFS, options, and cryptos - all commission-free. Robinhood is giving listeners a free stock like Apple, Ford, or Sprint to help build your portfolio - sign up at armchair.robinhood.com

Summary: Lena Dunham is six months sober after getting addicted to the anxiety medication Klonopin, People reports. The Girls star said during an appearance on Dax Shepard's podcast that her anxiety and PTSD got so bad she easily found a doctor to prescribe the drug. "I was having crazy anxiety and having to show up for things that I didn't feel equipped to show up for. But I know I need to do it, and when I take a Klonopin, I can do it," explained the 32-year-old, who is also in the news Monday due to her controversial plan to adapt a Syrian refugee story for the big screen, USA Today reports. But eventually, "it stopped being 'I take one when I fly,' to 'I take one when I'm awake,'" she said of the pills. "If I look back, there were a solid three years where I was, to put it lightly, misusing benzos [benzodiazepines, drugs used to treat anxiety], even though it was all quote unquote doctor prescribed," she continued. Getting off Klonopin was not pleasant: "Nobody I know who are prescribed these medications is told, 'By the way, when you try and get off this, it's going to be like the most hellacious acid trip you've ever had where you're f---ing clutching the walls and the hair is blowing off your head and you can't believe you found yourself in this situation,'" she said. "Now the literal smell of the inside of pill bottles makes me want to throw up."

multi_news

en

Summarize: By. Sarah Dean. Surrogacy lawyer Stephen Page has slammed Australia's strict regulations as he told how his clients turn to Thai surrogates in desperation. The babies of desperate Australians who are using surrogate mothers in Thailand could end up being put into orphanages after Thai surrogacy laws changed this week, a lawyer has warned. Australians using surrogates in Thailand could also be prosecuted for human trafficking under the new laws that ban surrogacy if the prospective parents aren't blood relatives. Lawyer Stephen Page called the changes 'appalling' and said his clients have been left with no way to contact the pregnant woman carrying their babies, after the Thai military allegedly confiscated medical records from IVF clinics. 'I've been contacted by parents who can't contact the surrogate parents midway through pregnancy. They can't find out whether their baby or the mother is OK,' Mr Page told Daily Mail Australia. 'It's a disaster how the Thai government have announced it. 'These children didn't ask to born in this mess,' he explained. Mr Page spoke out on the same day that it was revealed a Thai surrogate mother revealed she was forced to care for her six-month-old baby after an Australian couple refused to take him home once they found out he had Down syndrome. The Australians had paid 21-year-old Pattharamon Janbua $11,700 to give them a baby but when she gave birth to twins - a boy and a girl - they only took the girl home to Australia. Baby boy Gammy has a congenital heart condition and is critically unwell. The Thai surrogate mother has received more than $182,000 in donations to care for Gammy after he was abandoned. Mr Page said all the Australian couples he'd met only seek overseas surrogacy as a last resort because Australian laws are so restrictive. 'The laws here makes it almost impossible. You can't advertise, you can't get an egg donor. Some people have waited seven years.' He explained that parents who were unable to conceive naturally, cancer patients and gay couples came to him after all other avenues had been exhausted. They usually manage to have a child through a Thai surrogate within 18 months or two years. 'Australians are the highest per-capita users of overseas commercial surrogacy, even though in three states it's a criminal offence,' he said. Over 400 Australian children were born in Thailand between 2012-2013 and 600 were born in India. 'On a global scale that's a huge number. Now the Thai Government have said there won't be any overseas surrogacy allowed at all,' Mr Page explained. Baby boy Gammy has a congenital heart condition and is critically unwell. He said this will cause more pressure on the Australian surrogacy system, plus parents will end up spending over $100,000 to get treatment in the United States or Canada. It is cheaper to have a surrogate child in Thailand and India at around $80,000. Mr Page said the changes in Thai law came after a story in the Bangkok Post about Chinese families using Thai clinics to chose the gender of their surrogate child, which outraged the world. 'Suddenly the Thai Government had a crackdown. They are fearing a loss of face because of that story and they want to be seen as tough,' Mr Page said. The lawyer, who is based in Brisbane but works with Australians who are trying to have children from every state, said he wants the Australian government to take active steps with Thai authorities to make sure people who have signed contracts with pregnant surrogates can get their children back to Australia. 'What I would hate to see is these babies stuck in a Thai orphanage or people prosecuted for child trafficking offences for something that has been legal for years,' he added. The Australian couple who have abandoned Gammy remain anonymous but they reportedly told Ms Janbua to have an abortion when they found out four-months into the pregnancy that one of the babies had Down syndrome. The Australian couple, who have remained anonymous, reportedly told Ms Chanbua to have an abortion. 'I would like to tell Thai women – don't get into this business as a surrogate. Don't just think only for money... if something goes wrong no one will help us and the baby will be abandoned from society, then we have to take responsibility for that,' Ms Janbua said, the Sydney Morning Herald reports. The couple paid an extra $1673 when they first realised - three-months into the pregnancy - that Ms Janbua was having twins for them. Ms Janbua is a Buddhist and thinks abortion is a'sin'. She originally agreed to become a surrogate mother because of her family's financial problems and the arrangement was set-up through an agency. The Australian man and his ethnic-Asian wife could not conceive a baby themselves. Ms Jambua, from a village in Chonburi province in northern Thailand, gave birth to Gammy and his twin sister in Bangok hospital. However, when the babies were born the agent took the girl away and delivered her to the Australian couple who Ms Jambua has never met. She never received the remaining $2341 that she was owed by the agent and is now struggling to keep her baby alive. A Hope For Gammy campaign has been set up on Go Fund Me and has now smashed its $25,000 target after receiving more than $50,000. The page pleads: '6 month old baby Gammy was born in Bangkok with down syndrome and a congenital heart condition. He was abandoned by his family and is being cared for by a young Thai woman who does not have the funds for his desperately needed medical treatment. 'Please make a donation so that he can have these operations and improve his quality of life. All monies raised will be kept in trust and will only be used for the care and wellbeing of Gammy.' Ms Chanbua, 21, agreed to become a surrogate mother because of her family's financial problems. One doctor has donated $3,000 to the cause. An administrator for the page wrote: 'Dr Pisit of ALL IVF has made a very generous donation after hearing about the Gammy Story. No ALL IVF Center staff have ever been involved in the Gammy case, but are touched by his situation and wanted to help. Thank you very much.' Gammy's tragic story has caused outrage on Twitter. Richard Long wrote: 'Takes a bit to make me angry but this story does. what greedy, selfish people.' Another user, @ChickkinOz, said 'these people need to be financially responsible for this child and woman for life. Unbelievable, how are they parents.' While @BCmanutddesi called it 'OUTRAGEOUS!! 'This story just makes my blood boil!!,' @parentingfiles said. Australians aren't the only people that travel to Thailand for surrogacy reasons. Earlier his year, there were 65 babies stuck in Thailand that were conceived by gay Israeli couples and birthed by surrogate Thai women, the Times of Israel said. The claims were made by the Facebook group 'Help Us Bring the Babies Home.' The babies were allegedly unable to be brought to Israel because the Interior Ministry Gideon Sa'ar has not granted Israeli citizenship to the infants. Commercial surrogacy is banned in Australia and it is illegal for people living in Queensland, NSW and the ACT to undertake commercial surrogacy in Thailand. It's also illegal for Australians to select a baby's sex. Current Australian Medicare policy forbids Medicare rebates for IVF use for surrogacy and to receive surrogacy as a treatment option in Australia the following conditions must be fulfilled:. Many Australians have flocked to Thailand over the years because the rules were far less strict. However, the rules have changed this week. After Thailand’s military government reviewed 12 Thai IVF clinics involved in surrogacy cases they have announced new laws. Surrogacy is now only recognised in Thailand if:. Surrogacy in Thailand is illegal if:. These new laws will now exclude almost every Australian from pursuing surrogacy in Thailand

Summary: Lawyer Stephen Page said Australia's surrogacy laws are too restrictive. His clients use Thai surrogate mothers after trying all other avenues. Changes in Thailand this week have outlawed the practice. Comes as Thai woman Pattharamon Janbua reveals she was offered $11,700 to be a surrogate mother by an Australian couple. But when she gave birth to twins they only took the girl. Left the boy who has Down syndrome in Bangkok.

cnn_dailymail

en

Summarize: Tower Heist November 2, 2011 If it had provided me with nothing else, "Tower Heist" would have afforded me the sight of a solid gold automobile being lowered from the penthouse of the Trump Tower with Matthew Broderick dangling from it. Sometimes you appreciate such simple human spectacles. To be sure, Trump Tower has been renamed "The Tower," and the man dangling from the car isn't the Donald, but this is an imperfect world. This isn't a great heist movie for a lot of reasons, beginning with the stupidity of its heist plan and the impossibility of these characters ever being successful at anything more complex than standing in line. There also is the problem with Ben Stiller being cast as the hero: He was born to play the victim of heists, not the gang leader. He's going against type. The victim here is played by Alan Alda, who is so loathsome he'd make a dartboard for OWS parties. Quibble, quibble. The movie is broad and clumsy, and the dialogue cannot be described as witty, but a kind of grandeur creeps into the screenplay by Ted Griffin and Jeff Nathanson. It's the kind of story where the executives at a pitch meeting feel they're being bludgeoned over the head with box-office dollars. There is also the novelty that here is a comedy that doesn't go heavy on the excremental, the masturbatory and symphonies of four-letter words. It's funny in an innocent screwball kind of way. The story: Josh Kovacs (Ben Stiller) is the perfectionist building manager at the most luxurious condo skyscraper in New York, which providentially is on Columbus Circle, in the exact footprint of Trump Tower. His team works flawlessly, beginning with the beloved doorman Lester (Stephen Henderson). The penthouse is owned by Arthur Shaw (Alan Alda), a financial wheeler-dealer, whose walls display priceless modern art. His most prized possession is a bright red 1953 Ferrari, once owned by Steve McQueen. It was taken apart piece by piece, he explains to FBI agent Claire Denham (Tea Leoni), and assembled there. The FBI is on the job because Shaw has been running a Ponzi scheme, and among his loot are the pension plan and investments of the tower's employees. So dear old Lester and all the others are penniless. Enraged, Kovacs recruits a team to break into the apartment. They're looking for a wall safe, but then discover Shaw's Ferrari is solid gold: $65 million is hidden in plain sight. Obviously, this requires stealing the car from the penthouse, where there's no door or elevator that can handle it. The team: Lester, of course; Mr. Fitzhugh (Broderick), who is jobless, broke, has lost his family and being evicted from the building, ­and characters played by Casey Affleck, Michael Pena, Gabourey Sidibe (her second film since her Oscar nomination) as a Jamaican whose father would crack safes, and — well, Kovacs decides they need someone more familiar with crime and enlists Slide (Eddie Murphy), a loud-talking dude from the street in his neighborhood. Murphy, in his first role since 2009, is in full Eddie Murphy mode, with comic riffs and astonished double takes. I won't describe how they plan to get the car out of the building, especially as the Macy's Thanksgiving Day Parade is passing directly below. But let me share with you that I suffer from a fear of heights, and the last thing you could get me to do is stand next to an open window on an floor upper of a high-rise and try to reach out and grab a Ferrari. The notion that no one would notice a bright red car being lowered from the tower is preposterous, but realism is not the point. This movie would fall to pieces if it didn't hurtle headlong through its absurdist plot without ever pausing for explanations. Everybody wants the financial crisis and its party-guest-that-won't-leave recession to be over, but now I'm especially anxious for the economy to right itself. Otherwise, more movies like Tower Heist are going to be made. A big-star caper about a disgruntled gang of sad sacks plotting to rob a Madoff-style fat cat who's lit off with their savings, Tower Heist comes from Brett Ratner (one of Hollywood's fattest cats), applying a polished, populist sheen to an Ocean's Eleven-ish split-second-timing, safecracking vehicle. The setting is "the most expensive apartment building in North America," a Trumpian condo on Central Park West where manager Josh Kovacs (Ben Stiller) oversees a crack crew of maids, maintenance guys, doormen, elevator operators, and concierges. When the Tower's richest resident, Arthur Shaw (Alan Alda), is arrested by the feds for fraud, Kovacs has to tell his staff that the penthouse-dwelling investor had been handling their pensions. What's left? Nothing. The veteran doorman (Stephen McKinley Henderson) is so bummed he tries to throw himself in front of a subway. And so a plot, born of revenge - and the certitude that Shaw has millions stashed in his apartment - is born. But how are Kovacs, concierge Charlie (Casey Affleck), new employee Enrique (Michael Pena), and a failed, foreclosed investment banker (a doughy Matthew Broderick) going to pull off this job? Not a one has a clue on the ins and outs of B and E. So Kovacs seeks the guidance of Slide, a fast-talking street mug from Queens with an impressive arrest record. Eddie Murphy, wearing a do-rag and a comically contemptuous scowl, plays the guy with more fire and flair than we've seen from the star in quite a while. A scene with Slide ordering his motley gang of amateurs to prove their mettle by lifting $50 worth of merchandise from retailers in a mall is amusing, and his exchanges with Precious' Gabourey Sidibe (she's a maid with a Jamaican accent and safecracking chops) are charged with comic innuendo. Devoting more time to the setup than to the follow-through, Tower Heist doesn't really build suspense so much as it builds impatience - for the thing to be over. Tea Leoni, trying out some quasi-New York intonations, is an FBI agent assigned to the Shaw case, who then finds herself in a romantic assignation with Stiller's character. The heist itself is set for Thanksgiving Day, with the Macy's Parade and its giant balloons providing distraction. In fact, a sign of the level of sophistication that Stiller and company - and Ratner and company - are operating on: The timing of the break-in hinges on the assumption that the Tower's security team will drop everything when the big Snoopy float trundles down Central Park and stops at their door. Contact movie critic Steven Rea at 215-854-5629 or srea@phillynews.com. Read his blog, "On Movies Online," at http://www.philly.com/philly/blogs/onmovies/

Summary: Tower Heist is a recession comedy, telling the story of a group of men stealing their own money back from a rich swindler. Critics say it's worth a watch: "Here is a comedy that doesn't go heavy on the excremental, the masturbatory, and symphonies of four-letter words. It's funny in an innocent screwball kind of way," writes Roger Ebert in the Chicago Sun-Times. Ben Stiller and Eddie Murphy star in "the kinds of roles they both do best," notes Betsy Sharkey in the Los Angeles Times. "Their face-off in the front seat of an out-of-control car is worth the price of admission." It's a "middlingly well-done evocation of the big-budget caper you remember with vague fondness from long-ago matinees at the mall," writes Dana Stevens at Slate, and its "populist" bent is "cathartic." Steven Rea recalls the flick less fondly in the Philadelphia Inquirer. "Now I'm especially anxious for the economy to right itself. Otherwise, more movies like Tower Heist are going to be made."

multi_news

en

Write a title and summarize: The standard approach for identifying gene networks is based on experimental perturbations of gene regulatory systems such as gene knock-out experiments, followed by a genome-wide profiling of differential gene expressions. However, this approach is significantly limited in that it is not possible to perturb more than one or two genes simultaneously to discover complex gene interactions or to distinguish between direct and indirect downstream regulations of the differentially-expressed genes. As an alternative, genetical genomics study has been proposed to treat naturally-occurring genetic variants as potential perturbants of gene regulatory system and to recover gene networks via analysis of population gene-expression and genotype data. Despite many advantages of genetical genomics data analysis, the computational challenge that the effects of multifactorial genetic perturbations should be decoded simultaneously from data has prevented a widespread application of genetical genomics analysis. In this article, we propose a statistical framework for learning gene networks that overcomes the limitations of experimental perturbation methods and addresses the challenges of genetical genomics analysis. We introduce a new statistical model, called a sparse conditional Gaussian graphical model, and describe an efficient learning algorithm that simultaneously decodes the perturbations of gene regulatory system by a large number of SNPs to identify a gene network along with expression quantitative trait loci (eQTLs) that perturb this network. While our statistical model captures direct genetic perturbations of gene network, by performing inference on the probabilistic graphical model, we obtain detailed characterizations of how the direct SNP perturbation effects propagate through the gene network to perturb other genes indirectly. We demonstrate our statistical method using HapMap-simulated and yeast eQTL datasets. In particular, the yeast gene network identified computationally by our method under SNP perturbations is well supported by the results from experimental perturbation studies related to DNA replication stress response. Recent advances in the next-generation sequencing and other high-throughput technology has allowed researchers to collect various types of genome-scale datasets, providing unprecedented opportunities to discover detailed gene regulation processes in cells via analysis of the massive data. The standard approaches for identifying the causal regulatory relationship among genes have been based on examining gene-expression data collected after an experimental perturbation of one or two genes such as in gene knockout studies [1], [2] or over-expression studies [3]. In a typical experimental design, genome-wide gene-expression levels are measured using microarrays under different experimental conditions such as strains with one or two genes knocked out [1], [2]. Then, the differential gene-expression patterns between control and experimental conditions are examined to obtain clues as to the organization of genes into functional modules and key regulators of those modules. However, this standard approach for identifying the wiring of gene networks based on experimental perturbations of gene regulation system comes with many limitations. Experimentally perturbing the activity of a gene can be very costly, time-consuming, and laborious and it is even more so for repeating such perturbation for every single gene in an organism to obtain a comprehensive picture of gene network wiring. Furthermore, the experimental methods are usually limited to a perturbation of one or two genes at a time due to experimental infeasibility and combinatorial explosion in the number of experiments to perform. Thus, they cannot be used to perturb more than two genes at the same time to obtain information on multifactorial gene interactions. More importantly, it is often not possible to apply such experimental perturbation studies to humans for ethical reasons. Finally, given the set of differentially expressed genes under each perturbation, it is difficult to distinguish between those genes that are directly regulated by the perturbed gene and those genes in the downstream of the pathway whose expressions are influenced as secondary/indirect effects. Genetical genomics approach has been proposed as a less expensive but more powerful alternative to the approach with experimental perturbations [4], [5]. Genetical genomics treats genetic variation as naturally-occurring perturbation of gene regulatory networks and tries to learn gene networks by examining the effects of genetic variation on gene expression measurements within a large population of individuals. The key advantage of genetical genomics approach is that unlike experimental perturbations that can be performed only on one or two genes at a time, there are more than millions of genetic variants across genomes in the case of a human population, enabling the effects of multifactorial perturbations to be observed directly in gene expression data. Another advantage is that while experimental perturbation studies involve artificial perturbations in lab with often large perturbation effects, the perturbations of gene network by genetic variants occur in nature and usually induce more subtle changes in gene expressions. Thus, understanding the consequences of network perturbations by genetic variants is likely to lead to more direct understanding of the gene networks that exist in nature. In addition, genetical genomics approach can be easily applied to humans as well as other organisms, since genotype and gene-expression data are routinely collected for the purpose of expression quantitative trait locus (eQTL) mapping to understand the genetic architecture of complex phenotypes and diseases [6], [7]. However, the genetical genomics approach poses a significant computational challenge, because it is not obvious how to decode the effects of multifactorial genetic perturbations from genotype and gene expression data. In an experimental approach with a perturbation of one or two genes, the genes that are differentially expressed under each perturbation experiment can be easily identified with a simple computation. However, in genetical genomics approach, the gene expression variability is the result of aggregated effects of multifactorial perturbations by a large number of genetic variants and it is not obvious how to decouple the aggregated perturbation effects to identify the set of genes that are differentially expressed with respect to each perturbation by each individual genetic variants. Furthermore, as many of the genetic variants do not have any functional consequences or perturbation effects, genetical genomics approach has an additional computational challenge of identifying eQTLs or the genetic variants that affect gene expressions, while identifying the gene network perturbed by these eQTLs at the same time. Because of these computational challenges, given gene-expression and genotype data, researchers tended to limit their analysis to eQTL mapping, where eQTL mapping can be viewed as a special case of genetical genomics analysis that assumes an isolated effect of genetic perturbation on a single gene with no downstream effects in gene network. While statistical methods such as graph-guided fused lasso (GFlasso) [8] have been developed to detect genetic effects on multiple correlated gene-expression traits, they focused only on eQTL mapping assuming a known gene network, instead of performing a more powerful genetical genomics analysis. Those few existing computational methods for genetical genomics analysis have been limited in terms of computational efficiency and statistical power [9]–[12]. For example, discovering eQTLs and reconstructing the gene network perturbed by those eQTLs were performed in two separate steps, leading to reduced statistical power [9], or average gene-expression levels within each gene module were used as a trait to identify eQTLs rather than using the original gene-expression data, leading to the loss of information on individual gene activities [13]. In this paper, we propose a statistical framework that directly addresses all of the above computational challenges of genetical genomics analysis within a single statistical analysis to achieve the maximum statistical power for identifying gene networks via single-nucleotide-polymorphism (SNP) perturbations. Given SNP genotype and gene-expression data collected for a large number of individuals, our statistical method simultaneously identifies 1) the gene network structure by decoding the effects of multifactorial perturbations of gene regulation system by a large number of SNPs, 2) eQTLs that perturb this gene network, 3) the genes whose expressions are directly perturbed by eQTLs and the genes whose expressions are indirectly perturbed as secondary downstream effects of the direct perturbations in the network, and 4) detailed characterizations of the SNP perturbation effects on the gene network by decoupling the complex multifactorial SNP effects on the gene network with respect to each individual perturbation. Our proposed statistical framework is based on probabilistic graphical models, and in particular, we introduce a new statistical model, called a sparse conditional Gaussian graphical model (CGGM), that models a gene network under SNP perturbations as an undirected graphical model. In our statistical model, the unknown gene network is represented as a graph over gene-expression traits and this graph is associated with an unknown probability distribution that models the strengths of gene-gene interactions in the gene network and the strengths of perturbation effects of SNPs (Figure 1A). Then, both the gene network structure perturbed by SNPs and probability distribution associated with the network structure are learned jointly from data. We show that the learning problem is convex, leading to increased statistical power and a guarantee in the quality of the estimated model, and develop an efficient learning algorithm that scales to a large dataset. Given the estimated graphical model, we describe inference methods to characterize the detailed mechanisms of how the effects of SNP perturbations propagate through the network (Figures 1B–D). From the computational point of view, addressing the challenges of genetical genomics analysis requires handling the computational challenges of both gene-network analysis given gene-expression data and eQTL mapping given gene-expression and genotype data, namely gene-network structure learning and SNP feature selection, at the same time. We show that in fact our sparse CGGM subsumes as special cases both a sparse Gaussian graphical model [14]–[17], which is popular as a model for gene network, and a sparse linear regression model [8], [18], [19], which is widely used for eQTL mapping, thus providing a natural unifying representation for a gene network and eQTLs perturbing this network. Moreover, by embedding the standard regression model for eQTL mapping within a probabilistic graphical model and leveraging the representational power of a graphical model, our approach allows to extract a significantly more detailed characterization of the functional roles of eQTLs than any of the existing methods for eQTL mapping. In our experiments, we apply our statistical framework to HapMap-simulated and yeast eQTL datasets [20], [21]. Using HapMap-simulated data, we demonstrate our approach can recover the true underlying gene network under SNP perturbations, and at the same time, can recover true eQTLs with greater statistical power than other existing methods that have been developed for eQTL mapping. In addition, we applied our method to yeast eQTL dataset collected for 112 segregants of two yeast parent strains, BY4716 and RM11-1a [21]. Nearly all of the previous analyses of this dataset focused either on eQTL mapping or on gene network analysis ignoring the genetic information, with an exception of the genetical genomics analysis of this dataset performed by multivariate regression with covariance estimation (MRCE) [22] that has also been mistakenly called sparse CGGM [23] as we further discuss in the next section. However, the analysis by MRCE [23] was performed for only a small subset of the full dataset because of its expensive computational cost. In our experiment, MRCE took more than weeks of computation to analyze the full yeast eQTL dataset, whereas our method ran within a day. We provide an in-depth analysis of SNP perturbations of a subnetwork over genes involved in stress response in yeast, and show that this subnetwork obtained from SNP perturbations by our approach is well supported by the network inferred from experimental perturbations in knock-out studies in the literature. A Gaussian graphical model defines a probability distribution over an undirected graph that models a gene network. The nodes of the graph correspond to continuous-valued random variables for gene-expression traits and the edges represent probabilistic conditional dependence relationships between pairs of nodes [14]–[17]. Given microarray gene-expression measurements for genes and individuals, a Gaussian graphical model assumes that the gene-expression measurement for the th individual is an independently and identically distributed sample from a Gaussian distribution, where is a vector of 0' s and is a covariance matrix. Then, it is well-known that the inverse covariance represents a Gaussian graphical model, where the non-zero (or zero) value for in the th entry of represents the presence (or absence) of edges between the th and th gene-expression traits in the gene network. While each non-zero element in implies conditional dependency between the th and th gene-expression traits given all the other gene-expression traits, computing the inverse of to obtain the covariance amounts to performing an inference in this graphical model to obtain marginal dependencies, or equivalently dependencies between the two nodes without consideration of any other nodes. Graphical lasso [14], [16], [24] has been widely used to learn a sparse Gaussian graphical model, where only statistically significant gene-gene interactions have edges with non-zero entries in. Graphical lasso minimizes the negative log-likelihood with sparsity-inducing penalty as follows: (1) where is the trace of matrix, is the sample covariance matrix, is the norm of, and is the regularization parameter that determines the amount of sparsity. A large value of leads to a sparser estimate with a greater number of zero elements in. The optimal value for can be determined using cross-validation. The problem in Eq. (1) is convex and can be solved efficiently [16]. In eQTL mapping, the problem of identifying SNPs influencing gene-expression levels from eQTL data is often formulated as that of learning a multivariate linear regression model [8], [18], [19]. Given genotype data for SNPs, where is a vector of length with each element taking values from for the number of minor alleles at the given locus, and the expression measurements for genes for samples, a linear regression model for the functional mapping from SNPs to gene-expression traits is given as: (2) where is the regression coefficient matrix representing the unknown association strengths, and is the matrix of noise terms whose rows are Gaussian-distributed with mean zeros and covariance. Typically, a model without an intercept is considered, assuming that the genotype data are standardized to have mean and unit variance. Since each gene-expression trait typically has only a small number of eQTLs, lasso [19], [25] has been widely used to obtain a sparse estimate of. Lasso minimizes the squared-error criterion with penalty as follows: (3) where is a regularization parameter that controls the amount of sparsity in. Eq. (3) is convex with a single globally optimal solution, and efficient algorithms are available for solving it [26]. Lasso essentially performs separate regression analyses, treating the gene-expression traits as independent of each other. In order to combine the statistical power across multiple correlated gene-expression traits, GFlasso [8] assumed a known gene network and extended the standard lasso by including an additional penalty, called graph-guided fusion penalty, that encourages multiple related genes in the gene network to be influenced pleiotropically by a common SNP. Given a gene network with a set of edges and edge weights' s for each edge between the th and th genes, the graph-guided fusion penalty takes the form of, where each term in the penalty encourages the amount of influence of the th SNP on the expression levels of the th and th genes to be similar if the two genes are connected with an edge in the network. GFlasso was capable of identifying SNPs with pleiotropic effects, but it was restrictive in that the gene network should be known a priori. Within the same statistical framework of linear regression method, MRCE [22] attempted to shift the focus from eQTL mapping towards genetical genomics analysis by identifying the gene network and eQTLs jointly. Towards this goal, MRCE relaxed the assumption of uncorrelated noise (i. e., being a diagonal matrix) in lasso and estimated the full noise covariance matrix. Then, the inverse of the noise covariance corresponds to a gene network. MRCE minimizes the negative log-likelihood of data with an penalty for both and: (4) where and are the regularization parameters. We notice that unlike GFlasso, MRCE does not have any mechanisms to leverage the estimated gene network to model pleiotropic effects of SNPs on multiple correlated gene-expression traits in. The optimization problem in Eq. (4) is not convex, but bi-convex, since fixing either or and solving for the other is a convex optimization problem. Thus, Rothman et al. [22] proposed to optimize for each of and alternately given the other over iterations. However, they noted that this strategy often does not converge, and instead suggested to use an approximate method that prematurely terminates the iterative optimization procedure after two iterations. As we discuss in the Results section, we found that even this approximate method was too slow to be applicable to a dataset of even moderate size. The same statistical method for MRCE has been proposed independently in the literature under the name of sparse conditional Gaussian graphical models (CGGMs) [23]. However, we emphasize that the statistical model that is learned in MRCE is not a graphical model, because as we further discuss in detail in the next sections, the parameters do not model conditional dependencies as in graphical models but only models marginal dependencies. We believe that MRCE was mistakenly called a sparse CGGM due to the resemblance between the inverse noise covariance matrix in MRCE and the inverse covariance matrix in graphical lasso as well as the aspect of the standard regression model as a conditional model for given. The sparse CGGM that we propose in this paper is set up as a proper probabilistic graphical model and as we show in the next sections, is significantly more powerful than MRCE in terms of representational power and computational efficiency. Under the same name of sparse CGGMs, Li et al. [27] introduced a related but different statistical method that also models a gene network corresponding to in MRCE. However, unlike our approach and MRCE, the estimation procedure for the sparse CGGM in [27] amounted to a two-stage process, where the gene-expression data are pre-processed to remove SNP effects in the first stage and then these pre-processed gene-expression data are used to learn a gene network in the second stage. Thus, their graphical model was defined only on gene-expression traits and did not directly model the relationship between SNPs and gene expressions to identify eQTLs. In contrast, our sparse CGGM is set up as a graphical model on both gene expressions and SNPs, performs a joint estimation of gene network and eQTLs, and infers various perturbation effects of SNPs on gene expressions via inference. In this section, we introduce a statistical model for CGGM as a model for a gene network under SNP perturbations. Then, in the next sections, we describe a learning algorithm for estimating a sparse model for CGGM from data and discuss inference schemes for the estimated sparse CGGM. A sparse CGGM estimated from data captures the gene network structure and direct perturbations of the gene-expression levels by eQTLs via conditional dependency structure in the estimated graph structure. By performing inference on this estimated sparse CGGM, we can obtain a detailed characterization of how the direct SNP perturbation effects propagate through the gene network to perturb the expression levels of other genes indirectly. The key idea behind our proposed approach is to model a gene network under SNP perturbations as a Gaussian graphical model for a gene network conditional on SNPs. We derive a CGGM as a conditional distribution from the Gaussian graphical model for a joint probability distribution for SNPs and gene-expression traits for the th individual. Let us assume a Gaussian graphical model with covariance and inverse covariance, where zero mean is assumed after mean-centering each gene-expression trait and SNP. Then, the conditional distribution of given can be obtained as. We further re-write this conditional distribution, using the inverse covariance matrix and the partitioned inverse formula [28] to obtain a CGGM: (5) CGGM parameters and represent a gene network and SNP perturbation effects on this gene network, respectively. A non-zero value for the th element of indicates that the th SNP is an eQTL for the th gene-expression trait. This SNP perturbation captures the direct influence of the th SNP on the th gene expression, since the graphical model captures conditional dependencies. While in experimental perturbation studies the expressions of only one or two genes can be directly perturbed (e. g., by knocking out the genes), our CGGM for genetical genomics study allows multiple gene-expression traits to be perturbed by multiple SNPs at the same time. Then, this multifactorial genetic perturbations of gene-expression levels are decoded to learn a gene network by a learning algorithm that estimates and simultaneously. In order to show the direct correspondence between a CGGM and a general undirected graphical model, we re-write Eq. (5) by expanding the quadratic term in the Gaussian distribution in Eq. (5) to obtain: (6) where is a constant, also known as a partition function in the literature of probabilistic graphical models [29], which ensures that forms a proper probability distribution integrating to. As Eq. (6) is equivalent to the Gaussian-distribution form in Eq. (5), this constant can be obtained in a closed-form by directly comparing Eq. (6) with Eq. (5). If is positive definite, the integral in the partition function is finite and the probability distribution is well-defined. The representation in Eq. (6) explicitly shows that a CGGM is an undirected graphical model [29] defined over a graph with two sets of edges, namely the set of edges connecting each pair of gene-expression traits in gene network and another set of edges connecting each SNP to gene expressions that the SNP is influencing (Figure 1A). Then, following the definition of an undirected graphical model [29], the numerator in Eq. (6) is a weighted sum of features over the graph edges, where' s and' s are features and and define edge weights. The gene network is modeled an undirected graph, but the directions from SNPs to gene-expression traits are implicit, since the model is a conditional probability model for gene-expression traits conditional on SNPs. Since both gene-gene interactions and SNP perturbations of gene-expression traits are highly modular and localized, we are interested in learning a sparse model for CGGM. In other words, only statistically significant gene-gene interactions should be represented as edges with non-zero entries in and only a small number of statistically significant direct SNP perturbations should be estimated as having non-zero effect sizes in. In order to impose a sparsity constraint, we learn a sparse CGGM by minimizing the negative log-likelihood of data with an penalty as follows: (7) where is the negative log-likelihood of data based on Eq. (6) or equivalently Eq. (5), and and are the regularization parameters that control the amount of sparsity. It is not necessary to explicitly consider the positive-definite constraint for within the optimization problem in Eq. (7), because the partition function in the data log-likelihood contains term that acts as a log-barrier function for the positive-definite constraint [30]. Within the penalty for, we do not penalize the diagonal elements of, since we found that this leads to a slightly better performance in our experiments, consistent with what has been reported for graphical lasso. It is straightforward to prove that the problem in Eq. (7) is convex (Text S1) [30]. Thus, the learning algorithm is guaranteed to find the globally optimal solution that achieves the maximum statistical power. The main challenge for solving Eq. (7) arises from the non-smoothness of the penalty function. We adopt a variant of accelerated proximal gradient algorithms, called a Nesterov' s second method [31], that has been developed as a general-purpose algorithm for handling a non-smooth component of the parameter estimation problem while improving the convergence (and thus, computation time) of the standard gradient descent algorithm [31]–[33]. We provide details of the learning algorithm in Text S2. Lasso [25] and graphical lasso [14], [16], [24] can be viewed as special cases of the sparse CGGM estimation problem in Eq. (7). When, the sparse CGGM learning problem in Eq. (7) essentially reduces to applying graphical lasso to gene-expression data, ignoring genotype data, since the large encourages all or nearly all of the elements of to be set to zeros. On the other hand, if, the sparse CGGM learning problem becomes equivalent to lasso that fits a regression model for each gene-expression trait separately, ignoring gene network, since the large tends to set all or almost all of the off-diagonal elements of to zeros. The optimal values for and that strike the right balance between these two extreme cases can be found by cross-validation. So far, we showed that by learning a sparse CGGM, it is possible to decode the underlying gene network and its direct multifactorial perturbations by SNPs from data. Now, we show that given a sparse CGGM estimated from data, we can perform inference on this graphical model to characterize the mechanisms of SNP perturbations of gene network in detail. Below, we discuss how inference schemes can be used on our estimated model to learn about indirect/secondary downstream effects of the direct SNP perturbations, a decomposition of the overall multifactorial SNP perturbation effects with respect to each individual direct perturbation, and a decomposition of observed covariance in gene expressions into genetic and non-genetic components. We note that all of these inference schemes involve only few simple matrix operations and are highly efficient. In order to simulate eQTL datasets, we used the SNP genotype data from HapMap phase III release 2 [20] as SNP data and simulated gene-expression traits, given and known model parameters. We used the SNP data for chromosome 21 of the 343 individuals of African origin, including ASW, LWK, MKK, and YRI population groups. After removing SNPs with minor allele frequency and highly correlated SNPs with squared correlation coefficient, we obtained 4,901 SNPs. In each simulated dataset, we randomly selected a region of 500 SNPs and simulated the values of 30 gene-expression traits for each individual, based on the CGGM in Eq. (5). As almost all statistical methods for eQTL mapping assumes the standard linear regression model in Eq. (2), we performed experiments on gene-expression traits simulated from this model as well. In order to set the model parameters, we first set the sparsity pattern and then assigned values to the non-zero elements of the parameters as follows. While in our simulation studies we primarily focused on the relatively small datasets of 500 SNPs and 30 gene-expression traits as described above, in order to demonstrate the performance and scalability of our method, we also applied our method to larger-scale simulated datasets of 1,000 SNPs and 500 gene-expression traits. Because MRCE, the main competing method to our approach, required substantially more computation time than our approach even on the smaller datasets, we were unable to compare the performance of MRCE on these larger simulated datasets. Instead, we compared our method with other computationally efficient methods, including GFlasso and a base-line approach of applying graphical lasso [16] and lasso [25] sequentially to learn gene networks and eQTLs. We use precision-recall curves and prediction errors as quantitative measures of the performance of different statistical methods. Precision-recall curves summarize how accurately each method recovers the true eQTLs and gene network structure by plotting precisions and recalls on - and -axes. In order to compute precisions and recalls, for each simulated dataset, we ranked all the elements of the estimated parameter matrices in a descending order according to their absolute values and compared this ranked list with the set of non-zero elements in the true parameters. On the other hand, prediction errors evaluate the performance of different methods on how accurately each method can predict gene-expression levels, given SNPs and estimated model parameters. Once the parameters are estimated using training data, prediction errors are obtained as, where is the prediction of gene expressions given by the model for the th individual in an independent test dataset and is the number of samples in the test set. Given the 343 samples in the full dataset, we used 300 samples as a training dataset and the remaining 43 samples as a test dataset. In order to determine the optimal regularization parameters in sparse CGGM, MRCE, and GFlasso during the training phase, we created a grid for different choices of regularization parameters, performed a five-fold cross-validation for each point on the grid, and selected the values that give the smallest cross-validation error as the optimal regularization parameters. In order to illustrate the behavior of a sparse CGGM, we present the results from applying our method to a single dataset simulated from a CGGM parameterization and compare them with what we obtained from GFlasso and MRCE (Figure 2). The non-zero elements of the true model parameters were drawn from for and for. Since GFlasso requires the gene network to be known, we used the correlation coefficient matrix of gene-expression trait data thresholded at as a gene network in GFlasso estimation. The true parameters for and along with are shown in the left, middle, and right columns, respectively, in Figure 2A. The estimated parameters for sparse CGGMs, MRCE, and GFlasso are shown in Figures 2B–D, respectively. In the plots for and, the rows and columns correspond to gene-expression traits and SNPs, respectively, and the results are shown only for the first 150 SNPs. In each panel, the white pixels correspond to the zero elements of the parameters and the darker pixels to non-zero elements. We note that while sparse CGGM provides the estimates of both and, MRCE and GFlasso provide a single estimate of eQTL effect sizes in and do not distinguish between direct and indirect effects of eQTLs on gene-expression traits. As shown in Figure 2B, our method successfully recovers the three gene modules in the true gene network as the block-diagonal structure in along with the sparse direct perturbation of this network by eQTLs in. When we perform inference in the estimated sparse CGGM by computing to learn indirect perturbation of the network by eQTLs, the direct perturbations of eQTLs in propagate primarily within each gene module in, leading to vertical stripes in. Although MRCE learns a gene network from data, unlike sparse CGGM, it does not have any mechanism to leverage this gene network to learn pleiotropic or indirect effects of eQTLs on gene modules and the estimated in Figure 2C shows isolated eQTLs for individual gene-expression traits rather than vertical stripes. As can be seen in Figure 2D, the GFlasso estimate of shows vertical stripes for eQTLs common within each gene module. However, it is immediately clear that GFlasso results have significantly more false positives for eQTLs than sparse CGGM and MRCE. This demonstrates that genetical genomics approach has the potential to improve the accuracy for detecting eQTLs than the conventional approach that focuses solely on eQTL mapping. We performed a quantitative comparison of the performance of sparse CGGM, MRCE, and GFlasso, by obtaining precision-recall curves and prediction errors averaged over 50 simulated datasets. Since MRCE and GFlasso are based on the standard linear regression model and sparse CGGM is based on a graphical model, we evaluate the different methods on datasets simulated from both models. Since MRCE and GFlasso use the standard linear regression model, we also compared the performance of the different methods, using datasets simulated from the model in Eq. (2) with known parameters for and (Figure 6). We present the precision-recall curves for and averaged over 50 simulated datasets in Figures 6A and B, respectively, and show the prediction errors in Figure 6C. In our simulation, we set the true parameter values to random draws from for and for. As can be seen in Figure 6, even if the datasets were simulated from the standard linear regression model as used in MRCE and GFlasso, our method still outperforms MRCE and GFlasso. The simulation results so far demonstrated that our method has greater power for identifying gene networks and eQTLs than other methods. However, in these experiments, we were constrained to use relatively small datasets of only 30 gene-expression traits with 500 SNPs, because MRCE could not handle larger datasets effectively in a systematic simulation study. In this section, we demonstrate the effectiveness and scalability of our method, using substantially larger simulated datasets of 500 gene-expression traits and 1,000 SNPs. Given a region of 1,000 SNPs from chromosome 21 of the African individuals in HapMap phase III SNP data as described above, we simulated the values for 500 gene-expression traits, assuming sparse CGGMs with the true parameters determined as follows. We assumed that the true gene networks are scale-free networks, and set the network using the following strategy. First, we determined the number of neighbors of each node by making a random draw from a power-law distribution. Then, we applied the algorithm for generating a scale-free network [36] that repeatedly connects two nodes until we achieve the desired node degrees initially determined according to the power-law distribution. Given this network structure, we set the edge weights to random draws from a uniform distribution, and set to the graph Laplacian of the edge-weight matrix with small positive values added to the diagonal elements. We set the true eQTLs in by choosing each SNP as an eQTL for each gene-expression trait with probability and selecting one additional SNP as an eQTL for hub nodes with more than 20 neighbors in the network. For each eQTL in, we set the eQTL effect sizes to random draws from a uniform distribution with the signs of the values determined randomly. In Figure 7, we compare the performance of the different methods averaged over 30 datasets simulated according to the above strategy. The results are shown for the precision-recall curves for the accuracy of detecting gene-network structures (Figure 7A) and eQTLs (Figure 7B) as well as prediction errors (Figure 7C). As MRCE could not run on a single dataset of the given size within a few days, instead of using MRCE in our experiment, we compared our method with GFlasso and also with a two-stage method of applying graphical lasso and lasso to learn gene networks and eQTLs separately. We observe from Figure 7 that sparse CGGMs outperform all the other methods on these large-scale datasets. In order to examine the scalability of sparse CGGM, MRCE, and GFlasso, we compared the computation time for a single run of the different methods on varying sizes of datasets in Figure 8. Figure 8A shows the computation time for varying the number of gene-expression traits with the number of SNPs fixed at, whereas Figure 8B shows the results from varying the number of SNPs with the number of gene-expression traits fixed at. Even though we used the approximate method for MRCE to reduce the computational cost of the exact method, our sparse CGGM optimization is more efficient by orders of magnitude than MRCE for problems of all sizes. Although GFlasso is more efficient than both sparse CGGM and MRCE, it is significantly more limited in that it focuses only on the problem of eQTL mapping. We applied our method to an eQTL dataset collected for two yeast parent strains, BY4716 (BY) and RM11-1a (RM), and their 112 segregants [21]. We obtained SNP genotypes for 1,260 loci after removing the redundant SNPs with the same genotypes in neighboring regions of the genome and obtained expression measurements for 3,684 genes after removing the genes whose expression measurements were missing for more than 5% of the 114 samples. In order to select the optimal regularization parameters and, we performed a cross-validation with three random splits of data into 100 samples for estimating model parameters and 14 samples for computing cross-validation errors. Then, a final estimate of parameters was obtained by training a model on the entire dataset using the optimal regularization parameters. Below, we examine the yeast gene network and eQTLs with direct and indirect perturbations estimated by our method. In addition, we provide an in-depth analysis of a subnetwork with a strong evidence of being involved in DNA replication stress response based on the literature. We also provide a quantitative comparison of sparse CGGMs and other methods in terms of prediction errors. Since many previous works showed that gene networks tend to have a scale-free topology with few hub genes having many neighbors, we examined the gene network parameters in the estimated sparse CGGM for a scale-free property [37]. Given the network edge weights in, we defined the degree of each node as the sum of the absolute values of all incoming edge weights for the node. Then, the best ordinary least square fit of linear model for the empirical cumulative degree distribution was, showing that the estimated network has a strongly scale-free topology. Overall, in our estimate of network, 14 genes were connected to more than 100 other genes, 156 genes had more than 10 neighbors, and 1,593 genes had at least one neighbor. We hypothesized that each hub gene and its immediate neighbors form a hub-gene module and are involved in a common biological process. In order to test this hypothesis, we performed a gene ontology (GO) enrichment analysis for the 25 largest hub-gene modules, using Fisher' s exact tests (Table 1). We found that each hub-gene module was significantly enriched with genes in a common GO category, showing that the genes in each hub-gene module are likely to participate in a common pathway. Next, we examined the eQTLs identified by our method as perturbing the above gene network. The eQTLs with direct perturbations of the gene network as captured in tended to concentrate on a small number of genetic loci, forming eQTL hotspots. Although the sparsity pattern of showed that 1,248 out of 1,260 SNP loci regulate directly at least one gene-expression trait, the top 10 SNPs that affect the largest number of gene-expression traits accounted for 15. 8% of all SNP/gene-expression-trait pairs with direct influence of SNPs on gene-expression traits, and the top 20 SNPs accounted for 28. 5%. We defined these top 20 SNPs as eQTL hotspots, and the genes directly regulated by each eQTL hotspot as a hotspot-regulated gene module (Table 2). In order to avoid redundancy, in the case of multiple eQTL hotspots within a 20 kb region with largely overlapping hotspot-regulated gene modules, we examined only one of those hotspots with the largest hotspot-regulated gene module. Out of the 13 eQTL hotspots that have been previously reported in analysis of the same dataset in [38], 9 hotspots overlapped with the results from our method. In order to investigate whether the genes in each hotspot-regulated gene module are involved in a common biological function, we performed GO enrichment analysis (Table 2). We performed Fisher' s exact tests, using GO slim categories downloaded from http: //www. geneontology. org/GO. slims. shtml, after removing the GO categories with more than 500 genes. Our results show that all of the hotspot-regulated gene modules are significantly enriched for some GO categories, providing evidence that each eQTL hotspot regulates a functionally coherent set of genes. Since indirect SNP perturbations result from direct SNP perturbations propagating through the network, eQTLs with direct perturbations are likely to have stronger effect sizes than indirect perturbations. In Figure 9A, we compared the overall distribution of effect sizes of direct and indirect SNP perturbations as captured in and of the sparse CGGM by plotting histograms of the absolute values of non-zero elements in and. For indirect SNP perturbations, only those SNP/gene-expression-trait pairs that were estimated to be zero in but non-zero valued in were included. As can be seen in Figure 9A, the direct perturbations are generally stronger than indirect perturbations, confirming our hypothesis. Then, we examined whether the direct SNP perturbations estimated by our method are more likely to be cis eQTLs than the indirect perturbations. We declared the direct and indirect SNP perturbations in and as cis eQTLs, if for a given pair of SNP/gene-expression-trait, the gene sequence overlaps with the linkage region represented by the given SNP. The histogram in Figure 9B shows the distribution of the effect sizes of the estimated direct and indirect SNP perturbations for cis eQTLs. As can be seen in Figure 9B, direct SNP perturbations are significantly more frequent in cis eQTLs than indirect SNP perturbations, and explain nearly all of the cis eQTLs with strong effect sizes. When we examined the cis eQTLs with direct perturbations in our estimated model, we found that our approach was able to identify some of the well-known direct genetic perturbations in the literature. The genotypes for LEU2, URA3, HO, and LYS2 are known to differ in the parent strains, BY and RM, where these genetic differences have a large impact on the expressions of the corresponding genes as well as other genes [21]. While LYS2 was not included in our analysis, the LEU2, URA3, and HO expressions were found to have cis eQTLs with direct perturbations in our analysis, and at the same time, in our estimate of gene network, LEU2 and URA3 appeared as hub genes with more than 50 neighbors. In particular, the cis eQTLs with direct perturbations of LEU2 and URA3 were found to have the strongest effects among all cis eQTLs shown in Figure 9B, whereas HO had a cis eQTL with moderately strong direct perturbation. These results provide evidence that our method can recover the true direct SNP perturbations of a gene network, by decoupling direct SNP perturbations of gene expressions from their secondary/indirect effects on other gene expressions. We performed an in-depth analysis of the subnetwork around the TFS1 gene and its perturbation by eQTLs. This subnetwork is shown in Figure 10A, where the edge thicknesses correspond to the absolute values of edge weights in, representing the strength of dependency between two gene-expression traits. To avoid clutter, we only show the edges with the absolute values of edge weights. This subnetwork in Figure 10A contains many genes involved in DNA replication stress response and other types of stimulus response. In particular, TFS1 has been identified as a high-copy suppressor of guanine nucleotide-exchange factor CDC25, which activates the Ras/cyclic AMP pathway regulating growth and metabolism in response to nutrients [39]. Many of the genes in this subnetwork, including TFS1, its immediate neighbors (PGM2, SOL4, RTN2, GDB1, RME1, PRB1, SDS24, IGD1), and 22 other genes, have been previously observed with changed abundance or localization under DNA damage [40]. In addition, the DDR2 gene in the subnetwork that codes for the DNA damage responsive protein has been found to have multi-stress response function [41]. Also, several hub genes in the subnetwork have been annotated as responding to other stress conditions such as heat shock (HSP26) and oxidative stress (CTT1 and GAD1) [42]–[44]. In this paper, we presented a new statistical framework for genetical genomics analysis to learn a gene network by treating SNPs as naturally occurring perturbants of a gene network. Within this framework, we introduced a statistical model, called a sparse CGGM, for modeling a gene network under SNP perturbations and discussed an efficient learning algorithm and inference methods. While genetical genomics approach has been recognized as a more effective and less costly method for learning a gene network than experimental methods, this approach has not been widely used mainly because of the computational challenge that the effects of perturbations by often millions genetic variants at a time need to be decoded from data. Our approach directly addresses this challenge and identifies a gene network by decoupling the effects of multifactorial perturbations in eQTL data. At the same time, our approach addresses many of the weaknesses of the experimental methods and is able to identify which genes are directly perturbed by each SNP or are indirectly perturbed as downstream effects in the pathway. As eQTL data collection is being routinely performed for model organisms, and is more amenable for human tissues than experimental perturbations, our approach opens up doors to the possibility of leveraging these datasets for gene network learning rather than focusing on finding eQTLs from such data. Although the primary goal of our work and more generally genetical genomics analysis is to identify a gene network, our statistical approach has additional advantages of enhancing the current statistical tools of eQTL mapping and extracting significantly more detailed information on the functional role of eQTLs in the context of gene network. Our approach provides a flexible statistical framework for learning a gene network along with eQTLs that can be easily extended in several different ways. For example, although in this paper, our gene network was defined over the expression levels of mRNAs, it is straightforward to include microRNA expression data to construct a network over both mRNA and microRNA expressions, both of which can be perturbed by genetic variants. Another possible extension is to model epistatic interactions among SNPs within sparse CGGM by introducing additional features for SNP interactions in the probabilistic graphical model. However, there are certain limitations to our approach. Although our approach can handle thousands of gene-expression traits and SNPs efficiently, it is still not efficient enough to be directly applied to genome-wide analysis of eQTL datasets of higher-level organisms with tens of thousands of gene-expression traits and millions of SNPs. For such large-scale datasets, we suggest to split the full dataset into smaller sets of gene-expression traits by applying a clustering algorithm to obtain coarse-grained gene modules. Then, our approach can be applied to each subset of gene-expression traits for coarse-grained gene modules to extract fine-grained information on gene-network connectivities. In order to perform a full joint analysis of all data, in future work, we will consider improving the computational bottleneck of matrix inversion for the gene network parameters in the learning algorithm by replacing it with an approximate but computationally less expensive inversion. Another future direction is to relax the assumption in our model that the gene-expression traits under SNP perturbations follow a Gaussian distribution. Although Gaussian graphical models have been widely used to infer a gene network from gene-expression data due to many of the properties of Gaussian distributions that lead to easy computations, this assumption can be potentially restrictive for modeling realistic biological processes. The software for sparse CGGMs is available at http: //www. cs. cmu. edu/~sssykim/softwares/softwares. html#scggm.

Title: Learning Gene Networks under SNP Perturbations Using eQTL Datasets Summary: A complete understanding of how gene regulatory networks are wired in a biological system is important in many areas of biology and medicine. The most popular method for investigating a gene network has been based on experimental perturbation studies, where the expression of a gene is experimentally manipulated to observe how this perturbation affects the expressions of other genes. Such experimental methods are costly, laborious, and do not scale to a perturbation of more than two genes at a time. As an alternative, genetical genomics approach uses genetic variants as naturally-occurring perturbations of gene regulatory system and learns gene networks by decoding the perturbation effects by genetic variants, given population gene-expression and genotype data. However, since there exist millions of genetic variants in genomes that simultaneously perturb a gene network, it is not obvious how to decode the effects of such multifactorial perturbations from data. Our statistical approach overcomes this computational challenge and recovers gene networks under SNP perturbations using probabilistic graphical models. As population gene-expression and genotype datasets are routinely collected to study genetic architectures of complex diseases and phenotypes, our approach can directly leverage these existing datasets to provide a more effective way of identifying gene networks.

lay_plos

en

Summarize: By. Kate Lyons. Julia Gillard's former boyfriend and ex-union official Bruce Wilson has admitted he charged a construction company without providing them any of the training services he promised for almost a year. Thiess was invoiced by the Australian Workers' Union Workplace Reform Assocation, an alleged slush fund legally established by Julia Gillard and operated by Mr Wilson as treasurer. It is alleged that the money paid by Thiess was in part used to pay for Mr Wilson's home at Fitzroy in Melbourne. Former AWU official and ex-boyfriend of Julia Gillard, Bruce Wilson, arrives to give evidence at the Royal Commission into Trade Union Governance and Corruption, in Sydney today. 'The training work that you say was done began in the beginning of 1993,' counsel assisting the commission Jeremy Stoljar said, addressing Mr Wilson. 'So no training [of] the workers was done by the association for the calendar year 1992?'Mr Wilson told the royal commission into union corruption that was correct. 'I had some access to some paper work and I had looked at some things but in terms of on the site, that's correct,' he said, adding that self-confessed union bagman and associate Ralph Blewitt knew this as well. Mr Wilson denied the invoices were fraudulent, saying that the agreement was like a legal retainer between a law firm and a client. 'The agreement between Thiess and ourselves [was] that we would invoice them from the beginning of the contract to the nominated end of the contract,' he said. 'If for whatever reason you don't do legal work you still send the bill, I bet,' Mr Wilson said. The Royal Commission into union corruption is investigating union slush fund activity and whether money from the Australian Workers' Union funded the renovations of Julia Gillard's house. Bruce Wilson is the ex-boyfriend of Julia Gillard and allegedly made payments to her in the mid-90s. The royal commission into trade union governance and corruption is examining whether money was used to pay for renovations at Ms Gillard's Abbotsford property as well. Bruce Wilson was also confronted with a denial from beyond the grave by the man he says was central to a purported workplace safety scheme that has been described as a corrupt union slush fund. Mr Wilson told the Royal Commission into Trade Union Governance and Corruption on Thursday that the late Glen Ivory had been appointed as training officer on a Western Australia building site on behalf of the Workplace Reform Association (WRA), the organisation he set up with the assistance of his then-girlfriend and union lawyer Ms Gillard. However Mr Wilson was presented with a statement, made by Mr Ivory before his death, in which the one-time president of the WA branch of the Australian Workers' Union said no training officer was ever appointed and he was never aware of around $2,000 a week billed to construction firm Thiess to pay for the role. Mr Ivory died in 2004 but in a statement given to West Australian police in 1997, said the union had never authorised establishing the WRA or opening bank accounts in its name. Counsel assisting the commission, Jeremy Stoljar SC, asked Mr Wilson if his evidence that Mr Ivory was the training officer, was false. Mr Wilson denied that and questioned Mr Ivory's statement. 'I would like to know who prepared this statement for Ivory because it wasn't him,' Mr Wilson said. Mr Stoljar said: 'There seem to be a long list of people, according to you, who are not telling the truth.' 'You have used the name of the late Mr Ivory knowing that he's no longer with us and can't defend himself, is that right?,' Mr Stoljar said. Mr Wilson replied: 'Not at all. In fact I wish he was.' Yesterday, a builder told the commission that Mr Wilson paid for the renovations of Ms Gillard's home in 1993. Athol James, 84, said that he was paid by Julia Gillard for the renovations, who in turn was funded by cash payments from Mr Wilson, suggesting for the first time that there was a direct link between the former prime minister and the union funds. 'During the work I would deal with Ms Gillard in relation to any payment for the completed work,' Mr James said. 'I would give her the invoice. I am pretty certain she said she would get money from Bruce and pay me in the next few days. I'm certain she said Bruce was paying for it.' Mr James replaced some doors and windows in the home between March and June 1993 at a cost of $6,040 according to invoices tendered in the commission. In August a further invoice of $2,986 was submitted by Mr James' company for fencing and flooring at the home. One of Mr Wilson's former employees, Wayne Hem, a researcher and librarian for the Australian Workers' Union, also told the commission yesterday that in 1995 Mr Wilson gave him $5,000 to deposit in Ms Gillard's account. 'He took a wad of notes out of his pocket and he wrote on a piece of paper a bank account number,' Mr Hem said in his witness statement,' Mr Hem said of Mr Wilson. 'He handed me the cash and the piece of paper and asked me to deposit the cash. 'I looked at the paper, asked him to tell whose account it was, and handed him the piece of paper back so that he could write the details on the paper for me. 'He then wrote Julia Gillard on the piece of paper and handed it back to me.' Mr Hem counted the money and deposited it at the Commonwealth Bank in Carlton before returning to the office, he told the commission

Summary: Bruce Wilson is an allegedly corrupt union official. The union organisation of which he was treasurer received payment for a year of training services that they did not provide. Told the commission that the late Glen Ivory ran the training in WA. A statement made by Mr Ivory in 1997 denied he was involved in or knew about the position in WA or saw any of the money related to it. Yesterday a builder told the commission that Mr Wilson paid for renovations to Julia Gillard's home in 1993 and a union employee told of how Mr Wilson got him to deposit $5,000 into Julia Gillard's bank account.

cnn_dailymail

en

Summarize: Introduction Since 2008, California has experienced more dry years than it has wet years. Drought conditions in California are currently "exceptional" and "extreme" in much of the state, including in prime agricultural areas of the Central Valley, according to the U.S. Drought Monitor (see Figure 1 ). Such conditions pose significant challenges to water managers who before this dry winter were already grappling with below-normal surface water storage in the state's largest reservoirs. Groundwater levels in many areas of the state also have declined due to increased pumping over the last three dry years. While rains in March improved the water year outlook somewhat—moving the year from the driest on record in terms of precipitation to date to the third-driest—water managers are concerned about how long this drought will last and its long-term impacts. Further, the short-term effects of the drought are also a concern. A relatively dry winter with little existing snowpack raises the question over whether water supplies will be refreshed later in the year. The extent of the drought in California has generated varied and widespread effects. Most of the San Joaquin Valley is in exceptional drought—the most intense level of drought reported by the Drought Monitor—and federal and state water supply allotments are at historic lows. Many farmers are fallowing lands and some are removing permanent tree crops. Cities and towns have also been affected, and the Governor of California has requested voluntary water use cutbacks of 20%. The drought has also affected fish and wildlife species and the recreational and commercial activities they support. Current drought conditions in California and much of the West have fueled congressional interest in drought and its effects on water supplies, agriculture, and ecosystems. Several bills have been introduced in the 113 th Congress to address different aspects of drought in California and other regions. Of these bills, S. 2198 (Emergency Drought Relief Act of 2014) has passed the Senate, and H.R. 3964 (Sacramento-San Joaquin Valley Emergency Water Delivery Act) has passed the House. This report summarizes these two bills, discusses similarities and differences between the bills, and analyzes how these bills could address issues and questions associated with the drought in California. Central to addressing the drought from a federal and state perspective is the coordinated operation of the federal Central Valley Project (CVP) and the State Water Project (SWP). Both projects collect and store water in reservoirs in northern California. They also divert water from the San Joaquin and Sacramento rivers delta confluence with San Francisco Bay (Bay-Delta) and pump water south to water users in central and southern California. While the CVP serves mostly agricultural water contractors, the SWP serves largely urban or municipal and industrial contractors; however, both projects serve some contractors of both varieties. The operation of this system has been of interest Congress since there is a federal nexus with respect to the CVP. Congress and the Administration have been involved in addressing CVP operations through manuals and procedures laid out by existing federal laws such as the Endangered Species Act (ESA, P.L. 93-205, 16 U.S.C. §§1531-1543) and the Central Valley Project Improvement Act (CVPIA, Title 34 of P.L. 102-575 ). Summary of H.R. 3964 and S. 2198 H.R. 3964 H.R. 3964 was introduced on January 29, 2014, and entitled the Sacramento-San Joaquin Valley Emergency Water Delivery Act. It passed the House on February 5, 2014. H.R. 3964 is similar to H.R. 1837 (introduced in the 112 th Congress) with some notable additions. Below is a summary of each title in H.R. 3964. Each title addresses a different aspect of California water policy. Title I. Central Valley Project Water Reliability. Overall, Title I would make numerous changes to Central Valley Project (CVP) management and operations, primarily by amending the Central Valley Project Improvement Act (CVPIA). Specifically, it would amend CVPIA to broaden the purposes for which water previously dedicated to fish and wildlife can be used; add to the purposes a provision "to ensure" water dedicated to fish and wildlife purposes is replaced and provided to CVP contactors by the end of 2018 at the lowest "reasonably achievable" cost; change the definitions of fish covered by the act; broaden the purposes for which the Central Valley Project Restoration Fund (CVPRF) monies can be used; reduce revenues into the CVPRF; mandate operation of CVP and SWP according to a1994 interim agreement, the Bay-Delta Accord; and mandate development and implementation of a plan to increase CVP water yield by October 1, 2018. Title II. San Joaquin River Restoration. Title II would direct the Secretary of the Interior to cease implementation of the San Joaquin River Restoration Settlement Agreement, which was agreed to in 2006 and was authorized under the San Joaquin River Restoration Settlement Act (SJRRS) in 2010. It would declare that this legislation satisfies all obligations of the Secretary and others to keep in good condition any fish below Friant Dam, including obligations under the California Fish and Game Code, the state public trust doctrine, and the federal ESA. It would also remove the salmon restoration requirement in the SJRRS that was authorized in P.L. 111-11. Title III. Repayment Contracts and Acceleration of Repayment of Construction Costs. This title would direct the Secretary of the Interior, upon request from water contractors, to convert utility-type water service contracts to repayment contracts, and then allow accelerated repayment of those outstanding repayment obligations. Irrigation repayment obligations (net construction cost) for the CVP for 2012, the last year for which such data are readily available, total approximately $1.18 billion; municipal & industrial (M&I) repayment obligations for 2012, the last year for which such data are readily available, total approximately $121 million. Title IV. Bay-Delta Watershed Water Rights Preservation and Protection. Title IV would provide assurances of water rights protections for those with water rights senior to the CVP, including Sacramento River Valley Settlement Contractors. It would also direct a new shortage policy for certain north-of-Delta CVP water service contracts, which would aim to limit maximum reductions to these supplies. Title V. Miscellaneous. Title V declares that the unique circumstances of coordinated operations of the CVP and SWP "require assertion of Federal supremacy to protect existing water rights throughout the system" and that as such shall not set precedent in any other state. Title V also declares that nothing in the act shall "affect in any way" the State of California Proclamation of State Emergency and associated executive order issued by the governor on January 14, 2014. It would also adjust a Wild and Scenic River boundary, potentially allowing for increased storage at Exchequer Dam. S. 2198 S. 2198, the Emergency Drought Relief Act of 2014, was introduced on April 1, 2014, and passed the Senate on May 23, 2014. S. 2198 contains eight sections and is largely (but not entirely) focused on addressing water supply and drought issues in California. The following points summarize the sections in the bill: Section 1 and 2 are the Table of Contents and Findings of the bill, respectively. The Findings state that the 2013-2014 drought in California fully satisfies the conditions needed for exercising emergency decision-making, analytical, and public-review requirements under four laws: (1) The Endangered Species Act, (2) The National Environmental Policy Act of 1969, (3) water control management procedures of the Corps of Engineers (Corps) under 33 U.S.C. §222.5, and (4) the Reclamation States Emergency Drought Relief Act of 1991 ( P.L. 102-250 ). Section 3 includes definitions of terms used in the bill. For example, the term Secretaries is to include the Secretaries of Agriculture, Commerce, and the Interior, and the Administrator of the Environmental Protection Agency. Section 4(a) would direct the Secretaries to provide the maximum quantity of water supplies possible to CVP and Klamath Project agricultural, municipal and industrial (M&I), and refuge service and repayment contractors; SWP contractors; and any other locality or municipality in the state of California. This would be done by approving, consistent with applicable laws and regulations, projects and operations to provide additional water supplies as quickly as possible, and based on available information, to address emergency conditions. Section 4(c) of S. 2198 contains 13 subsections that would direct the Secretaries to implement several specific project-related and operational actions largely in California for carrying out Section 4(a). As with Section 4(a), Section 4(c) states that all actions are to be accomplished consistent with applicable laws and regulations. A summary of the 13 subsections under Section 4(c) is below: Section 4(c)(1) would direct the Secretaries to ensure that the Delta Cross Channel Gates (Delta Gates) remain open to the greatest possible extent and timed to maximize peak tide flood periods and to provide water supply and water quality benefits. This action would be authorized for the duration of the drought emergency-declaration by the state. According to the section, this operation is to be consistent with the State Water Resources Control Board (SWRCB) order for a Temporary Urgency Change (TUC) in terms, in response to drought, effective January 31, 2014, as modified by subsequent orders. Section 4(c)(2)(A) would direct the Secretaries to collect data associated with the operations of the Delta Gates and the effect of operations on threatened and endangered species listed under the Endangered Species Act (ESA), water quality, and water supply. Section 4(c)(2)(B) would direct an assessment of the data collected, and require the Director of the National Marine Fisheries Service (NMFS) to make recommendations for changing the operations of the CVP and SWP, including, if appropriate, changes to reasonable and prudent alternatives in the BiOps issued by NMFS on June 4, 2009. The provision states that the changes should be likely to produce fishery, water quality, and water supply benefits. Section 4(c)(3)(A) would direct the Secretaries to implement turbidity control strategies that would allow for increased water deliveries while avoiding jeopardy to adult delta smelt at the SWP and CVP pumps. This would be done according to the FWS Delta smelt BiOp. Section 4(c)(3)(B) would direct the Secretaries to manage reverse flow in the Old and Middle Rivers (OMR) according to the FWS Delta smelt Biological Opinion (BiOp) dated December 15, 2008, and the NMFS BiOp for salmonids, dated June 4, 2009, to minimize water supply reductions for the CVP and SWP. Section 4(c)(4) would direct the Secretaries to adopt a 1:1 inflow to export ratio (I:E ratio) for increased San Joaquin River flows resulting from water transfers and exchanges, among other purposes. The flow would be measured at Vernalis on a three-day rolling average from April 1 through May 31each year, as long as the governor's drought emergency declaration is in effect. Section 4(c)(5) would direct the Secretaries to issue all necessary permit decisions under their authority for temporary barriers or operable gates in Delta channels to improve water quantity and quality for SWP and CVP South-of-Delta water contractors and other water users within 30 days of receiving a permit application from the state. According to this section, barriers or gates "should" provide species benefits and protection and in-Delta water quality and "shall" be designed so that formal Section 7 consultation under ESA would not be necessary. Section 4(c)(6)(A) would direct the head of the FWS and the Commissioner of the Bureau of Reclamation (Reclamation) to complete all necessary National Environmental Policy Act (NEPA) and ESA requirements, within 30 days of receiving a request for a permit, for final permit decisions on water transfers associated with voluntary fallowing of nonpermanent crops in the state of California. Section 4(c)(6)(B) would direct the head of FWS to allow "any water transfer request associated with fallowing" to maximize water supplies for non-habitat use, as long as the action would comply with federal law and regulations. Section 4(c)(7) would direct the Secretaries "under the existing authority of the Secretary of the Interior," to participate in, provide grants to, or provide funding for, pilot projects to increase water in reservoirs in regional river basins that are experiencing "extreme, exceptional, or sustained drought." These basins would have to directly affect the water supply of California and includes the Colorado River basin. Further, the Secretary (presumably the Secretary of the Interior), is to work with the "respective State" in regards to providing grants, participation, or funding to or for activities in the Upper Division of the Colorado River. (It is unclear if State refers to a state other than California.) Section 4(c)(8) would direct the Secretaries to maintain all rescheduled water supplies in San Luis Reservoir and Millerton Reservoir for the following year, unless unable to do so due to storage capacity limitations. Section 4(c)(9) would direct the Secretaries to "the maximum extent possible... without causing land subsidence or violating water quality standards" meet contract water supply needs of CVP refuges through the use of water conservation measures, water conveyance facilities, and wells for groundwater resources. To accomplish these activities, the Secretaries would use funding available under the Water Assistance Program or WaterSMART Program of DOI. Further, Section 4(c)(9)(B) would redirect a quantity of water obtained from measures in subparagraph (A) from refuges to CVP contractors. Section 4(c)(10) would authorize the Secretaries to coordinate with the Secretary of Agriculture to create an agreement with the National Academy of Sciences to conduct a study on the effectiveness and environmental impacts of salt cedar biocontrol activities and their effect on increasing water supplies and improving habitat on the Colorado River in California and elsewhere. Section 4(c)(11) would direct that any WaterSMART grant funding allocated to California be made available on a "priority and expedited basis": (1) for emergency drinking and municipal supplies to meet minimum public health and safety needs; (2) to prevent loss of permanent crops; (3) minimize economic losses from drought; and (4) to provide conservation tools and technology with immediate water supply benefits. Section 4(c)(12) would direct the Secretaries to implement "offsite upstream projects" in the Delta and upstream Sacramento River and San Joaquin River basins in coordination with California Department of Water Resources and Department of Fish and Wildlife. Projects are to offset the effects of actions taken under this act on ESA listed species. Section 4(c)(13) would direct the Secretaries to use "all available scientific tools" to identify and implement any changes to the real-time operations of any Reclamation, state, and local water projects that could result in additional water supplies. Section 4(d) states that the provisions of Section 4 shall apply to all federal agencies that have a role in approving projects in Sections 4(a) and 4(c) of this bill. Thus, although not specifically mentioned, if the Corps of Engineers or another agency has a permitting or approval role in one of the projects that could be implemented under Section 4, the provisions of Section 4 would also apply to that agency. Section 4(e) would direct federal agencies, upon request of the state of California, to use "expedited procedures under this subsection" to make final decisions related to federal projects or operations that would provide additional water or address emergency drought conditions under Sections 4(a) and 4(c). Pursuant to Section 4(e)(2), after receiving a request from the state, the head of an agency referred to in Section 4(a), or the head of another federal agency responsible for reviewing a project, the Secretary of the Interior would be required to convene a "final project decision meeting" with the heads of all relevant federal agencies "to decide whether to approve a project to provide emergency water supplies." After receiving a request for resolution, the Secretary would be required to notify the heads of all relevant agencies of the request for resolution, the project to be reviewed, and the date of the meeting. The meeting must be convened within seven days of the request for resolution. Not later than 10 days after that meeting, Section 4(e)(4) would require the head of the relevant federal agency to issue a final decision on the project. The Secretary of the Interior is authorized to convene a final project decision meeting at any time, regardless of whether a request for resolution is requested under 4(e)(2). Section 5 would direct agencies responsible for "carrying out this act" to consult with the Council on Environmental Quality (CEQ) to develop "alternative arrangements" to comply with NEPA in accordance with existing regulations "during the emergency." Section 6 addresses California's use of monies in its State Revolving Fund (SRF) programs that assist wastewater and drinking water infrastructure projects, pursuant to the federal Clean Water Act (CWA) and the federal Safe Drinking Water Act (SDWA), respectively. The section would direct the Administrator of the EPA, when allocating SRF funds, to require that the state of California review and give priority to projects that will "provide additional water supplies most expeditiously to areas that are at risk of having inadequate supply of water for public health and safety purposes or to improve resilience to droughts." Further, the Director is to require the state to review and prioritize funding for such projects, direct the EPA Administrator to expedite review of Buy American waiver requests, if such requests are submitted, and authorize 40-year loan repayments to the SRFs. The bill would provide that nothing in Section 6 authorizes EPA to modify existing state-by-state funding allocations, funding criteria, or other requirements related to the CWA and SDWA SRF programs for the state of California. Section 7 states that if the bill were to be enacted, it would not preempt any California state law in effect on the date of such enactment, including area-of-origin, or other water rights protections. Section 8 states that authorities under Section 4(a); Section 4(c), subsections (1) through (6), (8) and (9), and (11) through (13); Section 5; and Section 6 would permanently expire when the governor of the state suspends the drought emergency declaration. Comparison of H.R. 3964 and S. 2198 H.R. 3964 and S. 2198 share the objective of increasing water supplies for agricultural and urban users. The bills, however, largely differ in their approach to achieve this objective. This section summarizes and provides analysis of selected similarities and differences between the bills. H.R. 3964 and S. 2198 have few similarities in their specific approaches to addressing drought conditions in California; however, to different degrees, they both aim to provide more water for users that receive water from the CVP and SWP. The primary thematic similarity among the bills is to authorize or direct activities to increase water supplies for users, while, in some cases, decreasing or meeting the minimum water needs of the environment (e.g., fish and wildlife, and water quality). The duration of these changes varies. In some cases, they would be authorized only in times of a declared drought or decreased water supplies, and in other cases, these activities would be authorized permanently under all conditions. H.R. 3964 primarily aims to increase water deliveries to California's CVP contractors, particularly those south of the Delta, who have seen reductions in deliveries since passage of the CVPIA in 1992. The bill would potentially ease some restrictions on CVP and SWP water operations and would allow more water to be available for users resulting from those changes. The bill would likely result in greater water deliveries by preempting some federal and state laws, including fish and wildlife protections and other CVP operational mandates tied to the coordinated operations of the CVP and SWP. It is unclear what impacts such changes would have on other water users in the state. H.R. 3964 would establish the 1994 Bay Delta Accord (Accord) as a basis for operation of the CVP and SWP pumps in the Delta, rather than current (and evolving) in-Delta water quality standards and proscriptions included in federal biological opinions (BiOps). These standards and restrictions impose water flow restrictions that appear to be a contributing factor to reduced pumping and water availability in the Delta. S. 2198 would direct the Secretaries of selected federal agencies to provide the maximum quantity of water supplies possible to CVP and other water users in the state of California by approving, consistent with applicable laws and regulations, projects and operations to provide additional water supplies as quickly as possible. Although activities are to be consistent with laws and regulations, presumably including those regarding the environment, S. 2198 provides direction to federal agencies to maximize water supplies within such constraints. This juxtaposition makes it difficult to understand the potential effect of the proposed legislation. It would appear to fall to the implementing agency to decide what actions are both in compliance with S. 2198 directives to increase storage while remaining consistent with law and regulations. It is not clear for example how or when agencies would determine the effects of providing "maximum water supplies" on species viability and water quality. Such effects may not be apparent, quantifiable, or known for several years into the future. Conversely, agencies and water users may not agree that an agency's actions adequately implement the legislations direction to provide "maximum water quantities." While some observers believe that agencies should not maximize water supplies to the detriment of species in the long term, others are advocating relaxation of some laws and regulations, or meeting minimum standards of environmental laws while maximizing water supplies. Selected Similarities Between H.R. 3964 and S. 2198 While the two bills take significantly different approaches to increasing the reliability of water supply during dry years, some similar issue areas and provisions in the bills lend themselves to comparison. A summary of some selected provisions are provided below: H.R. 3964 and S. 2198 would provide authority to expedite water transfers with different conditions. H.R. 3964 would direct the Secretary to facilitate and expedite water transfers and prohibit environmental or mitigation requirements as a condition to transfers. S. 2198 would not waive environmental requirements for water transfers, but instead would set a limit on the number of days for making a final permit decision. Specifically, S. 2198 would direct the head of the FWS and the Commissioner of Reclamation to complete all necessary NEPA and ESA requirements, within 30 days of receiving a request for a permit, for final permit decisions on water transfers associated with voluntary fallowing of nonpermanent crops in the state of California. The bill would also direct the head of FWS to allow "any water transfer request associated with fallowing" to maximize water supplies for non-habitat use, as long as the action would comply with federal law and regulations. Both bills address NEPA so as to address the objective of streamlining the permit process or in some cases bypassing the federal permit process, although they do so in different ways. For example, H.R. 3964 states that compliance with the California Environmental Quality Act shall suffice for compliance with NEPA for filing of a Notice of Determination or a Notice of Exemption for any project related to the CVP or delivery of water from the CVP. Further, H.R. 3964 would not require Reclamation to cease or modify federal actions or activities related to any project of the CVP or water delivery from the CVP due to the pending completion of any judicial review of a determination made under NEPA. S. 2198 would direct agencies responsible for "carrying out this act" to consult with the Council on Environmental Quality (CEQ) to develop "alternative arrangements" to comply with NEPA in accordance with existing regulations "during the emergency." In addition, as noted above S. 2198 would require final permit decisions to be made within 30 days under the NEPA process. Both bills would direct rescheduled water supplies in the San Luis Reservoir to be held for use in the following year by water users. Specifically, H.R. 3964 would direct the Secretary of the Interior to allow certain south-of-Delta water service or repayment contractors to reschedule unused CVP water for storage and subsequent use in the following year. The bill includes timelines and conditions, including that such rescheduling shall not interfere with CVP operations in the contract year into which the water has been rescheduled. Similarly, S. 2198 would require the Secretary of the Interior to hold all rescheduled water supplies in San Luis Reservoir and Millerton Reservoir for the following year, unless unable to do so due to storage capacity limitations. These directions appears to be consistent with the approach of Reclamation in recent years in making available rescheduled water, subject to available storage and that year's CVP operations. Both bills aim to increase water supplies in reservoirs either by authorizing potential increases in water storage capacity or by authorizing the implementation of projects that would increase water in existing reservoirs. For example, H.R. 3964 would authorize the Secretary to partner with local joint power authorities and others in pursuing storage projects (e.g., Sites Reservoir, Upper San Joaquin Storage, Shasta Dam and Los Vaqueros Dam raises) authorized for study under CALFED ( P.L. 108-361 ), but would prohibit federal funds to be used for this purpose or for financing and constructing the projects. S. 2198 would direct federal agencies to participate in, provide grants to, or provide funding for pilot projects to increase water in reservoirs in regional river basins that are experiencing "extreme, exceptional, or sustained drought." Both bills appear to acknowledge and incorporate some state actions into their directives. H.R. 3964 states that nothing in the act shall "affect in any way" the Proclamation of State Emergency and associated Executive Order (Emergency Order) issued by Governor Brown on January 17, 2014, or the authorities granted by the Proclamation. Further, H.R. 3964 would not limit the authority provided by the Proclamation to allow the SWRCB to modify standards or operational constraints adopted to implement the Bay-Delta Accord so as to make additional water supplies available to service areas during a state of emergency. S. 2198 would authorize actions to ensure that the Delta Gates remain open to the maximum extent possible, consistent with the operational and monitoring criteria specified in the SWRCB Temporary Urgency Change Petition Order. Further, S. 2198 states that it will not preempt any state laws, including area of origin and other water rights protections. Selected Differences Between H.R. 3964 and S. 2198 There are considerably more differences than similarities between H.R. 3964 and S. 2198. The differences hinge on the fundamental approach the bills take towards providing and allocating water supplies for users. S. 2198 generally provides authority to approve projects and actions to maximize water supplies for users within existing laws and regulations; whereas H.R. 3964 would amend existing laws that in some cases would preempt state and federal law to re-allocate water supplies and achieve its objectives. Some examples of the most prominent provisions that would amend federal law to address water conveyance and supplies for users under H.R. 3964 include the following: Title I of H.R. 3964 addresses many provisions of the CVPIA, including provisions that would potentially decrease the amount of project water for fish and wildlife purposes, alter enhancement and mitigation activities, reduce water transfer limitations, repeal tiered pricing formulas, and change other restoration and mitigation provisions. For example, H.R. 3964 would direct the Secretary of the Interior to facilitate and expedite water transfers and prohibit environmental or mitigation requirements as a condition to transfers. Section 108 of H.R. 3964 would prohibit "any" state or federal law (including the public trust doctrine and possibly certain California water rights laws) from reducing water supplies beyond those allowed in the Bay-Delta Accord and declaring a federal supremacy over water management to "protect existing water rights throughout the system." This approach would create standards for delivering water supplies that would not be limited by other laws that could diminish these supplies (e.g., environmental laws such as ESA and state water quality regulations). Title II of H.R. 3964 would repeal much of the authority to implement the San Joaquin River Restoration Settlement (SJRRS) under P.L. 111-11. For example, Section 201 of H.R. 3964 directs the Secretary of the Interior to "cease any action" to implement the stipulated Settlement Agreement on San Joaquin River Restoration. The bill would also amend the San Joaquin River Restoration Settlement Act's purpose to be restoration of the San Joaquin River, instead of implementation of the Settlement Agreement. Further, it would remove several provisions from P.L. 111-11 that would authorize physical restoration of the San Joaquin River such as channel and structural improvements. The section would also modify Friant Dam operations to address Restoration Flows. Significantly, the bills would also differ in the duration of some of the provisions that would be authorized. H.R. 3964's changes to laws and operations would persist after the drought declaration is lifted; whereas S. 2198 has termination clauses for several selected provisions that would end when the current drought declaration has been lifted. Both bills contain provisions that address certain issues that are not covered in the other Chamber's bill. For example, H.R. 3964 would make extensive changes to implementation of federal reclamation law under CVPIA, the contracting provisions under the 1939 Reclamation Project Act, restoration efforts under the San Joaquin River Restoration Settlement Act, and state and federal relationships under Section 8 of the Reclamation Act of 1902. The bill would also alter the way the state of California implements its own state laws with regard to operation of the CVP and SWP and non-native fisheries. S. 2198 does not address these issues directly, and would instead focus efforts on several mandated actions that are not directly addressed in H.R. 3964. These actions would affect water conveyance and supplies in the Delta and include, altering the operations of the Delta gates, adopting a 1:1 inflow to export for increased San Joaquin River flows, and implementing strategies to control turbidity at pumps, among other things. (See bill summaries for more details.) Potential Issues for Congress Drought conditions in California and proposed state and federal solutions to address them under H.R. 3964 and S. 2198 raise several issues and questions that might be of interest to Congress. Many of these issues relate to the central question of how to increase water supplies for users while sustaining environmental and other conditions in a manner that satisfies existing or altered federal and state laws. A background discussion of selected key questions and the issues they generate is provided below. How much water would be delivered to users under each bill? The objective of both bills is to increase water deliveries and reliability for users; in particular water users south of the Delta. Neither bill contains assurances for delivering a certain amount of water, nor quantifies an amount of additional water to be generated by activities authorized in each respective bill. Based on this uncertainty, some might question how much more water might be delivered to users by each bill if enacted? S. 2198 contains broad language that would direct agencies to maximize water supplies and approves pilot projects for increasing water stored in water stressed areas. It is uncertain how much water could be delivered to users from specified projects authorized under S. 2198 and other projects that are not. Further, S. 2198 would provide federal agencies with broad discretion to conduct operations that would maximize water use while still adhering to state and federal laws and regulations. It is unclear how changes to this authority would affect how much water would be delivered to users since the amount would be based on federal actions yet to be documented. H.R. 3964 would implement several measures that would redirect water from fish and wildlife uses, among others, to agricultural and municipal users. However, quantifying the amount of additional water for users if H.R. 3964 is enacted is difficult. For example, one of the bill's most significant changes would be to set the 1994 Bay Delta Accord as the operational guide for the CVP and the SWP, while also waiving federal ESA regulations and other laws pertaining to the operation of the CVP and SWP. This would set maximum restrictions on water exports from the Delta depending on the time of year and guarantee a reliable supply of water for certain stakeholders, among other things. However, the exact amount of additional water made available in accordance with this change would depend on a number of factors. For instance, while H.R. 3964 appears to waive implementation of the ESA as it pertains to operations, the Accord included a section that authorized operational flexibility to comply with federal ESA regulations. It is unclear if the ESA provisions regarding operational flexibility would be applicable if H.R. 3964 were enacted. Under a separate provision, the Accord protected water users from losing water supplies to support future listings of species under ESA. According to the Accord, the protection of species that are listed after the Accord shall result in no additional water cost relative to the Bay-Delta protections embodied in the Plan and will, to the maximum extent possible, use the flexibility provided within Section 4(d) of the ESA. Additional water needs will be provided by the Federal government on a willing seller basis financed by Federal funds, not through additional regulatory re-allocations of water within the Bay-Delta. It is unclear if this provision in the Accord would reflect the listing of species after the bill would be enacted or would date back to when the Accord was written in 1994. In summary, the Accord provided water supply reliability as well as discretion to export water to users. H.R. 3964 would further these advantages by making operations not subject to ESA or any other law pertaining to the CVP and SWP. H.R. 3964 also includes several other provisions that would be likely to increase water deliveries for users, but are difficult to quantify. For example, H.R. 3964 would provide replacement water for CVP contractors for water dedicated for fish and wildlife purposes, approves the development of a plan to increase CVP yield, and would authorize non-federal construction of water storage projects. What would be the short- and long-term environmental effects of each bill? Both bills support reallocating water supplies to users from environmental considerations. Under H.R. 3964, some laws and regulations that dedicate water supplies for environmental uses would be exempted, thus allowing federal agencies to supply more water to users. For example, the provision to operate the CVP and SWP under the Bay-Delta Accord, without regard to ESA, would benefit some water users, but environmental stakeholders may contend that the loss of ESA regulations will harm listed species in the region. Requirements for operational flexibility and planning for sustaining endangered and threatened fish species in the Delta would appear to be lowered as it relates to pumping by H.R. 3964. Operations under the bill are to strictly adhere to the prescripts in the Bay-Delta Accord; however laws pertaining to operations (including ESA) would be disregarded under H.R. 3964. On the other hand, some might contend that the existing Biological Opinions also do not allow enough operational flexibility for water supply purposes, and that restrictions to date have not had a meaningful impact on species (including those that were already declining). If pumping operations maximize water exports to users under the guidelines proposed by H.R. 3964, lower water supplies for fish and the ecosystem could have short and long term environmental consequences, although the extent of these consequences is currently unknown. Some may argue that the environmental damage from the change will be minimal, and would be tempered by the benefits of greater water deliveries to some agricultural and municipal users affected by the drought. Under S. 2198, the Secretaries would be directed to maximize water supplies in project development and operations while the California governor's drought declaration is in effect. Some might question if the actions in this section and the broad direction to maximize water supplies for users might have unintended or long-term consequences for species in the Bay-Delta. For example, projects and actions might meet the minimum requirements under law for addressing species and water quality, but not account for long term effects. Indeed, some contend that if managers were required to maximize water supplies in implementing projects and actions under 103(b), their discretionary flexibility to make decisions would be narrower. Therefore, maximizing water supplies would appear to benefit water users under drought conditions; the long term effects on other factors such as species viability, recreation, and water quality would be unclear. What are other long-term ramifications of each bill? Longer-term consequences of the proposed bills may be of interest to Congress. Provisions under H.R. 3964 would be in effect beyond the current drought, and would continue in perpetuity absent future changes to the statute. As discussed above, this could have long-term environmental effects that change the scope of water planning in the Bay-Delta region. For example, some have argued that if ESA and state protections in the Bay-Delta are removed as proposed, there would be no incentive to implement the BDCP, a habitat conservation plan currently under development. Further, the bill, if enacted, would set some precedents. For example, the waiver of ESA and state laws in order to provide increased water deliveries for federal contractors would be a significant departure from other approaches that defer to state laws and federal environmental statutes such as ESA. Some might use this provision as an example and justification for proposing exceptions to ESA guidelines on a species by species basis. H.R. 3964 would also elevate the supply and use of natural resources as a priority over species concerns, which could have ramifications beyond the water-use arena. S. 2198 would largely be applicable during the current drought declaration (with few exceptions), thereby reducing its long-term effects. However, some might contend that its directive to maximize water use when contemplating actions taken under existing law would also elevate resource use at the expense of the environment. Even though environmental laws and regulations would have to be followed, it appears that S. 2198 would encourage federal agencies to meet the minimal requirements for the environment under applicable laws. How would activities under each bill be funded? Neither S. 2198 nor H.R. 3964 has specifically authorized new appropriations to fund activities authorized under the bill. S. 2198 would use existing authorities for funding under other laws to fund certain projects and activities, and in some cases provisions under S. 2198 would re-direct or re-prioritize activities under existing authorities to address drought-related activities. H.R. 3964 largely authorizes changes under existing laws for operations, activities, and procedures to generate water for users, and would redirect funding from some sources. There is less emphasis placed on implementing projects and activities in H.R. 3964 compared to S. 2198. In some cases under H.R. 3964, funding is assigned to water districts, such as funding for the pilot program to protect native anadromous fish is directed to water districts. Additionally, the bill would require certain studies that could eventually result in the construction of projects (and, potentially, federal funding requirements) in the future. Are there potential precedent-setting provisions under these bills? There are some potential precedent-setting provisions in both bills that might be of interest to Congress. Both bills elevate the need to supply additional water to users in comparison to other uses (e.g., environment and recreation). The directive to maximize water supplies for users under S. 2198 as a priority over other considerations (e.g., water quality or habitat conservation) might cause some to describe the provision as precedent-setting since it lowers the discretionary flexibility of agencies and prioritizes one resource need over others during a time of water shortage. Others might counter this notion by stating that other factors such as water quality and species needs are addressed in other laws and regulations that S. 2198 is not changing. Essentially, agencies would have to balance the new directives with parameters prescribed in existing law and regulations, yet do so with less flexibility. The long-term effects of S. 2198 itself would be tempered since most of its provisions will sunset after the drought declaration in California is lifted. However, some might view the directive to maximize water supplies for users for actions specified within BiOps as precedent setting. Even if regulations in the BiOps are followed, any discretionary flexibility provided to agencies to manage water supplies would be narrowed because they would directed to maximize water supplies for users. These directives could eventually be significant during other water supply shortages, especially during times of drought. H.R. 3964 contains several potential precedent-setting provisions. Similar in theme to S. 2198, H.R. 3964 would prioritize water supplies for users over other competing uses. The policy mechanisms used to achieve this objective differ from S. 2198. For example, the waiver of ESA and state laws in order to provide increased water deliveries for federal contractors would be a significant departure from previous approaches that defer to state laws and federal environmental statutes such as ESA, NEPA, and the Clean Water Act, and may attract attention despite Section 501 of the bill, which notes that nothing in the act shall serve as precedent for other states. Specifically, some might contend that provisions under H.R. 3964 that waive certain federal ESA provisions for the region could set a precedent for addressing ESA on a species by species basis, or region by region basis. Further, H.R. 3964 would prohibit "any" state or federal law (including the public trust doctrine) from reducing water supplies beyond those allowed in the Bay-Delta Accord and declaring a federal supremacy over water management to "protect existing water rights throughout the system." All of these changes are significant, and could hypothetically be a model for similar legislation in other areas.

Summary: California is experiencing serious water shortages due to widespread drought. Even though much of the state is served by two large water infrastructure projects that store water for future use-the federal Central Valley Project (CVP) and the State Water Project (SWP)-both projects have had to reduce water deliveries to the farmers and communities that they serve. Many water users have received no water from the CVP and SWP this year and are supplementing surface water supplies with groundwater. Some water basins are experiencing overdraft of local aquifers (i.e., extracting of more ground water than will be replenished over time). The dry hydrological conditions, in combination with regulatory restrictions on water being pumped from the Sacramento and San Joaquin Rivers Delta confluence with San Francisco Bay (Bay-Delta) to protect water quality and fish and wildlife, have resulted in historic water supply cutbacks for senior water rights users in some areas. The effects are widespread and are being felt by many economic sectors. The extent and severity of the drought is also taking its toll on fish and wildlife resources and has increased concern for wildfires. California also experienced severe water supply shortages during a three-year drought, which lasted from 2008 - 2010 and during a five-year drought from 1987 to 1992. Several bills have been introduced in the 113th Congress to address California water supply and drought in particular. This report discusses the similarities and differences between two bills that have been passed by their respective chambers: H.R. 3964, which passed the House on February 5, 2014; and S. 2198, which passed the Senate on May 22, 2014. H.R. 3964 and S. 2198 have few similarities in their specific approaches to addressing drought conditions in California; however, to different degrees, they both aim to provide more water for users that receive water from the CVP and SWP. The primary thematic similarity shared between the bills is to authorize or direct activities that would attempt to increase water supplies for users while, in some cases, decreasing or meeting the minimum water needs of the environment (e.g., fish and wildlife, and water quality). The duration of the authorization for these activities varies under each bill. In some cases, activities aimed to increase water supplies are authorized in times of a declared drought or decreased water supplies, and in other cases, these activities are authorized permanently without conditions. The differences between the bills hinge on the approach the bills take towards allocating water supplies for users. S. 2198 would authorize the approval of projects and actions to maximize water supplies for users within existing laws and regulations; whereas H.R. 3964 would amend laws, and in some cases, pre-empt state and federal law to re-allocate water supplies and achieve its objectives. A short-term issue for Congress is how to address the drought, and in particular, demands for more water from the CVP and SWP without jeopardizing the continued existence of several fish species, degrading water quality, or overriding state water rights allocations. A long-term issue for Congress is how to improve the supply and reliability of federal water deliveries and stabilize, and potentially restore, the aquatic ecosystems upon which water and power users and diverse economies depend upon. Efforts to address the long-term water and environmental needs of the state have been focused, in part, on the Bay Delta Conservation Plan (BDCP). However, the BDCP is controversial and if approved is expected to take years, if not decades, to implement. In the meantime, questions continue to be raised about annual Bay-Delta pumping levels and their adequacy in providing water supply to state and federal contractors and their effects on fish and wildlife, particularly on threatened and endangered species.

gov_report

en

Summarize: Former Egyptian President Hosni Mubarak, second right, waves at his supporters, who with his sons Alaa, right, and Gamal. left attend a hearing in their retrial on appeal in Cairo, Egypt, Saturday, April... (Associated Press) The Cairo appellate court on Wednesday set May 11 for the resumption of ousted Egyptian President Hosni Mubarak's retrial in the deaths of hundreds of protesters during the uprising that deposed him. More than two years after Mubarak was forced from office, his fate remains a highly contentious issue. An order to transfer the 84-year-old ex-president back to a prison hospital from a military facility set off a noisy demonstration Wednesday. Mubarak supporters blocked the road in front of the military hospital and forced a delay in his transfer, according to a security official who spoke on condition of anonymity because he was not authorized to speak to reporters. Mubarak remains in custody on new corruption charges, though a court ordered him released earlier this week before his retrial over the deaths of protesters. The decision to transfer him back to Tora prison, where his two sons are being held before facing a corruption trial, came after the prosecutor ordered the formation of a medical committee to look into Mubarak's health. Mubarak appeared in court Saturday for the first time since his conviction in June 2012. After he was wheeled into the courtroom on a hospital gurney, he sat upright, grinned and waved to supporters from inside the metal defendant's cage. In January, an appeals court overturned a life sentence against Mubarak for failing to prevent the killing of nearly 900 protesters during the 18-day uprising in 2011. He was the first Arab leader to appear in a defendant's cage and stand trial by his own people. The new date for the retrial was set after the judge in the case recused himself last weekend. The judge had ordered acquittals in October for 25 Mubarak loyalists accused of organizing a deadly attack in which assailants on horses and camels stormed downtown Cairo's Tahrir Square during the uprising. President Mohammed Morsi's Freedom and Justice Party, a branch of the Muslim Brotherhood, criticized the judiciary for several recent acquittals. "The acquittals of corrupt and criminal Mubarak-era figures confirms that the revolution is not complete," party spokesman Murad Ali said in a statement. He said the acquittals highlight "dysfunction in the judiciary system." Morsi and his government have had several run-ins with the judiciary over powers and edicts. In an effort to boost the nation's battered economy, some Brotherhood members have supported holding reconciliation talks with former officials toward return of stolen funds. The largely liberal and secular opposition has criticized such moves, saying Morsi has not taken needed steps to begin reforming the judiciary. Activists and lawyers connected to Mubarak's retrial say there is no guarantee that new evidence will be submitted in the case. They complain about a lack of a comprehensive transitional justice program to hold Mubarak and former regime officials accountable for crimes committed during his rule, as well as the killing of protesters. Late Wednesday, Egypt's prosecutor general ordered the arrest of 22 people suspected of forming and funding the so-called Black Bloc, masked young men who fought security forces during anti-Muslim Brotherhood protests over the past months. The prosecution said in a statement that the suspects were accused of "forming a group with intention to commit terrorist crimes, violence, theft, murder" and a long list of other charges. No names were released. The Muslim Brotherhood group has blamed Egypt's liberal opposition of fomenting street violence, saying they want to destabilize the country and show that Islamist rule is weak. The opposition denies this. Maintaining that violence is a normal and expected result of political chaos. Also Wednesday, a lower court in Cairo ordered the country's prime minister to serve one year in prison and be removed from office for failing to implement a ruling on the privatization of a flax company. The court ruled that Prime Minister Hesham Kandil had not carried out a September 2011 court ruling invalidating the sale of Tanta Flax & Oil company to Saudi businessman Abdullah al-Kaaki. The ruling can be appealed. A separate case on the sale of the company, based in the city of Tanta north of Cairo, is to be reviewed by the country's Supreme Administrative Court in May. A spokesman for the Cabinet could not be immediately reached for comment. The sale was completed under the Mubarak regime in 2005, well before Kandil became prime minister. Previously, company workers filed complaints to prosecutors against one of Kandil's predecessors for not enforcing the court's decision. Workers have been protesting against privatization of the company, complaining that the government's policies had not changed despite the uprising. They also alleged that before the uprising, company administrators tried to bribe farmers not to grow flax in order to slow production, making the sale of the company cheaper for investors and easier for the government. (Reuters) - Egypt’s ousted president Hosni Mubarak was taken back to prison from an army hospital on Thursday after appearing fitter at his aborted retrial on charges of complicity in the killings of protesters in 2011. Egypt's ousted President Hosni Mubarak sits inside a dock at the police academy on the outskirts of Cairo April 15, 2013. REUTERS/Stringer Hundreds of his supporters blocked the road in front of the hospital late on Wednesday, delaying the transfer, the MENA state news agency said. “We love you Mubarak” and “Down, down with the rule of the Muslim Brotherhood,” chanted the protesters, referring to new President Mohamed Mursi’s group. The retrial of Mubarak will start again on May 11, a Cairo appeals court said on Wednesday. A first attempt collapsed on Saturday when the presiding judge withdrew from the case and referred it to another court. Judge Mustafa Hassan Abdullah had been widely criticized for acquitting security men accused of attacking protesters in an incident in which crowds were charged at by men riding camels during the 2011 uprising which overthrew Mubarak. The new presiding judge will be Mahmoud Kamel El-Rashidi, a low-profile jurist. Many Egyptians were angered when the 84-year-old Mubarak, who was seriously ill last year, appeared in good health, smiling and waving to the public in court on Saturday, and there were calls for him to be sent back to jail. The prison hospital is fully able to deal with Mubarak’s health, the interior minister said in a statement carried by MENA later on Thursday. Mohamed Ibrahim said that in the event of an “urgent health crises”, the former president would be transferred immediately to a hospital outside the prison in accordance with prison regulations. The prosecutor general’s office said it had decided Mubarak would be returned to Torah prison on the outskirts of Cairo. Mubarak was taken by car from the Maadi Military Hospital to the prison in a heavily guarded police convoy early on Thursday, MENA reported.

Summary: Hundreds of Hosni Mubarak fans last night crowded into the road in front of the military hospital where he had been staying, attempting to block or at least delay his transfer back to prison, Egyptian state news reported today. Chants of "We love you Mubarak!" and "Down, down, with the rule of Muslim Brotherhood!" rang out from the crowd. The former Egyptian ruler is now back behind bars at Tora prison once more, Reuters reports. The move came following outcry over Mubarak's apparent display of health at a hearing on Saturday. Prosecutors ordered a medical committee to look into his health, then made the decision to send him back to Tora. Mubarak faces a retrial on charges that he failed to prevent the deaths of almost 900 protesters during his ouster. The trial will begin May 11, a court decided yesterday, according to the AP.

multi_news

en

Write a title and summarize: Bacterial whole genome sequencing offers the prospect of rapid and high precision investigation of infectious disease outbreaks. Close genetic relationships between microorganisms isolated from different infected cases suggest transmission is a strong possibility, whereas transmission between cases with genetically distinct bacterial isolates can be excluded. However, undetected mixed infections—infection with ≥2 unrelated strains of the same species where only one is sequenced—potentially impairs exclusion of transmission with certainty, and may therefore limit the utility of this technique. We investigated the problem by developing a computationally efficient method for detecting mixed infection without the need for resource-intensive independent sequencing of multiple bacterial colonies. Given the relatively low density of single nucleotide polymorphisms within bacterial sequence data, direct reconstruction of mixed infection haplotypes from current short-read sequence data is not consistently possible. We therefore use a two-step maximum likelihood-based approach, assuming each sample contains up to two infecting strains. We jointly estimate the proportion of the infection arising from the dominant and minor strains, and the sequence divergence between these strains. In cases where mixed infection is confirmed, the dominant and minor haplotypes are then matched to a database of previously sequenced local isolates. We demonstrate the performance of our algorithm with in silico and in vitro mixed infection experiments, and apply it to transmission of an important healthcare-associated pathogen, Clostridium difficile. Using hospital ward movement data in a previously described stochastic transmission model, 15 pairs of cases enriched for likely transmission events associated with mixed infection were selected. Our method identified four previously undetected mixed infections, and a previously undetected transmission event, but no direct transmission between the pairs of cases under investigation. These results demonstrate that mixed infections can be detected without additional sequencing effort, and this will be important in assessing the extent of cryptic transmission in our hospitals. Whole genome sequencing (WGS) offers the prospect of high precision investigation of infectious disease outbreaks [1], [2]. Close genetic relationships between organisms isolated from different infected cases suggest transmission is a strong possibility, whereas transmission between cases with genetically distinct isolates can be excluded. WGS has been successfully applied to several high profile national outbreaks, in particular the Escherichia coli outbreak in Germany [3]–[5], and cholera outbreak in Haiti [6]. The advent of rapid benchtop sequencing technology allows WGS to be applied in clinically relevant timescales to local outbreaks, for example those caused by the important healthcare-associated pathogens Clostridium difficile and MRSA [7], [8]. The increased resolution offered by WGS allows isolates apparently identical by traditional genotyping methods to be distinguished [7], [9]. Fast availability of this precise information on person-to-person transmission to individual healthcare practitioners and institutions is likely to transform the practice of routine infection control [1], [7]. However, potentially undetected mixed infections—infection with two or more unrelated strains of the same species—means that transmission cannot be excluded with complete certainty [10]. This is because if a mixed infection is present in a transmission donor or recipient and only one isolate sampled from each, it is possible the sequenced isolates may differ even though an identical strain is present in both cases. In this scenario, transmission would be incorrectly excluded, exposing a potentially serious weakness of the technique. Even so, sequencing single colonies is common practice in microbiology, and the protocol has underpinned the majority of bacterial WGS studies to date [3]–[8] (but see [11], [12]). Traditional approaches to investigating mixed infection are expensive because they involve separate sub-culture of multiple bacterial colonies, a process in which multiple individual colonies are transferred to a separate culture plate and re-incubated [10]. Because this approach is cost and labour intensive, it is not used in routine clinical laboratories or in large-scale transmission studies. As WGS in bacteria typically yields generous depth of coverage (measured by the number of reads mapping to any particular site in the sequenced genome [1], [13]), interrogation of these reads offers the prospect of detecting mixed infection by sequencing an aggregate of colonies at the same cost as sequencing an individual colony. In this approach, the short reads produced by next generation sequencers would be mapped to a reference genome using a standard method [13]. The composition of bases mapping to any given nucleotide position can then be analysed to detect evidence of multiple strains. Whereas bacterial genomes should normally be haploid, a pattern of bases that resembles a heterozygous base call in a diploid genome is symptomatic of mixed infection [14]. This idea has been used to detect viral genetic diversity within individual hosts [15], [16]. In viral sequences, the density of single nucleotide polymorphisms (SNPs) may be sufficient to allow common SNPs to be identified between overlapping reads and haplotypes to be reconstructed [15]. Clearly this ability is dependent on the within-host viral diversity, the sequencing technology and depth of sequencing coverage. In contrast, the density of SNPs between sequences in potential mixed bacterial infections is much lower; for example, in the major hospital-associated bacterial pathogen C. difficile, there may be 100–10000 SNPs over a total genome of 4. 3 million base pairs, which corresponds to just 1 SNP in 400–40000 base pairs [17]. At this density, SNPs are sufficiently sparse that complete haplotype reconstruction is not possible from current short-read sequencing with read lengths of the order of 100 base pairs. Many if not all SNPs are likely to lack adjacent variants closer than the maximum read length, making it impossible to associate these reads with the correct haplotype. The one exception to this is the scenario in which the haplotypes make up markedly different proportions of the sample. The major healthcare-associated infection, C. difficile [18], provides an important example of where undetected mixed bacterial infection may affect estimates of transmission between cases. C. difficile causes substantial morbidity and mortality, and is the focus of costly prevention efforts in healthcare systems worldwide [19]. Although it is generally believed that C. difficile is predominantly nosocomially acquired [18], a recent study found that <25% of C. difficile infections in Oxfordshire, UK, over a 2. 5 year period could be linked to a previous case with the same strain type via hospital ward contact [20], suggesting a substantial unsampled reservoir for human infections. However a potential limitation of this study was that only one strain was sequence typed per case and therefore mixed infections could in theory comprise some or much of the unsampled reservoir. C. difficile mixed infection rates of ∼7–13% have been consistently described over the last decade [10], [21]–[24], but their significance in transmission has never been investigated. We have therefore developed a method for detecting mixed infection from bacterial WGS data that exploits frequency differences between the dominant and minor strain making up the sample and compares putative base calls to a database of known sequences to assist in determining the haplotypes present. We demonstrate our algorithm performs well in in silico and in vitro mixed infection experiments and apply it to quantify the extent of transmission arising from mixed C. difficile infections in order to determine its relevance to routine hospital outbreak investigations. We developed a maximum likelihood based method to detect mixed infection in bacterial WGS data, based on high quality base counts at sites known to vary on the basis of available previously sequenced isolates. The algorithm can be applied to any set of variable sites within a genome. As the stochastic transmission model above had suggested potential mixed ST infections, we initially investigated variable sites within the MLST loci as these are sufficient to demonstrate if mixed ST infection is present. We then investigated sites across the whole genome that are known to vary within an individual ST, allowing us to determine the precise identity of mixed infection strains. To calibrate the mixed infection estimator all reads from 100 whole genome sequences derived from a single colony, and thus expected not to be mixed, were initially analysed investigating the 150 variable sites within the MLST loci for evidence of mixed ST infection. The ST previously obtained by PCR was recovered using our method on all occasions and accounted for a median of 100% (interquartile range [IQR] 99. 9–100%, range 93. 5–100%) of the sample based a median (IQR) read depth of 80 (67–93) (Figure S1). The divergence between the dominant and minor haplotypes was estimated at a median 0 SNPs (IQR 0 – 0 SNPs, range 0–15 SNPs). A likelihood ratio statistic was used to compare the maximum likelihood obtained under the mixed infection model, with the likelihood of the data without mixed infection. For each sample in the calibration set we calculated the deviance (−2 times the log likelihood ratio) and used the quantiles of the distribution to set a threshold for calling mixed infection of ≥19. 4 in order to achieve a 5% false-positive rate. This empirical approach to choosing the significance threshold avoids making unrealistic assumptions about the statistical distribution of the deviance under the null hypothesis of single infection. Simulated mixed infections were generated to test the ability of our method to detect mixed infections, and the constituent strains. Reads obtained from the unmixed samples above were mixed in silico to create 10000 simulated mixed ST infections with median (IQR) read depth 78 (67–90) and mixture proportions from 0. 5 to 0. 95. The known input mixture proportion was estimated with a root mean square error, RMSE, of 0. 086 (see Figure S2a for the distribution of estimated mixed proportions across the 10 input proportions). Accurate mixture proportion estimates were obtained even when the simulated sequence divergence was as low as 3 SNPs between dominant and minor sequences. Mixture proportions closer to 1 were associated with a smaller variance and RMSE. The divergence between sequences at the MLST loci was estimated with a RMSE of 0. 079, consistently across varying mixture proportions (Figure S2b). Having already set the specificity of the algorithm to 95% with the empirical calibration procedure above, we found that the sensitivity of the algorithm in this dataset for detection of simulated mixed infections was 99. 0%. The two input STs were recovered as the most likely pair on 9704/10000 occasions, 9151 with the correct ordering of the dominant and minor STs (Figure S3). As expected, the minor ST was less likely to be recovered when it made up a smaller proportion of the overall sequence. Recovery of neither input ST was associated with mixture proportions near 0. 5 and relatively low divergence between input sequences (median input divergence 0. 033 where neither ST recovered versus 0. 073 in all other samples, Kruskal–Wallis p<0. 001). To confirm the performance of the estimator in vitro, DNA extracted from single colonies was mixed in known proportions prior to sequencing. Thirty-six mixed ST infections were simulated: DNA from 12 single ST infections was mixed with DNA from 12 different single ST infections, at 3 different mixture proportions – 50/50%, 70/30% and 90/10%. Using our method and whole genome data the input pair of dominant and minor haplotypes was obtained as the most likely on all occasions and the mixture proportion and divergence estimated with RMSEs of 0. 032 and 0. 002 respectively (Figure 2, supplementary table S1a). In order to demonstrate our method is also able to detect mixed infections where the two infecting strains are of the same ST, but differ at a whole genome level, we also simulated mixed infections of the same ST. A database of previously sequenced Oxfordshire isolates[30] was used to determine the variable sites within each ST across the rest of the whole genome. These variable sites were analysed for evidence of within-ST mixed infection, using the same algorithm as for mixed ST infection, determining the most likely dominant and minor sequences from the unique whole genome sequences within each ST in the database. Fifteen within-ST mixed infections were generated with DNA from 5 pairs of isolates sharing the same ST (STs 1,3, 8,14,46), but with differing whole genome sequences, at 3 different mixture proportions (50/50%, 70/30% and 90/10%). The correct dominant and minor sequences were obtained on all occasions (Table S1b). Mixture proportions and between sequence divergence were accurately estimated with a single exception where the within sequence divergence was over-estimated in a 90/10% mix (Figure 2). Accurate estimation of mixture proportions was possible even in a mixed infection where the samples differed only by a single site, with estimated mixture proportions of 0. 50,0. 70 and 0. 92 for input values of 0. 50,0. 70 and 0. 90. The median (IQR) read depths for these simulations were 82 (72–91). Having confirmed the accurate performance of our method, we then applied it to the 15 potential mixed infection transmissions described above where transmission was highly plausible based on hospital contacts but the STs obtained from sequencing single colonies differed (Figure 1). When we aligned sequence data from the 26 samples, the Burrows Wheeler Aligner, BWA [28], outperformed Stampy [27] because a number of samples also included sequence from non-C. difficile anaerobic bacteria. DNA for sequencing was obtained from an area of confluent growth on primary culture plates, and despite the use of selective agar and individual colonies resembling C. difficile, other similar antibiotic-resistant anaerobic gut bacteria were detected in some samples (by extracting 16S ribosomal RNA genes using BLAST [31] from de novo assemblies [32] of the sequences and comparison with the Ribosomal Database Project [33]). Sequence reads from these other species do not map or map poorly to the reference genome, therefore the percentage of reads mapped with Stampy to the CD630 reference ranged from 11. 0%–95. 4%, with 15/26 samples having <60% of reads mapped. As Stampy is designed to perform well with relatively large sequence variation relative to the reference, in the more contaminated samples markedly divergent reads were mapped to the MLST loci. These reads must have arisen from other species as such divergence would not be expected within the highly conserved housekeeping genes of the MLST loci within C difficile. These divergent reads were interpreted by our algorithm as mixed infection, such that a clear relationship was seen between samples estimated to contain mixed infection based on Stampy mapping and those with low percentages of reads mapped to the reference (figure 3a). We therefore remapped all samples with BWA to increase the penalties associated with insertions and deletions relative to the reference such that only reads arising from C. difficile would map to the MLST loci. This allowed assessment of the proportion of mixed infection across all 26 samples (figure 3b). Reductions in read depth were modest with BWA compared to Stampy (overall median (IQR) read depth was 21 (15–80) with Stampy across 26 samples, versus 18 (13–75) with BWA). Using our method with whole genome data we found 2 of 26 cases (8% of cases, 95% confidence interval, CI, 1–25%) had evidence of mixed ST infection, coincidently in the same transmission model pair, pair 13 (see Figure 1). The estimated dominant ST matched the original ST from MLST PCR in all 26 cases. The putative donor with a mixed ST infection (donor A with a ST1 dominant infection) had a minor ST46 infection that accounted for 3% (95%CI 2–4%) of the sample. However, this did not concord with the dominant ST17 infection found in the putative recipient (recipient A). This recipient in turn had a minor ST recovered, ST1, with sample frequency 8% (95%CI 6–10%), which was compatible with acquisition from donor A. Therefore one of the donor-recipient ST matches predicted by the stochastic transmission model on the basis of shared time and space in the hospital but ruled out by single colony sequencing appeared to be explained by mixed infection (Figure 4). To scrutinize in more detail whether the WGS data were compatible with transmission of the dominant ST1 infection in donor A to recipient A as a minor infection, we exploited a panel of 45 unique Oxfordshire ST1 genomes to assist in whole genome prediction of the dominant and minor haplotypes in both cases (Figure 4a). Informally, our method compared recipient A' s minor ST1 sequence to all 45 ST1 whole genome sequences in our database (which included an ST1 genome sequenced from a single colony from donor A) using a total of 79 ST1-specific SNPs across the whole genome. The most likely recipient A minor sequence (posterior probability = 0. 9997) was from another patient (donor B), and differed by 8 SNPs scattered throughout the genome from the sequence found in donor A (Figure 4c). In fact, donor B represents a substantially more plausible donor than donor A identified by the stochastic transmission model on the basis of epidemiological data alone, because the short-term rate of evolution in C. difficile has been estimated at ∼1 SNP/genome/year [12], [30]. Donor B was also epidemiologically linked to recipient A, albeit less strongly than donor A. Recipient A was diagnosed on day 77 of a 93-day admission on a surgical ward. Donor B was diagnosed 63 days earlier and spent 34 days after diagnosis on the same ward as the recipient, and was also readmitted for 2 days to the same ward, 6 days before the recipient' s diagnosis (Figure 4b). Not only does this reiterate the power of WGS for differentiating potential transmission donors that appear identical on the basis of low-resolution genotyping alone, it also demonstrates that our method is able to extend the approach to mixed infections and identify the source of the minor strain. We did not find strong evidence for onward transmission from the minor sequence in the mixed infection in recipient A. A single further case (Figure 4b, c, recipient B) with the identical sequence was identified, but the patient had not shared time or space in hospital with donor B or recipient A prior to diagnosis. Given the relatively high prevalence of ST1 and its relatively low diversity even at the whole genome level, indirect transmission via community contact or an undiagnosed third party is the most likely explanation. Additionally, only two descendant sequences (Figure 4, recipient C, recipient D) were identified from the phylogenetic tree of all Oxfordshire ST1s (Figure 4c). Both patients shared time on the same ward with donor B, but not with the mixed infection case (recipient A) after this case' s diagnosis. Therefore donor B may have been the source of onward transmissions, but probably not the mixed infection recipient A. Having found evidence of mixed infections with differing STs, we applied our method to search for previously undetected mixed infections of the same ST in the 24 putative donors and recipients without evidence of mixed-ST infection (Table 1). Five samples contained evidence of mixed infection according to our method. In three cases the divergence estimated between dominant and minor sequences was consistent with levels of within host diversity observed in serially sampled patients where up to 2 SNPs were expected between samples taken on the same day (95% prediction interval) [30]. As such these cases might not have arisen from two transmission events, but from evolution within a host of the same strain. Discounting these 3 cases, we therefore identified 2 mixed infections of the same ST, to add to the 2 mixed infection cases identified with different STs. The two within-ST mixed infection cases had an estimated divergence between the dominant and minor sequences that differed substantially from the best matching sequences in the database, 542 SNPs and 56 SNPs compared to best matches in the database of 1022 SNPs and ≤4 SNPs respectively (Table 1). This suggests the true minor sequence was not present in the database, highlighting our method works best with an established database of local sequences, but is able to identify when novel sequences arise. We describe a new approach for detecting mixed infection from bacterial whole genome sequence data with low SNP density, utilizing a computationally efficient algorithm that we show performs well in in silico and in vitro simulations. This offers the prospect of screening for mixed infection in transmission studies and routine outbreak surveillance without labour and cost-intensive individual sub-culture of multiple colony picks and the expense of typing or sequencing these isolates separately. We demonstrate the utility of the approach, which is generalizable to any bacterial pathogen/loci for which a database of known sequences exists, using both WGS and MLST in C. difficile. Our new approach revealed a number of biologically meaningful findings. In our sample of clinical cases significantly enriched for the possibility of mixed ST infection due to the high prior probability of transmission based on epidemiological data but without matching sequence types, we found only 2/26 (8%) cases had evidence of a mixed ST infection. This is consistent with previous estimates for mixed genotype infections of ∼7–13% [10], [21]–[24], although we might have expected to find a higher prevalence had mixed infection genuinely been contributing to transmission. However, these previously undetected mixed infection events could not account for transmission between the 15 putative donor-recipient pairs sequenced. The fact that these pairs were highly selected based on hospital exposure suggests that mixed infection is unlikely to explain a large proportion of the ∼75% CDI cases which cannot be linked to a previous case based on hospital ward exposure [20]. However, by interrogating a larger database of >1200 genomes [30] representing potential donors that were previously sequenced from single colonies, we did find an example of transmission leading to mixed infection. Using the extra resolution afforded by whole genome data we were able to refine our estimate of the likely donor. This revealed a previously undetected transmission event, reflecting additional transmission from the donor, and another transmission event on the ward in question. The significance of the infection for the recipient is unclear; but as ST1 is a virulent strain, it is possible that whilst it only accounted for the minority of the C. difficile sequenced it may nevertheless have been the cause of the patient' s illness. Therefore, use of our method in outbreak investigation demonstrably offers the ability to detect additional transmission as well as robust determination that true transmission events are not being missed. We were also able to detect mixed infections where both infections shared the same sequence type in 2/24 (8%) cases without mixed ST infections and detect likely within host variants in 3 further cases. In order to capture the full diversity of C. difficile present on the primary culture plate a sweep was taken across all the growth. In around half the samples this resulted in contamination of the sequenced reads with other bacterial species, despite morphological appearances consistent with C. difficile. This necessitated use of a restrictive mapping algorithm (BWA) favouring mapping reads closely related to the reference. Differences in the proportion of mixed infections estimated by the same algorithm from these two mapping methods highlight the impact of such choices on inferences made from whole genome data. The principle advantage of the primary culture sweep is the ability to capture the full diversity present on the plate, rather than selecting a limited number of colonies for sub-culture. However if contamination with other bacterial species is a concern, one possible refinement still enabling an assessment of mixed infection, without expensive sequencing of multiple single picks, might be to sample multiple individual colonies from the primary culture plate, and sub-culture these together on a single plate prior to sequencing. Paradoxically such approaches may actually increase sensitivity even if only relatively modest numbers of colonies are sampled (e. g. 10–20 colonies). This is because high levels of contamination result in reduced read depths for a given sequencing effort, as evidenced by the lower median depth achieved in samples with <60% of reads mapped, 14, compared to 77 in samples with ≥60% of reads mapped. However, further sub-culture does risk increasing any biases introduced by differential growth of strains on culture media, relative to their original frequency within the host. The sequencing process itself can also potentially introduce read frequency biases, however this did not appear to have a significant impact in the in vitro simulations performed. Although our method assumes mixtures contain only 2 sequences, it still should detect the presence of mixed infection where there is a dominant sequence and several minor sequences. We would expect the estimated minor sequence would be a hybrid of the true minor sequences. This might be apparent where the minor sequence did not match a known sequence, or where >2 nucleotides were found at a single SNP site. A possible hybrid minor sequence could then prompt further more detailed investigation including sub-culture of individual isolates. In the case of C. difficile, mixed infection with more than 2 genotypes is reported, but the majority of mixed infections are with 2 genotypes [10], [23]. When comparing bacterial sequences, SNPs are often sparsely distributed throughout the genome, making it likely that a mixture with several minor sequences would still only contain biallelic SNPs. Therefore instead of the two-stage approach of estimating the mixture proportions followed by haplotype matching we demonstrate, any future approach to detect mixtures of more than 2 bacterial sequences would have to jointly estimate mixture proportions and haplotypes. Such an approach would still have to make use of a library of known haplotypes, given the limited numbers of SNPs relative to read lengths. As the current approach also depends on access to a database of known haplotypes this emphasises the benefits of read archives which could enable sequence data generated by different researchers to be incorporated into such a database. Future availability of long read sequencing, including “strand sequencing” with no theoretical read length limit [13], may allow approaches taken in viral sequencing to be applied using SNPs identified at the ends of overlapping sequence fragments to reconstruct haplotypes [15], [16] or may simplify the identification of mixed infection to identifying individual genomes sequenced in a single read. However until then, next-generation whole genome sequencing offers the potential for high-throughput, labour- and cost-effective screening for mixed infection, and such approaches should become the standard when investigating transmission and potential outbreaks. This study was approved by the Berkshire Research Ethics Committee (10/H0505/83) and the National Information Governance Board (8-05 (e) /2010) without requiring individual patient consent. Selective culture for C. difficile was undertaken following an alcohol-shock on modified Brazier' s cycloserine-cefoxitin-egg yolk agar. Plates were incubated anaerobically at 37°C for up to 7 days following the method of Griffiths et al [26]. DNA was extracted directly from a sweep taken across each primary culture plate to capture the complete genetic diversity present: a 5 µl loop was passed through an area of confluent growth, and the loopful of growth then suspended in saline prior to DNA extraction with a commercial kit (QuickGene, Fujifilm, Tokyo, Japan). All growth was morphologically consistent with C. difficile, exhibited a characteristic odour and fluoresced under ultraviolet light. Extracted DNA underwent whole genome sequencing using the Illumina HiSeq 2000 platform (San Diego, California, USA) generating 100 base-pair reads. Sequence reads were mapped using two aligners, Stampy [27] (with an expected substitution rate of 0. 01) and Burrows-Wheeler Aligner (BWA, with default settings) [28] to the C. difficile 630 reference genome (Genbank: AM180355), CD630 [29]. High quality base counts were extracted from mapped data for variable sites using SAMtools [34], retaining bases with a base quality score ≥30 and a mapping quality score ≥30. As the initial algorithm was designed to detect mixed ST infection, the variable sites analysed were first restricted to the 150 single nucleotide variants (SNPs) within the 7 MLST loci based on all published alleles [35]. The variable sites studied were subsequently extended to make full use of the whole genome data, see results above. To allow extraction of 16S ribosomal RNA genes, reads were also assembled de novo using Velvet with the Velvet Optimiser [31]. Each sample was assumed to be a mixture of 2 haplotypes, resulting in one dominant and one minor haplotype, with the proportion of the total sequence present made up by the dominant haplotype denoted μ. For each sample analysed we let, N = total number of variable sites considered nj = total number of reads at a variable site j = 1…N bij = an observed nucleotide from a single read i = 1…nj mapped to variable site j, from the set {A, C, G, T} Bj = a vector of the nj nucleotides from the reads mapped to site j, ε = Pr (sequencing error in a base call). Assumed constant across all bases calls, having filtered our data to exclude low quality bases and reads μ = proportion of the sample from the dominant haplotype (0. 5≤μ≤1) a1j = nucleotide in the dominant haplotype at site j a2j = nucleotide in the minor haplotype at site j Aj = the combination of nucleotides in the dominant and minor haplotypes respectively, a1j and a2j, one of the set of all 16 possible pairs of nucleotides, A: (1) We expressed the probability of observing a particular nucleotide in a given read mapped to site j in terms of the underlying dominant and minor haplotypes, the mixture proportion and error probability. We assume the probability of a sequence error, ε, is constant across all variable sites, and if an error occurs it is equally likely to result in any of the three alternative nucleotides (i. e. if the true nucleotide is A, then a read containing C, G, or T is equally likely): (2) As ε is treated as a known constant, the probability of observing the nj nucleotides mapped to site j, for a given value of Aj is: (3) Where Aj is unknown, summing over all possible values of Aj gives: (4) To define Pr (Aj) for each possible value of Aj we let d be the proportion of all variable sites included in the analysis that are divergent between the dominant and minor haplotypes. At sites divergent between the haplotypes 12 possible pairs of nucleotides could be present, and at non-divergent sites 4 pairs of nucleotides are possible, such that: (5) Combining (4) and (5), we then expressed the probability of observing the nj nucleotides mapped to site j, for a given mixture proportion and divergence between the dominant and minor haplotypes: (6) The values of μ and d were then jointly estimated from their likelihood: (7) A major question is how to determine whether the data are consistent with a mixed infection. A simple but arbitrary approach would be fix thresholds of μ and d, (e. g.). However, we adopted an alternative approach: comparing the maximum likelihood obtained under the mixed infection model with the likelihood of the data without mixed infection, i. e. μ = 1, d = 0. Comparing the log-likelihood ratio statistic to a chi-squared distribution is problematic, as the null hypothesis is on the edge of the parameter space. Therefore we used a calibration set of 100 samples known not to contain mixed infection to determine a deviance (−2 log likelihood ratio) threshold for confirming mixed infection. The value of the threshold was chosen to achieve a 5% false positive rate. This empirical approach by using a calibration set of actual sequences also has the advantage that it accounts for low-level sample contamination that may occur during sequencing. This would not be easily accounted for in another alternative for determining mixed infection, simulating under the null hypothesis in a bootstrapping approach. Confidence intervals for μ and d were generated by non-parametric bootstrap sampling. The variable sites were sampled with replacement 1000 times keeping each Bj constant. A database of known sequences was used to estimate the dominant and minor haplotypes present, using the estimate of μ obtained above. From (6), for each potential haplotype pair the value of Aj and d are known therefore the probability of observing all the nucleotides mapped to site j is: (8) Therefore the likelihood of a given pair of dominant and minor haplotypes given the sequence data is: (9) Finally, the posterior probability of each pair of haplotypes was obtained using the product of the prevalence of the dominant and minor haplotypes as their prior probability and the likelihood of each pair above. For MLST analyses the prevalence of each ST in Oxfordshire from September 2007 to March 2010 was used [20]. STs not found during the study but present in pubMLST [35] were assumed to be as prevalent as the least common ST. For whole genome analyses the prevalence of each unique sequence during the study was used. When using whole genome data to assess whether the dominant and minor pair selected were consistent with the data the estimated divergence and 95% confidence intervals were compared with the actual divergence between the dominant and minor sequences. Where the actual pairwise divergence fell within the estimated 95% confidence interval the pair was considered a good match. However when the divergence fell outside of the confidence interval this was interpreted as evidence that the true dominant or minor sequence was not present in the database. For all analyses the value of ε was set to the sum of the base and error mapping rates, assuming each had a PHRED score of 30 (the thresholds used for determining high quality bases to retain in the analysis), i. e. ε = 2×10−3. This represents the upper bound on the value of ε after filtering. However results were similar with lower values of ε tested up to ε = 2×10−4. To generate in silico simulated mixed infections two samples known not to be mixed themselves were mixed in varying proportions. Firstly, read depths were normalised across the two samples by multiplying base counts in the sample with lower coverage to match the coverage in the other sample. Nucleotides were then sampled from reads mapped to each variable site (with replacement). The input sequence each read was sampled from was determined using a binomial distribution with parameters of normalised read depth, and input mixture proportion. All analyses were conducted using R (http: //www. r-project. org). The code used can be found in Text S2. Text S3 contains a short Python (http: //www. python. org) script that can be used to obtain high quality base counts from mapped BAM files. Text S4 contains an explanation of the required input files for Text S2 and the output generated. Dataset S1 contains an example dataset of the 26 patient samples analysed for the presence of mixed ST infection, and provides an example of the formatting on the input and output files. The sequences reported in this paper have been deposited in the European Nucleotide Archive Sequence Read Archive under study accession number ERP002428 and are available at http: //www. ebi. ac. uk/ena/data/view/ERP002428.

Title: Detection of Mixed Infection from Bacterial Whole Genome Sequence Data Allows Assessment of Its Role in Clostridium difficile Transmission Summary: Traditionally, outbreaks of infectious diseases are investigated by considering contact between cases and their exposure to possible sources of infection. This can be enhanced by using the genetic fingerprint of bacteria to rule out transmission between cases infected with unrelated strains. However, in some cases patients are infected with more than one strain of the same species of bacteria. This is known as mixed infection. Using current methods usually only one strain of bacteria is analysed, so transmission might be ruled out wrongly if there is a mixed infection. We developed a method that exploits new high-resolution genetic fingerprinting in bacteria to detect patients that are infected with multiple strains of the same bacterial species. We investigated the important healthcare-associated infection Clostridium difficile, revealing previously undetected mixed infections, and identifying a previously undetected transmission event. By interrogating a database of bacterial strains, our method deduced the mixed strain types, which we showed were not compatible with direct transmission among the patients under investigation. Our method can improve the sensitivity of outbreak investigation across different types of bacteria, which will ultimately help to reduce transmission in hospitals and the community.

lay_plos

en

Write a title and summarize: We perform a comprehensive integrative analysis of multiple structural MR-based brain features and find for the first-time strong evidence relating inter-individual brain structural variations to a wide range of demographic and behavioral variates across a large cohort of young healthy human volunteers. Our analyses reveal that a robust ‘positive-negative’ spectrum of behavioral and demographic variates, recently associated to covariation in brain function, can already be identified using only structural features, highlighting the importance of careful integration of structural features in any analysis of inter-individual differences in functional connectivity and downstream associations with behavioral/demographic variates. Understanding individual human behavior has attracted the attention of scientists and philosophers since antiquity. The first quantitative approach intended to deepen such understanding dates to the first half of the 19-th century when skull measures were related to human behavior or cognitive abilities (Simpson, 2005; Fodor, 1983). Technical, intellectual and clinical advances in the last two centuries allow us to now accurately quantify brain structure and function (Lerch et al., 2017; Huettel et al., 2004; Friston et al., 2002; Woolrich et al., 2004; Rorden et al., 2007), and to summarize certain ‘aspects’ of human behavior by means of standardized tests. Such advances facilitate exploratory statistical learning analyses to uncover previously hidden relationships between brain features and human behavior, demographics or pathologies (Poldrack and Farah, 2015). These developments are expected to be pushed even further with the emergence of the big data magnetic resonance imaging (MRI) epidemiology phenomenon (Van Essen et al., 2013; Collins, 2012), and some examples of such expectations have already reported associations with blood-oxygen-level dependent (BOLD) brain function (Finn et al., 2015; Smith et al., 2015); for example, functional connectivity patterns can be used to identify individuals (Finn et al., 2015), predict fluid intelligence (Finn et al., 2015), or describe a mode of functional connectivity variation that relates to lifestyle, happiness and well-being (Smith et al., 2015). Although the brain’s structural-functional relationships are not yet fully understood, linking structure to behavior is essential for either type of imaging modality to be fully interpretable as an imaging phenotype. Furthermore, given the long-term character of some demographic variables (e. g. overall happiness), we hypothesize that different brain structural features, such as regional variation in the density of gray matter or subject-dependent degree of cortical expansion, should also reflect these relationships. To test these hypotheses, in this work we make use of the large quantity of high quality behavioral and neuroimaging data collected by one of the big data initiatives, the Human Connectome Project (Van Essen et al., 2013) (HCP). The HCP sample includes detailed structural imaging, diffusion MRI, resting-state and several different functional MRI tasks for each subject. Furthermore, the availability of more than 300 behavioral and demographic measures (Van Essen et al., 2012) allows the post-hoc exploration of a wide range of associations (Groves et al., 2011). We further hypothesize that behavioral variations can be explained by more general brain structure variations than isolated single feature variations (e. g. cortical thickness variations); we consequently extract multiple structural features from the different MR modalities and perform a simultaneous analysis by linked independent component analysis (Linked ICA; Groves et al., 2011; Groves et al., 2012). Linked ICA is a Bayesian extension of Independent Component Analyses developed for multi-modal data integration, where multiple ICA factorizations are simultaneously performed and all of them share the same unique mixing matrix. Such analyses increase statistical power by evidence integration across different features (Wolfers et al., 2017; Doan et al., 2017) and have been shown to be powerful in identifying correlated patterns of structural and diffusion spatial variation that can then be studied in relation to individual behavioral and demographic measures (Doan et al., 2017; Douaud et al., 2014; Francx et al., 2016). Although similar analyses have been previously performed (Douaud et al., 2014), in this work we benefit from the unique characteristics of the data sample; we consider brain and behavioral data from close to 500 ‘healthy young adults’ which reduces common pathology- and age-related variance and increases the power to detect associations due to normal cross-sectional variability. Our results support the hypothesis that structural brain features are strongly associated with demographic and behavioral variates. Interestingly, the most relevant mode of inter-individual variations across brain structural measures identified through the multi-modal data fusion approach maps on to recent findings obtained using functional MRI data from the same HCP cohort. In particular, our findings closely resemble the ‘positive-negative’ set of behavioral measures identified in Smith et al. (2015) on the basis of functional (co-) variations. Using post-hoc analysis of the functional and structural modes we show that inter-individual differences attributed to brain function need to be reconsidered taking into account variations in brain structure across the cohort. The multi-modal structural brain data analyses (Figure 1, operations A and B) resulted in a total of 100 collections of component maps, each of which can be represented by a collection of 7 spatial maps covering the gray-matter space (voxel-based morphometry feature (VBM) ), diffusion skeleton space (Fractional Anisotropy (FA), Mean Diffusivity (MD) and Anisotropy Mode (MO) features), cortical vertex space (cortical thickness (CT) and pial area (PA) features) and a voxel-wise map of the Jacobian deformation (JD). In addition, each collection of maps is associated with a single vector of contributions that describe the degree to which a given collection is ‘driven’ by the different modalities (feature loadings). Finally, each collection is associated with a single vector that describes how each individual subject contributes to the component (subject loadings). Post-hoc linear correlation analyses of these subject contributions with behavioral measures identified, after FDR correction (Figure 1, operations C, D and E, FDR corrected q < 2. 2 × 10-4), a total of 155 significant brain-behavior correlations, summarized by 30 components reflecting at least one significant relationship to behavior. We provide the full results in Supplementary file 2 and a brief summary in the bottom left panel of Figure 1 where we color code the significant Pearson correlation values for the components showing at least one Bonferroni corrected (Bonferroni corrected q < 1. 4 × 10-6) significant correlation to a behavioral or demographic measure. Only a single component (number 6) shows strong associations across a broad set of behavioral domains (48 measures) and across all structural modalities (i. e. is not dominated by one of the structural data types in that no single modality contributes >50% to the total variance of the component). The relative contributions from the different modalities are 22% for VBM, 6% JD, 15% FA, 23% MD, 20% MO, 7% CT and 4% PA (Appendix 1—figure 1), reflecting a dominance of gray matter densities and diffusion measures and a lower involvement of the purely morphometric and cortical measures. Relating the behavioral associations, in Figure 1 bottom right panel we provide a summary of the behavioral measures significantly correlating with component six as well as the corresponding Pearson correlation values. Note that in the cases where several measures are grouped together we report their mean correlation value - full results are given in Supplementary file 2. We observe that component number six relates to various behavioral scores including working memory, language function and general wellbeing (life satisfaction, social support). In Figure 2 we present the associated spatial maps: VBM measures are most heavily weighted in bilateral orbitofrontal cortex, temporal pole, lingual gyrus and the putamen (first row). Morphometric differences (JD features) load into temporal lobes, caudate and brainstem (second row), and white matter tracts do most heavily weigh onto the internal capsule, anterior thalamic radiation and the anterior corona radiata (3rd, 4th, and 5th rows). Cortical effects (6th and 7th rows) are largely associations with multi-modal association cortex that show effects whereas primary sensory cortices are not implicated. Note that the involvement of areas such as the putamen and lingual gyrus are relevant to explain the behavioral relationships found with working memory and word processing. Furthermore, the involvement of structural connections between subcortical and prefrontal areas as well as the orbitofrontal cortex and temporal poles could explain the link to more complex functions such as emotional support or life satisfaction. Note that each component considers structural multi-modal characterizations of the brain where each modality contains unique information and together builds into a multi-modal multivariate component. Consequently, although these results are hard to interpret as being nested into the same space as (functional) canonical brain networks, the structural weighting in gray matter modalities in orbitofrontal and temporal cortex, in conjunction with the white matter tracts that connect those regions, is a clear indication of an underlying network structure relating to component six and consequently, to its behavioral associations. Several other components also reflect behavioral patterns worth recognizing. In Figure 3 we report spatial maps associated with the components showing at least one Bonferroni corrected significant relationship with any behavioral measure (p<1. 4×10−6). For components 1,2 and 89 we show spatial maps for all modalities contributing (Appendix 1—figure 1). In order to provide a clearer interpretation, for the other components we decided to show a selection of the relevant modalities and full NIfTI maps are separately available as supplementary material. Component one relates mainly to gender, physical strength and language and it is defined by significant changes in gray matter density (VBM measures) and cortical areal expansion (PA measure). Its associated spatial patterns appear to in fact reflect brain size and cortical area differences in both temporal lobes. Similarly, component two is driven by VBM maps and correlates with variations in gender, age, height, weight and strength. Its spatial extent includes the paracingulate gyrus and bilateral insular and opercular cortex. Components 7,24,25,29 and 55 are driven by at least three feature modalities and they map into gender, weight, body mass and height. Component seven maps into gender and shows cingulate gyrus and insular cortex. Component 24 maps into weight and body mass and is mapped into putamen, intracalcarine cortex and thalamus. Components 25 and 29 relate height with the inferior temporal gyrus and the cerebellum together with strong DWI weightings in the brainstem. Component 55 relates to weight and maps into the precentral gyrus and asymmetric differences in DWI measures. Number 89 maps VBM and JD into hematocrit and involves the lingual and occipital fusiform gyrus. Finally, component 20 maps JD and VBM in the posterior midline into age and relationship status. Although another set of components show associations to behavior, these are limited to a single modality and/or a small set of behavioral variates (Supplementary file 2). Many of these components show simple relationships to overall size measures such as weight, body mass (BMI) or height, and the associations are weaker than those reported above; we consequently decided to not further discuss their spatial extent in this work and we provide full NIfTI images as supplementary material. To validate the robustness of the presented results to the model order choice we performed analyses at different dimensionalities and observe that especially lower indexed components are highly reproducible. In particular, component number six is recovered at dimensionalities 90 and 110 with a subject mode correlation value of around r ~ 0. 9 (details can be found in Appendix 1, section ‘Robustness: model order’). Regarding the influence of purely morphometric differences in the analyses, a comparative analysis excluding the JD revealed essentially unaltered brain-behavior associations. Analysis of the JD feature in isolation showed that no fully corrected significant association to the reported positive-negative structural mode is found when considering uniquely morphometric differences, even if considering several components together. However, uncorrected statistics suggests that information of the positive-negative mode could already be present at the morphometric level. These results are presented in Appendix 1, section ‘Robustness: analyses without Jacobians’, and ‘Robustness: Analyzing morphometric differences’. Given the similar associations to behavior found between the presented structural mode (component 6) and the ‘positive-negative’ functional mode reported in Smith et al. (2015), and since both results are obtained using the HCP sample, we quantified the linear relation between them. With the analysis restricted to the 421 subjects common to both studies, we found that the structural and the functional subject modes are significantly correlated (r = 0. 4643, r2 = 0. 21, permutation p<10−5). Post-hoc correlation analyses to behavior replicated the original functional positive-negative mode by identifying 60 functional-behavioral relationships (Smith et al., 2015); we found that 22 of these behavioral measures are also associated to the structural mode and that there is no significant difference in the correlation values provided by the functional or the structural analyses at these intersecting behavioral measures (details can be found in Appendix 1, section: ‘On the power of structural and functional associations to behavior’). To identify the linear dependence between the behavioral/demographic modes obtained from functional and structural data we used a generalized linear model (GLM). We regressed the structural mode from the functional one and performed post-hoc linear correlation analysis of the residualised functional mode relative to behavioral variates as in Smith et al. (2015). Note that structural features – due to the necessary co-alignment within the functional pipelines – acts as a mediator and therefore could induce significant imaging-to-behavior associations (also see Bijsterbosch et al., 2018). Conversely, however, the structural features enter into the cross-subject analysis without any possible cross-talk from functional data, so that there is no possible interference from functional to structural features. The post-hoc correlation analysis of the residualised functional mode to behavior revealed a significant decrease in correlation (mean r decrease = 0. 078, p<0. 01) that result in the structural mode removing 73% of the 60 associations originally found using functional data. The remaining 16 significant relationships involve measures as handedness, education, tobacco use, list sorting, delay discount, and intelligence. As such, the two modes are significantly overlapping. We also performed a structural-functional Linked-ICA analyses where we added partial correlation matrices obtained from resting state fMRI to the set of originally considered structural features. We selected functional fMRI features to match Smith et al. (2015); details on data availability and processing are provided in Appendix 1, section ‘Individual features pre-processing’. This structural-functional analysis recovered the positive-negative mode reported in the originally reported multi-modal structural analyses. More concretely, we found a component, number 16, significantly correlating (r = 0. 89, p<10^−5) with the mainly reported structural mode (component 6). The contribution of each modality to this mode equals 20% for VBM, 15. 6% for FA, 24. 4% for MD, 23. 9% for MO, 7% for CT, 3% for PA, 5% for JD and 0. 0012% for the functional partial correlation feature. While all structural features reflect approximately the same contribution as in the original structural analyses, it is interesting that the functional data does marginally contribute to the found mode, suggesting that structure in its own can explain the positive-negative behavioral mode. As a final step in our analysis we performed a causal analysis between the structural mode (component 6) and the functional mode reported in Smith et al. (2015), on the basis of calculating pairwise likelihood ratios (Hyvarinen and Smith, 2013) between the function-to-structure and structure-to-function model. This analysis estimated a likelihood ratio of ~0. 04, that is a significant structure to function causation effect (p<0. 0025, using permutation testing) (Hyvarinen and Smith, 2013) (for details see Appendix 1, section ‘Testing structure-function causal effects’). Replication of these causal results was achieved by performing an analogous multi-modal structural Linked ICA analyses considering this time the HCP1200 sample, and including only the subjects not used in the originally considered HCP500 sample. The analyses revealed a component that, restricted to the 331 intersecting subjects, showed once more a significant correlation with the positive-negative mode reported in Smith et al. (r = 0. 1773, p<0. 002). Furthermore, consecutive causal analyses from the structural mode to the functional mode estimated a likelihood ratio of ~0. 09, that is a significant structure-to-function causation effect (p<0. 005). We present a simultaneous analysis of brain structural measures that reveals how several types of behavior and demographics link to variations in such measures of brain structure. Several components detect simple associations between brain size (encoded in gray matter density and cortical area) being related to gender, strength, endurance or language function. More interestingly, we encounter a single pattern of gray and white matter covariation that is strongly associated with several measures relating to cognitive function including working memory and language function, while also being strongly related to several measures of wellbeing including life satisfaction or emotional support. Accordingly, the spatial organization of the component that relates to these measures predominantly includes regions and connections that are relevant to working memory and word processing such as the putamen and lingual gyrus (Mechelli et al., 2000; Arsalidou et al., 2013). Additionally, the inclusion of regions such as the orbitofrontal cortex and temporal poles, as well as structural connections from subcortical to prefrontal regions, could explain the link to more complex functions such as emotional support and life satisfaction. Furthermore, the mode of structural variation we report here relates to several recently reported results obtained using functional MRI. In particular, our results relate to the ones presented in Finn et al. (2015) since it identifies fluid intelligence measures and it also shares many behavioral measures also identified by the ‘positive-negative’ mode reported in Smith et al. (2015). Clearly, the functional analyses presented in Smith et al. (2015) and the one we present here, while using entirely different MRI measurements, are both able to get at the core of the same behavioral spectrum; in fact, the structural mode and the functional mode are strongly correlated subject measures (r = 0. 46). Our analyses reliably augment the spectrum of behavioral variables reported by the functional analyses by extending it with many working memory, language, relational task, ASR and DSM measures (Figure 1 bottom right and Supplementary file 2). It is to note here that while the statistics reported in Smith et al. (2015) were obtained from a Canonical Correlation Analyses (CCA) between partial correlation matrices and all behavioral measures at once, the statistics we present here involve simple linear correlations. While the former type of analysis can benefit from the multi-variate type of analysis through the application of CCA, ensuing results can be hard to interpret. The straight-forward individual linear correlation analysis against the behavioral/demographic measures separately instead affords simple interpretation. These findings directly look into the relationship between brain structure and function. In fact, the functional mode of variation is strongly associated with connectivity in brain areas approximately resembling the Default Mode Network (Smith et al., 2015) and, given the spatial extent and the strong weight of the DWI data in the structural mode we report, it seems reasonable to assume that these white matter structure variations could contribute to the functional connectivity changes reported in Smith et al. (2015). Further, we found no clear spatial overlap between the reported structural mode and the cortical functional extent of the ‘positive-negative’ mode, suggesting that integrated functional-structural analyses should increase the sensitivity of both functional and structural analyses. Further, these results might question whether group functional connectivity measures using fMRI provide direct measures of brain connectivity or are biased due to individual structural differences that may become ‘visible’ in the analysis of functional cross-subject. An analogous multimodal analysis excluding the JD feature provided equivalent results to those presented here (Supplementary file 3) and unimodal analysis of only the JD features (using simple ICA-based decomposition (Beckmann and Smith, 2004) of the single JD modality) did not provide significant correlation to the behavioral mode at the level of fully corrected statistics. These extra analyses confirm that the structural features relating to the behavioral mode are not uniquely driven by morphometric differences. The post-hoc correlation analysis of the residualised functional mode to behavior revealed a significant decrease in correlation (mean r decrease = 0. 078, p<0. 01) that result in the structural mode removing 73% of the 60 associations originally found using functional data. The remaining 16 significant relationships involve measures as handedness, education, tobacco use, list sorting, delay discount, or intelligence. As such, our results confirm that many associations previously attributed to functional connectivity are already present at the structural level. This could be interpreted in terms of a specialization of functional imaging towards a specific subset of behavioral measures for which it provides strong effects even after linear accounting for the structural findings, implying that not all previously identified associations can be explained through inter-individual differences in brain structure. As such, these two modes are significantly overlapping measures that are not fully reflected in the Jacobian deformation field. The presence of residual functional associations to behavior suggests that these associations - although possibly influenced by structural variation - cannot uniquely be attributed to simple morphometric differences. These results align with recent findings by Bijsterbosch et al. (2018) who show that individual spatial configurations extracted from functional MRI rather than the connectivity profiles between areas seem to stronger relate to the positive-negative mode. While the presence of residual associations could be interpreted as evidence for functional-structural integration, care needs to be taken with regards to the interpretation of these associations and changes thereof. First, note that all of these methods interrogate the linear relationships between variates. It is entire possible that the association between imaging phenotypes and behavioral/demographic measures involve non-linear relationships that remain at best incompletely accounted for within these analytical frameworks. Second, the implicit symmetry of linear correlations implies that a corresponding residualised analysis (where we regress functional variations from the structural mode) similarly removes significant associations. Indeed, in such a case only 7 out of 48 associations remain significant (relating to weight, antisocial behavior (DSM), family structure problems, relational task or adult self-report (ASR) questions, see Appendix 1, section ‘On the power of structural and functional associations to behavior’). These results suggest a segregation of different structural and functional specializations towards different behavioral measures with for example, intelligence being, not only, but more related to brain function, and antisocial or relational task measures relating more strongly to brain structure. Finally, a causal analysis revealed a significant structural to functional mode causation (Hyvarinen and Smith, 2013) where the likelihood of the structural mode causally influencing the functional mode (from Smith et al., 2015) is >20 times higher than the likelihood of the reverse causation. Although the causal model introduced in Hyvarinen and Smith (2013) considers the residuals after linear modeling of a pair of signals, care is advised when considering causal inference on two vectors of observations, as we cannot exclude the possibility that unobserved underlying processes simultaneously influence brain structure and function (‘hidden causation’). Nevertheless, these causal findings align with the fact that cross-subject analysis of functional data typically necessitates processing of structural data (e. g. through co-registration into a common space). As such, structural variations will enter as mediating factor in any functional analysis pipeline and need to be accounted for suitably. However, there is no reverse influence of functional variations in the analysis of structural measures. Such dependencies remain poorly modeled in current analysis procedures and future work will have to focus on robustifying functional MRI analysis with regard to cross-subject variations in brain structure, for example by more advanced alignment procedures and/or through derivation of functional measures that are invariant under variations in structure. This will have important implications for the interpretation of future finding across neuroimaging ‘big data’ studies and will help improve our understanding of the functional-structural integration and its relation to behavioral associations. To uncover relationships between the behavioral/demographic measures and the components obtained from the Linked-ICA decomposition we perform a correlation analysis between each independent component subjects’ contribution and each available behavioral measure. This operation is schematically summarized in Figure 1 operation C. To take into account the family structure present in the HCP sample while assessing significance we use the Permutation Analysis of Linear Models (PALM) (Winkler et al., 2014; Winkler et al., 2015) and use 106 permutations per tested correlation (Figure 1 operation D). We define significance at p<0. 05 and address the multiple comparison by applying FDR correction (Benjamini and Hochberg, 1995) as well as full Bonferroni correction (Figure 1 operation E).

Title: Inter-individual differences in human brain structure and morphology link to variation in demographics and behavior Summary: For years, scientists have tried to explain human behavior by measuring brain characteristics. During the first half of the 19th century, craniometry, the science of taking measurements of the skull, was a popular field of research and cognitive abilities as well as many behaviors were associated with different skull sizes and shapes. Although craniometry has been broadly discredited as a science, the study of brain structure and function, and their correlation to human behavior, continues to this day. Currently, one of the most powerful tools used in the study of the brain is magnetic resonance imaging (MRI), which relies on strong magnetic fields and radio waves to produce detailed imaging. These images can provide functional information, by measuring changes in blood flow to different parts of the brain, as well as structural information such as the amount of gray or white matter or the size of different brain regions. Many studies have shown correlations between functional MRI (fMRI) data and behavioral and demographic traits, such as years of education, lifestyle habits or stress. Another advance in the study of the relationship between behaviors and the brain has been the emergence of better statistical analysis tools thanks to increasing computing power. These tools have made it possible to integrate data from different sources and analyze many variables at the same time, allowing patterns to emerge that would have been previously missed. Llera et al. have analyzed a large dataset from young healthy volunteers to show that changes in behavioral traits can be predicted by brain structure, and not just by brain function as previously shown. Different types of brain structural data, including what the surface of the brain looks like and relative volumes of gray and white matter, were integrated and analyzed, and correlations between changes in these variables and changes in the demographic and behavioral traits of the subjects were found. Previously, a robust relationship had been established between specific patterns of connections and activity in the brain and a group of characteristics such as life satisfaction, working memory, weight and strength, loneliness, family history of drugs and alcohol use, etc. Llera et al. show that this relationship also holds between the traits and structural brain data. As an example, there is a positive correlation between changes in the number of years of education and the income of the subjects and changes in a pattern of integrated structural data that include the amount of gray matter, white matter integrity and size of specific brain structures. Given these findings it becomes important to reconsider whether differences between individuals previously attributed to brain function could simply explained by the shape or size of the brain and its parts. These findings show that physical brain characteristics, including its size or the shape of its surface, could predict information such as individuals' lifestyle decisions or their income; also implying that these characteristics are not simply a product of brain function. The results also demonstrate the power of combining different types of brain data to predict patterns in behavior.

lay_elife

en

Summarize: A company that served as a showcase for the Obama administration’s effort to create jobs in clean technology shut down Wednesday, leaving 1,100 people out of work and taxpayers obligated for $535 million in federal loans. Solyndra, a California solar panel maker, had long been an administration favorite. Over the past two years, President Obama and Energy Secretary Steven Chu each had made congratulatory visits to the company’s Silicon Valley headquarters. Although Wednesday’s announcement came as a surprise, House Republicans and government auditors had questioned the wisdom of the administration’s loan guarantees to the company, backed by capital from billionaire Democratic fundraiser George Kaiser. In July, a House subcommittee subpoenaed White House documents related to the guarantee, and after Wednesday’s developments, Republican lawmakers vowed to continue investigating. Solyndra officials said in a news release that they were suspending operations and planned to seek Chapter 11 bankruptcy protection. The move would give the company time to evaluate options, including selling the business or licensing its technology to other companies. “This was an unexpected outcome and is most unfortunate,” Solyndra chief executive Brian Harrison said in a statement. “Regulatory and policy uncertainties” made it impossible to raise capital to quickly rescue the operation, he said. The White House said that it remained committed to building an economy based on clean technology. “While we are disappointed by this particular outcome, we continue to believe the clean energy jobs race is one that America can, must and will win,” it said in a statement. “The Department of Energy’s overall portfolio of investments — which includes dozens of other companies — continues to perform well and is on pace to create thousands of jobs.” Wednesday’s announcement came amid a broader shakeout in the solar industry. Energy Department officials said that less expensive solar panels made by government-subsidized companies in China undercut Solyndra’s products. “We have always recognized that not every one of the innovative companies supported by our loans and loan guarantees would succeed,” Energy Department spokesman Dan Leistikow said in a statement. “But we can’t stop investing in game-changing technologies that are key to America’s leadership in the global economy.” The Treasury Department provided Solyndra’s loan, on the assurance of the Energy Department. The terms were reviewed in advance by the White House Office of Management and Budget, and almost all of the $535 million has been disbursed to Solyndra. Taxpayers might be on the hook for most of the loan if Solyndra is unable to repay, said experts in the stimulus and loan guarantee program. The Energy Department could seek repayment in court, but receiving more than a nominal amount is unlikely because of the company’s depleted cash and assets. “Congress recognized the risks inherent in such an effort and wisely set aside funding to offset any potential defaults or losses,” Leistikow’s statement said. Some of the biggest investors in Solyndra, which made easy-to-install solar panels for industrial applications, were venture capital funds associated with Kaiser, a key Obama fundraiser. The company, its connections to the administration and the imperiled federal loan guarantee were detailed in a Washington Post report in June. On July 13, the Republican subcommittee majority voted to subpoena White House documents related to the loan guarantee, as it probed how Solyndra received the administration’s first loan guarantee under the federal stimulus plan. Material sought by the committee included e-mails and other documents that the lawmakers said officials at the Office of Management and Budget had failed to produce voluntarily. On Wednesday, Republicans on the House Energy and Commerce Committee issued a statement saying that Solyndra executives and administration officials had repeatedly assured staff investigators that the company was financially sound. They called Solyndra’s closing the latest indication that Obama’s stimulus policy had failed. “We smelled a rat from the onset,” Rep. Fred Upton (R-Mich.), chairman of the committee, said Wednesday in a joint statement with Rep. Cliff Stearns (R-Fla.), chairman of the committee’s investigations subcommittee. “For an administration that parades around the banner of transparency, they fought us tooth and nail all summer long in turning over relevant documents related to the credit approval, and today we found out why.” Administration officials have said the loan guarantee was issued on its merits alone. Democrats said the White House had done its best to comply with congressional investigators, whose requests were what Rep. Henry A. Waxman (D-Calif.) in July called a “fishing expedition.” Solyndra had repeatedly been highlighted as a model by the Obama administration. Chu attended the groundbreaking of the factory that Solyndra built using the federal loan, and Vice President Biden’s image was beamed to the ceremony through a video feed. In early 2010, independent auditors questioned whether Solyndra could remain a “going concern.” Obama visited Solyndra’s factory in May 2010. “The future is here,” Obama said in his appearance, praising plans “to hire a thousand workers.” A month after Obama’s visit, the company withdrew plans for a public stock offering. A few weeks later, Government Accountability Office auditors announced that the Energy Department had given favorable treatment to some loan-guarantee applicants. A GAO report said the department bypassed required steps for funding awards to five applicants, including Solyndra. Earlier this year, the Energy Department’s inspector general criticized the agency for not maintaining e-mails discussing how loan-guarantee winners were selected. GAO auditors, who first uncovered the department’s rush to provide Solyndra a loan without completing required reviews, fear that similar defaults could happen with other loan guarantee projects that weren’t properly vetted. In June, Solyndra chief Harrison told The Post that the company’s finances had improved. With cumulative sales of more than $250 million, he said, Solyndra “doubled our production from 2009 to 2010, and we’ll double it again from 2010 to 2011.” Costs for solar panels have dropped rapidly as the market matures, so that stronger companies are emerging and less competitive ones are falling by the wayside, said Rhone Resch, president of the Solar Energy Industries Association. But solar industry analyst Peter Lynch said that Solyndra struggled from the beginning with an imbalanced financial model. “You make something in a factory and it costs $6, you sell it for $3, but you really, really need to sell it for $1.50 to be competitive,” Lynch said of Solyndra. “It was an insane business model. The numbers just don’t work, and they never did.” In a blow to the Obama administration's efforts to create green jobs, solar-cell maker Solyndra announced Wednesday that it will close its remaining Fremont factory, lay off its 1,100 employees and file for bankruptcy. The news marked an abrupt end for a company once considered among the most innovative in a fast-changing industry. The bankruptcy also represents a high-profile failure for a federal stimulus program that gives loan guarantees to green-tech manufacturers. Solyndra was the first company to win one of the guarantees, receiving $535 million in 2009 to build its second factory in Fremont less than a mile from the company's original plant. Both President Obama and former Gov. Arnold Schwarzenegger toured the new plant, citing it as a symbol of the nation's economic recovery and commitment to a green economy. But Solyndra, whose solar modules are thin tubes rather than flat panels, struggled to compete against a flood of low-priced solar cells pouring out of heavily subsidized factories in China. Last year, the company canceled plans for a $300 million initial public stock offering and closed its first Fremont factory, laying off 40 people. Breaking the news Early Wednesday morning, as workers on the night shift left the factory floor, Chief Executive Officer Brian Harrison met with them to break the news. Most had been let go by 9 a.m. "We are incredibly proud of our employees, and we would like to thank our investors, channel partners, customers and suppliers for the years of support that allowed us to bring our innovative technology to market," Harrison said in a news release. "This was an unexpected outcome and is most unfortunate." Republican critics of the loan program were livid. A congressional panel had started investigating in February how Solyndra won approval for the loan guarantees. Republicans focused on the first plant closure and the fact that one of the company's investors, George Kaiser, was an Obama contributor. "In an apparent rush to push stimulus dollars out the door, the Obama administration wasted $535 million in taxpayer funds in guaranteeing a loan to a firm that has proven to be unviable in the global market," Rep. Cliff Stearns, R-Fla., who chairs the House Energy and Commerce Committee's oversight and investigation subcommittee, said Wednesday. The panel already had subpoenaed records about the Solyndra loan from the U.S. Department of Energy. Risk of startups The Energy Department's public affairs director said Wednesday that while Solyndra's application was carefully vetted, investing in startup companies always carries risks. The loan program was created under the Bush administration in 2005 but became part of the federal stimulus effort under Obama. "We have always recognized that not every one of the innovative companies supported by our loans and loan guarantees would succeed, but we can't stop investing in game-changing technologies that are key to America's leadership in the global economy," Public Affairs Director Dan Leistikow wrote in a blog post on the Energy Department website. The federal government must now try to recover its investment through Solyndra's Chapter 11 bankruptcy proceedings, or taxpayers will be on the hook. Solyndra executives, meanwhile, will consider selling the business or licensing its technology. Tough industry The bankruptcy serves as another stark reminder of the fierce headwinds facing America's solar industry. The United States once dominated solar manufacturing. But as other nations - most notably China - jumped in, the U.S. share of the global market slid to below 10 percent, according to the Energy Department. Solar module prices have plunged more than 40 percent in recent years, squeezing companies' profit margins even as sales of solar systems grow. Two other U.S. solar companies, Evergreen Solar and SpectraWatt, filed for bankruptcy protection in August.

Summary: One of the showpieces for President Obama's green jobs push is going under-and leaving the federal government on the hook for $535 million worth of guaranteed loans in the process. Solyndra, a California-based solar cell manufacturer, told workers yesterday that it would be closing its remaining plant, laying off its 1,100 workers and declaring Chapter 11 bankruptcy, the San Francisco Chronicle reports. The company's cylindrical cells were innovative, but proved unable to compete with cheaper offerings from China. Solyndra was given government-backed loans as part of the stimulus, and both President Obama and Arnold Schwarzenegger toured its facilities. Now, critics are livid. House Republicans had already questioned the loan guarantees, subpoenaing related documents in July, the Washington Post reports. "In an apparent rush to push stimulus dollars out the door, the Obama administration wasted $535 million," complained Rep. Cliff Stearns. The Energy Department responded by saying not all startups will succeed, "but we can't stop investing in game-changing technologies."

multi_news

en

Summarize: Farmer's cologne: A new field-tested, cow-calming scent for men After giving it a test run I'm happy to report it a qualified success -- at least in the office cube farm environment (I never made it to a real farm)-- where my co-workers found the earthy, ever-so-slightly woody fragrance "intriguing," "complex" and "interesting." To me it was redolent of the grain and hay smells of the cow barn from my Vermont childhood (we usually had one dairy cow at a time - some five over the course of my youth), with an ever-so-slight medicinal note my scent memory puts in the same category as the various salves, udder balms and tinctures that went along with that '70s-era exercise in animal husbandry. When I first caught wind of the cologne -- made by the same Maine-based company that makes manly grooming products like tobacco-scented beard oil, whiskey-scented aftershave and a soap called "Hunting Camp" -- I was intrigued by the notion that the potion was formulated to be "aromatherapeutic and pleasing to cows and livestock." Does your dairy herd get skittish every time you hit the milking parlor drenched in Drakkar Noir? Does a splash of Hugo by Hugo Boss have your flock of sheep heading for the hills? If so, the answer to your fragrance faux pas may well be Portland General Store's new Farmer's Cologne. I recently had a chance to chat with Portland General Store's co-founder Lisa Brodar (the "nose" of the company) to find out a bit more about how the idea came about and who, exactly, the target audience is for a $110 vial of cow-calming cologne. All the Rage: How on Earth did you come up with the idea for this scent? Lisa Brodar: I was looking for an idea for a new cologne – I was thinking about doing a Hollywood scent actually – but my partner [co-founder Troy Tyler] and I have really gotten into homesteading and farming and trying to establish a permaculture garden so we decided to do something that involved that -- and supports the causes we support. That’s why 10% of profits goes to the Maine Organic Farmers and Gardeners Assn. ATR: Is cologne-related wilding a widespread problem? LB: In doing my research I found some material that talked about how cows and livestock don’t like strong fragrances. I remember reading one story about a farmer whose wife washed some of his clothes in a fragrant detergent and the cows really went really crazy and started acting up. They just hated it. And I thought: ‘Now that’d be a challenge!’” ATR: What was your process in formulating this scent? LB: Believe it or not, I actually found a list of scents that are beneficial and aromatherapeutic to livestock – cows specifically. But the actual making of the cologne was very challenging because a lot of those scents are a little off-putting to humans; they’re very strong tree-type essential oils that tend not to blend very well. And some of the scents do different things, some are supposed to calm them, others are for fertility. ATR: So it’s safe to say that the process for creating this scent was a different animal altogether? LB: Yes - exactly. I played around with a lot of different things – there were a lot of failures. I would let a version sit in a bottle for a few days and come back and it would smell terrible. Eventually I decided to use Sandalwood Vanautu essential oil for a base. Sandalwood wasn’t on the list [of beneficial scents] but it doesn’t really bother them either – it’s neutral to them. Then I added in some essential oils of the things that cows do like. ATR: Such as? LB: One is blue tansy, which has a really interesting smell, it’s almost like an ammonia-type of smell with some earthiness to it. Another livestock-friendly one in there is violet leaf. ATR: Did you end up field testing the final product? LB: I did. I have some friends with farms that have cows and horses and I wore it while I was near the animals. I put my arm up to a cow’s nose and gave the side of his face a scratch and he seemed happy. And I had one horse nuzzle me – of course I have no idea if that was because of the scent or if he was just a friendly horse. But none of [the animals] seemed put off by it. What is your all time favorite scent? Rose. It is pretty much perfect. There are many colognes and perfumes on the market meant to make you smell like your favorite celebrity or a nice beachy day, but Farmer’s Cologne will make you smell like a rancher fresh from the fields. Creator Lisa Brodar says Farmer’s Cologne is “for the guy in Brooklyn who wants to move back to the land, to become a homesteader … but who still likes going out at night,” according to Modern Farmer. Brodar tested the cologne’s “authenticity” by dousing herself in it before visiting a dairy farm. Modern Farmer reports, “Anecdotally, the cows rubbed up against her quite a bit — especially the females.” Brodar admits the test wasn’t scientific, but “all the signs seemed positive.” The Los Angeles Times put the scent to a human test and reported it “a qualified success … my co-workers found the earthy, ever-so-slightly woody fragrance ‘intriguing,’ ‘complex’ and ‘interesting.’ To me it was redolent of the grain and hay smells of the cow barn from my Vermont childhood.” At $110 per bottle (60 ml), the chance to smell like a farmer doesn’t come cheap. Surprisingly, the product is vegan and at least 85 percent organic, according to Portland General Store‘s website. The company will also donate 10 percent of profits to the Maine Organic Farmers and Gardeners Association. So, at least it’s no BBQ Cologne, but it’s up to personal preference if Farmer’s Cologne has the potential to become anyone’s scent of choice. Image Source: Bob Jagendorf/Flickr The powerful cow nose can pick up a scent from 6 miles off, and not for nothing – sex, death and family are all linked to a cow’s sense of smell. A mother cow tracks her calves by scent, and will grow anxious if separated. Smell is the main love currency between bulls and their mates. And cows have proven skittish about the odor of blood and offal (raising questions about whether they grasp their own mortality). Heavy stuff, this. Now perhaps you’ll suppress your snicker — there’s a new cologne from Portland, Maine, specially calibrated for cows. “I set out to make something sexy and subtle, that cows would find soothing,” says creator Lisa Brodar. Field Testing Cow Cologne Dutch Hollow Farm John Varvatos Eau de Toilette To determine whether Farmer’s Cologne brings all the cows to the yard, Modern Farmer staff writer Jesse Hirsch and editorial fellow Parker Hatley headed tofor a field test. Hirsch liberally poured on the Farmer’s Cologne, while Hatley lathered up with nightclub favorite The comparison test was twofold: fraternizing with some calves (i.e., young tastemakers), then milking a couple of full-grown cows. Here are the findings: 1) Young cows love Farmer’s Cologne. The calves swarmed Hirsch, sniffing and sticking their heads through the fence to say hello. At one point, Hirsch dumped a bunch of the cologne in his bag (clumsiness, not science) and one frisky lady started pulling it over the fence with her teeth. 2) John Varvatos, not so much. The calves acted spooked around Hatley, bracing their legs and keeping about 5 feet of distance. One brave little soul ventured in to smell him, then skittered off. “That one literally just made a retching noise,” said Hatley. 3) Adult cows love Farmer’s Cologne. Hirsch milked a cow named Minty (herself named for a pleasant smell). She was copacetic and calm, despite Hirsch’s ham-handed attempts to secure milking equipment to her udders. 4) John Varvatos, not so much. Hatley’s cow, Edrinalee, grew skittish immediately. She kicked off her milking equipment twice, and eventually farmer Nathan Chittenden had to restrain her legs with a hook (“90 percent of our cows never require the hook,” said Chittenden.) She also took twice as long as Minty to be milked, and gave less product. Naturally, this was one of the least scientific tests possible. Variables that could have affected the results: general demeanor of the milkers, Minty and Edrinalee’s moods, their positions on the milking line, etc. Chittenden says his cows do react to smells; they might nip at your hair if it’s freshly washed, and they’re averse to the odor of smoke. Still, he doubts the power of this new cologne. “There are so many factors that could have created these results,” he said. “I wouldn’t give it too much weight.” Brodar owns Portland General Store, maker of natural scents for the rustic, modern hombre. Options include Moonshine, Moss, Tobacco, and Wood. Her new, cow-friendly cologne costs $110 a bottle and is targeted at the urban cowboy, “with the sun and dust clouds casting a warm light across his weathered skin” (a quote from the product description). From our partners at VICE “ The cows rubbed up against her quite a bit — especially the females. Many of Brodar’s scents are meant to be evocative, like Saltwater, designed to “conjure the sense of a dad in a 1970s photo, lounging on a sun-stained beach.” Or Whiskey, which doesn’t smell like whiskey at all (sorry boozehounds). But this new Farmer’s Cologne gives more than an abstract flavor of farm life – it was tested on cows. Brodar got the idea from Fragrancefreeliving.com, after the site ran a post about a Canadian farmer. In this (somewhat dubious) story, the nameless farmer’s cows are acting weird; he decides they’re repulsed by his odor. Apparently his wife was using artificially scented detergent in the laundry — and his cows weren’t into it. Soon the farmer started keeping a stash of fragrance-free clothes in the barn. Problem solved. Brodar thinks cows are hypersensitive to artificial scents, because they haven’t been conditioned like humans. Take scented fabric softener, which promise to transport you to a breezy meadow, to the smell of sunshine itself. In truth, dryer sheets smell as much like the sun as Dimetapp tastes like a grapevine. “Cows are like newborn babies,” says Brodar. “They haven’t been conditioned to enjoy chemical smells. They’ll sneeze and shy away.” Brodar’s challenge: Could she design a cologne that would appeal to both the sensitive bovine sniffer — and the stylish modern farmer? She started doing research, ferreting out info from obscure corners of the web. She learned that cows have reacted well to woody essential oils. Sandalwood, for instance, is used in India – where the bovine is sacred – as a cow-calming agent. It’s also been added to cattle feed in Wales, to reduce methane emissions. Brodar tinkered, mixing natural oils and essences — sandalwood and sage, cedar and blue tansy (plus a few proprietary secrets). Finally, she hit on a balance she liked. It had a woody, earthen musk, with only a hint of the pungency found in mainstream fragrance (a writer in the Los Angeles Times is blunt: “Redolent of the grain and hay smells of the cow barn from my Vermont childhood … with an ever-so-slight medicinal note.”) Before hitting the open market, Brodar did some product testing — with a very select focus group. Doused in the cologne, she made three visits to a small Maine dairy farm. The first trip was to introduce herself to the cows, the second was to attempt a milking, and the third was to spend time in the barn, “just hanging out” with her new cow friends. Results? The farm’s owner told Brodar the cows seemed relaxed, and that milk production was high during her visits. Anecdotally, the cows rubbed up against her quite a bit — especially the females. Brodar admits the test wasn’t scientific, but “all the signs seemed positive.” (See sidebar for Modern Farmer‘s own rigorous field test.) Of course, it’s not the cows who will shell out over a hundred bucks for a small bottle of cologne. It’s the farmer — or the wannabe farmer. “This probably isn’t for the third-generation farmer who smells like whiskey and washes with Castile soap,” she says. “It’s for the guy in Brooklyn who wants to move back to the land, to become a homesteader … but who still likes going out at night.” Photo at top: Staff writer Jesse Hirsch field tests the new cow cologne. Credit: Parker Hatley

Summary: A cow pasture may not be the most typical testing ground for a new cologne, but then new colognes typically don't get written up in Modern Farmer. Such is the case with Farmer's Cologne out of Maine, which goes for $110 a bottle and has the unique selling point that cows seem to like it. That is, a chic farmer could wear it and not upset the sensitive noses of his bovine charges. Creator Lisa Brodar mixed natural oils and essences such as sandalwood, sage, and blue tansy to create a scent that has "a woody, earthen musk, with only a hint of the pungency found in mainstream fragrance," writes Jesse Hirsch. His unscientific field test suggests that cows genuinely like it. In an earlier story in the LA Times, Adam Tschorn gives the cologne a favorable write-up and says it "was redolent of the grain and hay smells of the cow barn from my Vermont childhood... with an ever-so-slight medicinal note." If you can't picture an old-school farmer spritzing himself with a pricey cologne before milking, that might be because Brodar doesn't see farmers like that as her key clientele. "It's for the guy in Brooklyn who wants to move back to the land, to become a homesteader... but who still likes going out at night." One Green Planet likes that the product is vegan and mostly organic. The curious can check it out at the Portland General Store website.

multi_news

en

Write a title and summarize: Bats are reservoirs for a wide range of zoonotic agents including lyssa-, henipah-, SARS-like corona-, Marburg-, Ebola-, and astroviruses. In an effort to survey for the presence of other infectious agents, known and unknown, we screened sera from 16 Pteropus giganteus bats from Faridpur, Bangladesh, using high-throughput pyrosequencing. Sequence analyses indicated the presence of a previously undescribed virus that has approximately 50% identity at the amino acid level to GB virus A and C (GBV-A and -C). Viral nucleic acid was present in 5 of 98 sera (5%) from a single colony of free-ranging bats. Infection was not associated with evidence of hepatitis or hepatic dysfunction. Phylogenetic analysis indicates that this first GBV-like flavivirus reported in bats constitutes a distinct species within the Flaviviridae family and is ancestral to the GBV-A and -C virus clades. Bats (order Chiroptera), after rodents, comprise the most diverse group of mammals with more than 1,100 species. They are present on six continents, often have substantial habitat overlap with humans [1] and harbor several zoonotic viruses causing significant human morbidity and mortality, including Ebola- and Marburgvirus, Nipah virus (NiV), and SARS-like coronaviruses [2]–[5]. Proximity of bats to human populations may facilitate the zoonotic transmission of viruses either through direct contact, via amplifying domestic animal hosts, or through food-borne routes [6]–[8]. The current study was set up as part of a viral discovery effort to target key wildlife reservoirs in emerging disease hotspots. Bangladesh is a ‘hotspot’ for emerging zoonotic diseases [9], with a relatively high diversity of wildlife that likely harbors new zoonotic pathogens, one of the densest human populations on the planet, and a high level of connectivity between people, domestic animals and wildlife. In Bangladesh and India, frugivorous Pteropus giganteus bats have been identified as a reservoir for NiV [10], [11], which has been recognized as the cause of several outbreaks of encephalitis [12]–[14]. Pteropus giganteus bats are common throughout the Indian subcontinent, living in close association with humans and feeding on cultivated fruit [14]. NiV transmission from bats to humans has been linked with the harvest and consumption of raw date palm sap, which becomes contaminated with bat feces, urine or saliva overnight when bats such as P. giganteus come to feed from the collecting pots [14], [15]. Date palm sap or other foods eaten by both bats and people, may also serve as a vehicle for transmission of other bat-borne agents. Several zoonotic flaviviruses, including Japanese encephalitis virus, West Nile virus, and Kyasanur forest virus have been identified in bats; however, to date, GB viruses have not [1]. GB viruses A and C (GBV-A and -C) represent two recently identified species that are currently unassigned members of the family Flaviviridae [16]. GBV-A viruses have been described in New World primates and are not known to infect humans [17]–[19], while GBV-C (also known as Hepatitis G virus (HGV) ) have frequently been isolated from humans in many regions of the World, including India and Bangladesh [19]–[23], and from wild chimpanzees (Pan troglodytes) in Africa [24], [25]. Here we describe discovery of a virus in the serum of healthy bats in Bangladesh, tentatively named GB virus D (GBV-D), that is distantly related to GBV-A and -C and represents a new member of the family Flaviviridae. Every effort was made to minimize bat stress and avoid injury during capture, restraint, and sampling procedures. This study was conducted following Wildlife Trust institutional guidelines under IACUC approval G2907 issued by Tufts New England Medical Center, Boston, Massachusetts. As part of a longitudinal surveillance study of Nipah virus in bats, 98 free-ranging P. giganteus bats were caught from a colony of approximately 1800 individuals in the Faridpur district of Bangladesh in December 2007 (Figure 1). Each bat was anesthetized using isoflurane gas; morphometric measurements (weight, forearm length, head length, and body condition) were taken and bats were aged [10]. Each bat was marked for future identification using an RFID microchip (AVID corp, www. avidid. com) implanted subcutaneously between the scapulae. Three mL of blood were collected and placed into serum separator tubes (vacutainer; Becton Dickinson, Franklin Lakes, NJ, USA). Serum was allowed to separate overnight at 4°C then drawn off without centrifugation and immediately frozen using a liquid nitrogen dry shipper. To inactivate potentially infectious agents, serum samples were heat-treated at 56°C for 30 min and then stored at −70°C. For RNA extraction, 250 µL of serum was added to 750 µL Tri-Reagent LS (Molecular Research Center, Cincinnati, OH, USA). Saliva was collected from the bat' s throat using a sterile cotton swab. Urine was collected either by catching urine in a 1. 0 mL sterile cryovial while the bat was urinating, or by urethral swab. Urine and saliva swabs were immediately placed into 1 mL Tri-Reagent LS and frozen in liquid nitrogen. Total RNA from serum was extracted for UHTS analysis to screen for the presence of microorganisms. Five microliters of total RNA from each bat were combined into 4 pools: 4 pregnant bats; 4 non-pregnant female bats, and 2 pools of 4 adult male bats, respectively. Reverse transcription (RT) was performed on DNase I-treated (DNA-free, Ambion Inc., Austin, TX, USA) RNA pools to generate cDNA using Superscript II RT (Invitrogen, Carlsbad, CA, USA) and random octamers linked to a defined arbitrary, 17-mer primer sequence tail (MWG, Huntsville, AL, USA) [26]. After RNase H treatment cDNA was amplified by the polymerase chain reaction (PCR), applying a 9∶1 mixture of the defined 17-mer primer sequence and the random octamer-linked 17-mer primer sequence, respectively [27]. Products of >70 base pairs (bp) were selected by column purification (MinElute, Qiagen, Hilden, Germany) and ligated to specific linkers for sequencing on the 454 Genome Sequencer FLX (454 Life Sciences, Branford, CT, USA) without DNA fragmentation [28], [29]. Sequences were analyzed using software applications implemented at the GreenePortal website (http: //tako. cpmc. columbia. edu/Tools/). Multiple forward and reverse primers for RT-PCR (available upon request) were designed using the sequences obtained by UHTS in order to fill gaps between fragments. Amplifications were performed with Bio-X-act (Bioline, London, UK) according to manufacturer' s protocols. Products were size fractionated by electrophoresis and directly sequenced in both directions with ABI PRISM Big Dye Terminator 1. 1 Cycle Sequencing kits (Perkin-Elmer Applied Biosystems, Foster City, CA, USA) at a commercial facility (Genewiz, South Plainfield, NJ, USA). Additional methods applied to obtain the genome sequence included touch-down PCR [30], 2-step walking PCR [31], and 3′- and 5′- RACE (Invitrogen). A real time Taqman PCR assay was developed to screen bat samples for GBV-D. Reactions were performed in a 25 µL volume by using commercial Taqman Universal Master Mix (Applied Biosystems, Foster City, CA, USA). Primers and probe were designed to target a 60 nt region in the NS4A gene region: Fadi-forward, 5′- gCAgCTgCgTgTgCCA; Fadi-reverse, 5′- ACACCCATgATgTTACCACgAC; Fadi-probe, 5′- FAM- AggACCCggTCgCTCCAgCA-T-BQX (TIB Molbiol, Adelphia, NJ, USA). Cycling conditions were: 50°C for 2 min, and 95°C for 10 min, followed by 45 cycles at 95°C for 15 sec and 60°C for 1 min. Thermal cycling was performed in an ABI 7300 real-time PCR system (Applied Biosystems). A liver function panel was conducted at the International Center for Diarrheal Disease Research (Dhaka, Bangaldesh) using non heat-treated bat sera (Automated Chemistry Analyzer AU 640, Olympus Corporation, Tokyo, Japan). The following parameters were analyzed: total protein, albumin, globulin, albumin∶globulin ratio, total cholesterol, total bilirubin, alkaline phosphatase, alanine transferase, aspartate aminotransferase, gamma glutamyltransferase, and lactate dehydrogenase. Sequence alignments were generated with ClustalW software [32] and phylogenetic relationships deduced using Geneious software [33]. Statistical significance was assessed by bootstrap re-sampling of 1000 pseudoreplicate data sets. Sequence relations were determined from p-distance matrices calculated with pairwise deletion for missing data and homogeneous patterns among lineages based on ClustalW alignments as implemented in MEGA software [34]. Sliding window similarity analysis was performed using SimPlot [35]. Potential signalase cleavage sites, glycosylation sites, and phosphorylation sites were analyzed using the respective prediction servers available at the Center for Biological Sequence Analysis (http: //www. cbs. dtu. dk/services/). Total RNA from the serum of healthy bats captured at a roost in the Faridpur district of Bangladesh was extracted for UHTS analysis. Extracts of 16 individual bats were combined into 4 pools consisting of 4 pregnant adult bats, 4 non-pregnant adult female bats, or 2×4 adult male bats. Each pool yielded between 1,400 and 2,000 assembled contigs or singlton reads (representing 50,000–75,000 reads ranging in size from 31–328 nt). Two reads of 238 and 215 nucleotides (nt) derived from the pregnant bat pool had distant homology to GBV-A sequences at the deduced amino acid (aa) level in the E2 and NS4A gene regions respectively (BLASTX); no homology was detected by searches at the nt level (BLASTN; local copy of the executables with standard settings except that the reward for a nucleotide match was set to 2 instead of 1). No viral sequences were detected in other pools at the nt or aa levels. Screening of the individual RNA preparations from the pregnant bat pool using primers derived from the UHTS reads confirmed the presence of the GBV-like sequence in the serum of bat 93. A quantitative real time PCR assay indicated a load of approximately 30 000 RNA copies in bat-93 serum extract, and identified an additional 4 positive bat sera from the original 98 samples (5/98; 5%), indicating serum loads ranging from 350 to 70,000 RNA copies per assay. These positive samples came from male bats that were not included in the initial UHTS pools. Extracts of saliva from the five positive bats indicated a load of approximately 200 RNA copies in bat 93; no signal was obtained with urine extracts from the five positive bats. Near full-length genome sequence was generated from bat-93 and a second positive serum (bat 68), applying primers crossing gaps between UHTS reads as well as touch-down PCR [30], 2-step walking PCR [31], and 3′- and 5′-RACE (Invitrogen) protocols. The two genome sequences were 96% identical at the nt level (GenBank Accession nos. GU566734 and GU566735), indicating two strains of the same virus. Comparison of deduced polyprotein sequence to other GBV and hepaciviruses indicated highest nt and aa sequence identities to GBV-A and -C (Table 1, Figure 2). The genomic sequence of the GBV-like virus identified in P. giganteus bats, tentatively named GBV-D, comprises 9,633 nt with 52 nt of potentially 5′-untranslated region (UTR), one continuous open reading frame (ORF) of 9318 nt (3106 aa) and 265 nt of 3′-UTR (Figure 3). Mature structural proteins in GB viruses, as well as other flaviviruses, are the product of cleavage by host signal peptidase [36]. In GBV-D the first potential signal sequence cleavage site is present after a stretch of 57, largely basic aa (6 kDa, pI = 12), followed by sequence homologous to E1 (pfam 01539, http: //pfam. sanger. ac. uk/) (Figure 3). The single glycosylation site N177IT present in that sequence is located in a position comparable to GBV-C, -A, -B and HCV glycosylation sites. Identification of the downstream E2 termini is less apparent as the next 580 aa contain multiple potential signal sequences and 10 potential glycosylation sites that indicate no homology to hepaciviral E2/NS1 (pfam 01560), until the sequence aligns with N-terminal NS2 motifs (pfam 01538) (Figure 2, Figure 3). However, despite similarity to pfam 01538 no signal sequence compatible with cleavage at A759/A was found; cleavage may occur at G826/R, which combined with potential signalase cleavage at A584/F may indicate the existence of a heavily glycosylated potential 26 kDa product instead of the p7 trans-membrane protein identified in HCV [37]–[39] or the 13 kDa variant described in GBV-B [40], [41]. Conserved C-terminal motifs of the autocatalytic NS2/NS3 endoprotease domain are compatible with NS2/NS3 cleavage at S1067/A and comparable to other GBV and HCV [42]. Figure 3 indicates potential cleavage sites for NS3 (peptidase S29, pfam 02907; DEAD box helicase, pfam 07652; helicase C, pfam 00271), NS4A (pfam 01006), NS4B (pfam 01001), NS5A (domain-1a zinc finger, pfam 08300; domain-1b, pfam 08301), and NS5B (pfam 00998). Conserved aa motifs were recognized in NS proteins. RNA-dependent RNA polymerase (RdRp) motifs in RdRp block III that are conserved with respect to other GBV and hepaciviruses were identified in NS5B (Figure 3) [43]–[46]. Potential phosphorylation sites are present at multiple serine (9), threonine (14) and tyrosine (4) residues in NS5A, compatible with its possible function as a phosphorylation-regulated mediator of viral replication [47]. However, significant conservation of primary sequence is not obvious for phosphorylation sites, proline-rich, or interferon-sensitivity determining region motifs [48]–[50]. The C-terminal portion of NS3 has homology to conserved NTPase/helicase motifs [51]; the N-terminal portion includes conserved active triad residues H1123, D1147, S1204 of serine protease [52], the viral protease responsible for cleavage of mature non-structural proteins [53]. Likewise, the active triad H991, E1011, C1032 of the cis-acting protease activity in the C-terminal portion of NS2 is conserved with respect to other GBV and HCV [42]. The only other discernable motif identified was a well-conserved N75 C/D C motif at the N-terminus of E1 (Figure 3) [54]. Phylogenetic analysis of GBV-D was performed in comparison to selected representatives of GBV-A, GBV-B, GBV-C and HCV. Analysis of NS5B aa sequence (Figure 4A) confirmed a closer relationship of GBV-D to GBV-A and -C than to GBV-B or HCV as also indicated by pairwise sequence comparisons (Table 1). The same relationships were also apparent when NS3, or the complete polyprotein sequence were analyzed (Figure 4B and C, respectively). All three trees show GBV-D consistently at the root of the GBV-A/-C viruses, indicating an independent phylogenetic clade compatible with a separate species distinct from the recently created genus Hepacivirus [16]. A liver serum chemistry panel was conducted on sera from 15 bats, the five GBV-D infected and 10 non-infected animals. Standard assays to detect hepatitis and/or impaired liver function were performed [55]. Levels of total protein, alanine transferase, aspartate aminotransferase and total cholesterol were within published ranges reported for P. giganteus, except for bat 33 (infected) and bat 73 (uninfected), which had modest elevation in aspartate aminotransferase. Reference values for albumin, globulin, albumin∶globulin ratio, total bilirubin, alkaline phosphatase, gamma glutamyltransferase and lactate dehydrogenase are not available for P. giganteus, however, values were comparable to those reported for other Pteropus species [56]. Mean values did not significantly differ between infected and uninfected bats (Table 2). Molecular analyses of sera from Pteropus giganteus bats from Faridpur, Bangladesh led to the identification of a 9,633 nt sequence consistent in genomic organization with known GBV and other species within the family Flaviviridae [16]. Whereas previous studies of bats have employed assays that test for known pathogens, ours is the first report of an unbiased molecular approach to pathogen discovery in this important reservoir of emerging infectious diseases. The modest yield of novel microbial sequences may reflect the choice of sample (e. g., serum vs feces, tissue or another specimen), competition between host and microbial template during unbiased amplification, or both. Efforts to address template competition are under way that include subtraction of host nucleic acids or the use of semi-random primers that do not amplify host sequences. Such efforts will likely enhance the sensitivity and throughput of unbiased sequencing technologies for pathogen discovery. The discovery of this chiropteran flavivirus broadens both the taxonomical and geographical distribution of GB-like viruses. Three types of GB viruses have been described: GBV-A, -B and -C [18], [19], [24], [25], [54], [57]. GBV-B, which has never been found in humans and was only reported in captive tamarins after serial passage of the original human GB serum [58], is most closely related to HCV and was recently classified together with HCV into a new genus, Hepacivirus, within the family Flaviviridae [16]. GBV-A and -C remain unclassified members of the family. GBV-A have been isolated from several New World monkeys. Different genotypes appear to be associated with specific monkey species of the genera Saguinus, Callithrix (Callitrichidae family) and Aotus (Aotidae family), without any clinical signs associated with infection [24], [54], [57]. GBV-C have been isolated from humans with non-A-E hepatitis; however, its pathogenicity is unknown and the virus is widespread in the human population [21], [59]–[61]. Population studies showed that GB viruses are enzoonotic and species-specific within both Old and New World nonhuman primates as well as humans, and have likely co-evolved with their hosts over long periods of time [62]. Previously, the only GBV found in the Old world was GBV-C from chimpanzees (in Africa) and humans. Although GBV-C were found in humans, GB viruses have not been previously reported in primates or other animals on the Indian subcontinent. GBV-C and -A are remarkable for a truncated or missing capsid (C) protein [18], [19]. Due to exhaustion of our samples we were unable to complete assessment of the 5′-terminal sequence; nonetheless, RACE experiments suggest that GBV-D likely codes for a short basic peptide, instead of a full-length C protein. The first methionine (M1) predicts a peptide of 57 aa (pI = 12); however, the more favorable Kozak context [63] of M3 indicates a 55 aa peptide. After signalase cleavage from the polyprotein precursor, this peptide may be functional, possibly influencing maturation of, or directly binding to, the E1 and/or E2 glycoproteins. Phylogenetic analyses of NS5B, NS3 and complete polyprotein sequence place GBV-D at the root of the GBV-A and -C clades and are consistent with a model wherein GBV-D is ancestral to GBV-A and -C clades. Mixed relationships indicative of recombination events [64] were not evident (Figure 2, Figure 4). Both pteropid bats and chimpanzees are restricted to the Old World. While the range of chimpanzees (Africa) and P. giganteus (the Indian subcontinent) do not overlap, it is possible that other primate species in Bangladesh or India, such as macaques, or other fruit bats in Africa such as Eidelon spp., whose range overlaps that of chimpanzees, may carry related viruses. While GBV-A is only known from primates of the New World, an African origin has been suggested for GBV-C based on a 12-aa indel sequence in NS5A [65]. Although the NS5A sequence of GBV-D, similar to that of GBV-A, appears elongated in the indel region, compatible with their respective earlier phylogenetic branching compared to GBV-C, little sequence conservation is observed in that region. The bats in this study, like primates infected with their associated GBV [66], all appeared to be healthy. The lack of chemical evidence of hepatic inflammation or dysfunction suggests that this virus may not target hepatic cells in bats. This is consistent with the behavior of GBV-A in its natural primate hosts [54]. In contrast, elevated alanine transferase levels and mild hepatitis are observed in experimental infections of macaques with GBV-C isolates from humans [67]. Five percent of the bats we studied were infected with one of at least two different strains of GBV-D, which suggests widespread viral circulation within this species. The observation that bats are asymptomatically infected with diverse strains that constitute a distinct phylogenetic clade is compatible with a co-evolutionary relationship between GBV and their hosts [57], [62], and supports the hypothesis that P. giganteus bats may be a natural reservoir for GBV-D. In one case we were able to detect GBV-D nucleic acid in saliva. This suggests a potential route for viral transmission via fighting or grooming behavior, or via food shared by bats. Pteropus giganteus is a frugivorous bat species that carries NiV, a zoonotic paramyxovirus [10], [11]. This species lives in close association with humans in Bangladesh and bats have been observed drinking from (and urinating into) date palm sap collecting pots [14]. Human consumption of contaminated palm juice is proposed to be a major route of NiV transmission [68]. Although it is unclear whether infectious virus was present in bat saliva, the observation that saliva can contain GBV-D nucleic acids provides a biologically plausible mechanism for transmission from infected bats to other hosts. While it is currently unknown whether GBV-D virus occurs in humans, up to 20% of non-A-E hepatitis cases remain unexplained [19].

Title: Identification of GBV-D, a Novel GB-like Flavivirus from Old World Frugivorous Bats (Pteropus giganteus) in Bangladesh Summary: Bats are important reservoirs for emerging zoonotic viruses with significant impact on human health including lyssaviruses, filoviruses, henipaviruses and coronaviruses. Opportunities for transmission to humans are particularly prominent in countries like Bangladesh, where people live in close association with bats. Whereas previous studies of bats have employed assays that test for known pathogens, we present the first application of an unbiased molecular approach to pathogen discovery in this reservoir for emerging zoonotic disease. Unbiased pyrosequencing of serum from Pteropus giganteus bats enabled identification of a novel flavivirus related to Hepatitis C and GB viruses. Viral nucleic acid was present in 5 of 98 (5%) sera, and in the saliva of one animal. Sequence identification of two strains of the virus, tentatively named GBV-D, suggests P. giganteus as a natural reservoir. Detection of viral nucleic acid in saliva provides a plausible route for zoonotic transmission. Phylogenetic analysis indicates that GBV-D is ancestral to GBV-A and -C, and separate from the recently classified genus Hepacivirus. Our findings provide new insight into the range of known hosts for GB-like viruses and demonstrate the power of unbiased sequencing to characterize the diversity of potentially zoonotic pathogens carried by bats and other reservoirs.

lay_plos

en

Summarize: A 10-year-old girl who wrote a heart-wrenching letter to her father on the fifth anniversary of his death has been reunited with the note after dropping it in a car park. The touching message addressed 'Dear Daddy' was handwritten by Summer Lloyd, from Yeovil, Somerset, and was going to be attached to a balloon before being let off into the sky. However, the youngster dropped the letter outside the Prince of Wales Pub on Ham Hill in Somerset, and feared she had lost it forever. The touching note, which was found outside the Prince of Wales Pub on Ham Hill in Somerset, was written by Summer Lloyd, 10, (left) to her father on the fifth anniversary of his death. She planned to attach it to a balloon but dropped it. Summer gave a plant to the pub's landlady Nicki Holroyd (right) after she returned it today. The heart-breaking letter is addressed 'Dear Daddy' and was written by Summer, who signs off 'Lots of love, your little girl'. Her father died suddenly five years ago and she was going to let off a balloon with the note. In the touching note to her father, who died suddenly five years ago, she writes: 'At night I sometimes look at the sky and I make a wish on the brightest star I see and I believe it is you.' She also tells how she wishes she could have had 'one last goodbye and one last hug before you took your journey to your new home in heaven.' The note is signed off: 'RIP Daddy. Lots of love, your little girl Summer xxxxxxx.' It has now been reunited with the youngster after a customer handed it in to the pub and landlady Nicki Holroyd launched a Facebook appeal in a bid to return it. Summer said she was delighted her note was found and said she had let the balloon off without the letter, having feared it was lost. She said: 'We let off the balloon anyway and a bird appeared in the sky which seemed to hover near us, it was very special. ‘Thank you Nicki for giving me back my letter, I think I will keep it now and frame it.' The schoolgirl went to the pub today to retrieve her letter and handed Ms Holroyd some flowers to thank her for keeping it safe. Summer, 10 (left), was delighted to be reunited with the letter after letting off a balloon (right) without it. Summer's mother Sarah said: ‘I really appreciate what Nicki did, it meant a lot to Summer. ‘The appeal on Facebook was seen all over the world including her relatives in Australia, so she said to me this morning “mummy I'm famous!” ‘It's been tough and she misses her dad so every year we try to do this - it helps her and is a kind of therapy.’ Ms Holroyd, 51, had posted an image of the letter on Facebook in a bid to try and trace Summer and return the note. She wrote alongside the photograph: 'One of our customers handed this in. 'It's the most heart-wrenching letter from a young girl who has written the most lovely letter to her dad who has died and is in heaven. 'Please help to try and trace her, we can never throw it away. 'As far as I can gather the letter was found in the car park so I think it was dropped rather than left.' The letter was found after being dropped in the car park of the Prince of Wales Pub on Ham Hill in Somerset (pictured). It has now been reunited with Summer after an appeal on Facebook was spotted by the family. The Prince of Wales Pub said on Facebook today that the letter had been returned to the little girl's family. She added: 'It doesn't feel right that we have it. It is a beautifully written letter so we need to have a go at reuniting it with its author. 'The writer is called Summer and judging from the letter's content, she has brothers and sisters.' Ms Holroyd confirmed today that she had managed to hand the letter back after Summer’s family contacted the pub. She said: ‘I'm so pleased the letter has been reunited with Summer, she touched all our hearts. ‘What a lovely girl and such a sweet letter.’ She also thanked those on social media who helped share the image which resulted in the Lloyd family getting in touch. Writing on the pub's official Facebook page, she said: 'Thank you all for your help in finding the rightful owner of such a special letter. 'They are very grateful we didn't just disregard it and are pleased to have it back.' 'Dear Daddy. I love you. I miss you so much and I wish you were here right now! 'At night I sometimes look at the sky and make a wish and I make a wish on the brightest star I see and I believe it is you. 'I always think of you on your birthday, father's day, my birthday and Christmas and always after. 'Happy some days sad the other but right now I can feel you in my heart and you are always in my mind but I just wish I could have said one last goodbye and one last hug before you took your journey to your new home in heaven. 'I know all my brothers and sisters and everyone in our familys (sic) miss you every day too and wish you were still here but until we meet again or talk again I will leave you to rest. 'I love you so much xx RIP daddy xx and I hope you are happy where you are xxx. 'Lots of love, your little girl Summer, I love you xxxxxxx.'

Summary: Summer Lloyd wrote the letter to her father on fifth anniversary of his death. 10-year-old was planning to attach it to a balloon and let it off into the sky. But she dropped it in car park of rural Somerset pub and feared it was lost. Addressed 'Dear Daddy', it tells how she loves and misses father so much. Also says: 'I make a wish on the brightest star I see and I believe it is you' Has now been returned to young girl after her family spotted online appeal.

cnn_dailymail

en

Summarize: Introduction Chapter 11 of the U.S. Bankruptcy Code is used by financially troubled business debtors that want to reorganize their financial affairs so that they may remain in business rather than liquidate. Although a trustee is appointed in chapter 7 liquidations, in a business reorganization under chapter 11, the debtor generally remains in possession and no trustee is appointed, thus allowing those most familiar with the business to continue managing it. The Bankruptcy Code generally provides debtors the opportunity to either assume or reject executory contracts in existence at the time the bankruptcy petition is filed. One sort of executory contract, collective bargaining agreements (CBAs), is treated somewhat differently. Although rejection of any executory contract is subject to the approval of the court, for most contracts, the business judgment rule applies and courts generally approve rejections that the debtor deems to be in its business interest. Rejection of CBAs must meet a higher standard. Section 1113 of the Bankruptcy Code provides the procedures that must be followed to reject a CBA. Recently introduced legislation would modify several sections of the Bankruptcy Code, including § 1113. H.R. 3652 and its companion bill, S. 2092, were introduced by Representative Conyers and Senator Kennedy and are entitled the "Protecting Employees and Retirees in Business Bankruptcies Act of 2007." In this report, the two bills will be referred to as either H.R. 3652 or "the bill." This report's analysis of the bill will be limited to the modifications it proposes for § 1113 of the Bankruptcy Code. These modifications are found in § 8 of the bill. In its findings section, the bill asserts that despite recently enacted provisions to limit executive compensation, executive pay enhancements flourish in business bankruptcies at the expense of workers and retirees. According to the bill, workers and retirees are being disproportionately burdened in business bankruptcies. These workers and retirees have no way to diversify the risk of an employer's bankruptcy and are least able to absorb the losses imposed. H.R. 3652 urges "[c]omprehensive reform... to remedy these fundamental inequities in the bankruptcy process and to recognize the unique firm-specific investment by employees and retirees in their employers' business through their labor." Background In 1984, the Bankruptcy Code was amended to add 11 U.S.C. § 1113, which outlines the requirements that must be met before a court can approve rejection of a collective bargaining agreement (CBA) by a debtor company using chapter 11 to reorganize. The section applies only to chapter 11 bankruptcies. Although there are no committee reports to explain the reason for adding 11 U.S.C. § 1113, its addition followed the U.S. Supreme Court's holding in National Labor Relations Board v. Bildisco and Bildisco. It is generally believed that Congress added the section in response to Bildisco. Bildisco was decided in February 1984, resolving a split between the circuits regarding the standard for rejection of a CBA. The Court held that rejection required that the agreement be burdensome to the debtor company and that rejection was favored after balancing the equities of the specific case. The Court also held that the debtor in possession did not automatically assume the CBA post-petition and would not violate § 8(a)(5) of the National Labor Relations Act (NLRA) if it unilaterally changed the terms of a CBA prior to the bankruptcy court's approval of rejection of that agreement. By adding § 1113, Congress provided both a procedure and a standard for rejection of CBAs and clarified that they could not be rejected under 11 U.S.C. § 365 as are other executory contracts. Furthermore, unilateral changes to the CBA were addressed and generally prohibited. Overview of Proposed Changes to 11 U.S.C. § 1113 H.R. 3652 proposes a number of changes to existing subsections of 11 U.S.C. § 1113 as well as adding six new subsections. As written, the bill would entirely replace the text of the first three subsections; however, the actual change to the text of the first subsection is minimal. At first glance, the bill appears to make dramatic changes in the Bankruptcy Code, but in some cases, the bill's language may be clarifying the Code rather than substantively changing it. In other cases, the language in the bill may be intended to either legislate resolution of some point of law that has been disputed in the courts or legislatively overrule existing case law. However, since there are no committee reports as yet, CRS cannot discern with certainty the sponsors' intent in proposing the changes. The proposed changes will be discussed in order, subsection by subsection, with accompanying discussion about the current state of the law, including ambiguities in the current code, various courts' interpretations, and scholarly writings about 11 U.S.C. § 1113. All headings referencing a subsection of 11 U.S.C. § 1113 refer to the subsections as proposed by this bill. 11 U.S.C. § 1113(a) Although the language of H.R. 3652 indicates that subsection (a) is deleted entirely, there is only one difference between the current text and the proposed text—that is the removal of the words "assume or." As currently written, 11 U.S.C. § 1113(a) states that a debtor "may assume or reject a collective bargaining agreement only in accordance with the provisions of this section." However, that is the only time that assumption of CBAs is referred to in the entire section. Courts generally have found that 11 U.S.C. § 365 governs the assumption of CBAs, but removing "assume" from the language of 11 U.S.C. § 1113(a), would seem to make it clear from the statute that nothing in 11 U.S.C. § 1113 applies to assumptions of CBAs. Note, however, although it would remove "assume" from this subsection, the bill would add a later subsection stating that assumptions of CBAs are in accordance with 11 U.S.C. § 365, which addresses executory contracts generally. 11 U.S.C. § 1113(b) H.R. 3652 would limit the modifications to the existing CBA that can be proposed by the debtor. The current law provides general guidance about the type of proposal that should be made: a proposal should provide the modifications in benefits and protections that are necessary for reorganization and assure fair treatment to "all creditors, the debtor, and all of the affected parties." In contrast, the bill would limit proposals to those that would (1) limit the effect of the labor group's financial concessions to no more than two years after the effective date of the plan; (2) be the minimum savings the debtor needs to successfully reorganize; and (3) not put too great a burden on the labor group, either in amount or nature of the concession, in comparison to burdens placed on other groups, "including management personnel." Current law puts no time limit on the duration of the effects a debtor's proposed modifications to a CBA may have on the relevant affected labor group. Although an authorized representative always has the option of rejecting a debtor's proposal, a court will not necessarily find that the debtor's proposal was not fair and equitable to all affected parties even if its effects on the labor group are long-lasting. If the court finds the proposal fair and equitable, it may grant rejection of the CBA. H.R. 3652 would prohibit court approval of rejection unless the debtor's proposals for modification were in compliance with the proposed limitations. Therefore, limiting the debtor to proposals affecting the labor group for no more than two years would assure labor groups that they would not be confronted with situations in which a CBA's rejection was approved by the court after the labor group had rejected a debtor's proposal for lengthy concessions. If such lengthy concessions were proposed, the court would not be allowed to approve rejection because the debtor's proposal would not be in compliance with the requirements of (proposed) 11 U.S.C. § 1113(b)(1)(A). However, limiting the duration of modifications to a CBA may limit the debtor's ability to successfully reorganize. Modifications that can, in just two years, provide sufficient economic relief for the company's survival may necessarily require economic concessions from employees that are too burdensome to be acceptable because the effect on paychecks is too great. Conversely, modifications that last no more than two years but also have a smaller effect on paychecks may not provide sufficient economic relief to allow the debtor company to survive, effectively forcing the company into liquidation. The bill's second requirement for debtors' proposals is that they must "be no more than the minimal savings necessary to permit the debtor to exit bankruptcy such that confirmation of such plan is not likely to be followed by the liquidation of the debtor." It is questionable whether this will do anything to clarify existing law, under which there have been conflicts over the meaning of "necessary" in the current requirement that the debtor make a proposal that "provides for those necessary modifications in the employees benefits and protections that are necessary to permit... reorganization." Some courts have held that necessary means the minimum needed to avoid immediate liquidation; other courts have found that "necessary" is a more lenient standard than "essential," and have looked at whether the modifications will ensure the debtor's ability to survive reorganization. By including the phrase "such that confirmation of the plan is not likely to be followed by the liquidation of the debtor," it seems that the bill is intended to use the more lenient standard. However, the use of "no more than the minimal savings" could cause a court to use a stricter standard. If the bill's language were strictly interpreted to mean that the debtor may propose no more than the absolute minimum savings, the debtor might be in a virtually untenable position. One court, in construing the current law's requirement that modifications be "necessary" to allow reorganization, noted that in the context of this statute "necessary" must be read as a term of lesser degree than "essential." To find otherwise, would be to render the subsequent requirement of good faith negotiation, which the statute requires must take place after the making of the original proposal and prior to the date of the hearing, meaningless, since the debtor would thereby be subject to a finding that any substantial lessening of the demands made in the original proposal proves that the original proposal's modifications were not "necessary." If the proposed requirement that proposed modifications would produce no more than the minimal savings required were taken literally, debtors would be similarly constrained. The third limitation on proposals looks only at the burdens that are placed on the groups with whom the debtor is expected to have continuing relationships, rather than looking at whether all are being treated "fairly and equitably" as required by current law. The proposed change would also specify management personnel as one of the groups to be considered in determining whether the labor group is being overly burdened. Throughout the history of 11 U.S.C. § 1113, courts have considered management personnel when considering whether a debtor's proposal treated all parties fairly and equitably. However, they have looked at the whole picture rather than simply comparing burdens. For example, a proposal to reduce wages for union employees was considered fair and equitable even though some management employees received an increase in pay. The court's rationale was that it was fair to increase the pay of supervisors who had been earning less than those they were supervising. The language for proposed 11 U.S.C. § 1113(b)(1)(C) could be construed to require those cuts in wages and benefits for employees must be matched by similar cuts for management employees. Whether that similarity would be construed to require dollar-for-dollar parity or percentage-based parity is unknown. 11 U.S.C. § 1113(c) Current law requires three conditions be met before a court can grant a motion to reject a CBA: (1) The debtor must meet the requirements of 11 U.S.C. § 1113(b)(1) by (a) presenting a proposal that both treats all parties equitably and proposes changes necessary for reorganization, and (b) providing the representative with information needed to evaluate the proposal; (2) The representative must have refused to accept the debtor's proposal without good cause; and (3) "[T]he balance of equities [must] clearly favor[] rejection." H.R. 3652's proposed subsection (c) would have three main prongs as does the current subsection, but most of its similarity ends there. Current law has three fairly simple subparagraphs, each of which involves some discretionary judgment regarding facts and circumstances. The subparagraphs in proposed subsection (c) are complex and one provides a presumption that would bar rejection of a CBA if not effectively rebutted. Current practices among companies in bankruptcy may have triggered a perceived need for this provision. It appears that other provisions of this subsection may be in part a response to recent court decisions, but may be responding to Bildisco as well. 11 U.S.C. § 1113(c)(1) Impasse. One of the changes in the process required for a court to approve rejection of a CBA is a new requirement that the parties have reached an impasse. The Bildisco Court specifically stated that approving a debtor's request for rejection should not require the courts to determine that negotiations had reached an impasse. Although 11 U.S.C. § 1113 was introduced in response to concern over the Bildisco decision, neither the word "impasse" nor the concept appears in the current section 1113. In proposed 11 U.S.C. § 1113(c)(1) the word appears twice and it appears a third time as a concept. CRS is uncertain if including "impasse" in H.R. 3652 is an attempt to resolve a long-standing issue or a response to current court decisions involving the airline industry. As noted below, courts have recently enjoined strikes that were threatened in response to rejection of CBAs. The Railroad Labor Act (RLA), unlike the National Labor Relations Act (NLRA), requires parties to "exert every reasonable effort to make... [an] agreement." According to recent court decisions, labor groups governed by the RLA continue to be bound by this obligation even after a court has approved rejection of a CBA under 11 U.S.C. § 1113. These courts interpreted the RLA as requiring labor groups to continue collective bargaining until there is no possibility that the parties can agree. At that point, most would agree that the parties have reached an impasse. If the changes to § 1113(c)(1) are adopted, courts may need to determine if impasse is reached at some earlier point. CRS is uncertain how courts would construe the requirement that the parties be at "impasse." Since the proposed bill includes the phrase "further negotiations are not likely to produce a mutually satisfactory agreement," courts may use a "more likely than not" standard. If, however, the courts construed "impasse" as equivalent to the recent court interpretations of the RLA standard, requiring an impasse as a prerequisite to rejection could effectively eliminate most rejections—possibly through attrition since bargaining may well continue for a considerable period of time before a court would consider the parties at an impasse. If the company were to delay filing for bankruptcy and try to negotiate modifications to the CBA, parties who had not been able to reach a mutually satisfactory agreement might be considered to be at impasse when the bankruptcy case commences. However, whether the bargaining takes place before or after the bankruptcy filing, if it takes place over an extended period of time, a company might be forced to liquidate rather than reorganize. Those opposing this provision are likely to argue this would defeat the purpose of chapter 11 and, by not preserving jobs, would not protect workers. Those in favor of this provision are likely to argue that it encourages the parties to negotiate modifications each can accept, allowing the company to then continue with its workforce in place under a revised CBA. 11 U.S.C. § 1113(c)(1)(A). In addition to finding that the parties are at an impasse, this subparagraph requires that, before approving a request for rejection, the court find that the debtor has fulfilled the requirements regarding proposing modifications. This is similar to current law, which also requires the debtor to have fulfilled the requirements of current subsection (b)(1), except that the requirements that must be met are different. The proposed change mirrors current law in requiring that the debtor provide appropriate information to the representative and bargain in good faith. 11 U.S.C. § 1113(c)(1)(B). Under the bill, before approving rejection, the court must also "consider[] alternative proposals by the authorized representative and determine[] that such proposals do not meet the requirements of subparagraphs (A) and (B) of subsection (b)(1)." There is some ambiguity in this wording. Is the court to evaluate the representative's proposals as possible alternatives to the current CBA that the court might be able to impose on both the debtor and the labor group in lieu of outright rejection? On the other hand, could it mean that the court is simply to look at the representatives' proposals to determine whether they all meet the requirements of the subparagraphs? If they do, is the court then powerless to change the status quo of the CBA? There is nothing in the bill that explicitly gives the court the discretion to evaluate the representative's counterproposals and substitute one for the existing CBA. However, nothing in the current 11 U.S.C. § 1113(c) gives courts the power to impose the debtor's last proposal on both the debtor and the labor group after the court has approved rejection, yet courts have exercised that power. Inconsistencies between courts in applying the current law appear to be part of the impetus behind H.R. 3652. Allowing the courts more discretion might increase those inconsistencies and lead to more "forum shopping" in bankruptcy filings. Courts might construe proposed subsection (c)(1) as simply providing prerequisites that must be met before a CBA can be rejected. In this case, proposed subparagraphs (A) and (B) might act as a constraint on negotiations by the representative. Since liquidation of the company normally would involve loss of jobs, it may be in the labor group's interest to make concessions if the debtor cannot reorganize without those concessions. However, as noted earlier, at times the burden on employees would be too great if the required economic relief provided to the employer were concentrated in a period of two years. To lessen the immediate impact on employees' paychecks, a representative might want to spread the effect of the financial concessions over three years rather than two. However, a representative might be reluctant to offer such a proposal if making it would open the door for court-approval of rejection. This might create a built-in conflict between the labor group's interest in avoiding rejection of the CBA and its interest in preserving jobs by making sufficient concessions to the debtor to assure successful reorganization. Current law does not require the court to look at the representative's counterproposals, but only at whether the representative had good cause for rejecting the debtor's proposals. Under current law, rejection has generally been the "stick" that was applied when representatives could not come to an agreement with debtors and did not have good cause for refusing to agree. The effect was to encourage negotiations, which is what section 1113 was intended to do. It is unclear whether the proposed provisions would encourage both parties to negotiate. It is possible that the provisions could create an imbalance in the two parties' motivation to negotiate, but at this point, we do not know which party might be more motivated by the proposed provisions. 11 U.S.C. § 1113(c)(1)(C). This simply reiterates the impasse requirement by specifying that the court may only approve rejection if it finds that "further negotiations are not likely to produce a mutually satisfactory agreement." As noted earlier, courts may construe this as requiring less certainty as to the futility of further negotiations than exists under the RLA's requirement for continued bargaining. Under current law, the bankruptcy courts do not evaluate the prospects for an eventual agreement between the parties. 11 U.S.C. § 1113(c)(1)(D). This provision requires the court to consider how the labor group would be affected by the debtor's proposal, but it seems to presume that the labor group will strike if the CBA is rejected. It requires the court to consider the effect of such a strike, including the debtor company's ability to "retain an experienced and qualified workforce." Reorganization in bankruptcy is based on the concept that it is better for all concerned if a company can continue in business rather than liquidate. If the result of rejection of a CBA is a strike that would effectively put the company out of business, the court may decide not to allow a rejection. If, however, the debtor company is not in a position to remain in business under the terms of the existing CBA, the company may be forced to liquidate rather than reorganize. This alternative might leave all creditors, including the labor group, in worse shape than they would have been had the company reorganized. 11 U.S.C. § 1113(c)(2) This subsection provides parameters for the court's consideration of whether the debtor's proposed modifications meet the requirements of subsection (b). The court must consider the impact on all subsidiaries and affiliates of the debtor company, including foreign subsidiaries and affiliates, but what this means in practice is unclear. The court is also required to examine the history of financial concessions made by the labor group. If any have been made within twenty-four months prior to the filing of the bankruptcy petition, the court's evaluation of the debtor's proposed modifications must aggregate the effect of the earlier concession with the effect of the currently proposed modifications. This aggregation is unlikely to affect whether the proposed modifications meet the requirements of proposed 11 U.S.C. 1113(b)(1)(A)-(B), but is likely to affect evaluation of the burden imposed on the labor group as compared to other groups. 11 U.S.C. § 1113(c)(3) Under current law, in considering whether to approve rejection, the court has discretion in concluding that the required conditions have been met. While H.R. 3652 does not remove all of the court's discretion, in one area the bill appears to significantly restrict the court's discretion. H.R. 3652 would establish a presumption that the debtor has overly burdened the labor group in comparison to the burdens on other groups, including management, if it "has implemented a program of incentive pay, bonuses, or other financial returns for insiders or senior management personnel during the bankruptcy, or... within 180 days" before the case began. Unless that presumption can be effectively rebutted, the debtor will have failed to meet the requirements for rejection. The Bankruptcy Abuse Prevention and Consumer Protection Act of 2005 (BAPCPA) restricted "key employee retention plans" (KERPS), which provided retention bonuses and severance pay to management employees who were retained to manage the business through its reorganization. Since BAPCPA became effective, there has been a move toward paying managers incentive payments, which were not restricted. Though some of these incentive pay schemes have been rejected by the courts as actually being retention bonuses that did not meet BAPCPA's requirements, others have been upheld as incentive bonuses and, therefore, not subject to the restrictions imposed by the post-BAPCPA Bankruptcy Code restrictions. In 2006, both the Senate and the House introduced bills that would have limited the use of incentive bonuses in the same way that BAPCPA had limited retention pay. Though the bills were not passed by the 109 th Congress, their provisions are included in H.R. 3652. This bill would extend BAPCPA restrictions on retention pay to incentive and performance bonuses as well as "bonus[es] of any kind, or other financial returns designed to replace or enhance incentive, stock, or other compensation in effect" before the bankruptcy petition was filed. These restrictions are bolstered by the bill's proposed amendment to 11 U.S.C. § 1113(c)(3). This proposed amendment could make it difficult for the court to approve rejection of a CBA if there were any sort of incentive pay, even if the court had approved the incentive pay after finding that it was necessary to retain a person whose services were essential for the business to continue, and met the other restrictions of 11 U.S.C. § 503(c)(1). Arguably, this could put a court in the position of having little flexibility to make decisions that could result in the debtor company's successful reorganization—if it allowed incentive pay to retain someone essential to the business, it could be unable to approve rejection of a CBA if the debtor could not rebut the presumption that the labor group was being burdened more than management. If it did not allow incentive payments, the company might lose an employee who was seen as necessary for survival. Either alternative might cause the debtor to liquidate rather than reorganize. However, it could also be argued that this provision would encourage debtors to carefully consider whether incentive pay was necessary and, if necessary, limit it so that an effective argument could be made that the incentive did not create a situation in which the labor group was disproportionately burdened by the modifications in a CBA. 11 U.S.C. § 1113(d) Under current law, the court is required to schedule a hearing within fourteen days after the debtor files an application for rejection. All interested parties currently have the right to attend the hearing and be heard and must receive notice at least ten days before the hearing. The court must rule on the application within thirty days unless otherwise agreed to by the debtor and representative. If the court does not rule within the required time, the debtor may unilaterally modify or terminate the CBA pending the court's ruling. H.R. 3652 would extend the period required for notice to at least twenty-one days. The bill deletes, rather than modifies, the provision for holding the hearing within fourteen days of the filing date. The deletion may have been unintentional—the intent may have been to set the same time frame for notice as for hearing. On the other hand, the deletion may have been intended to avoid requiring an early hearing on an application for rejection, permitting additional time for continuing negotiation between the debtor and the authorized representative. The bill would restrict the parties who could appear and be heard, limiting them to only the debtor and the authorized representative. This may have the effect of streamlining the hearing process by eliminating consideration of other parties' concerns. Under both current and proposed law, the creditors would have an opportunity to approve or reject the reorganization plan, which would incorporate the results of the rejection hearing. Under the bill's proposals, there would be no time frame within which the court would be required to rule and no provision allowing the debtor to unilaterally modify a CBA while a ruling was pending. This appears to encourage continuing negotiations between the debtor and the authorized representative without a statutory deadline. 11 U.S.C. § 1113(e) The bill proposes no changes to this section—while parties continue to negotiate changes to a CBA, courts would continue to be allowed to approve interim modifications to a CBA "if essential to the continuation of the debtor's business, or in order to avoid irreparable damage to the estate." However, the addition of subsection (g) as proposed in the bill, allowing labor groups to strike or engage in other methods of "self-help" in response to court-ordered modifications under this subsection, may tend to reduce either the extent to which courts are willing to approve interim modifications or the potential benefit to the debtor of an interim modification. If so, it could lead to liquidations rather than reorganizations when interim modifications are essential for the company to remain in business. 11 U.S.C. § 1113(f) H.R. 3652 would not change the current language, but would add a provision regarding allowed administrative claims. Under the bill's proposal, all payments required under 11 U.S.C. § 1113 on or before the date of confirmation of the reorganization plan would be considered allowed administrative claims. That would mean that the plan would be required to provide for full payment of the claims. 11 U.S.C. § 1113(g) Currently there is no statute addressing whether court-approved rejection of a CBA gives rise to a claim for damages and courts have been divided on the subject. The bill would add a subsection that would define rejection of a CBA as a breach and would address the effect of rejection of a CBA, in terms of both money damages and "self-help"—the right of affected employees to strike. Rejection as Breach This is one of the subsections where the use of a particular word may have import that is not immediately obvious. In general, rejection of executory contracts has been treated as a breach. However, recently, in Northwest Airlines Corporation v. Association of Flight Attendants, rejection of a CBA was characterized not as a breach but as an abrogation. As the court viewed it, an abrogation has a different legal effect than does a breach. While a breach would have a remedy, an abrogation under 11 U.S.C. § 1113 terminates the provisions of the CBA and allows substitution of court-approved provisions. It is possible that the word breach is used in this proposed subsection merely to identify the rationale for the prescribed remedy. On the other hand, it is possible that the word was used to legislate an effect of rejection that is different than that determined by the Northwest Airlines court. In evaluating which is more likely to be the case, one should consider that the court specifically contrasted the effect of rejection under 11 U.S.C. § 365 with that under 11 U.S.C. § 1113, stating, "Contract rejection under § 1113, unlike contract rejection under § 365, permits more than non-performance." According to the court, the purpose of 11 U.S.C. § 1113 is "to permit CBA rejection in favor of alternate terms without fear of liability after a final negotiation before, and authorization from, a bankruptcy court." This seems to imply that the Northwest Airlines court's position is not only that rejection is an abrogation rather than a breach, but also that there are no damages to be recovered from rejection of a CBA under 11 U.S.C.§ 1113. Money Damages Under the bill, court-approved rejection would be a breach of contract with the same effect as rejection of any other executory contract under 11 U.S.C. § 365(g), but would exclude those damages from the limitations of 11 U.S.C. § 502(b)(7). Under 11 U.S.C. § 365(g), rejection of a contract is treated as a breach of contract immediately before the date the bankruptcy petition was filed. Section 502(b)(7) limits damages for termination of an employment contract to one year's compensation, without acceleration, plus any unpaid compensation. Although H.R. 3652 specifically excludes damages for rejected CBAs from the damage limitation of 11 U.S.C. § 501(b)(7), the explicit exclusion may not be necessary since courts have held that the subsection does not apply to CBAs. Section 365(g) of the Bankruptcy Code sets the date of the breach as just before the filing of the petition, which would make such claims pre-petition claims. Pre-petition claims are generally unsecured, nonpriority claims. However, this bill proposes to define administrative expenses, which are priority claims, as including all payments required under 11 U.S.C. § 1113 that must be paid on or before the date the reorganization plan is confirmed. Proposed subsection (g) does not actually mandate payment of the breach damages before the confirmation date, so it is unclear whether those damages are intended to be treated as an administrative expense and, therefore, a priority claim rather than as a pre-petition, nonpriority claim. If given the status of an administrative claim, it is difficult to foresee a situation in which a company could benefit from rejection of a CBA since it would appear likely that any financial gain garnered by rejecting the CBA would be lost through the breach damages for rejections. If those damages are treated as are other breach damages for rejection of executory contracts, they would be unsecured, nonpriority, pre-petition claims, and the reorganization plan could provide for partial rather than full payment of them, thereby allowing some economic benefit to the company in bankruptcy. "Self-help" Self-help by a labor group may consist of a strike or a threat of strike even though a strike could be an economic blow that a distressed company might arguably be unable to recover from. When a CBA is rejected in chapter 11 reorganization under the current provisions of 11 U.S.C. § 1113(c), labor groups' right to strike seems to depend upon whether the group is covered by the RLA or the NLRA. Groups covered by the NLRA may strike even if the rejected CBA contained a "no strike" clause. Since the CBA no longer exists after rejection, the "no strike" clause has no continuing effect. Airline transportation workers, however, are covered by the RLA, which requires that the parties exert every reasonable effort to negotiate agreements even after a court-approved rejection. Therefore, several recent cases involving the airlines have resulted in injunctions prohibiting the unions from striking. Modifications to CBAs under current 11 U.S.C. § 1113(d)(2) or (e) do not make the CBA ineffective in its entirety. Therefore, although a "no strike" clause would become ineffective after rejection of a CBA, it would remain in effect under current law when there are interim modifications to a CBA. H.R. 3652 would change the law so that all labor groups, even those controlled by the RLA would have the right to strike when a CBA was rejected. The right to strike would also exist if interim modifications were approved by a court—apparently without reference to whether the CBA included a "no strike" clause. Since a strike might be a fatal economic blow to a distressed company and since interim modifications are approved by the court only when they are either "essential to the debtor's business []or... to avoid irreparable harm to the estate," codifying the right to strike after court-approved interim modifications might jeopardize both the debtor company's existence and its creditors' claims. The proposed subsection would, by its language, also preempt all other federal and state laws regarding labor groups' right to engage in self-help. 11 U.S.C. § 1113(h) Under current law, there is no provision for future modifications of a CBA if the debtor's financial condition improves. In negotiations over CBAs, representatives may ask for "snap-back" provisions that would provide for future modifications, but the absence of such a provision would not necessarily lead to a court's determination that the representative had good cause for rejecting the debtor's proposal. H.R. 3652 would add a subsection to assure that, based on changed circumstances, representatives could request modifications after CBAs were either rejected or modified. The bill would require the court to grant the request if the change would result in the new provisions being no more than the minimum savings needed for the debtor to reorganize successfully. Assurance of the possibility of future favorable modifications might make representatives more inclined to cooperate with debtors' proposals for modifications. However, under current law, while "snap-back" provisions have been available for modifications, they have not been required as part of either a negotiated modification or a court-approved rejection. 11 U.S.C. § 1113(i) Currently there is no provision for arbitration rather than a court hearing to rule on a motion for rejection of a CBA. H.R. 3652 would add a subsection to allow arbitration in lieu of a court hearing if requested by the authorized representative, so long as the court finds that arbitration would help the parties reach an agreement that was mutually satisfying. This could reduce the demand for courts' resources; however, only the authorized representative can make the request. The debtor cannot make the request, and the court cannot order arbitration without a request. Using arbitration to resolve a debtor's request to reject a CBA may open greater possibilities for finding a middle ground between complete rejection of a CBA and assumption of the existing CBA. It may also, however, increase the time required to resolve the issue. Under current law, unless otherwise agreed to by the debtor and representative, the court is required to hold hearings on requests for approval of rejection within no more than twenty-one days and to rule on the application no later than thirty days after the beginning of the hearing. As noted earlier, the proposed changes to § 1113 eliminate both of these deadlines. The bill does not directly address which party will pay for arbitration. It appears, however, that if all of the bill's provisions were to become law, the debtor would probably pay for the arbitration as an administrative expense since subsection (j) provides for reimbursing the representative for reasonable costs and fees incurred. 11 U.S.C. § 1113(j) Although current law includes provisions for allowing priority claims as administrative expenses for various expenses incurred in reorganization, there is no provision for reimbursing the authorized representative for fees and costs incurred in complying with the requirements of 11 U.S.C. § 1113. The bill would add subsection (j) to make these costs reimbursable upon request and notice and hearing. Under the bill's proposed changes, they would be considered administrative expenses. As administrative expenses, they would be priority claims whose payment in full must be provided for in the plan for reorganization. This provision could result in shorter negotiations or more flexible proposals by the debtor, who would need to balance the cost of continued negotiations with the economic benefit that might be gained through those negotiations. However, it could also lead to more liquidations if administrative expenses increased to the point that they could not be accommodated in a reorganization plan. 11 U.S.C. § 1113(k) When a debtor's reorganization plan involves either selling all or part of the business or ceasing some or all of the business, the bill would require the debtor and authorized representative to meet to determine the effects on the labor group. Any accrued obligations that were not assumed as part of a sale transaction would be treated as administrative expenses. Under current law, all post-petition obligations that are required by the CBA are considered administrative expenses. Additionally, where a CBA has been assumed, accrued pre-petition obligations under the CBA may also be administrative expenses. 11 U.S.C. § 1113(l) Although the bill would remove the word "assume" from 11 U.S.C. § 1113(a), it would add a subsection that would clearly state that assumption of CBAs are treated as are other executory contracts and assumed under 11 U.S.C. § 365. Conclusion In its findings, the bill states that Congress finds that chapter 11 was enacted "to protect jobs and enhance enterprise value for all stakeholders," but is, instead, being used to "caus[e] the burdens of bankruptcy to fall disproportionately and overwhelmingly on employees and retirees." Revising the process for rejection of CBAs is one of the ways this bill proposes to rectify the inequities it asserts. For many companies in bankruptcy, expense for employees is the largest expense in the budget, and some modification of that expense may be essential to their successful reorganization. Section 1113, as it currently exists, has provided labor groups with protection from debtor companies' unfettered rejections of CBAs, but has also provided a method for debtor companies to reject CBAs when they could not reach a compromise with the authorized representatives of the labor groups. The proposed revisions to section 1113 would constrain both debtor companies and the courts when debtors file under chapter 11. The bill clearly contemplates allowing labor groups to have a greater, possibly definitive, role in determining the feasibility of reorganization. Labor groups, but not debtors, would be allowed to request arbitration rather than a court hearing to determine approval of a debtor's request to reject a CBA. In certain circumstances, the bill would allow labor groups to obtain future relief due to changed circumstances without having to bargain with the company. The bill would also extend the right to strike to all labor groups whenever a CBA was modified or rejected without their consent. Finally, the bill provides labor groups with a defined remedy for rejection of a CBA, though courts might differ in their interpretation of that remedy. Companies in financial distress may argue that the bill's proposed changes to chapter 11 are insufficiently flexible to allow successful reorganization. If that is their conclusion, they might try to resolve their financial difficulties outside of bankruptcy or choose to liquidate rather than reorganize.

Summary: Introduced in the 110 th Congress, the Protecting Employees and Retirees in Business Bankruptcies Act of 2007 ( H.R. 3652 ) proposes a number of changes to the U.S. Bankruptcy Code. According to the sponsors, the changes are needed to remedy inequities in the bankruptcy process and to recognize that employees and retirees have a unique investment in their companies through their labor. The bill contains many proposals for changing the Bankruptcy Code. This report focuses on the amendments and additions to 11 U.S.C. § 1113, which provides the procedures that are to be followed if a debtor in possession wants to reject a collective bargaining agreement (CBA). The changes proposed for § 1113 may be intended to promote negotiation between the debtor and the authorized representatives of labor groups that have existing CBAs with the debtor company. They also appear to constrain court involvement in the process. This could lead to more agreed-upon modifications and fewer rejections of CBAs. Alternatively, it could prolong the negotiation process and put burdens on the debtor that would make liquidation more feasible than reorganization. The bill prescribes the parameters of offers that may be made by the debtor in negotiations as well as the requirements that must be met before a court can approve rejection. It attempts to curtail what the sponsors have referred to as "excesses of executive pay" by making rejection of a CBA difficult if executives are to receive incentive pay and by requiring consideration of past concessions by the labor group in determining whether the labor group is being disproportionately burdened by proposed modifications to a CBA. H.R. 3652 appears to propose changes to § 1113 that would resolve some differences between courts in interpreting the requirements for modification or rejection of a CBA. It also clearly states that rejection of a CBA is a breach of contract, even when approved by the court, and clarifies the damages that are available. The bill provides an absolute right of all employees to strike if their CBA is modified or rejected. This contrasts with recent court decisions involving unions representing employees of financially distressed airlines in which the employees were enjoined from striking.

gov_report

en

Summarize: Covent Garden at 11.15 p.m. Torrents of heavy summer rain. Cab whistles blowing frantically in all directions. Pedestrians running for shelter into the market and under the portico of St. Paul's Church, where there are already several people, among them a lady and her daughter in evening dress. They are all peering out gloomily at the rain, except one man with his back turned to the rest, who seems wholly preoccupied with a notebook in which he is writing busily. The church clock strikes the first quarter. THE DAUGHTER [in the space between the central pillars, close to the one on her left] I'm getting chilled to the bone. What can Freddy be doing all this time? He's been gone twenty minutes. THE MOTHER [on her daughter's right] Not so long. But he ought to have got us a cab by this. A BYSTANDER [on the lady's right] He won't get no cab not until half-past eleven, missus, when they come back after dropping their theatre fares. THE MOTHER. But we must have a cab. We can't stand here until half-past eleven. It's too bad. THE BYSTANDER. Well, it ain't my fault, missus. THE DAUGHTER. If Freddy had a bit of gumption, he would have got one at the theatre door. THE MOTHER. What could he have done, poor boy? THE DAUGHTER. Other people got cabs. Why couldn't he? Freddy rushes in out of the rain from the Southampton Street side, and comes between them closing a dripping umbrella. He is a young man of twenty, in evening dress, very wet around the ankles. THE DAUGHTER. Well, haven't you got a cab? FREDDY. There's not one to be had for love or money. THE MOTHER. Oh, Freddy, there must be one. You can't have tried. THE DAUGHTER. It's too tiresome. Do you expect us to go and get one ourselves? FREDDY. I tell you they're all engaged. The rain was so sudden: nobody was prepared; and everybody had to take a cab. I've been to Charing Cross one way and nearly to Ludgate Circus the other; and they were all engaged. THE MOTHER. Did you try Trafalgar Square? FREDDY. There wasn't one at Trafalgar Square. THE DAUGHTER. Did you try? FREDDY. I tried as far as Charing Cross Station. Did you expect me to walk to Hammersmith? THE DAUGHTER. You haven't tried at all. THE MOTHER. You really are very helpless, Freddy. Go again; and don't come back until you have found a cab. FREDDY. I shall simply get soaked for nothing. THE DAUGHTER. And what about us? Are we to stay here all night in this draught, with next to nothing on. You selfish pig-- FREDDY. Oh, very well: I'll go, I'll go. [He opens his umbrella and dashes off Strandwards, but comes into collision with a flower girl, who is hurrying in for shelter, knocking her basket out of her hands. A blinding flash of lightning, followed instantly by a rattling peal of thunder, orchestrates the incident] THE FLOWER GIRL. Nah then, Freddy: look wh' y' gowin, deah. FREDDY. Sorry [he rushes off]. THE FLOWER GIRL [picking up her scattered flowers and replacing them in the basket] There's menners f' yer! Te-oo banches o voylets trod into the mad. [She sits down on the plinth of the column, sorting her flowers, on the lady's right. She is not at all an attractive person. She is perhaps eighteen, perhaps twenty, hardly older. She wears a little sailor hat of black straw that has long been exposed to the dust and soot of London and has seldom if ever been brushed. Her hair needs washing rather badly: its mousy color can hardly be natural. She wears a shoddy black coat that reaches nearly to her knees and is shaped to her waist. She has a brown skirt with a coarse apron. Her boots are much the worse for wear. She is no doubt as clean as she can afford to be; but compared to the ladies she is very dirty. Her features are no worse than theirs; but their condition leaves something to be desired; and she needs the services of a dentist]. THE MOTHER. How do you know that my son's name is Freddy, pray? THE FLOWER GIRL. Ow, eez ye-ooa san, is e? Wal, fewd dan y' de-ooty bawmz a mather should, eed now bettern to spawl a pore gel's flahrzn than ran awy atbaht pyin. Will ye-oo py me f'them? [Here, with apologies, this desperate attempt to represent her dialect without a phonetic alphabet must be abandoned as unintelligible outside London.] THE DAUGHTER. Do nothing of the sort, mother. The idea! THE MOTHER. Please allow me, Clara. Have you any pennies? THE DAUGHTER. No. I've nothing smaller than sixpence. THE FLOWER GIRL [hopefully] I can give you change for a tanner, kind lady. THE MOTHER [to Clara] Give it to me. [Clara parts reluctantly]. Now [to the girl] This is for your flowers. THE FLOWER GIRL. Thank you kindly, lady. THE DAUGHTER. Make her give you the change. These things are only a penny a bunch. THE MOTHER. Do hold your tongue, Clara. [To the girl]. You can keep the change. THE FLOWER GIRL. Oh, thank you, lady. THE MOTHER. Now tell me how you know that young gentleman's name. THE FLOWER GIRL. I didn't. THE MOTHER. I heard you call him by it. Don't try to deceive me. THE FLOWER GIRL [protesting] Who's trying to deceive you? I called him Freddy or Charlie same as you might yourself if you was talking to a stranger and wished to be pleasant. [She sits down beside her basket]. THE DAUGHTER. Sixpence thrown away! Really, mamma, you might have spared Freddy that. [She retreats in disgust behind the pillar]. An elderly gentleman of the amiable military type rushes into shelter, and closes a dripping umbrella. He is in the same plight as Freddy, very wet about the ankles. He is in evening dress, with a light overcoat. He takes the place left vacant by the daughter's retirement. THE GENTLEMAN. Phew! THE MOTHER [to the gentleman] Oh, sir, is there any sign of its stopping? THE GENTLEMAN. I'm afraid not. It started worse than ever about two minutes ago. [He goes to the plinth beside the flower girl; puts up his foot on it; and stoops to turn down his trouser ends]. THE MOTHER. Oh, dear! [She retires sadly and joins her daughter]. THE FLOWER GIRL [taking advantage of the military gentleman's proximity to establish friendly relations with him]. If it's worse it's a sign it's nearly over. So cheer up, Captain; and buy a flower off a poor girl. THE GENTLEMAN. I'm sorry, I haven't any change. THE FLOWER GIRL. I can give you change, Captain, THE GENTLEMEN. For a sovereign? I've nothing less. THE FLOWER GIRL. Garn! Oh do buy a flower off me, Captain. I can change half-a-crown. Take this for tuppence. THE GENTLEMAN. Now don't be troublesome: there's a good girl. [Trying his pockets] I really haven't any change--Stop: here's three hapence, if that's any use to you [he retreats to the other pillar]. THE FLOWER GIRL [disappointed, but thinking three halfpence better than nothing] Thank you, sir. THE BYSTANDER [to the girl] You be careful: give him a flower for it. There's a bloke here behind taking down every blessed word you're saying. [All turn to the man who is taking notes]. THE FLOWER GIRL [springing up terrified] I ain't done nothing wrong by speaking to the gentleman. I've a right to sell flowers if I keep off the kerb. [Hysterically] I'm a respectable girl: so help me, I never spoke to him except to ask him to buy a flower off me. [General hubbub, mostly sympathetic to the flower girl, but deprecating her excessive sensibility. Cries of Don't start hollerin. Who's hurting you? Nobody's going to touch you. What's the good of fussing? Steady on. Easy, easy, etc., come from the elderly staid spectators, who pat her comfortingly. Less patient ones bid her shut her head, or ask her roughly what is wrong with her. A remoter group, not knowing what the matter is, crowd in and increase the noise with question and answer: What's the row? What she do? Where is he? A tec taking her down. What! him? Yes: him over there: Took money off the gentleman, etc. The flower girl, distraught and mobbed, breaks through them to the gentleman, crying mildly] Oh, sir, don't let him charge me. You dunno what it means to me. They'll take away my character and drive me on the streets for speaking to gentlemen. They-- THE NOTE TAKER [coming forward on her right, the rest crowding after him] There, there, there, there! Who's hurting you, you silly girl? What do you take me for? THE BYSTANDER. It's all right: he's a gentleman: look at his boots. [Explaining to the note taker] She thought you was a copper's nark, sir. THE NOTE TAKER [with quick interest] What's a copper's nark? THE BYSTANDER [inept at definition] It's a--well, it's a copper's nark, as you might say. What else would you call it? A sort of informer. THE FLOWER GIRL [still hysterical] I take my Bible oath I never said a word-- THE NOTE TAKER [overbearing but good-humored] Oh, shut up, shut up. Do I look like a policeman? THE FLOWER GIRL [far from reassured] Then what did you take down my words for? How do I know whether you took me down right? You just show me what you've wrote about me. [The note taker opens his book and holds it steadily under her nose, though the pressure of the mob trying to read it over his shoulders would upset a weaker man]. What's that? That ain't proper writing. I can't read that. THE NOTE TAKER. I can. [Reads, reproducing her pronunciation exactly] "Cheer ap, Keptin; n' haw ya flahr orf a pore gel." THE FLOWER GIRL [much distressed] It's because I called him Captain. I meant no harm. [To the gentleman] Oh, sir, don't let him lay a charge agen me for a word like that. You-- THE GENTLEMAN. Charge! I make no charge. [To the note taker] Really, sir, if you are a detective, you need not begin protecting me against molestation by young women until I ask you. Anybody could see that the girl meant no harm. THE BYSTANDERS GENERALLY [demonstrating against police espionage] Course they could. What business is it of yours? You mind your own affairs. He wants promotion, he does. Taking down people's words! Girl never said a word to him. What harm if she did? Nice thing a girl can't shelter from the rain without being insulted, etc., etc., etc. [She is conducted by the more sympathetic demonstrators back to her plinth, where she resumes her seat and struggles with her emotion]. THE BYSTANDER. He ain't a tec. He's a blooming busybody: that's what he is. I tell you, look at his boots. THE NOTE TAKER [turning on him genially] And how are all your people down at Selsey? THE BYSTANDER [suspiciously] Who told you my people come from Selsey? THE NOTE TAKER. Never you mind. They did. [To the girl] How do you come to be up so far east? You were born in Lisson Grove. THE FLOWER GIRL [appalled] Oh, what harm is there in my leaving Lisson Grove? It wasn't fit for a pig to live in; and I had to pay four-and-six a week. [In tears] Oh, boo--hoo--oo-- THE NOTE TAKER. Live where you like; but stop that noise. THE GENTLEMAN [to the girl] Come, come! he can't touch you: you have a right to live where you please. A SARCASTIC BYSTANDER [thrusting himself between the note taker and the gentleman] Park Lane, for instance. I'd like to go into the Housing Question with you, I would. THE FLOWER GIRL [subsiding into a brooding melancholy over her basket, and talking very low-spiritedly to herself] I'm a good girl, I am. THE SARCASTIC BYSTANDER [not attending to her] Do you know where _I_ come from? THE NOTE TAKER [promptly] Hoxton. Titterings. Popular interest in the note taker's performance increases. THE SARCASTIC ONE [amazed] Well, who said I didn't? Bly me! You know everything, you do. THE FLOWER GIRL [still nursing her sense of injury] Ain't no call to meddle with me, he ain't. THE BYSTANDER [to her] Of course he ain't. Don't you stand it from him. [To the note taker] See here: what call have you to know about people what never offered to meddle with you? Where's your warrant? SEVERAL BYSTANDERS [encouraged by this seeming point of law] Yes: where's your warrant? THE FLOWER GIRL. Let him say what he likes. I don't want to have no truck with him. THE BYSTANDER. You take us for dirt under your feet, don't you? Catch you taking liberties with a gentleman! THE SARCASTIC BYSTANDER. Yes: tell HIM where he come from if you want to go fortune-telling. THE NOTE TAKER. Cheltenham, Harrow, Cambridge, and India. THE GENTLEMAN. Quite right. [Great laughter. Reaction in the note taker's favor. Exclamations of He knows all about it. Told him proper. Hear him tell the toff where he come from? etc.]. May I ask, sir, do you do this for your living at a music hall? THE NOTE TAKER. I've thought of that. Perhaps I shall some day. The rain has stopped; and the persons on the outside of the crowd begin to drop off. THE FLOWER GIRL [resenting the reaction] He's no gentleman, he ain't, to interfere with a poor girl. THE DAUGHTER [out of patience, pushing her way rudely to the front and displacing the gentleman, who politely retires to the other side of the pillar] What on earth is Freddy doing? I shall get pneumonia if I stay in this draught any longer. THE NOTE TAKER [to himself, hastily making a note of her pronunciation of "monia"] Earlscourt. THE DAUGHTER [violently] Will you please keep your impertinent remarks to yourself? THE NOTE TAKER. Did I say that out loud? I didn't mean to. I beg your pardon. Your mother's Epsom, unmistakeably. THE MOTHER [advancing between her daughter and the note taker] How very curious! I was brought up in Largelady Park, near Epsom. THE NOTE TAKER [uproariously amused] Ha! ha! What a devil of a name! Excuse me. [To the daughter] You want a cab, do you? THE DAUGHTER. Don't dare speak to me. THE MOTHER. Oh, please, please Clara. [Her daughter repudiates her with an angry shrug and retires haughtily.] We should be so grateful to you, sir, if you found us a cab. [The note taker produces a whistle]. Oh, thank you. [She joins her daughter]. The note taker blows a piercing blast. THE SARCASTIC BYSTANDER. There! I knowed he was a plain-clothes copper. THE BYSTANDER. That ain't a police whistle: that's a sporting whistle. THE FLOWER GIRL [still preoccupied with her wounded feelings] He's no right to take away my character. My character is the same to me as any lady's. THE NOTE TAKER. I don't know whether you've noticed it; but the rain stopped about two minutes ago. THE BYSTANDER. So it has. Why didn't you say so before? and us losing our time listening to your silliness. [He walks off towards the Strand]. THE SARCASTIC BYSTANDER. I can tell where you come from. You come from Anwell. Go back there. THE NOTE TAKER [helpfully] _H_anwell. THE SARCASTIC BYSTANDER [affecting great distinction of speech] Thenk you, teacher. Haw haw! So long [he touches his hat with mock respect and strolls off]. THE FLOWER GIRL. Frightening people like that! How would he like it himself. THE MOTHER. It's quite fine now, Clara. We can walk to a motor bus. Come. [She gathers her skirts above her ankles and hurries off towards the Strand]. THE DAUGHTER. But the cab--[her mother is out of hearing]. Oh, how tiresome! [She follows angrily]. All the rest have gone except the note taker, the gentleman, and the flower girl, who sits arranging her basket, and still pitying herself in murmurs. THE FLOWER GIRL. Poor girl! Hard enough for her to live without being worrited and chivied. THE GENTLEMAN [returning to his former place on the note taker's left] How do you do it, if I may ask? THE NOTE TAKER. Simply phonetics. The science of speech. That's my profession; also my hobby. Happy is the man who can make a living by his hobby! You can spot an Irishman or a Yorkshireman by his brogue. I can place any man within six miles. I can place him within two miles in London. Sometimes within two streets. THE FLOWER GIRL. Ought to be ashamed of himself, unmanly coward! THE GENTLEMAN. But is there a living in that? THE NOTE TAKER. Oh yes. Quite a fat one. This is an age of upstarts. Men begin in Kentish Town with 80 pounds a year, and end in Park Lane with a hundred thousand. They want to drop Kentish Town; but they give themselves away every time they open their mouths. Now I can teach them-- THE FLOWER GIRL. Let him mind his own business and leave a poor girl-- THE NOTE TAKER [explosively] Woman: cease this detestable boohooing instantly; or else seek the shelter of some other place of worship. THE FLOWER GIRL [with feeble defiance] I've a right to be here if I like, same as you. THE NOTE TAKER. A woman who utters such depressing and disgusting sounds has no right to be anywhere--no right to live. Remember that you are a human being with a soul and the divine gift of articulate speech: that your native language is the language of Shakespear and Milton and The Bible; and don't sit there crooning like a bilious pigeon. THE FLOWER GIRL [quite overwhelmed, and looking up at him in mingled wonder and deprecation without daring to raise her head] Ah--ah--ah--ow--ow--oo! THE NOTE TAKER [whipping out his book] Heavens! what a sound! [He writes; then holds out the book and reads, reproducing her vowels exactly] Ah--ah--ah--ow--ow--ow--oo! THE FLOWER GIRL [tickled by the performance, and laughing in spite of herself] Garn! THE NOTE TAKER. You see this creature with her kerbstone English: the English that will keep her in the gutter to the end of her days. Well, sir, in three months I could pass that girl off as a duchess at an ambassador's garden party. I could even get her a place as lady's maid or shop assistant, which requires better English. That's the sort of thing I do for commercial millionaires. And on the profits of it I do genuine scientific work in phonetics, and a little as a poet on Miltonic lines. THE GENTLEMAN. I am myself a student of Indian dialects; and-- THE NOTE TAKER [eagerly] Are you? Do you know Colonel Pickering, the author of Spoken Sanscrit? THE GENTLEMAN. I am Colonel Pickering. Who are you? THE NOTE TAKER. Henry Higgins, author of Higgins's Universal Alphabet. PICKERING [with enthusiasm] I came from India to meet you. HIGGINS. I was going to India to meet you. PICKERING. Where do you live? HIGGINS. 27A Wimpole Street. Come and see me tomorrow. PICKERING. I'm at the Carlton. Come with me now and let's have a jaw over some supper. HIGGINS. Right you are. THE FLOWER GIRL [to Pickering, as he passes her] Buy a flower, kind gentleman. I'm short for my lodging. PICKERING. I really haven't any change. I'm sorry [he goes away]. HIGGINS [shocked at girl's mendacity] Liar. You said you could change half-a-crown. THE FLOWER GIRL [rising in desperation] You ought to be stuffed with nails, you ought. [Flinging the basket at his feet] Take the whole blooming basket for sixpence. The church clock strikes the second quarter. HIGGINS [hearing in it the voice of God, rebuking him for his Pharisaic want of charity to the poor girl] A reminder. [He raises his hat solemnly; then throws a handful of money into the basket and follows Pickering]. THE FLOWER GIRL [picking up a half-crown] Ah--ow--ooh! [Picking up a couple of florins] Aaah--ow--ooh! [Picking up several coins] Aaaaaah--ow--ooh! [Picking up a half-sovereign] Aasaaaaaaaaah--ow--ooh!!! FREDDY [springing out of a taxicab] Got one at last. Hallo! [To the girl] Where are the two ladies that were here? THE FLOWER GIRL. They walked to the bus when the rain stopped. FREDDY. And left me with a cab on my hands. Damnation! THE FLOWER GIRL [with grandeur] Never you mind, young man. I'm going home in a taxi. [She sails off to the cab. The driver puts his hand behind him and holds the door firmly shut against her. Quite understanding his mistrust, she shows him her handful of money]. Eightpence ain't no object to me, Charlie. [He grins and opens the door]. Angel Court, Drury Lane, round the corner of Micklejohn's oil shop. Let's see how fast you can make her hop it. [She gets in and pulls the door to with a slam as the taxicab starts]. FREDDY. Well, I'm dashed!

Summary: It's a dark and stormy night, and a crowd of people are seeking refuge from the rain in front of a church in London's Covent Garden market. Among them are an older woman and her daughter, their son Freddy, an old, well-dressed military man, a poor young flower girl with a thick Cockney accent, and a strange man standing in the shadows writing down everything the flower girl says. Trouble starts when the older woman starts asking the flower girl questions. The girl flips out and starts telling everyone what a good girl she is. The crowd comes to her defense and everything seems fine until some guy informs her about the strange man taking notes. People think he's some kind of cop, or maybe just a pervert. She flips out again, although its pretty darn hard to understand what she's saying through her thick accent, until the note-taker shows himself, and everybody sees that he's not a cop or a pervert, he's just an rich guy with nice boots and a knack for guessing where people come from, geography-wise. People are amazed/frightened by this ability. He tells the flower girl to, well, shut up. She whines some more. He asks her to kindly shut up again and to please stop butchering the English language. He then tells the old guy that he could pass off the crazy flower girl as royalty by teaching her how to speak. The two men introduce themselves - turns out they're both well-respected linguists. The note-taker is Henry Higgins, teacher of phonetics, the old guy an expert on the dead Indian language Sanskrit. Higgins takes pity on the flower girl and gives her a sovereign. The girl jumps for joy, starts howling like a banshee - no, really - and jumps in the next cab. The two men head back to Pickering's hotel for dinner, and poor old Freddy gets left in the rain, abandoned by his mom and sis.

booksum

en

Summarize: Current Law Tax Law Churches qualify for tax-exempt status as IRC § 501(c)(3) organizations. These organizations may not "participate in, or intervene in (including the publishing or distributing of statements), any political campaign on behalf of (or in opposition to) any candidate for public office." This is an absolute prohibition. Thus, a church that engages in any amount of campaign activity may have its § 501(c)(3) status revoked. It may also, either in addition to or in lieu of revocation, be taxed on its political expenditures under IRC § 4955. The tax equals 10% of the expenditures, which is increased to 100% if the church does not take timely action to recover the expenditures and establish policies preventing future ones. The tax may also be imposed on church managers at lower rates. IRC § 501(c)(3) only prohibits campaign intervention. Other types of political activities are permitted. The line between the two can be difficult to discern. Clearly, churches may not make statements that endorse or oppose a candidate, publish or distribute campaign literature, or contribute to a campaign. On the other hand, they may conduct activities not related to elections, such as issue advocacy and supporting or opposing individuals for nonelective offices. In general, an activity is permissible unless it is structured or conducted in a way that shows bias towards or against a candidate. Thus, churches may do such things as create and distribute voter education materials, host candidate forums, and invite candidates to appear at church functions so long as these activities do not show a preference for or against a candidate. Biases can be subtle, and whether an activity is campaign intervention depends on the facts and circumstances of each case. The tax laws do not prohibit religious leaders from participating in campaign activity as individuals. Religious leaders may endorse or oppose candidates in speeches, advertisements, etc., in their capacity as private citizens. A leader may be identified as being from a specific church, but there should be no intimation that he or she is speaking as a representative of the church. The church may not support the activity in any way. Thus, a leader may not make campaign-related statements in the church's publications, at its events, or in a manner that uses its assets. This is true even if the leader pays the costs of the publication or event. Campaign Finance Law The Federal Election Campaign Act (FECA), which regulates the raising and spending of campaign funds, is separate and distinct from the tax code. FECA prohibits corporations from using treasury funds to make contributions and expenditures in connection with federal elections, but does not prohibit unincorporated organizations from making such contributions and expenditures. FECA also requires regular filing of disclosure reports by candidates and political committees of contributions and expenditures, and by persons making independent expenditures that aggregate more than $250 in a calendar year. Under FECA, the term "political committee" is defined to include any committee, club, association, or other group of persons that receives contributions or makes expenditures aggregating in excess of $1,000 during a calendar year. As a result of a 2002 amendment to FECA, corporations—including tax-exempt corporations—are further prohibited from funding "electioneering communications," which are defined as broadcast communications made within 60 days of a general election or 30 days of a primary that "refer" to a federal office candidate. Federal Election Commission (FEC) regulations provide an exception to this prohibition for "qualified nonprofit corporations," which do not include churches. In McConnell v. FEC, the Supreme Court upheld the constitutionality of FECA's prohibition on corporate treasury funds being spent for electioneering communications. More recently, however, the Court in Wisconsin Right to Life, Inc. v. FEC (WRTL II) found that this prohibition was unconstitutional as applied to ads that Wisconsin Right to Life, Inc. sought to run. While not expressly overruling its decision in McConnell v. FEC, which had upheld the provision against a First Amendment facial challenge, the Court limited the law's application. Specifically, it ruled that advertisements that may reasonably be interpreted as something other than an appeal to vote for or against a specific candidate are not the functional equivalent of express advocacy, and therefore, cannot be regulated. Analysis of Legislation Bills introduced in the 110 th, 109 th, 108 th, and 107 th Congresses would have allowed churches to engage in some amount of political campaign activity without risking their tax-exempt status. Each bill addressed the issue in a different way. Thus, they provide examples of various approaches Congress could take, if it so chose, to amend the tax code's prohibition on campaign activity by churches. No such legislation has yet been introduced in the 111 th Congress. None of the bills would have changed the reporting requirements under current law. Churches, unlike most tax-exempt organizations, are not required to file an annual information return (Form 990) with the IRS. Tax-exempt organizations permitted to engage in political activities are generally required to report information about those activities on the form's Schedule C. Thus, while the bills would have permitted churches to engage in campaign activities, they would not have required churches to report to the IRS on those activities. H.R. 2275 (110th Congress) H.R. 2275 would have repealed the political campaign prohibition in IRC § 501(c)(3). Thus, it would have allowed churches and other § 501(c)(3) organizations to engage in all types of campaign activity without jeopardizing their tax-exempt status. The bill did not expressly impose any limitation on the amount of permissible campaign activity. However, the existing requirement in I.R.C.§ 501(c)(3) that organizations be "organized and operated exclusively" for an exempt purpose would appear to require that any such activity have been insubstantial. Churches and other organizations would have still been subject to tax on their political expenditures, thus possibly providing a disincentive to engage in activities with associated taxable expenditures. It appears the bill would have allowed churches and other § 501(c)(3) organizations to establish § 527(f)(3) separate segregated funds to conduct election-related activities. Churches would have still been subject to applicable campaign finance laws. H.R. 235 (109th Congress) Under H.R. 235, the Houses of Worship Free Speech Restoration Act, churches would not have been treated as participating in campaign activity "because of the content, preparation, or presentation of any homily, sermon, teaching, dialectic, or other presentation made during religious services or gatherings." This rule would have applied for purposes of § 501(c)(3) status, eligibility to receive tax-deductible contributions under § 170(c)(2), various estate and gift tax provisions (§§ 2055, 2106 and 2522), and the § 4955 excise tax on political expenditures. The bill clarified that no church member or leader would be prohibited from expressing personal views on political matters or elections during regular religious services so long as those views were not disseminated beyond the service's attendees. Dissemination would have included a mailing with more than an incremental cost to the church and any electioneering communication. The bill expressly stated that it did not permit disbursements for electioneering communications or political expenditures prohibited by FECA. It appears that H.R. 235 would have permitted activities such as the express endorsement of a candidate by church leaders and others during religious services, requests for contributions to candidate committees and other political committees during religious gatherings, and written endorsements in church bulletins and inserts. Any expenditures for these activities would not have been subject to the § 4955 tax. The bill would not have allowed churches to set up § 527(f)(3) separate segregated funds or change existing campaign finance laws. H.R. 235 (108th Congress) H.R. 235, an earlier version of the Houses of Worship Free Speech Restoration Act, was identical to the version introduced in the 109 th Congress except it did not reference IRC §§ 2055, 2106, 2522 and 4955 nor did it include the clarification concerning church leaders. While this version did not provide an exception from the § 4955 tax, it would seem from a practical standpoint that this difference between the two versions could be insignificant because many of the activities permitted under the bills would have little or no associated expenditures. H.R. 4520 (108th Congress) The provision in H.R. 4520, former section 692 (Safe Harbor for Churches), was only briefly in the bill before the House Ways and Means Committee struck it by unanimous consent. It would have done several things. First, churches would not have been treated as participating in campaign activity solely because of their religious leaders' private statements. Second, churches that unintentionally intervened in a political campaign would not have lost their tax-exempt status or eligibility to receive deductible contributions unless the church or its religious leaders had done so on more than three occasions during the year. Third, unintentional violations of the § 501(c)(3) prohibition would have been subject to a new excise tax. If the church had at least three unintentional violations during the year, the tax would have equaled the highest corporate tax rate multiplied by the church's gross income, contributions, and gifts. If the church had two violations, then the tax would have equaled that amount divided by two. If the church had one violation, then the tax would have equaled the full amount divided by 52. The tax would have been reduced by any amount imposed under § 4955. This bill was more restrictive than the others because it would have only permitted unintentional violations of the campaign prohibition and even those violations would have been fined. Thus, this bill was specifically targeted at removing the risk that churches that inadvertently engaged in campaign activity could lose their tax-exempt status, as opposed to permitting churches to engage in such activity. The impact of the provision addressing religious leaders' private statements could be unclear because it could be interpreted as simply codifying existing law. H.R. 2357 and S. 2886 (107th Congress) H.R. 2357 and S. 2886, the Houses of Worship Political Speech Protection Act, would have allowed § 501(c)(3) churches to engage in campaign activity so long as it was "no substantial part" of a church's activities. S. 2886 —but not H.R. 2357 —clarified that the bill would not allow disbursements for electioneering communications not permitted under FECA. H.R. 2357 received a floor vote on October 2, 2002, and failed to pass by a vote of 178 to 239. The "no substantial part" test, which is currently used to measure § 501(c)(3) organizations' lobbying activities, is a flexible standard. Thus, the bills would have required each church to be judged on a case-by-case basis as to whether its campaign activities were a substantial part of its activities. Churches would have been allowed to engage in any type of campaign activity; however, the § 4955 tax could have discouraged churches from conducting activities with associated taxable expenditures. It could be unclear the extent to which the bills would have permitted churches to establish § 527(f)(3) separate segregated funds without overstepping the "no substantial part" rule. Churches would have still been subject to applicable campaign finance laws. H.R. 2931 (107th Congress) Under, H.R. 2931, the Bright-Line Act of 2001, a church would only have violated the campaign prohibition if it normally made expenditures for campaign activity in excess of 5% of its gross revenues. Lobbying expenditures could not have normally exceeded 20% of its gross revenues, and the church could not have normally spent more than 20% of its gross revenues on campaign and lobbying activities combined. The bill did not define the term "normally." The bill would have permitted churches to routinely engage in any type of campaign activity without risking their tax-exempt status so long as their expenditures for such activities did not "normally" exceed the limits. Thus, in practice, no or low-cost campaign activities could have been conducted almost without limit. Churches would have been allowed to occasionally engage in campaign activity in excess of the limits so long as this did not normally happen. It could be unclear the extent to which a church would have been able to establish a § 527(f)(3) separate segregated fund under the bill and still comply with the 5% limit. Any campaign activity would have been subject to the applicable campaign finance laws.

Summary: In recent years, there has been increased attention paid to the political activities of churches. Churches and other houses of worship qualify for tax-exempt status as Internal Revenue Code § 501(c)(3) organizations. Under the tax laws, these organizations may not participate in political campaign activity. Separate from the prohibition in the tax code, the Federal Election Campaign Act (FECA) may also restrict the ability of churches to engage in electioneering activities. Legislation had been introduced in the past several Congresses that would have allowed churches to participate in at least some campaign activity without jeopardizing their § 501(c)(3) status. These bills were the Houses of Worship Free Speech Restoration Act, H.R. 235 (109th Congress) and H.R. 235 (108th Congress); a provision briefly included in the American Jobs Creation Act of 2004, H.R. 4520 (108th Congress); the Houses of Worship Political Speech Protection Act, H.R. 2357 and S. 2886 (107th Congress); and the Bright-Line Act of 2001, H.R. 2931 (107th Congress). In the 110th Congress, H.R. 2275 would have repealed the prohibition against campaign intervention in IRC § 501(c)(3). Unlike the other bills, H.R. 2275 would have applied to all § 501(c)(3) organizations and not just churches. No similar legislation has yet been introduced in the 111th Congress. This report provides an overview of the tax and campaign finance laws relevant to these bills and a discussion of how each bill would have amended current law. For further discussion of the laws restricting campaign activity by churches, see CRS Report RL34447, Churches and Campaign Activity: Analysis Under Tax and Campaign Finance Laws, by [author name scrubbed] and [author name scrubbed].

gov_report

en

Summarize: By. Daily Mail Reporter. A 20-year-old woman killed while sharing a snowmobile driven by her allegedly intoxicated friend thought she had chosen the safer driver. Victoria Henderson died on Wednesday night after flying off the back of a snowmobile operated by Nicholas Krenz and hitting an ice shack on frozen Bone Lake, Wisconsin. Krenz, 21, allegedly veered to avoid the shack, throwing the young woman off. Tragic: Victoria Henderson, 20, died on Wednesday night after being thrown off the back of a snowmobile and hitting an ice shack. She died from her head injuries. Heartbreaking: Victoria Henderson (left) died on Wednesday night after flying off the back of a snowmobile driven by her friend and hitting an ice shack on frozen Bone Lake, Wisconsin. Her boyfriend Thomas Mergens (right) was trailing the pair. Henderson's boyfriend Thomas Mergens was trailing the pair on a separate snowmobile when the accident happened about 10pm. Ironically, Henderson, from the western Wisconsin town of Luck, had refused to ride with her boyfriend because she felt he drove too fast. The two men tried desperately to revive the woman, who was wearing a helment, but she died at the scene. She suffered serious head injuries. Sheriff Peter Johnson said that Henderson 'typically rode with Krenz because her boyfriend [Mergens] drove too fast' Scene: Krenz had allegedly veered to avoid this ice shack on Bone Lake, Wisconsin, when the accident happened. Arrested: Nicholas Krenz, 21, was arrested at the scene on suspicion of drunk driving. 'It looks like [Krenz] took a left and tossed her to the right (in a) last-second (maneuver),' he added. Krenz was arrested on suspicion of drunk driving. The Twin Cities man was not hurt and remains free pending charges. Henderson had moved from Little Rock, Arkansas and worked at the Thirsty Otter Tavern and Resort for about a year. The tavern has organized a fundraiser for the popular server's family. 'Tori was an Employee, Friend and part of our Otter Family,' read a notice on the tavern’s Facebook page. 'With very heavy hearts we invite you to come and help us celebrate her life and the wonderful person that she was. Tori was loved by everyone and will be missed terribly!!!!!â€

Summary: Victoria Henderson, 20, died in snowmobile accident at Bone Lake, Wisconsin about 10pm Wednesday. She was thrown off when 21-year-old Nicholas Krenz, the driver, veered to avoid an ice shack. Henderson struck the shack and died at the scene. Krenz was arrested for drunk driving. Henderson had refused to ride with her boyfriend, Thomas Mergens, because she felt he drove too fast. He was trailing the pair.

cnn_dailymail

en

Summarize: BACKGROUND OF THE INVENTION The present invention relates to smoking devices, and more particularly, to a smoking article which includes flavor releasing material and aerosol generating material which are volatilized by the heat generated by burning tobacco, but are not directly subjected to the burning tobacco. Smoking articles having a tobacco column with a tubular member therethrough, wherein the tube is filled with an aerosol releasing material, are known. The following patents illustrate various known smoking articles of this type: U.S. Pat. No. 3,258,015 issued on June 28, 1966 to C. D. Ellis, et al.; U.S. Pat. No. 3,356,094 issued on Dec. 5, 1967 to C. D. Ellis, et al.; U.S. Pat. No. 4,340,072 issued on July 20, 1982 to Bolt, et al.; U.S. Pat. No. 4,714,082 issued on Dec. 22, 1987 to Chandra K. Banerjee, et al.; U.S. Pat. No. 4,715,389 issued on Dec. 29, 1987 to Dwo Lynn, et al.; and U.S. Pat. No. 4,732,168 issued on Mar. 22, 1988 to James L. Resce, et al. In U.S. Pat. Nos. 3,356,094; 4,340,072 and 4,732,168, smoke from the burning tobacco is mixed with the aerosol and delivered to the smoker&#39;s mouth. In U.S. Pat. No. 715,389, a tobacco column has a central channel which holds a plug of carbonized tobacco with plugs of aluminum screen to both sides of the tobacco plug. Both smoke from the tobacco column and pyrolyzed products of the carbonized tobacco plug are delivered to the smoker&#39;s mouth. In U.S. Pat. No. 3,258,015, the aerosol from a nicotine-releasing composition located within a central tube passes through a nucleating chamber wherein the aerosol is cooled and condensed to droplets before being discharged to the smoker&#39;s mouth. SUMMARY OF THE INVENTION The present invention provides a smoking device having a central tube of an impermeable material located within a tobacco column, wherein the central tube contains a heat absorbing, porous non-tobacco substrate including a flavor releasing material which is more straightforward in construction than the similar known smoking devices. The present invention further provides a smoking device of the class described wherein smoke from the burning tobacco column does not enter the smoker&#39;s mouth. The present invention also provides a smoking device of the class described which does not require a nucleating chamber for the aerosol generated in the central tube. More particularly, the present invention provides a smoking device having a tobacco column with a central tube disposed therein, the central tube being fabricated of a paper material which is impermeable to smoke and which is friable at the smoldering temperature of the tobacco of the tobacco column; a heat absorbing substrate of porous non-tobacco material disposed within the tube; a flavor releasing material mixed with the porous substrate, which flavor is volatile at the smoldering temperature of the tobacco of the tobacco column; an aerosol generating material impregnating the porous substrate and being aerosolized by the heat generated by the smoldering tobacco; a mouthpiece which may or may not include a filter coaxially located at one end of the tobacco column, and sealing means at the interface of the mouthpiece and tobacco column to prevent the passage of smoke from the tobacco column into the mouthpiece. BRIEF DESCRIPTION OF THE DRAWING A better understanding of the invention will be had upon reference to the following description in conjunction with the accompanying drawings wherein the numerals refer to like parts throughout the several views and wherein: FIG. 1 is a longitudinal cross-sectional view of one embodiment of the present invention; FIG. 2 is a longitudinal cross-sectional view of another embodiment of the present invention; FIG. 3 is a longitudinal cross-sectional view of yet another embodiment of the present invention; FIG. 4 is a longitudinal cross-sectional view of yet a further embodiment of the present invention; FIG. 5 is a longitudinal cross-sectional view of a still further embodiment of the present invention; FIG. 6 is a longitudinal cross-sectional view of even still a further embodiment of the present invention; FIG. 7 is a longitudinal cross-sectional view of a further embodiment of the present invention; and FIG. 8 is also a longitudinal cross-sectional view of a further embodiment of the present invention. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS With reference to FIG. 1, there is shown a smoking device, generally denoted as the numeral 10, of the present invention. The smoking device 10 comprises a generally cylindrical tobacco column 12 circumferentially wrapped with a paper wrapper 14. The paper wrapper 14 is preferably of the type having a controlled burning rate which emits little visible smoke, commonly referred to as sidestream smoke. It is further contemplated that the tobacco column 12 be double wrapped, that is be wrapped with two layers of such wrapper paper. A mouthpiece 16 is located at the outlet end 20 of the tobacco column 12 coaxial with the tobacco column 12 and is connected thereto by a circumscribing tipping material 18 which overlaps the adjacent end of the tobacco column 12. The mouth piece 16 is shown as being a hollow cylindrical structure fabricated of an impermeable material such as a plastic. A rigid paper tube 22 is concentrically located within the tobacco column 12 and extends the entire length of the tobacco column 12 so that the outlet end 24 of the tube 22 is open to the outlet end 20 of the tobacco column 12 and the other, or inlet end 26 of the tube 22 is open to the opposite or front end 28 of the tobacco column 12. The tube 22 is gas impermeable and is friable at the smoldering temperature of the tobacco of the tobacco column 12. The central paper tube can be pretreated with a burn retardant such as sodium chloride, magnesium chloride, ammonium sulfamate, sodium borate, or ammonium sulfate. The tube 22 is filled with a substrate of a porous non-tobacco, heat absorbing material such as alumina, charcoal, or vermiculite. In addition, a flavor releasing material is included in the tube 22. The flavor material can be, for example, a flavorful tobacco admixed with the substrate material, or a liquid flavor extract composition impregnating the porous substrate, such as a nicotine extract, which vaporizes at the smoldering temperature of the tobacco of the tobacco column 12. An aerosol generating material, such as glycerine, propylene glycol and mixtures thereof, also impregnating the porous substrate 30 is aerosolized by the heat generated by the smoldering tobacco column. A seal 32, such as an impermeable metal or treated paper ring, is located at the interface of the mouthpiece 16 and the outlet end 20 of the tobacco column 12 to prevent smoke from the smoldering tobacco column 12 from entering the mouthpiece. FIG. 2 illustrates a somewhat different embodiment of the smoking device, generally denoted as the numeral 110, of the present invention which is identical to the smoking device 10 in almost all respects. For the sake of brevity of description, the identical features are identified by identical numerals and their description will not be repeated. The only difference between the smoking device 110 and the smoking device 10 is that in the smoking device 110 the outlet end 24 of the tube 22 terminates a distance of 1-5 mm short of the outlet end 20 of the tobacco column 12. FIG. 3 illustrates a somewhat different embodiment of the smoking device, generally denoted as the numeral 210, of the present invention which is identical to the smoking device 10 in almost all respects. For the sake of brevity of description, the identical features are identified by identical numerals and their description will not be repeated. The only difference between the smoking device 210 and the smoking device 10 is that in the smoking device 210 the inlet end 26 of the tube 22 terminates a distance of 1-5 mm short of the front end 28 of the tobacco column 12. That is, the tube inlet end 26 is spaced a distance from the tobacco column front end 28 inside the tobacco column 12 such that the inlet tube end 26 is initially covered or closed by tobacco of the tobacco column 12. The result is that upon initial ignition of the tobacco column 12 at the front end 28, air drawn into the tube 22 through the tube inlet end 26 passes through the smoldering tobacco coal to induce air flow which aids lighting the smoking device. FIG. 4 illustrates a somewhat different embodiment of the smoking device, generally denoted as the numeral 310, of the present invention which is identical to the smoking device 210 in most respects. The only difference between the smoking device 310 and the smoking device 210 is that in the smoking device 310 the outlet end 24 of the tube 22 terminates a distance of 1-5 mm short of the outlet end 20 of the tobacco column 12 in addition to the tube inlet end 26 of the tube 22 terminating a distance of 1-5 mm short of the front end 28 of the tobacco column 12. FIG. 5 illustrates yet another embodiment of the smoking device, generally denoted as the numeral 410, of the present invention which is identical to the smoking device 10 in most respects. For the sake of brevity of the description, the identical features are identified by identical numerals and their description will not be repeated. In the smoking device 410, the hollow cylindrical mouthpiece of the smoking device 10 has been replaced by a filter mouthpiece 416 fabricated of, for example, fibrous cellulose acetate. Also, in the smoking device 410, the tube 22 extends completely through the filter mouthpiece 416 so that the tube outlet end 24 is open to the outlet end 417 of the filter mouthpiece 416. With the use of a filter mouthpiece 416, the seal 32 can be created by treating the filter material of the filter mouthpiece 416 at the interface with the tobacco column 12 with a material which will close the pores or openings of the filter mouthpiece. FIG. 6 illustrates yet a further embodiment of the smoking device, generally denoted as the numeral 510, of the present invention which is virtually identical to the smoking device 410. For the sake of brevity of the description, the identical features are identified by identical numerals and their description will not be repeated. The only difference between the smoking device 510 and the smoking device 410 is that in the smoking device 510, the outlet end 24 of the tube 22 terminates a distance short of the outlet end 417 of the filter mouthpiece 416. That is, the tube outlet end 24 is spaced a distance from the filter mouthpiece outlet end 417 inside the filter mouthpiece 416 such that the tube outlet end 24 is covered by filter material of the filter mouthpiece 416. FIG. 7 illustrates a still further embodiment of the smoking device, generally devoted as the numeral 610, of the present invention which is also substantially identical to the smoking article 410. For the sake of brevity of the description, the identical features are designated by identical numerals and, therefore, their description will not be repeated. The difference between the smoking device 610 and the smoking device 410 is that in the smoking device 610 the inlet end 26 of the tube 22 terminates a distance short of the front end 28 of the tobacco column 12. That is, the tube inlet end 26 is spaced a distance from the tobacco column front end 28 inside the tobacco column 12 such that the tube inlet end 26 is initially covered or closed by tobacco of the tobacco column 12. Turning now to FIG. 8, there is shown yet another embodiment of the smoking device, generally denoted as the numeral 710, of the present invention which is also similar to the smoking device 410 in most respects. Therefore, for the sake of brevity of the description, identical features are denoted by identical numerals and their description will not be repeated. The differences between the smoking device 710 and the smoking device 410 are that in the smoking device 710, the outlet end 24 of the tube 22 terminates a distance short of the outlet end 417 of the filter mouthpiece 416, and the inlet end 26 of the tube 22 terminates a distance short of the front end 28 of the tobacco column 12. Therefore, the tube outlet end 24 is spaced a distance from the filter mouthpiece outlet end 417 inside the filter mouthpiece 416 such that the tube outlet end 24 is covered or closed by filter material of the filter mouthpiece 416, and also the tube inlet end 26 is spaced a distance from the tobacco column front end 28 inside the tobacco column 12 such that the tube inlet end 26 is initially covered or closed by tobacco of the tobacco column 12. The foregoing detailed description is given primarily for clearness of understanding and no unnecessary limitations are to be understood therefrom for modifications will become obvious to those skilled in the art upon reading this disclosure and may be made without departing from the spirit of the invention and scope of the appended claims.

Summary: A smoking device includes a tobacco column having a wrapper and either a mouthpiece or filter rod located coaxially at one end of the tobacco column. A rigid tube is concentrically located in the tobacco column. A substrate of porous material is located within the tube. A flavor releasing material and an aerosol generating material are also disposed within the tube. A smoke impermeable seal is located at the interface of the tobacco column and the mouthpiece/filter.

big_patent

en

Summarize: Story highlights "It feels good to feel Mother Earth beneath my feet," Louis Taylor says The Pioneer Hotel in Tucson, Arizona, caught fire in 1970, killing 29 Taylor, then 16, was quickly arrested and convicted of arson Modern experts have called the evidence into question What is it like to be thrown behind bars when you're 16 and told you'll languish there for the rest of your life, all for a crime you adamantly maintain you didn't commit? Louis Taylor knows. He was convicted of arson in a fire that killed 29 people. But forensic experts now say they can no longer determine whether someone set the hotel fire on that cool winter day in 1970. And on Tuesday, in a Tucson, Arizona, courtroom, he pleaded no contest to the charges in a new hearing and was sentenced to time served -- almost 43 years. Taylor, now 59 with a shaved head, stood quietly during Tuesday's proceedings. But the son of one of the victims of the disastrous blaze at the Pioneer Hotel left him with a warning. "I harbor no feelings of ill will or vengeance against you, for my father is now gone and nothing can ever be done to change that fact," Paul D'hedouville II said. "Do as you choose, Mr. Taylor, but choose wisely and do not waste your new beginning at life. The eyes of this courtroom and those beyond these walls, in mind and spirit, will be watching you." Taylor spoke briefly to reporters after he traded his orange prison garb for a T-shirt and slacks and walked out of prison, saying, "It feels good to feel Mother Earth beneath my feet -- free Mother Earth." "It's a tale of two tragedies -- the Pioneer Hotel fire, and me getting convicted for it," he said. A vintage landmark burns The Pioneer Hotel, built in 1929, was renowned for its gracious ballroom. At 11 floors, it was a protruding gem in downtown Tucson's skyline at the time. On December 20, 1970, the vintage hotel was filled with guests, and hundreds more were reveling in holiday cheer at a corporate Christmas party. Just after midnight, a blaze broke out. The landmark building's firefighting measures were badly out of date, and the Pioneer quickly transformed into an inferno. A morbid spectacle of human tragedy unfolded. Twenty-eight people died from smoke inhalation, burns, or, in some cases, when they jumped out of windows to escape. The fire wiped out whole families. Jake Crellin was the first journalist on the scene. "I still have flashbacks from time to time from some of the stuff I saw, flashbacks of people jumping out of windows to their death," said the former news director of CNN affiliate KVOA He avoided looking at the scene with the naked eye, gazing instead through the viewfinder of a camera. "It helped make it a little easier to watch," he told the affiliate. A crowd of bystanders gathered and looked on in horror. Some hotel guests were able to knot bed sheets together to make ropes and rappel to safety. It was one of the deadliest tragedies in Tucson's history. A quick arrest Within hours, police arrested a teenage boy, court documents said. It was Louis Taylor, who had been inside the hotel. He wasn't a guest and did not work there. And he had books of matches in his pocket. During police interrogations, the juvenile claimed to have seen someone set the fire. This was before anyone had suspected arson. But the young man changed his story multiple times. It made officers suspicious: Maybe it was arson; maybe it was Taylor who started the fire. Criminal witnesses Journalist Crellin and KVOA kept up with the case. Taylor told him that "he had some very tough interviews with the police." He was innocent, he said, a stance he has always maintained. In an interview on the 25th anniversary of the fire, he told the broadcaster that the fire never goes out of his head. "I think about it all the time, because I know in my heart and God knows that they got the wrong person. I was at the wrong place at the wrong time." Prosecutors called two witnesses who were in juvenile detention with Taylor. They told the court that Taylor confessed to the crime to them behind bars. Later, one of the boys said he had been coerced into his testimony and that it was false, according to court documents. Experts for the prosecution and the defense testified that the fire, in their opinion, was caused by arson, though the details of their explanations differed. In the end, Taylor was convicted of 28 counts of felony murder. Judge Charles Hardy, who presided over the case, told Taylor that he didn't believe he meant to hurt anyone. But the punishment was stiff: "the rest of his natural life in prison," a sentence that at the time did not officially exist in the state of Arizona, a court document said. In hindsight Decades later, people involved in the conviction and sentencing began to feel bad about the case. The CBS investigative magazine "60 Minutes" took up the case. The judge told the program that, looking back, he would not have voted to convict. The evidence, he said, was not strong enough. And if the then-teenager did set the fire, it was not Taylor's fault that the hotel was poorly suited to deal with any kind of fire. Lawyers from the Arizona Justice Project got involved. The non-profit reviews cases it feels don't live up to just legal standards. "It is our mission to help assure that Arizona's prisons are not housing those actually innocent of crime or otherwise victims of manifest injustice," reads the mission statement on its website. The lawyers encouraged the state to review the arson testimony in the original trial based on modern methods. Two review committees determined that there is no longer enough evidence available to tell whether arson was in play. They said that the experts in the original trial "used methods no longer valid in the science of today." One of the original trial experts, Cy Holmes, still a fire investigator four decades later, still stands by his testimony today, a court memorandum filed Monday said. But his testimony can't pin it on Taylor. Arizona's Pioneer Hotel fire re-examined Steve Kroft revisits the case of Louis Taylor, who may have been falsely accused and imprisoned for decades for setting a hotel fire in Tucson that killed 28. A man whose murder conviction in a 1970 Arizona hotel fire that killed 29 people was called into question has entered a plea, clearing the way for his freedom. FILE - In a Dec. 20, 1970 file photo Tucson, Ariz., firefighters apply a steady stream of water during the Pioneer International Hotel fire, that resulted in 29 deaths. Louis Cuen Taylor who has... (Associated Press) The plea deal Tuesday marks a stunning reversal for an inmate who was just 16 years old when he was arrested in the fire. Louis Taylor has been behind bars ever since and will leave prison at the age of 59. Taylor has since spent more than four decades in prison, consistently maintaining his innocence after being sentenced to 28 consecutive life terms in the December 1970 fire at the Pioneer Hotel in Tucson. Taylor, who is black, contends he was wrongly convicted by an all-white jury after he says police failed to investigate other suspects.

Summary: Louis Taylor is about to leave prison for the first time since he was 16 years old, after spending almost 43 years in prison for an arson that he has always claimed he never committed-and which experts now say might not have even been arson at all. Taylor was convicted for a 1970 blaze that killed 28 people and destroyed a historic hotel in Tucson. The then-teenager was in the hotel, even though he wasn't a guest, and had a matchbook in his pocket. He told police during what he recalled as "very tough" interrogations that he'd seen someone else start the fire, CNN recounts. Taylor was sentenced to life in prison. But the judge has long expressed skepticism about the case, telling 60 Minutes recently that the evidence wasn't strong enough to convict-he's even sent Taylor Christmas gifts and law books, the AP reports. Forensic experts, meanwhile, have said that the original trial's experts "used methods no longer valid in the science of today" to declare the blaze as arson. "Today, all that media scrutiny finally resulted in action, as Taylor entered a plea of no contest, in a deal that will see him released from prison at last.

multi_news

en

Summarize: Smiths Falls, Ontario (CNN) Joshua Boyle said the gravity of the situation his family survived is starting to sink in. Now that he, his wife, Caitlan Coleman, and their three children are safe, he's beginning to realize the impact five years in captivity had on his family. "We're pretty broken and we didn't expect this," Boyle told CNN's Paula Newton on Sunday. Boyle and Coleman were kidnapped in Afghanistan by terrorists from the Taliban-affiliated Haqqani network in 2012. Coleman was pregnant at the time of their kidnapping, and all their children were born in captivity. They were freed Thursday in a mission that Pakistani forces carried out based on intelligence from US authorities. Boyle said there was a firefight between his terrorist captors and Pakistani rescuers. While the bullets were flying, Boyle realized his middle child had never seen daylight, he said. JUST WATCHED American-Canadian family freed from captivity Replay More Videos... MUST WATCH American-Canadian family freed from captivity 01:03 "It was the first time in his life he saw the sun. He doesn't know there's a sun in the world," Boyle said. Boyle said he and Coleman "spent five years telling ourselves that it's all going to be OK, because as soon we we get out of here...as soon as we get back to our families, we're going to be so happy." "The big surprise we didn't see coming is that's not the case, because we're both pretty distressed. Not because of our own trauma, because we didn't realize that our family was this broken," Boyle said. When the family returned to Canada Friday, Boyle told reporters their captors raped his wife and authorized "the killing of my infant daughter." Boyle did not say whether the militants actually killed a child. Sources close to the family said Boyle alluded to at least one forced abortion while in captivity. His captors' actions were in retaliation for his "repeated refusal to accept an offer" from them, he said, without providing details on what the offer was. Boyle told CNN he's not ready to talk about that part of the experience. JUST WATCHED Freed hostage: Taliban killed baby, raped wife Replay More Videos... MUST WATCH Freed hostage: Taliban killed baby, raped wife 01:45 "We would really just ask the public to respect our grief right now and be sensitive and patient," he said. In a Friday interview, Boyle said he and Coleman were in Afghanistan "helping the most neglected minority group in the world, those ordinary villagers that live deep inside Taliban-controlled Afghanistan, where no NGO, no aid worker and no government has ever successfully been able to bring the necessary help." When talking to CNN, Boyle didn't dispute reports they were also there as tourists, saying, "Nothing is black and white of why you go somewhere." Boyle acknowledges he knew it was a dangerous trip, but the couple chose to go anyway. "The fact that something is dangerous, for some people that's the end of the deal....That's not really how I look at the world," Boyle said. The couple wanted to go somewhere where they could be useful, "and provide the most support and compassion...to suffering people," Boyle said. "We prayed about it. And we made the decision that it's worth the risk." Pakistani officials have said that the family was freed in northwestern tribal areas of the country after their forces acted on intelligence provided to them by the United States. At a news conference, Maj. Gen. Asif Ghafoor, the spokesman for the Pakistani military, said its forces had managed to trace the vehicle carrying the hostages within five hours of a tip from the United States, and had rescued the hostages after blowing out the vehicle’s tires. The captors “fled on foot,” he said. Mr. Boyle, in a video message posted by the Pakistani military soon after their freedom, effusively thanked the Pakistani military for a “tremendously professional operation,” and said the military and intelligence forces “got between the car and the criminals to make sure the prisoners were safe and that my family was safe.” American officials have expressed gratitude to Pakistan for the release, and President Trump called it “a positive moment” in the countries’ relationship. The release came as pressure by the Trump administration seemed to be mounting on Pakistan for its ties to the Afghan insurgency. American officials have said repercussions could be severe if Pakistan failed to curtail its support for the Afghan insurgency, and in particular, continue to allow a haven for its leaders, including the Haqqanis. But Afghan officials in Kabul viewed the hostage release as an old Pakistani trick of offering the United States a concession each time the pressure builds. A senior Afghan official said that two and a half years ago, its intelligence service had concluded that the family had been moved across the border into Pakistan, and that the information had been shared with the Americans. In recent years, the Haqqani network has become increasingly integrated with the mainstream Taliban. The network’s leader, Sirajuddin Haqqani, serves as the Taliban’s deputy supreme leader and has played an important role in the insurgency’s military victories. SMITHS FALLS, ONT.—During his years as a hostage, 4-year-old Jonah Boyle was terrified to close his eyes. This wasn’t just the protest of a child who didn’t want to nap or go to bed. “Even if you tried to play peekaboo with him, he would scream, he would panic,” said his father, Joshua Boyle. Linda Boyle kisses her granddaughter, Grace. She and her two brothers, Jonah and Noah, the children of freed hostages Joshua Boyle and Caitlan Coleman, have known no life other than what they experienced at the hands of their kidnappers. ( Steve Russell / Toronto Star ) Patrick Boyle holds his granddaughter, Grace. Her parents, Caitlan Coleman and Joshua Boyle, were kidnapped in Afghanistan in 2012 and all three of their children were born in captivity. ( Steve Russell / Toronto Star ) The fear began one evening when the kidnappers transferred Jonah, his younger brother, Noah, and their parents from one prison to another. The boys were asleep, and the guards forced Boyle and his wife, Caitlan Coleman, to leave their sons and get into the car first. Jonah was also asleep until the kidnappers returned. “A bunch of masked men with Kalashnikovs then came into the room — their mother and father aren’t there — and start picking them up and say, ‘Come on, come on, we go in the car,’ pulling him to some place he doesn’t know.” Boyle told this story Saturday not to recount the horror his son endured — but to highlight his recovery. Article Continued Below Jonah Boyle, 4, looks out from behind a door in his grandparents' home. Jonah had trouble getting to sleep on his first day in Canada because he was so excited to be free, said his father, Joshua. ( Steve Russell/Toronto Star ) “Last night he wouldn’t close his eyes because he was so excited and he just wanted to sit on his pile of toys with a gigantic smile on his face,” Boyle said. “It took him about three hours to fall asleep, and it wasn’t three hours of panic. It was three hours where he just wanted to really, really cherish this gigantic rabbit and these plastic Lego blocks and these toys, and he wanted to sit there and bask in being ‘no bandi’ after all of this time.” “Bandi” is what the kidnappers called their hostages. Coleman and Boyle would tell their sons hundreds of stories about how life would be once they were free, even as they sometimes lost hope that they ever would be. Boyle spoke to the Star on Saturday from his parents’ home in a wide-ranging interview — the first since the couple, their sons and a newborn daughter, Grace, were freed in a dramatic rescue by Pakistani forces three days earlier. Read more: Joshua Boyle demands justice from Afghan government after returning to Canada Article Continued Below Details about the rescue are still unconfirmed, but Boyle said all five family members were in the trunk of a vehicle to be transferred to another location when shots were fired. Some of the kidnappers were killed and others fled. On Saturday he described some of their darkest moments while being held hostage: cells that were no bigger than a bathtub, or underground; his wife’s rape and forced abortion; the daily cruelty of the kidnappers. And then there was the devastating boredom during five years spent almost entirely without books, newspapers or movies — allowed only a slate and a piece of chalk. Boyle said that when they once asked for something to read or anything to relieve the tedium, the kidnappers returned with a pile of dirty dishes to wash. They didn’t know Justin Trudeau was Canada’s prime minister until after they were rescued. One of the captors told Boyle the new U.S. president was Donald Trump before he was forced to make a “proof-of-life” video. “It didn’t enter my mind that he was being serious,” he said. Joshua Boyle and his son, Jonah, play in the garden at his parents house in Smiths Falls, Ont., Saturday. ( Lars Hagberg/The Canadian Press ) But outside Boyle’s father’s office where we spoke Saturday, there was little evidence of what his children had been through as they enjoyed their first full day of freedom in Canada. Jonah was fascinated by flushing the toilet, and had dirty pants and bare feet from digging in the vegetable garden. Noah, 2, played with wooden trains with his mother and aunt Heather. Boyle’s mother, Linda, found the best position to soothe her months-old granddaughter, Grace, was snug against her side, cradled like a football. Candy wrappers littered the floor; tables were covered by colouring books, bouquets of flowers, a cake from Pakistan’s high commissioner. A Welcome Home banner hung over the dining room windows. The library looked as though a hurricane of toys and children’s clothes had touched down. Boyle said he knows there will be many more questions about the family’s captivity and rescue, and he plans to address them in coming days, already fielding an inbox full of emails from media outlets around the world. Coleman, on the other hand, wants to stay quiet for now and declined to be interviewed. When the young family arrived back in Canada on Friday night at Toronto’s Pearson airport, Boyle’s statement to journalists prompted more questions than answers. He spoke of the murder of his daughter, “martyr” Boyle, which some news outlets reported as the killing of a newborn named Margaret. He called for justice for his captors, whom he wanted the Taliban to punish, or for them to be brought before the International Criminal Court. Coleman, 31, and Boyle, 34, were kidnapped in Afghanistan in October 2012 during a backpacking trip through Central Asia. On Friday, Boyle said they travelled to the country as “pilgrims” to help people in need in a Taliban-controlled region. Patrick and Linda Boyle's home in Smiths Falls, Ont., is finally filled with toys, books, games and the sound of children. The couple welcomed their son Joshua Boyle, his wife Caitlan Coleman and their three children, Jonah, Noah and Grace, who were recently rescued from a five-year hostage nightmare. ( Steve Russell/Toronto Star ) His comment led to speculation about the couple’s intent, with some noting Boyle’s previous brief marriage to Zaynab Khadr, the daughter of Egyptian-born Canadian Ahmed Said Khadr, who had been suspected of financing Al Qaeda before he was killed by Pakistani forces in 2003. Boyle said on Saturday that he had read U.S. media reports that questioned why he and Coleman were in Afghanistan. “I’m a harmless hippie and I do not kill even mice,” Boyle said. “I’ve been vegetarian for 17 years. Anybody who knows me would laugh at the notion that I went with designs on becoming a combatant.” When the Haqqani network kidnapped Boyle, Coleman was five months pregnant. All three of the couple’s children were born in captivity, and they kept Coleman’s second pregnancy a secret, surprising the captors when Noah was delivered. The Afghanistan-based Haqqani network are skilled kidnappers who often hold hostages for years as they negotiate lucrative financial deals or the release of prisoners. But holding women or children is rare for the group — and among the many attempts to free the family over the years was an appeal to respect Pashtunwali, a sacred code of honour in the region among Pashtuns. “Those who are Haqqani are different,” Boyle said Saturday, growing angrier as he spoke of the kidnappers. “These are people who have no relationships in life that are not purely mercenary. They have no real friends, only cohorts. They have no wives, children. Those we met who were not orphans spoke of hating their parents.” He said the captors showed no mercy — to any of them. Of the three children, it is the middle boy, Noah, who appears to be suffering the most from the ordeal. At least a quarter of his days are spent crying and screaming, Boyle said. Noah Boyle sleeps on a sofa with his aunt, Heather Boyle, close by. Joshua Boyle says he and his wife, Caitlan Coleman, told their sons hundreds of stories about how life would change once they were set free. ( STEVE RUSSELL/TORONTO STAR ) “He’s not having a temper tantrum; it’s that he saw the colour of orange and orange scares him, or that he saw a screwdriver and screwdrivers scare him. Boots scare him,” he said. Security and police are stationed outside the Boyle house. When they came to the door Saturday, the toddler panicked. “He’s not scared of them specifically; he’s scared of the boots,” said Boyle. “Because the only people he has seen wear boots are people who are coming in to kick you.” Read more about:

Summary: After five years in captivity, freedom is a lot harder than Joshua Boyle expected. The Canadian man tells CNN he and his American wife, Caitlan Coleman, and their three children are suffering. "We're pretty broken and we didn't expect this," he says. After arriving in Toronto Friday night, the family spent a rocky weekend trying to adjust. Boyle, 34, says he and Coleman, 31, endured their confinement by "telling ourselves that it's all going to be OK, because as soon [as] we get out of here... we're going to be so happy. The big surprise we didn't see coming is that's not the case, because we're both pretty distressed... we didn't realize that our family was this broken." Their middle child, Noah, 2, is having the roughest time, per the Star. Despite toys strewn around Boyle's parents' Ontario home and doting family members to play with, the toddler frequently cries and screams. "He's not having a temper tantrum," Boyle says. The boy is scared of everyday objects, and the color orange. He panicked when police showed up wearing boots, "because the only people he has seen wear boots are people who are coming in to kick you," Boyle says. Meanwhile, the Taliban denies Boyle's claims Haqqani kidnappers raped Coleman and killed their infant daughter, per the New York Times. The child died during a miscarriage, a rep says, and Coleman was never separated from her husband, not "even for a few minutes-and the reason for that was to avoid any suspicions."

multi_news

en

Summarize: FIELD OF THE INVENTION [0001] This invention relates to the administration of vaccines and other pharmaceuticals, and, in particular embodiments, to vaccines and other pharmaceuticals that are administered into or below the layers of the skin. BACKGROUND OF THE INVENTION [0002] The ability to properly administer vaccines and other pharmaceuticals is a critical component of modern healthcare. Children commonly receive an array of vaccinations, beginning at birth and continuing through adolescence. These inoculations generally include Hepatitis B (“Hep-B”), Diphtheria/Tetanus/Pertussis (“DTP”), Haemophilus influenzae type b (“Hib”), Polio (“IPV”), Pneumococcal conjugate (“PCV7”), Measles/Mumps/Rubella (“MMR”) and Varicella (or “Chickenpox”). Vaccinations for Hepatitis A (“Hep-A”), Influenza, Lyme Disease and/or Pneumococcal Polysaccharide may also be administered in particular instances. Moreover, because some vaccines have only a limited period of efficacy, they must be administered to individuals on a periodic basis to ensure resistance to infection; with certain vaccines, so-called “booster shots” are required. By way of example, the influenza vaccine, or “flu shot,” is routinely administered to adults on an annual basis at the beginning of the flu season in autumn. “Booster” Tetanus shots are recommended every ten years following the primary series of vaccinations that are administered during infancy, and upon an as-needed basis in response to cuts or puncture wounds in certain circumstances. [0003] Most vaccines are administered by conventional needle injection. The depth of injection and corresponding configuration of the needle or needles required is different for various vaccines, yet the devices utilized (e.g., syringes, and in some instances, needle-less injectors) are relatively simple and may be easily operated by healthcare professionals. However, there are a host of vaccines and other pharmaceuticals (including many currently in the development pipeline at pharmaceutical companies around the world) whose conventional means of administration is significantly more complex, requiring skill, dexterity and careful attention to detail. By way of example, the Vaccinia (i.e., “Smallpox”) vaccine is among the vaccines in this category. [0004] The Smallpox vaccine is generally administered into the skin over the insertion of the deltoid muscle or the posterior aspect of the arm over the triceps muscle. A multiple-puncture technique uses a pre-sterilized, bifurcated needle (such as those commercially available from Becton, Dickinson and Company; Franklin Lakes, N.J.) that is inserted vertically into a vaccine vial, causing a droplet of vaccine to adhere between the prongs of the needle. The droplet contains the recommended dosage of vaccine, and its presence within the prongs of the bifurcated needle is confirmed visually. Holding the bifurcated needle perpendicular to the skin, approximately fifteen punctures are rapidly made with strokes vigorous enough to allow a trace of blood to appear after 15-20 seconds. These punctures are made in an area no larger than 5 mm in diameter. Any vaccine remaining on the skin is wiped off with dry sterile gauze, and the gauze is disposed of in a biohazard waste container. [0005] Some vaccines have never been administered to a large population, generally because they are still in an experimental phase (e.g., an HIV/AIDS vaccine). Others have not been administered for many years. For example, the Smallpox vaccine described above was last administered on a large-scale basis in the late 1970&#39;s. The disease was officially declared eradicated by the World Health Organization on May 8, 1980, and vaccination programs were terminated. Now, more than twenty years later, a significant portion of the world population has not been immunized, and may rapidly fall victim to a mass epidemic should an outbreak occur. Moreover, diseases such as Smallpox tend to spread quickly. Some of these diseases do not require skin-to-skin contact for infection. They can be airborne or be transmitted by other pathological means, such as by nosocomial transmission (i.e., the spread of a disease through a health care setting, such as a clinic or hospital, as is often the case with Ebola hemorrhagic fever (“Ebola HF”) in African health care facilities). [0006] Particularly during a time when the potential for outbreak of infectious disease is high, there is a need in the art for a simple medical device to administer vaccines and other pharmaceuticals, such as the Smallpox vaccine, an AIDS/HIV vaccine or any number of other products. Such a device would provide healthcare professionals with an important tool to use in administering vaccinations and inoculations in a fast, safe and simple manner. Moreover, since non-healthcare professionals may also bear responsibility for vaccinating a population of individuals in an emergency situation, the need for a device that accomplishes these goals is now imperative. SUMMARY OF THE DISCLOSURE [0007] In one embodiment of the present invention, a vaccine/pharmaceutical administration device includes a group of lancets encased in a housing. The group of lancets may be affixed to a lancet base that is biased between two springs: an injection spring and a safety spring. The injection spring provides the necessary force to drive the group of lancets out of the injection end of the device and into or through the skin of a vaccination recipient, while the safety spring subsequently recoils the group of lancets back into the housing following vaccine/pharmaceutical administration. Thus, during operation, the group of lancets is exposed from the interior of the device housing only during the vaccination or inoculation. However, in alternate embodiments of the invention, the group of lancets may be exposed from the interior of the housing to deposit a vaccine or other pharmaceutical on the sharp tips of the lancets. The device may be actuated by a pushbutton trigger that fractures a set of shear pins in mechanical communication with the lancet base. Non-slip finger rests may additionally be included on the housing to enhance stability and for further ease of use. [0008] In another embodiment, the vaccination device may be prepackaged with a vaccine or other pharmaceutical, or a component of the final pharmacological product that incorporates a vaccine or pharmaceutical. Different vaccine and pharmaceutical packaging arrangements may be used in connection with various embodiments of the invention to achieve, for example, optimal drug storage conditions and to enable the use of a range of vaccine and other pharmaceutical formulations (e.g., multiple-component products, viscous formulations, etc.). [0009] In a further embodiment of the present invention, a method of administering an injection or vaccine inoculation includes selecting an administration site, and deploying an injection with the aforementioned device. Prior to administering the vaccine or pharmaceutical product, a cap may be removed from the injection end of the device. The device may thereafter be actuated with the pushbutton trigger. [0010] In a still further embodiment of the present invention, a method for manufacturing the aforementioned device includes an assembly process, which, in particular embodiments may include an inline manufacturing procedure. The housing is provided, and the safety spring, lancet base, injection spring and pushbutton trigger are placed into the housing. Shear pins may be included to mechanically stabilize the lancet base. A finger support may be secured to the housing; in various embodiments, by a rotational locking mechanism. Securing the finger support may compress the injection spring such that an application of force to the pushbutton trigger that breaks the shear pins releases the tension in the injection spring to drive the lancets out of the injection end of the housing. The safety spring thereafter provides sufficient force to recoil the lancets back into the housing. BRIEF DESCRIPTION OF THE DRAWINGS [0011] FIG. 1 a depicts a cross-sectional view of an injection device in accordance with an embodiment of the present invention. FIG. 1 b depicts an elevational view of the injection device from the actuation end thereof, and FIG. 1 c depicts an elevational view of the same injection device from the injection end thereof. [0012] FIG. 2 depicts a partial cross-sectional view of an injection end of an injection device with a cap in accordance with an embodiment of the present invention. A soft matrix material is illustratively included between the cap and the group of lancets included in the device. [0013] FIG. 3 depicts a cross-sectional view of a finger support with two finger rests in accordance with an embodiment of the present invention. The finger support illustratively depicted therein includes a locking channel. [0014] FIG. 4 a depicts a cross-sectional view of a housing in accordance with an embodiment of the present invention. The housing illustratively includes a series of grooves therein, as well as a locking tab. FIGS. 4 b and 4 c depict elevational views of the housing from the injection end and actuation end thereof, respectively. [0015] FIG. 5 a depicts an elevational view of a lancet base in accordance with an embodiment of the present invention. The lancet base illustratively includes a group of lancets. It further illustratively includes a series of guides configured about its axial circumference. FIGS. 5 b and 5 c depict elevational views of the lancet base from the injection end and actuation end thereof, respectively. DETAILED DESCRIPTION OF THE INVENTION [0016] The present invention is based on a device that may be used to administer a vaccine or another pharmaceutical or injectate. It is particularly well suited for use with mammals in the treatment and prevention of human disease or in veterinary applications. The device may be particularly advantageous for the administration of vaccines and other pharmaceutical products that are delivered through the superficial epidermis; although, in alternate embodiments, the device may be used for the administration of vaccines and other pharmaceutical products at a variant delivery depth, such as intradermally, subdermally, subcutaneously or intramuscularly. [0017] By way of example, Smallpox vaccine may be administered with the apparatus and methods of the present invention. Further, as it is believed that Smallpox vaccine may be effective in the treatment or prevention of diseases other than Smallpox (e.g., Monkeypox), references herein to “Smallpox vaccine” or “Smallpox vaccination” shall be understood as being applicable to the treatment and prevention of these other disease conditions, as well. However, Smallpox vaccine is merely one example of a product that is suitable for use in connection with the device and methods of the present invention. [0018] Numerous other products may be used in alternate embodiments, including, but in no way limited to, HIV/AIDS vaccines, Hep-B vaccines, DTP vaccines, Hib vaccines, IPV vaccines, PCV7, MMR vaccines and Chickenpox vaccines. Vaccinations for Hep-A, Influenza, Lyme Disease and Tetanus (both the primary vaccination series and booster shots), as well as Pneumococcal Polysaccharide are still further examples of vaccines and other products that may be administered with various embodiments of the invention. [0019] The device and methods of the present invention are uniquely well suited to the mass vaccination of a population in the event of an epidemic or biological warfare. Thus, by way of example, the Anthrax vaccine may be administered with the device and methods of the present invention. Anthrax vaccine is conventionally administered in a series of three primary, subcutaneous injections at 0, 2 and 4 weeks, and three booster vaccinations at 6, 12 and 18 months; the vaccine manufacturer (BioPort Corporation; Lansing, Mich.) recommends annual booster shots after the primary series and initial set of booster vaccinations. Intramuscular versions of this vaccine are presently being studied, which may also be suitable for use with the device of the present invention, as well as other formulations that may be developed for variant delivery depths. Additionally, an outbreak of tularemia may be addressed with the device and methods of the present invention. Tularemia may be spread through the bite of an infected insect or other arthropod (usually a tick or deerfly), by handling infected animal carcasses, by eating or drinking contaminated food or water, or by inhaling the bacterium Francisella tularensis. While no vaccine is presently available in the United States for tularemia, one is currently under review by the U.S. Food and Drug Administration. Other diseases commonly spread through bacterial infection, such as bacterial meningitis and Ebola HF, are still further examples of applications for the present invention. A vaccine for Ebola HF has yet to be developed, but the disease still represents a good example of the type of medical condition that may benefit from the device of the present invention; particularly, because the individuals responsible for performing a mass inoculation once a vaccine is developed are not likely to all be trained physicians. [0020] In sum, as will be readily appreciated by one of skill in the art, there are a host of diseases and pathological conditions that may be addressed with the device and methods of the present invention, whether those diseases and conditions relate to a mass epidemic, to biological terrorism or by the more mundane transmission of illness in a human or animal population, and whether the vaccines and pharmaceutical products are presently available, under development or yet to be identified. In fact, the device and methods of the present invention may be used in connection with still further applications, such as veterinary practice (e.g., to vaccinate cattle). [0021] As illustratively depicted in FIG. 1, the device 100 includes a housing 101 with an injection end and an actuation end. The injection end may include an opening 111 through which a group of lancets 103 is exposed during the administration of a vaccination or injection of a pharmaceutical product. The group of lancets 103 may include any number of lancets (even just a single lancet), depending upon the particular delivery parameters of the vaccine or other pharmaceutical product being injected with the device 100. Further, the actuation end of the device 100 may include a pushbutton trigger 106 that a user may operate to actuate the device 100. The pushbutton trigger 106 may include a non-slip surface 117. [0022] The housing 101 may also include finger rests 107 for ease of device operation. The finger rests 107 may be disposed upon a finger support 118 that is attached to the device housing 101. These finger rests 107 may include non-slip surfaces 116, and may impart device stability by providing a grip that readily conforms to the fingers of a user. They also provide a surface against which to squeeze in order for a user to create the force required against the pushbutton trigger 106 for device actuation. In the embodiment depicted in FIGS. 1 and 3, there are two such finger rests 107 disposed at 180° opposite one another along the exterior, axial length of the housing 101. Other configurations of finger rests 107 may be included in the device 100, as well. [0023] The housing 101 may be configured to any suitable size and scale, depending on a variety of factors, such as, but in no way limited to, the delivery parameters of the vaccine or pharmaceutical product, manufacturing requirements for the device and the ease of operation and manual handling by a user. In embodiments of the device 100 configured for the administration of a Smallpox vaccine, the housing 101 may be less than about five inches in overall length; more preferably, less than about two inches in overall length. It will be readily understood, however, that housings of alternate lengths (for Smallpox vaccine or otherwise) remain within the ambit of the present invention, and may even be more desirable than the relatively short housing length described above in particular instances (e.g., to accommodate different gripping techniques employed by device users or to configure the devices for particular storage and shipping parameters). [0024] The device 100 may further include a group of lancets 103, each having a sharp tip. The group of lancets 103 may be affixed to a lancet base 104 that is free to move axially within the device housing 101. In an embodiment of the present invention for the administration of Smallpox vaccine, there may be from about thirty to about forty lancets included in the group of lancets 103, although a variant number of lancets may be included in particular instances (e.g., to properly deliver a more or less concentrated version of a Smallpox vaccine that requires greater or fewer skin punctures, respectively, and to accommodate the particular delivery parameters of the wide variety of products that may be administered with the device 100 ). For example, in various embodiments of the invention, the group of lancets 103 may include one lancet, five lancets, ten lancets, twenty lancets or any number of lancets therebetween or greater. Any configuration of the group of lancets 103 in the lancet base 104 may be utilized. In one embodiment, the individual lancets are arranged approximately equidistant from one another throughout the surface area of the lancet base 104 nearest the injection end of the housing 101. Alternatively, the individual lancets may be arranged in a symmetrical pattern throughout the surface area of the lancet base 104 nearest the injection end of the housing 101. Other lancet arrangements may be used, as well. In one embodiment of the device 100 that is particularly well suited to administration of a Smallpox vaccine, there are approximately 36 lancets grouped approximately uniformly in the lancet base 104. [0025] The lancet base 104 may additionally include guides 113 configured about its axial circumference. In one embodiment, these guides 113 communicate with corresponding grooves 112 in the interior surface of the housing 101. However, in alternate embodiments, no such grooves 112 are included in the housing 101. The guides 113 (whether or not corresponding grooves 112 are included) may provide axial stability during device use, while reducing the frictional force imparted by the internal axial surface of the housing 101 as the lancet base 104 slides through the housing 101. The lancet base 104 illustratively depicted in FIGS. 1 and 5 includes four guides 113 configured at 0°, 90°, 180° and 270° about the axis of the lancet base 104. Alternate guide configurations may be employed, as well. Additionally, the lancet base 104 may be in direct mechanical communication with the pushbutton trigger 106. [0026] The lancet base 104 may be biased between two springs: an injection spring 102 and a safety spring 105. The injection spring 102 provides the necessary force to drive the group of lancets 103 out of the opening 111 in the injection end of the device 100 and force the sharp tips into and/or through the skin of a recipient. The safety spring 105 subsequently recoils the group of lancets 103 back into the housing 101. In this fashion, the group of lancets 103 is exposed from the interior of the housing 101 only during the administration of a vaccination or injection of another pharmaceutical product. In alternate embodiments, the device 100 may be configured such that the group of lancets 103 may be exposed from the interior of the housing 101 to deposit the vaccine on their sharp tips prior to device use. The injection spring 102 may be configured between the lancet base 104 and the pushbutton trigger 106 ; a portion of the lancet base 104 may reside within the injection spring 102. The safety spring 105 is configured between the lancet base 104 and the injection end of the housing 101 ; the group of lancets 103 and a portion of the lancet base 104 may reside within the safety spring 105. [0027] The lancet base 104 may be held in position with respect to the device housing 101 prior to actuation by shear pins 108. Any suitable number of shear pins 108 may be used in connection with various embodiments of the present invention, and they may be arranged in any desirable configuration, such as symmetrically about the longitudinal axis of the device 100. In one embodiment, two shear pins 108 are included and are disposed 180° opposite one another. The shear pins 108 are each attached on one end to the lancet base 104. On their opposing end, each shear pin 108 is in contact with the device housing 101. In one embodiment of the present invention, as depicted in FIG. 1, the ends of the shear pins 108 that contact the housing 101 rest against a ridge 113 (depicted in FIG. 4 a ) on the interior of the housing 101. When the device 100 is fully assembled, the force of the compressed injection spring 102 against the lancet base 104 forces the end of the shear pins 108 in contact with the device housing 101 against the ridge 113. Additionally, as depicted in FIG. 1, the lancet base 104 may be in direct mechanical contact with the pushbutton trigger 106. This may provide still further support for the shear pins 108 against the ridge 113. Upon application of sufficient force to the pushbutton trigger 106 the shear pins 108 fracture, thereby releasing the lancet base 104 such that it can move freely toward the injection end of the device 100. The compressed injection spring 102 may then drive the group of lancets 103 out of the opening 111 to administer the injection or vaccination. [0028] As illustratively depicted in FIG. 2, the device 100 may further include a cap 109, both in those embodiments where the device 100 is prepackaged with a vaccine or other pharmaceutical product, and those embodiments where the device 100 is not prepackaged with a vaccine or other pharmaceutical product. In embodiments where the device 100 is prepackaged with a vaccine or other pharmaceutical product, the sharp tips of the group of lancets 103 may be maintained in a soft matrix 110 that protects the sharp tips and prevents the product from leaking through the opening 111 configured on the injection end of the device 100. In embodiments where the device 100 is prepackaged with a viscous product (e.g., a paste) the sharp tips of the group of lancets 103 may be maintained in a casing that includes a well for each of the sharp tips (not shown). The wells may protect the tips and prevent the viscous product from escaping through the opening 111 configured on the injection end of the device 100. The cap 109 may be included around the soft matrix 110 or casing of wells (not shown), and may be removably attached to the injection end of the device housing 101. [0029] As noted above, the device 100 may be prepackaged with a vaccine or other pharmaceutical, or a component of the final pharmacological product that incorporates a vaccine or pharmaceutical. In the latter instance, where a multiple-component vaccine or pharmaceutical product is utilized, a first component may be prepackaged with the device 100, while the second component may be maintained separately. The sharp tips of the group of lancets 103 including (e.g., coated with) the first component may then be “dipped” into a container with the second component; thereby generating a two-component pharmacological mixture for administration with the device 100. The sharp tips of the group of lancets 103 may be exposed from the opening 111 at the injection end of the device 100 to accomplish the dipping operation, although that is not required. [0030] The device 100 may further be configured for inline manufacturing. The housing 101 may be provided, and the safety spring 105, lancet base 104 (with group of lancets 103 oriented toward the injection end of the housing 101 ), injection spring 102 and pushbutton trigger 106 may then be placed into the housing 101 (in the embodiment of the present invention illustratively depicted in FIG. 1, these components may be placed into the housing 101 in the aforementioned order). Shear pins 108 may be included to mechanically stabilize the lancet base 104, and may rest against a ridge 113 in the interior of the housing 101. A finger support 118 may then be secured to the housing 101 ; in various embodiments, by a rotational locking mechanism. [0031] As illustratively depicted in FIGS. 3 and 4 a, the rotational locking mechanism may include a locking tab 115 disposed on the interior of the housing 101 that communicates with a locking channel 114 configured on the interior of the finger support 118. The locking tab 115 may first slide through the locking channel 114 when the finger support 118 is placed on the actuation end of the housing 101. Once the finger support 118 is moved a predetermined length along the longitudinal axis of the housing 101, it may be rotated such that the locking tab 115 secures the finger support 118 to the housing. Securing the finger support 118 to the housing 101 may also compress the injection spring 102 between the pushbutton trigger 106 and lancet base 104, but not to such a great degree that the shear pins 108 break. This act of securing may also place the lancet base 104 and pushbutton trigger 106 in direct mechanical contact in such fashion as to support the shear pins 108 against the ridge 113. Any number of rotational locking mechanisms may be included in the device 100. In one embodiment, two such mechanisms are included (i.e., a pair of locking tabs 115 and locking channels 114 disposed 180° opposite one another. A cap 109 may be secured to the housing 101 at any point in the manufacturing operation (e.g., before placing the various components into the housing 101, after securing the rotational locking mechanism or at any other suitable point in the manufacturing operation). The cap 109 may protect the group of lancets 103 and/or coat the sharp tips of the group of lancets 103 with a vaccine or other pharmaceutical product. EXAMPLE Administration of a Vaccination [0032] A device of the present invention is configured for inoculation with a Smallpox vaccine. An end cap is removed from the device and an appropriate vaccine administration site is selected (e.g., the skin over the insertion of the deltoid muscle or the posterior aspect of the arm over the triceps muscle). A group of 36 lancets is included in the device, and are pre-coated with a Smallpox vaccine. The injection end of the device is held against the surface of the skin at the vaccine administration site. The device is actuated by depressing a pushbutton trigger configured thereupon. Upon actuation, the group of 36 lancets coated with the Smallpox vaccine is exposed from an opening at the injection end of the device housing. These lancets pierce the skin of the recipient, thereby depositing the Smallpox vaccine into the recipient&#39;s superficial epidermis. The group of lancets is subsequently recoiled into the housing of the device by operation of a safety spring included therein. The device is then disposed of, and the vaccination is complete. Any excess vaccine remaining on the skin surface may be wiped off with sterile gauze. [0033] While the description above refers to particular embodiments of the present invention, it should be readily apparent to people of ordinary skill in the art that a number of modifications may be made without departing from the spirit thereof. The accompanying claims are intended to cover such modifications as would fall within the true spirit and scope of the invention. The presently disclosed embodiments are, therefore, to be considered in all respects as illustrative and not restrictive, the scope of the invention being indicated by the appended claims rather than the foregoing description. All changes that come within the meaning of and range of equivalency of the claims are intended to be embraced therein.

Summary: An apparatus for administering a vaccine or other pharmaceutical includes a group of lancets that are exposed by the device to administer the injection. The group of lancets is housed within the device prior to actuation, and is recoiled into the device following the injection. The device may be actuated by depressing a trigger, and may include non-slip finger rests for ease of use. The device may additionally be prepackaged with the vaccine or other injectate. The device is a safe and convenient tool for administering vaccines and other pharmaceutical products; particularly those that require multiple, shallow skin piercings to effect proper delivery. The device of the present invention is particularly advantageous in the administration of a Smallpox vaccine. It is also designed for ease of manufacturing, as it may be assembled through an inline manufacturing process.

big_patent

en

Summarize: Lame-duck New Jersey Gov. Chris Christie (R) was pilloried nationwide during the 2016 presidential election as he was repeatedly demeaned by then-candidate Donald Trump and his aides, most notably when he was apparently sent to fetch Big Macs for the future president. But a Politico story published Friday raises a different possibility: What if those stories were fake news? Sam Nunberg, a former Trump campaign aide, told Politico that he fabricated the story of Christie fetching McDonald's for Trump because he wanted to humiliate the governor. "The sad reality is that it was believable," Nunberg said. Christie himself claimed that other gaffes of his have been exaggerated, too. Take his infamous summer trip to the beach, for example — a beach he'd ordered closed to the public over the July 4 weekend during a state budget shutdown, but then used for himself and his friends and family anyway. Christie defended himself, saying he did not regret the shoreline excursion because he'd already told his children that they'd spend the holiday on the beach. He added that he had no way of knowing he was being photographed: "Could you imagine that I could see the long lens? Of course not." Christie's various scandals didn't seem to bother President Trump all that much, however, as the mogul reportedly made several overtures to the governor to secure his endorsement during the Republican presidential primary. Although Christie did not address rumors that Trump extended — and then rescinded — an offer for him to be vice president, he did say that Trump offered "two Cabinet positions and three other really senior positions in the administration." "I've turned them all down because they weren't stuff I was interested in," Christie said. Read the full profile of the outgoing governor at Politico. Kelly O'Meara Morales Photo: Spencer Platt/2016 Getty Images Chris Christie has assured the public that he is not Donald Trump’s hostage. But a new report suggests that he may be the Republican nominee’s indentured servant. Trump gets the umbrella; Christie gets the rain. https://t.co/jCUkDTLVzN pic.twitter.com/MFieMfv62K — Jim Roberts (@nycjim) March 15, 2016 The past week has produced countless reports on how the Trump campaign is severely understaffed. But a parenthetical detail in Ryan Lizza’s latest campaign dispatch reveals just how shoestring the operation is — and just how far the New Jersey governor has fallen. Governor Chris Christie, of New Jersey, another of Trump’s opponents early in the campaign, has transformed himself into a sort of manservant, who is constantly with Trump at events. (One Republican told me that a friend of his on the Trump campaign used Snapchat to send him a video of Christie fetching Trump’s McDonald’s order.) As Mediaite notes, Trump first revealed the master-servant dynamic in his relationship with Christie back in February, when a hot mic caught him ordering the governor to “get on the plane or go home.” Karma is real, and crueler than we’d ever imagined. Story highlights Chris Christie was on the shortlist to be Donald Trump's vice presidential pick Trump eventually went with Mike Pence and Christie says it was disappointing Cleveland, Ohio (CNN) Chris Christie conceded in an interview Tuesday he was "disappointed" that Donald Trump didn't pick him to be his running mate -- but he's already "over it." The New Jersey governor was one of the final three contenders in the running for the GOP vice presidential nomination, but Trump instead picked Indiana Gov. Mike Pence. Christie said he knew he was "close," but didn't think he was going to make the final cut. "When it was clear that Donald wanted me to compete for this job and to be considered, I wanted to win, of course you do. But it's not like my lifetime dream is to be vice president of the United States," Christie said in an interview with CNN's Jamie Gangel. "So I'm disappointed, no doubt I was disappointed, but I'm over it." Before Christie was in the running to be Trump's running mate, he had been considered a top contender for the job of U.S. attorney general in a Trump administration. But even with the vice presidential selection process behind him, Christie wouldn't reveal his interest in that position and said he and Trump have not discussed the position or what Trump's cabinet would look like. Read More TRENTON—Chris Christie had some thoughts on how I should write this article. “You should break out of leading with ‘the most unpopular governor in galactic history’ and all this other shit that everybody hits F2, F3, F4 [on and] bang, bang, bang, the paragraphs flip in,” the outgoing New Jersey governor said on a recent afternoon, tapping his conference room table like a keyboard. “You should do something different.” Story Continued Below Christie had spent almost three hours reminiscing on his meteoric political rise, the bridge saga, his failed 2016 campaign and his controversial Donald Trump endorsement, his subsequent White House adventures and some of his more infamous misadventures, like sitting on a beach he had ordered closed and being caught by a photographer’s long-lens camera. So, with 68 days left in his governorship and the interview winding down, he urged me to forget all that and focus on the good things he had done for his state—and perhaps memorialize him as the pragmatic Republican governor who had cleaned up New Jersey and won a second term in hostile territory. He essentially wanted the story to ignore much of what happened afterward. And yet, any fair assessment of Christie’s legacy has to reckon with the highs and the lows. For four years, from 2009 until 2013, he was a political rock star. Iowa activists wooed him to run for president in 2012, even flying to New Jersey to make their case. Magazine covers hailed his brilliance. (“THE BOSS,” blared one TIME cover he loves.) He screamed at people on the boardwalk while carrying an ice cream cone. It didn’t matter. His approval rating soared above 75 percent in a reliably blue state. After two stinging defeats to Barack Obama, some in the GOP saw a potential winner in Christie’s combination of raw talent, fundraising prowess and ability to woo minorities and Democrats. Many on his team thought him a shoo-in GOP nominee. But he passed up a run in 2012, figuring he wasn’t ready. Then, for the next four years, Christie became something of a national punching bag. Everything people loved about him seemed to become what they hated. The bridge lanes closed. Investigations mushroomed around his office. Allies and aides were convicted in the closings. His presidential ambitions cratered. Christie, who prides himself a prodigious fundraiser, couldn’t attract donors to his campaign. He was beaten by Trump, a political novice, and then mocked for fetching Trump McDonald’s—even though he didn’t do that—and for looking like a hostage during his endorsement of Trump, even though he says he wasn’t. His musical hero, New Jersey’s own Bruce Springsteen, even sang a duet mocking him with Jimmy Fallon, his favorite late-show host. “They shut down the toll booths of glory because we didn’t endorse Christie,” the two men sang to the tune of “Born to Run.” “We’re stuck in Gov. Chris Christie’s Fort Lee, New Jersey traffic jam.” In the longest interview Christie has given in years, as he dropped oyster crackers into a large vat of chili, he said the story of his rise and fall had not been told accurately. He was never as good as depicted—nor as bad. “I never felt 78, and I don’t feel the 22,” he said of his approval ratings. “What I hope at the end of the day is that this really is about my eight years, and the bridge stuff is part of that, and the Trump stuff is part of that, but it’s only a part.” *** The apex for Christie was Nov. 5, 2013. Voters would head to the polls the following day and grant him a resounding re-election victory—61 percent of the vote, including 50 percent among Hispanics, rare for a Republican. His campaign was exultant: They had hoped for 60 percent to show Republicans he was the 2016 force to be reckoned with. The moment seared into Christie’s mind is the night before Election Day. His campaign organized a raucous rally in the Democratic, Hispanic stronghold of Union City. Streets were closed for the occasion. He was greeted by thousands of Hispanic voters blowing vuvuzelas and carrying union signs and pictures of Christie on sticks when he rolled up to City Hall, on a bannered campaign bus with New Mexico Gov. Susana Martinez. She spoke in Spanish; he spoke Christie, his uniquely pugnacious argot of New Jersey mannerisms and brash self-confidence. Brian Stack, the Democrat mayor, gave a rousing endorsement that broke against the New Jersey Democratic political machine. Christie’s operation had wooed Democratic mayors for months. “I want to send a shock wave through the state,” Christie said onstage. “No one can ever take that away from me, and whatever is happening now doesn’t make that any less real,” he told me in our interview, calling the rally a defining moment of his political life. “What I really thought was, like, 'Let the good times roll.’ It wasn’t even that good things were coming. They were all happening, and I didn’t expect them to stop. But you never do,” Christie said. ‘NO ONE CAN EVER TAKE THAT AWAY FROM ME’ Clockwise, from upper left: In Nov. 2012, Christie comforts Alice Cimillo, whose home was damaged by superstorm Sandy; One year later, on Nov. 5, 2013, Christie celebrates his reelection at Asbury Park Convention Hall; New Jersey Governor Chris Christie is given a Green Bay Packers hat by state Senate President Stephen Sweeney after the annual State of the State address on January 13, 2015; Christie speaks during the 110th Town Hall Meeting with families affected by Superstorm Sandy at a VFW hall on February 19, 2014. Getty Images Christie had ruled Trenton with an iron fist and a gaze toward the national stage. Republicans had bent to his will, voting for whatever he wanted, whenever he demanded. There were no juicy stories of palace intrigue, even among his advisers, who sometimes privately disagreed. Most of his team came from the U.S. attorney’s office, and they were fiercely loyal to their longtime patron. Christie has often been a volcanic boss, sometimes screaming and cursing at aides in humiliating episodes they vividly remember years later. But those didn’t make the public eye. “That first term, he ran a hermetically sealed operation,” said Charles Stile, the state’s preeminent political columnist for the Bergen Record. “There were no leaks. I’ve never seen an administration operate with that much discipline.” Christie’s political specialty was the town hall—where he delivered virtuoso, and sometimes emotional, appearances that fueled his reputation as a bold truth-teller. His office turned the format into a polished performance worthy of a touring Broadway show. He gave the same script every time. The same aide introduced him. He tossed the jacket the same way to the same aide. The crowd was often stacked. “If you’re going to give it, you’re going to get it back,” he warned would-be hecklers at every event. They were all filmed. But for all that, they never felt inauthentic: Christie would leave voters in tears with stories about his tough-knuckled mother on her deathbed, his friend who died of overdoses, his emotions after Sandy. On policy, Christie was both hard-nosed and pragmatic. He capped property taxes in a notoriously high-tax state. He cleaned up a budget mess left by his disgraced predecessor, Gov. Jon Corzine. He persuaded Stephen Sweeney, a burly ironworker’s union official who leads the state Senate, to make a compromise on pensions that would require unions to pay more. “He came to my union office and we sat down the second day,” Sweeney recalled. “And his comment to me, are we going to get anything done, or do what is always done and fight? He wanted to get things done, and so did I.” The Friday Cover Sign up for POLITICO Magazine’s email of the week’s best, delivered to your inbox every Friday morning. Email Sign Up By signing up you agree to receive email newsletters or alerts from POLITICO. You can unsubscribe at any time. At the time, New Jersey’s pension system was among the most underfunded in the country, and Christie’s predecessors didn’t pay. (Christie also has a checkered record—while paying more than his predecessors, he also skipped some payments.) Stile, a sometimes fierce critic of the governor, said, “The time of practically skipping and significantly shorting the pension system has pretty much stopped. It went on for 15 years leading up to him. He deserves credit for that.” Christie also made dramatic gestures signaling he was a different kind of Republican—as when he appointed a Muslim judge, Sohail Mohammed, to the bench and loudly defended him against sharp attacks on his religion. Liberals applauded. He won praise for restructuring the state’s medical colleges. He showed particular interest in the impoverished city of Camden, forging an alliance with Democratic Mayor Dana Redd and pushing new charter schools far and wide. Perhaps more than anything, there was Superstorm Sandy. When the storm walloped New Jersey and left billions in damage, it may have been Christie’s shining moment back home. He was everywhere, all the time, for months, surveying devastated towns, destroyed wastewater systems, broken bridges, flooded streets and funerals. He greeted President Obama as a hero in a famous embrace, even though for years, his aides ferociously denied it was an actual hug. Aides say the storm’s aftermath was when Christie was the sharpest, the most unhealthy and the most stressed out. He would convene daily meetings and schedule calls after midnight. Trekking across the state, he became seen as a New Jersey everyman, profane and gruff, devastated and jubilant, in the muck and on the television. It felt like however people must have felt about Bill Clinton in Arkansas in 1991. Everyone felt it. This is about to happen.” “His immediate goal was to get the state to some semblance of normal as quickly as he could,” recalled Marc Ferzan, the New Jersey storm czar and a Christie friend. “He was as hardworking as anyone who worked on Sandy, and he had great instincts.” It all coagulated in Union City. Two days after the election, Christie sent Matt Mowers, a longtime aide, to New Hampshire to lead the party—and begin plotting his 2016 run. Others, like bridge mastermind David Wildstein, said they were going to Iowa. His team was counting the days. “You could not have told anybody who was a Christie supporter that he wouldn’t be the Republican nominee,” said Rich Constable, a longtime senior aide in the governor’s office. “This is a remarkable talent who is wicked smart. It felt like however people must have felt about Bill Clinton in Arkansas in 1991. Everyone felt it. This is about to happen.” Christie sometimes calls his world “Rancho Christie,” and life was good on the ranch. *** Fast forward two months, and Christie hit bottom. Explosive emails brought a full-bore scandal to his doorstep—the closure of the world’s busiest commuter bridge, allegedly to punish a Democratic mayor who wouldn’t endorse him as governor, into full view. The Wall Street Journal and the Bergen Record had trickled out damaging stories for months, but the emails from David Wildstein changed it all when they were released in early January. “Time for some traffic problems in Fort Lee,” Bridget Kelly, a senior Christie official, wrote. “Got it,” Wildstein returned. The emails also implicated Bill Baroni, a top Port Authority official. Christie had been scheduled to attend a Sandy event with Constable that morning. Constable said he remembers turning his car around on the highway when the event was canceled. BRIDGEGATE Clockwise from upper left: Christie enters the Borough Hall in Fort Lee to apologize to Mayor Mark Sokolich on January 9, 2014; On ‘Late Night,’ host Jimmy Fallon performs “Gov. Christie Traffic Jam” with Christie idol Bruce Springsteen; Bill Baroni, former deputy executive director of the Port Authority of New York and New Jersey, exits a federal courthouse in March 2017 after being sentenced to two years in prison stemming from his involvement in the Bridgegate scandal; Bridget Anne Kelly, former deputy chief of staff for New Jersey Governor Chris Christie, after being sentenced to 18 months in prison. Getty Images He talked to a round-robin of aides: longtime spokeswoman Maria Comella, who broke the news to the governor just after his morning workout, and political adviser Mike DuHaime, who paced the parking lot of the Tick Tock Diner in Clifton as the governor surveyed the damage and vented. Christie convened senior staff at the governor’s mansion around an upstairs table, where they’d met dozens of times before. They read the stories breaking online and the emails and watched the wall-to-wall TV coverage. Christie went through long periods of silence. Who knew what, Christie asked? Could he survive? What should he say to the public? Whom should he fire? Was it going to get even worse? “It was all about sheer survival,” one person present said. There were arguments: Should they fire Bill Stepien, the governor’s top political aide, or David Samson, the Christie-appointed head of the Port Authority, who later pleaded guilty on a separate felony charge? Was Michael Drewniak, the governor’s press secretary mentioned in the emails, a liability? Stepien, who is now the White House political director, was axed, and DuHaime was given the duty to tell him, even though he disagreed with the decision. Samson survived. Drewniak met with the governor's senior staff for two hours and managed to save his job. No one ate much of anything, several aides remember. Christie made none of the firing calls himself. Nor did he yell or shout, people present say. He was ashen and looked ghostly and appeared on the verge of tears for much of the day. His brother Todd Christie, a Wall Street type and informal adviser, stopped by. Samson popped in. So did Bill Palatucci, a longtime confidant. Eventually, he slept—badly—and decided to have a marathon news conference denying any involvement in the lane closures. Then he went underground for months. It didn’t get better. Everything Christie had done in his first term—the hard-nosed tactics, the micromanaging at the Port Authority, calling mayors to cancel meetings when he was mad, his outbursts and the blurry line between his political and policy operations—was under fresh scrutiny. He had won a huge electoral victory, but Democrats still controlled the legislature and most major cities—and they saw blood in the water. Soon others were launching fresh charges against his administration, like the mayor of Hoboken, who accused him of holding Sandy money hostage. The U.S. attorney’s office eventually said her claims were without merit. “Frankly, she should have been charged for providing false information,” Christie told me. In following months, friends say, he was sullen and quiet on the phone, rare for the voluble Christie. He stayed largely out of public view. During one event at Times Square promoting the Meadowlands Super Bowl, he was booed loudly. Christie hopped into the car devastated and rode back to New Jersey silent. For a while, allies and aides say, Christie feared he was going to be charged himself over what became known as Bridgegate, though he always denied involvement. He demurred when I asked him about it repeatedly. “I always tried to have confidence in the process and in the system,” he said. Inside the governor’s orbit, people still debate his exact role—what he knew, and when. Several aides told me they believed he knew more about the closures than he ever let on, even if he didn’t plan them. Why did he delete the texts he had exchanged with a senior aide, Regina Egea, during a particularly bad day of testimony? For months, he’d known that something seemed kinky at the bridge and had talked to aides about it. There was a photo of Wildstein and Baroni at the Sept. 11 ceremony that year—which happened while the closings were underway—when the men said they told the governor. Wildstein said he laughed about it. Christie told me the speculation was hogwash. He says he doesn’t even remember the texts with Egea. He said he only learned about the nature of the closing from the emails. And as for Wildstein, he says they didn’t tell him that day. I don’t even think the true story has ever been told about why it was done,” said Christie. Christie said that if he were going to exchange sensitive conversations with Egea, why would he text her when she worked two offices over? He referenced a famous—and now mocked—answer, where he told a reporter he was “moving the cones” one month before the emails came out, when asked about the lane closures. “But would I have ever gotten up and said, 'Oh, yeah. I was in disguise that morning in overalls and a hat and I was the one moving the cones.' Now, if I had known that something was actually going on, do you think I would have actually done that?” he said. The investigation lasted more than a year. Wildstein pleaded guilty and cooperated. The trial of Kelly and Baroni drove Christie crazy. He would sometimes call aides and friends several times a day to vent and swear. On several occasions, he thought about firing back and ordering up statements. “I was on trial,” he explained to me. “I wasn’t allowed to be there, I wasn’t allowed to respond, but the case was tried against me, not against the people who actually were sitting with the courtroom—with absolutely no evidence I had any involvement.” Christie said neither side had called him to the courtroom because “the government told David Wildstein’s version of the truth. The defense told Bridget Kelly and Bill Baroni’s versions of the truth.” “I don’t even think the true story has ever been told about why it was done,” he said. “I don’t buy the fact and I’ve never bought the fact that this was done to penalize the mayor of Fort Lee.” He declined to say why he thought it was done, saying he didn’t know. Wildstein, who is now taking playwriting courses in Florida as the appeals process continues, declined to comment on the record about the bridge. He is expected to become more involved in politics in upcoming months. But he did take a parting shot at Christie: “Among my regrets is I got snookered by this guy.” *** Nothing makes Christie aides cringe more than one quote he gave on the governorship: that he wanted to “squeeze all the juice out of the orange” for himself and his family. “Chris Christie was always prone to self-inflicted wounds. Some of the optics we had to deal with were so disappointing because they were avoidable,” said Michael Drewniak, his longtime spokesman. There was, of course, this summer’s embarrassment of being photographed sitting on a closed beach, lounging in a beach chair as New Jersey residents stewed at home. Before that, there was the time Christie flew to the desert and stayed at a posh resort with the king of Jordan, taking a $30,000 gift and explaining the Hashemite monarch was a “personal friend.” The time he took a state helicopter to his son’s baseball game so he could also meet with donors urging him to run for president. That time he went to Disney World during a snowstorm, even with his lieutenant governor out of state. The times he screamed at New Jersey residents and officials—calling for a grandmother legislator to be hit with a bat, chasing a man while carrying an ice cream cone, calling a Navy SEAL a jerk. The time, as U.S. attorney, that he stayed in such luxurious hotel rooms and took such expensive limos that the federal government came out with new guidelines for all U.S. attorneys. Christie loved showing off pictures with celebrities and taking lavish vacations. He loved being on the sideline, in the owner’s box, wherever he could go that was closest to the nexus of it all. He was starstruck with his fame, several longtime aides said. ‘HE WAS STARSTRUCK WITH HIS FAME’ Clockwise, from upper left: Christie with New York Mets chairman & CEO Fred Wilpon in the owner’s box during the final game of the season in 2010; Backdropped by the Al Aqsa Mosque compound, Christie, visits Jerusalem's old city; During New Jersey’s state government shutdown, Christie and family/friends use the beach at the governor’s summer house; and Christie is joined at a post-Sandy press conference by Dept. of Homeland Security Secretary Janet Napolitano and Hoboken Mayor Dawn Zimmer. Getty Images His penchant for getting what he wanted at all times was so ingrained that it once even led to a showdown between Buckingham Palace and Wildstein—which Wildstein won. When Queen Elizabeth II was coming to ground zero, her office blanched at a request to add the governor’s children to a list of people meeting the queen. Wildstein told the palace the visit could not happen. Eventually, a compromise was worked out, and the queen met the Christie kids. For these more sympathetic former Christie aides, they find his behavior puzzling: How could such a talented politician, with such an innate understanding of politics and perception, make such boneheaded decisions? Even to some of his staunchest defenders, the episodes fueled an image of a out-of-control, out-for-myself executive who could not give a damn about the public. Here’s what Christie has to say about that: “I understand that people obsess on optics. I’ve never been a guy who obsesses on optics.” Christie has rarely apologized, and told me that most of his outbursts at New Jersey residents were strategic. He seemed to grow happy talking about a recent encounter in which he got into a heated argument with a voter at the polling station near his house. Nor does he regret chasing the man on the boardwalk while carrying an ice cream cone, saying the man had used the F-word in front of his children. Asked whether such episodes are emotional, uncontrolled outbursts, Christie responded: “A lot of the dummies in your business think it is.” His own associates don’t see it that way; Drewniak said that many of the outbursts were “spontaneous” episodes that led to weeks of headaches rather than calculated strategy. Others said he couldn't control his temper. The one outburst he regrets, Christie said, was calling a Navy SEAL who challenged him at a town hall a “jerk”—but even then, he insisted he was fundamentally in the right: “I think he merited the comment, but I shouldn’t have said it.” At one point in our conversation, he ticked through each well-known incident and explained himself, growing animated and at times profane. “I assume that the king of Jordan doesn’t put people up at the Motel 6. He’s the king of Jordan,” Christie said. In a mocking tone, he added: “Your Majesty, is there a Motel 6 in the area so I won’t offend anybody?” I assume that the king of Jordan doesn’t put people up at the Motel 6. He’s the king of Jordan,” said Christie. Most New Jerseyans are either Eagles or Giants fans, and Christie drew particular derision for flying on a private plane owned by Dallas Cowboys owner Jerry Jones to several games and taking luxury box seats. Some critics raised concerns that Jones had business in front of the Port Authority of New York and New Jersey, which Christie partially controlled. After weeks of headaches, Christie begrudgingly agreed to fly commercial to a Cowboys playoff game. Aides said he still wanted to take the free plane. “I became governor and got to know Jerry. He invited me to the games, and where am I supposed to sit when he invites me to the games? He’s going to sit me with them,” he said. The beach incident annoys Christie maybe the most. He was sunning in a chair with his family, in the middle of a budget standoff this July 4 weekend. He had ordered the beaches closed because there was no state budget. The Star-Ledger sent a photographer down the shoreline in a private plane and snapped pictures that went viral on the internet. Children made Halloween costumes of Christie on the beach. “Could you imagine that I could see the long lens?” Christie said, asked if he knew the plane was carrying a photographer to snap pictures of him. “Of course not.” Even so, Christie insisted he didn’t regret the shoreline excursion. He had worked the rest of the day, and had promised his children and their friends a vacation for months on July 4 weekend. Nothing made his longtime circle angrier than the beach. “There have been so many times I wanted to pummel him,” one longtime aide said. “I would have pummeled him in the face that day.” Another called his decisions “completely and totally fucking inexplicable.” “Those things became distractions,” said Mike DuHaime, his top political adviser. “They were bigger distractions than anyone anticipated.” “He overreached often,” Drewniak said. “He would get his blinders on and just be incredibly stubborn.” He added: “I don’t regret working for him. He was the best boss I ever had. It was all part of the package.” *** In the words of Christie’s favorite singer, Bruce Springsteen, his political fortunes were stuck somewhere in the swamps of Jersey by 2014. He was diminished by Bridgegate but still thought he had a chance in 2016. Many of his aides were skeptical but went along with the plan: He would chart his course as chairman of the Republican Governors Association, travel the country, raise money, build alliances and try to put together a presidential campaign infrastructure. He raised record amounts of cash for the RGA and helped win more than 30 gubernatorial races. He could still make national headlines anytime he wanted. Christie entered the presidential race in June 2015 at his New Jersey high school. “I saw a path, but we were under no illusions about how difficult it was going to be,” DuHaime said. “And none of us saw the Trump phenomenon coming.” Christie and his team knew he had little chance in Iowa and South Carolina, so they cast their lot in New Hampshire, where, it was thought, his ideological pragmatism and skill at retail politics would be huge assets. Drawing on the playbook that had worked so well back home, Christie crisscrossed the state in a bus and held more than 100 town halls. He was able to secure more endorsements than any other candidate. There were a number of times it looked like he had momentum: He won the coveted Union-Leader endorsement. A clip of him talking about opioid addiction went viral. His prosecutor bona fides became useful amid terrorist attacks, and he slashed Marco Rubio at the final debate before the vote. “I’ve always been good at it and I’ll always be good at it,” Christie said of his stage performances. By Christmas, Christie’s hustle seemed to have paid off: He found himself in second place, where he thought he would ultimately finish. But that turned out to be the high-water mark of his campaign. He soon was inundated with money from super PACS linked to Rubio and Jeb Bush, and Trump dropped his friendly stance and ripped him over the bridge. “The GW Bridge, he knew about it,” Trump said. “How do you have breakfast with people everyday of your lives. … They’re closing up the largest bridge in the world. They never said ‘Hey boss, we’re closing up the George Washington Bridge.’ So they’re talking about the weather? He knew about it. He totally knew about it.” Instead of firing back at Trump, who he figured couldn’t be beaten in New Hampshire, Christie lashed out at Rubio, who was competing for the same pool of educated, moderate voters. Other candidates and their teams said Christie, who prided himself on taking on difficult challenges, shirked the ultimate political one. “You saw so many other candidates try and fail at that tactic and strategy,” Matt Mowers, Christie’s New Hampshire director, said of attacking Trump. “You would see those candidates lose support in the polls. It never seemed strategically advantageous.” Mowers said it was almost impossible to gain traction in the state with such a crowded field and Trump’s uncanny ability to earn media attention and blot out the sun. Voters would love Christie and say he was on “their list,” Mowers said, but they would eventually go with Trump, who was even more “tell-it-like-it-is.” DuHaime said the calculation was to only swing at Trump hard if it was a one-on-one field, and that the governor knew Trump was going to win. His attack on Rubio didn’t work; the Florida senator’s voters defected, but to other candidates. Christie’s strategy was falling apart. He couldn’t raise enough money, a particularly painful shortcoming for a once-prolific fundraiser. After the onslaught of ads attacking him, he continued to fall in the campaign’s daily tracking polls—and he didn’t have the resources to hit back. The governors he’d raised money for as RGA chair didn’t support him in return, infuriating his team. DuHaime called it “cowardly.” “I think it was an enormous leadership opportunity lost for the Republican governors,” Christie said. “They just sat on the sidelines for reasons that I’ll never completely understand because there were a lot of good candidates to pick from.” And back in New Jersey, Christie was haunted by home-state problems: sagging poll ratings, a crumbling NJ Transit system, credit downgrades, a steady stream of headlines from the ongoing Bridgegate trial, a separate investigation into Samson, the wobbly financial fortunes of Atlantic City. Even his widely praised response to Superstorm Sandy had became a negative. “That hug was never forgiven by so many people in the Republican establishment,” said DuHaime, who thinks Christie’s embrace of Obama hurt him with hyperpartisan GOP primary voters even more than Bridgegate. Christie sat stoically as the returns came in, him finishing sixth. He stared at his father. His children cried. He knew he was going to drop out but decided to wait a day after talking to Larry Hogan of Maryland, a friend and one of the few fellow governors who had campaigned with him. He returned to New Jersey and posted a statement on Facebook, dropping out on Feb. 10. *** Before Christie flew to Dallas to endorse Donald Trump two weeks later, he didn’t tell some of his most senior aides. They learned about it from his secretary while he was in the air. Christie had assured aides after New Hampshire that he didn’t plan to endorse in the race, and they looked forward to trying to salvage his legacy in New Jersey. After he learned the news, Kevin Roberts, then communications director, called his team into an emergency meeting and told them. He was met with silence. “We’re fucked,” Roberts said, according to attendees. The decision was widely loathed in his circle. DuHaime, his top political adviser, declined to follow his lead. Maria Comella, his top aide for years, later came out with a statement endorsing Hillary Clinton. TRUMP Clockwise, from upper left: Christie and Senator Marco Rubio during a January 14, 2016, GOP presidential debate; Christie stands behind Trump during a rally at the Forth Worth Convention Center in Texas, announcing his endorsement of the businessman’s candidacy ahead of the March 2 “super Tuesday” elections; On Nov. 20, 2016, President-elect Trump and Gov. Christie shake hands before their meeting at Trump International Golf Club, in Bedminster Township, New Jersey; Trump and Christie prepare to speak to supporters at a March 14, 2016, rally at Youngstown Airport in Ohio. Getty Images By this time, Christie had already grown so unpopular that the governor found a novel way to punish one of his adversaries after one of their volcanic fights. He called into a radio show and praised Sweeney, the state Senate leader and a Democrat, describing him as a great governing partner. “He was praising me to hurt me, and I knew exactly what he was doing, and he did too,” Sweeney said. Christie explains his endorsement of Trump as a pragmatic move. “I was the first,” he reminded me. “And I turned out to be right.” The endorsement gave him a chance to be in the game—and Christie couldn’t stand the idea of being a lame-duck governor on the sidelines. Now he talks to Trump several times a week. He loved playing Hillary Clinton in debate prep. When Trump won, he was onstage. At the same time, several aides said, it was essentially a white surrender flag on his governorship. “One, I wanted to make him a better candidate—and two, I wanted him to beat Hillary Clinton because I didn’t want Hillary Clinton to be president and I thought he was the guy who was going to give us the chance to do that,” Christie told me. But, he hastened to add, “It doesn’t mean that I agree with everything Donald Trump does. I don’t. But I agree on a hell of a lot more with him than I do with Hillary Clinton, right?” Former aides say Christie made the decision after Trump courted him extensively, asking him frequently to endorse. Christie was angry with the other candidates and frustrated with the whole ordeal of running. “Trump worked him harder than anyone else in trying to get it. He called him repeatedly,” DuHaime said. DuHaime said Christie called him the night Trump won South Carolina. The two men agreed the billionaire developer would be the nominee—so Christie decided to endorse. “The right thing for him to do was to endorse Trump at the time. That is not what I wanted to do for myself, so I didn't go work for him,” DuHaime said. Some aides and allies say he endorsed early in hopes of getting a plum job if Trump won. Christie denied that. “I know that whatever a candidate may say to you before they’re elected means little once they’re elected. Because everything changes. A whole bunch of different people get in their ear and everything else. So, no. I wouldn’t make that calculation because I know from my own experience that candidates will say anything, and you can’t count on that beforehand,” he said. During a news conference soon after the endorsement, Christie stared blankly behind Trump, his eyes blinking. Twitter wags instantly pronounced that he looked like a hostage. The clips went viral on the internet and infuriated Christie. “My job was to introduce him, and the original plan was to introduce him and go offstage,” Christie said. “I introduce him, he comes up the stage, he goes, ‘Stay here with me.’ ‘OK.’ So I stood back there. I was like, ‘All right.’” “I’d love for somebody to actually do that and stand behind someone at a press conference and have any other look on your face,” he said. Had he laughed or smiled, Christie said, he would have been called a “goofball.” Christie agreed to helm the transition, but he craved a certain spot in the administration: attorney general. And he didn’t get it. Instead, he suffered a series of fresh humiliations. There was the time Trump told a large crowd in Christie’s home state that the governor would no longer eat Oreos. There was the time The New Yorker reported an aide saying that Trump had made Christie fetch him McDonald’s, a nugget that instantly went viral. (Sam Nunberg, a former Trump aide, told me he made up the story to embarrass Christie—and that it spread like wildfire. “The sad reality is that it was believable,” Nunberg said, chuckling.) UPDATE: New Yorker reporter Ryan Lizza says Nunberg was not the source for his story. There was the time, at a rally in February 2016, that Trump told him to get on the plane and “go home” before Trump spoke, seeming to mock his own campaign surrogate. Christie sees the Tennessee tarmac incident differently. “People were acting like it was a fucking punishment. The guy gave me his smaller plane and said, ‘Leave early so you don’t have to wait for me, because you’ve been so great to me the last two days doing this for two days.’ And then asshole reporters write that he was like, ‘Get Chris off the stage,’” the governor said. “That’s the stuff that drives you crazy.” I would never underestimate Jared’s ability to be involved in whatever he wants to do be involved in,” Christie said. Christie said even he was taken aback by Trump’s nice gesture to send a second plane after two days on the trail. “Just when you think you’ve got him figured out, like in a bad way, he does something really generous and over-the-top that makes you go like, ‘He is a good guy in his heart,’” he said. Christie’s generous interpretation of Trump’s treatment of him even extends to his own ouster. Two days after Trump’s surprise win, Steve Bannon and Christie were seen arguing for several hours in a glass office in the transition headquarters in New York. Bannon was firing him as chair of the transition, and Christie wasn’t taking the news well. He wanted to know who was behind it, and he suspected Trump’s son-in-law Jared Kushner, whose father he had prosecuted as U.S. attorney. “Oh, I asked,” Christie said, referring to Bannon. “He didn’t answer. But [based on] subsequent conversations I’ve had with the president, I just don’t believe this was the president’s decision.” Aides later threw his transition materials in wastebaskets. Christie, who often attributes his habit of feuding to his “Sicilian mom and Irish dad,” insists he holds no grudges. He said the president had made a smart decision to get rid of some aides—he named Bannon and Reince Priebus—and said others would be soon to go. Chief of staff John Kelly, he said, was doing much better. He declined to take a shot at Kushner when asked about the Trump son-in-law’s diminished White House role. “I would never underestimate Jared’s ability to be involved in whatever he wants to do be involved in,” Christie said. *** Christie, who is only 55, won’t say what is next. He says he wants to make money and doesn’t plan to run for president again. He says he has no immediate plans to join the White House under Trump. “He’s offered me two different Cabinet positions and three other really senior positions in the administration, and I’ve turned them all down because they weren’t stuff I was interested in,” he said. He said there could be opportunities in media, at law firms and on Wall Street. He has joked that Mary Pat Christie, his investment banker wife, has told him he needs to realize his “earning potential.” But power and fame motivate Christie more than money, those closest to him say, and they think he’ll be back in the public glare. When I came to see him, he was sitting in a conference room with two Coke cans, that large bowl of chili, a basket of wavy potato chips, gifts lining the walls, newspapers praising his ascent and Springsteen and a Notre Dame football sign outside the door reading, “PLAY LIKE A CHAMPION TODAY.” His daughter goes there, and he has become a fan. I hadn’t seen Christie in two years since I covered him for the Wall Street Journal, but he started the conversation almost mid-sentence. His photographer had told me downstairs that Christie, a mercurial man, was in a fantastic mood. He only asked to go off the record twice. Before I saw him, Christie was meeting with Phil Murphy, the next governor and a former Goldman Sachs executive who cast much of his campaign on a referendum against Christie. The New Jersey press corps no longer had much interest in Christie, instead clamoring outside in the cold to meet his successor. Christie no longer holds court from his sprawling governor’s office; he closed the State House for repairs earlier this year, and is serving out his final days from a makeshift fifth-floor office in a drab, gray government building. One of his spartan walls has a lonely “Born to Run” Springsteen poster. A large sign on the streets of desolate Trenton notes where you can find Christie, when he is there. ‘I KEPT MOVING’ Christie in the East Room of the White House, attending an October 2017 speech by President Donald Trump on the opioid crisis. Getty Images He wasn’t in a bomb-throwing mood about Murphy and seemed to be still sizing him up—and looking for weaknesses. “I have no way of knowing,” he said when asked if Murphy was prepared for the job. “But I’m sure he’ll be ready and he’ll be fine by Inauguration Day. He’s a little overwhelmed now.” His tight circle of aides is no longer with him. Many have been gone for years. Christie often keeps his own schedule and trusts his own counsel above all. In fact, some of his aides had no idea I was even on his schedule until the night before. In person, Christie is eminently likable and convincing. He can say something that is not true without blinking an eyelid—and can almost convince you it is, even if you know better. He still possesses all the assets that made him a rising GOP star and all of the flaws that led to his astonishing fall: relentless ambition and pragmatic competence, shrewd political instincts tempered by inexplicable blind spots, a penchant for vengeance and a volcanic temper, a keen sense of humor and an ability to project empathy, an obsession with fame but humility enough to keep up with old high school friends on Facebook. “He is a dynamic, complicated figure that is too easily caricatured,” said Comella, who was at his side for all of it. What Christie wanted me to see was that he was content, and proud of his record as governor. The economy has improved, with unemployment falling from about 10 percent to about 5 percent. He ended the estate tax. He brought bail reform to New Jersey, a move widely hailed and followed by other states. He shined a light on opioids and eventually led the national commission while boosting funding to address the crisis at home. Years from now, Christie said, people won’t hate him so much. “I think the situation at the bridge started it. Then I think committing to being the RGA chairman, which led to a lot of travel being outside the state, it led to people believing I wasn’t able to do my job, which is kind of ridiculous. Then running for president. Again, which leads you beyond the state more and then lastly, endorsing the president—and he’s not popular here. That probably doesn’t make me popular in the state where he lost by double digits,” Christie said. He added: “I never stopped my forward momentum, right? I may have slowed but you saw me back then. I didn’t get in the fetal position and say, ‘Please leave me alone,’” Christie said. “I kept moving.” *** Those who have known Christie the longest tend to have the most complicated feelings about him. Like Tom Kean—the former governor who nurtured and mentored Christie, only to become a critic. Their connections run deep. After he said he wanted to get into politics, Christie’s mother drove him to Kean’s house and had her teenage son shadow Kean. Both families lived in Livingston. Kean, then a local politician, eventually became governor for two terms and was Christie’s biggest supporter. He swore him in to county government. He wrote a heaping letter praising Christie to become U.S. attorney. He was a trusted adviser. Things changed as Christie rose. In 2013, Kean celebrated the governor’s re-election backstage. Two days later, Christie started a campaign to unseat Tom Kean Jr., the governor’s son, who was Senate minority leader. The two men had fought over state Senate races, and Christie wanted a more loyal ally in the job. “I was happily congratulating him on his election one night. Two days later, he didn’t tell me—all of a sudden, guess what he’s doing, he’s making calls against your son,” Kean said. But Republicans bucked him and kept Kean’s son in power. “It was the first time he’d been beaten in New Jersey,” Kean said of Christie, with a bit of familial pride. Eventually, the two men talked, and Christie “came close to an apology,” Kean said. “I’m not sure he apologized, but that might be as close as you get from Chris Christie.” The two men haven’t talked in over a year, Kean said. He said the governorship went downhill because Christie spent too much time out of state, didn’t listen to his staff and stopped caring in the past year, “spitting in people’s eyes.” Still, he praised some of Christie’s accomplishments, particularly on taxes. “He’s not someone who likes criticism,” Kean said. “His problem is he had too many yes men on his staff.” Kean added: “He’ll resurface because he has too much ability not to.” “This why it’s sad in a sense. He’s the most able politician I know, with possibly the exception of Bill Clinton,” Kean said. “I thought if he made use of that properly, he was going to be one of the state’s really great governors. He could have been one of the great governors.” Sweeney, the state Senate president, paused for a few seconds when I asked him whether Christie was a good governor. Christie had met with Sweeney for 15 minutes in the middle of our interview, and he later suggested Sweeney, despite being a Democrat, might offer a solid testament to his success. Sweeney said Christie was a tough fighter who had usually been honest with him, and that he was “pragmatic” and that “he’s a governor that used every inch of the power that was given to him by the constitution.” “I think he did a good job at times. At times, he made mistakes,” Sweeney said. “He took some tough shots at some people on the way up. When you’re on your way up, everyone is with you. When you’re punching people, when you’re on your way down, those punches are coming back at you.” After seeing Christie in Trenton, I reunited with Drewniak and Roberts, his former communications director, for dinner at the Langosta Lounge on the Asbury Park boardwalk. Drewniak, towering and bald, had a reputation in Trenton as pugilistic. Yet deep down, Drewniak is a bit of a softie—he has two yapping dogs named Peanut and Lilly and can grow emotional on a dime. He is a master fisherman who grills a mean steak—and is ready to spend more time grilling and fishing than fighting political battles. He is also planning a move to Florida. "I was thinking about talking to you,” Drewniak told me. “And he still freaks me out.” Smoking cigarettes outside, with the famed Stone Pony in sight and waves crashing in, we made small talk with two locals. Both of them began torching Christie and praising Phil Murphy, the new governor, who threw his celebration party on the boardwalk Tuesday night. Christie threw his there four years ago. Almost out of habit, Drewniak jumped in to defend the outgoing governor, his record and charisma. He introduced himself as “Mike,” leaving out his last name and longtime affiliation. New Jersey Republican Gov. Chris Christie says in a new interview that he suspected senior White House adviser Jared Kushner was behind his ouster from President Trump's transition team. In a wide-ranging Politico interview posted Thursday, Christie details a conversation with now-ousted White House chief strategist Stephen Bannon, who was the one who told Christie he was being fired from the transition team. In it, he says he asked Bannon directly whether Kushner was behind it. ADVERTISEMENT “Oh, I asked,” Christie said. “He didn’t answer. But [based on] subsequent conversations I’ve had with the president, I just don’t believe this was the president’s decision.” He added that the president offered him a number of positions in the Trump administration, but that he turned the president down due to lack of interest. “He’s offered me two different Cabinet positions and three other really senior positions in the administration, and I’ve turned them all down because they weren’t stuff I was interested in,” Christie said. Trump's team announced shortly after the election that Christie was being replaced by Vice President Pence on the transition team. At the time, sources said that the reason for Christie's ouster was his aides' tendency to clash with Kushner's associates. “The Christie people are from New Jersey, they act like they’re in charge, and Jared Kushner is like, ‘You're not really in charge,' " one transition team source said last November. At the time, Christie's ouster was spun by the Trump team as a move to show Trump's seriousness about "draining the swamp." "Anybody seeing today's news about the appointment of Vice President-elect Mike Pence Michael (Mike) Richard PenceHillicon Valley: Trump signs off on sanctions for election meddlers Russian hacker pleads guilty over botnet Reddit bans QAnon forum FCC delays review of T-Mobile, Sprint merger EU approves controversial copyright law Overnight Defense: Trump marks 9/11 anniversary Mattis says Assad 'has been warned' on chemical weapons US identifies first remains of returned Korean war troops The Ruth Bader Ginsburg 2018 midterm elections: #Vote4RUTH MORE to run the Presidential Transition Team realizes that President-elect Donald J. Trump is serious about changing Washington whether the town likes it or not," then-Trump aide Jason Miller said at the time. "This might ruffle the delicate sensitivities of the well-heeled two-martini lunch set, but President-elect Trump isn't fighting for them, he's fighting for the hard-working men and women outside the Beltway who don't care for insider bickering," Miller added.

Summary: Despite reportedly being Donald Trump's fast-food fetcher during the campaign, Chris Christie really seemed to want to keep working on the former's transition team, admitting he was legitimately bummed when he was unceremoniously removed from that role and replaced with VP-elect Mike Pence. But per the Week and the Hill, that McDonald's run may have been a myth from the start, and Christie apparently doesn't blame Trump at all for dumping him for Pence-because he thinks it was Jared Kushner's doing. Those reports both emerge from a Politico interview with the outgoing New Jersey governor, who spent nearly three hours dishing with Josh Dawsey on the 2016 election, his state's Bridgegate, and everything in between. Christie says as he was being fired just days after the election, he had a heated conversation about the matter with then-aide Steve Bannon, and Christie tried to twist his arm to admit Kushner had been the force behind Christie's firing (Christie had prosecuted Kushner's father in 2005 and helped send him to prison). "I asked," Christie tells Dawsey. "[Bannon] didn't answer. But [based on] subsequent conversations I've had with the president, I just don't believe this was the president's decision." And that tale about Christie heading to McDonald's for Trump? Ex-Trump aide Sam Nunberg tells Dawsey he planted the fake story to humiliate Christie. "The sad reality is that it was believable," Nunberg says. Dawsey's entire sit-down with Christie here, including how longtime aides often thought he made "totally f---ing inexplicable" decisions.

multi_news

en

Write a title and summarize: Toute crise systémique deviendrait impossible puisque les circuits du crédit et des paiements seraient dissociés. REUTERS/PASCAL LAUENER En 1891, après beaucoup d’autres pays, les citoyens suisses votaient pour donner à une banque centrale unique le monopole de l’émission de moyens de paiement, et mettre ainsi fin à l’émission anarchique de billets par les banques commerciales, cause de faillites bancaires, de désastres économiques et de misère sociale et individuelle. Bien entendu, comme partout, les banques ont contourné l’obstacle en émettant des dépôts à vue par le biais du crédit bancaire, et ont repris le contrôle quasi complet de l’offre de monnaie avec toujours les mêmes conséquences : spéculation, inflation, déflation, crises, chômage… Pour les Suisses, à la suite de la crise de 2008, l’intervention massive de l’Etat fédéral pour éviter l’effondrement conjoint du système bancaire et de l’ensemble de l’économie a été le coup de trop. C’est ainsi qu’exerçant leur droit d’initiative, plus de 100 000 Suisses proposent à leurs concitoyens de « revoter » la suppression du pouvoir de création monétaire des banques, comme leurs aïeux l’avaient osé. Il s’agirait de sortir les dépôts à vue du bilan des banques et de traiter cette « monnaie électronique » comme le sont aujourd’hui les billets. Réputée émise par la Banque centrale, cette monnaie serait la propriété exclusive des déposants (alors qu’aujourd’hui, les dépôts ne sont que des créances sur les banques remboursables à vue). Les banques n’agiraient plus que comme des gestionnaires exécutant les ordres de paiement de leurs clients, comme aujourd’hui les conservateurs-titres. Parmi les derniers en 1891 à contrôler leur monnaie, les Suisses seront-ils ainsi les premiers à ouvrir au monde une nouvelle voie pour réformer des systèmes monétaires et financiers en crise? Lire aussi Réguler la finance sans abolir les banques Si la réforme proposée peut paraître surprenante, elle a de solides fondements en science économique. Elle s’inscrit, en fait, dans la droite ligne du plan de l’Ecole de Chicago, élaboré dans les années 1930, et des projets défendus par un grand nombre d’économistes parmi les plus talentueux (des « libéraux » comme Fisher, Simons, Friedman, Allais… ou des keynésiens, comme Tobin, sous la forme du « narrow banking », et Minsky). Jusqu’à une date récente, elle a reposé sur la proposition d’une couverture intégrale des dépôts à vue par des dépôts équivalents à la Banque centrale (monnaie de base). La monnaie scripturale Aujourd’hui, et c’est l’option retenue dans la réforme proposée en Suisse, c’est tout simplement la monnaie scripturale qui deviendrait monnaie de base, comme le proposaient Huber et Robertson en 2000. Une différence de présentation pour un même but : mettre fin au régime actuel d’un système bancaire dit « à couverture fractionnaire » dans lequel les banques peuvent créer ex nihilo 100 de dépôts à vue en émettant un nouveau crédit de 100 sur lequel elles perçoivent un intérêt, n’étant tenues d’en couvrir qu’une fraction minime à la banque centrale. Trois conséquences découleraient de ce changement fondamental : 1) L’alimentation monétaire de l’économie ne dépendrait plus des « humeurs », optimistes ou pessimistes, des agents économiques (envie d’emprunter des emprunteurs et désir de prêter des banques), mais de la politique de la Banque centrale. 2) Tout crédit serait financé par l’épargne courante, donc sans création de pouvoir d’achat additionnel. 3) La rente monétaire des banques liée à leur privilège d’émission de monnaie serait supprimée et rendue à la collectivité, d’où des ressources nouvelles pour celle-ci. Du point de vue du fonctionnement du système économique et financier, les changements seraient considérables. Toute crise systémique deviendrait impossible puisque les circuits du crédit et des paiements seraient dissociés. La régulation économique s’en trouverait facilitée, et les excès spéculatifs limités puisque la création monétaire serait désormais sous le contrôle total de la banque centrale, qui agirait avec souplesse dans le cadre d’objectifs à moyen terme définis constitutionnellement pour éviter les dérapages dans l’utilisation de l’arme monétaire. De ce point de vue, l’articulation entre politique monétaire et politique budgétaire serait renforcée puisque la création monétaire interviendrait dans sa plus grande part comme ressource budgétaire additionnelle (récupération de la rente monétaire) et serait modulée en fonction de la conjoncture. Le marché des fonds prêtables retrouverait tout son rôle d’allocation des ressources d’épargne sans qu’aucun rationnement ne soit à craindre, avec des taux d’intérêt débarrassés des interférences monétaires. En sous-produit de la réforme, les excès de liquidités liés aux politiques de quantitative easing [assouplissement quantitatif] et de stabilisation des changes seraient épongés sans coup férir. Comparés à de tels avantages, qui conduiraient en fait à extirper « le cancer monétaire de nos économies de marché » (Maurice Allais), les efforts que demande la réforme paraissent bien modestes car ils se traduiraient surtout par un surcroît de travail pour les informaticiens, les comptables et les juristes. Aucun effort pour les déposants et les emprunteurs actuels, qui ne verraient aucune différence. Seulement un peu plus de travail pour les banques, qui devraient innover dans la recherche de ressources à terme et pour compenser la perte de la rente monétaire dans un climat de concurrence accrue. Un tel projet de réforme ne vise pas à traiter « la finance en ennemi », mais à lui fournir le cadre institutionnel qui la mettrait vraiment au service de la collectivité.

Title: "Monnaie pleine": un référendum en Suisse pour brider la finance Summary: Plus de 100 000 Suisses ont proposé à leurs concitoyens de "revoter" la suppression du pouvoir de création monétaire des banques, explique Christian Gomez, économiste et ancien banquier. L'initiative a pour objectif de confier l'émission monétaire uniquement à la Banque nationale et non pas aussi aux banques de crédits.

mlsum_fr

fr

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Pathways to College Act''. SEC. 2. FINDINGS. Congress finds the following: (1) An educated workforce is crucial to the success of the United States economy. Access to higher education for all students is critical to maintaining an educated workforce. More than 80 percent of the 23,000,000 jobs that will be created in the next 10 years will require postsecondary education. Only 36 percent of all 18- to 24-year olds are currently enrolled in postsecondary education. (2) Workers with bachelor's degrees earn on average $17,000 more annually than workers with only high school diplomas. Workers who earn bachelor's degrees can be expected to earn $1,000,000 more over a lifetime than those who only finished high school. (3) The ACT recommends that schools-- (A) provide student guidance to engage students in college and career awareness; and (B) ensure that students enroll in a rigorous curriculum to prepare for postsecondary education. (4) The Department of Education reports that the average student-to-counselor ratio in high schools is 315:1. This falls far above the ratio recommended by the American School Counselor Association, which is 250:1. While school counselors at private schools spend an average of 58 percent of their time on postsecondary education counseling, counselors in public schools spend an average of 25 percent of their time on postsecondary education counseling. (5) While just 57 percent of students from the lowest income quartile enroll in college, 87 percent of students from the top income quartile enroll. Of students who were in eighth grade in 2000, only 20 percent of the lowest-income students are projected to attain a bachelor's degree by 2012, compared to 68 percent of the highest income group, according to the Advisory Committee on Student Financial Assistance in 2006. (6) A recent report by the Consortium on Chicago School Research found that only 41 percent of Chicago public school students who aspire to go to college took the steps necessary to apply to and enroll in a 4-year institution of higher education. The report also reveals that only \1/3\ of Chicago students who want to attend a 4-year institution of higher education enroll in a school that matches their qualifications. Even among students qualified to attend a selective college, 29 percent enrolled in a community college or did not enroll at all. (7) The Consortium found that many Chicago public school students do not complete the Free Application for Federal Student Aid, even though students who apply for Federal financial aid are 50 percent more likely to enroll in college. Sixty-five percent of public secondary school counselors at low-income schools believe that students and parents are discouraged from considering college as an option due to lack of knowledge about financial aid. (8) Low-income and first-generation families often overestimate the cost of tuition and underestimate available aid; students from these backgrounds have access to fewer college application resources and financial aid resources than other groups, and are less likely to fulfill their postsecondary plans as a result. (9) College preparation intervention programs can double the college-going rates for at-risk youth, can expand students' educational aspirations, and can boost college enrollment and graduation rates. SEC. 3. GRANT PROGRAM. (a) Definitions.--In this Act: (1) ESEA definitions.--The terms ``local educational agency'' and ``Secretary'' have the meanings given the terms in section 9101 of the Elementary and Secondary Education Act of 1965 (20 U.S.C. 7801). (2) Eligible local educational agency.--The term ``eligible local educational agency'' means a local educational agency in which a majority of the secondary schools served by the agency are high-need secondary schools. (3) High-need secondary school.--The term ``high-need secondary school'' means a secondary school in which not less than 50 percent of the students enrolled in the school are-- (A) eligible for a school lunch program under the Richard B. Russell National School Lunch Act; (B) eligible to be counted under section 1124(c) of the Elementary and Secondary Education Act of 1965 (20 U.S.C. 6333(c)); or (C) in families eligible for assistance under the State program funded under part A of title IV of the Social Security Act (42 U.S.C. 601 et seq.). (b) Competitive Grants to Eligible Local Educational Agencies.--The Secretary is authorized to award grants, on a competitive basis, to eligible local educational agencies to carry out the activities described in this section. (c) Duration.--Grants awarded under this section shall be 5 years in duration. (d) Distribution.--In awarding grants under this section, the Secretary shall ensure that the grants are distributed among the different geographic regions of the United States, and among eligible local educational agencies serving urban and rural areas. (e) Applications.-- (1) In general.--Each eligible local educational agency desiring a grant under this section shall submit an application to the Secretary at such time, in such manner, and accompanied by such information as the Secretary may reasonably require. (2) Contents.--Each application submitted under paragraph (1) shall include a description of the program to be carried out with grant funds and-- (A) a description of the secondary school population to be targeted by the program, the particular college-access needs of such population, and the resources available for meeting such needs; (B) an outline of the objectives of the program, including goals for increasing the number of college applications submitted by each student, increasing Free Application for Federal Student Aid completion rates, and increasing school-wide college enrollment rates across the local educational agency; (C) a description of the local educational agency's plan to work cooperatively with programs funded under chapters 1 and 2 of subpart 2 of part A of title IV of the Higher Education Act of 1965 (20 U.S.C. 1070a-11 et seq. and 1070a-21 et seq.), including the extent to which the agency commits to sharing facilities, providing access to students, and developing compatible record-keeping systems; (D) a description of the activities, services, and training to be provided by the program, including a plan to provide structure and support for all students in the college search, planning, and application process; (E) a description of the methods to be used to evaluate the outcomes and effectiveness of the program; (F) an assurance that grant funds will be used to supplement, and not supplant, any other Federal, State, or local funds available to carry out activities of the type carried out under the grant; (G) an explanation of the method used for calculating college enrollment rates for each secondary school served by the eligible local educational agency that is based on externally verified data, and, when possible, aligned with existing State or local methods; and (H) a plan to make the program sustainable over time, including the use of matching funds from non- Federal sources. (3) Method of calculating enrollment rates.-- (A) In general.--A method included in an application under paragraph (2)(G)-- (i) shall, at a minimum, track students' first-time enrollment in institutions of higher education; and (ii) may track progress toward completion of a postsecondary degree. (B) Development in conjunction.--An eligible local educational agency may develop a method pursuant to paragraph (2)(G) in conjunction with an existing public or private entity that currently maintains such a method. (f) Special Consideration.--In awarding grants under this section, the Secretary shall give special consideration to applications from eligible local educational agencies serving schools with the highest percentages of poverty. (g) Use of Funds.-- (1) In general.--An eligible local educational agency that receives a grant under this section shall develop and implement, or expand, a program to increase the number of low- income students who enroll in postsecondary educational institutions, including institutions with competitive admissions criteria. (2) Required use of funds.--Each program funded under this section shall-- (A) provide professional development to secondary school teachers and counselors in postsecondary education advising; (B) ensure that each student has not less than 1 meeting, not later than the first semester of the first year of secondary school, with a school counselor, college access personnel (including personnel involved in programs funded under chapters 1 and 2 of subpart 2 of part A of title IV of the Higher Education Act of 1965 (20 U.S.C. 1070a-11 et seq. and 1070a-21 et seq.)), trained teacher, or other professional or organization, such as a community-based organization, approved by the school, to discuss postsecondary options, outline postsecondary goals, and create a plan to achieve those goals; (C) provide information to all students enrolled in the secondary schools served by the eligible local educational agency and parents beginning in the first year of secondary school on-- (i) the economic and social benefits of higher education; (ii) college expenses, including information about expenses by institutional type, differences between sticker price and net price, and expenses beyond tuition; (iii) paying for college, including the availability, eligibility, and variety of financial aid; and (iv) the forms and processes associated with applying for financial aid; and (D) ensure that each secondary school served by the eligible local educational agency develops a comprehensive, school-wide plan of action to strengthen the college-going culture within the school. (3) Allowable use of funds.--Each program funded under this section may-- (A) establish mandatory postsecondary planning classes for secondary school seniors to assist the seniors in the college preparation and application process; (B) hire and train postsecondary coaches with expertise in the college-going process; (C) increase the number of counselors who specialize in the college-going process serving students; (D) train student leaders to assist in the creation of a college-going culture in their schools; (E) provide opportunities for students to explore postsecondary opportunities outside of the school setting, such as college fairs, career fairs, college tours, workplace visits, or other similar activities; (F) assist students with test preparation, college applications, Federal financial aid applications, and scholarship applications; (G) establish partnerships with programs funded under chapters 1 and 2 of subpart 2 of part A of title IV of the Higher Education Act of 1965 (20 U.S.C. 1070a-11 et seq. and 1070a-21 et seq.)), and with community and nonprofit organizations to increase college-going rates at secondary schools served by the eligible local educational agency; (H) provide long-term postsecondary follow up with graduates of the secondary schools served by the eligible local educational agencies, including increasing alumni involvement in mentoring and advising roles within the secondary school; (I) create and maintain a postsecondary access center in the school setting that provides information on colleges and universities, career opportunities, and financial aid options and provide a setting in which professionals working in programs funded under chapters 1 and 2 of subpart 2 of part A of title IV of the Higher Education Act of 1965 (20 U.S.C. 1070a-11 et seq. and 1070a-21 et seq.)), can meet with students; (J) deliver college and career planning curriculum as a stand-alone course, or embedded in other classes, for all students in secondary school; and (K) increase parent involvement in preparing for postsecondary opportunities. (h) Supplement, Not Supplant.--Funds made available under this section shall be used to supplement, and not supplant, other Federal, State, and local funds available to carry out the activities described in this section. (i) Technical Assistance.--The Secretary, directly or through contracting through a full and open process with 1 or more organizations that have demonstrated experience providing technical assistance to raise school-wide college enrollment rates in local educational agencies in not less than 3 States, shall provide technical assistance to grantees in carrying out this section. The technical assistance shall-- (1) provide assistance in the calculation and analysis of college-going rates for all grant recipients; (2) provide semi-annual analysis to each grant recipient recommending best practices based on a comparison of the recipient's data with that of secondary schools with similar demographics; and (3) provide annual best practices conferences for all grant recipients. (j) Evaluation and Reporting Requirements.-- (1) Measure enrollment and track data.--Each eligible local educational agency that receives a grant under this section shall-- (A) measure externally verified school-wide college enrollment; and (B) track data that leads to increased college going, including college applications sent and Free Application for Federal Student Aid forms filed. (2) Evaluations by grantees.--Each eligible local educational agency that receives a grant under this section shall-- (A) conduct periodic evaluations of the effectiveness of the activities carried out under the grant toward increasing school-wide college-going rates; (B) use such evaluations to refine and improve activities conducted with the grant and the performance measures for such activities; and (C) make the results of such evaluations publicly available, including by providing public notice of such availability. (3) Report.--Not later than 3 years after the date of enactment of this Act, the Secretary shall submit to the appropriate committees of Congress a report concerning the results of-- (A) the evaluations conducted under paragraph (2); and (B) an evaluation conducted by the Secretary to analyze the effectiveness and efficacy of the activities conducted with grants under this section.

Title: A bill to authorize the Secretary of Education to award grants to local education agencies to improve college access Summary: Pathways to College Act - Authorizes the Secretary of Education to award competitive five-year grants to local educational agencies that serve mostly high-need secondary schools for programs to increase the number of students from low-income families who attend college. Defines "high-need secondary schools" as those where at least one-half of the students are from low-income families. Requires grantees to use such funds to: (1) train teachers and counselors to provide students with advice concerning postsecondary education; (2) ensure that each student receives postsecondary information and planning assistance before the end of their first semester of secondary school; (3) inform students and parents regarding the benefits, expenses, and financing of higher education; and (4) ensure that their schools develop comprehensive, school-wide plans of action to strengthen their college-going culture. Directs the Secretary to provide technical assistance to grantees in calculating and analyzing their college-going rates and adopting best practices for elevating such rates. Requires grantees to measure externally verified school-wide college enrollment, track data that leads to increased college-going, and evaluate the success of their grant activities.

billsum

en

Summarize: BACKGROUND OF THE INVENTION [0001] 1. Field of the Invention [0002] The present invention relates generally to electrocardiogram (ECG) and blood oxygenation (SpO 2 ) sensors, and more particularly to a novel periumbilical sensor array for placement on a newborn infant and its use in association with an umbilical cord clamp, all within a wireless monitoring system. [0003] 2. Description of the Related Art [0004] The monitoring of the heart and overall circulatory system of certain newborn infants becomes important when any of a number of symptoms indicate possible congenital or acquired conditions that may require treatment. Two monitoring methods associated with the heart and the circulatory system that are frequently applied to patients of all ages are electrocardiograph measurements and blood oxygenation measurements. Attempts to monitor these parameters for newborn infants meet with specific problems related to the fragility of infant skin surfaces and the tendency of infants to actively reject the placement of wired sensor patches and the like on their bodies. [0005] ECG devices are medical devices that measure the electrical activity of the heart. The beating of the heart is coordinated by electrical nerve impulses and the resultant muscle contractions. This electrical activity of the heart can be measured by an ECG system and the rhythms analyzed to determine if the heart is beating as it should. This measurement and analysis includes the rate and regularity of beats as well as the size and position of the chambers, any damage to the heart, and the effects of drugs or of devices to regulate the heart. [0006] Infants who might have an ECG performed include those with suspected congenital heart disease, cardiomyopathy, or arrhythmia that may have been initially seen on a simple heart rate monitor. The ECG is non-invasive and is typically obtained by placing small pads or electrodes (called leads) on the surface of the infant&#39;s chest and abdomen. These leads are attached with wires to the ECG monitoring instrument that reads the electrical signals. The heart rhythm may be displayed and/or printed as a graph to be interpreted by the cardiologist. The ECG trace will indicate what happens to the electrical signal each time the heart beats. The different “waves” or peaks on an ECG trace show the electrical signals within the body triggering different parts of the heartbeat. [0007] ECG measurements can suffer from the introduction of unintended artifacts in the sensed data. Artifacts are changes in the graphed rhythm that are not attributable to the electrical activity of the heart and are common in newborn ECG measurements. Various causes include limb lead reversal, incorrect chest lead positioning, electrical interference from other hospital equipment, and various types of patient movement common in neonates such as hiccoughs. [0008] For most patients, including newborn infants, there are few significant risks associated with the process of obtaining an ECG. The most common is mild irritation of the skin from the application and removal of the electrodes. An ECG monitor is used on most newborn infants in neonatal intensive care units (NICU), such as babies with apnea related to prematurity, or babies receiving medications that elevate the heart rate. However, ECGs are reluctantly carried out for very small premature infants because the chest is so small and the skin is still very fragile. [0009] In a standard twelve-lead ECG, electrodes are attached to the surface of the patient&#39;s body, with each electrode corresponding to a particular area of the patient&#39;s heart. Because the hearts of neonatal patients are anatomically shifted more to the right of the body than the hearts of adult patients, it is often necessary to monitor neonatal patient&#39;s hearts with right-sided chest electrodes for ECG diagnostic and monitoring procedures. [0010] It is often easier to carry out ECG measurements on newborn infants with the much simpler three-lead ECG. While still providing valuable information about the condition of the heart, only three electrodes are positioned on the skin, making for a much easier implementation on small patients. In a three-electrode system, the signal from one electrode is used as a reference signal for a difference between the signals of two other electrodes (e.g. ECG vector). By using this reference signal, and a differential amplifier configuration, a very good (albeit simpler) ECG trace can be acquired. [0011] Accurate placement of the electrodes is a primary concern when preparing a patient for an ECG procedure. If the electrodes are not positioned properly or if they do not properly contact the patient&#39;s skin, the recorded data may be invalid. Conventional electrodes are positioned individually on the patient with each electrode being coupled to a separate lead wire. Acquiring a multi-lead ECG for a neonatal patient with conventional electrodes encounters several problems. Accurately positioning and attaching as many as thirteen conventional electrodes to a neonatal patient can be difficult and time consuming even for a skilled clinician. Due to the small chest size of neonatal patients, the conventional electrodes are often too large to fit. Moreover, the electrodes do not adhere well and often irritate the delicate skin of the neonate. The close proximity of the electrodes makes clipping on as many as thirteen lead wires very difficult, with the lead wires often becoming tangled during the attachment process. [0012] Lead wires from electrodes in general will inhibit movement by and around the patient. The wires will stress the electrodes, resulting in malfunction or disconnection from the patient. Because patients need to be moved often during a day, the electrodes also must often be removed and replaced. If not replaced in exactly the same position, the ECG will be different over time. These problems are magnified in the case of neonatal patients whose movements cannot be controlled as easily as the movements of adult patients. Since conventional electrodes do not adhere well to the skin of neonatal patients, the electrodes are even more likely to detach. [0013] Even if the electrodes remain in place and the lead wires remain untangled while a first set of ECG data is acquired; it is difficult to repeat the exact placement of the electrodes in order to acquire subsequent sets of ECG data from the same patient. Consecutive sets of ECG data are often required in order to periodically monitor the patient&#39;s recovery progress or general cardiac health. In order to make a valid comparison, the electrode placement for the subsequent sets of ECG data must be the same as the first set of ECG data. [0014] Some efforts have been made to address the problems associated with the placement and use of many electrodes and many lead wires. Wireless ECG systems connect the electrodes to a transmitter to avoid the long wires form the patient to a monitor. Some efforts have also been made to provide an ECG device (both wired and wireless) that eliminates the need to precisely position the electrodes on the patient and prevents the tangling of lead wires. These efforts have generally been directed at providing for a strip of electrodes that are connected to a single bundled lead wire cable. In general, however, these efforts have been unsuccessful in eliminating the problems described above for the neonatal patient. Some of these efforts in the past include the following: [0015] U.S. Pat. No. 6,453,186 B1 issued to Lovejoy et al. on Sep. 17, 2002 entitled Electrocardiogram Electrode Patch describes an electrocardiogram (ECG) electrode patch for attachment to a neonatal or infant patient. The ECG electrode patch includes a plurality of at least three electrodes coupled to a substrate. [0016] U.S. Pat. No. 5,425,362 issued to Siker et al. on Jun. 20, 1995 entitled: Fetal Sensor Device discloses an apparatus and method for non-invasively sensing parameters associated with the health of a fetus, the health of the placenta and the mother. The device includes a probe for inserting the sensors within the uterus of the mother. The sensors are described as potentially measuring heart rate, oxygen saturation, temperature, chemical parameters and electroencephalogram activity. [0017] U.S. Pat. No. 6,551,252 B2 issued to Sackner et al. on Apr. 22, 2003 entitled: Systems and Methods for Ambulatory Monitoring of Physiological Signs describes a system directed to the field of ambulatory monitoring. The sensors include one or more ECG leads and one or more inductive plethysmographic sensors with conductive loops positioned close to the individual to monitor at least basic cardiac parameters, basic pulmonary parameters, or both. The monitoring apparatus also includes a wired unit for receiving data from the sensors, and for storing the data in a computer-readable medium. [0018] U.S. Pat. No. 5,868,671 issued to Mahoney on Feb. 9, 1999 entitled: Multiple ECG Electrode Strip discloses a harness for placement on a patient&#39;s chest to allow for ECG measurements. The harness includes a strip of nonconductive film having a connector terminal at one edge for connection to an ECG measuring devise. The strip has a number of electrodes formed on it, each having leads extending to the connector terminal. A backing layer may be peeled-off to expose the electrodes. [0019] U.S. Pat. No. 6,611,705 B2 issued to Hopman et al. on Aug. 26, 2003 entitled Wireless Electrocardiograph System and Method describes a method and system for wireless ECG monitoring. An electrode connector, transmitter and receiver operate with existing electrodes and ECG monitors. [0020] U.S. Patent Application Pub. No. 2004/0073127 A1 filed by Istvan et al. on May 16, 2003 entitled: Wireless ECG System discloses a wireless monitoring system similar to the Hopman et al. system described above. The wireless transceiver is described as being strapped to the arm of the patient and removably connected to the sensor wire leads. [0021] As indicated above, hemoglobin oxygen saturation is a second circulatory system parameter that can provide valuable information about a patient, especially neonatal patients with symptoms of congenital problems. An oxygen saturation monitor in its most common form, known as a pulse oximeter, is a medical device used to monitor the amount of oxygen in the blood. In its most basic form, a small cuff with a light element and a light sensor is wrapped around the infant&#39;s foot, hand, toe, or finger. Light passes through the tissues from one side of the cuff to the other. The light waves are altered by the amount of oxygen in the blood, the measurement of which allows for a calculation of the percentage of blood oxygenation. The typical prior art approach for measuring oxygen saturation uses a large non-portable bedside unit, or a portable unit with recording capabilities limited to oxygen saturation. Such devices typically display a measurement in a hospital or laboratory setting. Such devices, when portable, typically are limited to short duration recording or recording only of oxygen saturation. [0022] Pulse oximetry is currently the most widely used, non-invasive form of oxygen monitoring. Some pulse oximeters are built into cardio-respiratory monitors, which also display the heart rate, respiration characteristics, and blood pressure. The oximeter allows the amount of oxygen in the blood to be monitored without having to actually draw blood from the patient for laboratory testing. Pulse oximeters are not typically harmful to infants. They do not require frequent rotation of sample sites and do not burn or require calibration. However, they are subject to false readings and false alarms due to the frequent and uncontrolled movement of the infant patient Some efforts have been made in the past to address the problems associated with pulse oximetry in the neonatal environment. These include the following: [0023] U.S. Pat. No. 6,125,296 issued to Hubelbank on Sep. 26, 2000 entitled Electrocardiographic and Oxygen Saturation Signal Recording describes a portable machine which records electrocardiograph and oxygen saturation data signals in a removable memory device. The information is provided by an oxygen saturation sensor attached to a patient and having lead wires with electrodes attached directly to the patient. [0024] U.S. Pat. No. 6,470,200 B2 issued to Walker et al. on Oct. 22, 2002 entitled Pacifier Pulse Oximeter Sensor describes a sensor structured to be incorporated into an infant pacifier. This system relies on a reflective technology rather than the transilluminescence of most pulse oximeters. [0025] Other efforts have been made to generally improve pulse oximeters by reducing their size and their power requirements. Efforts have also been made to improve accuracy and the range of information provided. Some of these efforts in the past include the following: [0026] U.S. Pat. No. 6,714,804 B2 issued to Al-Ali et al. on Mar. 30, 2004 entitled: Stereo Pulse Oximeter describes a multi-lead, multi-point system that looks at oxygen saturation in various locations in the patient. The system is described as being particularly useful in the management of persistent pulmonary hypertension in neonates. [0027] U.S. Pat. No. 6,697,658 B2 issued to Al-Ali on Feb. 24, 2004 entitled: Low Power Pulse Oximeter describes a modified sampling mechanism that serves to reduce the power consumption of a pulse oximeter. [0028] U.S. Pat. No. 6,496,711 B1 issued to Athan et al. on Dec. 17, 2002 entitled: Pulse Oximeter Probe describes a system that utilizes a light to frequency converter to improve accuracy in a portable pulse oximeter unit. [0029] The Sackner et al. device described above does make an effort to combine ECG and oxygen saturation measurements into a single unit but fails entirely to address the concerns associated with the neonatal patient, operating as it does in the ambulatory field. Placement of the combined sensor system on the newborn infant remains the most difficult problem to overcome. Some efforts have been made in the past to attach various devices, some electronic, to the umbilical cord stub of a newborn, where the stub is established by a clamping device that remains in place for a period of time. Most of these however are directed to simple identification of the child as opposed to the monitoring of ECG and/or oxygen saturation information. Some of these efforts include: [0030] U.S. Pat. No. 5,006,830 issued to Merritt on Apr. 9, 1991 entitled: Method and Device for Deterring the Unauthorized Removal of a Newborn from a Defined Area discloses a method and device with a locking umbilical clamp having an attached identification mark and an attached triggering device. A detection system is triggered upon the removal of the umbilical clamp from a defined area. A wristband is provided, also with an identification mark, for attachment to the wrist of a person authorized to remove the newborn from the defined area. [0031] U.S. Pat. No. 5,440,295 issued to Ciecwisz et al. on Aug. 8, 1995 entitled: Apparatus and Method for Preventing Unauthorized Removal of a Newborn Infant from a Predetermined Area describes an apparatus that includes an electrical transponder detachably securable to an umbilical cord clamping device. When the clamping device is closed the transponder unit also becomes attached to the umbilical cord of the infant. When the infant is discharged from the maternity ward the transponder units can be recycled by removal with the umbilical cord clamp. [0032] U.S. Patent Application Pub. No. 2001/0035824 A1 filed by Fourie et al. on Apr. 18, 2001 entitled: Infant Monitoring and Identification Apparatus describes a system and method for monitoring a controlled area in a maternity ward or other healthcare facility. Access-ways to and from the controlled area are provided with monitoring stations and all infants and mothers are provided with a co-operant pair of monitored devices. The devices have communication means enabling wireless communication of identification data. In the case of the infant this identification device is included in the umbilical cord clamp. [0033] While many attempts have been made in the past to provide ECG and SpO 2 monitoring systems that meet the special needs of a neonate, few if any of the devices accommodate the movement and size of a newborn and provide the convenience of a single device that can monitor both the ECG and the oxygen saturation. The goals of data accuracy and patient comfort are simply not met by any system described in the prior art. It would be desirable therefore to have a system for monitoring ECG and SpO 2 in a newborn infant that provides for repeatable accurate placement of the necessary sensors, comfort to the sensitive skin of the newborn, wireless capabilities to eliminate the presence of long sensor leads, and the use of already existing “attachments” to the newborn for the placement and positioning of the wireless transceiver unit. SUMMARY OF THE INVENTION [0034] The above-mentioned difficulties in positioning and attaching conventional electrodes and lead wires to neonatal patients to acquire a multi-lead ECG, mean that multi-lead ECGs are acquired from these patients less often than from adult patients and less often than desired. Thus, there is a need in the field for a device that provides easy, accurate, and consistent attachment of an ECG sensor on a neonatal patient. Accordingly, the present invention provides a novel periumbilical ECG sensor for placement on a newborn infant. [0035] It is an advantage of the present invention to reduce the labor and time associated with the positioning and placement of electrodes on a patient for an ECG procedure. It is another advantage of the invention to ensure consistent placement of these electrodes. It is still another advantage of the invention to minimize the total cost of the materials and equipment for implementing an ECG procedure. Yet another advantage of the invention is the elimination of the need for individual lead wires. [0036] It is still a further advantage of the present invention to improve the reliability and integrity of the acquired ECG data. It is still another advantage of the invention to improve the procedure for acquiring ECGs from neonatal patients. [0037] The present invention also permits the collection of saturated oxygen data from the same monitoring equipment in order to further simplify the number of devices and attachments required to monitor the neonate. Conventional SpO 2 data collection devices are subject to false data due to movement and the present invention provides a means to collect the data with minimal risk of artifacts due to movement. The present invention provides a manner of accurately and securely positioning an SpO 2 sensor on an infant to reduce the acquisition of false data. [0038] It is yet another advantage of the present invention to provide a transceiver for wirelessly transmitting the ECG and SpO 2 signals to a monitoring station for display. Various other features and advantages of the invention are set forth in the following drawings, detailed description, and claims. BRIEF DESCRIPTION OF THE DRAWINGS [0039] FIG. 1 is a front view of a sensor constructed in accordance with the present invention. [0040] FIG. 2 is a schematic block diagram of the components of the present invention and their functional relationships. [0041] FIG. 3 is a perspective view showing an application of the system of the present invention in place on an infant in a medical care setting. [0042] FIG. 4 is a detailed view of the implementation of the sensor of the present invention in conjunction with an umbilical cord clamp. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS [0043] Reference is made first to FIG. 1 for a description of the periumbilical sensor component of the present invention. Periumbilical sensor array 10 in accordance with the present invention preferably comprises a base 12 having three ECG electrodes 14, a hemoglobin oxygen saturation (SpO 2 ) sensor 15 (comprising a light source 20 and a photo detector 18 ) and a pair of arms 16 (comprising hook and loop fasteners 17 and 19 ). ECG electrodes 14 are connected to ribbon cable 40 by way of wires 22, 28, and 30 and are positioned on the distal ends of three radiating extensions of base 12. [0044] Light source 20 and photo detector 18 of SpO 2 sensor 15 are connected to ribbon cable 40 by way of wires 24 and 26. In one preferred embodiment, light source 20 would comprise a visible light LED (light emitting diode) and an infrared LED as is known in the art of pulse oximetry. In such an embodiment, wire 26 may actually comprise two or more wires to provide the necessary electrical connections to drive the light sources of SpO 2 sensor 15. Likewise, wire 24 connected to photo detector 18 may actually comprise two or more wires as necessary to provide the electrical connection to receive the data signal from the photo detector 18, again as is well know in the art of pulse oximetry. [0045] Base 12 is preferably made from a fabric material but may also be made of plastic or other suitable material. Base 12 may be of multi-layer construction to provide both strength (as a substrate for the sensors and wires described above) and comfort for the infant. Adhesive areas, as described in more detail below, may be incorporated into the skin side of base 12 for placement and positioning of the sensor array on the infant. [0046] Reference is now made to FIG. 2 for a description of the various functional components of the present invention and their interaction to provide the monitoring of the ECG and SpO 2 of the infant. FIG. 2 is a schematic block diagram-showing the functional arrangement of the various components including the periumbilical sensor array base patch 10. Sensor array 10 is shown as functionally comprising ECG sensors 14 and SpO 2 sensor 15. These sensors are connected (as described above) to a component incorporated into the enclosure of umbilical cord clamp 50 by way of ribbon cable 40 (shown in FIG. 1 ). This short length of hardwire connection between the sensor array 10 and the electronic components enclosed within cord clamp 50 is flexible enough and short enough to pose little opportunity for entanglement or discomfort. The actual connection to the cord clamp enclosure is described in more detail below. [0047] The electronic components enclosed in cord clamp 50 enclosure include sensor electronics 52 and data signal transceiver 54. In the preferred embodiment, sensor electronics 52 comprise basic signal processing circuitry necessary to receive and condition the sensor data in a manner that makes the signal suitable for localized RF (radio frequency) transmission. Under some circumstances it may be desirable to utilize non-RF wireless transmissions (such as IR or other frequency light communications) in a manner of substitution well known in the art. Likewise, sensor electronics 52 comprise the basic driver circuitry necessary to drive the light source LED(s) of SpO 2 sensor 15. The specific circuitry associated with the pulse oximetry sensor components is not unique to the present invention and is of the type typically required for transillumination pulse oximetry. Alternate embodiments of the present invention could incorporate more or less of the required circuitry into the cord clamp enclosure 50. In one embodiment, the necessary pulse oximetry sampling controller circuitry could be fully incorporated into the sensor electronics package 52 such that the light source driver circuitry requires no outside input signal to operate. In such an embodiment data signal transceiver 54 may in actuality simply be a transmitter with no requirement that a control signal to the pulse oximetry sensor be transmitted to the unit within the cord clamp enclosure 50. [0048] Finally included within umbilical cord clamp enclosure 50 is DC power supply 56, which in the preferred embodiment is simply a lithium cell battery of sufficient life to supply the sensors and sensor electronics with the necessary voltages typically required for such operation over a number of weeks. Data signal transceiver 54 (which also receives power from DC power supply 56 ) takes the sensor signal data and provides the necessary electronics (known in the art) to transmit the data signal containing the sensor data in the form of a short range RF transmission. Likewise, in the event the sampling controller components of the pulse oximetry circuitry are not incorporated into sensor electronics 52, signal transceiver 54 will contain the electronic circuitry necessary to receive the RF transmissions that would control the light source drivers for the SpO 2 sensor 15. [0049] At a point remote from the sensor array base patch 10 and the umbilical cord clamp 50 are positioned the necessary electronics to send and receive the data signals to and from the data signal transceiver 54. As described in more detail below, these electronic components would typically be positioned adjacent the bed surface or enclosure that the infant is placed within while monitoring is to occur. Data signal transceiver 62 receives the RF signal from data signal transceiver 54 and pre-processes the signal before passing it to signal analyzer electronics 64. The monitoring base station components 62 and 64 are powered by standard AC power source 66 as is typical in the field of wireless monitoring devices. Also as typical in patient monitoring devices, the signal data may be conditioned and presented for viewing on a data display device 68 (such as an instrument display screen or a chart recorder), or may be sent to a data record storage medium 70 for later retrieval or for distant downloading and review. [0050] Referring now to FIG. 3, periumbilical sensor array 10 is shown positioned on a newborn infant by fastening arms 16 about the infant&#39;s umbilical cord stub. Although arms 16 preferably have hook and loop fasteners 17 and 19 thereon as described above, any suitable fasteners (such as snaps or buckles) will suffice for this purpose. Alternatively, arms 16 may be of sufficient length as to tie them around the umbilical cord stub. The base material of sensor array 10 also preferably has an adhesive, such as an adhesive with a peel-off disposable covering, for firmly adhering the array of electrodes 14 to the skin of the infant. End 42 (shown in FIG. 1 ) of ribbon cable 40 is connected to the electronics module (not shown) in the rear cavity of an umbilical cord clamp 50 of the type described in U.S. Pat. No. 6,443,958, the disclosure of which is incorporated herein by reference. [0051] Umbilical cord clamp 50 is constructed in a manner that allows it to both cut and seal the umbilical cord after the birth of the infant. The structure is such that once closed the cutting and clamping surfaces are fully enclosed within the clamp which is designed to permanently remain closed even as the umbilical cord stub falls off of the infant. The enclosure associated with this type of clamp permits the incorporation of a small electronics package into its interior with no or only slight modification to the shape and size of the clamp. [0052] As shown in FIG. 3, the infant “wears” the combination of the umbilical cord clamp 50 and the sensor array 10 with the short length of ribbon cable 40 connecting them. The base station monitoring equipment consisting of data signal transceiver 62, signal analyzer electronics 64, and data display device 68, are shown as they would be positioned close to the infant. [0053] FIG. 4 shows in greater detail the arrangement whereby the sensor array 10 of the present invention is connected to the umbilical cord clamp 50 by way of ribbon cable 40. The preferred arrangement shown would comprise a flexible direct connection between the ribbon cable 40 and the individual wires of sensor array 10. Connection of the ribbon cable 40 to the electronics module 52 housed within cord clamp 50 would be removably achieved by way of connector 55 rigidly positioned on cord clamp 50. Other arrangements whereby other ribbon cable connectors may be positioned adjacent the sensor array in place of or in addition to the connector on the cord clamp are anticipated. [0054] As indicated above, the preferred sensor for measuring SpO 2 in the infant&#39;s blood hemoglobin is for transilluminational pulse oximetry involving a measurement of oxygenation levels across a capillary bed through interposed skin layers. This can be accomplished at the umbilical cord stub in part because of the highly vascular tissue present at the location and in part because of the manner in which the stub extends away from the infant&#39;s skin surface. The light source and light detector components of the pulse oximetry sensor are for clarity shown in FIG. 4 as laying generally in the same plane when in actuality the attachment of arms 16 around the cord stub would place them in an appropriately opposing orientation across the base of the stub. It is anticipated, however, that slight modifications of the sensor arrangement could make it plausible to utilize a reflectance oximetry approach that would not require the sensor components to be positioned in opposition to each other. [0055] Although the foregoing specific details describe a preferred embodiment of this invention, persons reasonably skilled in the art will recognize that various changes may be made in the details of this invention without departing from the spirit and scope of the invention as defined in the appended claims. Therefore, it should be understood that this invention is not to be limited to the specific details shown and described herein.

Summary: A periumbilical infant ECG sensor for measuring the heartbeat of a newborn infant. The ECG sensor also preferably includes an SAO2 sensor for measuring the oxygen saturation level of the infant&#39;s haemoglobin. The ECG sensor is fastenable about the stub of the infant&#39;s umbilical cord. The ECG sensor is preferably connected to an electronics module housed in a cavity of an umbilical cord clamp. The electronics module has a power source for supplying power to the ECG sensor and the SAO2 sensor and a transceiver for wirelessly transmitting the ECG and SAO2 signals to a monitoring station.

big_patent

en

Write a title and summarize: We present a simple model for coherent, spatially correlated chaos in a recurrent neural network. Networks of randomly connected neurons exhibit chaotic fluctuations and have been studied as a model for capturing the temporal variability of cortical activity. The dynamics generated by such networks, however, are spatially uncorrelated and do not generate coherent fluctuations, which are commonly observed across spatial scales of the neocortex. In our model we introduce a structured component of connectivity, in addition to random connections, which effectively embeds a feedforward structure via unidirectional coupling between a pair of orthogonal modes. Local fluctuations driven by the random connectivity are summed by an output mode and drive coherent activity along an input mode. The orthogonality between input and output mode preserves chaotic fluctuations by preventing feedback loops. In the regime of weak structured connectivity we apply a perturbative approach to solve the dynamic mean-field equations, showing that in this regime coherent fluctuations are driven passively by the chaos of local residual fluctuations. When we introduce a row balance constraint on the random connectivity, stronger structured connectivity puts the network in a distinct dynamical regime of self-tuned coherent chaos. In this regime the coherent component of the dynamics self-adjusts intermittently to yield periods of slow, highly coherent chaos. The dynamics display longer time-scales and switching-like activity. We show how in this regime the dynamics depend qualitatively on the particular realization of the connectivity matrix: a complex leading eigenvalue can yield coherent oscillatory chaos while a real leading eigenvalue can yield chaos with broken symmetry. The level of coherence grows with increasing strength of structured connectivity until the dynamics are almost entirely constrained to a single spatial mode. We examine the effects of network-size scaling and show that these results are not finite-size effects. Finally, we show that in the regime of weak structured connectivity, coherent chaos emerges also for a generalized structured connectivity with multiple input-output modes. Firing-rate fluctuations and irregular spiking are ubiquitous in the neocortex [1,2]. Furthermore this temporal variability is often observed to be correlated across spatial scales ranging from local cortical circuits to the entire brain: in local cortical circuits both in membrane potential fluctuations [3] and on the level of spiking [4–7], in the coherency measured in brain-wide EEG signals [8,9], and in the global signal observed across all voxels in fMRI measurements [10–12]. A class of theoretical models has successfully accounted for temporal variability via internally generated chaotic dynamics of recurrent networks, whether through excitation-inhibition balance in spiking models [13,14] or the more abstract models of rate chaos in randomly connected networks [15]. Yet a key emergent feature of these models is the decorrelation of neural activity such that the macroscopic, population activity remains nearly constant in time. Population-wide coherence or synchrony can be generated in a variety of ways for example by introducing spatial modes with self-excitation, but this comes at a cost of drowning out the chaotic fluctuations and yielding fixed points [16]. Indeed a major challenge to theorists has been to produce network models which generate spatially coherent, temporally irregular fluctuations which can account for broad spatial correlations observed in experiments. Two recent studies have shown that excitation-inhibition balance networks can generate spatially modulated correlations [17,18]. In both of these studies the correlations are driven by common input from an external source, and the average correlation across the network remains small. It remains an open question whether a network can internally generate correlated fluctuations that are coherent across the entire network. The chaotic dynamics of a network of randomly connected firing-rate neurons has been well-studied [15,19]. In such a network each individual neuron’s firing rate is given by a non-linear function of its input, which is in turn a weighted sum of the firing rates of all other neurons in the network. The network exhibits a phase transition from a fixed point to chaotic activity in which the randomness of the weights reverberates uncorrelated fluctuations throughout the network. Typically in this chaotic regime pairwise correlations are small and no coherent fluctuations emerge. Here we extend this model by adding a low-rank structured component of connectivity to the random connections. The structured connectivity sums the fluctuations along one spatial mode and projects them along a second, orthogonal mode yielding coherent fluctuations without drowning out the individual neuron variability which continues to drive the chaotic dynamics. A previous work studied a specific example of this structure and focused primarily on analyzing the non-chaotic regime [20]. Here we focus on the chaotic regime and show that this form of structured connectivity together with random connections provides a basic mechanism for internally generating coherent fluctuations. In order to proceed analytically, we take a perturbative approach, assuming J1 ≪ g. In this regime we assume the fluctuations in h ¯ (t) are Gaussian and we turn to computing the autocorrelations of both the coherent component Δ ¯ (τ) ≡ ⟨ h ¯ (t) h ¯ (t + τ) ⟩ (7) and of the residuals, Δ δ (τ) ≡ ⟨ δ h i (t) δ h i (t + τ) ⟩. (8) For small J1 we assume that the coherent current is small (h ¯ ⪡ 1) and therefore in the dynamics of the residual currents (Eq 5) we approximate ∑j Jij ϕj ≈ ∑j Jij ϕ (δhj). The result is that to leading order the autocorrelation of the residuals is given by the zeroth-order (J1 = 0) autocorrelation. That is, the residual currents fluctuate as independent Gaussian processes almost identically to the situation without structured connectivity. These residual fluctuations are summed over the output mode yielding substantial fluctuations in νT δϕ (recall, νi ∼ O (1) ). These in turn drive Gaussian fluctuations in the coherent mode and we show in Methods and S1 Appendix that its autocorrelation is given to first-order by Δ ¯ (τ) ≈ (J 1 g) 2 Δ δ (τ) (9) That is, to leading order the autocorrelation of the coherent component is simply a scaled version of the local, residual autocorrelation. We verify this prediction numerically in Fig 1E for J1 = 0. 1 showing the normalized autocorrelations, q ¯ (τ) = Δ ¯ (τ) Δ ¯ (0) and q δ (τ) = Δ δ (τ) Δ δ (0), as well as the prediction from theory. Qualitatively this means that in this regime chaos is driven by the emergent fluctuations in the local synaptic current similar to in the J1 = 0 case, and that the coherent component can be said to absorb these fluctuations passively along the input mode, ξ. In this regime then, the coherence is given simply by χ = Δ ¯ (0) Δ ¯ (0) + Δ δ (0) ≈ J 1 g (10) Numerically, we find that this approximation provides a good description of the system’s state for up to J 1 g ≈ 0. 2 (Fig 1D). We can understand the coherent chaos in this regime qualitatively: the residual synaptic currents driven by the random connectivity fluctuate as uncorrelated Gaussian processes, and the resulting independent fluctuations in firing rates will be summed over the output mode, ν, which projects to the input mode, ξ, driving coherent fluctuations in h ¯ (t). If the two modes, ξ and ν had substantial overlap then the coherent fluctuations along ξ would drive positive feedback through ν driving the neurons to a fixed point. The orthogonality of these modes effectively embeds a feedforward structure from the output mode, ν, to the input mode, ξ, within the recurrent connectivity. This enables the persistence of stable fluctuations along the input mode, ξ, which do not feedback to ν, thus preventing either saturation or oscillations. Importantly, in the regime of passive coherence we can relax the restrictions on ξ and ϕ: Our results here hold for any smooth, sigmoidal non-linearity and for any ξ which has norm N and is orthogonal to ν. In fact approximate orthogonality is sufficient in this regime: structured connectivity consisting of an outer product of two randomly chosen vectors will generate mildly coherent fluctuations. We observe that as J1 increases to values near g, the network displays significant variability in the dynamics from realization to realization. The coherent mode autocorrelation function, Δ ¯ (τ), for example, is no longer self-averaging (Fig 2A). As we increase system size, N, we find that the realization-to-realization variability in Δ ¯ (0) saturates to a finite value (Fig 2B). Moreover, as J1 increases we observe realization-dependent transitions out of chaos to either fixed points or limit cycles (Fig 2C). The reason for this realization dependence is that as J1 increases and the fluctuations in the coherent mode grow, feedback is generated through the interaction between the random connectivity, J, and the input and output modes, ξ and ν. First of all, J maps the coherent activity back along the input mode with a small realization-dependent component which we ignored in Eq 4 driving feedback directly to the coherent current, h ¯. Secondly, J maps the coherent activity along the the residuals in a realization-dependent direction biasing the residual fluctuations δh. This direction in turn will have realization-dependent component along the output mode, ν, and therefore the coherent activity may additionally drive feedback by pushing the residual fluctuations along the output mode. See S1 Appendix for more details. To suppress the strong realization dependence of the dynamics, we refine the random connectivity matrix by defining J ˜ ≡ J - J ξ ξ T N (11) This subtracts from each row of J its weighted average along the input mode. This “row balance” subtraction has been previously observed to remove realization-dependent outliers from the eigenspectrum of the full connectivity matrix [21,22]. We find here that row balance suppresses realization-to-realization variability in the nonlinear chaotic dynamics, for example reducing the variability in the autocorrelation of the coherent mode, Δ ¯ (τ) (Fig 2D). We observe that with row balance this variability drops as a function of increasing system size, suggesting (although not proving) that the dynamics are now self-averaging in the limit of large N, at least for these values of J1 (Fig 2E). The impact of row balance on the chaotic dynamics can be understood by noting that the resulting connectivity matrix, J ˜, now has a null-space, and the input mode, ξ, lies within it (J ˜ ξ = 0). The result of row balance then is to ensure that the random connectivity matrix filters out any coherent activity fluctuations, ϕ ¯ (t): J ˜ ϕ = J (I - I ξ ξ T N) (ϕ ¯ ξ + δ ϕ) = J δ ϕ (12) This prevents the coherent mode activity from driving feedback to the dynamics of the coherent current (S1 Appendix). Interestingly, we find that row balance allows chaotic fluctuations to persist for larger values of J1, whereas without row balance a substantial fraction of realizations exhibit fixed points or limit cycles for J1 > g (Fig 2F and 2G). Furthermore, the chaotic dynamics are more coherent with row balance than without (Fig 2H). As the structured connectivity is made stronger row balance appears to enable the dynamics to grow increasingly coherent even as chaotic fluctuations persist. When we increase the strength of structured connectivity, J1, we find that with row balance the network yields chaotic dynamics which are strikingly coherent and display switching-like macroscopic activity (Fig 3A). In contrast to the case of weak structured connectivity, the coherent mode dynamics are no longer passively driven by the fluctuations in the residual synaptic currents. This is evidenced by the normalized autocorrelation of the coherent mode, q ¯ (τ), which is no longer close to the normalized residual autocorrelation, qδ (τ), but rather has qualitatively different dynamics including longer time-scales (Fig 3B as compared to Fig 1E). We find that the coherence, χ, increases steadily as a function of the strength of structured connectivity, J1, and notably it is independent of system size (Fig 3C). To check whether this highly coherent state is chaotic, we calculate the largest Lyapunov exponent and verify that the dynamics are indeed chaotic for a vast majority of realizations even as the fluctuations are highly coherent (Fig 3D). We now examine the qualitative changes in the chaotic state of the network with row balance as J1 increases. We observe that for J1 ≲ 1 the fluctuations are unimodal with an approximate Gaussian shape. The temporal fluctuations are dominated by a single time constant as with J1 = 0 (Fig 4A and 4B). On the other hand, for larger values of J1 the fluctuations deviate dramatically from Gaussian and instead become sharply bimodal (Fig 4A). Furthermore, we find that with larger values of J1 the network exhibits intermittent switching between two different values of h ¯ (Fig 4B, top right). We observe that the dynamics at both of these values of h ¯ are qualitatively distinct as reflected by the speed of the dynamics and the level of coherence. We define the speed of the dynamics as the norm of the vector of first time-derivatives per neuron: 1 N ∑ i (d h i d t) 2. Similar measures have been used to find fixed points and slow dynamics in highly non-linear dynamics [23]. We observe that the two distinct values of h ¯ are both associated with vanishing speed (Fig 4B, middle right). Additionally they are associated with very high levels of coherence, i. e. small residuals as quantified by the population variance, 1 N ∑ i (δ h i (t) ) 2 (Fig 4B, bottom right). Evidently, in the network with larger values of J1 there are two distinct states with slow dynamics and high levels of coherence, and the network switches rapidly between these two. In contrast, with mild structured connectivity both the speed and the variance of the residuals remain roughly constant throughout the trial (Fig 4B, left). To gain insight into the emergence of the switching dynamics, we examine the most frequent value of ∣ h ¯ (t) ∣ as a function of J1 and we find that there is a rapid crossover from a state with unimodal fluctuations around zero, to a state with bimodal peaks and that the most frequent value of ∣ h ¯ (t) ∣ saturates quickly with J1 and then remains constant (Fig 4C). What is the nature of this regime? And what determines the two values of h ¯ that come to dominate the dynamics? Because the bouts of slow dynamics are associated with small residuals we linearize the dynamics around h (t) ≈ h ¯ (t) ξ and assume that δhi ≪ 1. This gives ϕ (t) ≈ ϕ ¯ (t) ξ + ϕ ′ (h ¯ (t) ) δ h (13) Note that we have made use of the fact that ξi = ±1 and that ϕ is an odd function. Because ξ is in the null-space of the row-balanced connectivity (J ˜ ϕ = J δ ϕ, as discussed above) the residual dynamics (Eq 5) become d δ h d t = - δ h + ϕ ′ (h ¯) J ^ δ h (14) We observe that in these linearized dynamics the coherent mode current, h ¯ (t), plays the role of a dynamic gain via the slope of the transfer function, ϕ′. In the linearized dynamics we turn to the eigenvectors, u (k), of J ^ and decompose the residual dynamics according to δh = ∑k ck u (k). Given an instantaneous value of h ¯, the independent dynamics of the eigenmodes are d c k d t = (- 1 + ϕ ′ (h ¯) λ k) c k (15) where λk is the kth eigenvalue of J ^. (We show in S1 Appendix that J ^ has the same eigenvalues as J ˜). By the well-known circular law of random matrices, the leading eigenvalue, λ1, has real part approximately equal to g. If ∣ h ¯ (t) ∣ is small then ϕ ′ (h ¯) ≈ 1 and there are many modes that diverge exponentially. If ∣ h ¯ (t) ∣ is large then ϕ ′ (h ¯) ≈ 0 and then all the modes decay exponentially. However, there are two critical values of h ¯ which yield marginal and therefore slow dynamics for the leading mode, c1. These are the values, h ¯ c, for which the slope of the transfer function is equal to 1 g: h ¯ c = ϕ ′ - 1 (1 g) (16) If h ¯ (t) ≈ h ¯ c and the residuals are small then the time constant of fluctuations in the leading eigenmode, (1 - ϕ ′ (h ¯) g) - 1, are very long. Indeed we find that the most frequent value of ∣ h ¯ (t) ∣ as a function of g fits the curve hc (g) very well (Fig 4D). We conclude that the switching between two states each with slow dynamics and a high level of coherence observed in Fig 4B reflects a distinct dynamical regime of self-tuned coherent chaos. In this regime the coherent mode self-adjusts to a critical value so that the dynamics of the small residuals are near-marginal, giving rise to slow dynamics. The above linearized dynamics (Eq 14) are not exact and therefore non-linear interactions eventually destabilize the system and precipitate a state-switch. Nevertheless, the linearized dynamics dominate the dynamics of the small residuals during the bouts of high coherence. As observed in Fig 4C, when we increase J1, the most frequent value of ∣ h ¯ (t) ∣ rapidly increases until it saturates at a value very near to ϕ ′ - 1 (1 g). Moreover, we find that this crossover to the regime of self-tuned coherent chaos occurs at moderate values of J1 (on the order of g), independently of network size. Notice the crucial role of row balance in facilitating self-tuned coherent chaos: row balance filters out the direct contribution of the coherent mode activity to the dynamics of the residuals and enables the coherent mode to act as a dynamic gain. The coherent mode then self-adjusts to cancel the leading eigenvalue of J ^ and yield bouts of slow, highly coherent dynamics. We note that we can loosen the constraint on the symmetry of the transfer function and allow any smooth sigmoidal transfer function if we restrict the input mode to be uniform, ξi = 1 for all i. We show an example of the self-tuned coherent chaotic state for a non-symmetric transfer function in S1 Fig. We generalize our model in order to construct a network with multiple modes of coherent activity. In this extension we take the structural component, M, to be a low-rank matrix comprised of the sum of outer products between input modes, ξ (k), and output modes, ν (k). We require that the subspace spanned by the input modes be orthogonal to the subspace spanned by the output modes. Using singular value decomposition we can find orthogonal bases for each of these subspaces, such that without loss of generality we can additionally assume that each pair of input modes and each pair of output modes are orthogonal. In sum we assume ξ (k) ⊥ ξ (j) and ν (k) ⊥ ν (j) for all j ≠ k, and ξ (k) ⊥ ν (j) for all j, k. We write the structured component of connectivity as M = J 0 ∑ k = 1 d w k N ξ (k) ν (k) T (20) where we have introduced a parameter J0 that controls the overall strength of the structured connectivity, and a set of parameters wk satisfying ∑ k = 1 d w k 2 = 1 that determine the relative weight of the different modes. We can extend our schematic representation and think of each row vector ν (k) T as a separate output mode connected in a feed-forward-like manner to the input mode, ξ (k), (Fig 8A) and then decompose the dynamics into the residual dynamics identical to the above (Eq 5) and the dynamics of the coherent activity along each separate input mode (by approximation analogously to Eq 4): d h ¯ (k) d t ≈ - h ¯ (k) + J 0 w k N ν (k) T ϕ (21) where each separate coherent current is given by h ¯ (k) ≡ 1 N ξ (k) T h. The analytical results found above for the regime of passive coherence can be directly extended to the case of multiple modes. In particular, in the limit where J0 ≪ g, the separate coherent modes are independent of each other and driven passively by the residual fluctuations (Fig 8C) such that Δ ¯ (k) (τ) ≈ J 0 2 g 2 w k 2 Δ δ (τ) (22) where Δ ¯ (k) (τ) = 〈 h ¯ (k) (t) h ¯ (k) (t + τ) 〉 is the autocorrelation function of the kth coherent mode. The resulting covariance matrix, Cij ≡ 〈ϕi ϕj〉, has a low-rank structure which is shaped by the input modes (Fig 8B). In particular, by Taylor expanding ϕi around δhi: C i j ≈ ⟨ (ϕ (δ h i) + ϕ ′ (δ h i) ∑ k h ¯ (k) ξ i (k) ) (ϕ (δ h j) + ϕ ′ (δ h j) ∑ k h ¯ (k) ξ j (k) ) ⟩ (23) Since the residuals are on average uncorrelated and the distinct input modes are orthogonal, we find using Eq 22 that to leading order: C ≈ < ϕ ′ >2 Δ δ (0) J 0 2 g 2 ∑ k = 1 d w k 2 ξ (k) ξ (k) T (24) We generalize our measure of coherence to measure the d-dimensional coherence, or the fraction of total power which is shared along the d input mode directions: χ (d) ≡ ∑ k = 1 d ⟨ (h ¯ (k) ) 2 ⟩ 1 N ∑ i ⟨ h i 2 ⟩ (25) and we find that for J0 ≪ g and finite d χ (d) ≈ J 0 g (26) Numerically, this prediction holds well for up to J 0 g = 0. 2 for at least up to d = 4 as we show in Fig 8D, and we expect it to hold for larger d as well. We note that in the regime of passive coherence, just as in the case of a single coherent mode, we can relax the restrictions on ξ (k) and ϕ: Our results hold for ξ (k) any norm N vector orthogonal to ν (j) ∀j and ξ (j) ∀j ≠ k, and also for ϕ any sigmoidal function. In addition, we can generalize row balance by subtracting the weighted row-average for each input mode such that every ξ (k) will reside in the null space of the new connectivity matrix, J ˜ (d): J ˜ (d) ≡ J - J 1 N ∑ k = 1 d ξ (k) ξ (k) T (27) For d > 2 this generalized row balance does not appear to preserve chaotic fluctuations and instead fixed points or limit cycles appear for J0 ∼ O (1). Intriguingly, for d = 2 we observe that with generalized row balance the chaotic regime persists as the structured connectivity is strengthened and the dynamics become increasingly coherent. The dynamics display switching-like activity in which at any time one of the two coherent modes appears to be near the critical value hc while the other mode is near zero (Fig 8E). It appears that the generalized coherence approaches 1 while chaos persists (Fig 8F) such that we conjecture that just as in the case of d = 1, here too in the large N limit χ (2) → 1 as J0 → ∞. Coherent fluctuations are prevalent in cortical activity ranging in spatial scale from shared variability in membrane potential and spiking in local circuits to global signals measured across the scalp via EEG or across voxels via fMRI [3,4, 9,11]. Constructing a model that intrinsically generates coherent fluctuations has been a challenge to theorists. We have studied the intrinsic generation of coherent chaotic dynamics in recurrent neural networks. Our model consists of rate-based neurons whose recurrent connections include a structured component in addition to random connections. The structured component is a low-rank connectivity matrix consisting of outer products between orthogonal pairs of vectors which allow local fluctuations to be summed along an output mode, amplified and projected to an input mode resulting in coherent fluctuations. The orthogonality of input and output mode effectively embeds a purely feedforward structure within the recurrent connectivity, thus avoiding feedback of the coherent fluctuations along the input mode. In the regime where the structured component is weak, the local synaptic currents are effectively uncoupled from the coherent mode activity and their dynamics are similar to that of a random network with no structured component at all. The local fluctuations are summed by the structured component of connectivity to drive the coherent mode, which follows those fluctuations in a passive manner. In this regime of passive coherent chaos we derive a perturbative dynamical mean-field theory following [15,19] which shows that the coherence grows linearly with the ratio of the strength of structured connectivity to the random connectivity. We show that this analysis extends to multiple modes of coherent activity yielding a finite-rank covariance pattern for the coherent fluctuations. For moderate strength of structured connectivity the network exhibits significant realization-dependence and most realizations transition to either a fixed point or a limit cycle. A realization-dependent theory of these transitions is beyond the scope of this work. We add a row-balance constraint, placing the input mode in the null-space of the random connectivity matrix, and we observe that this constraint preserves chaos, reduces the variability between realizations, and increases the level of coherence. With row balance, increased strength of structured connectivity yields a crossover to a distinct regime of self-tuned coherent chaos. In this regime the network undergoes Up-Down-like switching between two states each of which are characterized by slow, highly coherent dynamics. We show how row balance facilitates this regime by enabling the coherent mode to act as a dynamic gain to the dynamics of the residual currents. Consequently, intermittent marginal dynamics emerge as the coherent mode self-adjusts to one of two critical values. Interestingly the crossover to this self-tuned coherent regime happens for moderate strength of structured connectivity, independently of network size. In the regime of self-tuned coherent chaos, realization-dependent qualitative differences begin to emerge with increasing strength of structured component, J1. For realizations of the row-balanced random connectivity with real leading eigenvalue, symmetry-breaking emerges such that individual initial conditions yield trajectories that spend more time near one of the critical values of the coherent mode than the other. For realizations with complex leading eigenvalue, oscillatory fluctuations begin to emerge. The frequency of these oscillations is well predicted by the phase of the leading eigenvalue. Note that we have not addressed the question of the necessary scaling of J1 for the emergence of realization-dependence in the chaotic regime for the limit of large system size. As structured connectivity is further strengthened chaos persists even as coherence continues to increase until the dynamics are dominated almost entirely by the one dimensional fluctuations of the coherent mode. For a finite network, above some critical strength of the structured component the system converges to either a fixed point or a limit cycle, depending on the leading eigenvalue of the row-balanced random connectivity. Our numerical work suggests that the critical strength of structured connectivity grows with the system size, most likely scaling as J 1 c ∼ N (at least as J 1 c ∼ N). Hence we conjecture that for the scaling of the strength of structured connectivity presented here, as the network size diverges coherent chaos persists independent of J1 for most realizations, and the level of coherence can be brought arbitrarily close to 1. Importantly, in the regime of weak structured connectivity and passive coherence some of the assumptions of our model can be loosened. First, in this regime row balance on the random connectivity is not necessary. Additionally, we need not require the input mode be binary but rather any general pair of orthogonal vectors can serve as input and output mode. Moreover we can loosen the restriction on orthogonality: a random pair of vectors can be used without qualitative impact on the dynamics presented here because the contribution of the realization-dependent overlap between the two vectors in this regime will be negligible relative to the typical contribution from the full-rank random connectivity, J. On the other hand, achieving self-tuned and highly coherent chaos requires the network be finely-tuned to a high degree. The orthogonality of the input and output modes is not enough in order to achieve highly coherent chaos because of interactions between the random and structured components of connectivity. We therefore constrain the random component to satisfy row balance by ensuring that the input mode of the structured connectivity be in the null-space of the random component of connectivity. In addition to row balance, the self-tuned coherence regime depends on the choice of the single-neuron transfer function and input-mode vector. In the case where the transfer function is an odd function, such as tanh used throughout the main text, the input mode can be any binary vector. Otherwise, high coherence is achieved only for a uniform input mode, ξi = 1∀i. In the latter case, the theory developed here predicts coherent fluctuations that switch between two non-symmetric values of the coherent mode, corresponding to the two points where where the slope of the transfer function equals 1 g, and we have verified this numerically (S1 Fig). An interesting question is whether the particular structure of the connectivity matrix in our model can be achieved by a biologically plausible synaptic learning rule. Prior studies of sequence generation have constructed learning rules that yield connectivity which is comprised of outer-products of random vectors [24,25] and these could form the basis for learning the necessary orthogonal rank-one structure. Plausible learning rules for yielding balanced excitation-inhibition dynamics [26–28] could potentially provide a foundation for learning row balance. It is thus plausible that the constraints of our model can be achieved by an appropriate synaptic learning, especially for the more robust regime of mild coherence. On the other hand, it is unclear to us whether the high degree of fine tuning required for the self-tuned coherence regime can be achieved by a biologically plausible learning rule. Investigating candidates of appropriate learning rules for generating coherent chaos, is beyond the scope of this work. In the case of a uniform input mode the model can be constructed as an excitation-inhibition network, for example with half the neurons defined as excitatory by setting νi = 1 and the other half defined as inhibitory via νi = −1 (or a larger inhibitory value to compensate for a smaller fraction of inhibitory neurons). From this perspective the coherent fluctuations, in particular in the regime of passive coherence, can be understood within the framework of dynamic excitation-inhibition balance [13]. In this case the pair of balance equations are degenerate and constrain only the mean excitatory population rate to be nearly equal the inhibitory rate, but otherwise leave the overall mean rate unconstrained. Local residual fluctuations yield only small differences in mean population rates, thus leaving the balance satisfied, but these small differences drive significant coherent fluctuations because of the strong balanced connectivity. In the general setting of excitation-inhibition balance the pair of balance equations fully determine the mean rates to leading order and no coherent fluctuations are possible without introducing shared fluctuations in the external drive. We note that excitation-inhibition networks in the literature have sometimes been constructed yielding degenerate balance equations. As we have shown here, such choices have dramatic impact on the dynamics and the results should not be assumed to be generalizable. In parallel to our study a pre-print has been published which explores a very similar model [29]. The authors observe a similar phenomenon as the self-tuned coherence studied here, and attempt to explain it by an iterative numerical solution of locally Gaussian dynamic mean-field equations. They do not make the role of row balance clear in their analysis. In contrast, we have focused on analytical solutions in the limit of both weak and strong structured connectivity, deriving a perturbative dynamic mean-field solution for the regime of weak structure and passive coherence. As we have shown here row balance is critical for moderate structure and self-tuned coherent chaos. Additionally we have shown that a full understanding of the properties of the highly coherent regime requires a realization-dependent mean-field analysis. In particular, we have explained that the leading eigenvalue of the row-balanced random connectivity matrix impacts qualitative features of the chaotic dynamics, yielding either broken symmetry or oscillatory fluctuations. Furthermore the critical strength of structured connectivity that leads to a transition to either fixed point or limit cycle is correlated with the extent of overlap between the leading eigenvector and the output mode. As mentioned in the main text and introduction, a previous study also explored the case of a single orthogonal E-I structured component [20]. They derived the fixed point and limit cycle solutions which we reviewed here, but did not focus on the chaotic regime and they did not discuss the role of network size in the transition out of chaos. Our focus here was on the chaotic regime, both the emergence of coherence for small structured connectivity and the imprint of the non-chaotic regime on the chaotic dynamics for moderate structured connectivity. A separate study has claimed to observe coherent activity in excitation-inhibition networks of spiking neurons [30]. A study of the dynamics of spiking neurons is beyond the scope of our work, although we would conjecture that coherent activity would arise with orthogonal, rank-one E-I structure in that setting as well. Previous work has shown how shared inputs from external drive can drive correlated fluctuations in excitation-inhibition networks [17,18]. In our current work, in the context of rate neurons, we show that such correlated fluctuations can be generated internally by a recurrent network without external drive. In order to avoid either saturation or pure oscillations the coherent activity mode must not drive itself through a feedback loop. In order to achieve this it is necessary that the structured component embed an effectively-feedforward projection between a pair of orthogonal modes. In parallel, Darshan et al [31] have developed a theory for internally generated correlations in excitation-inhibition networks of binary units. The underlying principle is similar: the recurrent connectivity embeds a purely feedforward structure. We note that the structured component of connectivity in our network is non-normal. The dynamics of non-normal matrices have drawn a fair amount of interest with suggested functional impact on working memory [32,33] and amplification [34]. Non-normal matrices embed feedforward structure within recurrent connectivity, and the resulting dynamics even in a linear system are not fully determined by the eigenspectrum but depend on the structure of the corresponding eigenvectors [35]. It has been shown that E-I networks are generally non-normal, and that rank one E-I structure amplifies small differences between excitatory and inhibitory rates driving a large common response [34,36]. This amplification is related to the way in our network, small fluctuations of the residuals are summed along the output mode and drive coherent fluctuations along the input mode in the regime of passive coherence, but these fluctuations are internally driven by the non-linear dynamics whereas the dynamics in those previous studies were linear. As pointed out in [37], a structured component such as in our model is purely feedforward and can be considered an extreme case of non-normality as it has only zero eigenvalues and therefore all the power in its Schur decomposition is in the off-diagonal. The results here depend on this property and cannot be extended to connectivity with only partial feedforward structure. Rate model dynamics with a rank-one structured component have been studied in depth recently [38,39]. Since these works focused on time-averaged activity and not fluctuations they did not observe coherent activity in the case of an outer product of a pair of orthogonal vectors as studied here. These works also differed in that the strength of the structured connectivity was scaled as 1 N. This scaling is similar to our limit of weak structured connectivity, J1 ≪ 1, and guarantees that dynamic mean-field theory holds in the limit of large system size, but in that scaling coherent fluctuations will appear only as a finite-size correction. It has been previously observed [21] and then proven [22] that adding an orthogonal outer-product to a random matrix generates realization-dependent outliers in the eigenspectrum, and furthermore that these outliers are be removed by row balance. It has been previously observed that performing such a subtraction has significant impact on the resulting dynamics [20,40]. Yet the relationship between the change in eigenspectrum and the dynamics has not been made clear beyond the basic observations regarding the stability of a fixed-point at zero. Here we suggest that the impact of row balance on the chaotic dynamics is not directly related to the eigenspectrum but that this adjustment should be thought of as effectively subtracting the coherent-mode activity from each individual neuron, thus -preventing feedback loops to the coherent mode. We show that row balance enables the emergence of slow residual dynamics with the coherent mode playing the role of dynamic gain, and that it is crucial for the emergence of self-tuned chaos and highly coherent dynamics. In conclusion we have presented a simple model which generates coherent chaos in which macroscopic fluctuations emerge through the interplay of random connectivity and a structured component that embeds a feedforward connection from an output mode to an orthogonal input mode. Our analytical approach begins by decomposing the network dynamics to the coherent component, i. e. the projection onto ξ, and the residuals that remain after subtracting the coherent component from each individual neuron. We write the full dynamics without row balance: d h d t = - h + J ϕ + J 1 N ξ ν T ϕ (28) The coherent component is defined by h ¯ ≡ 1 N ξ T h. Following this definition we project the full dynamics onto 1 N ξ to obtain the exact coherent mode dynamics: d h ¯ d t = - h ¯ + J 1 N ν T ϕ + ξ T N J ϕ (29) The residuals are defined by δ h ≡ h - h ¯ ξ. Following this definition we subtract d h ¯ d t ξ from the full dynamics to obtain the exact residual dynamics: d δ h d t = - δ h + J ϕ - ξ ξ T N J ϕ = - δ h + J ^ ϕ (30) where J ^ ≡ P ξ J, where P ξ = I - ξ ξ T N is the projection matrix onto the orthogonal complement of ξ. We note that by definition the constraint ξT δh = 0 must be satisfied automatically by the residual dynamics (Eq 30), and this is ensured because the output of J ^ is guaranteed to be orthogonal to ξ. Because ξ and J are independent, and furthermore we can assume that ϕj is independent of Jij, therefore ξ T N J ϕ ∼ O (1 N) for the typical realization and can be ignored in the coherent dynamics (Eq 29). This yields the approximate coherent mode dynamics (Eq 4) presented in the main text. We discuss the realization-dependence of this approximation in S1 Appendix. Without the structured component of connectivity (J1 = 0), the chaotic dynamics can be described by a dynamic mean-field theory which treats the dynamics of the hi as independent Gaussian processes. The theory derives and solves a self-consistency equation for the autocorrelation of the typical hi [15,19]. Here we treat the structured component of connectivity in our model as a small perturbation to the dynamic mean-field theory by assuming J1 ≪ g. In this regime we assume that the residual dynamics, δhi, behave as independent Gaussian processes described by their autocorrelation: Δ δ (τ) ≡ ⟨ δ h i (t) δ h i (t + τ) ⟩ (31) and that the structured component of connectivity drives small Gaussian fluctuations in the coherent component, ∣ h ¯ ∣ ⪡ 1, which are described by the coherent autocorrelation: Δ ¯ (τ) ≡ ⟨ h ¯ (t) h ¯ (t + τ) ⟩ (32) As we derive in S1 Appendix, the residual autocorrelation is given to leading-order by (1 - ∂ 2 ∂ τ 2) Δ δ (τ) ≈ g 2 C (τ) (33) where C (τ) ≡ ⟨ ϕ (δ h i (t) ) ϕ (δ h i (t + τ) ) ⟩ (34) This equation yields Δδ (τ) ≈ Δ0 (τ), where Δ0 (τ) is the autocorrelation when J1 = 0. The coherent autocorrelation is then determined to leading order by (1 - ∂ 2 ∂ τ 2) Δ ¯ (τ) ≈ J 1 2 C (τ) (35) which yields solution Δ ¯ (τ) ≈ J 1 2 g 2 Δ 0 (τ) (36) Thus for J1 ≪ g fluctuations in the coherent input are driven passively by the residual fluctuations, and the resulting autocorrelation of the coherent mode is simply a scaled version of the autocorrelation of the residuals. It is worth noting that for J1 ∼ g the assumption of Gaussianity is broken due to the cross-correlations between the ϕj. See S1 Appendix for a detailed derivation. In the limit of large J1 we assume δhi ≪ 1, and approximate ϕ j ≈ ϕ (ξ j h ¯) + ϕ ′ (h ¯) δ h j, where we have made use of the symmetry of the transfer function and the binary restriction on ξj. Note that this linearization holds without symmetric transfer function for the case of uniform ξj = 1 as well. Using the random connectivity with row balance constraint, J ˜, this yields dynamical equations: d δ h d t = - δ h + ϕ ′ (h ¯) J ^ δ h (37) d h ¯ d t = - h ¯ + J 1 N ϕ ′ (h ¯) ν T δ h (38) In this regime h ¯ acts as a dynamic gain on the residual synaptic currents through ϕ ′ (h ¯). Given h ¯ the equation for the residual currents is linear and therefore their dynamics can be decomposed in the eigenbasis of J ^. As we show in S1 Appendix, these eigenvalues are identical to those of J ˜. We write the eigenvectors as u (i) with J ^ u (i) = λ i u (i), and decompose the vector of residual current as δh = ∑i ci u (i). This yields dynamics d c i d t = (- 1 + ϕ ′ (h ¯) λ i) c i (39) The only (marginally) stable, non-zero fixed point is achieved with c1 ≠ 0 and ci = 0 for all i > 1. And the fixed-point equation is c 1 * (1 - ϕ ′ (h ¯ *) λ 1) = 0 (40) This fixed point only exists if λ1 is real, and yields a fixed-point requirement for h ¯ *: h ¯ * = ϕ ′ - 1 (1 λ 1) ≈ ϕ ′ - 1 (1 g) (41) In order to close the loop we turn to the fixed point equation for the coherent dynamics: h¯*=J1Nϕ′ (h¯) νTδh*. Using δ h * = c 1 * u (1), this yields a solution to leading order for c 1 *: c 1 * = N g ϕ ′ - 1 (1 g) J 1 ν T u (1) (42) as reported in [20]. If λ1 is complex there is no fixed point but rather a limit-cycle solution to the dynamics of the complex-valued c1 exists with δh (t) = Re [c1 (t) u (1) ], and ci = 0 for all other eigenmodes. In S1 Appendix we show that this limit cycle must have period equal to T = 2 π Re λ 1 Im λ 1 (Eq 18, as reported in [20] as well). This holds far from the transition to limit cycle, despite the non-linearity. Furthermore, the average value of ϕ′ over a period must be the critical value: 〈 ϕ ′ (h ¯) 〉 = 1 g. The trajectory must cross this critical value at some time in the limit-cycle and therefore without loss of generality we assume that h ¯ (0) = ϕ ′ - 1 (1 g). In S1 Appendix we derive the expression: h ¯ c ≈ c 1 0 J 1 | ν T u (1) | N g cos (θ 0 + Im (ν T u (1) ) ) (43) This is analogous to the fixed point equation for h ¯ * and c 1 *. In both cases the requirement that δ h i = c 1 u i (1) ⪡ 1 requires that c1 be maximally O (1) and motivates our conjectures about the realization-dependence and system-size scaling of the transition out of chaos. In particular, we expect and confirm numerically that the critical value of J1 for transition to either fixed point or limit cycle is inversely proportional to |νT u (1) | and grows with network size (see main text and Fig 7). We note that in the limit of large N we expect that the typical size of the imaginary component of the leading eigenvalue, λ1, shrinks such that the typical period grows. These longer period oscillations are characterized by square-wave-like shape in which the dynamics of the coherent component slows around the critical value h ¯ c = ϕ - 1 (1/g) (S3 Fig). The fraction of realizations with real leading eigenvalue in the large N limit has not been calculated analytically to our knowledge. We find numerically that this fraction appears to saturate roughly around 3 10 for N ≳ 8000. In order to calculate the largest Lyapunov exponent, we begin with a point h0 along the trajectory of the dynamics and we solve concurrently for the dynamics of the trajectory, h (t) with h (0) = h0, and for a randomly chosen perturbation, η (t). The trajectory h (t) yields the time-dependent Jacobian matrix for each point along the trajectory: J i j (t) = - 1 + J i j ϕ ′ (h j (t) ) (44) We choose a random unit-norm vector η (0) = η0 and iterate the linearized dynamics of the perturbation: d η d t = J η (45) The largest Lyapunov exponent is given by lim t → ∞ 1 t log ∥ η (t) ∥ (46) In practice we iterate 45 until t = 5000, that is, 5000 times the intrinsic time-scale of the dynamics, and we renormalize η (t) at intervals of t = 100n for n = {1,2, …, 50}. We classify fixed points numerically by a threshold on the fluctuations of the coherent input: std (h ¯ (t) ) ≤ 5 x 10 - 4. We classify limit cycles by a threshold on the second peak of the normalized coherent autocorrelation: q ¯ p e a k ≥ 0. 9. We confirm that all of the trials with negative Lyapunov exponent were categorized as either fixed points or limit cycles. A small fraction of trials classified as limit cycles had positive Lyapunov exponents but with the largest one 0. 0043.

Title: Coherent chaos in a recurrent neural network with structured connectivity Summary: Neural activity observed in the neocortex is temporally variable, displaying irregular temporal fluctuations at every accessible level of measurement. Furthermore, these temporal fluctuations are often found to be spatially correlated whether at the scale of local measurements such as membrane potentials and spikes, or global measurements such as EEG and fMRI. A thriving field of study has developed models of recurrent networks which intrinsically generate irregular temporal variability, the paradigmatic example being networks of randomly connected rate neurons which exhibit chaotic dynamics. These models have been examined analytically and numerically in great detail, yet until now the intrinsic variability generated by these networks have been spatially uncorrelated, yielding no large-scale coherent fluctuations. Here we present a simple model of a recurrent network of firing-rate neurons that intrinsically generates spatially correlated activity yielding coherent fluctuations across the entire network. The model incorporates random connections and introduces a structured component of connectivity that sums network activity over a spatial "output" mode and projects it back to the network along an orthogonal "input" mode. We show that this form of structured connectivity is a general mechanism for producing coherent chaos.

lay_plos

en

Summarize: Michael Corsello walked out of the hospital Wednesday after overdosing earlier in the day, and he has a message for viewers. NBC10's Cydney Long explains. Fourteen people overdosed in Camden in a four-hour period Wednesday from what the New Jersey attorney general described as "fentanyl-laced heroin." None of the overdose victims died, but most of them were taken to Cooper University Medical Center. All of the overdoses occurred in the South Camden area, Camden County Police Department spokesman Dan Keashen said. Michael Corsello, 27, told NBC10 he was one of the 14 people who overdosed. He spent several hours in the emergency room. "My hands were bound," Corsello said. "They said that I was freaking out. I was punching myself in the face. They said that I was screaming at the top of my lungs. I was going ballistic and then I just dropped." The series of overdoses took place from 10 a.m. to 2 p.m., with many occurring on Broadway south of the Police Administration Building. Police made an arrest related to the overdoses, Keashen said. Alexander Velazquez, 54, was charged Thursday with distribution. New Jersey Attorney General Chris Porrino later tweeted from his personal account with a sense of urgency about the "mass overdose." Corsello was holding heroin in his hands while speaking to NBC10 and said he planned on using it as soon as he finished the interview. He also desperately wanted to share a message about the toll his addiction has taken on him. "I have bald spots in my head," he said. "I've gotta wear a mohawk for the rest of my life. I've got scars all over my body because of this drug. I want every kid to understand, if they can stay away from this, I've ruined three families." Fentanyl is a powerful opioid about 100 times more potent than heroin. When used illegally, it is often converted to powder form by drug dealers. The proliferation of opioids continues to claim more lives across the nation than car crashes and homicides. The Centers for Disease Control and Prevention estimates 142 people die from a drug overdose every day. Half of the deaths are linked to opioids. President Donald Trump declared the opioid epidemic a national emergency in August at the urging of the presidential opioid commission. The commission is led by New Jersey Gov. Chris Christie, who has focused his last months in office around combating the opioid epidemic. Underneath the total increase is the surge in deaths dues to fentanyl and related synthetic opioids, more powerful relatives of heroin and morphine. Widely tainting the illicit drug supply of heroin and counterfeit pain pills, these synthetic opioids doubled their share of the previous year's already alarming overdose toll, according to the new data, which is provisional, with final mortality figures expected in December. The US is in the midst of an epidemic of drug overdose deaths, with nearly 65,000 people killed by heroin, cocaine, and prescription painkillers in 2016, a 21% jump from a year earlier. That rise was first reported by Mother Jones in September. "Shocking numbers," epidemiologist Daniel Ciccarone of the University of California, San Francisco School of Medicine told BuzzFeed News. "I see only growing problems in my field work," he added, with fentanyl becoming the new normal for heroin buyers in places like Chicago and Charleston, West Virginia. Fentanyl and other synthetic opioid painkillers are now the leading cause of overdose deaths nationwide, killing more than 20,000 people last year, according to provisional CDC data. The increase is remarkable because fentanyl only arrived in the illicit drug supply in a noticeable way around 2012, and has now raced ahead of drugs usually responsible for overdose deaths. Fentanyl is roughly 50 times more potent than morphine and about 10 times more potent than heroin. The death of Prince in April 2016 resulted from a fentanyl overdose, reportedly from counterfeit pain pills found in his possession. Carfentanil, an even more potent relative of fentanyl, has been linked to mass outbreaks of deadly overdoses nationwide. Research by Ciccarone and colleagues has suggested that their link to overdoses comes not from the potency of the these drugs in and of itself, but rather the sharp changes in potency they introduce into illicit drug markets. Overall, opioid overdose deaths quadrupled from 8,050 in 1991 to 33,091 in 2015, according to the CDC. Heroin deaths quadrupled from 3,036 in 2010 to 12,989 in 2015, driven by a sharp increase in the heroin supply. Now fentanyl is creating a third wave of overdose deaths, as those first two waves have steadied to each kill around 15,000 people a year. On August 10, President Donald Trump called the overdose epidemic a national emergency in remarks at his golf resort in Bedminster, New Jersey. However, he has still not made an official declaration of an emergency two months later. “After waiting so long for an emergency declaration, I think it’s time to move on," former Office of National Drug Policy official Regina LaBelle told BuzzFeed News. "Today, let’s look at what we need to do to address the epidemic – build an effective treatment system to reduce overdose deaths, improve our recovery system, expand opportunities to intervene at every stage of an opioid use disorder," she said by email. "If there is one issue where there is bipartisan consensus, it’s this one.” (CNN) Opioid drugs -- including both legally prescribed painkillers such as oxycodone and hydrocodone, as well as illegal drugs such as heroin or illicit fentanyl -- are not only killing Americans, they are shortening their overall life spans. Opioids take about 2½ months off our lives, according to a new analysis published in the medical journal JAMA. In 2015, American life expectancy dropped for the first time since 1993. Public health officials have hypothesized that opioids reduced life expectancy for non-Hispanic white people in the United States from 2000 to 2014. Researchers have now quantified how much opioids are shortening US life spans. The researchers noted that the number of opioid overdose deaths are probably underestimated because of gaps in how death certificates are completed. From 2000 to 2015, death rates due to heart disease, diabetes and other key causes declined, adding 2¼ years to US life expectancy. But increases in deaths from Alzheimer's disease, suicide and other causes offset some of those gains. On average, Americans can now expect to live 78.8 years, according to data from 2015, the most recent data available. That's a statistically significant drop of 0.1 year, about a month, from the previous year. Women can still expect to live longer than men -- 81.2 years vs. 76.3 years -- but both of those estimates were lower in 2015 than they were in 2014. Life expectancy at age 65 remained the same in 2015. Once you've reached that age, you can expect to live another 19.4 years. Again, women fare slightly better: 20.6 years vs. 18 years for men. Drug overdose deaths reach new highs Drug overdose deaths are expected to continue to reach new record highs. The Centers for Disease Control and Prevention expects drug overdose deaths to top 64,000 in 2016 when the numbers are finalized -- that's more than the number of American troops lost during the Vietnam War. Most of these overdoses involved an opioid. Since 1999, the number of opioid-related drug deaths has more than quadrupled. While prescription opioids like oxycodone or hydrocodone were considered to be driving factors in the increasing rates of overdose in the early part of the 2000s, heroin and illicit fentanyl have become the drivers for opioid overdose deaths in recent years. In fact, the number of overdose deaths related to fentanyl is expected to more than double, from an estimated 9,945 in 2016 to 20,145 in 2017, the CDC says. For the first time, fentanyl will be the leading cause of opioid overdose. 'It's a national emergency' On the heels of the release of a draft report of the President's Commission on Combating Drug Addiction and the Opioid Crisis, over the summer, President Donald Trump said "The opioid crisis is an emergency, and I am saying, officially, right now, it is an emergency. It's a national emergency. "We're going to spend a lot of time, a lot of effort and a lot of money on the opioid crisis," he added. "It is a serious problem the likes of which we have never had." Yet, five weeks have passed since Trump's statement, and the White House has yet to make any sort of formal announcement of a national emergency. In addition, this week, New Jersey Gov. Chris Christie, a Republican who chairs the drug addiction commission, posted a letter on the White House's website requesting an additional four weeks for the commission to complete its final report. "In the interest of submitting... sound recommendations, our research and policy development are still in progress," wrote Christie. "Accordingly, and pursuant to the Executive Order establishing the Commission, we are seeking an additional four weeks to finalize our work." Join the conversation See the latest news and share your comments with CNN Health on Facebook and Twitter.

Summary: Fourteen people overdosed on heroin laced with fentanyl in a span of just four hours Wednesday in Camden, New Jersey, NBC Philadelphia reports. While none of Wednesday's overdoses in Camden were fatal, BuzzFeed-citing new data from the CDC-reports fentanyl and other synthetic opioids are now the leading cause of overdose deaths in the US, having killed more than 21,000 people last year. One epidemiologist calls those numbers "shocking." Fentanyl is about 50 times stronger than morphine and 10 times stronger than heroin. Researchers say the increase in overdose deaths-a jump of 21% between 2015 and 2016 driven by fentanyl and synthetic opioids-is likely due to people buying heroin or counterfeit pain pills and not expecting the spike in potency. Opioids, including fentanyl, are reducing life expectancy in the US by 2.5 months, CNN reported last month. American life expectancy dropped in 2015 for the first time since 1993, and overdose deaths are thought to be the reason. Experts believe overdose deaths will continue to increase, at least in the near future. According to CDC estimates, more Americans died of overdoses-the majority of which involved opioids-in 2016 than died in the Vietnam War. President Trump has called the situation a national emergency but has yet to officially declare it as such.

multi_news

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Milk Regulatory Equity Act of 2005''. SEC. 2. MILK REGULATORY EQUITY. (a) Minimum Milk Prices for Handlers; Exemption.--Section 8c(5) of the Agricultural Adjustment Act (7 U.S.C. 608c(5)), reenacted with amendments by the Agricultural Marketing Agreement Act of 1937, is amended by adding at the end the following new subparagraphs: ``(M) Minimum Milk Prices for Handlers.-- ``(i) Application of minimum price requirements.-- Notwithstanding any other provision of this section, a milk handler described in clause (ii) shall be subject to all of the minimum and uniform price requirements of a Federal milk marketing order issued pursuant to this section applicable to the county in which the plant of the handler is located, at Federal order class prices, if the handler has packaged fluid milk product route dispositions, or sales of packaged fluid milk products to other plants, in a marketing area located in a State that requires handlers to pay minimum prices for raw milk purchases. ``(ii) Covered milk handlers.--Except as provided in clause (iv), clause (i) applies to a handler of Class I milk products (including a producer-handler or producer operating as a handler) that-- ``(I) operates a plant that is located within the boundaries of a Federal order milk marketing area (as those boundaries are in effect as of the date of the enactment of this subparagraph); ``(II) has packaged fluid milk product route dispositions, or sales of packaged fluid milk products to other plants, in a milk marketing area located in a State that requires handlers to pay minimum prices for raw milk purchases; and ``(III) is not otherwise obligated by a Federal milk marketing order, or a regulated milk pricing plan operated by a State, to pay minimum class prices for the raw milk that is used for such dispositions or sales. ``(iii) Obligation to pay minimum class prices.--For purposes of clause (ii)(III), the Secretary may not consider a handler of Class I milk products to be obligated by a Federal milk marketing order to pay minimum class prices for raw milk unless the handler operates the plant as a fully regulated fluid milk distributing plant under a Federal milk marketing order. ``(iv) Certain handlers exempted.--Clause (i) does not apply to-- ``(I) a handler (otherwise described in clause (ii)) that operates a nonpool plant (as defined in section 1000.8(e) of title 7, Code of Federal Regulations, as in effect on the date of the enactment of this subparagraph); ``(II) a producer-handler (otherwise described in clause (ii)) for any month during which the producer- handler has route dispositions, and sales to other plants, of packaged fluid milk products equaling less than 3,000,000 pounds of milk; or ``(III) a handler (otherwise described in clause (ii)) for any month during which-- ``(aa) less than 25 percent of the total quantity of fluid milk products physically received at the plant of the handler (excluding concentrated milk received from another plant by agreement for other than Class I use) is disposed of as route disposition or is transferred in the form of packaged fluid milk products to other plants; or ``(bb) less than 25 percent in aggregate of the route disposition or transfers are in a marketing area or areas located in one or more States that require handlers to pay minimum prices for raw milk purchases. ``(N) Exemption for Certain Milk Handlers.--Notwithstanding any other provision of this section, no handler with distribution of Class I milk products in the marketing area described in Order No. 131 shall be exempt during any month from any minimum price requirement established by the Secretary under this subsection if the total distribution of Class I products during the preceding month of any such handler's own farm production exceeds 3,000,000 pounds.''. (b) Exclusion of Nevada From Federal Milk Marketing Orders.-- Section 8c(11) of the Agriculture Adjustment Act (7 U.S.C. 608c(11)), reenacted with amendments by the Agriculture Marketing Agreement Act of 1937, is amended-- (1) in subparagraph (C), by striking the last sentence; and (2) by adding at the end the following new subparagraph: ``(D) In the case of milk and its products, no county or other political subdivision of the State of Nevada shall be within the marketing area definition of any order issued under this section.''. (c) Records and Facility Requirements.--Notwithstanding any other provision of this section, or the amendments made by this section, a milk handler (including a producer-handler or a producer operating as a handler) that is subject to regulation under this section or an amendment made by this section shall comply with the requirements of section 1000.27 of title 7, Code of Federal Regulations, or a successor regulation, relating to handler responsibility for records or facilities. (d) Effective Date and Implementation.--The amendments made by this section take effect on the first day of the first month beginning more than 15 days after the date of the enactment of this Act. To accomplish the expedited implementation of these amendments, effective on the date of the enactment of this Act, the Secretary of Agriculture shall include in the pool distributing plant provisions of each Federal milk marketing order issued under subparagraph (B) of section 8c(5) of the Agriculture Adjustment Act (7 U.S.C. 608c(5)), reenacted with amendments by the Agriculture Marketing Agreement Act of 1937, a provision that a handler described in subparagraph (M) of such section, as added by subsection (a) of this section, will be fully regulated by the order in which the handler's distributing plant is located. These amendments shall not be subject to a referendum under section 8c(19) of such Act (7 U.S.C. 608c(19)).

Title: To ensure regulatory equity between and among all dairy farmers and handlers for sales of packaged fluid milk in federally regulated milk marketing areas and into certain non-federally regulated milk marketing areas from federally regulated areas, and for other purposes Summary: Milk Regulatory Equity Act of 2005 - Amends the the Agricultural Adjustment Act, reenacted with amendments by the Agricultural Marketing Agreement Act of 1937, to subject specified Class I milk handlers (including producer-handlers) to federal milk marketing order minimum and uniform price requirements applicable to the county in which the plant of the handler is located, at federal order class prices, if the handler has packaged fluid milk product route dispositions, or sales of packaged fluid milk products to other plants, in a marketing area located in a state that requires handlers to pay minimum prices for raw milk purchases. Exempts from such provision: (1) a handler operating a nonpool plant; (2) a producer-handler for any month during which packaged fluid milk route dispositions and sales to other plants are less than three million pounds of milk; or (3) specified handlers whose fluid milk products are disposed of as route dispositions or transfers, or whose dispositions or transfers are in states requiring minimum prices for raw milk purchases. Subjects a Class I milk handler in the Arizona-Las Vegas marketing area (Order 131) to minimum milk price requirements for any month in which the handler distributes in such area at least three million pounds of Class I products from his or her own production. Excludes Nevada from federal milk marketing orders.

billsum

en

Summarize: By. Chris Pleasance. PUBLISHED:. 13:41 EST, 2 December 2013. |. UPDATED:. 15:19 EST, 2 December 2013. Police Constable Gareth Browning is in critical but stable condition in hospital after allegedly being run over while trying to stop a stolen car. Three people have been arrested after a police officer was allegedly hit by a stolen car leaving him in critical condition. PC Gareth Browning was his by a black Mazda Areosport as he tried to stop the car at around 5.30pm on Saturday. One man, 28, and a 31-year-old woman have been arrested today on suspicion of attempted murder. A third suspect, a 34-year-old woman, has been detained on suspicion of assisting an offender. All three, from Reading, are in custody. PC Browning is in a critical but stable condition in the John Radcliffe Hospital, Oxford. His family, thought to be from Thatcham, Berkshire, are at his bedside. Browning and his colleague were on foot patrol on Lower Early Way in Reading on Saturday when they saw the car, which had been stolen from a house 10 days earlier, speeding around a residential area. They tried to stop it by throwing a stop stick, similar to a stinger, into the road but the car swerved onto the pavement and hit Browning so hard he was thrown into the air. He is believed to have landed on his his head, causing severe injuries. As his colleague ran to help the driver avoided the stinger, escaped, and the vehicle was found abandoned a short time later. Thames Valley Police’s Assistant Chief Constable, John Campbell, said: 'That officer went on duty that afternoon with the sole purpose of protecting the public and he’s ended up in a very seriously ill condition in hospital. 'His family are very shocked by what has gone on and we are offering them all the support we can. According to police a stolen car similar to this one was used to ram PC Browning during the attack. 'His colleagues are also shocked and upset by what has happened. Professionally, they are continuing with the job as we always do when there are tragic consequences. It's had an impact but we carry on as you would expect.' PC Browning works at Loddon Valley Police Station where he has served for 10 years. The 07-registered Mazda was stolen during a burglary in the affluent area of Sonning Common on November 21. Thieves broke into the property and took the keys before making off with the car. Police are still appealing for witnesses anybody with information is asked to call 101 or Crimestoppers anonymously on 0800 555 111

Summary: PC Gareth Browning was hit while on foot patrol last Saturday. He was trying to stop a stolen black Mazda using a stinger. However the car swerved onto the pavement and ran into him. He is believed to have landed on his head causing severe injuries. The driver fled and the car was found abandoned later. Man, 28, and woman, 31, arrested on suspicion of attempted murder. Woman, 34, has been arrested on suspicion of assisting an offender.

cnn_dailymail

en

Summarize: A burglar is back behind bars just six months after he vowed to end his 30-year life of crime. Martin Gilbert, 48, blamed drugs and alcohol for his past when he made a public apology last June to a victim whose house he had raided twice. But his promises came to nothing. Just before Christmas he stole jewellery and valuables from five houses and a church in his home city of Newcastle - and some victims were in their 80s. Empty promises: Martin Gilbert (left) grinned in June as he joined Christine Bell (right), whose house he had burgled twice, and promised never to offend again. Now he is back behind bars after doing just that. Gilbert said he was 'totally ashamed' as he pleaded guilty this week to six counts of burglary at Newcastle Crown Court, where he was told a jail term is inevitable. He admitted breaking into a home and two sheltered flats on November 29 before raiding the Presbyterian St Anthony's Church on December 2 and two more homes on December 11. Kevin Wardlaw, prosecuting, said: 'Some of the complainants in these cases are elderly, some in their 80s.' Jamie Adams, defending, told the judge Gilbert wished to be sentenced as soon as possible. 'He is a certified burglar,' he said. 'He knows what to expect.' Recorder Andrew Dallas told Gilbert, who appeared via a video link from prison, he would be sentenced in three weeks and warned more time behind bars inevitable. 'This is someone who has re-offended in six months,' the judge said. 'It's just a question of fixing the length of the sentence.' As he did so the burglar repeatedly said: 'I'm very sorry and I'm totally ashamed of what I have done. I'm very sorry.' Evidence: CCTV had previously caught Gilbert, whose criminal career has lasted 30 years, in the act. Gilbert stole jewellery and cash worth almost £30,000 and covered his hands with socks from a clothes line. Gilbert, from Walker, Newcastle, vowed to turn his back on crime in June after meeting one of his victims and seeing how much misery he had caused, posing with her for pictures in the press. He had fed a drugs habit by stealing cash and valuables from the homes of others during a crime career spanning 30 years. Gilbert, whose son was murdered in 2008, was jailed for three and a half years in 2011 for a burglary spree during which he raided 18 homes, stealing cash and jewellery worth almost £30,000. Most of the thefts were from elderly people's bungalows and during broad daylight. He was eventually caught on CCTV using residents' own tools to smash his way into their homes. At one he even took socks off the washing line to cover his hands. He was released from prison on licence in July 2013 after serving 21 months. As part of his rehabilitation he was offered the chance to take part in a'restorative justice' programme, which gives criminals the opportunity to meet their victims and see the impact their crimes have had. Reconciliation: Christine Bell (right), from whom Gilbert stole previously, said she was disappointed. So in June last year Gilbert, who has two daughters and is a grandfather, was introduced to Christine Bell, whose home he burgled twice. Mrs Bell, who works as a court usher, had told him how his raid left her feeling nervous entering her own home. Today she said she was disappointed. 'If I'm ever tempted again I will think of her,' Gilbert said last year. 'I just want to say sorry to everyone I have burgled. 'At the time I didn't think about the victims at all, I was so off my head on drugs and alcohol. I was in a bad state and was just doing it for money to feed my habit. 'I just needed money. But I've realised now and I'm just really really sorry for all the pain and hurt I have caused. 'I have been in and out of prison most of my life, but this time I just thought; "I don't want to end up back here. I need to change my ways."' Gilbert will be sentenced later this month

Summary: Martin Gilbert, 48, made vocal apology in June after 30-year life of crime. 'I want to say sorry to everyone,' he declared. 'I didn't think of the victims' But he raided five homes and church in Newcastle just before Christmas. Some of the victims had their jewellery stolen and were in their 80s. Gilbert warned jail is inevitable after he admitted six counts of burglary.

cnn_dailymail

en

Summarize: By. Daily Mail Reporter. PUBLISHED:. 08:50 EST, 5 March 2014. |. UPDATED:. 13:08 EST, 5 March 2014. A motorcyclist left paralyzed when he was hit by a terrified Range Rover driver who was trying to escape a swarm of bikers last year has claimed he was simply there for a ride. Speaking to the Today show on Wednesday, Edwin Mieses Jr., 26, denied being part of a gang and said he'd gone to New York with three friends from Massachusetts after seeing the ride advertized on the internet. The father-of-two was part of a group of bikers allegedly surrounded an SUV driver after he clipped one of them while driving in Manhattan on September 29. The driver, 33-year-old Alexian Lien,. was scared for the safety of his wife and two-year-old child, who were. both in the car, and knocked some of the bikers down so he could escape,. police said. Scroll down for video. Hurt: Edwin Mieses Jr. was left paralyzed after he was plowed down by an SUV that was trying to escape a swarm of bikers in Manhattan last year. Doctors say it is unlikely that he will walk again. Emotional: His wife Dayana wiped away tears as Mieses recalled the moment he was hit by the SUV. But Mieses told the Today show that he never saw any intimidating actions against the driver. He said he had climbed off his bike to check on the fellow rider who had been clipped when Lien plowed him down. 'I see him [the biker] get hit in the corner of my. eye,' he said. 'We were all riding together... I just got off like. any other human would. I got off to check on him to make sure he was. alright. 'I seen it wasn't really that serious. I was telling guys to just keep going - I really didn't want to ruin. the ride. As soon as I turn around and start walking back toward my bike, that's when I got ran over. 'As soon as he hit me, I shut my eyes. I didn't want to open my eyes because I knew he had hurt me.' Injuries: An image shows Mieses, who suffered broken legs and spinal injuries, in hospital after the crash. Speaking out: He appeared on the Today show on Wednesday with his wife and lawyer, Gloria Allred. Mieses suffered broken legs and spine injuries that left him paralyzed - and doctors have said it is unlikely he will ever walk again. 'They told me it was 99.9 per cent. that I wasn't going to walk, but I refuse to believe that,' Mieses said. 'I want to. walk more than they want me to walk.' Still, Mieses said he does not blame Lien - who police say was protecting his family - for his injuries. 'I don't blame him,' he said. 'I'm not him to know what was going through his mind.' Lien was not charged in the incident,. but Mieses' lawyer Gloria Allred said that, while they have not filed a. civil lawsuit, they have not ruled it out. For. now, Mieses, an aspiring rapper who performed with the name Jay Meezee. ahead of the crash, is just trying to adjust to his new life. He said. the incident helped him find his faith. Caught on camera: Footage of the incident showed the driver, 33-year-old Alexian Lien, hit some of the bikers that had surrounded him last September. Police said he was trying to protect his family. Knocked down: Mieses can be seen lying in the road behind as the SUV continues to drive on. Terrifying: The bikers eventually surrounded the car, tried to smash a window and beat up the driver. 'I've realized that life is more important to us than what we take,' he said. 'What. would I do to be able to walk again or go to the bathroom on my own again - we. don't value it. It's allowed me to see things from a different angle.' Startling footage that was later uploaded to the internet captured the terrifying incident last year. A police spokesman said that Lien recalled how a large number of motorcyclists were driving 'erratically' around him during the annual New York ride and he 'accidentally collided with one'. The footage shows one motorcyclist brake hard in front the the car and seems to get bumped by it. The video shows the Range Rover accelerate suddenly knocking over bikes and motorcyclists, driving over the top of them. Scared: Lien, pictured with his wife, was dragged from the car and left needed stitches. Police said the bikers continued to chase Lien and ambushed his car when it came to a stop in Manhattan traffic. They they allegedly dragged him from his car and attacked him. During the incident, Lien's scared wife, Rosalyn Ng, called 911 four times in nine minutes. Lien, a Columbia University graduate who now works at Credit Suisse, was taken to Columbia University Medical Center, where he received stitches. He was later released. Eleven bikers have been indicted in the crash but all cases are still pending

Summary: Edwin Mieses Jr. was part of a group of bikers accused of surrounding an SUV driver after he hit one of them in New York last September. The driver plowed down Mieses to escape - leaving the biker paralyzed. On Wednesday, Mieses insisted he was not intimidating driver Alexian Lien and that he had been checking on another rider when he was hit. But Mieses said he does not blame Lien for his injuries. Footage released last year showed the bikers following the SUV and pulling Lien from the car, beating him and leaving him needing stitches.

cnn_dailymail

en

Summarize: BACKGROUND OF THE INVENTION [0001] The present invention generally relates to contrast media formulations and, more particularly, to nonionic x-ray contrast media formulations, radiological compositions containing such formulations and methods for x-ray visualization utilizing such compositions. [0002] The search for ideal contrast media for X-ray radiodiagnostic studies has extended over many decades. Bismuth subnitrate was the first radiocontrast agent used for visualization of the alimentary tract. Later, barium sulfate, a safer agent, was introduced. Barium sulfate has remained the most widely used radiographic agent for the alimentary tract (W. H. Strain, International Encyclopedia of Pharmacology and Therapeutics, Section 76, Vol. 1, Radiocontrast Agents, Chapter 1, Historical Development of Radiocontrast Agents, 1971, Pergamon Press). The inorganic, insoluble oral agents like bismuth subnitrate and barium sulfate serve as valuable tools for gastrointestinal radiodiagnosis. [0003] Unlike gastrointestinal radiodiagnosis, urographic and angiographic X-ray procedures, require intravascular administration of a safe, water-soluble, radiopaque contrast medium. Since the introduction of the water-soluble ionic triiodobenzoic acid derivatives, such as diatrizoic acid and iothalamic acid, in the early 1960&#39;s, radiographic visualization of the vascular system has become the most important application of X-ray contrast media. These X-ray procedures are valuable in the diagnosis and evaluation of a variety of diseases that involve or cause alterations in normal vascular anatomy or physiology. [0004] The progress in X-ray contrast media development has been extensively documented; e.g., U. Speck, “X-ray Contrast Media”, Medical Division Publication, Department of Medical Information, Schering AG; D. P. Swanson et al., “Pharmaceuticals in Medical Imaging” (1990) McMillan Publishing Co.; M. Sovak, “Radiocontrast Agents”, (1984), Springer Verlag. Preferred intravascular X-ray contrast agents possess a combination of desirable properties. Such properties include the following to various degrees: (1) maximum x-ray opacity; (2) biological safety; (3) high water solubility; (4) chemical stability; (5) low osmolality; and (6) low viscosity. In particular, studies have shown that high osmolality can be correlated with undesirable physiologic adverse reactions to x-ray contrast media, e.g., nausea, vomiting, heat and pain. [0005] A significant advancement in the area of triiodobenzene based X-ray contrast media has been the development of non-ionic triiodobenzoic acid derivatives such as iopamidol, iohexyl and ioversol. In general, aqueous solutions of these non-ionic agents have less osmolality than previous agents and hence, provide greater patient comfort when injected. Adverse reactions, especially in the sensation of pain, warmth, and hemodynamic effects are greatly reduced as compared to the ionic triiodobenzoic acid derivatives. However, at equal iodine concentrations, the viscosity values of these non-ionic formulations are higher than for formulations of ionic triiodobenzoic acid based contrast agents. [0006] Further reduction of osmolality of X-ray contrast media resulted from the introduction of non-ionic dimeric agents such as iotrolan and iodixanol. These agents because of isoosmolality values, as compared to the non-ionic monomeric agents, provide even greater patient comfort by reducing nausea and vomiting upon intravenous injection and by causing much less pain upon peripheral arterial injection. However, the frequency and intensity of delayed side reactions in patients are higher for such non-ionic dimers. The viscosity of such non-ionic dimeric agent-based formulations is also substantially greater than for the corresponding monomeric analogs. Thus there remains a need for safe formulations of X-ray contrast media with low viscosity and low osmolality [0007] In U.S. Pat. No. 5,698,739 (Sovak), Sovak describes a separate class of dimeric non-ionic X-ray contrast media with at least one primary carboxamide group as a substituent, an example of this class of dimers being Iosmin. According to Sovak, the presence of primary carboxamide group conferred higher iodine content and sterically exposed the hydrophobic character of the neighboring iodine molecules ensuring the formation of aggregates and thus lowering the osmolality. [0008] Another attempt to optimize formulations involves combining a monomer with low viscosity value with a dimer of low osmolality value wherein the substituents on the iodinated aromatic groups are similar. U.S. Pat. No. 5,695,742, discloses injectable aqueous compositions comprising mixtures of non-ionic iodinated aromatic monomers and non-ionic iodinated aromatic dimers having an intermediate osmolality value compared to the pure solutions wherein the mixtures are also disclosed as having a lower viscosity than expected. [0009] With the purpose of decreasing the delayed side reactions seen with the non-ionic dimers, German Patent Application DE 19627309 discloses mixtures comprising monomers and dimers of ionic and non-ionic triiodoaromatic compounds as well as gadolinium complex compounds. Since the mixtures include an ionic contrast agent, the osmolality of such a mixture would be higher than the osmolality value for the pure nonionic dimer contrast agent. [0010] We have now surprisingly discovered novel monomer-dimer mixtures having improved property, e.g. osmolality and viscosity, profiles in which the dimer has at least one primary carboxamide group in the triiodobenzene nuclei and the monomer has no primary carboxamide groups in the triiodobenzene nuclei. SUMMARY OF THE INVENTION [0011] Among the various aspects of the present invention may be noted the provision of nonionic contrast agents, radiological compositions and methods for x-ray visualization; and the provision of such agents with improved osmolality and viscosity which are substantially non-toxic. [0012] Briefly, the present invention is directed to mixtures comprising at least one monomer and at least one dimer both derived from triiodinated benzene derivatives. The monomer corresponds to Formula I and the dimer corresponds to Formula II; [0000] [0000] wherein [0013] A 1, B 1, and D 1 are independently —CON(R 3 )R 1 or —N(R)C(O)R 2 ; [0014] A 2, A 3, B 3, and D 2 are independently —CON(R)R 1 or —N(R)C(O)R 2 provided, however, at least one of A 2 and A 3 is —CONH 2 ; [0015] E 2 and E 3 are independently selected from the group consisting of —CON(R)—, —N(R)C(O)— and —N(COR 2 )—; [0016] each R is independently H, a linear or branched (C 1 -C 8 ) alkyl residue optionally substituted with one or more hydroxy, alkoxy or hydroxyalkoxy groups or combinations thereof, or a member of a (C 3 -C 7 ) cyclic residue, said cyclic residue being optionally interrupted by —O—, —S— or —NR 4 —, and/or optionally substituted with one or more hydroxy, alkoxy or hydroxyalkoxy groups or combinations thereof, the cyclic residue comprising R, the nitrogen atom to which it is bonded and another moiety, that moiety being (i) —C(O)R 2 when A 1, A 2, A 3, B 1, B 3, D 1 or D 2 is —N(R)C(O)R 2 or (ii) R 1 when A 2, A 3, B 3, or D 2 is —CON(R)R 1 ; [0017] each R 1 is independently (i) hydrogen, (ii) a linear or branched (C 1 -C 8 ) alkyl residue, optionally substituted with one or more hydroxy, alkoxy, hydroxyalkoxy groups or combinations thereof or by —NRC(O)R 1 or —C(O)N(R)R 1, (iii) the residue of a carbohydrate, or (iv) a member of a (C 3 -C 7 ) cyclic residue, said cyclic residue being optionally interrupted by —O—, —S— or —NR 4 —, and/or optionally substituted with one or more hydroxy, alkoxy or hydroxyalkoxy groups or combinations thereof, the cyclic residue comprising R 1, the nitrogen atom to which it is bonded and another moiety, that moiety being (a) R when A 2, A 3, B 3, or D 2 is —CON(R)R 1 or (ii) R 3 when A 1, B 1, and D 1 is —CON(R 3 )R 1 ; [0018] each R 2 is independently (i) a linear or branched (C 1 -C 8 ) alkyl residue, optionally substituted with one or more hydroxy, alkoxy or hydroxyalkoxy groups, or combinations thereof or (ii) a member of a (C 3 -C 7 ) cyclic residue, said cyclic residue being optionally interrupted by —O—, —S— or —NR 4 —, and/or optionally substituted with one or more hydroxy, alkoxy or hydroxyalkoxy groups or combinations thereof, the cyclic residue comprising R 2, R, the nitrogen atom to which R is bonded and the carbonyl moiety to which R 2 is bonded; [0019] each R 3 is independently linear or branched (C 1 -C 8 ) alkyl residue, optionally substituted with one or more hydroxy, alkoxy or hydroxyalkoxy groups or combinations thereof, or taken together with R 1 and the nitrogen atom to which R 3 and R 1 are bonded, form a (C 3 -C 7 ) cyclic residue, said cyclic residue being optionally interrupted by —O—, —S— or —NR 4 —, and/or optionally substituted with one or more hydroxy, alkoxy or hydroxyalkoxy groups or combinations thereof; [0020] each R 4 is independently hydrogen or a linear or branched (C 1 -C 8 ) alkyl residue, optionally substituted with one or more hydroxy, alkoxy, hydroxyalkoxy groups or combinations thereof; and [0021] X is a bond or a linear or branched (C 1 -C 8 ) alkylene chain which is optionally substituted by up to six hydroxy groups, said alkylene chain being optionally interrupted by —O—, —S—, —NR 4 — or —N(R)C(O)— groups. [0022] The present invention is further directed to mixtures comprising a monomer, a dimer, and at least one imaging agent other than the monomer and the dimer wherein the monomer corresponds to Formula I and the dimer corresponds to Formula II. [0023] The present invention is further directed to a method of diagnostic imaging, the method comprising administering to an individual a contrast agent comprising a mixture of at least one monomer and at least one dimer, the monomer corresponding to Formula I and the dimer corresponding to Formula II, and carrying out an imaging procedure on such individual. [0024] Other aspects and features of the present invention will be, in part, apparent, and, in part, pointed out hereinafter. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS [0025] In accordance with the present invention, it has been found that contrast media compositions corresponding to mixtures of at least one monomer of Formula I and at least one dimer of Formulae II, wherein the dimers of Formula II contain at least one primary carboxamide substituent and the monomers of Formula I do not contain any primary carboxamide substituents, have unexpectedly and favorably lower osmolality and viscosity values than would be predicted based solely upon the contribution of the monomer and dimer in the mixture. In a currently preferred embodiment, the contrast media composition corresponds to a mixture of a monomer of Formula I and a dimer of Formula II. Without being bound to any particular theory, in view of the nature of the differences in the substituents on the monomer and dimer it is surprising to find that compositions arising from such monomer-dimer mixtures have favorable intermolecular attractions between the dimers of Formula II and the monomers of Formula I that appear to result in molecular aggregation and thereby reduce the effective number of particles present in solution and hence, the osmolality of the mixture. [0026] Advantageously, X-ray contrast media comprising a mixture of at least one monomer and at least one dimer of the present invention may be prepared with both improved viscosity and osmolality characteristics. Accordingly, mixtures of the present invention preferably comprise monomer and dimer in a weight ratio of iodine in the monomer and dimer, respectively, based on the iodine concentration in the mixture (e.g. in mg l/mL formulation). Broadly the weight ratio of iodine in the monomer to iodine in the dimer is about 1:20 to about 20:1. In one embodiment, the mixture comprises the monomer and dimer in a weight ratio of about 1:9 to about 9:1. In one preferred embodiment, for example, the mixture comprises the monomer and dimer in a weight ratio of about 1:5.7 to about 5.7:1. In another preferred embodiment, the mixture comprises the monomer and dimer in a weight ratio of about 1:9 to about 1:1. In yet another preferred embodiment, the mixture comprises the monomer and dimer in a weight ratio of about 1:3 to about 1:1. [0027] As previously described, contrast media of the present invention comprise a monomer corresponding to Formula I. [0000] [0028] wherein A 1, B 1 and D 1 are as previously defined. In one embodiment, A 1 and B 1 are each —C(O)N(R 3 )R 1 and D 1 is —N(R)C(O)R 2 with each R 1, R 2 and R 3 of A 1, B 1 and D 1, being independently selected from the range of substituents originally identified in connection with Formula I. For example, in this embodiment A 1 and B 1 may be —CONHR 3 wherein each R 3 of A 1 and B 1 is independently methyl, hydroxymethyl (—CH 2 OH), ethyl, hydroxyethyl (—CH 2 CH 2 OH or —CH(OH)CH 3 ), propyl, hydroxypropyl (—CH 2 CH 2 CH 2 OH) or dihydroxypropyl (—CH 2 CH(OH)CH 2 OH); more preferably, in this embodiment, each R 3 of A 1 and B 1 is independently hydroxyethyl (—CH 2 CH 2 OH or —CH(OH)CH 3 ), hydroxypropyl (—CH 2 CH 2 CH 2 OH) or dihydroxypropyl (—CH 2 CH(OH)CH 2 OH). By way of further example, in this embodiment, the R and R 2 substituents of D 1 may independently be hydrogen, methyl, hydroxymethyl (—CH 2 OH), ethyl, hydroxyethyl (—CH 2 CH 2 OH or —CH(OH)CH 3 ), propyl, hydroxypropyl (—CH 2 CH 2 CH 2 OH), 2-methoxyethyl (—CH 2 CH 2 OCH 3 ), 1-methoxy-2-hydroxypropyl (—CH 2 CH(OH)CH 2 OCH 3 ), or dihydroxypropyl (—CH 2 CH(OH)CH 2 OH); more preferably, in this embodiment, the R and R 2 substituents of D 1 are preferably selected from methyl, hydroxymethyl (—CH 2 OH), hydroxyethyl (—CH 2 CH 2 OH), 2-methoxyethyl (—CH 2 CH 2 OCH 3 ), and dihydroxypropyl (—CH 2 CH(OH)CH 2 OH). By way of further example, in this embodiment A 1 and B 1 may be —CON(CH 3 )R 3 wherein each R 3 of A 1 and B 1 is independently methyl, hydroxymethyl (—CH 2 OH), ethyl, hydroxyethyl (—CH 2 CH 2 OH or —CH(OH)CH 3 ), propyl, hydroxypropyl (—CH 2 CH 2 CH 2 OH) or dihydroxypropyl (—CH 2 CH(OH)CH 2 OH); more preferably, in this embodiment, each R 3 of A 1 and B 1 is independently hydroxyethyl (—CH 2 CH 2 OH or —CH(OH)CH 3 ), hydroxypropyl (—CH 2 CH 2 CH 2 OH) or dihydroxypropyl (—CH 2 CH(OH)CH 2 OH). By way of further example, in this embodiment, the R and R 2 substituents of D 1 may independently be, hydrogen, methyl, hydroxymethyl (—CH 2 OH), ethyl, hydroxyethyl (—CH 2 CH 2 OH or —CH(OH)CH 3 ), propyl, hydroxypropyl (—CH 2 CH 2 CH 2 OH), 2-methoxyethyl (—CH 2 CH 2 OCH 3 ), 1-methoxy-2-hydroxypropyl (—CH 2 CH(OH)CH 2 OCH 3 ), or dihydroxypropyl (—CH 2 CH(OH)CH 2 OH); more preferably, in this embodiment, the R and R 2 substituents of D 1 are preferably selected from methyl, hydroxymethyl (—CH 2 OH), hydroxyethyl (—CH 2 CH 2 OH), 2-methoxyethyl (—CH 2 CH 2 OCH 3 ), and dihydroxypropyl (—CH 2 CH(OH)CH 2 OH). [0029] In a preferred embodiment, the contrast media comprises a monomer selected from the group consisting of: [0030] iomeprol {C 17 H 22 I 3 N 3 O 8 ; N,N′-bis(2,3-dihydroxypropyl)-5-[(hydroxyacetyl)methylamino]-2,4,6-triiodo-1,3-benzenedicarboxamide; CAS [RN] [78649-41-9]}, [0000] [0031] iopromide {C 18 H 24 I 3 N 3 O 8 ; N,N′-bis(2,3-dihydroxypropyl)-2,4,6-triiodo-5-[(methoxyacetyl)amino]-N-methyl-1,3-benzenedicarboxamide; CAS [RN] [73334-07-3]}, [0000] [0032] ioversol {C 18 H 24 I 3 N 3 O 9 ; N,N′-bis(2,3-dihydroxypropyl)-5-[(hydroxyacetyl) (2-hydroxyethyl)amino]-2,4,6-triiodo-1,3-benzenedicarboxamide; CAS [RN] [87771-40-2]}, [0000] [0033] iohexyl {C 19 H 26 I 3 N 3 O 9 ; 5-[acetyl(2,3-dihydroxypropyl)amino]-N,N′-bis(2,3-dihydroxypropyl)-2,4,6-triiodo-1,3-benzenedicarboxamide; CAS [RN] [66108-95-0]}, [0000] [0034] iopentol {C 20 H 28 I 3 N 3 O 9 ; 5-[acetyl(2-hydroxy-3-methoxypropyl)amino]-N,N′-bis(2,3-dihydroxypropyl)-2,4,6-triiodo-1,3-benzenedicarboxamide, CAS [RN] [89797-00-2]}, [0000] [0035] iopamidol {C 17 H 22 I 3 N 3 O 8 ; 5-[(2-hydroxy-1-oxopropyl)amino]-N,N′-bis(2-hydroxy-1-(hydroxymethyl)ethyl)-2,4,6-triiodo-1,3-benzenedicarboxamide, CAS [RN] [60166-93-0]}, [0000] [0036] and [0037] iobitridol {C 20 H 28 I 3 N 3 O 9 ; N N′-bis(2,3-dihydroxypropyl)-5-[[3-hydroxy-2-(hydroxymethyl)-1-oxopropyl]amino]-2,4,6-triiodo-N,N′-dimethyl-1,3-benzenedicarboxamide; CAS [RN] [136949-58-1]} [0000] [0038] Contrast media of the present invention also contain a dimer corresponding to Formula II [0000] [0039] wherein A 2, A 3, B 3, D 2, E 2, E 3 and X are as previously defined. In one embodiment, X is methylene (—CH 2 —) or ethylene (—CH 2 CH 2 —), preferably methylene, and A 2, A 3, B 3, D 2, E 2 and E 3 are as originally defined in connection with Formulae I and II. In another embodiment, each of A 2 and A 3 is —C(O)NH 2, each of B 3 and D 2 is —C(O)N(R)R 1, and E 2, E 3, and X and each R and R 1 are as originally defined in connection with Formulae I and II. In another embodiment, each of A 2 and A 3 is —C(O)NH 2, each of B 3 and D 2 is —CONHR, and E 2, E 3, and X and each R are as originally defined in connection with Formulae I and II. In another embodiment, each of A 2 and A 3 is —C(O)NH 2, each of B 3 and D 2 is —C(O)NHR 1, and -E 2 -X-E 3 - is —N(R)C(O)CH 2 C(O)N(R)— and each R and R 1 is as originally defined in connection with Formulae I and II. In another embodiment, each of A 2 and A 3 is —C(O)NH 2, each of B 3 and D 2 is —CONHR, and -E 2 -X-E 3 - is —N(R)C(O)CH 2 C(O)N(R)— and each R and R 1 is independently selected from hydrogen, methyl, hydroxymethyl (—CH 2 OH), ethyl, hydroxyethyl (—CH 2 CH 2 OH or —CH(OH)CH 3 ), propyl, hydroxypropyl (—CH 2 CH 2 CH 2 OH) or dihydroxypropyl (—CH 2 CH(OH)CH 2 OH); more preferably, in this embodiment, each R and R 1 is independently hydroxyethyl, hydroxypropyl, or dihydroxypropyl. In yet another embodiment, the contrast media comprises iosmin (also known as iosimenol) {C 31 H 36 I 6 N 6 O 14 ; 5,5′-[(1,3-dioxo-1,3-propanediyl) bis[(2,3-dihydroxypropyl) imino]]bis[N-(2,3-dihydroxy propyl)-2,4,6-triiodo-1,3-benzenedicarboxamide; CAS [RN] [181872-90-2]} as the dimer: [0000] [0040] In a preferred embodiment, the contrast media comprises the dimer of Formula II, preferably iosmin, together with one or more monomers selected from the group consisting of iomeprol, ioversol, iohexyl, iopamidol, iopromide, iobitridol and iopentol, preferably ioversol, iohexyl, and iopamidol, and more preferably ioversol. [0041] Optionally, the contrast media of the present invention further comprises an imaging agent of a class not corresponding to either of Formulae I and II. For example, the contrast media may additionally comprise X-ray contrast imaging agents not corresponding to Formula I or II. Alternatively, the contrast media may comprise other types of imaging agents such as ultrasound, magnetic resonance (MR), radionuclide, and optical imaging agents and may be used for other imaging applications. Other types of imaging agents are described in H. S Thomsen, R. N. Muller and R. F. Mattrey, Editors, Trends in Contrast Media, (Berlin: Springer-Verlag, 1999); and E. M. Sevick-Muraca, et al., Near-Infrared Imaging with Fluorescent Contrast Agents, In: M.-A. Mycek and B. W. Pogue, Editors, Handbook of Biomedical Fluorescence, (New York: Marcel-Dekker, 2003, chapter 14); and Textbook of Contrast Media Edited by Peter Dawson, David Cosgrove and Ronald Grainger, ISIS Medical Media 1999; and are hereby incorporated by reference. Broadly, the amount of such optional imaging agent is about 0.01 to about 15 mole percent based on the total moles of monomer and dimer in the mixture. [0042] Radiological compositions may be prepared containing the above mentioned mixtures of iodinated nonionic compounds as an x-ray contrast agent together with a pharmaceutically acceptable radiological vehicle by following established methods used to manufacture such injectable formulations. Pharmaceutically acceptable radiological vehicles include those that are suitable for injection such as aqueous buffer solutions; e.g., tris(hydroxymethyl)amino methane (and its salts), phosphate, citrate, bicarbonate, etc., sterile water for injection, physiological saline, and balanced ionic solutions containing chloride and/or bicarbonate salts of normal blood plasma cations such as Ca, Na, K and Mg, and other halides, carbonates, sulphates, phosphates of Na, K, Mg, Ca. Other buffer solutions are described in Remington&#39;s Practice of Pharmacy, Eleventh Edition, for example on page 170. The vehicles may advantageously contain a small amount (e.g., from about 0.01 to about 15.0 mole %) of a chelating agent such as ethylenediamine tetraacetic acid (EDTA), calcium disodium EDTA, or other pharmaceutically acceptable chelating agents such as calcium monosodium DTPA-BMEA (Versetamide; Mallinckrodt Inc.). The composition further comprises non-radiographic additives selected from the group consisting of excipients, such as, for example, glycerol, polyethylene glycol or dextran, and anticlotting agents, such as, for example, heparin or hirudin. [0043] The concentration of the x-ray contrast agent of the present invention in the pharmaceutically acceptable vehicle, e.g., water, will vary with the particular field of use. A sufficient amount is present to provide satisfactory x-ray visualization. For example, when using aqueous solutions for angiography, the concentration of iodine is broadly about 100 to about 500 mg/ml, preferably about 140 to about 400 mg/ml, and the dose is in the range of 25-300 ml. The radiological composition is administered so that the contrast agent remains in the living animal body for about 0.5 to 3 hours, although shorter or longer residence periods are acceptable as needed. Thus, for vascular visualization, the mixture disclosed herein and analogous mixtures may be formulated conveniently in vials, bottles, ampules or prefilled syringes containing 10 to 2000 ml of an aqueous solution. These containers may be made of glass, plastic or other materials suitable for pharmaceutical products. [0044] In one embodiment, the mixtures of this invention may be formulated as micelles, liposomes and micro/nano particles. These formulations may enhance delivery and localization of the inventive compositions to/at the desired organ or site. The target specificity of these formulations can be enhanced by incorporating suitable targeting molecules such as peptides, saccharides, fatty acids, and the like. Preparation and uses of these formulations are well known in the art. [0045] The diagnostic compositions of the invention are used in the conventional manner. The compositions may be administered to a patient, typically a warm-blooded animal, either systemically or locally to the organ or tissue to be imaged, optimally using a power injector when appropriate, and the patient then subjected to the imaging procedure. For example, in the case of selective coronary arteriography, an amount of the radiological composition, sufficient to provide adequate visualization, is injected into the coronary system and the system is scanned with a suitable device such as a fluoroscope. The agent may be used in various other radiographic procedures e.g., in cardiography, coronary arteriography, aortography, cerebral and peripheral angiography, orthography, intravenous pyelography and urography. [0046] X-ray contrast Imaging Procedures are found in Albert A. Moss, M. D., Gordon Gamsu, M. D., and Harry K. Genant, M. D., Computed Tomography of the Body, (Philadelphia, Pa.: W.B. Saunders Company, 1992) and M. Sovak, Editor, Radiocontrast Agents, (Berlin: Springer-Verlag, 1984). [0047] The following examples illustrate the invention and are not limiting. In each of the examples, osmolality is determined at 37° C. using the Wescor 5500 Vapor Pressure Osmometer. Viscosity is determined at 25° C. and 37° C. using Brookfield Analog Micro Viscometer Model LVT or Digital Model DV-II+ Cone/Plate Viscometer. EXAMPLE 1 [0048] 1A. 320 mgl/ml Iosimenol Injection formulation: 62.13 grams of Iosimenol, 0.224 grams of Tromethamine, 0.1 grams of Edetate calcium disodium and 0.22 grams of NaCl were mixed in 75 ml of water for injection (WFI) at room temperature (RT) until completely dissolved. The pH was adjusted to ˜6.8 using 1N hydrochloric acid solution or 1N sodium hydroxide solution and the formulation was brought up to the final volume of 100 ml with WFI. A 50 ml aliquot of the above formulation in a bottle was autoclaved at 121° C. for 20 minutes. Both autoclaved and unautoclaved above samples were tested for osmolality (at 37° C.) and viscosity (at 25° C. and 37° C.) values using established methods. [0049] 1B. Mixed XRCM Formulation: Equal amounts (on a volume basis) of above unautoclaved Iosimenol Injection formulation and 320 mgl/ml of the commercial formulation of Ioversol (OPTIRAY-320; sold by Mallinckrodt Inc., St. Louis Mo., USA) were mixed. One milliliter of OPTIRAY-320 contains 678 mg of ioversol with 3.6 mg of tromethamine as a buffer, 0.2 mg of edetate calcium disodium as a stabilizer with pH adjusted between 6 and 7.4 with hydrochloric acid or sodium hydroxide. A portion of this mixed formulation was autoclaved at 121° C. for 20 minutes. [0050] Autoclaved and unautoclaved samples were tested for osmolality (at 37° C.) and viscosity (at 25° C. and 37° C.) values using established methods and the values are tabulated (Table 1). Table 1 summarizes the osmolality and viscosity of the Iosimenol for Injection, Experiment 1A, before and after autoclave (Nos. 1 and 2 respectively), and of the mixed MRCM formulation, Experiment 1B, before and after autoclave (Nos. 3 and 4 respectively). The osmolality and viscosity values for the autoclaved and unautoclaved samples are comparable. Therefore, subsequent samples were not autoclaved. [0000] TABLE 1 Mixed XRCM Formulation-320 mgl/ml Vis- Vis- loversol Osmolality cosity cosity 320 losimenol Auto- (mOsm/kg) (cps) (cps) No. mgl/ml Injection claved 37° C. 25° C. 37° C. 1. 0% 100% No 286 15.5 8.9 2. 0% 100% Yes 288 15.2 8.7 3. 50% 50% No 485 10.1 6.3 4. 50% 50% Yes 486 10.2 6.2 EXAMPLE 2 [0051] A 320 mgl/ml Iosimenol formulation was prepared following the procedure defined in Example 1A, except no NaCl was added. The formulation was not autoclaved. [0052] An Ioversol 320 mgl/ml formulation (OPTIRAY-320) was mixed with the above Iosimenol formulation in different ratios. Osmolality (at 37° C.) and viscosity (at 25° C. and 37° C.) were measured for the starting samples and the unautoclaved, mixed samples following established methods. The results are summarized in Table 2. For sample set Nos. 1, 3 and 4, the individual (Iosimenol and Ioversol) and the mixed samples were tested on the same day. For sample set No. 2, the individual samples and the mixed sample were also tested on the same day but on a day other than the testing day for sample set Nos. 1, 3 and 4. Table 2 also lists the theoretically expected values of osmolality and viscosity for the mixtures (Theory). These theoretical values were calculated based on the percentage contributions from the pure samples. [0000] TABLE 2 Mixed XRCM Formulation-320 mgl/ml Vis- loversol losimenol Osmolality Viscosity cosity 320 Without (mOsm/kg) (cps) (cps) No. mgl/ml NaCl 37° C. 25° C. 37° C. 1. 100% 0% 680 9.2 6.0 0% 100% 201 11.5 6.8 30% 70% 338 10.0 6.2 Theory 345 10.8 6.56 2. 100% 0% 702 9.2 5.7 0% 100% 194 11.8 6.5 50% 50% 430 9.6 5.8 Theory 448 10.5 6.1 3. 100% 0% 680 9.2 6.0 0% 100% 201 11.5 6.8 70% 30% 534 9.3 6.0 Theory 536 9.9 6.24 4. 100% 0% 680 9.2 6.0 0% 100% 201 11.5 6.8 90% 10% 640 9.3 5.9 Theory 632 9.43 6.08 EXAMPLE 3 [0053] The autoclaved Iosimenol Injection formulation (IF) sample from Example 1A was diluted to a concentration of 300 mgl/ml with WFI. Commercial 300 mgl/ml samples of Ioversol (OPTIRAY-300, sold by Mallinckrodt Inc, St. Louis Mo., USA), of Iopamidol (ISOVUE-300 sold by Bracco, Milan, ITALY) and of Iohexol (OMNIPAQUE-300 sold by Amersham, London, UK) were obtained. [0054] Each milliliter of OPTIRAY-300 contains 636 mg of ioversol with 3.6 mg of tromethamine as a buffer, 0.2 mg of edetate calcium disodium as a stabilizer and the pH was adjusted between 6 and 7.4 with hydrochloric acid or sodium hydroxide. Each milliliter of ISOVUE-300 contains 612 mg of iopamidol with 1 mg tromethamine as a buffer, 0.39 mg edetate calcium disodium as a stabilizer and the pH adjusted between 6.5 and 7.5 with hydrochloric acid or sodium hydroxide. Each milliliter of OMNIPAQUE-300 contains 647 mg of iohexyl, 1.21 mg tromethamine, 0.1 mg edetate calcium disodium and the pH adjusted between 6.8 and 7.7 with hydrochloric acid or sodium hydroxide. [0055] Iosimenol Injection (300 mgl/ml) formulation (IF) was mixed with individual 300 mgl/ml commercial formulations of Ioversol (OPTIRAY-300), Iopamidol (ISOVUE-300) and Iohexyl (OMNIPAQUE-300) in equal amounts (on a volume basis). Osmolality (at 37° C.) and viscosity (at 25° C. and 37° C.) values were measured for all samples (N=7) following established methods. The results are summarized in Table 3. Values for “Theory” are as described for Example 2. [0000] TABLE 3 Mixed XRCM Formulation-300 mgl/ml Osmolality, Viscosity Viscosity (mOsm/kg) (cps) (cps) No. Composition 37° C. 25° C. 37° C. 1. losimenol Injection (IF) 273 10.9 6.3 loversol 657 7.6 4.8 50% IF + 50% loversol 444 8.2 5.2 Theory 465 9.25 5.55 2. losimenol Injection (IF) 273 10.9 6.3 lopamidol 654 7.1 4.6 50% IF + 50% lopamidol 463 7.9 5.0 Theory 463 9.0 5.45 3. losimenol Injection (IF) 273 10.9 6.3 lohexol 691 9.5 5.9 50% IF + 50% lohexol 478 9.1 5.7 Theory 482 10.2 6.1 EXAMPLE 4 [0056] A 320 mgl/ml Iosimenol Injection formulation was made as described in Example 1A. To 10 ml of the Iosimenol formulation was mixed with 1.059 grams of Ioversol powder to give 370 mgl/ml of mixed formulation (13.5% iodine from monomer/86.5% iodine from dimer). The osmolality at 37° C. was determined to be 277 mOsm/kg. The viscosity value at 37° C. was determined to be 9.1 centipoise (cps).

Summary: The present invention generally relates to nonionic x-ray contrast media formulations, radiological compositions containing such agents and methods for x-ray visualization utilizing such compositions. The invention especially relates to injectable radiological compositions for x-ray visualization comprising a pharmaceutically acceptable vehicle and a mixture of a monomer, being a triiodo-substituted benzene nucleus, and a dimer, being two linked triiodo-substituted benzene nuclei, such that the mixture demonstrates favorable properties.

big_patent

en

Summarize: WILMINGTON, N.C. (Reuters) - From turtles to fish, the denizens of two North Carolina aquariums will be facing Hurricane Florence alone after their handlers were forced to leave under mandatory evacuation orders. A full rainbow over the empty parking area of the North Carolina Aquarium At Fort Fisher highlights the Aquariums spadefish fountain, as staff prepares for Hurricane Florence in Kure Beach, North Carolina, U.S. September 11, 2018. Courtesy Jane Kepler/N.C. Aquarium at Fort Fisher/Handout via REUTERS Florence, a Category 3 hurricane on the five-step Saffir-Simpson scale and still growing, is expected to strike North Carolina late Thursday or early Friday, potentially bringing deadly high seas and catastrophic flooding. Animal handlers at two of the state’s three major aquariums, located on the vulnerable Outer Banks barrier islands and other threatened coastal areas, had no choice but to leave on Wednesday after making last-minute preparations. “The animals are part of our family,” said Danielle Bolton, spokeswoman for the Pine Knoll Shores aquarium, which closed to the public on Tuesday. “It is very emotional having to close and not know exactly what’s going to happen.” The animals “got fed as much as they could the last few days,” Bolton said. At the other two aquariums, North Carolina Aquarium at Fort Fisher, some 20 miles south of Wilmington, and on Roanoke Island, employees also did everything they could to protect the various sea creatures. “(The handlers) are all very concerned about what will happen and what could happen,” said Robin Nalepa, a spokeswoman for the North Carolina Aquarium, which is home mostly to fish, sharks, reptiles and sea turtles. “Obviously, we sit right on the coast, but part of the building has been there for 40 years, since 1976,” she said. Before leaving, employees completed an extensive checklist that included preparing animal habitats as best they could for the incoming storm, Nalepa said. Some animals were moved to safer parts of the building, water levels were topped off and generators were left running to oxygenate the water, she said. “It’s not only personally distressing that there’s a (Category 3) hurricane that we’re all trying to prepare for personally, but that it could impact the animals that they care for on a daily basis. It can really take a toll,” she added. Bolton of Pine Knoll Shores noted that some sea creatures are more resilient than others. “Sharks can go two to three weeks without eating. However, we don’t normally let them go that long in the aquarium,” Bolton said. “We might find one or two of the smaller fish missing. We hope that’s not gonna happen.” Officials at the North Carolina Aquarium on Roanoke Island decided to keep a crew of four at the facility during the storm, even though area residents had been ordered to evacuate, spokesman Brian Postelle said. “The determination was made that it was a reasonable call for them to stay at the aquarium,” Postelle said by telephone. “The aquarium itself is a very strong building.” The center of Florence was forecast to draw close to the North Carolina coast on Friday afternoon - perhaps lingering just offshore - then drift southwest along the shoreline before turning inland on Saturday, according to the National Hurricane Center in Miami. (This version of the story fixes number of evacuated aquariums in first and third paragraphs to two, not three; in paragraphs 13-14 adds comments to show that some crew remain at Roanoke Island aquarium) What do Waffle Houses have to do with risk and disaster management? As anyone who has heard Administrator Fugate speak once or twice knows, more than you might think. During his days as the head of Florida’s Department of Emergency Management, Craig began to use a simple test to determine how quickly a community might be able to get up and running again after a disaster: The Waffle House test. If this comparison seems odd at first, think again. Yesterday, EHS Today, a magazine for environment, health and safety leaders, explained that major companies such as The Home Depot, Walmart, and Waffle House serve as role models in disaster preparedness. They’ve taken necessary steps to prepare. These companies have good risk management plans to ensure that their stores continue to operate when a disaster strikes, and also provide basic supplies to people in their community. As the article explains, the Waffle House test is: If a Waffle House store is open and offering a full menu, the index is green. If it is open but serving from a limited menu, it’s yellow. When the location has been forced to close, the index is red. Because Waffle House is well-prepared for disasters… it’s rare for the index to hit red. As Craig often says, the Waffle House test doesn’t just tell us how quickly a business might rebound – it also tells us how the larger community is faring. The sooner restaurants, grocery and corner stores, or banks can re-open, the sooner local economies will start generating revenue again – signaling a stronger recovery for that community. The success of the private sector in preparing for and weathering disasters is essential to a community’s ability to recover in the long run. EHS Today’s article serves as a good reminder that businesses should get ready. Up to 40 percent of businesses affected by a natural or man-made disaster never reopen, according to the Insurance Information Institute. Keep your business out of this statistic. As we’ve said before, learn about the resources available to help your company prepare for a disaster – and stay in business. Hurricane Florence continues on its path toward the United States East Coast and is expected to sweep the Carolinas through Saturday. And that means one thing: Waffle House has its Storm Center up and running, monitoring and tracking the path of Hurricane Florence. The ⁦@WaffleHouse⁩ Storm Center is activated and monitoring #Florence. Plan ahead and be safe. pic.twitter.com/UOBi5oZRRi — Waffle House News (@WaffleHouseNews) September 11, 2018 https://platform.twitter.com/widgets.js You may be wondering why in the world is Waffle House in the disaster management business? The Norcross, Georgia-based chain keeps almost every one of its 2,100 locations open 24/7, no matter what the weather forecast says. That includes staying open during natural disasters such as Hurricane Florence. How fully a Waffle House is able to operate is an important indicator of how well a community may be faring. In fact, it’s such a major indicator that the Federal Emergency Management Agency (FEMA) established a “Waffle House index” following the devastating 2011 tornado that hit Joplin, Missouri. The Waffle House index maps locations that are fully or partially functioning as normal, and those that are closed. The pleasantly simple index is also color-coded: A green index means a Waffle House is open and offering a full menu. means a Waffle House is open and offering a full menu. A yellow index means a Waffle House is open, but offering a limited menu. means a Waffle House is open, but offering a limited menu. A red index means a Waffle House has been forced to close. “If a Waffle House can serve a full menu, they’ve likely got power (or are running on a generator). A limited menu means an area may not have running water or electricity, but there’s gas for the stove to make bacon, eggs, and coffee: exactly what hungry, weary people need,” FEMA communications specialist Jessica Stapf wrote in a 2017 blog post. The logic goes that the sooner a Waffle House can get back on the grid, any number of local institutions including banks, grocery stores, and post offices can start functioning again. And already, one South Carolina Waffle House has turned red on the current Waffle House Index. The Myrtle Beach Waffle House has completely closed until the hurricane passes. For critical weather information, please visit www.weather.gov. To learn more, see www.commerce.gov. Parts of the U.S. Government are closed. However, because the information this site provides is necessary to protect life and property, it will be updated and maintained during the Federal Government shutdown. Tweet with a location You can add location information to your Tweets, such as your city or precise location, from the web and via third-party applications. You always have the option to delete your Tweet location history. Learn more

Summary: The unwelcome Florence has almost arrived. The Category 2 hurricane is due to make landfall in North Carolina on Friday with devastating consequences, and the Washington Post reports that flooding already has begun. See the National Hurricane Center for the latest, including projections on rainfall and wind along the storm's expected path. Related coverage of Florence and other menacing storms, including Super Typhoon Mangkhut: Augmented reality: Wilmington, NC, could see a flood surge of 9 feet. What would that look like? See this tweeted video from meteorologist Ryan Davidson for a scary explanation. Waffle House: The chain has its own storm center and is monitoring Florence, and Fortune explains the significance. Waffle House tries to keep stores open no matter the forecast, and FEMA actually uses a "Waffle House index" to gauge how bad things are-green means the local restaurant is open, yellow means open with limited menu, and red means closed. On their own: Animals at three major aquariums in the Outer Banks of North Carolina will have to ride out the storm without their human handlers, reports Reuters. The sites are located within mandatory evacuation zones, and the humans have prepared the facilities as best they could before clearing out.

multi_news

en

Summarize: Outsiders don’t want their daughters to marry any local boys, according to the village elders swapping stories in a tailor’s shop behind the Sikh temple, because most residents are infected with black jaundice. That’s what they call hepatitis C, which is so common in parts of India’s Punjab state that the tailor-shop gossips might not be off base in their estimate. But prevalence could be something of an advantage these days. Drugmakers have made the village of Lande Rode one of the theaters in a battle to grab market share for sofosbuvir, a miracle cure that Gilead Sciences Inc. sells in the U.S. as Sovaldi at a retail price of $1,000 a pill. Gilead licensed 11 Indian companies to make generic versions, and they sealed marketing deals with others. Competition has been so fierce it’s driven down the cost and spurred thousands to be tested. QuickTake Access to Medicines Manufacturers “want more and more patients” and are willing to wheel and deal on price, said Nirmaljeet Malhi, a gastroenterologist at Apollo Hospitals in Ludhiana, about 200 kilometers (124 miles) from Lande Rode. “If one agrees to it, the others will also have to. It’s a race where one cannot say no -- because then they’re going to lose the business.” The companies sponsor screening drives, hand out free test kits to hospitals and offer bulk discounts to entire villages. Sofosbuvir was cheap by most any standard when it hit the market in Punjab at $10 in March. Then the cost kept dropping, to as low as $4.29, and doctors predict it will continue to fall. Game Changer That’s in contrast to the situation in the U.S., where Gilead set off a firestorm in December 2013 by listing Sovaldi at $84,000 for a 12-week course regimen. It’s a game-changing drug, often wiping out an infection in three months, and without the debilitating side effects of earlier treatments that took longer. Still, the cost started the latest backlash over high medicine prices. Dozens of state Medicaid plans limited access to the drug, and a U.S. Senate report chastised the company. Gilead, which has said it priced Sovaldi responsibly and thoughtfully, is giving insurers and bulk purchasers discounts. Like others in the industry, the company arranges to make life-saving cures available in some parts of the world for far less; laws and pressure introduced so-called tiered pricing after expensive anti-HIV treatments became available in the ’90s and reduced deaths in rich countries and not poor ones. In exchange for a 7 percent cut of sales, Gilead gave companies including Mylan NV, Cipla Ltd. and Natco Pharma Ltd. rights to make generics for distribution in 101 developing nations where hepatitis C is often untreated and $1,000 is more than people might earn in a year. The company wants to “foster competition in the marketplace” in low-income areas, according to spokesman Nathan Kaiser. Now there are more than a dozen sofosbuvir versions for sale in India. “The market has become highly competitive in the last six months with close to 20 companies launching their own,” said M.V. Ramana, executive vice president and head of branded markets at Dr. Reddy’s Laboratories Ltd. The U.S. Pays a Lot More for Top Drugs Than Other Countries Competition Benefits The sofosbuvir rivals are aggressive about expanding the customer base by making the pills affordable and diagnosis easier. Dr. Reddy’s, for example, set up a venture with lender Arogya Finance to offer no-interest loans for patients, and Abbott Laboratories worked with French medical equipment company Echosens SAS to supply Indian hospitals with 13 ultrasound machines that determine the level of fibrosis, or hardening, without a liver biopsy. A main benefit of the competition, according to doctors, is that so many are being tested for hepatitis C, which can lead to cirrhosis and liver cancer. As many as 150 million people have the disease, according to the World Health Organization, including at least 12 million in India. Common modes of transmission are tainted medical equipment and reuse of syringes. Liver Scans Some of the highest infection rates are in Lande Rode and other villages of Punjab’s cotton-growing Malwa belt, where 30 percent to 50 percent of the population might have the virus, said Gagandeep Goyal, a gastroenterologist at Global Healthcare, a hospital sandwiched between an Adidas store and a Vodafone outlet in Bathinda, the fifth-largest city in Punjab. There are expenses beyond the drug itself. Villagers are encouraged to go to hospitals in cities for exams to determine the amount of virus in the blood and the exact strain, and scans to see the amount of scarring on the liver. At Malhi’s hospital the charge for a liver scan is 3,500 rupees ($52.86). Malhi said pharmaceutical companies might be persuaded to help defray these costs too. “If bulk treatment is required -- say, in a village where 200 people are positive -- they might give more favorable pricing to that village for complete treatment,” he said. As for the drug itself, he said, if he tests 20,000 people and finds 2,000 infected, he might be able to negotiate to get the cost of a 12-week course reduced by a third to $1,000. “Where in the U.S., you get one pill, here you get an entire treatment,” he said. “People in these villages can afford this -- possibly everybody can.” The disease is a topic of conversation for the elders at the tailor’s shop in Lande Rode, a cluster of concrete houses dotting dirt roads and surrounded by rice and wheat fields. Baldev Singh, a farmer and official of the Sikh temple, said he reckoned 80 percent of the village is infected. Singh’s family is like many. He was successfully treated with interferon injections last year, before the antiviral pill was available. He looks older than his 45 years, his beard fully gray and his eyes hidden behind sunglasses, even inside the tailor’s dimly lit shop. His wife, brother and 16-year-old nephew have hepatitis C; the nephew is taking sofosbuvir financed by a loan. But Singh hasn’t had his teenage sons tested yet -- and his wife takes an Ayurvedic medicine whose ingredients include capers and wild chicory. Singh said he thinks her viral count is too low to warrant the expense of generic Sovaldi. “And anyway,” he said, “the price is supposed to come down a little more, right?” — With assistance by Caroline Chen, and Doni Bloomfield Insurers deny almost a quarter of requests for sofosbuvir/lepidasvir (Harvoni) to treat people with chronic hepatitis C virus (HCV) infection, investigators from Yale Liver Center report in PLoS One. However, most of those who were initially refused subsequently gained access after appeal. Advanced liver disease and Medicare/Medicaid insurance were associated with earlier decision and approval times, whereas Medicare/Medicaid coverage and high viral load were significant predictors of initial approval. “We found that nearly one in four were denied initial approval, although most patients eventually obtained drug authorization through the appeals process,” comment the authors. “Fewer than 10% of patients ultimately failed to obtain access to therapy, although the appeals process led to further delay in treatment initiation.” Treatment of HCV infection has been revolutionised by the development of direct-acting antiviral (DDA) agents. Compared to traditional therapy with pegylated interferon/ribavirin, treatment with DDAs is associated with better tolerability, improved adherence and high cure rates. Because of its efficacy, the combination sofosbuvir/ledipasvir (SOF/LED) is recommended by professional organisations in the US for the treatment of HCV genotype-1 infection. However, it is necessary for insurers to accept that treatment with DAAs is medically necessary and authorise access. A 12-week course of treatment with SOF/LED costs $94,500, or $1,125 per pill. Because of this high cost, insurer authorisation often requires that people have advanced fibrosis (F3 or above) or cirrhosis. Investigators from Yale Liver Center wanted to see how many people with HCV were obtaining authorisation for therapy with SOF/LED in a “real world’ setting, and also the factors associated with approval, time to decision, and time to approval. They therefore designed a retrospective study involving 129 people prescribed SOF/LED at the centre between October and December 2014. Their mean age was 57 years, 61% were male and 61% had liver cirrhosis. Over three-quarters (77.5%) received initial approval. A further 17 (14%) subsequently obtained access to the treatment on appeal. The average time to final appeal was 26 days, and for those who were approved, the average time to decision was 23 days. Faster approval time was seen for people with Child-Pugh Class B disease (14 vs. 25 days, p = 0.048). People with Medicaid/Medicare coverage were more likely to be initially approved than those with private insurance (92% vs 71%, p = 0.002). A viral load above 6 million iu/ml was also associated with initial approval (84% vs. 63%, p = 0.04). Factors associated with shorter decision and approval times were female gender, advanced fibrosis and higher MELD score. Psychiatric disease was a significant predictor of shorter time to approval. “This is the first study to our knowledge assessing real-world access to interferon-free DAA regimens in established cohorts of patients with chronic HCV seeking antiviral therapy,” write the investigators. “These results contribute to the limited data available addressing the proportion of patients successfully obtaining drug authorization through public and private insurance carriers, time to approval, and predictors of approval.” They emphasise, “most patients filing a pre-authorization request for SOF/LED are eventually approved, but nearly 1 in 4 were denied access upon initial request, which may represent a barrier within the HCV care cascade.” A different study design, which looked at insurance approvals in patients presenting prescriptions at a specialty pharmacy chain in four US states, presented at the 2015 Liver Meeting, found that patients with Medicaid insurance were significantly more likely to be refused insurance coverage of their hepatitis C treatment.

Summary: It's starting to seem like America is an expensive place to get a disease. Bloomberg reports sofosbuvir-a Hepatitis C "miracle cure"-that retails for $1,000 per pill in the US is currently going for $4.29 in India, and that price is continuing to drop. Like other pharmaceutical companies, Gilead Sciences is making generic versions of its drug available in developing countries. More than a dozen generic versions of sofosbuvir, which can get rid of Hepatitis C in just three months, are currently being sold by multiple companies in India. And those companies are constantly lowering prices to gain a bigger market share. "If one agrees to it, the others will also have to," an Indian gastroenterologist tells Bloomberg. "It's a race where one cannot say no-because then they're going to lose the business." These cheap, generic versions of sofosbuvir are great for India, where at least 12 million people-and up to 50% of the population in some areas-have Hepatitis C, Bloomberg reports. But in the US, the steep price-nearly $95,000 for a 12-week course-is limiting access, according to aidsmap.com. A recent study found almost 25% of people with chronic Hepatitis C have their initial requests for sofosbuvir denied by insurance companies. That number lowers to less than 10% after appeals-but appeals take time away from treatment. Insurance companies often require patients to have advanced fibrosis or cirrhosis before they agree to take on the cost of sofosbuvir. Bloomberg reports Medicaid is also limiting access to sofosbuvir. Gilead, which has faced criticism over high prices from the US Senate, stands behind its pricing.

multi_news

en

Summarize: BACKGROUND OF THE INVENTION The present invention relates to storage racks and, more particularly, to a safety lock for interlocking horizontal beams with vertical frame supports. A typical pallet rack comprises a frame made of vertical posts which are interconnected by horizontal beams. Rigid slats or sheets may be positioned upon opposing beams to form shelves. Alternatively, the beams may be used alone like shelves. Horizontal platforms, or pallets, loaded with articles to be stored, are positioned upon the opposed beams or slats or sheets spanning the beams, where they are used. In essence, the rack is an open shelving arrangement. In heavy duty pallet racks or similar types of frames which are utilized to support heavy weights, it is desirous that the beams which extend horizontally between the corner posts and other parts of the frames be maintained in their position. Thus, it is desirous to include a locking device on the horizontal beams to interlock the beams with the frame support posts against accidental withdraw of the beams. In the past, one piece locking devices have been utilized on the end connectors of the beams. While these one piece locking devices provide satisfactory results, designers are always seeking to improve the art. SUMMARY OF THE INVENTION Accordingly, it is an object of the present invention to provide an improved safety lock device for horizontal beams in pallet rack systems. The safety lock device of the present invention provides the art with a two-piece locking device. The two pieces are easily manufactured by stamping or the like processes from spring steel or similar materials. The safety lock device has one piece readily adaptable to be affixed to a beam end connector. The second piece is easily installed with the first piece to provide the end connector with a safety locking device. The two piece safety lock device is relatively inexpensive to manufacture and reduces the tooling cost associated with an intricate die to manufacture a one-piece safety latch. The two-piece safety lock device provides for on-site assembly of the second member as well as removal and replacement of the second member, if the second member is damaged. From the following detailed description taken in conjunction with the accompanying drawings and the subjoined claims, other objects and advantages of the present invention will become apparent to those skilled in the art. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a perspective view of a pallet rack assembly in accordance with the present invention. FIG. 2 is an enlarged perspective view of FIG. 1 within Circle 2. FIG. 3 is an exploded perspective view of the safety lock in accordance with the present invention. FIG. 4 is a vertical cross-section view of FIG. 2 through a plane defined by line 4--4 thereof. FIG. 5 is a rear perspective view along the direction of the plane defined by line 5--5 of FIG. 4. FIG. 6 is another embodiment of the safety lock in accordance with the present invention. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT Referring to the figures, particularly FIG. 1, a typical pallet rack is illustrated and designated with the reference numeral 10. The pallet rack is formed of four vertical frame posts 12 that are interconnected by horizontal front and rear beams 14 and horizontal braces 16. In addition, the posts may be further connected together by angularly arranged cross braces 18 which stiffen the frame. The beams 14 include angle shaped end connectors 20 which include upper, lower and center pins 22a, 22b, and 22c, respectively, which are force fitted or stamped within openings 23 formed in the connectors. These pins are loosely inserted into apertures 24 of the posts 12 to secure the beams 14 onto the frame posts 12. The end connectors 20 also include a safety lock mechanism 30 to lock the beams 14 within apertures 24 on the frame posts 12. The safety lock mechanism 30 includes a hold down or cross member 40 and a hook member 60. The members 40 and 60 are generally formed or stamped from spring steel or other strong resilient material. The cross member 40 includes four legs, that is, lower leg 42, transverse legs 44 and 46, and lower leg 48. (see FIG. 3) Leg 42 is relatively larger than the other legs and includes an aperture 50. The aperture 50 enables the cross member 40 to be rigidly secured to the end connector 20 by a center pin 22c. The center pin 22c is positioned through the aperture 50, in the cross member 40, and is stamped into place, to expand it, so that it is rigidly secured to the cross member. Cross member legs 44 and 46 transversely extend from the cross member body 54 with respect to the lower leg 42 and oppose one another. The legs 44 and 46 are stamped into the cross member 40 such that raised shoulders 53 and 55 are formed between the legs 44 and 46 and the body 54 to elevate the legs 44 and 46 from the plane of the body 54, as seen in FIGS. 2-4. This elevation enables the hook member 60 to be positioned under the transverse legs 44 and 46. The upper end of the upper leg 48 is bent into an end flange 56. The flange 56 is adapted to be positioned into an aperture 58 in the end connector 20. This positions the cross member 40 relative to the connector prior to stamping the stud 22c. The hook member 60 includes a U-shaped body having a pair of legs 62 and 64 connected by a V-shaped base or web 66. The interior side of the web 68 is continuous with legs 62 and 64 to define an inner edge that closely fits around cross member leg 42, as seen in FIG. 2. The hook member legs 62 and 64 are positioned under cross member legs 44 and 46 to retain the hook member between the end connector 20 and the cross member. The hook member web 66 has bent outer edge flanges 70 and 72 extending from its outer V-sides enabling gripping of the hook member 60. Also the web 66 includes a downwardly extending neck portion 74 whose lower edges are bent perpendicularly to form a pair of hooks 76. (see FIG. 6) The neck 74 is integral with the hook member web 66 and legs 62 and 64 forming the unitary hook member 60. The hooks 76 generally have a receiving portion 78 to enable a portion of the posts 12 to be secured therein, as seen in FIGS. 4 and 5. The tips 80 of the hooks 76 prevent the hooks 76 from being accidentally disengaged from the posts 1 while the hooks 76 are secured thereto. Generally, the cross member 40 is fixedly positioned upon the end connector 20 with the end flange 56 of the upper leg 48 aligned within aperture 58 and with the stud 22c fixed within the connector aperture 23 and cross member aperture 50. The stud 22c is stamped or compressed, like a rivet, to expand it and to outwardly deform its end portion 81 to permanently affix the cross member 40 onto the end connector 20. Before expanding the stud, the legs 62 and 64 of the hook member 60 are positioned underneath the legs 44 and 46 of the cross member 40. When the legs 62 and 64 are arranged underneath the legs 44 and 46, the hook 76 extends through a lower aperture 82 (see FIG. 3) formed in the connector 20. The hook member is made of a springy member, such as spring steel, so that its hooks 76 may be moved relative to the connector 20. In the event that the hook member is bent or otherwise damaged in use, it may be easily removed and replaced. For example, by prying the hook 76 outwardly of the aperture 82 with a coin or screwdriver, the hook member may be slid downwardly from beneath the cross member legs 44 and 46. Then a new hook member may be slid into place. The end connector 20 is ready to be secured to a frame post 12 to secure the beams 14 to the frame support posts 12. The pins 22a, 22b and 22c on the end connectors 20 are positioned within the inverted teardrop shaped apertures 24 formed in the frame posts 12. Each of the pins has an enlarged head 84 which is inserted through the enlarged upper portion 86 of the aperture 24. When the connector and pins are lowered, the heads are non-removably held by the lower, smaller portions 88 of the apertures 24, as seen in FIG. 5. The hooks 76 resiliently snap into the upper larger portion of the teardrop aperture 86 which it overlaps. The hooks 76 prevent inadvertent removal of the end connectors 20 from the frame posts 12. To disengage the hook members 60 from the frame posts, a screwdriver or a coin or the like can be utilized to pry beneath the flanges 72 or 74 to withdraw the hooks 76 out of the teardrop apertures 24. This enables the pins 22 to be moved from the lower smaller aperture portions 88 upwardly into the larger aperture portions 86 of the teardrop apertures 24 to permit removal of the heads 84 from the teardrop apertures 24. Turning to FIG. 6, a second embodiment of the present invention is shown. FIG. 6 illustrates a hook member 60 similar to that previously described. The elements which are substantially the same as those previously described have been identified with the same reference numerals. The differences of the alternate embodiment will be pointed out below. The legs 62 and 64 of the U-shaped hook member 60 include struck-out or embossed stop members 90, 92, 94 and 96. Upper stop members 90 and 92 are generally formed near the free extending upper ends of the legs 62 and 64. The members 90 and 92 are struck-out of the legs 62 and 64 and extend from the legs 62 and 64 to form projecting fingers or stops. The fingers 90 and 92 are resilient and deflectable towards and away from the legs 62 and 64. The lower stop members 94 and 96 are stamped into the legs 62 and 64 to form fixed raised nubs. The stop members 90, 92, 94 and 96 prevent movement of the U-shaped hook member 60 once it is positioned under the legs 44 and 46 of the cross member 40. The fingers 90 and 92 deflect, enabling them to pass underneath the leg members 44 and 46. Once passing underneath the legs 44 and 46, the fingers 90 and 92 spring upward and the nubs 94 and 96 contact the lower sides of the legs 44 and 46 to secure the U-shaped hook member 60 in place on the cross member 40, as seen in FIG. 6. Thus, the members 90, 92, 94 and 96 prevent movement of the hook member 60 while it is positioned on the cross member 40 on the end connector 20. While the above detailed description describes the preferred embodiment of the present invention, it will be understood that the present invention is susceptible to modification, variation and alteration without varying from the scope and fair meaning of the subjoined claims.

Summary: A pallet rack system has a safety lock on end connectors of horizontal beam members to prevent accidental removal of the horizontal beams from the vertical frame supports. The safety lock includes a cross-shaped member rigidly secured to the beam connectors and a U-shaped member associated with the cross-shaped member to operatively couple the U-shaped member with the end connector. The U-shaped member includes a hook which cooperates with an aperture in the frame supports to lock the safety lock device to the frame support which, in turn, locks the horizontal beams with the vertical frame supports.

big_patent

en

Summarize: A garage in an upmarket area of London has gone on the market for a staggering £100,000 - and the owner can only keep it for 14 years. The double lock-up is located off Cheyne Gardens, Chelsea, where the price of the average home is almost £4million. The courtyard, just a minute's walk from the Thames, is just seven feet wide meaning it can just about squeeze in a Range Rover - otherwise known as a Chelsea Tractor. The £100,000 garage (circled) in Cheyne Gardens, Chelsea - where the average price of a home is almost £4million - has had plenty of interest. With just 14 years left on the garage's lease, which cannot be extended, the secure parking space will cost £7,142 a year, £137 a week, or £20 a day. Despite the cost of the garage, it has had a plenty of interest from people living nearby. Many residents of nearby streets paid multi-million pound sums for their homes which have nowhere secure to park. John D Wood & Co, the upmarket estate agent selling the garage, has a five-bedroom home for sale on Cheyne Row for £6.45million. It has three bathrooms, two reception rooms, a pantry, laundry with patio, wine cellar and store rooms, gardens, separate studio - but no garage. The £100,000 price tag makes the lock-up as expensive as a renovated cottage in the West Country or a charming two-bed home in Cumbria. For £100,000 - the same price as the garage in Chelsea - you could buy this charming two-bedroom cottage in Aikton, which is just five miles from the Scottish border and comes with wooden beamed ceilings and an open fireplace. The cosy two-up two-down is perfect first step on to the housing ladder for young families and is just 15 miles from the Lake District. Robert Green, director of John D Wood & Co, said: 'The garage is located in a part of Chelsea close to the large houses of Cheyne Walk, and smart flats of Cheyne Gardens. 'Many of the owners of these houses and flats value being able to park a classic or special car away from the street and winter weather. 'Normally these garages rent for up to £8,500 per year, so the opportunity to acquire one on a lease with 14 years remaining has created good interest. 'The price offers a degree of certainty, and by paying upfront for 14 years one can forget about rent reviews.'

Summary: Garage in Cheyne Gardens, Chelsea, is up for sale for staggering £100,000. Lock-up is just 7ft wide - just about enough to fit a Range Rover inside. The pricey garage has only 14 years left on its non-renewable lease. This means the secure parking space will be worth £20 a day to its owner. £100,000 buys a cottage in the West Country and a family home in Cumbria.

cnn_dailymail

en

Summarize: Who Are Local Election Officials? There are more than 9,000 local election jurisdictions in the United States. (3) In most states, they arecounties or major cities, but in some New England and Upper Midwest states, they are smalltownships -- for example, more than 1,800 townships in Wisconsin. (4) Given that diversity and otherdifferences among states -- such as wealth, population, and the role of state election officials --responsibilities and characteristics of LEOs are likely to vary among the states. Nevertheless, somepatterns emerged from the survey. The demographic characteristics of LEOs are unusual for a groupof government officials. According to the survey results, the typical LEO is a whitewoman between 50 and 60 years old who is a high school graduate. She was elected to her currentoffice, works full-time in election administration, has been in the profession for about 10 years, andearns under $50,000 per year. She belongs to a state-level professional organization but not anational one, and she believes that her training as an election official has been good to excellent. As with any such description, the one above does not capture the diversity within thecommunity surveyed. About one-quarter of LEOs are men, about 5% belong to minority groups,40% are college graduates, and 8% have graduate degrees. They range from 24 to 89 years of age,and have served from 1 to 50 years. About one-third were appointed rather than elected to theirposts. Reported salaries range from under $10,000 to more than $120,000. About one-third belongto regional, national, or international professional organizations. The demographic profile of LEOs is unusual, especially for a professional group. While itis possible that some of the above results were statistical artifacts, it is likely that overall they reflectthe demographic characteristics of LEOs in general. If so, those characteristics appear to differ fromthose of other local government employees. For example, according to U.S. Census figures, whilewomen comprise a higher proportion of the local government workforce than men overall, (5) men comprise a higherproportion of local government general and administrative managers. (6) About 20% of those managersbelong to minorities. (7) The causes of those differences are not apparent. The patterns do not appear to be a result ofthe fact that most LEOs are elected, as the demographic characteristics of legislators appear to belargely similar to those for local government managers. (8) Potential policy implications of the demographic characteristicsof LEOs are discussed later in this report. Perceptions and Attitudes about Voting Systems The kinds of voting systems used in the United States have been changing over the past 20years. In particular, the computerization of voting has climbed dramatically during that period. Increasingly, jurisdictions have turned to computer-assisted voting systems -- especially optical scanand direct recording electronic (DRE) systems. In 1980, fewer than one-quarter of jurisdictions usedcomputer-assisted systems, with under 5% using optical scan and DRE systems. In contrast, morethan 75% used computer-assisted systems in 2004, with more than half of those using opticalscan. (9) Over that 20-yearspan, the most dramatic changes have been the seven-fold increase in the use of optical scan byjurisdictions, from about 7% in 1990 to more than 45% in 2004, and the doubling in DRE usebetween the 2000 and 2004 elections, from 10% to 20%. The number of jurisdictions usingpunchcards, lever machines, and hand-counted paper ballots was declining even before theenactment of HAVA. Use of these systems fell by more than half between 1990, when they wereused by more than 80% of jurisdictions, and 2004, with about 30% usage. The major alternativevoting systems in use at present are therefore optical scan and DRE. About half of jurisdictions with optical scan systems use precinctcount. In general, the survey results reflect the patterns found in other studies. (10) However, those studies,unlike the survey, did not distinguish between central-count and precinct-count systems. Thedistinction may be important from a policy perspective because for optical scan voting systems, onlythe precinct-count version provides for detection of improperly marked ballots by machine beforethe ballot is cast, allowing voters to correct mistakes such as overvotes (this is often called second-chance voting ). Central-count systems rely entirely on visual inspection by the voter todetect errors. About half (49.9%) of the jurisdictions surveyed use optical scan voting systems. Ofthose, 44.9% are central-count systems. (11) HAVA promotes but does not require the use of voting machinesthat detect errors. (12) LEOs are highly satisfied with whatever voting systems they areusing now. Most LEOs (more than 85% altogether) reported that they are highlysatisfied with their current voting systems and that the systems performed very well during theNovember 2004 election (more than 90%). There was little variation in the degree of satisfactionwith different kinds of voting systems, but the differences are illuminating: The most highly rated systems were precinct-count optical scan and DREs,which are the most compatible of current systems with the goals and requirements of HAVA. Ratings for these systems were not significantly different from each other. Both precinct-count optical scan and DRE systems were rated significantlyhigher than lever machines, hand-counted paper systems, and central-count optical scan with respectto overall satisfaction. There were no significant differences in the performance ratings of differentsystems for the November 2004 election, except between DREs, which were rated highest, andcentral-count optical scan, which was rated lowest. (13) While generally satisfied with their current systems, LEOs also indicated areas whereimprovements are needed. In rating a set of desired qualities of voting systems and the degree towhich their current voting system has those characteristics, the four features rated highest for boththe current and desired system were accuracy in counting, reliability, security, and ease of use by voters. Current systems were rated lowest in comparison to desired features for prevention of voter errors, ease of use by persons with disabilities, and machine error. Two features were rated higher as characteristics of the current voting system than they were indesirability: speed in vote counting, and cost of acquisition. The characteristics rated lowest for both current and desired systems were impact on different socioeconomic groups, and alternative-language capability. Not surprisingly, users of DREs and precinct-count optical scan systems rated them higherfor prevention of voter error than users of other systems rated theirs. DRE users also rated theirsystems higher than users of other systems did theirs for ease of use by disabled persons and formultiple-language use. Most jurisdictions acquiring new voting systems choose those thathelp voters avoid errors. The length of time that jurisdictions reported using theircurrent voting systems varied widely, from one year or less to more than 200 years. The average is12 years. (14) About onein six jurisdictions reported that they had acquired a new voting system since 2000, and half of thoseobtained DREs, which prevent overvotes and can help voters minimize unintentional undervoting. The remainder chose optical-scan systems, and more than three-quarters of those acquiredprecinct-count versions. About 40% of respondents indicated that they are likely to replace theircurrent voting system within the next five years, with similar proportions as above expecting tochoose DREs, precinct-count, and central-count optical scan systems. Overall, 85% of recentlyacquired or planned voting systems assist voters in preventing or detecting many ballot-markingerrors. LEOs tend to choose new voting systems with similarcharacteristics to what they use at present. LEOs might be expected to choose newvoting systems that behave in a similar manner to those they have been using. In particular,jurisdictions replacing punch-card and hand-counted paper systems might be more likely to chooseoptical scan, which is also paper-based. Those replacing lever machines might be expected tochoose DREs, since neither system uses paper ballots. The survey results support that hypothesis: Lever machine users are four times more likely to switch to DREs than to optical scan. Levermachine users who switch to optical scan systems are five times more likely to choose precinct-countthan central-count, which might be expected, as lever machines are also precinct-count systems. Users of punchcards are more likely to switch to optical scan systems than to DREs and are morelikely to choose precinct-count than central-count. The results for LEOs using hand-counted papersystems are not conclusive but suggest a preference for optical scan over DRE systems. LEOs have more concerns about the security and performance ofvoting systems they are not using themselves. While LEOs tend to be very satisfiedwith the systems that they are using, they have more reservations about other kinds. Average supportfor other systems was substantially less than that for the system in use. Punchcards, lever machines,and hand-counted paper ballots all received negative average ratings from those LEOs not usingthose systems. DREs and the two types of optical scan received positive ratings on average, withprecinct-count rated the highest. Central-count optical scan was rated a bit higher than DREs, whichis perhaps surprising given the finding discussed above that most jurisdictions planning to obtainnew systems expect to adopt either DREs or precinct-count optical scan. This issue was also examined more specifically for DREs and optical scan users. DRE usersrated their systems higher than non-DRE users in all specific performance categories tested --including security, reliability, usability, and cost -- except for multiple-language capability. Thesame patterns held in comparisons of optical-scan users and nonusers. (15) The reasons why nonusersrated alternative-language capability higher than users is not clear. DRE users do not support the use of voter-verifiable paper audittrails (VVPAT), but nonusers do. One of the most striking differences betweenusers and nonusers of DREs is in their attitudes toward the proposal that DREs be required toproduce paper ballots on which voters can verify their choices before the ballot is cast (Fig. 1) -- asystem also called voter-verifiable paper audit trail (VVPAT). (16) Most DRE users (70%)do not support the use of VVPAT and most do not plan to add them to their voting systems, whereasabout 70% of LEOs not using DREs do support VVPAT. DRE users opposing VVPAT mostcommonly cited risk to voter privacy, printer reliability, and cost as the reasons. While lack of utilitywas not listed as an option, it was written in by 9% of those respondents. However, even thoserespondents (DRE users and nonusers) who expressed support for VVPAT were generally willing(65%) to spend only $300 or less for the feature. Figure 1. Support for Voter-Verified Paper Audit Trails (VVPAT) among LocalElection Officials Who Use DREs and Other Voting Systems Source: Texas A&M University, in coordination with the Congressional Research Service. Both DRE and optical scan users do not generally believe that their voting system softwareis vulnerable to attack by viruses or hackers. They also believe that current state and federalcertification procedures for software and hardware are adequate and that any security concerns withtheir systems can be adequately addressed by good security procedures. For both systems, nonusersare less confident in security and certification and more concerned about software vulnerability. However, they had greater concerns about the vulnerability of DREs than optical scan systems. Table 1. Importance of Different Factors in the Recent andPlanned Acquisition of New Voting Systems by Local Election Jurisdictions Note: Respondents were asked to rate the importance of each factor from 0 (not at all important)to 10 (extremely important). Recent systems are those acquired within the last three years. Plannedsystems are those expected to be acquired within five years. The number reported is the medianresponse. Source: Texas A&M University, in coordination with the Congressional Research Service. The Help America Vote Act (HAVA): Impacts and Attitudes HAVA requirements and funding have been a major factor in the adoption of new votingsystems by LEOs. Among the 17% of jurisdictions reporting that they acquired voting systems since2000, about half reported receiving federal funding for that purpose, with about one-third reportingthat most of the funding was from federal sources. About 40% of respondents expect to acquire newsystems within the next five years. HAVA and state requirements and funding were listed as themost important factors in those decisions (Table 1). (17) Concerns about the accuracy or cost of the previous or currentsystems were among the least important factors. Most respondents who plan to replace their currentsystems expect to change all voting machines in the jurisdiction, but 42% anticipate acquiring onenew system per precinct to meet HAVA accessibility requirements. (18) Most LEOs consider themselves familiar with and knowledgeableabout HAVA. The requirements and other provisions of HAVA have substantialimpacts on local jurisdictions, and some requirements, such as provisional balloting, are aimeddirectly at local officials. It would therefore be expected that most local election officials would befamiliar with HAVA provisions, and that is in fact the case. Only 10% of LEOs reported a lack offamiliarity with the act, and more than half consider themselves to be very familiar with itsrequirements. Most LEOs support HAVA provisions. Whenasked about the specific provisions of HAVA, LEOs on average rated each of them positively (Table2), with the highest support given to the provision of federal funding and the lowest to theprovisional voting requirement. However, even with respect to federal funding, there werecomplaints, many relating to a perceived slowness in distribution of funds. LEOs were alsoconcerned that federal requirements would lead to higher operating costs that local jurisdictionswould not be able to afford. The results suggest that support is associated to some degree with ease of implementation,although none of the provisions was rated especially difficult or especially easy to implement onaverage. For example, the two provisions requiring implementation that received the highest levelsof support -- facilitating participation for military or overseas voters, and provision of informationfor voters -- were also rated as the easiest to implement, and provisional voting was considered thesecond most difficult. However, the disability access requirement received a substantially higherlevel of support than the identification requirement for certain first-time voters, even though theformer was considered the most difficult to implement while the latter was among the least difficult. A common remark about the disability requirement was the perception that it is unnecessary oronerous for jurisdictions with small populations. This argument was also made before HAVA wasenacted. Proponents of the accessibility provision counter that the mobility of U.S. society and thepresence of "hidden" disabled persons, as well as other factors, make the uniform application of thisprovision necessary. The creation of the federal Election Assistance Commission (EAC), which has beensomewhat controversial, was seen as an advantage by most LEOs, with only one in seven seeing itas a disadvantage. During the debate on HAVA, some observers argued that the EAC should bepermanent, and others that it should exist only until all requirements payments authorized in the actare distributed. In February 2005, the National Association of Secretaries of State took the positionthat the EAC should be temporary, although that position was tempered in subsequent statements. Provisional voting received the highest percentage of negative assessments, with 35% ofrespondents considering it a disadvantage, and 48% an advantage. It was the only category for whichresponses were strongly polarized, with many LEOs rating it a strong advantage and almost as manya strong disadvantage. It was not possible to determine for this report what factors might accountfor the polarized response. Table 2. Ratings of Individual HAVA Provisions as Advantageor Disadvantage Note: Respondents were asked to rate each provision on a scale of 1 (disadvantage) to 7 (advantage). The disadvantage column lists the percentage who rated a provision at 1, 2, or 3; the neutral columnthe percentage who chose 4; and the advantage column those who chose 5, 6, or 7. Source: Texas A&M University, in coordination with the Congressional Research Service. LEOs believe that HAVA is making some improvements in theelectoral process. The survey asked LEOs to rate the degree to which HAVA hasresulted in improvements in elections in their jurisdictions -- from no improvement to majorimprovement. Only 12% of LEOs responded that it led to no improvement, but only 7% respondedthat it led to major improvement. The average response was halfway between those two extremes. A comparison of how LEOs rated HAVA overall with other characteristics of the officials suggeststhat younger officials who are comfortable with technology and familiar with HAVA tended to besupportive of the legislation. Not surprisingly, those who believe that there is too much federalinvolvement in the election process tended to be less supportive. Less obvious was the finding thatcollege-educated LEOs also tended to be less supportive, although the effect was smaller than forthe other factors. About 23% of respondents provided suggestions for improving HAVA. The threemost common areas for improvement listed were federal funding, registration and voteridentification, and provisional ballots. The Role of Voting System Vendors There has been some debate and uncertainty about the role and influence of voting systemmanufacturers and vendors in the selection of voting systems by local jurisdictions. Some observershave argued that vendors have undue influence in what voting systems jurisdictions choose. Othersbelieve that such concerns are unwarranted. But little has been known of how LEOs view vendorsand their relationships with them. The results of the survey were mixed with respect to theimportance of vendors. LEOs appear to have high trust and confidence in them but do not rate themas being especially influential with respect to decisions about voting systems. LEOs trust and have confidence in the voting system vendors theywork with. Most jurisdictions using computer-assisted voting reported that theyhad interacted with their voting-system vendors within the last four years. (19) More than 90% of LEOsconsidered their voting system vendors responsive and the quality of their goods and services to behigh. They felt equally strongly that the recommendations of those vendors can be trusted. However, about a fifth of respondents thought that vendors are willing to sacrifice security forgreater profit, although 60% disagreed. Also, a quarter felt that vendors provide too many aspectsof election administration. LEOs do not believe that vendors are very influential in decisionsabout acquiring new voting systems. When LEOs were asked what sources ofinformation they relied on with respect to voting systems, state election officials received the highestaverage rating, with about three-quarters of LEOs indicating that they rely on state officials a greatdeal. Next most important were other election officials, followed by the EAC and advocates for thedisabled. About one-third stated that they rely on vendors a great deal, a level similar to that forprofessional associations. Only 2% rated vendors higher than any other source, whereas 20% ratedstate officials highest. Interest groups were rated lower than vendors, and political parties and mediareceived the lowest ratings. When LEOs were asked about the influence of different actors on decisions about votingsystems, the overall pattern of response was similar to that for information sources. Once again,state, local, and federal officials were judged the most influential, (20) and political parties andthe media the least, with vendors in between. An exception was that local nonelected officials wereconsidered less influential on average than vendors. Both voters and advocates for the disabled wererated as more influential on average than vendors. No LEOs rated vendors as more influential thanany other source. In contrast, 12% listed themselves as the most influential. About two-thirds ofLEOs believe that local elected officials should have more influence, about one-third that stateelected officials should, and about half believe that the federal government has too much influence. Fewer than 10% of LEOs believe that there is insufficient oversight of vendors by the federalgovernment and states, but about one in six believe that local governments do not exercise enoughoversight. About half of LEOs believe that the federal government exercises too much oversight ofvendors, about a third believe that states do, and about one in six that local governments do. Possible Caveats As with any survey, care needs to be taken in drawing inferences from the results discussedabove. One question that could arise is whether the sample is representative of LEOs as a whole. Steps were taken in the design of the study to minimize the risk that the sample would not berepresentative. For example, simply drawing the sample at random from the nationwide pool ofelection administrators would have resulted in a disproportionately large number of jurisdictionsfrom New England and the upper Midwest, where elections are administered by townships ratherthan counties. (21) Toprevent such regional overrepresentation in the sample, no more than 150 officials were chosen tobe surveyed from each state. For states with fewer than 150 election jurisdictions, all were includedin the sample; for other states, 150 LEOs were chosen at random to be included in the sample. Overall, neither the sample design nor the characteristics of the responses suggest that the results areunrepresentative of the views and characteristics of local election officials. (22) Another potential caution for interpretation relates to the inherent limits of surveys such asthis one. In particular, there is no way to guarantee that the responses of the election officialscorrespond to their actual beliefs. In addition, there is no way to be certain that any particular beliefcorresponds to reality. The question of vendor influence provides an illustration of the possibilityfor disparity. For several reasons, LEOs might be reluctant to rate vendors as having the level ofinfluence on decisions about voting systems that they actually believe is the case. Alternatively, theymight believe that vendors have only modest influence whereas in fact the influence is much greater. The possibility of a disparity is raised in this case because LEOs indicated a very high level of trustand confidence in vendors but indicated that their influence was comparatively minor. A final caution involves how survey results might be used to inform policy decisions. Onthe one hand, the results could be used to support the shaping of policy in directions expressed byLEOs in their responses. In many cases, such policy changes might be appropriate. On the otherhand, it is possible that at least some of those desired changes would not in fact yield the mosteffective or appropriate policies. In such cases, the results might more constructively be used to helppolicymakers identify issues for which improvements in communication and understanding areneeded. Potential Policy Implications The survey results may have policy implications for several issues at the federal, state, andlocal levels of government. Some issues that may be relevant for congressional deliberations arehighlighted below. Election Officials. Many observers havecommented favorably on the experience and dedication of the nation's local election officials. Survey results are consistent with that view. At the same time, other observers, including someelection officials, have called for increased professionalism in election administration. Some surveyresults suggest areas of potential professional improvement, such as in education and in professionalinvolvement at the national level. Congress could address this potential need by means such asfacilitating educational and training programs for LEOs and promoting professional certification ofelection officials by entities accredited through the EAC. The seemingly unique demographic characteristics of LEOs as a group of governmentofficials may have other policy implications, but they are not altogether clear. However, someobservers may argue that efforts should be undertaken to ensure that LEOs reflect the diversity ofthe workforce or voting population as a whole, especially with respect to minority representation. Voting Systems. Since the enactment of HAVA,controversy has arisen over whether DRE voting systems are sufficiently secure and reliable. Thesurvey revealed that LEOs who have experience with DREs are very confident in them and do notgenerally support the addition of a voter-verified paper audit trail (VVPAT) to address securityconcerns. However, LEOs using other systems are much less confident in DREs and moresupportive of VVPAT. The strongly dichotomous results suggest that as Congress considers whetherto require the use of VVPAT or similar security mechanisms, it might be useful to determine whetherDRE users are overconfident in the security of their systems or, alternatively, whether nonusers needto be better educated about the reliability and security of DRE systems. (23) The Help America Vote Act (HAVA). Thesurvey results suggest that HAVA is in the process of achieving several of its policy goals. Thegeneral support of HAVA provisions -- including those such as the creation of the EAC and theprovisional ballot requirement that have been somewhat controversial -- implies that LEOs are inagreement with the goals of the act and are active partners in its implementation. The overwhelmingchoice of new voting systems that assist voters in avoiding errors indicates that the HAVA goal ofreducing avoidable voter error is in the process of being met. The areas of concern expressed byLEOs -- such as how to meet the costs of ongoing implementation of HAVA requirements -- raiseissues that Congress may wish to address as it considers HAVA appropriations and reauthorization. The close relationship between LEOs and the vendors of their voting systems seems unlikelyto change as a result of HAVA. However, with the codification by HAVA of the voting systemstandards and certification processes, the influence of the federal government in decisions about newvoting systems might be expected to increase in relation to that of vendors and others. However, theinfluence of state elected officials seems unlikely to decline, especially given the responsibilities thatHAVA places on state governments with respect to election administration. Research Needs. Scientific opinion surveys oflocal election officials are rare, (24) and additional research may be useful to address some of thematters raised by this study. For example, a survey of state election officials might provide usefulinformation and might additionally be helpful in assessing the most appropriate federal role inpromoting the effective implementation of HAVA goals at all levels of government. One common suggestion of LEOs for improving HAVA was to provide a means of adjustingrequirements to fit the needs of smaller jurisdictions. To determine what, if any, such adjustmentswould be appropriate, it may be useful to have specific information on how the needs andcharacteristics of different jurisdictions vary with size -- something that was beyond the scope of thissurvey. It could also be useful to identify how the duties of LEOs vary with size and othercharacteristics of the jurisdiction. In many jurisdictions, election administration is only part of theLEO's job. It is not known to what degree these other responsibilities might affect electionadministration -- negatively or positively. Finally, this survey provided only one snapshot of LEO characteristics and perceptions. Itmight be beneficial to perform similar surveys periodically to identify trends and explore newquestions and issues.

Summary: There are more than 9,000 local election jurisdictions in the United States. Local electionofficials (LEOs) are responsible for administering elections in those jurisdictions. LEOs aretherefore critical to the successful implementation of the Help America Vote Act of 2002 (HAVA, P.L. 107-252 ) and state election laws, but there has been little objective information on theperceptions and attitudes of those officials about election reform. This report, which will not beupdated, discusses the results of a recent scientific survey of LEOs. The findings may be useful toCongress in considering funding and possible reauthorization of HAVA. The demographic characteristics of LEOs are unusual for a group of government officials. Almost three-quarters are women, and 5% belong to minority groups. Most do not have a collegedegree, and most were elected to their positions. Some survey results suggest areas of potentialprofessional improvement, such as in education and in professional involvement at the national level. Over the past 20 years, jurisdictions have turned increasingly to computer-assisted votingsystems -- especially optical scan and direct recording electronic (DRE) systems. The mostimportant factors reported by LEOs in the acquisition of new systems are federal and staterequirements and funding. HAVA encourages but does not require systems that detect voter error,but it does require that voting machines be available that are fully accessible to persons withdisabilities. About half of jurisdictions with optical scan systems use central-count, which cannothelp voters to correct mistakes before casting the ballot. However, most jurisdictions acquiring newvoting systems are choosing either precinct-count optical scan or DREs, both of which can helpvoters avoid errors. LEOs are generally highly satisfied with whatever voting systems they are using now. Theyhave less confidence in the performance and security of other systems. DRE users generally opposethe use of voter-verified paper audit trails (VVPAT) for DREs, but users of other systems favor it. This result could mean that users are overconfident in DREs or that nonusers are insufficientlyknowledgeable about them. LEOs also tend to favor new systems that have characteristics similarto what they have been using -- for example, lever machine users tend to favor DREs. LEOs trustthe voting system vendors they work with but do not believe that those vendors are very influentialin decisions about acquiring new voting systems. LEOs consider themselves knowledgeable about and familiar with HAVA. They supportindividual provisions of the act, most strongly for federal funding and least strongly for provisionalballoting. To some extent, provisions rated more difficult to implement receive less support. MostLEOs believe that HAVA has resulted in some improvement in elections in their jurisdictions. Those rating HAVA higher overall tend to be younger, more comfortable with technology, and morefamiliar with the act. The areas for improvement of HAVA most commonly listed are federalfunding and the requirements for registration, voter identification, and provisional balloting.

gov_report

en

Write a title and summarize: The tracing of potentially infectious contacts has become an important part of the control strategy for many infectious diseases, from early cases of novel infections to endemic sexually transmitted infections. Here, we make use of mathematical models to consider the case of partner notification for sexually transmitted infection, however these models are sufficiently simple to allow more general conclusions to be drawn. We show that, when contact network structure is considered in addition to contact tracing, standard “mass action” models are generally inadequate. To consider the impact of mutual contacts (specifically clustering) we develop an improvement to existing pairwise network models, which we use to demonstrate that ceteris paribus, clustering improves the efficacy of contact tracing for a large region of parameter space. This result is sometimes reversed, however, for the case of highly effective contact tracing. We also develop stochastic simulations for comparison, using simple re-wiring methods that allow the generation of appropriate comparator networks. In this way we contribute to the general theory of network-based interventions against infectious disease. Modelling has become a central tool in understanding the epidemiology of infectious disease, and designing control strategies. One control method, contact tracing, has been considered in a large number of disease contexts. These include the 2003 SARS pandemic [1], [2], the 2001 UK FMD epidemic [3]–[6], contingency planning for deliberate release of smallpox [7], [8], and control of sexually transmitted infections [9]–[11]. A particular benefit of tracing is that it allows targeting of control, at the cost of effort spent on finding the individuals at risk. Since contact tracing takes place as a process over the network of interactions between hosts, it is natural to consider network-based models of this process. Theoretical work has so far dealt with contact tracing as a branching process [12], through modifications to mean-field equations [13], pairwise approximations [14] and simulation [15]. This work means that the implications of heterogeneous numbers of contacts (and related network properties such as assortativity) for the efficacy of contact tracing are reasonably well understood. For the case of clustering, due to the analytical challenge posed by the existence of short closed loops in the contact network, it has generally been more difficult to make similar progress. Existing theoretical work has therefore either been restricted to the ‘limiting case’ of clump structured populations, with all clustering due to completely connected cliques [16], or else simulation on exemplar networks [13], [14], [17]. In this work, we derive an improved triple closure for clustered pairwise models that removes two significant problems with existing closure regimes, and use this to make a systematic investigation of the impact of clustering on the efficacy of contact tracing, keeping other network and epidemiological parameters constant as appropriate. We find that, for many parameter choices, there are intuitive explanations, borne out by modelling, for the increased impact of contact tracing as clustering increases. This is not, however, a completely general result, meaning that the full implications of clustering for the efficacy of contact tracing are subtle and should be the subject of case by case investigation. We perform our analysis within the SIS paradigm, meaning that while some of our terminology will be general to all infectious disease epidemiology, other statements will be geared towards the modelling of sexually transmitted infections where recovery/treatment does not confer lasting immunity. The dynamics underpinning our model are shown schematically in Figure 1. Individuals are either susceptible (), infectious () or traced () and move between these compartments due to four processes: infection; treatment; tracing; and stopping tracing. This paradigm is suitable for the consideration of sexually transmitted diseases, where infectious individuals can transmit infection to contacts, then seek treatment, which clears the pathogen and stops transmission but leaves the individual susceptible. It also involves the process of contact tracing, which we use as a general term that includes both partner notification and efforts by public-health workers to track down potentially infected individuals. The four processes described so far separate into two categories: those that happen at an individual level, and contact processes. Seeking treatment and the cessation of tracing take place in the population at rates proportional to a number of individuals, and so fall into the former category. Using square brackets around a quantity to indicate its expected number in the population (so that quantities in square brackets are extensive expected numbers rather than intensive proportions) we take treatment to happen at a rate, where is the treatment rate constant, and the cessation of efforts to trace a treated individual' s contacts to happen at rate, where is the rate constant associated with the end of tracing. Infection and contact tracing, on the other hand, are contact processes, and so take place at a rate proportional to a number of partnerships in the population. The full set of partnership links can be thought of as forming a network, through which contact processes spread. For infection, the rate is, where the term in brackets is the number of susceptible-infectious pairs in the population and is the transmission rate constant, and for tracing, the rate is, where the term in brackets is the number of infectious-traced pairs in the population and is the tracing rate constant. We have introduced here a notation in which a arrow is drawn from a state that transmits across the link to the state that is affected by the transmission, which will become important when we consider triples in addition to pairs. To consider the impact of network structure, in particular clustering, on the efficacy of contact tracing, we consider a scenario in which an infection with underlying SIS dynamics is at its endemic equilibrium, and then contact tracing is introduced and the numbers infectious measured over time. This requires a dynamical model, and so we now turn to two complementary methods that we use to study the system in question: ODE-based models and stochastic simulation. Models based on ordinary differential equations (ODEs) are widely used in infectious disease modelling. We present here a series of ODE systems that can be used in the context of network models, starting with mean-field approaches, and moving on to pairwise models. We have found that, for application to contact tracing, mean-field models and existing pairwise closures are inadequate and so we develop an improved pairwise model to study this system. A complementary approach to pairwise models comes from individual-based, stochastic simulation where an explicit network is generated and dynamical processes are simulated using Monte Carlo methods. In order to provide a good comparison between pairwise models and simulation, we generate explicit networks that are designed to introduce structure to the population along the lines that we have been considering, by introducing finite neighbourhood size and clustering, without introducing other significant structural features. This enables us to test results derived using pairwise equations against stochastic results. It also complements our general approach of looking at the implications of finite neighbourhood size and clustering ceteris paribus, as an aid to intuitive understanding of the impact of population structure on disease and intervention dynamics. While other methods exist to generate networks with significant clustering coefficients, such as [20]–[22], and some special clustered networks have the attractive property of begin easily generated and analysed [23], [24], we use simple rewiring methods that are easily described and whose implications for global network structure can be readily understood, but which limit us to a smaller region of network parameter space. Most importantly, we find that giant component sizes for networks generated using our methods typically exceed 99%. For our baseline network parameters, we set to determine the effects of finite neighbourhood size and clustering. We also take the network size to be to produce little variability due to stochastic effects after the initial stages of an epidemic. Our main aim is to measure the effects of clustering,, and this is varied between 0 and. The recovery rate,, can be formally set to 1 through non-dimensionalisation, and we set to achieve separation of timescales. Our epidemiological motivation for this separation is the expected difference in the time from infection to detection and treatment, and the time taken to notify sexual partners. For emerging respiratory infections, such a separation of timescales would, of course, not exist. The other dynamical rates, and are fixed indirectly. For the tracing rate,, we vary the proportion of contacts successfully traced,, between 0 and 1, which then determines. For the infection transmission rate,, we need methods for fitting to a given endemic equilibrium, in both stochastic and ODE contexts. Figure 2 shows the comparison of stochastic simulation on networks of the type we have been considering with both mean-field SIS, standard pairwise, improved pairwise, and also the triplewise model of [29]. This demonstrates good agreement between simulation and network ODE models, but poor agreement with the mean-field model. The inclusion of the triplewise model shows that disagreements between pairwise models and simulation in the clustered network are largely due to higher order structure, however these effects are nowhere near as large as the differences between mean-field and pairwise models. Since triplewise models involve a massive increase in computational burden, we do not consider that in this case their use is justified. The results of Figure 2 were obtained by fitting the improved pairwise model to a given endemic state,. The impact of this fitting on the transmission rate and number of pairs, while varying the clustering coefficient, is shown in Figure 2, panes C and D. The need to incorporate network structure into models that involve contact tracing is shown by Figure 3. Panes A and B show predictions of prevalence over time for several models, which demonstrate that while both pairwise approaches are in good agreement with simulation, the failure of the mean-field model is dramatic—and similarly large failures can be observed in several other regions of parameter space. For the case of a clustered network in Pane B, the agreement between pairwise models and simulation becomes slightly worse than for the unclustered network results of Pane A, with the improved pairwise model providing a closer fit. Most importantly, the improved pairwise model is in qualitative disagreement with simulation—while both mean-field and standard pairwise models predict a peak in infection before reaching the endemic state, which is not seen in either the improved pairwise model or simulation. We therefore use the results of Panes A and B to rule out the use of mean-field and standard pairwise models. This leaves the improved pairwise model, which we systematically compare to simulation in Panes C and D. Since both the improved pairwise model and simulation depend on underlying parameters in the same way, they form a complementary pair of approaches to the study of contact tracing in clustered populations. The only exception to this is the case of low prevalence of infection, where stochastic effects become important and the stochastic model predicts extinction at higher transmission rates than the pairwise model. We consider the effects of clustering on the efficacy of contact tracing using pairwise models by starting the system at the endemic state in the absence of any contact tracing. We then introduce tracing at a success probability, and allow the system to evolve away from the endemic state for 0. 1 and one generations (time periods and respectively, corresponding to policy evaluation after a number of months and a number of years for an endemic STI) and measure the numbers infectious. This gives the results in Figure 4, which show that clustering increases the efficacy of contact tracing at a given success rate at one infectious generation, but not at 0. 1 generations, depending on the actual tracing success rate. Pane C shows this variety of responses, where clustering is more effective for large success rates at this small time—the very large rates require still smaller times to demonstrate this effect, since after 0. 1 disease generations they have passed into the regime where clustering leads to less effective tracing. The results shown in Panes C and D of Figure 2 provide a guide to intuition to explain these results. Clustering increases the number of pairs present at a given endemic state, and contact tracing can be viewed as hyper-parasitism on the network of infected individuals. This means that clustering can be expected to enhance the efficacy of contact tracing by increasing the neighbourhood size of the infected sub-network. On the other hand, to explain a constant level of endemic infection as clustering is increased, a larger underlying rate of transmission must be present, which will undermine tracing as an individual left untouched by a wave of tracing will reinfect their immediate neighbourhood more quickly. Exactly which parameter choices allow either effect to dominate is not clear, except that lower levels of tracing success always cause clustering to increase the efficacy of tracing. Otherwise, it appears that the impact of clustering on contact tracing needs to be evaluated on a case-by-case basis. To see the dynamics of infection that generate the results in Figure 4, we plot stochastic and improved pairwise temporal and parametric dynamics for two exemplar values of contact tracing success,, in Figure 5. For, we see in Pane A that the system settles over time to a different endemic state, and in Pane C that this involves consistently lower levels of infection in the clustered system than the unclustered system, meaning that clustering has enhanced the efficacy of contact tracing. By contrast, for, we see in Pane B that contact tracing drives infection to extinction, and from Pane D that this involves firstly higher levels of infection in the clustered system and then lower levels of infection for both the pairwise and stochastic models. We see a final reversal of the impact of clustering in Pane B, which is present in only the pairwise system: at longer times clustering again reduces the efficacy of contact tracing. At this point, stochastic variability in simulations has become highly significant and so we would not expect the two models to agree, since the pairwise equations should only hold in the limit where stochastic effects are negligible. To simulate in this regime would require extremely large population sizes, perhaps beyond what would ever be considered for realistic human scenarios. We have provided an intuitive and general framework in which to study the impact of network clustering on the efficacy of contact tracing in the control of infectious disease. This has produced three major results. Firstly, the effects of contact tracing often cannot be accurately captured by mean-field models, necessitating a modelling approach that incorporates network structure. Secondly, we have demonstrated that due to the increased number of infectious-infectious pairs seen in clustered networks at a given pathogen burden, contact tracing at a fixed, relatively low success rate will be more effective at larger levels of clustering than at the same fixed success rate without clustering. Finally, we have demonstrated that this increased efficacy is not completely general, and is reversed for large tracing success rates at certain times. This demonstrates the need to be cautious in the consideration of the epidemiological effects of a network property as subtle as clustering—unfortunately it is not possible to obtain a general ‘rule of thumb’ for its impact. Our approach has been to consider the impact of clustering on a network with fixed, finite neighbourhood size, in the absence of other known important dynamical effects such as risk structure and assortativity. The complexity of even our simplified problem provides justification for our approach, however it would be of significant interest to see how these quantities interact with each other. The full impact of higher order structure than triangles is also, as suggested by our stochastic results, likely to be important. Another important difference may manifest itself if we were to consider a disease with long-lasting immunity, obeying SIR dynamics, or other compartmental structure, including complex intervention strategies and comparable tracing and recovery timescales. Our preliminary work in this direction suggests that our novel result about clustering reducing contact tracing efficacy can be extremely significant in other contexts, however a full consideration of this would take us significantly beyond the aims of the present work.

Title: The Impact of Contact Tracing in Clustered Populations Summary: There are multiple ways to control infectious diseases-vaccination and drugs such as antibiotics or anti-virals form part of the pharmaceutical approach, however another route is to stop people infecting each other. This can be done either through general efforts to reduce epidemiologically relevant contacts, or through a more targeted attempt to trace the contacts of known cases who can then be isolated or treated. The impact of this kind of contact tracing is a priori likely to depend strongly on the network of contacts linking people together. In this paper, we develop new mathematical and computational techniques to model the impact of clustering: the probability that any two contacts of a given individual are also linked to each other in the network, creating triangles. Often, and for intuitively understandable reasons, the presence of clustering increases the efficacy of contact tracing, however we show that in the regime of highly effective contact tracing sometimes the opposite is true.

lay_plos

en

Summarize: A woman and three brothers associated with the Brothers for Life gang will today be charged with the execution-style shootings of Mahmoud Hamzy and Joe Antoun on the streets of Sydney. Associate Mahmoud Hamzy, cousin of jailed Brothers for Life boss Bassam Hamzy, was shot dead in Revesby Heights, south-west of Sydney, on October 29 last year. Amanda Crowe, 32, was arrested at her Dulwich Hill home in Sydney's inner west around 6am on Monday and has since been charged with murder and other offences relating to Mr Hamzy's death. Two men have been charged with the shooting death of convicted standover man, Joe Antoun, at his home in Strathfield last December. Crowe did not apply for bail when she fronted Burwood Local Court on Monday, but her lawyer said she would when she returned to court in November, the ABC reports. Three brothers - Fahed Quami, 32, Mumtaz, 29 and Jamil, 22 - also appeared in Burwood Local Court charged with Mr Hamzy's murder. The three Quami brothers were all in custody on other charges. Fahed and Mumtaz Quami were also charged with an additional count of murder for the roles they allegedly played in the fatal shooting of convicted standover man, Joe Antoun, at his home in Strathfield, in Sydney's inner west, last December. The 50-year-old construction industry identity was shot four or five times in the head and chest after opening the front door of his home. Amanda Crowe, 32, was arrested at her Dulwich Hill home in Sydney's inner west around 6am on Monday and has since been charged with murder and other offences relating to Mahmoud Hamzy's death. His wife Tegan Mullens tried to revive him as their two six-year-old twin daughters watched on. Mr Antoun had been in and out of jail for the past three decades. He and his brother Antoine were charged in 2001 with attempting to extort a cafe owner in Darling Harbour. His conviction was eventually overturned in 2006. Two other people have already been charged over Mr Antoun's death, including Navid Khalili, 25, and Kasim Ali Khan, 24. At the time of his death, Fairfax Media reported Mr Antoun had been involved in an ongoing feud with another well known construction industry figure reportedly worth millions of dollars. Three men were captured on CCTV cameras on Bardo Circuit in Revesby Heights the night associate Mahmoud Hamzy was gunned down. Police believe three men charged over Mr Hamzy's death used this Nissan as their getaway car. The Commander of the Homicide Squad, Detective Superintendent Willing, said the charges for both Hamzy and Antoun's deaths stemmed from some outstanding police work. 'The detectives working these cases have done an outstanding job,' Detective Superintendent Willing said. 'Their investigative nous and unyielding commitment has resulted in numerous people being charged with murder and other major criminal offences. 'To date, four people have been charged in relation to the murder of Mahmoud Hamzy and four have been charged in relation to the murder of Joe Antoun. 'Rest assured, more charges will be laid in the future as we intend to hunt down and bring to justice anyone who was involved in these ruthless crimes.' Mr Antoun, had been in and out of jail for the past three decades, was shot four or five times in the head and chest in front of his wife Tegan and two six-year-old twins. Sorry we are not currently accepting comments on this article

Summary: Mahmoud Hamzy was shot dead in Revesby Heights on October 29, 2013. Amanda Crowe, 32, was arrested on Monday morning and will be charged with Hamzy's murder. Three other brothers - Fahed Quami, 32, Mumtaz, 29 and Jamil, 22 - will also be charged with gang associate's death. Fahed and Mumtaz Quami will face additional charges for shooting death of standover man Joe Antoun last December. He was shot dead at his Strathfield home as his wife and two six-year-old daughter's watched on.

cnn_dailymail

en

Summarize: Tweet with a location You can add location information to your Tweets, such as your city or precise location, from the web and via third-party applications. You always have the option to delete your Tweet location history. Learn more NAIROBI, Kenya -- Three Kenyan soldiers were killed confronting terrorists who had attacked and seized Nairobi's Westgate mall, military officials said Tuesday. The operation to secure the shopping center continued during the day, with explosions and sporadic shooting being heard. Officials said Kenyan forces were combing the building for other gunmen and explosives. Six terrorists had been killed, they said. According to Kenyan officials, no hostages remain in the mall. "Regrettably, three of KDF [Kenyan Defense Forces] soldiers involved in Westgate Mall rescue operations have succumbed to their injuries," a military spokesman said on Twitter. The confirmation came as some Kenyans announced on Twitter that they were mourning soldiers who had died in the attack. Ruth Mutegi tweeted, "My cousin was only 28 yrs old, a vibrant KDF soldier who has left behind a wife and a kid barely one year old. He died protecting others." One Kenyan on Twitter called on officials to be honest about military causalities. "The government should be truthful on the KDF soldiers killed. At Homa Bay we are already mourning the death of Jacktone Puodi, a KDF soldier," said Jared Owuor Aol. "A lot of people are very angry and confused about the wrong reporting by the government," she added. The Interior Ministry said, "We condole with them, say a prayer for their families and friends." The terror group Shabab, which has claimed responsibility for the assault on the mall, continued to use Twitter to post its own version of events, claiming that casualties were higher than Kenyan authorities had admitted. Successive Shabab Twitter accounts have been closed in the past few days, only to spring up again. There is still no clarity on the number of hostages held by the gunman in the siege, and their fates. Early Tuesday, Kenyan officials referred to rescued hostages, without offering details of how many had been saved or where they had been taken. "Wishing quick recovery to the injured hostages and service men. I send my condolence to the bereaved families," police chief David Kimaiyo tweeted early in the day. Amid a blitz of unity and patriotism on social media, some Kenyans had begun to question the official account. "There is a side of this story we should talk about when all is over. The police casualties. Friendly fire. Huge," tweeted Robert Alai, a prominent figure on Kenyan social networks. Speculation mounted that wanted British terrorism suspect Samantha Lewthwaite may have been involved in the attack, after Kenyan Foreign Minister Amina Mohamed said a British woman and several Americans were involved. However, her account contradicted that of Interior Minister Joseph Ole Lenku, who said no women were involved. Kenyan media said witnesses who survived the attack claimed to have seen a woman leading the gunmen in the early hours of the assault. ALSO: Egypt court bans all Muslim Brotherhood activities Against the odds, some Syrians rebuild amid the ruins Mexican officials say 10 people fatally shot at baseball party Twitter: @latimesdixon robyn.dixon@latimes.com Soi is a special correspondent. An image grab taken from AFP TV shows Kenyan troops taking position on September 21, 2013 inside the Westgate mall in Nairobi as a victim (R) lies on the ground. Gunmen entered the mall on September 21 and killed at least 68, wounding over 175 others. On September 24, gunmen and hostages reportedly remain inside the mall. (Nichole Sobecki/AFP/Getty Images) Stephen, center, who lost his father in Saturday's attack at the Westgate Mall in Nairobi, Kenya, is comforted by relatives as he waits for the post mortem exam at the city morgue Monday, Sept. 23, 2013. Islamic extremist gunmen lobbed grenades and fired assault rifles inside Nairobi's top mall Saturday, killing dozens and wounding over a hundred in the attack. (AP Photo/Jerome Delay) Armed Kenyan policemen take cover outside the Westgate mall in Nairobi, on September 23, 2013. The attack, covered heavily by Kenyan blogger Robert Alai, has left at least 68 dead and over 175 others wounded. (Simon Maina/AFP/Getty Images) Robert Alai, a Kenyan blogger who earned praise for his coverage of the attack of the Westgate mall in Nairobi, Kenya. (Courtesy of Robert Alai) Kenyan blogger Robert Alai has utilized Twitter and Facebook to, over the course of the Westgate mall attack and subsequent hostage situation, deliver live coverage to over 100,000 people. Alai has earned praise from both fellow Kenyans and people following the situation abroad for his quick updates, a mixture of information from sources and official accounts. “On behalf of Kenyans in Australia, thanks mate for keeping us updated,” said Daniel Ngari via Twitter to Alai. “I followed all social media channels and live streams you were both reliable and timely on your info – thank you – good job man!” said Jude Clark, also via Twitter. “All Kenya media houses just repeating same stories, but one Robert Alai tweets fresh ones,” said Peter Mugo of Nairobi. “Kudos.” All Kenya media houses just repeating same stories, but one @robertalai tweets fresh ones. Kudos — Peter Mugo (@petermugo) September 22, 2013 The Westgate attack, begun by a group of al-Shabab militants on September 21 in Nairobi at the upscale Westgate mall, ended on Tuesday night. At least 72 have been killed in the attack; over 175 others have been injured. Alai said in an email that he was motivated to cover the situation for several reasons, including that he’s a curious person and that the government wasn’t putting out information in a timely manner. “I realised that the government was trying to contain and manage news flow without offering credible information about the attack,” he said. “I decided to defy police and government warning on anybody reporting what the police had not confirmed.” At different points in time, he criticized Kenyan broadcasters and other news agencies, and the government. In one case on Monday, Alai said that the Interior Ministry was “not helping with wrong info.” “Building is on fire on LIVE TV while you claim it has been put out,” he tweeted. Interior Ministry not helping with wrong info. Building is on fire on LIVE TV while you claim it has been put out. #WestgateAttack — Robert Alai (@RobertAlai) September 23, 2013 On September 21, he said that the initial reaction by the office of the Inspector General of Kenya’s national police and the Interior Ministry regarding the Westgate attack “shows you what is wrong with our police.” He also said that Kenyan news agencies weren’t doing well reporting on the situation. “This self censoring of Kenyan media will further complicate such attacks. Reality will set in soon,” he tweeted on Saturday. On Sunday, he said that while it was close to 20 hours after the intial attack, “no single Kenyan media has a 3-D illustration of #WestgateMall.” At the same time, some of Alai’s information comes from official sources and local news outlets and reporters. Following the Situation Despite a Risk Alai, a tech blogger, consultant, and social media strategist, is a controversial figure in Nairobi. He’s been accused of “hate speech” and other similar allegations regarding online postings, and has been sued and arrested in several cases. “I have been arrested for defying the police and ‘posting annoying messages on Twitter’ before but I decided to take the risk [of live-tweeting the situation],” he told Epoch Times. Alai has over 82,000 followers on Twitter, having gained more than 10,000 over the course of the Westgate situation, according to one of his followers. He’s also followed by more than 25,000 people on Facebook, where his updates are less frequent (as is usually the case, because Twitter is geared toward faster updates) but shared and liked more. On Twitter, many people are paying attention to Alai, both inside and outside of Kenya. For the first day and a half after the initial reports of the attack, Alai stayed up for 32 hours. After sleeping for about six hours, he woke up and got back online. “Morning everybody. Talked to officers on the ground. Operation still ongoing. Some hostages killed and body packed in a room,” he said in his first tweet back. Among being on the leading edge of multiple aspects of the reporting, Alai was one of the first to report that it may be the “White Widow” Samantha Lewthwaite behind the attack, saying that witnesses told him that there was a white woman among the al-Shabab shooters. FORMER HOSTAGES: Ringleader of #WestgateAttack is a lady with British accent. Might be the elusive widow. #WestgateAttack. — Robert Alai (@RobertAlai) September 22, 2013 On Monday, Kenya’s foreign minister told PBS that a British woman was among the attackers who were killed. Alai was also one of the first to report that the killed relative of Kenya’s President Uhuru Kenyatta was Kenyatta’s nephew, Mbugua Mwangi. On the other hand, some people have been displeased with Alai’s reporting, and he himself has admitted that he’s had trouble verifying everything that come through to him. “Verifying what was being sent to me was the hardest part of this job. Some send you untruths intentionally,” he said. At one point on Monday, he received over 200 images. One that he tweeted out ended up being a Wall Street Journal photo of an explosion in Kenya from May of this year. “Some of the photos are not authentic,” he said. The photo in question has since been deleted from his Twitter timeline. In his email to Epoch Times, Alai said that he is very interested in social justice “Pained when I see someone suffering because of something which can be prevented,” he said. “I am just interested in everyone getting his/her fair share of justice. “ In addition, he said he is patriotic. “I was given a chance to change my nationality. This is a beautiful country with a virgin flora and fauna. I believe in the Kenyan dream.” Follow @ETBreakingNews for breaking news from around the world. Follow reporter @ZackStieber. MORE coverage on the Westgate attack: Is ‘White Widow’ Samantha Lewthwaite Behind Nairobi Westgate Mall Attack? Mbugua Mwangi Dead: Nephew of Kenya’s President Killed in Nairobi Mall Attacks Kenya: Kristina Pratt, President Kenyatta’s Sister, Escapes Nairobi Mall Attack Jacktone Puodi, Kenyan Soldier, Reported Dead in Westgate Mall Attack Nairobi Attack Takes Bright Young Couple: Australian Ross Langdon, Pregnant Dutch Wife Elif Yavuz Ruhila Adatia-Sood One of 68 Dead After Terror Attack at Kenya’s Westgate Mall David Muthumbi Karechu Among Dozens of Kenyans Killed in Westgate Mall Attack Mitul Shah, Rajan Solanki, Nehal Vekaria, and Jyoti Vaya Among Indians Killed in Kenya Terror Attack

Summary: At one point during the Nairobi mall standoff, Kenya's information ministry informed the public that a fire at the mall had been extinguished. Just one problem with that, pointed out Kenyan blogger Robert Alai in a tweet: The fire was still blazing away on live TV. "Interior Ministry not helping with wrong info," he wrote. Alai has been covering the attack on social media and winning plenty of praise and followers, reports the Epoch Times. "I realized that the government was trying to contain and manage news flow without offering credible information about the attack," Alai tells the site. "I decided to defy police and government warning on anybody reporting what the police had not confirmed." With the the good comes the bad-Alai at one pointed retweeted a photo purportedly of the siege that actually was from an explosion in May. But on the flip side, he was among the first to report that Kenya's president had lost a nephew in the attack and that witnesses saw a white woman among the assailants, possibly Samantha Lewthwaite, the notorious widow of a terrorist. The LA Times calls Alai a "prominent figure on Kenyan social networks" and picks up on another his tweets: "There is a side of this story we should talk about when all is over. The police casualties. Friendly fire. Huge."

multi_news

en