Datasets:

Joemgu

/

sumstew

like 9

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Turkey Christian Churches Accountability Act''. SEC. 2. FINDINGS. Congress finds the following: (1) United States diplomatic leadership contributes meaningfully and materially to the protection internationally of religious minorities and their faith-based practices and places of worship. (2) The International Religious Freedom Act of 1998 states that ``It shall be the policy of the United States to condemn violations of religious freedom, and to promote, and to assist other governments in the promotion of, the fundamental right to freedom of religion.''. (3) The House of Representatives, when it adopted House Resolution 306 on December 13, 2011, called on the Secretary of State, in all official contacts with Turkish leaders, to urge Turkey to ``allow the rightful church and lay owners of Christian church properties, without hindrance or restriction, to organize and administer prayer services, religious education, clerical training, appointments, and succession'', and to ``return to their rightful owners all Christian churches and other places of worship, monasteries, schools, hospitals, monuments, relics, holy sites, and other religious properties, including movable properties, such as artwork, manuscripts, vestments, vessels, and other artifacts''. (4) On September 28, 2010, the House of Representatives adopted House Resolution 1631, calling for the protection of religious sites and artifacts, as well as for general respect for religious freedom in Turkish-occupied areas of northern Cyprus. (5) Christian churches and communities in the Republic of Turkey and in the occupied areas of Cyprus continue to be prevented from fully practicing their faith and face serious obstacles to reestablishing full legal, administrative, and operational control over stolen, expropriated, confiscated, or otherwise unreturned churches and other religious properties and sites. (6) In many cases the rightful Christian church authorities, including relevant Holy Sees located outside Turkey and Turkish-occupied territories, are obstructed from safeguarding, repairing, or otherwise caring for their holy sites upon their ancient homelands, because the properties have been destroyed, expropriated, converted into mosques, storage facilities, or museums, or subjected to deliberate neglect. (7) While the Turkish Government has made efforts in recent years to address these issues and to return some church properties, much more must be done to rectify the situation of Christian communities in these areas, as a vast majority of Christian holy sites continue to be held by the Turkish Government or by third parties. (8) On April 24, 2013, Catholicos Karekin II and Catholicos Aram I, spiritual leaders of the millions of Christian Armenian faithful in Armenia and the Diaspora, noted that Turkey continued to unjustly ``[retain] confiscated church estates and properties, and religious and cultural treasures of the Armenian people'', and called on Turkey ``[t]o immediately return the Armenian churches, monasteries, church properties, and spiritual and cultural treasures, to the Armenian people as their rightful owner''. (9) The boundaries of Turkey encompass significant historic Christian lands, including the biblical lands of Armenia (present-day Anatolia), home to many of early Christianity's pivotal events and holy sites, such as Mount Ararat, the location cited in the Bible as the landing place of Noah's Ark. (10) These ancient territories were for thousands of years home to a large, indigenous Christian population, but, because of years of repressive Turkish Government policies, historic atrocities, and brutal persecution, today Christians constitute less than one percent of Turkey's population. (11) As a result of the Turkish Government's invasion of the northern area of the Republic of Cyprus on July 20, 1974, and the Turkish military's continued illegal and discriminatory occupation of portions of this sovereign state, the future and very existence of Greek Cypriot, Maronite, and Armenian communities are now in grave jeopardy. (12) Under the Turkish occupation of northern Cyprus, freedom of worship has been severely restricted, access to religious sites blocked, religious sites systematically destroyed, and a large number of religious and archaeological objects illegally confiscated or stolen. (13) The United States Commission on International Religious Freedom, in its 2012 annual report, criticized ``the Turkish government's systematic and egregious limitations on the freedom of religion'', and warned that ``[l]ongstanding policies continue to threaten the survivability and viability of minority religious communities in Turkey''. (14) Christian minorities in Turkey continue to face discrimination, prohibitions on the training and succession of clergy, and violent attacks, which have at times resulted in lenient sentencing, including the reduced sentence for the murderer of the Catholic Church's head bishop in Turkey, Luigi Padovese, in June 2010, or delayed justice, including the unresolved torture and murder, in April 2007, of three employees of a Protestant Bible publishing house in Malatya, Turkey. (15) The Government of Turkey, in contravention of its international legal obligations, refuses to recognize the 2,000-year-old Sacred See of the Ecumenical Patriarchate's international status, has confiscated the large majority of the assets and properties of the Ecumenical Patriarchate, Greek cultural and educational foundations, maintains that candidates for the position of Ecumenical Patriarch must be Turkish citizens, and continues to refuse to reopen the Theological School at Halki, thus impeding training and succession for the Greek Orthodox clergy in Turkey. (16) The Government of Turkey, in contravention of its international legal obligations, continues to place substantial restrictions and other limitations upon the Armenian Patriarchate's right to train and educate clergy and select and install successors without government interference. (17) Religious freedom is an essential cornerstone of democracy that promotes respect for individual liberty, which contributes to greater stability, and is therefore a priority value for the United States to promote in its engagement with other countries. SEC. 3. REPORT REQUIREMENTS. (a) In General.--Not later than 180 days after the date of the enactment of this Act and annually thereafter until 2021, the Secretary of State shall submit to the Committee on Foreign Affairs of the House of Representatives and the Committee on Foreign Relations of the Senate a report on the status and return of stolen, confiscated, or otherwise unreturned Christian churches, places of worship, and other properties in or from the Republic of Turkey and in the areas of northern Cyprus occupied by the Turkish military that shall contain the following: (1) A comprehensive listing of all the Christian churches, places of worship, and other properties, such as monasteries, schools, hospitals, monuments, relics, holy sites, and other religious properties, including movable properties, such as artwork, manuscripts, vestments, vessels, and other artifacts, in or from Turkey and in the territories of the Republic of Cyprus under military occupation by Turkey that are claimed as stolen, confiscated, or otherwise wrongfully removed from the ownership of their rightful Christian church owners. (2) Description of all engagement over the previous year on this issue by officials of the Department of State with representatives of the Republic of Turkey regarding the return to their rightful owners of all Christian churches, places of worship, and other properties, such as monasteries, schools, hospitals, monuments, relics, holy sites, and other religious properties, including movable properties, such as artwork, manuscripts, vestments, vessels, and other artifacts, both those located within Turkey's borders and those under control of Turkish military forces in the occupied northern areas of Cyprus. (b) Inclusion in Annual Country Reports on Human Rights Practices and International Religious Freedom Report.--The information required under subsection (a) shall be summarized in the annual Country Reports on Human Rights Practices and International Religious Freedom Reports.

Title: Turkey Christian Churches Accountability Act Summary: Turkey Christian Churches Accountability Act - Directs the Secretary of State to report annually to Congress until 2021 on the status and return of stolen, confiscated, or otherwise unreturned Christian churches, places of worship, and other properties in or from the Republic of Turkey and in the areas of northern Cyprus occupied by the Turkish military. Requires such report to: (1) list all the Christian churches, places of worship, and other religious properties, including movable properties such as artwork and other artifacts, in or from Turkey and in the territories of the Republic of Cyprus under military occupation by Turkey that are claimed as stolen, confiscated, or otherwise wrongfully removed from their Christian church owners; and (2) describe all engagement over the previous year on this issue by Department of State officials with representatives of the Republic of Turkey. Requires that a summary of such information be included in the annual Country Reports on Human Rights Practices and the International Religious Freedom Reports.

billsum

en

Summarize: Starting in 1996, Alexa Internet has been donating their crawl data to the Internet Archive. Flowing in every day, these data are added to the Wayback Machine after an embargo period. Blogger Perez Hilton posts uncensored racy photo of 17-year-old Miley Cyrus on Twitter Denette/AP; Bouys/Getty Perez Hilton posted revealing photo of Miley Cyrus on his Twitter account before taking it down. Blogger Perez Hilton gave his fans a new look at teen star Miley Cyrus on Monday - up her skirt. Hilton posted an uncensored and very revealing photo of 17-year-old Miley on his Twitter account - showing her climbing out of a car in a short white dress while wearing no underwear. The posting came with a warning:"If you are easily offended, do NOT click here. Oh, Miley! Warning: truly not for the easily offended!" Hilton later removed the offending Twitter. But the photo remained posted on some sites with the word "censored" over the exposed area. Hilton, whose real name is Mario Lavandeira, frequently publishes upskirt photos of celebrities like Britney Spears on his website. One of the early trademarks of his blog was the addition of sometimes crude doodles to the photos he posted. Miley, who turns 18 in November, has faced a barrage of criticism lately in her attempts to shatter her Disney Channel image. Those efforts include wearing skimpy concert outfits, provocative photos and dance moves, and her controversial, growing pain-infused music video for the song "Can't Be Tamed." Miley Cyrus, Perez Hilton. (AP Photo/Chris Carlson/Matt Sayles) NEW YORK (CBS) Perez Hilton might be in some hot water after posting an uncensored photo of Miley Cyrus' private parts to his Twitter account. PICTURES: Miley Cyrus Early Monday morning, Hilton posted a picture of the 17-year-old pop star wearing a short white dress and no underwear. In the photo, Cyrus is in the midst of climbing out of an open-topped convertible car with her lady parts exposed. For his two million plus followers to see, the celebrity blogger posted the picture with the following introduction, "If you are easily offended, do NOT click here. Oh, Miley! Warning: truly not for the easily offended!" But it's the celebrity blogger that might need a warning. Cyrus is underage. Police might consider her naked image child pornography. Recently, Cryus has been facing a barrage of criticism for being too sexy due to skimpy concert outfits and her edgy single, "Can't Be Tamed" It is unclear if Hilton will face any legal trouble, but he might be setting himself up for yet another celebrity feud. Miley Cyrus Upskirt No Panties Picture There has been a lot of controversy from prudes about the Miley Cyrus upskirt picture above in which she is not wearing any panties. Puritan Westerners are complaining that showing a picture of 17 year old Miley Cyrus’ vagina is “child porn”. These backwards countries still consider 17 year old women like Miley, who have obviously already been around the block a few times, “minors”. I just don’t understand it, by the time my mom was Miley Cyrus’ age she had already married her uncle and birthed my 3 older brothers. We here at CelebJihad are once again being oppressed by the Zionist controlled west with their backwards laws, and can not express ourselves by posting a picture of Miley Cyrus’ pussy. There is a silver lining however. After careful examination of the Miley Cyrus upskirt no panties pic, we have determined that the photo is most likely a fake, and probably made by the Jews to entrap free speech crusading Muslims like ourselves. I first noticed that something was off with the picture after staring at Miley’s vagina for 30 minutes. Miley’s vagina in the picture looks normal, and not like the well used and beat up meat paddy that one would expect it to be. Miley’s hoo-hoo should look like a pack of chewed up bubble gum not the clean tight slit pictured. After some investigating we uncovered some additional pictures from the day this photo was taken. As you can see in the 2 photos below, Miley is wearing white panties on the day this alleged upskirt photo was taken. Whether she put those panties on after the upskirt picture was taken is still up for debate.

Summary: A star climbs out of a car with no panties on, flashing her lady parts for all to see: Miley Cyrus has officially joined the Lindsay-Britney club, compliments of...Perez Hilton. The celebrity blogger posted an upskirt photo of the teen star to his Twitter account yesterday-albeit with the warning, "If you are easily offended, do NOT click here." Hilton eventually removed the photo, the New York Daily News notes. Good thing, since CBS News helpfully reminds us that since Cyrus is 17, the shot might be considered child porn.

multi_news

en

Summarize: The boyfriend of the mother of "Baby Doe” has been arrested for allegedly killing the young girl now identified as Bella Bond. Michael McCarthy, 35, was arrested Friday for Bella's murder. Bond’s mother, 40-year-old Rachelle Bond, was arrested as an accessory after the fact. Sources say Rachelle Bond told police that McCarthy punched the girl several times in the stomach. Bond and McCarthy will be arraigned on Monday at Dorchester District Court. McCarthy is currently at a hospital. According to authorities, Bella Bond was just shy of her third birthday when her body was discovered inside a trash bag on Deer Island in June. Since then, investigators have tirelessly worked to identify the girl and how she died. During a news conference,Suffolk County District Attorney Dan Conley said multiple search warrants executed over the last 24 hours led to the girl’s identification. Police said a search warrant conducted on a home on Maxwell Street in Dorchester late Thursday. Police said the search warrants were executed after a tip came in from someone who said Bella's mother made a comment about her death. An official cause of death has not yet been determined, Conley said, but police believe they “have a very good idea of what happened to her,” Conley said. Prosecutors will issue more details of how Bella Bond died during the Monday arraignment, Conley said. "This child, whose very name means beauty, was murdered," Conley said. Conley said police believe she died inside her home. McCarthy is being treated at Beth Israel Deaconness Medical Center for a medical condition unrelated to the case. Also, authorities have identified Bella Bond’s father, but Conley declined to release it. Governor Baker said Friday that DCF had contact with Bella Bond twice, in 2012 and 2013. Both cases were closed. IDENTIFYING BELLA BOND Authorities said Bella was about 3 1/2 feet tall and weighed just over 30 pounds, which was normal for her height. Her ethnicity isn't yet clear. She was dressed in white pants with black polka dots, wrapped in a trash bag that contained a soft zebra-print blanket. As first reported in the Boston Globe, results of an analysis of pollen that coated Bella's pants and blanket gave some focus to the case, which has generated intense attention - but no concrete leads. "The amount and the types of pollen that were on those items suggest that she was from the Boston area," Suffolk County District Attorney spokesman Jake Wark told NBC News. Hundreds of tips from around 30 states and three or four countries, poured in about the child. Because Bella's body was only in the early stages of decomposition, detectives didn't think that she had been killed long before she was found. The pollen analysis - which police reviewed with the chief arborist of Boston's Arnold Arboretum, who agreed with the findings - buoyed suspicions that Bella was placed on Deer Island, rather than the idea that she washed up there after drifting from a faraway coastline. "At least it's a geographic location that we can target, as opposed to the entire world," Wark said, adding that Deer Island is "the kind of place that an outsider wouldn't know too well." A lab in Utah tested tooth and hair samples from Bella in an effort to identify her. BURIAL Over the past three months, Cardinal Sean O’Malley, as well as local funeral home directors and private citizens have offered to assist with the girl’s burial, Conley said. For more information on the Bella Bond case, visit our other stories here and here and here. (Copyright (c) 2015 Sunbeam Television. All Rights Reserved. This material may not be published, broadcast, rewritten, or redistributed.) The mother charged in connection with the killing of Bella Bond told police her boyfriend, Michael Patrick McCarthy, punched the girl formerly known as "Baby Doe" several times in the stomach, which led to her death, sources told 5 Investigates. Watch the report McCarthy has been arrested and charged with murder, and Rachelle Bond, Bella's mother, has been charged with accessory after the fact, Suffolk County District Attorney Daniel Conley said Friday. Video: Suffolk County DA officially identifies 'Baby Doe' as Bella Bond Conley did not offer specifics on Rachelle Bond's involvement, but she may have been involved in the placement of Bella's body on Deer Island. The young girl the world came to know as "Baby Doe" was identified Friday as 2-year-old Bella Neveah Amoroso Bond. Timeline: From 'Baby Doe to Bella "We hoped against hope that her death was not a crime. The evidence suggests otherwise. This child was murdered," said Conley. "She was a true innocent, her very name means beauty." Facebook photos of Bella Bond Video: Bella celebrates 2nd birthday Bella was just shy of 3 years old when she died, based on posts showing her second birthday party on Facebook. READ: Girl's aunt, grandparents shocked by revelations The break in the case, which was first reported by 5 Investigates' Kathy Curran, came after a tip was received and a search warrant executed at a Maxwell Street home in Dorchester Thursday. Final confirmation of Bella's identity requires positive identification using DNA testing by the State Medical Examiner. "The men and women who investigated this case have given her her name back. Now we will give her justice," said Massachusetts State Police Col. Richard McKeon. Neighbors confirmed to NewsCenter 5 that Bella lived in the Dorchester home. "She (the mother) tried to be responsible, but she was on drugs," said Yessiomora Torres. "She talked slurred, she’d come out and smoke a cigarette, her daughter would be crying." Emilys Acevedo knew Rachelle Bond as a loving parent. "All I remember is having a lot of Christmas presents for her daughter," she said. "Everything was about her daughter." Acevedo said Rachelle Bond was committed to changing her life after drug addiction, but this winter she said everything changed. "All of a sudden, she was gone," Acevedo said. "She wasn't in her apartment. Just out of the blue. Gone." "The mother and boyfriend are blaming each other for who harmed the child," said Massachusetts House Speaker Robert DeLeo, whose district includes Deer Island. Bella's cause of death still puzzles investigators. However, Conley said they have a strong case against the couple. "We have powerful evidence that has provided us a manner of death that we will be able to prove in court," said Conley. Torres said that when she stopped seeing Bella, she assumed the girl had been taken by the Department of Children and Families. "At one point she was briefly involved with DCF, but the case was closed in 2013," Gov. Charlie Baker said. DCF was involved with Rachelle Bond twice, according to a spokeswoman. There were allegations of neglect in both 2012 and 2013. In each case, DCF provided services and closed the case. The young girl’s body was found in a trash bag by a woman who was walking her dog on Deer Island on June 25. Photos: Blanket, clothing found with Baby Doe "This story is really going to hinge on who this child is and what her history was, who her family is and where she came from," said retired Massachusetts State Police Col. Timothy Alben, who led the investigation for months. "Then we are going to open the door to many investigative means." In the months after the discovery of her body, state police detectives acted on hundreds of leads suggesting possible matches for the young girl in Massachusetts and 35 other states and several countries. More than 200 girls were ruled out as being the young girl. The computer-generated image of Baby Doe was viewed nearly 60 million times. "It's a good day that we brought a name to this face," said Boston Police Commissioner William Evans. "It's a sad day that we lost a child and will never get her back. Hopefully she will now rest in peace."

Summary: "Baby Doe," the young girl found stuffed in a trash bag on a Boston beach back in June, has been identified. Police say the 4-year-old, named Bella, was the daughter of Rachelle Bond, who lives in Boston's Mattapan neighborhood, reports the Daily Beast; police had earlier linked the girl to the Boston area via pollen samples. Authorities were searching for Bond, 40, and a man, Michael McCarthy, 35, who the Daily Beast says are persons of interest in the girl's death. Officers say someone close to the girl's family contacted police yesterday because Bella hadn't been seen in a while. When the tipster asked about the girl, the pair claimed she had been removed from their care by the Department of Children and Families. Police say they searched a home in Mattapan yesterday and spoke to family members, per WCVB. WHDH reports one man is in custody, though it's not clear whether it's McCarthy. A rep for the Suffolk County District Attorney's office says the "investigation remains very active." Authorities haven't released any information on how Bella may have died, and an autopsy couldn't determine the cause of death. Earlier, they said she had not likely been dead long when her body was found on Deer Island. The Daily Beast reports Bond portrayed herself as a loving mother on social media. The last public photos shared of the pair appear to be from Christmas 2014. "Love her to death," one caption reads. "My life is complete again and worth living. I give her the world and more if I can."

multi_news

en

Summarize: By. Daily Mail Reporter. A teen in North Carolina was sent home from school on her last day of high school after school administrators determined that the outfit she was wearing was in violation of the school's dress code regrading skirt length. Her mother, however, has a plan to stick it to the school for what she and her daughter believe was an unfair punishment for breaking a fairly ambiguous rule. Violet Burkhart's mother's plan to protest the school's vague dress code: She's going to wear the exact same outfit to her daughter's graduation. Short: Violet Burkhart was sent home from school for wearing this dress, which administrators deemed too short. Protest: Amy Redwine (left) wore the same outfit to her daughter's graduation that got her sent home from school on her last day. 'I'm going to wear it in front of everyone and be proud just like she. should have been able to on her last day... With two hours left in the. day, Violet says teachers pulled her aside and said her dress was half an. inch too short,' Burkhart's mother, Amy Redwine, tells WGHP. The dress code at Central Davidson High School is admittedly vague. According to the school, it doesn't allow 'Shorts, skirts, skorts and dresses shorter than mid-thigh,' noting that 'Mid-thigh is a difficult measure.' The problem Redwine and her daughter have with the school is not with the dress code, rather with how administrators handled the situation. 'I thought my last day was going to be great and exciting, but they pretty much ruined it for me,' Burkhart told MyFox8.com. Too short: The principal told Redwine's daughter that the dress (pictured) was too short to wear to school. Her mother is equally upset with how the school handled things. 'I literally looked back at the clock and I’m thinking, it’s 1:00 in the afternoon on her last day of her senior year. My daughter — it’s supposed to be one of her best days and she’s there crying,' Redwine said. Burkhart says she wore that exact same dress to school at least five times before she was told to go home in the middle of her last day of high school. Another student at Central Davidson High School says she also had suffered from the school's vague dress code. 'My daughter goes to the same school and she was sent home. Not for the. length but she was told it enhanced her figure too much. Central. Davidson high school is a joke,' the mother of another student said. Pattern: Another mother also complained about the dress code after her daughter was sent home because her outfit 'enhanced her figure too much' As if the school's dress code wasn't vague enough, a clause in the dress code says 'Principals may elect to enact additional restrictions as deemed appropriate to preserve the educational environment.' In other words, if a principal doesn't like what a student is wearing, he or she may decide that it's damaging the 'educational environment' and force the student to go home

Summary: Violet Burkhart was sent home from Central Davidson High School on her last day because administrators thought her dress was too short. Burkhart says she'd worn the same dress to school several times before and it had never been a problem. The school's dress code is vague, defining short as anything'shorter than mid-thigh,' noting that 'Mid-thigh is a difficult measure' To protest the incident, Burkhart's mother, Amy Redwine, is wearing the same dress to her daughter's graduation.

cnn_dailymail

en

Write a title and summarize: The DNA deaminase APOBEC3G converts cytosines to uracils in retroviral cDNA, which are immortalized as genomic strand G-to-A hypermutations by reverse transcription. A single round of APOBEC3G-dependent mutagenesis can be catastrophic, but evidence suggests that sublethal levels contribute to viral genetic diversity and the associated problems of drug resistance and immune escape. APOBEC3G exhibits an intrinsic preference for the second cytosine in a 5′CC dinucleotide motif leading to 5′GG-to-AG mutations. However, an additional hypermutation signature is commonly observed in proviral sequences from HIV-1 infected patients, 5′GA-to-AA, and it has been attributed controversially to one or more of the six other APOBEC3 deaminases. An unambiguous resolution of this problem has been difficult to achieve, in part due to dominant effects of protein over-expression. Here, we employ gene targeting to dissect the endogenous APOBEC3 contribution to Vif-deficient HIV-1 restriction and hypermutation in a nonpermissive T cell line CEM2n. We report that APOBEC3G-null cells, as predicted from previous studies, lose the capacity to inflict 5′GG-to-AG mutations. In contrast, APOBEC3F-null cells produced viruses with near-normal mutational patterns. Systematic knockdown of other APOBEC3 genes in an APOBEC3F-null background revealed a significant contribution from APOBEC3D in promoting 5′GA-to-AA hypermutations. Furthermore, Vif-deficient HIV-1 restriction was strong in parental CEM2n and APOBEC3D-knockdown cells, partially alleviated in APOBEC3G- or APOBEC3F-null cells, further alleviated in APOBEC3F-null/APOBEC3D-knockdown cells, and alleviated to the greatest extent in APOBEC3F-null/APOBEC3G-knockdown cells revealing clear redundancy in the HIV-1 restriction mechanism. We conclude that endogenous levels of APOBEC3D, APOBEC3F, and APOBEC3G combine to restrict Vif-deficient HIV-1 and cause the hallmark dinucleotide hypermutation patterns in CEM2n. Primary T lymphocytes express a similar set of APOBEC3 genes suggesting that the same repertoire may be important in vivo. Human cells can express up to seven APOBEC3 (A3) proteins: A3A, A3B, A3C, A3D, A3F, A3G, and A3H [1], [2]. A3G is the archetypal restriction factor, capable of restricting Vif-deficient HIV-1 (hereafter HIV) by packaging into viral cores and then suppressing reverse transcription and deaminating viral cDNA cytosines to uracils (C-to-U) (reviewed by [3], [4]). The hallmark of A3G activity is viral genomic plus-strand G-to-A mutations within 5′GG-to-AG dinucleotide motifs, which reflects its minus-strand 5′CC-to-CU preference [5], [6]. However, HIV single-cycle and spreading infection experiments have yet to provide an overall consensus to explain the additional 5′GA-to-AA dinucleotide bias that is also commonly found in patient-derived viral sequences [7], [8], [9], [10], [11]. In fact, over-expression studies have implicated all six of the other A3 proteins in generating this mutation pattern, with multiple studies for and against each enzyme (reviewed by [3]). For example, despite several early studies strongly implicating A3F as a major source of the 5′GA-to-AA mutations ([12], [13], [14], [15] and nearly twenty more thereafter), two recent papers have questioned its relevance to HIV restriction and hypermutation [16], [17]. The data are even murkier and more conflicting for the other five human APOBEC3 proteins (reviewed by [3]; summarized in Discussion). Three major problems have made it difficult to address which endogenous A3 proteins cause HIV restriction and hypermutation. First, most prior studies have relied on transient or stable over-expression of a single A3 coupled to assays for viral infectivity and hypermutation. Although powerful for answering some questions, over-expression of a dominant and active DNA deaminase may overwhelm regulatory mechanisms and adversely affect the cell, result in nonspecific packaging into the virus, and create sequence artifacts by gratuitous deamination of non-productive viral replication intermediates. Most over-expression approaches are complicated further by being done in HEK293 (kidney) or HeLa (cervical) cells, which may not recapitulate as many aspects of restriction and/or viral replication as CD4+ T cell lines. Even best attempts to stably express physiological levels of APOBEC3 proteins in permissive CD4+ T cell lines are imperfect, because each A3 is expressed without other family members (i. e., out of normal endogenous context) and the expression of each protein is driven by heterologous promoters with foreign 5′ and 3′ untranslated sequences that are unlikely to be responsive to cellular signaling pathways triggered by viral infection and/or interferon signaling [16], [18], [19], [20], [21], [22], [23]. Second, the seven human A3 genes share high levels of nucleotide identity, which has hindered the development of gene-specific quantitative real-time (Q) -PCR assays and knockdown reagents. This problem is in the midst of being overcome with the development of robust Q-PCR assays [1], [2] and the creation of gene-specific knockdown constructs (this study and [24], [25], [26]). Finally, the field has yet to benefit from a robust genetic system, because HIV does not replicate in mouse models and the vast majority of human somatic cell lines are polyploid and/or difficult to engineer. In this study, we use gene targeting and knockdown experiments to systematically interrogate the impact of the endogenous A3 repertoire on Vif-deficient HIV replication in the near-diploid T cell line CEM2n. Null clones demonstrated that A3G is solely responsible for HIV 5′GG-to-AG hypermutations. A3F-null clones inflicted near-normal hypermutation patterns in Vif-deficient HIV, demonstrating that this enzyme alone is not responsible for 5′GA-to-AA hypermutations. Systematic depletion of other expressed A3 mRNAs in the A3F-null background revealed an unanticipated, major role for A3D in generating 5′GA-to-AA hypermutations and restricting Vif-deficient HIV replication. We conclude that endogenous A3D and A3F combine to generate hallmark 5′GA-to-AA hypermutations and A3G generates the 5′GG-to-AG hypermutations. All three enzymes work together to suppress Vif-deficient HIV replication and generate the classical non-permissive phenotype. The human T cell line CEM was originally isolated from a 3 year-old female with acute leukemia [27]. It is a model T cell system for HIV research that, along with its derivative CEM-SS, enabled the identification of A3G as a dominant HIV restriction factor [28]. However, our CEM laboratory stock proved sub-ideal for gene targeting because it tested near tetraploid (Figure S1). We noticed however that the original cytogenetic analyses of CEM had 47 chromosomes and a range of 41–95 [27]. We therefore obtained an early stock of CEM (CCRF-CEM), generated subclones by limiting dilution, and measured DNA content by flow cytometry. In comparison to our original CEM line, several of these subclones had half the DNA content and were most likely diploid (Figure 1A). One representative subclone, hereafter called CEM2n, was selected for further characterization. Flow cytometry showed that CEM2n expresses high levels of CD4 and the HIV co-receptor CXCR4 (Figure 1B). CEM2n still manifests the classic non-permissive phenotype by supporting wildtype HIV replication while restricting Vif-deficient HIV, similar to our tetraploid non-permissive line CEM (Figure 1C), as described originally [28], [29]. As anticipated by this phenotype, Q-PCR demonstrated expression of multiple A3 mRNAs (Figure S2 & below). Finally, karyotype analysis showed that CEM2n is near-diploid, with a total of 47 chromosomes, including three copies of chromosome 20 and a common T cell leukemia reciprocal translocation (Figure 1D). These characteristics indicated that CEM2n would be an appropriate model system to delineate the endogenous A3s involved in HIV restriction. Over 100 reports support a role for A3G in Vif-deficient HIV restriction (reviewed by [3]). A3G shows a strong bias for 5′GG-to-AG hypermutation, but it also has a secondary preference for 5′GA-to-AA invoking the formal possibility that it alone could be responsible for both dinucleotide signatures (e. g., [5], [6]). To address this possibility, we used two rounds of rAAV-mediated gene targeting to generate A3G-null derivatives. The A3G targeting construct replaces exon 3, which encodes the N-terminal zinc-coordinating deaminase domain, with a promoterless drug resistance cassette (Figure 2A). A correctly targeted A3G gene is expected to be null because transcripts originating at the A3G promoter will splice to an acceptor sequence within the 5′ end of the cassette and then terminate with a polyA sequence at the 3′ end of the cassette (i. e., the C-terminal two-thirds of the mRNA and protein should never be expressed). CEM2n was transduced with rAAV-A3G: : Neo and drug resistant clones were selected with G418. PCR showed that 6/103 (5. 8%) clones were targeted (Figure S3 & Table 1). To delete the remaining A3G allele, the drug resistance cassette was removed by transducing a representative clone with a Cre expressing adenovirus, and then subclones with a loxP-to-loxP recombination event were identified by PCR screening (Figure S3). Next, the original rAAV-A3G: : Neo construct was used for a second round of gene targeting. 2/86 drug resistant clones were null and 4/86 were retargeted, yielding a second round targeting frequency of 7. 0% (Table 1). The A3G-null clones had undetectable levels of A3G mRNA and protein and, importantly, the mRNA levels of all of the flanking A3 genes and the A3F protein levels were largely unperturbed (Figure 2B & C). The parental CEM2n line and its A3G-null derivatives had similar morphologies and growth rates. To explore the functional consequences of deleting the endogenous A3G gene, we performed single-cycle infectivity assays with VSV-G pseudotyped Vif-deficient HIVIIIB. After one full round of replication, new viruses produced from A3G-null cells were used to infect CEM-GFP reporter cells and GFP fluorescence was measured 2 days later by flow cytometry to quantify infectivity. In comparison to the fully non-permissive parental line CEM2n, the A3G-null derivative lines produced viruses with approximately 10-fold improved infectivity (Figure 2D). However, these viruses were still 2-fold less infectious than Vif-deficient HIV produced in parallel using the related permissive T cell line, CEM-SS. We note that although CEM-SS is commonly accepted as permissive for Vif-deficient HIV replication, our recent work revealed that it expresses multiple A3s including low levels of A3G [2]. Thus, it is quite possible that a fully null derivative of CEM2n could produce even higher levels of infectious Vif-deficient HIV (further supported by experiments described below). Regardless, these data demonstrate that endogenous A3G is not the only factor contributing to Vif-deficient HIV restriction in CEM2n. To gauge the gross level of G-to-A hypermutation in proviral DNA embedded in the genomes of the CEM-GFP reporter cells used above, we performed a series of differential DNA denaturation (3D-PCR) experiments [20], [30]. A 511 bp region of the HIV gag-pol gene was amplified over a range of PCR denaturation temperatures from 77. 2 to 85. 5°C and subjected to gel electrophoresis. As anticipated, Vif-deficient HIV proviruses derived from non-permissive T cell lines H9 and CEM2n yielded PCR products at low denaturation temperatures, down to 78. 4 and 79. 4°C, respectively, indicative of high levels of G-to-A hypermutation (Figure 2E). Vif-deficient HIV proviruses derived from CEM-SS only amplified at high denaturation temperatures, also as expected. In contrast, Vif-deficient proviruses derived from A3G-null cells yielded PCR amplicons at temperatures as low as 80. 4°C, suggesting major levels of residual hypermutation but lower than those inflicted by the full A3 repertoire in CEM2n. To examine mutational spectra, high temperature (unbiased) PCR amplicons were cloned and sequenced. As expected, Vif-deficient proviruses derived from the parental cell line CEM2n harbored extensive G-to-A hypermutations in two distinct dinucleotide contexts: 70% 5′GG and 30% 5′GA. This contrasted starkly to proviral sequences derived from A3G-null cells, in which the 5′GG-to-AG hypermutations nearly disappear (6%) (Figure 2F, Table 2, Figure S4, and Table S1). These results establish A3G as the major source of 5′GG-to-AG hypermutations, consistent with prior over-expression studies indicating that A3G is the only DNA deaminase that prefers minus strand 5′CC target sites (e. g., [5], [6], [31], [32]. These mutation spectra also implicate at least one other DNA cytosine deaminase in restricting HIV and generating 5′GA-to-AA hypermutations. Q-PCR revealed that CEM2n cells express six of seven A3 genes, A3B, A3C, A3D, A3F, A3G, and A3H, all of which have been implicated in catalyzing the 5′GA-to-AA hypermutation patterns (Figure S2, Discussion, and examples [12], [13], [14], [15]). A3F was our top candidate because (i) A3F expression tracks with A3G in non-permissive T cell lines, primary lymphocytes, and secondary immune tissues [2], [13], [20], (ii) A3F is encapsidated into budding viruses and restricts Vif-deficient HIV when over-expressed in permissive T cell lines [18], (iii) Vif targets A3F for degradation [14], [15], [18], (iv) A3F restriction capability and Vif counteraction activity is conserved with rhesus macaque A3F and SIV Vif [20], [33], and (v) Vif-deficient HIV isolates that regain the capacity to replicate on A3F expressing cells invariably restore Vif function [18]. However, despite this strong evidence favoring a role for A3F in HIV restriction and hypermutation, recent studies have questioned its importance [16], [17]. To determine the involvement of endogenous A3F in Vif-deficient HIV restriction and hypermutation, we generated A3F-null cell lines using two rounds of rAAV-mediated gene targeting as described above (Figure 3A and Figure S5). A3F-null clones showed no detectable mRNA or protein, and the mRNA levels of all of the flanking A3 genes and the A3G protein levels were largely unaffected (Figure 3B & C). Similar to the loss of A3G, the deletion of A3F resulted in cells semi-permissive for Vif-deficient HIV (Figure 3D) as well as in a modest decrease in the overall level of mutation as gauged by 3D-PCR (Figure 3E). However, we were surprised to find that the hypermutation spectrum of Vif-deficient HIV produced in A3F-null cells was indistinguishable from that of the same virus produced in the CEM2n parent, retaining a large percentage of 5′GA-to-AA mutations (Figure 3F, Table 2, Figure S4, and Table S1). Thus, the infectivity data showed that endogenous A3F does contribute to Vif-deficient HIV restriction, but the hypermutation data clearly implicate at least one other endogenous 5′TC deaminating A3. To identify the remaining source of the 5′GA-to-AA hypermutations, we developed a panel of short hairpin (sh) RNA reagents to systematically knockdown the expression of A3B, A3C, A3D, A3G, and A3H in the A3F-null background (Figure 4A). Knockdown efficiencies ranged from 50–80% and were specific to each intended A3 mRNA target. These efficiencies may be even higher at the protein level due to the known effects of shRNA in triggering mRNA cleavage/degradation and in suppressing translation [34], but this could only be confirmed for A3G due a lack of specific antibodies for the other A3s (Figure 4B). The parental CEM2n and A3F-null lines were transduced with non-silencing (shNS) and each of the aforementioned shA3 constructs. Pools of shRNA expressing cells were selected with puromycin (co-expressed from the same transducing virus), subjected to knockdown verification by Q-PCR, and infected as above with VSV-G pseudotyped Vif-deficient HIV to determine infectivity levels and hypermutation patterns. Each individual A3 knockdown had little impact on the infectivity or the 3D-PCR profile of Vif-deficient HIV produced in the CEM2n parental line (Figure 4C, 4D). A3F-null cells expressing the non-silencing shRNA yielded a significant 7-fold increase in the infectivity of Vif-deficient HIV over parental CEM2n as above (Figure 4C). Similarly, A3F-null cells transduced with shA3B or shA3C knockdown constructs produced Vif-deficient viruses with 8- and 9-fold infectivity increases, indicating no further contribution to restriction from these A3 proteins (Figure 4C). However, in contrast, A3F-null cells transduced with shA3D, shA3G, and shA3H constructs yielded Vif-deficient viruses that were 16-, 36-, and 14-fold more infectious, respectively (Figure 4C). Remarkably, the A3F-null/A3G-knockdown cells produced higher levels of infectious Vif-deficient HIV than CEM-SS cells (Figure 4C). Proviral DNA sequencing of Vif-deficient viruses produced in A3F-null cells in combination with non-specific shRNA (shNS), shA3B, shA3C, or shA3H showed no significant alteration in the fraction of hypermutations that occurred within 5′GA or 5′GG dinucleotides (Figure 4E, Table 2, and Table S1). Over 15 G-to-A mutations were found for all experimental conditions, with one exception being viral DNA originally produced in A3F-null/A3G knockdown cells, which yielded only 8 mutations (4 GG-to-AG and 4 GA-to-AA). In contrast, A3F-null/A3D knockdown cells produced almost no hypermutations in the 5′GA-to-AA dinucleotide context: 3% 5′GA, 93% 5′GG, and 4% other (Figure 4E, Table 2, Figure S4, and Table S1). This major contribution from A3D was only observed in the absence of A3F and it was rather surprising because most other reports have ascribed modest or no antiretroviral activity to this enzyme ([12], [19], [35], [36]; reviewed recently [3]). We conclude that, in CEM2n cells, endogenous A3D and A3F combine to restrict Vif-deficient HIV (with A3G) and, importantly, work together (mostly without A3G) to inflict 5′GA-to-AA hypermutations. An unavoidable consequence of gene targeting is the clonal nature of the procedure required to generate biallelic knockout derivatives of a parental cell line. Additionally, the previously described single-cycle assays on A3G-null and A3F-null cell lines were done several months apart with virus stocks produced at different times. To minimize these potential effects, two independently derived subclones of each of the knockout lines, A3G-null and A3F-null, as well as two independent subclones from the A3D and A3G shRNA knockdown pools were generated and assayed in parallel. Q-PCR and immunoblotting was used to confirm knockdown efficiencies, 60–85% for A3D and 60–70% for A3G (Figure 5A & B). These cell lines were infected with VSV-G pseudotyped Vif-deficient HIV to determine infectivity levels after approximately one round of replication (Figure 5C). As above, deletion of either A3G or A3F increased viral infectivity an average of 38- or 20-fold, respectively. Knockdown of either A3D or A3G in the CEM2n background had little effect. In contrast, knockdown of A3D or A3G in the A3F-null background resulted in additional increases in Vif-deficient virus infectivity, averaging 27- and 49-fold higher than the baseline level in fully restrictive CEM2n cells expressing non-specific shRNA. To assess the impact of A3 deletion and knockdown on HIV replication over time, a series of parallel spreading infections were initiated on the same panel of cell lines (Figure 5A & B). Cells were infected at a multiplicity of infection of 1% with either Vif-proficient or Vif-deficient HIVIIIB. Every 2–3 days supernatants were removed to infect the reporter line CEM-GFP to assay live virus and, in parallel, to measure p24 levels (Figure 5D and Figure S6). Vif-proficient virus replicated on every cell line tested with peaks of infection occurring on days 7 to 13. The precise reason (s) for this kinetic variation is unclear but it does not seem to correlate with A3 genotype (compare with Figure S6). As expected, Vif-deficient HIV replication was fully restricted in CEM2n cells but peaked readily in CEM-SS. A3G-null and A3F-null cells failed to produce detectable levels of infectious Vif-deficient virus, as monitored by the CEM-GFP (live virus) reporter system (although modest increases in p24 levels were detected in cell-free supernatants). In addition, knockdown of A3D or A3G in either the CEM2n background, or somewhat surprisingly, in the A3F-null background was unable to render cells fully permissive for Vif-deficient virus replication. Taken together, even though strong infectivity recoveries were evident in single round infections of cells completely lacking A3G or A3F or cells lacking A3F plus knocked-down A3D or A3G, the remaining endogenous A3s were still sufficient to restrict the spread of Vif-deficient virus (i. e., those A3s that were not manipulated by knockout or knockdown). These data combined to suggest that the simultaneous elimination of A3D, A3F, and A3G (and possibly also A3H) would ultimately be necessary to render CEM2n fully permissive for Vif-deficient HIV replication. Null mutations are a gold standard of genetics as they enable a definitive assessment of a given gene' s function by comparing the phenotype of the wildtype parental state with that of an isogenic null derivative. Here, we report the identification of a new T cell line, CEM2n, derived from the common parental line CCRF-CEM. CEM2n is near-diploid, expresses CD4 and CXCR4, supports Vif-proficient but not Vif-deficient HIV replication, expresses a complex A3 gene repertoire (similar to primary CD4+ T lymphocytes; Figure S2 & Ref. [2]), and is amendable to genetic manipulation by multiple methods including RNAi and gene targeting. We defined the HIV-restrictive A3 repertoire in this cell line by constructing A3G- and A3F-null derivatives, systematically depleting each expressed A3 with specific shRNA constructs, and performing a series of Vif-deficient HIV infectivity and proviral DNA hypermutation experiments. These data enable the conclusions that endogenous levels of A3D, A3F, and A3G combine to limit the infectivity of Vif-deficient HIV, that A3G acts alone to inflict 5′GG-to-AG hypermutations, and that A3D and A3F work together to elicit 5′GA-to-AA hypermutations. Since both 5′GG and 5′GA mutational patterns are common in patient-derived HIV proviral DNA sequences and a CEM2n-like A3 repertoire is expressed in primary CD4+ T lymphocytes, we hypothesize that these three A3s will also be responsible for HIV restriction and hypermutation in vivo (e. g., [10], [37], [38], [39], [40]). However, despite considerable efforts from our group and others, A3H remains a debatable factor in HIV restriction. This is due partly to the fact that some A3H haplotypes are more stable at the protein level (haplotypes II, V, VII>>I, III, IV, VI [41], [42], [43]). Over-expression studies are mostly consistent showing that A3H-hapII can restrict Vif-deficient HIV, that Vif can counteract this activity, and that these interactions are conserved between the A3H orthologs of other species and their cognate lentiviral Vif proteins [20], [41], [43], [44], [45], [46]. A3H is also expressed in primary CD4+ lymphocytes and induced upon HIV infection [20], [44]. However, our present studies were not able to unambiguously address whether this enzyme contributes to HIV restriction because endogenous A3H mRNA levels in CEM2n are ∼20-fold lower than those in primary CD4+ lymphocytes [2] (Figure S2). Even so, we observed a significant increase in Vif-deficient HIV infectivity in A3F-null/A3H-knockdown cells in comparison to the A3F-null line suggesting that even sub-physiological levels of endogenous A3H may be restrictive. This observation is additionally interesting in light of sequencing data showing that CEM2n is homozygous for the haplotype II genotype. Our present studies will also help resolve literature conflicts on the topic of Vif-deficient HIV restriction by A3A, A3B, and A3C (e. g., A3A: [12], [14], [26], [47], [48], [49], [50]; A3B: [12], [19], [20], [51], [52]; A3C: [12], [14], [15], [51], [53], [54]). A3A is not expressed in CD4+ T lymphocytes or cell lines and is therefore unlikely to have a role [1], [2], [47], [55]. It is also Vif-resistant, suggesting that it is of little threat to the virus, and incapable of restricting Vif-deficient HIV even upon stable over-expression in permissive T cell lines (e. g., [20]). A3B is expressed at low levels in CD4+ T lymphocytes and some T cell lines such as CEM, and its over-expression potently restricts HIV in the HEK293T model system [1], [2], [12], [20], [51], [52]. However, A3B is also insensitive to HIV Vif and does not restrict Vif-deficient HIV or inflict hypermutations when stably over-expressed in permissive T cell lines [12], [19], [20], [41], [51], [52], [56]. Taken together with data shown here that that A3B knockdown in parental CEM2n or the A3F-null background has no impact on virus infectivity or hypermutation profiles, we conclude that endogenous A3B also does not contribute to HIV restriction. A3C is highly expressed in primary CD4+ T cells and T cell lines, exhibits a 5′GA-to-AA hypermutation preference (especially with SIV-based viral substrates), and is susceptible to HIV Vif [2], [51], [54]. However, when over-expressed in permissive T cell lines SupT11 or CEM-SS, A3C does not encapsidate or restrict Vif-deficient HIV replication [20]. Moreover, since A3C knockdown in the parental CEM2n or the A3F-null background had no impact on virus infectivity in our present studies, we conclude that endogenous A3C is also unlikely to contribute to Vif-deficient HIV restriction. As elaborated in the Introduction, many prior published reports have been susceptible to a major weakness by being dependent upon enforced cDNA over-expression. Here, we overcome this drawback by identifying a new genetic system for host factor studies and systematically deleting and/or depleting endogenous A3 genes. Our studies demonstrate that A3G is the sole source of 5′GG-to-AG hypermutations and, formally, that it is a minor (at best) contributor to 5′GA-to-AA hypermutations. Our studies are also consistent with the phenotypes of the molecular clones engineered to be preferentially susceptible to A3F or A3G [57], [58]. However, our studies are additionally unique by providing an unanticipated demonstration of a major role for endogenous A3D in inflicting 5′GA-to-AA hypermutations. Thus, virtually all 5′GA-to-AA hypermutations can now be explained by overlapping A3D and A3F activities. Such an unambiguous assignment of function would not have been possible by simple over-expression studies because A3D and A3F have a similar 5′TC deamination preferences. Altogether, we conclude that endogenous levels of three enzymes – A3D, A3F, and A3G – combine to inflict signature G-to-A hypermutations and mediate HIV restriction. All T cell lines were maintained in RPMI supplemented with 10% fetal bovine serum (FBS) and 0. 5% penicillin/streptomycin (P/S). Our original CEM (4n) line was obtained from Michael Malim [28]. The initial CCRF-CEM line used here was obtained from the ATCC (cat #CCL119), and it was subcloned by limiting dilution to obtain multiple daughter clones including CEM2n. The HIV infectivity indicator cell line CEM-GFP was obtained from the AIDS Research and Reference Reagent Program. HEK293T cells were cultured in DMEM supplemented with 10% FBS and 0. 5% P/S. Giemsa banding and karyotype determination were performed at the University of Minnesota' s Cytogenetics Laboratory. Generation of rAAV targeting vectors was performed as described [59]. Homology arms were selected to avoid identity with other A3 genes and repetitive sequences. CEM2n genomic DNA was prepared using Gentra Puregene Cell Kit (Qiagen) and 1 kb homology arms were amplified using high fidelity PCR (Platinum Taq HiFi, Invitrogen). Primer sequences and genomic location of arms are listed in Table S2. Arms were cloned into pJet1. 2 using CloneJet PCR cloning kit (Fermentas) and sequence verified. Left arms were digested with SpeI and NotI and right arms were digested with SalI and NotI. pSEPT [59] plasmid was digested with SpeI and SalI and pAAV-MCS containing the viral ITR was digested using NotI. rAAV vectors were then constructed via four-way ligation and purified using standard phenol∶chloroform extraction followed by ethanol precipitation. 20 µl of each ligation mixture was used to transform 10 µl electro-competent DH10B cells. Plasmid DNA was harvested from ampicillin resistant colonies and verified by restriction digest and DNA sequencing. AAV-2 viral stocks were prepared by co-transfecting HEK293T cells at 50% confluency with sequence verified rAAV targeting vector, pHelper and pAAV-RC (Stratagene) (Trans-IT, Mirus). Three days after transfection, media and cells were collected and subjected to 3 cycles of freeze-thaw-vortex (30 min at −80°C, 10 min thaw at 37°C, 30 s vortex). Cellular debris was removed by centrifuging for 30 min at 12,000 rpm in a table-top centrifuge. rAAV was further purified and concentrated using an AAV Purification ViraKit (Virapur) per manufacturer' s instructions. One million CEM2n recipient cells were infected with a range of volumes (2–100 µl) of virus. Three days after infection, cells were seeded into 96-well plates at a density of 1000 cells/well in G418 containing media (1 mg/ml). G418 resistant clones were expanded and harvested for genomic DNA. Clones were screened for homologous recombination events at the desired locus with PCR primers specific to upstream (5′), downstream (3′) regions of the targeted allele, and the targeting vector. To recycle the targeting construct for the second allele, clones were infected with a Cre-expressing adenovirus (Ad-Cre-GFP, Vector Biolabs). Cells were cloned by limiting dilution and tested for drug sensitivity. mRNA isolation, reverse transcription and Q-PCR were performed as described [2]. RNA from 5×106 cells was isolated using the RNeasy kit (Qiagen). 1 µg total RNA was used to synthesize cDNA with random hexameric primers (AMV RT; Roche). cDNA levels were quantified using established procedures, primers, and probes [2] using a Roche LightCycler 480. All reactions were done in triplicate and A3 levels were normalized to the housekeeping gene TBP and presented relative to values for the parental CEM2n line. Vif-proficient (Genbank EU541617) and Vif-deficient (X26, X27) HIVIIIB A200C proviral constructs have been described [18], [19]. Vif-proficient and Vif-deficient HIV spreading infections were performed as previously described [18]. For p24 ELISA, anti-p24 mAb (183-H12-5C, NIH ARRRP) coated 96-well plates (maxisorp, Nunc) were incubated with supernatants from infected cultures for 1 hr. Following 3 washes with PBS 0. 1% Tween 20 (PBS-T), a second 1 hr incubation with a different anti-p24 mAb (9725, N. Somia) was used to ‘sandwich’ the p24 antigen. After an additional 3 PBS-T wash steps, p24 was quantified by 0. 5 hr incubation with an enzyme-linked secondary goat anti-mouse IgG-2A/HRP followed by 3 PBS-T wash steps and incubation with 3,3′, 5,5′ tetramethybenzidine (TMB) for 6 min. The reaction was stopped upon addition of 1 M H2SO4 and absorbance at 450 nm was quantified on a microplate reader (Synergy MX, Biotek). HEK293T cells were co-transfected at 50% confluence with a Vif-deficient HIV proviral expression construct and a VSV-G expression construct. Viral containing supernatants were harvested, titered on CEM-GFP, and used to infect CEM2n and A3-null derivatives at a 25% initial infection. 12 h post-infection cells were washed to remove remaining VSV-G virus and resuspended in RPMI growth media. 36 h later, viral containing supernatants were used to infect CEM-GFP reporter cells and cell and viral particle lysates were prepared. Cell pellets were washed and directly lysed in 2. 5× Laemmli sample buffer. Viral particles were isolated from filtered supernatants by centrifugation and then resuspended in 2. 5× Laemmli sample buffer. SDS-PAGE and immobilization of protein to PVDF was carried out using the Criterion system (BioRad). Immunostaining with CD4-PC7 and CXCR4-PE (Beckman Coulter) was carried out per the manufacturer' s instructions. CEM and CEM2n stained negative for CCR5 (data not shown). Infected CEM-GFP cells were fixed with 4% paraformaldehyde in 1× PBS. Fluorescence was measured on a FACS Canto II instrument (BD), and data were analyzed with FlowJo Flow Cytometry Analysis Software (Version 8. 8. 6). pLKO. 1 lentiviral vectors expressing short-hairpin RNA (shRNA) to A3B (TRCN00001420546), A3C (TRCN0000052102), A3D (TRCN0000154811), A3G (TRCN0000052191), and A3H (TRCN0000051799) were obtained from Open Biosystems. Lentivirus was produced by co-transfecting 50% confluent 293T cells with an shRNA expression construct, an HIV gag-pol helper plasmid, a VSV-G expression construct and Trans-IT (Mirus). Two days after transfection, supernatant was collected and replaced with fresh media. The following day, media was pooled and virus was clarified by passing supernatants through a 0. 45 µM PVDF filter. To concentrate the virus, clarified supernatants were centrifuged at 22,000× g for 2 h. Virus containing pellets were resuspended in 1× PBS. One million CEM2n and A3F-null cells were infected with 50 µl of virus and two days post-infection, media was replaced with puromycin containing media (1 µg/ml). Subclones were generated by limiting dilution in 96-well plates. Knockdown efficiency and specificity on transduced pools and subclones was assessed with Q-PCR [2]. 3D-PCR was carried out as described [20]. A 511 bp amplicon from the gag-pol genes of integrated proviruses was amplified with degenerate primers and quantified (Roche, LightCycler 480). Normalized amounts of integrated provirus were used for a second round of PCR over a range of denaturation temperatures using a gradient thermocycler (Eppendorf). 48 h after infection of CEM-GFP cells with Vif-deficient HIV, genomic DNA was prepared and PCR was used to generate a 511 bp amplicon over the gag-pol region. Primer sequences are listed in Table S2. This amplicon was cloned into pJet1. 2 using CloneJet PCR cloning kit (Fermentas) and sequenced. Duplicate sequences were discarded. Sequences were analyzed using Sequencher 4. 6 (Gene Codes Corp).

Title: Endogenous Origins of HIV-1 G-to-A Hypermutation and Restriction in the Nonpermissive T Cell Line CEM2n Summary: HIV uses its accessory protein Vif to shield itself from lethal mutagenesis by cellular APOBEC3 proteins. The APOBEC3-Vif interaction is therefore a promising target for drug development, and a clear definition of all proteins involved on both sides of this critical host-pathogen conflict is crucial. However, apart from APOBEC3G, conflicting over-expression studies have been published on the six other human APOBEC3s, some supporting and some refuting each protein' s involvement in HIV restriction. Here, we use a combination of gene targeting and RNA interference to define the endogenous sources of Vif-deficient HIV restriction and G-to-A hypermutation in a nonpermissive T cell line. As anticipated, APOBEC3G contributed partially to restriction and proved to be the source of hypermutations at 5′GG dinucleotides. However, a major and unexpected role for APOBEC3D became evident in the APOBEC3F-null background, with both proteins combining to suppress viral infectivity and form hypermutations at 5′GA dinucleotides. We conclude that endogenous levels of APOBEC3D, APOBEC3F, and APOBEC3G act redundantly to restrict Vif-deficient HIV and produce the two hallmark dinucleotide hypermutation patterns observed in patient-derived viral sequences. Therapeutic strategies that unleash this full'swarm' of restrictive APOBEC3 proteins are likely to be more effective than those that focus on enabling a single enzyme.

lay_plos

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Fiscal Year 2010 Federal Aviation Administration Extension Act''. SEC. 2. EXTENSION OF TAXES FUNDING AIRPORT AND AIRWAY TRUST FUND. (a) Fuel Taxes.--Subparagraph (B) of section 4081(d)(2) of the Internal Revenue Code of 1986 is amended by striking ``September 30, 2009'' and inserting ``December 31, 2009''. (b) Ticket Taxes.-- (1) Persons.--Clause (ii) of section 4261(j)(1)(A) of the Internal Revenue Code of 1986 is amended by striking ``September 30, 2009'' and inserting ``December 31, 2009''. (2) Property.--Clause (ii) of section 4271(d)(1)(A) of such Code is amended by striking ``September 30, 2009'' and inserting ``December 31, 2009''. (c) Effective Date.--The amendments made by this section shall take effect on October 1, 2009. SEC. 3. EXTENSION OF AIRPORT AND AIRWAY TRUST FUND EXPENDITURE AUTHORITY. (a) In General.--Paragraph (1) of section 9502(d) of the Internal Revenue Code of 1986 is amended-- (1) by striking ``October 1, 2009'' and inserting ``January 1, 2010''; and (2) by inserting ``or the Fiscal Year 2010 Federal Aviation Administration Extension Act'' before the semicolon at the end of subparagraph (A). (b) Conforming Amendment.--Paragraph (2) of section 9502(e) of such Code is amended by striking ``October 1, 2009'' and inserting ``January 1, 2010''. (c) Effective Date.--The amendments made by this section shall take effect on October 1, 2009. SEC. 4. EXTENSION OF AIRPORT IMPROVEMENT PROGRAM. (a) Authorization of Appropriations.-- (1) In general.--Section 48103 of title 49, United States Code, is amended-- (A) by striking ``and'' at the end of paragraph (5); (B) by striking the period at the end of paragraph (6) and inserting ``; and''; and (C) by adding at the end the following: ``(7) $1,000,000,000 for the 3-month period beginning on October 1, 2009.''. (2) Obligation of amounts.--Sums made available pursuant to the amendment made by paragraph (1) may be obligated at any time through September 30, 2010, and shall remain available until expended. (b) Project Grant Authority.--Section 47104(c) of such title is amended by striking ``September 30, 2009,'' and inserting ``December 31, 2009,''. SEC. 5. EXTENSION OF EXPIRING AUTHORITIES. (a) Section 40117(l)(7) of title 49, United States Code, is amended by striking ``October 1, 2009.'' and inserting ``January 1, 2010.''. (b) Section 41743(e)(2) of such title is amended by striking ``2009'' and inserting ``2010''. (c) Section 44302(f)(1) of such title is amended-- (1) by striking ``September 30, 2009,'' and inserting ``December 31, 2009,''; and (2) by striking ``December 31, 2009,'' and inserting ``March 31, 2010,''. (d) Section 44303(b) of such title is amended by striking ``December 31, 2009,'' and inserting ``March 31, 2010,''. (e) Section 47107(s)(3) of such title is amended by striking ``October 1, 2009.'' and inserting ``January 1, 2010.''. (f) Section 47115(j) of such title is amended by inserting ``and for the portion of fiscal year 2010 ending before January 1, 2010,'' after ``2009,''. (g) Section 47141(f) of such title is amended by striking ``September 30, 2009.'' and inserting ``December 31, 2009.''. (h) Section 49108 of such title is amended by striking ``September 30, 2009,'' and inserting ``December 31, 2009,''. (i) Section 161 of the Vision 100--Century of Aviation Reauthorization Act (49 U.S.C. 47109 note) is amended by inserting ``, or in the portion of fiscal year 2010 ending before January 1, 2010,'' after ``fiscal year 2009''. (j) Section 186(d) of such Act (117 Stat. 2518) is amended by inserting ``and for the portion of fiscal year 2010 ending before January 1, 2010,'' after ``2009,''. (k) Section 409(d) of such Act (49 U.S.C. 41731 note) is amended by striking ``September 30, 2009.'' and inserting ``September 30, 2010.''. (l) The amendments made by this section shall take effect on October 1, 2009. SEC. 6. FEDERAL AVIATION ADMINISTRATION OPERATIONS. Section 106(k)(1) of title 49, United States Code, is amended-- (1) by striking ``and'' at the end of subparagraph (D); (2) by striking the period at the end of subparagraph (E) and inserting ``; and''; and (3) by adding at the end the following: ``(F) $2,338,287,375 for the 3-month period beginning on October 1, 2009.''. SEC. 7. AIR NAVIGATION FACILITIES AND EQUIPMENT. Section 48101(a) of title 49, United States Code, is amended-- (1) by striking ``and'' at the end of paragraph (4); (2) by striking the period at the end of paragraph (5) and inserting ``; and''; and (3) by adding at the end the following: ``(6) $733,444,250 for the 3-month period beginning on October 1, 2009.''. SEC. 8. RESEARCH, ENGINEERING, AND DEVELOPMENT. Section 48102(a) of title 49, United States Code, is amended-- (1) by striking ``and'' at the end of paragraph (12); (2) by striking the period at the end of paragraph (13) and inserting ``; and''; and (3) by adding at the end the following: ``(14) $46,250,000 for the 3-month period beginning on October 1, 2009.''. Speaker of the House of Representatives. Vice President of the United States and President of the Senate.

Title: To amend the Internal Revenue Code of 1986 to extend the funding and expenditure authority of the Airport and Airway Trust Fund, to amend title 49, United States Code, to extend authorizations for the airport improvement program, and for other purposes Summary: Fiscal Year 2010 Federal Aviation Administration Extension Act - Amends the Internal Revenue Code to extend through December 31, 2009: (1) excise taxes on aviation fuels and air transportation of persons and property; and (2) the expenditure authority for the Airport and Airway Trust Fund. Authorizes appropriations through the three-month period beginning on October 1, 2009, for airport improvement program (AIP) projects, including project grant authority. Extends through December 31, 2009, various airport development projects, including: (1) the pilot program for passenger facility fees at nonhub airports; (2) small airport grants for airports located in the Marshall Islands, Micronesia, and Palau; (3) state and local airport land use compatibility projects; (4) the authority of the Metropolitan Washington Airports Authority to apply for an airport development grant and impose a passenger facility fee; (5) the temporary increase to 95% in the government share of certain AIP project costs; and (6) Midway Island airport development. Extends through FY2010 the authorization of appropriations for agreements the Secretary of Transportation makes for assistance under the small community air service development program. Extends through December 31, 2009, Department of Transportation (DOT) insurance coverage for domestic and foreign-flag air carriers. Allows further extension through March 31, 2010. Extends through March 31, 2010, air carrier liability limits for injuries to passengers resulting from acts of terrorism. Extends through December 31, 2009, certain competitive access assurance requirements for large or medium hub airport sponsors applying for AIP grants. Extends through FY2010 the termination date of any order issued by the Secretary with respect to the eligibility of certain places for essential air service compensation. Extends through the three-month period beginning on October 1, 2009, the authorization of appropriations for: (1) Federal Aviation Administration (FAA) operations; (2) air navigation facilities and equipment; and (3) research, engineering, and development.

billsum

en

Write a title and summarize: Relay cells are prevalent throughout sensory systems and receive two types of inputs: driving and modulating. The driving input contains receptive field properties that must be transmitted while the modulating input alters the specifics of transmission. For example, the visual thalamus contains relay neurons that receive driving inputs from the retina that encode a visual image, and modulating inputs from reticular activating system and layer 6 of visual cortex that control what aspects of the image will be relayed back to visual cortex for perception. What gets relayed depends on several factors such as attentional demands and a subject' s goals. In this paper, we analyze a biophysical based model of a relay cell and use systems theoretic tools to construct analytic bounds on how well the cell transmits a driving input as a function of the neuron' s electrophysiological properties, the modulating input, and the driving signal parameters. We assume that the modulating input belongs to a class of sinusoidal signals and that the driving input is an irregular train of pulses with inter-pulse intervals obeying an exponential distribution. Our analysis applies to any order model as long as the neuron does not spike without a driving input pulse and exhibits a refractory period. Our bounds on relay reliability contain performance obtained through simulation of a second and third order model, and suggest, for instance, that if the frequency of the modulating input increases or the DC offset decreases, then relay increases. Our analysis also shows, for the first time, how the biophysical properties of the neuron (e. g. ion channel dynamics) define the oscillatory patterns needed in the modulating input for appropriately timed relay of sensory information. In our discussion, we describe how our bounds predict experimentally observed neural activity in the basal ganglia in (i) health, (ii) in Parkinson' s disease (PD), and (iii) in PD during therapeutic deep brain stimulation. Our bounds also predict different rhythms that emerge in the lateral geniculate nucleus in the thalamus during different attentional states. Relay neurons are found in various brain nuclei including the thalamus [1]–[3]. Experiments have suggested that the inputs to a thalamic relay neuron can be divided into two categories: driving and modulating. The driving input typically contains sensory information (e. g visual, motor) and the modulating input controls relay of this sensory information back to cortex [4]. The driving input is made up of a few synapses on the proximal dendrites whereas the modulating input comprises all other synapses [5], [6] (see Figure 1 A). For example, the lateral geniculate nucleus (LGN) in the thalamus receives the driving input from the retina and projects to the primary visual cortex. The modulating input comprises descending inputs from layer 6 of the visual cortex and ascending inputs from the brain stem. The function of the LGN is to selectively relay sensory information from the retina subject to attentional needs [4], [7]. It has been observed that during different attentional needs (which translate into different relay demands), local field potentials (LFPs) in the LGN have a concentration of power in different frequency bands () [8], [9]. LFPs may be reflected in the modulating input because they are believed to arise from ensemble synaptic activity [10]. This would then suggest that one mechanism that controls relay in the LGN cell is the frequency of the modulating input. Similarly, relay neurons in the motor thalamus receive driving inputs from sensorimotor cortex, and modulating inputs from the basal ganglia (BG), specifically the Globus Pallidus internal segment (GPi) [4], [11]. The driving input contains information about the actual movement via proprioception, and the modulating input facilitates/impedes relay of this information to motor cortex [12]–[16]. It has been observed that neural activity in the GPi changes its oscillatory patterns when a subject' s cognitive state moves from being idle to planning a movement [17]. In particular, GPi activity has prominent beta band oscillations when the subject is idle, which then get suppressed when the subject plans to move. This suppression coincides with an emergence of gamma band oscillations. This would suggest, again, that one mechanism that controls relay in the motor thalamic cell is the frequency of the modulating input. In this study, we set out to quantify when and how these thalamic cells relay driving inputs. Previous attempts to study relay neurons are made in [15], [16], [18]–[20]. Specifically, in [18], [19] in-vitro experiments are used to understand how background synaptic input modulates relay reliability of a thalamic neuron. These studies suggest that the neuron' s reliability of relaying an incoming spike is governed by the background synaptic input (the modulating input) combined with intrinsic properties of the neuron. In particular [19], showed that if the variance of the background synaptic input increases, the transmission reliability goes down, and [18] showed that the feedback inhibition from the nucleus reticularis modulates the excitability of the thalamic cell membrane and hence gates transmission of spikes from the retina. An attempt to analytically study relay neurons is made in [15], where in they studied the effects of BG inhibition on the thalamic relay reliability. They used a order non-bursting model and phase-plane analysis to study relay neuron properties. However, they only considered a constant and a low frequency periodic modulating input. Additionally, only one deterministic periodic waveform was considered for the driving input. A follow up study with a similar objective is presented in [20], wherein the authors analyzed a relay neuron driven only by a driving input (no modulating input). Using Markov models, they studied how different distributions of driving pulse arrival times affect relay reliability. However, they did not present an explicit expression for the dependence of reliability upon input distributions and relay neuron properties. The work presented here is different from the above computational studies in that we include classes of modulating and driving inputs in our analysis, and we employ systems theoretic tools to obtain explicit analytical bounds on reliability as a function of the neuron' s electrophysiological properties (i. e., model parameters), the modulating input signal, and the driving signal parameters. Our analysis is applicable to any order model as long as the neuron does not spike without a pulse in the driving input and exhibits a refractory period. Consequently, our analysis is relevant for relay cells whose electrophysiological dynamics, including bursting, may be governed by several different ion channels and is more rigorous than previous works. Our lower and upper bounds contained reliability computed through simulation of both a second- and third-order model, and suggest, for example, that if the frequency of the modulating input increases and/or its DC offset decreases, then relay reliability increases. The methods used here are generally applicable to understanding cell behavior under various conditions. In the discussion section, we show how our analysis shed new insights into motor signal processing in health and in Parkinson' s disease with and without therapeutic deep brain stimulation. We also discuss how our bounds predict neural activity generated in the LGN during visual tasks with different attentional needs as well as during sleep. In particular, we show how our bounds predict the following observations in the LGN: (i) prominent and rhythms () in the LGN LFPs during high attentional tasks [9]; (ii) phase locking between rhythm () in LFPs and spiking activity in the LGN in awake behaving cats [21]; (iii) rhythms () in drowsy cats; and, (iv) even slower rhythms in sleeping cats [8]. A relay neuron receives two kinds of inputs: a driving input, and a modulating input, and generates one output,, as shown in Figure 1 B. The function of this type of neuron is to generate an output that relays the driving input at appropriate times. The modulating input does as its name implies i. e. it modulates the neuron' s ability to relay the driving input [4]. This relay neuron model structure has been widely used to model thalamic relay neurons [15], [16], [22]–[26]. We would like to understand exactly how the modulating input affects relay reliability of the neuron. To do so, we use a biophysical-based model to describe the electro-physiological dynamics of the relay neuron. We first begin with a second order model to highlight structure in the model dynamics, and then we present an order generalization. Recall that the output of the cell,, is the membrane voltage of the neuron. Then for time, (1a) (1b) (1c) (1d) (1e) In (1), are the membrane capacitance, ionic current, external current and synaptic reversal potential, respectively. is composed of currents, which is a low threshold calcium ion current, and which is the neuron' s membrane leakage current. is a constant external current, and, is an internal state of the system representing the probability that a calcium channel inactivation gate is open at a time. are temperature correction factor, maximum calcium current and leakage current conductance, respectively. The details of, and and numerical values used in our simulations are given in Tables 1 and 2. This is a simplified model of a thalamic neuron that is driven only by calcium ion and leak currents. We begin with this model because it is simple and still contains low threshold calcium currents which are shown to govern input selectivity of relay neurons, in a computational study [23]. This model has also been used to model neurons in the inferior olive for the purpose of studying sub-threshold oscillations [27]. Before we define relay reliability, we first define a relayed pulse. A relayed pulse is a successful response,, that occurs within after a pulse in the driving input,. See Figure S2 (Supplementary Material). Let, (11a) (11b) then the empirical reliability is defined as: (12) This definition of reliability is similar to the one defined in [15] and is not meaningful if spikes without a pulse in. But since our neuron is a stable neuron, this will never happen. In the limit that we observe the neuron for an infinite amount of time, the empirical reliability converges to (13) Let us define events (14a) (14b) We then see that (15) Here we have used the total probability law and the definition of conditional probability [35] to go from (13) to (15). Because we cannot generate a spike in the refractory zone,, we get that (16) For most neurons, the dynamics of the first component of the state,, are faster than the other states in the region, see Figure 2 C. Therefore, when, it returns to only if it is close to, otherwise it returns to. The return process to is much faster as compared to the return process to, due to slower dynamics arising near. Therefore, when, it spends most of its time close to, and hence we assume that the. Furthermore, since the, this assumption does not affect our results much. We will convince the reader that these assumptions are mild in the results section. Essentially, we will show that our reliability expressions under these assumptions match well to numerically computed curves for different relay neurons. Finally, since and are disjoint sets, we get: (17) Although not explicitly in (17), relay reliability is a function of the driving input parameters, and, the modulating input parameters, and and the neuron' s dynamics (i. e. model parameters) denoted by. In the next sections, we compute closed-form approximations of lower and upper bounds of reliability as a function of and, by computing and bounds on. To compute we first find a solution for the orbit tube and then find a solution for the response to a driving pulse given the state starts in. This solution shows us when the neuron generates a successful response. We later use this information to compute. In this section, we compute in (17) to ultimately obtain an expression for. Since a driving pulse that arrives at time can only result in either a successful response or an unsuccessful response, we can equivalently write the definition of as: (38a) (38b) (38c) Here, we have used the law of total probability and the definition of conditional probability [35] to arrive at (38c). We know that after a successful response at, the system state, only for. Therefore (39) Similarly, if denotes time spent in refractory zone after unsuccessful response, then we get: (40) Now by combining (13), (38c), (39) and (40) we get: (41) Since has a complicated dependence on the input and model parameters, it is difficult to calculate. However, it is certain that. This implies that, by properties of cumulative distributive functions [35]. Therefore, we get the following bounds: (42) Putting (41) and (42) together, we get: (43a) (43b) (43c) Now, we calculate. Recall that the inter pulse intervals of,, here is generated from an exponential distribution and is the refractory period. Therefore: (44a) (44b) (44c) It can be easily shown that: (45) is the average inter pulse interval,. Finally, by combining (43c) and (44) we get: (46a) Now we compute bounds on relay reliability i. e. Recall that: (47a) (47b) (47c) Similarly, we can write lower bound on reliability as: (48) Combining (47) and (48) we get: (49) From (49) and (44), one can see that if, which makes. This result is intuitive because if pulses in occur at a slow rate, then the solution of (4) has enough time to return to the orbit tube after each pulse. Therefore, and. Another interesting case emerges if. In this case and. This case has two interesting extremes: 1., making, 2., and both and approach. In case 1, an average a number of pulses occur in the time interval after a successful response. All of these pulses generate unsuccessful responses because the system state is inside during this interval. Therefore, for each successful response, we get unsuccessful responses making. However, in the second case, exactly one pulse occurs during the period after a successful response. Therefore, for every successful response we get at least unsuccessful response. Now, if, we get exactly one unsuccessful response for each successful response making. In Figure 5, we plot and vs for given by (3) with, and superimpose it with a numerically obtained curve through simulation of the original model (1). is estimated by doing repeated simulations on (4) with given by (3), and. We see that empirical reliability plus and minus its standard deviation are essentially within bounds and. From Figure 5 B, we see that increases with the frequency of the modulating input,. In Figure 6 A, we plot and vs for, along with empirical reliability computed numerically. We see that reliability decreases as (i. e. the mean value of modulating input) increases. In Figure 6 B, we plot vs for,. Reliability again decreases as increases. The dependence of reliability on the cell' s input parameters is explicit in our bounds. However, dependence of reliability on the model parameters is captured implicitly by the gain, and. The refractory period,, is well studied in literature and depends on inactivation gate time constants [38]. Therefore, in this section we discuss how the gain and depends on the properties of a relay neuron membrane dynamics. In Figure 7 A, we plot vs conductances and. We see that first decreases with increasing and then increases forming a parabola. Furthermore, with increasing, decreases. In Figure 7 B, we plot the dependence of the gain on and. is essentially a low pass filter whose amplitude decreases as frequency increases. Consequently, reliability increases with frequency (see (49) ). From the Figure, we can see that the gain,, in the high frequency range () increases with and decreases with. For lower frequencies,, has a complex dependence on &. This is an important result as we can increase/decrease reliability of the relay neurons by increasing/decreasing T-type or leak channel conductances which can be further used to treat diseases such as Parkinson' s disease (see discussion). In this section, we will apply (49) to a third order model of a thalamic relay neuron. In this case, the parametrs in the equation are computed from the third order model. We chose the 3rd order thalamic model used in [15], [16], [22], which is a simplification of model used in [39], [40]. This model exhibits bursting activity in the hyperpolarized state and non bursty firing in the depolarized state. The two responses of the model for an oscillating modulating input and a Poisson driving input (inter-pulse interval is given by (7) ) are shown in Figure 8 A and 9 A. The equations and parameters of the model are the same as those used in [15], [22]: (50a) (50b) (50c) In the (50),,, are the leak current, sodium and potassium current, respectively. and are the low threshold potassium current and external current respectively. are the temperature correction factors. All the parameters used are given in Table 3. A thalamic neuron generates a single spike when depolarized in the relay mode [15], [41]. However, it generates a burst of spikes when it receives a depolarizing input when it is in a hyperpolarized state [42]. We used, to model the hyperpolarized or bursty state. Whereas, models a single spike state of thalamic neuron. We can rewrite the (50) in the form of (4) by defining the state vector with: (51) In Figure 8 A, we plot the time profile of the voltage for a bursty neuron along with a zoomed in view of the burst in Figure 8 B. Figure 8 C plots our reliability bounds (49) along with empirical reliability computed numerically through simulation of the 3rd order model. We see that our bounds predict reliability well even for a bursty neuron. Note that we consider a burst response to a pulse as a successful response. In Figure 9 A, we plot the time profile of voltage for a non bursty neuron along with a zoomed in view of a successful spike in Figure 9 B. Figure 9 C plots our reliability bounds (49) along with empirical reliability computed numerically through simulation of the 3rd order model. Note that here therefore. We see that our bounds predict reliability well in this case also. In general, our analytical bounds are applicable as long as the model 1. does not generate a spike if there is no pulse in, and 2. has a threshold behaviour as defined in Materials and Methods section, and 3. shows a refractory period. The second condition is true for most neurons that satisfy the first condition. Our analysis may also be extended to include neurons that spike without any driving input (see Discussion), but in this manuscript we neglect such dynamics. Our reliability bounds were calculated assuming that the relay neuron does not fire spontaneously. However, many relay neurons show spontaneous firing in the absence of any input. This spontaneous firing is usually periodic (period) because it arises from the emergence of a limit cycle [43] and can be thought of as responses to background noise. Our analysis can therefore be extended to capture this by adding a periodic noise pulse train in the reference input, therefore the new reference input becomes: (52) Since a successful response to a pulse in is undesirable, we must modify our definition of reliability. To do this, we assume that the arrival of a pulse in cannot coincide with an arrival of a pulse in and thus successful responses to pulses in each signal are disjoint events. This leads us to define reliability as (53a) With this approach, our analysis can be extended to spontaneously firing neurons. We believe that the reliability will approximately be bounded as: (54) The above expression is reduced to (49) in the case i. e the noise period is much larger than the period of the driving input. In the case when the reliability becomes negative because noise pulses occur very frequently as compared to desirable driving input pulses. This generates undesirable successful responses making reliability negative. Note that (54) is only an approximate solution for the reliability of spontaneously firing relay neurons and we leave the exact solution to this problem for the future work. In the motor circuit, thalamocortical neurons receive a driving input from the motor cortex and a modulating input from the GPi segment in the basal ganglia (BG). See Figure 10 A. The function of the GPi input is hypothesized to enable/disable thalamic cells to relay cortical stimuli related to movement when movement is intended/not intended [14]. This is consistent with evidence that the BG both inhibits unwanted movements and enables intended movements in a timely manner [12], [13]. This GPi modulated thalamic relay ultimately enables reliable transfer of information from higher cortical layers to lower layers which then command the musculoskeletal system to generate planned movements [44]. The thalamic relay hypothesis is supported by previous studies [4], [16], [22]. In [16], [22], it is shown that relay reliability computed from a data-driven computational model of a thalamic neuron is low in Parkinson' s disease (PD), and high in both healthy and when therapeutic DBS is applied to the BG in PD. Previous works emphasize the inhibitory projections from GPi to motor thalamus [45]–[48]. They argue that when movements are intended/not intended, appropriate task-related GPi neurons decrease/increase their firing rates. This in turn disinhibits/inhibits thalamus and consequently enables/disables thalamic relay, respectively. Our analysis as well as recent experimental observations show that the story is a bit more complicated. GPi firing rates alone may not be the mechanism for thalamic relay, rather, the dynamics of the GPi activity control thalamic relay. In particular, it appears that the oscillatory dynamics of GPi activity control relay. Our relay bounds predict that if one intends to move, then the GPi neurons that project to motor thalamus should initially generate LFP activity that has prominent low frequency oscillations which allows the subject to remain idle, and then generate activity that has prominent high frequency oscillations which allows the subject to plan an intended movement and then move. We first discuss how our analysis concurs with observations obtained from a computational model of the motor circuit that characterizes neural activity dynamics in the BG and motor thalamus in health and in PD with and without therapeutic DBS. The computational model simulates neural activity when movements are planned and hence when motor thalamus should relay information from the cortex at all simulated times. We then discuss how our relay bounds accurately predict how GPi activity recorded from two healthy primates modulates during a structured behavioral task that forces an idle phase, and a planning phase during each task trial. As mentioned in the Introduction, neurons in the LGN receive driving input synapses from the retina and modulating input synapses from layer 6 of the visual cortex and the brain stem. The LGN then relays the driving input to visual cortex for perception. The LGN functions as a “gatekeeper” and allows only the relevant information to go through depending on attentional demands [7], [64]. In the LGN, the spatial map of the visual field is conserved [64], [65]. Here, we hypothesize that the LGN functions as a filter of the spatial map which shows a high relay reliability in spatial areas requiring high attention and lower reliability otherwise. Our analysis suggests then that LGN neurons relaying attended areas of the visual field receive higher frequency modulating inputs as compared to LGN neurons relaying areas which are ignored. Note that the modulating input represents the synaptic background activity, which is a major contributor to LFPs and EEG recordings [10]. Therefore, the frequency content of LFPs and EEG reflect the frequency of the modulating input. This hypothesis is supported by [8], where it was shown that the frequency of the LFPs in LGN depends on the arousal state of the cat. Specifically, they showed a prominent rhythm () in awake and naturally behaving cats, a rhythm () in drowsy cats and a slow rhythm () during sleep. Additionally [21], showed that, in wakeful naturally behaving cats, the spiking activity of relay-mode (non-bursty) neurons in the LGN is correlated with the phase of the alpha rhythm of the LFPs. Specifically, some neurons spike more at the peaks of the alpha wave while other neurons spike more at the valleys of the alpha rhythm. Using (36), we may be able explain why such phase locking occurs. In words, this equation says that relay neuron reliably relays the driving input only during a fixed phase interval of modulating input, and this phase interval depends on neuron membrane properties [21]. Finally, during deep sleep slow delta rhythms are observed in the EEG which are believed to be of thalamic origin [66]. This may cause even lower reliability in LGN and filter out all the visual information, resulting in deep sleep. On the other hand, high frequency & rhythms are observed during visual attentional tasks in the LFPs of cat LGN [9]. Our analysis shows that reliability increases with modulating input frequency, therefore we propose that the reliability during these tasks is greater than during natural wakeful behaviour for most LGN neurons. This results in larger relay of information which increases general productivity. In addition to the observed relationship between the LGN LFP oscillations and attention, it has been observed that during sleep, LGN neurons become hyperpolarized [42], [67]. In our model, this means that the DC offset of the modulating input,, is large which decreases reliability according to our analysis. The LGN neurons relay poorly and also exhibit a bursty behaviour (see Figure 6 A and 8). The lower reliability may result in less information relay from the LGN to the visual cortex, inducing sleep whereas the bursty behaviour may only be a by-product of hyperpolarization and may have nothing to do with information suppression. This agrees with [68] where in it is shown experimentally that although all bursts combine carry lesser information than all single spikes, individual burst is more informative than a single spike in the LGN output. The information carried in the bursty mode may be critical for waking up [42].

Title: Performance Limitations of Relay Neurons Summary: In cellular biology, it is important to characterize the electrophysiological dynamics of a cell as a function of the cell type and its inputs. Typically, these dynamics are modeled as a set of parametric nonlinear ordinary differential equations which are not always easy to analyze. Previous studies performed phase-plane analysis and/or simulations to understand how constant inputs impact a cell' s output for a given cell type. In this paper, we use systems theoretic tools to compute analytic bounds of how well a single neuron' s output relays a driving input signal as a function of the neuron type, modulating input signal, and driving signal parameters. The methods used here are generally applicable to understanding cell behavior under various conditions and enables rigorous analysis of electrophysiological changes that occur in health and in disease.

lay_plos

en

Summarize: Background DOD Readiness Reporting DOD defines “readiness” as the ability of the U.S. military forces to fight and meet the demands of the National Military Strategy. DOD uses a variety of automated systems, review processes, and reports to collect and disseminate information about the readiness of its forces to execute their tasks and missions. Two of the primary means of communicating readiness information are the Quarterly Readiness Report to Congress— which is a classified product prepared by the Office of the Under Secretary of Defense for Personnel and Readiness with input from the services, combatant commands, and Joint Staff and details military readiness on a quarterly basis—and the Joint Force Readiness Review, which is a classified product prepared by the Chairman of the Joint Chiefs of Staff and assesses the armed forces’ capability to execute their wartime missions under the National Military Strategy on a quarterly basis. The Joint Staff assesses the department’s overall ability to resource and execute the missions called for in the National Military Strategy. The overall assessments, which are classified, are based on joint and force readiness. Joint readiness focuses on the ability of the combatant commands to provide, integrate, and synchronize forces assigned to missions, while force readiness focuses on the ability of the force providers to provide forces and support capabilities. The military services organize their forces into units for training and equipping purposes. Joint guidelines require that commanders assess their units’ abilities to perform their core competencies, or their ability to undertake the wartime or primary missions for which they are organized or designed. These classified assessments are based on four distinct resource indicators—personnel, equipment availability, equipment readiness, and how well the unit is trained to conducts its missions. Joint guidelines also require joint and service unit commands to evaluate, in near real-time, the readiness of forces to accomplish assigned and potential tasks through the Defense Readiness Reporting System (DRRS). The system provides the means to monitor the readiness of DOD components to provide capabilities to support the National Military Strategy consistent with DOD priorities and planning direction. Through DRRS, commanders, military service chiefs, and agency directors assess the ability of their organizations to accomplish a task to standard, based on their capabilities, under conditions specified in their joint mission- essential task list or agency mission-essential task list. DOD’s Global Force Management Process In 2005, faced with a situation where its process for providing forces was not responsive enough to meet operational needs, and where the department was not able to provide funding to maintain the readiness of all its forces to do their full range of assigned missions, DOD established a centralized Global Force Management process. According to the department, establishment of the process enabled the Secretary of Defense to make proactive, risk-informed decisions on how to employ the force. The goal of Global Force Management is to allow officials to identify the global availability of forces and/or capabilities needed to support plans and operations. The department relies on Global Force Management to distribute the operational forces that belong to the military services among competing combatant commander requirements. Each combatant command documents its need for forces and/or capabilities, and then DOD uses the Global Force Management process in the following ways to meet identified needs. A portion of DOD’s operational forces are assigned to the combatant commands and positioned in the geographic combatant commander’s theater of operations to provide shorter response times. Combatant commanders have authority over forces assigned to them until the Secretary of Defense reassigns the forces. The combatant commanders receive additional forces to supplement their assigned forces through the allocation process. These forces are temporarily transferred to a combatant command to meet operational demands for both steady state rotational requirements that are planned in advance and emergent needs that arise after the initial allocation plan has been approved. They supplement a combatant commander’s assigned forces in order to mitigate near-term risk. The Global Force Management process also includes a process to apportion forces. Apportioned forces provide an estimate of the services’ capacity to generate capabilities along general timelines for combatant commander planning purposes. These are the forces that a combatant commander can reasonably expect to be made available, but not necessarily an identification of the actual forces that will be allocated for use when a contingency plan or crisis response plan transitions to execution. DOD and the Services are Taking Steps to Manage the Impact of Continued Deployments on Readiness Persistently Low Reported Readiness Levels Attributed to Various Factors After more than a decade of conflict, recent budget uncertainty, and decreases in force structure, U.S. forces are facing significant challenges in rebuilding readiness. DOD officials noted that it will take a significant amount of time to realize improvements in readiness as the department works to address identified challenges. In addition, the individual military services, which train and equip forces used by the combatant commands, report persistently low readiness levels. The services attribute the low readiness levels to various factors. Specifically, The Army attributes its persistently low readiness level to emerging demands, lack of proficiency in core competencies, and end strength reductions. Even as the Army has brought forces back from Afghanistan, the Army faces increasing emergent demands that strain existing capacity, such as the deployment of the 101st Airborne Division in Africa to respond to the Ebola crisis. In addition, other factors contribute to readiness challenges, including a lack of familiarity among leaders and units with the ability to conduct collective training towards core competencies because the Army focused on counterinsurgency for many years. Finally, the Army is downsizing to an end strength of 980,000—about a 12 percent reduction in size. Army leadership testified in March 2015 that any end strength reductions below this level would reduce the Army’s capability to support missions identified in defense guidance. The Navy attributes its persistently low readiness level to increased lengths of deployments for aircraft carriers, cruisers, destroyers, and amphibious ships, which has created significant maintenance challenges. The Navy currently has 272 ships, a decrease from 333 ships in 1998—an 18 percent decrease. Even as the number of Navy ships has decreased, the number of ships deployed overseas has remained roughly constant at about 100 ships. Consequently, each ship is being deployed more to maintain the same level of presence. In addition, the Navy has had to shorten, eliminate, or defer training and maintenance periods to support high deployment rates. The Air Force attributes its decline in readiness to continued demands and a reduced force structure. For example, in 1991 the Air Force had 154 fighter and bomber squadrons, and as of December 2015 the Air Force had 64 fighter and bomber squadrons—a 58 percent decrease from 1991 levels. Further, its readiness level has declined because of persistent demand for forces, a decline in equipment availability and in experienced maintenance personnel, and the impact of high deployment rates on units’ ability to conduct needed training. The Marine Corps attributes its readiness levels to an increased frequency of deployments to support the sustained high demand for the force; gaps in the number of unit leaders with the right grade, experience, and technical and leadership qualifications; and training shortfalls, including a lack of sufficiently available aircraft to train to standards, resulting from over a decade of war. While the services have reported readiness shortfalls across the force, there have been some readiness gains in select areas, such as Army Brigade Combat Teams and Marine Corps Infantry Battalions. For example, beginning in fiscal year 2014, reported readiness levels for Army Brigade Combat Teams generally improved, but plateaued in fiscal year 2015. In addition, readiness levels for infantry battalions have improved over the past 5 years as infantry units resumed training to core mission-essential tasks after the end of Operations Enduring Freedom and Iraqi Freedom. Global Demands Are Expected to Continue and to Challenge Some Portions of the Force Though DOD officials indicated that overall demand has been decreasing since 2013—primarily because of the drawdown of forces in Iraq and Afghanistan—DOD has reported that the ability of the military force to rebuild capacity and capability is hindered by continued, and in some cases increased, demand for some types of forces. Additionally, DOD is responding to these global demands with a reduced force structure, which further impacts reported readiness. For example, from fiscal year 2013 through fiscal year 2016, active component end strength decreased by about 7 percent and reserve component end strength decreased by about 4 percent across the force. Combatant command demand has consistently exceeded what the services are able to supply. DOD has spent most of the last decade responding to near-term combatant command demands, primarily in Iraq and Afghanistan. Combatant command officials we spoke with acknowledged that even though demand in support of U.S. Central Command operations in Iraq and Afghanistan had been decreasing, overall demand remains high and is likely to remain high in order to support global needs. For example, U.S. European Command officials noted that the command’s assigned forces are now staying in Europe and being used to meet the growing needs of the command, such as the response to Russian aggression, which officials noted has been the most significant driver of changes to the command’s needs since February 2014. Moreover, U.S. Pacific Command officials noted that their operational requirements have steadily increased to ensure adequate capability exists to address the increasingly unpredictable and provocative actions of North Korea and China. Global demands for select force elements, such as the Air Force’s personnel recovery units, the Army’s division headquarters, and the Navy’s carrier strike groups, have been persistently high. These high- demand force elements already face challenges in meeting service- established deployment-to-dwell ratios. For example: Units within the Air Force’s personnel recovery service core function have experienced challenges maintaining deployment-to-dwell ratio within the Air Force’s and Office of the Secretary of Defense’s stated goals of 1:2 and 1:5 for active and service component units, respectively. Specifically, the HC-130 fixed wing aircraft had a deployment-to-dwell ratio of approximately 1:1 for the active duty and 1:4 for the reserve component as of January 2016. The Army has experienced challenges in meeting the demand for division headquarters during fiscal years 2010 through 2015 and reports that it will continue to experience readiness challenges at the active component division headquarters level for the next few years. As of August 2015, division headquarters had a deployment-to-dwell ratio of less than 1:1, which requires Secretary of Defense approval and is in excess of the Army’s goal of 1:2 and the Office of the Secretary of Defense’s goal of 1:2. Because of increased demand over the past several years, many Navy ships have been deployed for 9 to 10 months or longer compared to the 7 months the Navy reports as a sustainable deployment length. Moreover, combatant commander demand for carrier strike groups has grown and the Navy is unable to meet current demand. Some portions of the force have experienced reduced demand and improved readiness. Our analysis shows that some of the decline in overall force demand can be attributed to the decline in demand for Army Brigade Combat Teams, which have experienced improved readiness. For example, as we found in May 2016, Brigade Combat Team demand decreased by more than two-thirds since fiscal year 2011 and was mostly met from fiscal years 2010 through fiscal year 2015. In addition, beginning in fiscal year 2014, reported readiness trends for Brigade Combat Teams generally improved, but plateaued in fiscal year 2015. DOD Is Undertaking Efforts to Reform Its Force Management Process DOD has undertaken efforts to better manage the demands placed on the force. Specifically, in 2014 the Joint Staff introduced plans to reform the Global Force Management process in an effort to address declines in readiness and capacity across the force. However, at the time of our report, the department was still working to complete implementation of Global Force Management reform initiatives and thus it is too soon to tell what impact implementation of these initiatives will have on DOD’s readiness recovery efforts. The department focused its Global Force Management reform on an effort to transition to a resource-informed process, instead of a process driven primarily by combatant command demand. The intent is to better balance the distribution of forces for high-priority missions with the need to rebuild the readiness of the force. Through Global Force Management reform, the department expects to be better positioned to reduce the burden on the force and allow the services time to rebuild readiness. Global Force Management reform efforts include the following changes. Revising combatant command plans: DOD officials noted that in 2015 the department began efforts to revise several major plans in an attempt to better reflect what the current and planned force is expected to achieve. This effort to revise major plans, which the combatant commands were currently undergoing at the time of our review, has already resulted in some changes. Implementing the “ceiling and floor” concept: This effort is intended to balance the availability of forces against combatant commander requirements. The “ceiling” is the maximum number of forces a force provider can generate under current funding levels while still achieving readiness recovery goals and the “floor” is the minimum force level needed in each combatant commander’s theater of operations for initial response needs. Forces included in the floor would only be considered for reallocation if there was a major operational plan being executed in another geographic area of responsibility. According to U.S. European Command officials, in an effort to rebuild service readiness, the services are not allowed to deploy forces above the identified ceiling without Secretary of Defense approval, which has resulted in more difficulty in sourcing combatant command requirements. DOD has reported that the results of implementing the “ceiling” and “floor” concept would not be fully realized until fiscal year 2017. Realigning the force assignment and allocation processes: This effort, which the department implemented in late 2014, is intended to realign the Global Force Management assignment and allocation processes to address the assignment of forces to the combatant commands prior to allocating additional forces in support of demands throughout the year. DOD uses the assignment of forces to provide the combatant commanders a base set of forces in support of both enduring and emergent requirements, thereby potentially mitigating risk. Realigning these Global Force Management processes should allow commanders to better understand the assigned forces they will have access to before requesting additional forces through the allocation process and mitigate risks inherent with declining force size and readiness challenges. Updating apportionment tables: DOD produces force-apportionment tables to (1) help leaders assess plans based on projected force inventory and availability; (2) inform risk estimates; and (3) inform mitigations. The overarching goal of the force apportionment tables is to provide improved assumptions to assess risk and produce better, executable plans. DOD previously required that the tables be produced annually, but through Global Force Management reform, and beginning in late 2014, the department began requiring quarterly updates to the tables. More frequent updates should provide the combatant commanders with a better representation of the forces available during planning. According to U.S. Southern Command officials, while updating the apportionment tables on a quarterly basis does not provide a sense of unit readiness, it is a helpful tool for planning purposes. Establishing a Readiness and Availability Priorities framework: The Readiness and Availability Priorities framework is intended to inform risk decisions and Global Force Management policy recommendations. Through the Readiness and Availability Priorities framework, the Joint Staff, in coordination with the services and combatant commands, assess the department’s ability to meet prioritized mission requirements and evaluate the associated risk based on force employment decisions that have already been approved. We found that the full impact of DOD’s Global Force Management reform is not known because some elements are in the early stages of implementation. In the time since portions of the reform have been put in place, officials have cited limited progress in better managing the services’ ability to meet combatant command demand. For example, our analysis of global force management data showed that between fiscal years 2013 and 2015, the number of combatant command requirements that the Secretary of Defense considered for sourcing decreased by about one-third. However, in fiscal year 2015, the department was still sourcing most combatant commander-identified requirements rather than making decisions that would have benefited the services’ readiness recovery efforts. Specifically, the Secretary of Defense provided full or partial sourcing to more than 90 percent of combatant command requirements. DOD’s Implementation and Oversight of Department-Wide Readiness Rebuilding Efforts Do Not Fully Incorporate Key Elements of Sound Planning DOD has stated that readiness rebuilding is a priority, but implementation and oversight of department-wide readiness rebuilding efforts has not fully included key elements of sound planning, which could place readiness recovery efforts at risk given the continued high pace of operations and many competing priorities. Leading practices we identified in our prior work show that sound strategic planning can enhance an agency’s efforts to identify and achieve long-range goals and objectives and entails consideration of key elements during planning efforts. Key elements include (1) a mission statement; (2) long-term goals; (3) strategies to achieve goals; (4) external factors that could affect goals; (5) metrics to gauge progress; and (6) evaluations of the plan to monitor goals and objectives. As summarized in table 1, however, our analysis of readiness recovery plans shows that DOD and the services have only partially incorporated these key elements of sound planning into their readiness rebuilding efforts. Mission Statement: Readiness Rebuilding Is a Mission Priority for DOD and the Services DOD strategic guidance makes it clear that readiness rebuilding is a priority that supports the department’s mission of deterring war, and each service has promulgated guidance highlighting readiness as a mission priority. Sound planning requires a mission statement that concisely summarizes what the organization does, presenting the main purposes for all its major functions and operations. In its strategic guidance, DOD states that its overarching mission is to provide military forces needed to deter war and to protect the security of the United States. Further, it has emphasized that rebuilding the readiness of the force supports its ability to accomplish the missions and to continue to meet the demands outlined in the National Military Strategy. Consequently, DOD’s emphasis on rebuilding readiness is outlined in key strategic guidance. For example, the Guidance for the Employment of the Force states that it is an overarching priority to recover readiness in each service while minimizing deployments. In addition, the Defense Planning Guidance states that the components are to continue their efforts to return to desired readiness levels by the end of the Future Years Defense Program. Alongside its emphasis on recovering readiness, however, DOD has stated that finding the proper balance between recovering readiness, force structure sizing, modernization, and future threats is an important component of the mission and the highest priority of its leadership. Thus, each of these priorities must be considered within the context of the risk they place on both the force and the mission. While each service has promulgated guidance highlighting the need to rebuild readiness, they have not consistently prioritized the importance of these efforts. For example: The Army has identified readiness as its highest priority. The Chief of Staff of the Army published specific readiness guidance with the overarching objective of maximizing the readiness of the total force. In the memorandum, the Chief of Staff noted that readiness was the service’s number one priority and that there was “no other number one” priority. Both the Navy and the Marine Corps emphasize the importance of rebuilding readiness. Specifically, the Vice Chief of Naval Operations testified that the Navy’s priority was implementation of the Optimized Fleet Response Plan, which is designed to support the Navy’s overall readiness recovery goals. In addition, the Assistant Commandant of the Marine Corps testified in support of the Marine Corps Posture Statement that, given the current fiscal environment, the service was working to maintain a balance between current readiness and projected future readiness, but that current readiness remains its main focus. Air Force leaders have stated that striking a balance between today’s readiness and future modernization is important, but exceptionally difficult. Recognizing the impact that combatant commander demand and uncertain funding, among other things, can have on readiness, the Air Force does not expect to recover readiness prior to 2020. However, according to Air Force and DOD strategic guidance, the Air Force must be prepared to operate in highly contested battle spaces in the future. Therefore, the Air Force is focusing on recapitalization and modernization of its aircraft to ensure it is able to meet combatant commanders’ capability and capacity requirements in the future. Long-Term Goals and Strategies: The Military Services Have Not Fully Established and DOD Has Not Validated Complete Goals or Comprehensive Strategies for Readiness Recovery DOD has linked readiness recovery to its ability to accomplish its missions. However, the military services have not developed complete goals or comprehensive strategies for rebuilding readiness that have been validated to ensure they reflect the department’s priorities. Two interconnected key elements of sound planning are to establish comprehensive and specific goals and to establish a strategy to achieve those goals. At the department level, the Office of the Under Secretary of Defense for Personnel and Readiness is responsible for developing plans, programs, and policies for readiness to ensure forces can execute the National Military Strategy, as well as oversight of military training and its enablers. The military services have the authority and responsibility to man, train, and equip forces for employment, and are also responsible for identifying critical readiness deficiencies and developing strategies for addressing the deficiencies. In line with these responsibilities, the Deputy Secretary of Defense established the Readiness Deputy’s Management Action Group (Readiness DMAG) in late 2011. The Office of the Under Secretary of Defense for Personnel and Readiness then charged the Readiness DMAG with synchronizing and coordinating actions and overseeing the military services’ readiness recovery efforts. Through the Readiness DMAG, DOD required the services to develop and implement readiness rebuilding plans that describe each service’s readiness goals and the time frames within which the goals could be met, with a focus on improved readiness for the full range of assigned missions. Each service has established some readiness recovery goals, but the goals only capture portions of the force and have been extended over time. Each service has also established readiness recovery strategies, but these strategies have been incomplete or not comprehensive and, in many cases, have not fully identified the resources required to achieve the goals the strategies support. Service Readiness Recovery Plans Do Not Capture the Entire Force and Have Changing Time Frames In 2015, the services reported their readiness rebuilding plans to DOD, which included some readiness goals, strategies for achieving the identified goals, and time frames for when the rebuilding efforts would be complete. Tasked by the Office of the Under Secretary of Defense for Personnel and Readiness to establish these plans, the services selected a representation of critical force elements that would allow them to highlight progress in working toward achieving identified goals. In response, the services selected force elements that were either experiencing a high pace of deployments, facing challenges in achieving readiness recovery, or were key to their respective readiness recovery efforts. For example, the Navy included ballistic missile submarines, carrier strike groups, amphibious ready groups, large surface combatants, attack submarines, and patrol aircraft. As part of their initial effort, the services had set goals and time frames for achieving readiness recovery. However, by the time of our review, many of the goals had been changed and time frames had been extended. Table 2 outlines the key force elements that the services’ readiness recovery plans are based on and the goals and time frames for the plans. Inconsistencies exist in the individual service readiness recovery goals and in the time frames for achieving them because of DOD’s decision to direct the services to develop their own respective readiness recovery plans without validating them to ensure that they are complete, comprehensive, and reflect the department’s priorities. For example, the services established readiness recovery goals, but these goals are only for portions of the force in each service. For instance, the Army established specific readiness recovery goals for five force elements (Brigade Combat Teams, Combat Aviation Brigades, Division Headquarters, Patriot Battalions, and Terminal High Altitude Area Defense Batteries). Also, the Army set readiness recovery goals for a large portion of its overall active component non-brigade Combat Team force and segments of its active-duty and Army National Guard Brigade Combat Teams, but these goals do not capture the entirety of the force. Moreover, the time frames that the services identified for achieving readiness recovery goals have been extended by some services since the plans were initially established in 2015; services extended the goals primarily because of the services’ inability to achieve initially identified goals with the strategies they outlined. Additionally, each service has either established or is working to establish strategies for helping achieve readiness recovery goals, but we found that some strategies are not comprehensive or complete. For example: Readiness recovery for the Navy is premised on successful implementation of the Optimized Fleet Response Plan. This plan seeks to provide a more sustainable force-generation model for Navy ships, as it reduces deployment lengths and injects more predictability for maintenance and training into ship schedules. According to Navy policy, this framework establishes a readiness-generation cycle that operationally and administratively aligns forces while aligning and stabilizing manning, maintenance and modernization, logistics, inspections and evaluations, and training. As of April 2016, the Navy had established optimized schedules for five of the six elements of the fleet and had plans to complete the remaining schedule for Amphibious Ready Groups before the end of May 2016. The Army’s strategy to achieve readiness goals is evolving, but as yet, incomplete. A key aspect of this strategy is to develop and implement a new force generation model called “sustainable readiness,” which the Army expects to implement in fiscal year 2017. The Army expects this model will provide increased predictability and visibility to optimize unit rotations and sustain readiness when units are not deployed. Additionally, the Army expects the model to generate more combat power and enabling capability given available resources, as well as to help define readiness goals. The Air Force strategy to rebuild readiness is predicated on conditions of consistent funding and decreasing operational demand. Without these two conditions being met, the Air Force has stated that readiness will not improve significantly. For example, the Air Force identified five influencers of future readiness, which are (1) operational tempos, as reflected in the ratio of deployment-to-dwell; (2) flying hour program; (3) critical skills availability, or having the right personnel for each position; (4) weapons system sustainment; and (5) training resource availability. Each of these influencers is affected by operational demand or consistent funding. The Air Force regularly measures its ability to increase its readiness using the five influencers. The Air Force found that while problems with any one area could lead to serious readiness problems, improvement required balanced efforts across all five areas. The Marine Corps does not yet have a measurable readiness goal with an analytical basis, or a specific strategy to meet its current overall readiness goal. The Marine Corps focuses on five institutional pillars of readiness, which include high quality people, unit readiness, capacity to meet combatant commander needs, infrastructure sustainment, and equipment modernization. In addition, the Marine Corps has established specific strategies to achieve goals developed for certain communities, such as aviation. For example, the Marine Corps issued the Ready Basic Aircraft Recovery Plan and 2016 Marine Aviation Plan in an effort to mitigate current readiness challenges and recover future readiness for the aviation community. Service Readiness Recovery Plans Do Not Fully Consider Resources Needed to Achieve Goals In overseeing readiness rebuilding efforts, neither the Office of the Under Secretary of Defense for Personnel and Readiness nor the Readiness DMAG has required that the services fully identify the resources required to support achievement of service-identified goals. A viable readiness recovery effort will require both DOD and the services to develop and agree on goals that can guide the efforts of the joint force, and clearly establish strategies that will result in the achievement of the goals. DOD has acknowledged challenges with funding, accepting that it is a constrained resource. However, the department has not identified the resources needed to fully implement readiness rebuilding efforts, and thus does not know what achieving readiness recovery will cost. In addition, adding funding may not help the services recover the readiness of their forces in some cases. For example, the Air Force’s Guardian Angel Weapon System, within the Personnel Recovery service core function area, is lacking experienced active-duty pararescue jumpers to meet combatant commander demand. To mitigate this problem, the Air Force continues to recruit new pararescue jumpers, but currently the least experienced personnel are filled well over authorized amounts, while mid-career personnel, who are required on all deployments and are needed to mentor and train new personnel, are filled at about half of their authorized amounts. Additional funding is not going to help the rebuilding efforts in the near term, as the units need time—about 7 years—to develop the least experienced personnel into mid-career and most experienced personnel, according to Air Force officials. In addition, the Chairman of the Joint Chiefs of Staff, the Vice Chief of Naval Operations, and the Assistant Commandant of the Marine Corps have all testified that DOD will not be able to address readiness problems with money alone, but that factors such as operational requirements and time must also be considered. For each service, the resource requirements needed to fully implement readiness recovery will vary by force element. For some force elements, the services understand the barriers to rebuilding readiness and in some cases have estimated portions of the expected costs. For example, we found that the Navy has estimated that total ordnance shortfalls across its aircraft carrier, cruiser, and destroyer force amount to at least $3.3 billion for items such as torpedoes and guided missiles, which are needed to fully achieve readiness recovery. In some cases, however, the services have not quantified or budgeted for the full costs of achieving identified readiness goals for specific segments of the force because readiness recovery goals have not been established. For example, lacking clearly established readiness recovery goals for the non-Brigade Combat Team portion of the National Guard and for the entirety of the Army Reserve, the Army is unable to identify the resources that would be required to achieve such goals. In addition, the Marine Corps has not articulated a measurable readiness recovery goal with any analytical basis, and as such, is not able to identify the resources needed to achieve that goal. External Factors: Service Readiness Recovery Plans Are Based on Assumptions That Have Not Fully Considered the Impact of External Factors Another key element of sound planning is understanding key factors that are external and beyond agency control that could significantly affect achievement of long-term goals. DOD and the services have identified potential risks to achieving their readiness recovery goals—such as budget uncertainty—but they have not fully considered how to account for these risks, including how they will influence the assumptions on which the plans are based. Based on our work, we found assumptions in three areas that are also questionable: (1) availability of funding, (2) ability to complete maintenance on time, and (3) whether operational tempo and other factors will allow sufficient time for training. Uncertainty About Funding DOD has reported that time and sufficient, consistent, and predictable resourcing are needed to allow the services to rebuild readiness. In an effort to help the services improve their readiness, Congress appropriated $1 billion in overseas contingency operations funds in 2016 that were designated for use in readiness improvement efforts. Like the rest of the federal government, however, DOD faces across-the-board spending reductions through sequestration. We previously examined the effects of sequestration on DOD, noting that the department placed an emphasis on preserving readiness when implementing spending reductions, but still expected sequestration to affect plans to improve military readiness by either delaying or cancelling activities. For example, we found that the Air Force cancelled or reduced participation in most of its planned large-scale fiscal year 2013 training events. Moreover, like much of the government, DOD has been funded through continuing resolutions, which create uncertainty about both when they will receive their final appropriation and what level of funding ultimately will be available. Recognizing these challenges, the Air Force cited funding levels for modernization and recapitalization as a risk to achieving readiness recovery within identified time frames, the Army noted that if sequestration were to return without a commensurate change to DOD’s strategy, the impact would be devastating to Army readiness, and the Navy noted that stable and consistent funding is key to implementing the Optimized Fleet Response Plan, which is the Navy’s plan to rebuild readiness. Inability to Meet Maintenance Time Frames Readiness recovery is premised on the services being able to meet maintenance time frames, but most of the services expect continued challenges in doing so. For example, over the last 5 years, shipyards have not completed the majority of required maintenance on time, primarily because high deployment rates have led to shortened, eliminated, or deferred maintenance periods and a growth in maintenance backlogs. In May 2016, we found that from fiscal years 2011 through 2014, 89 percent of aircraft carrier maintenance periods took more time than scheduled, which also increased the costs. Recognizing these challenges, the Navy implemented the Optimized Fleet Response Plan in 2014 in order to provide a more sustainable schedule for ships, introducing more predictability for maintenance and training. The Navy’s readiness recovery goal of 2020 assumes successful implementation of the Optimized Fleet Response Plan. With only a portion of the fleet having entered this optimized cycle, it is too early to assess its effectiveness, but as we previously found, the first three aircraft carriers have not completed maintenance tasks on time, and of the 83 cruisers and destroyers, only 15 have completed a Chief of Naval Operations maintenance availability under the Optimized Fleet Response Plan. Extended deployments to meet global demands have resulted in greater and more costly maintenance requirements. In addition, the Marine Corps is facing significant challenges in its aviation maintenance and the Air Force has significant shortages of maintenance personnel. Lack of Time and Resources to Conduct Training The services’ readiness recovery plans are further premised on the notion that units would have the time and resources to train to meet the full range of missions assigned to them. However, the high pace of deployments, reduced time at home station, and reduced funding for conducting full-spectrum training has had an effect on individual units’ ability to train and fully recover readiness. For example, the Army has stated that one of its greatest challenges inhibiting readiness recovery is difficulty maintaining collective training proficiency in its core competencies due to a lack of personnel depth and experience. Because the Army converted almost all Combat Training Center rotations between 2003 and 2012 to focus on counterinsurgency, opportunities to train thousands of company commanders, field grade officers, and battalion commanders on their unit’s core competency missions were lost. A key part of the Army’s plan is to ensure that these soldiers have repeated full spectrum training experience at combat training centers over the next several years. However, the Army projects increasing emergent demand that may jeopardize the Army’s ability to achieve this. In addition, high deployment rates for Air Force units have resulted in less time for units to complete their full training requirements. According to Air Force officials, high deployment rates mean there are fewer aircraft available to train on at home stations, and often the most experienced personnel are disproportionally deployed, leaving fewer experienced personnel available to train less experienced personnel at home stations. Moreover, the Air Force reported that the availability of training ranges, munitions for training, and training simulators, among others, were key factors for readiness rebuilding. The service has reported that while the training resource availability is relatively healthy in terms of operation and maintenance funding, substantial funding is required to address long-term investment shortfalls. Metrics and Evaluating Progress: DOD and the Services Track Readiness Trends, but Most of the Services Have Not Established Metrics and DOD Has Not Developed a Method to Evaluate Progress Toward Achieving Readiness Recovery An element of sound planning is developing a set of metrics that will be applied to gauge progress toward attainment of the plan’s long-term goals. These metrics are then used to evaluate the plan through objective measurement and systematic analysis to determine the manner and extent to which programs associated with the plan achieve their intended goals. For example, evaluations can be a potentially critical source of information in assessing (1) the appropriateness and reasonableness of goals; (2) the effectiveness of strategies by supplementing metrics with impact evaluation studies; and (3) the implementation of programs, such as identifying the need for corrective action. The Office of the Secretary of Defense, the Joint Chiefs of Staff, the combatant commands, and the military services assess and report, through various means and using various criteria, the readiness of forces to execute their tasks and missions. Some key reporting mechanisms include the Defense Readiness Reporting System, the Joint Forces Readiness Review, and the Quarterly Readiness Report to Congress. These processes provide snapshots of how ready the force is at a given point in time. However, most of the services have not fully established metrics to track progress toward achieving readiness recovery goals. Using metrics to gauge progress toward the attainment of a plan’s long- term goals would provide the services with an objective measurement to use at specific points in identifying the extent of progress in attaining readiness recovery, and would afford the department the opportunity to know whether the efforts are achieving their intended goals. Specifically, while most of the services continue to monitor overall operational readiness through the Defense Readiness Reporting System, they have not fully developed metrics to measure progress toward achieving their readiness recovery goals. For example, The Navy’s readiness recovery plan—the Optimized Fleet Response Plan—is based on maximizing ship operational availability. Operational availability measures the amount of time a ship can get under way and execute a mission. The Navy has developed long-range ship schedules that project operational availability output for various force types, such as carrier strike groups, over the next 9 years. While the Navy’s projections show some progress towards its operational availability readiness recovery goals, the Navy has not set specific benchmarks, interim goals, or milestones that it expects to achieve on an annual basis or otherwise to evaluate the effectiveness of readiness recovery efforts. Navy officials said that they have projections for readiness recovery and that there are some measures in place to keep leadership informed of readiness recovery efforts, but that they have not set specific benchmarks, interim goals, or milestones for tracking progress of readiness recovery efforts. The Army established thresholds for various metrics that impact readiness—such as sustainable deployment rates—for the select force elements that form the foundation for the readiness recovery plan. However, Army officials told us that these thresholds and metrics were not intended to be used to track its readiness progress. Rather, officials told us that the Army planned to use its process for regularly tracking, reporting, and projecting readiness to measure progress towards achieving readiness recovery, which includes periodic reports on readiness. Part of the process includes regularly monitoring the percentage of Brigade Combat Team and non-Brigade Combat Team units reporting the highest levels of readiness. However, the Army’s process does not set interim benchmarks for readiness recovery. Additionally, the Army does not track, report, or project readiness against the thresholds and metrics it has established for specific active component force elements or against its broader readiness goals for Brigade Combat Team and active component non-Brigade Combat Team forces. In early 2016, Air Force officials described operational tempo and other conditions that are necessary to begin to recover readiness and stated that until those conditions are met, readiness will not improve significantly. Once those conditions are met, readiness is expected to improve over an 8- to 10-year period. The Air Force will continue to use current readiness metrics, to include operational tempos as reflected in the ratio of deployment-to-dwell, and critical skills availability—having the right personnel for each position—to chart progress towards meeting its readiness recovery goal. However, the Air Force has stated that it will be at least 2020 before its starting conditions are met. The Marine Corps does not yet have a specific strategy or metrics to track its progress in achieving its overall readiness goal. The Marine Corps has established specific strategies and accompanying metrics to achieve goals developed for certain force communities, such as aviation, one of its most stressed communities. For example, the Marine Corps’ primary metric for assessing aviation readiness recovery is having sufficient aircraft available to fully train a squadron. While Marine Corps officials state that they regularly monitor readiness through multiple forums, the Marine Corps has not set specific benchmarks, interim goals, or milestones to evaluate the effectiveness of overall or force-community-specific readiness recovery efforts. Marine Corps officials explained that they have not been required to do so. Moreover, according to officials, lacking fully developed metrics to assess the services’ ability to measure progress toward achieving intended goals, DOD has not developed a method to evaluate readiness recovery efforts. Without metrics and a method for evaluating the effectiveness of overall readiness recovery efforts through objective measurement and systematic analysis, DOD may not be able to ensure that the department is achieving its intended goals. Conclusions With decreased commitments to Afghanistan and Iraq, DOD has seen improvements in the readiness of certain key force elements in recent years, such as Army Brigade Combat Teams and Marine Corps Infantry Battalions. DOD still faces low overall readiness rates, however, which the services expect to persist into the next decade. The department recognizes the importance of recovering the readiness of the force and has been taking steps, such as the establishment of service readiness recovery plans and changes to its force management process, but there are other areas where the department could refine its approach that might bring meaningful improvements to the readiness recovery effort. With the challenges posed by ongoing demand for forces around the world and the consequent high pace of operations for portions of the force, decreased time for maintenance and training, and budget uncertainty, it is important that DOD incorporate sound planning into its readiness recovery efforts. The effort for recovering readiness supports the department’s mission of providing military forces needed to deter war and to protect the security of the United States. However, we found some fundamental challenges with the overall readiness recovery effort. Specifically, the services’ readiness recovery plans do not include comprehensive goals and strategies for achieving the goals, metrics on which to measure progress against identified goals, and a full consideration of external factors including how they will influence the underlying assumptions of readiness recovery. In addition, DOD has not validated the service-established readiness rebuilding goals, nor does it have metrics on which it can evaluate readiness recovery efforts to determine the extent to which they reflect the department’s priorities and are achieving intended goals. Without metrics against which to measure the services’ progress toward agreed-upon, achievable readiness recovery goals, DOD will be unable to determine the effectiveness of readiness recovery efforts or assess its ability to meet the demands of the National Military Strategy, which may be at risk. Recommendations for Executive Action To ensure that the department can implement readiness rebuilding efforts, we recommend that the Secretary of Defense direct the Secretaries of the Departments of the Army, the Navy, and the Air Force to take the following three actions: Establish comprehensive readiness rebuilding goals to guide readiness rebuilding efforts and a strategy for implementing identified goals, to include resources needed to implement the strategy. Develop metrics for measuring interim progress at specific milestones against identified goals for all services. Identify external factors that may impact readiness recovery plans, including how they influence the underlying assumptions, to ensure that readiness rebuilding goals are achievable within established time frames. This should include, but not be limited to, an evaluation of the impact of assumptions about budget, maintenance time frames, and training that underpin the services’ readiness recovery plans. To ensure that the department has adequate oversight of service readiness rebuilding efforts and that these efforts reflect the department’s priorities, we recommend that the Secretary of Defense take the following two actions: Validate the service-established readiness rebuilding goals, strategies for achieving the goals, and metrics for measuring progress, and revise as appropriate. Develop a method to evaluate the department’s readiness recovery efforts against the agreed-upon goals through objective measurement and systematic analysis. Agency Comments and Our Evaluation In commenting on the classified version of this report, DOD partially concurred with three recommendations and concurred with two recommendations. The June 2016 classified report and this unclassified version have the same recommendations. DOD’s comments are reprinted in their entirety in appendix II. DOD also provided technical comments, which we incorporated into the report as appropriate. DOD partially concurred with our three recommendations that the secretaries of the Military Departments (1) establish comprehensive readiness rebuilding goals and a strategy for implementing identified goals, (2) develop metrics for measuring interim progress at specific milestones against identified goals, and (3) identify external factors that may impact readiness recovery plans. DOD noted that the department was currently working to define for the services the “ready for what,” which will provide the target for their readiness recovery goals. DOD further noted that the department would continue to work with the military services to refine their goals and the requisite resources, as well as the metrics and milestones required to implement and track their recovery strategies. The department raised concerns with our addressing the recommendation to both the Secretary of the Navy and the Commandant of the Marine Corps in our draft, stating that the Marine Corps is part of the Department of the Navy. We have revised the recommendation to reflect this comment. DOD concurred with our two recommendations that the Secretary of Defense (1) validate service-established readiness rebuilding goals, strategies for achieving the goals, and metrics for measuring progress, revising as appropriate and (2) develop a method to evaluate the department’s readiness recovery efforts against the agreed-upon goals through objective measurement and systematic analysis. The department stated that it would continue to work with the military services to validate and evaluate their readiness recovery goals and the metrics for measuring their progress. We are sending copies of this report to appropriate congressional committees; the Secretary of Defense; the Chairman of the Joint Chiefs of Staff; and the Secretaries of the Air Force, Army, and Navy. In addition, the report will be available at no charge on the GAO website at http://www.gao.gov. If you or your staff have any questions about this report, please contact me at (202) 512-3489 or pendletonj@gao.gov. Contact points for our Offices of Congressional Relations and Public Affairs may be found on the last page of this report. GAO staff who made major contributions to this report are listed in appendix III. Appendix I: Scope and Methodology This report is a public version of our June 2016 classified report. DOD deemed some of the information in that report as SECRET, which must be protected from public disclosure. Therefore, this report omits SECRET information and data such as readiness trend data, deployment data, and select details of the services’ readiness recovery plans. Although the information provided in this report is limited in scope, it addresses the same objectives as the classified report (with the exception of removing the discussion of readiness level from the first objective) and includes the same recommendations. Also, the overall methodology used for both reports is the same. To describe the factors that affect reported readiness levels and to identify the steps the department is taking to manage the impact of continued deployments on readiness, we reviewed and analyzed readiness data and information from the Office of the Secretary of Defense, the Joint Staff, the combatant commands, and each of the military services. Our analysis covered data from fiscal year 2008 through fiscal year 2015 to maximize the amount of available and reliable data for us to determine meaningful trends. We also analyzed data from the Joint Staff on the global demand for forces to document trends in demand from fiscal year 2012 through fiscal year 2016. We identified the trend in overall demand as identified by the combatant commands and identified the trend in the portion of this overall demand that DOD provided forces to support. We evaluated the department’s overall strategic-level readiness assessment (RA) and the RA of each of the military services to document trends in reported readiness. To determine historical and current readiness levels and key factors that contributed to those levels, we analyzed Quarterly Readiness Reports to Congress, Joint Forces Readiness Review documents, and the services’ readiness assessments. We also conducted interviews with Office of the Secretary of Defense, Joint Staff, and combatant command officials to discuss global demand trends, and obtained documentation, such as departmental guidance and related briefings, and reviewed these documents to understand DOD’s efforts to reform the departmental process used to source global demands. We interviewed Joint Staff officials to discuss these reform efforts and the subsequent impact the efforts had on overall readiness recovery. In addition, we assessed the reliability of the readiness data and global demand data through standardized questionnaires, reviews of documentation, and discussions with officials about data-collection processes. We concluded that both sets of data were sufficiently reliable for our purposes of reporting current and historical readiness trends and of documenting instances where the Secretary of Defense provided forces in support of requirements in favor of the combatant commands. To assess DOD’s implementation and oversight of department-wide readiness rebuilding efforts, we reviewed DOD’s plans for managing readiness rebuilding efforts as outlined in Readiness Deputy’s Management Action Group meeting documentation and summaries and a variety of readiness reporting documents and briefings submitted by the services, the Joint Staff, and combatant commanders. We reviewed DOD strategic-level documents and guidance, such as the Guidance for the Employment of the Force and the Global Force Management Implementation Guidance, to understand DOD’s investment in readiness recovery. We then analyzed the service plans for rebuilding readiness, including reviewing relevant documents and interviewing officials to identify and understand (1) the underlying assumptions and analysis behind those plans, (2) the long-term goals and time frames for achieving these goals, and (3) the interim goals and means to assess progress. We evaluated the extent to which the service readiness recovery goals face significant challenges within the time frames identified by analyzing service documents, including internal readiness recovery projections, milestones, and risks associated with readiness recovery, and interviewing service officials and operational units. By reviewing the service readiness recovery plans and obtaining service officials’ views on force elements that are key to rebuilding readiness, we selected several key force elements from each service to complete a more detailed, though non-generalizable, case study assessment on plans for rebuilding readiness of specific force elements, including historical reported readiness and demand and sourcing trends; readiness recovery strategies; and specific risks to readiness recovery for these force elements. We analyzed these documents and reviewed DOD’s efforts to oversee department-wide readiness rebuilding to determine if they included the key elements of sound strategic planning that GAO has identified in the course of our prior work. Specifically, we focused on six key elements that should be incorporated into sound strategic planning to facilitate a comprehensive, results-oriented framework. We selected key elements that the department would benefit from considering in its effort to achieve readiness recovery and meet the intent outlined in strategic guidance. Key elements include (1) a mission statement; (2) long-term goals; (3) strategies to achieve goals; (4) external factors that could affect goals; (5) metrics to gauge progress; and (6) evaluations of the plan to monitor goals and objectives. We determined these leading practices and the key elements to be the most relevant to evaluate DOD’s oversight of department-wide readiness rebuilding efforts. We compared DOD’s efforts to rebuild readiness with these key elements of sound planning practices to identify any gaps that may impact DOD’s ability to recover the readiness of the force. We interviewed Office of the Secretary of Defense and Joint Staff officials to discuss DOD’s role in the readiness rebuilding effort, changes being implemented to allow the services to better focus on rebuilding their readiness, and steps being taken to address challenges in achieving readiness recovery. We also interviewed officials at select combatant commands to discuss their coordination with DOD for readiness recovery, as well as any impacts resulting from service readiness recovery efforts. We conducted this performance audit from June 2015 to September 2016 in accordance with generally accepted government auditing standards. Those standards require that we plan and perform the audit to obtain sufficient, appropriate evidence to provide a reasonable basis for our findings and conclusions based on our audit objectives. We believe that the evidence obtained provides a reasonable basis for our findings and conclusions based on our audit objectives. Appendix II: Comments from the Department of Defense Appendix III: GAO Contact and Staff Acknowledgments GAO Contact Staff Acknowledgments In addition to the contact named above, individuals who made key contributions to this report include Patty Lentini and Kristy Williams, Assistant Directors; Paul Seely; Mike Silver; Sabrina Streagle; Nicole Volchko; Erik Wilkins-McKee; and Richard Winsor.

Summary: For over a decade, DOD deployed forces to support operations in Iraq and Afghanistan, and is now supporting increased presence in the Pacific and emerging crises in the Middle East and Eastern Europe. These deployments have significantly stressed the force. The House Report accompanying the National Defense Authorization Act for Fiscal Year 2016 included a provision that GAO review DOD's efforts to rebuild military readiness. This report (1) describes the factors that affect reported readiness levels and DOD's efforts to manage the impact of deployments on readiness, and (2) assesses DOD's implementation and oversight of department-wide readiness rebuilding efforts. This report is a public version of a previously issued classified product and omits information DOD identified as SECRET, which must be protected from public disclosure. GAO analyzed and reviewed data on reported readiness rates and departmental readiness rebuilding efforts. GAO interviewed DOD, Joint Staff, and combatant command officials regarding current demand and readiness rates and challenges with rebuilding military readiness. GAO also conducted separate reviews of the readiness of the military services. The Department of Defense (DOD) recognizes that more than a decade of conflict, budget uncertainty, and force structure reductions have degraded military readiness, and the department has efforts under way to manage the impact of deployments on readiness. The military services have reported persistently low readiness levels, which they have attributed to emerging and continued demands on their forces, reduced force structure, and increased frequency and length of deployments. For example, the Air Force experienced a 58 percent decrease in the number of fighter and bomber squadrons from 1991 to 2015 while maintaining a persistent level of demand from the combatant commands for the use of its forces. In addition, the Navy has experienced an 18 percent decrease in its fleet of ships since 1998 and an increase in demand, resulting in the deployment lengths for many ships increasing from 7 months to a less sustainable 9 months. DOD officials have indicated that overall demand has been decreasing since 2013, but the department has reported that the ability to rebuild capability and capacity is hindered by continued demand for some forces. To mitigate the impact of continued deployments on readiness, the Joint Staff has focused on balancing the distribution of forces for high-priority missions with the need to rebuild the readiness of the force. Efforts include revising major plans to better reflect what the current and planned force is expected to achieve and improving the management of DOD's process for sourcing global demands by, among other things, balancing the supply of forces with the minimum required to meet global demands. However, it is too soon to tell what impact implementation of these initiatives will have on DOD's readiness recovery efforts because the department is still working to complete implementation. DOD has stated that readiness rebuilding is a priority, but implementation and oversight of department-wide readiness rebuilding efforts have not fully included key elements of sound planning, putting the rebuilding efforts at risk. Key elements of sound planning for results-oriented outcomes include a mission statement supported by long-term goals, strategies for achieving the goals, metrics, and an evaluation plan to determine the appropriateness of the goals and effectiveness of implemented strategies. In 2014, DOD tasked the military services to develop plans for rebuilding readiness. Each service developed a plan based on the force elements that were experiencing a high pace of deployments or facing challenges in achieving readiness recovery. In 2015, the services reported their readiness rebuilding plans to DOD, which identified readiness goals and timeframes for achieving them, but these goals were incomplete and some of the timeframes have been extended. GAO found that the services have also not defined comprehensive strategies, with the resources required for achieving the identified goals, nor have they fully assessed the effect of external factors such as maintenance and training on readiness rebuilding goals. Moreover, the services have not fully established metrics that the department can use to oversee readiness rebuilding efforts and evaluate progress towards achieving the identified goals. Without DOD incorporating key elements of sound planning into recovery efforts, and amid competing priorities that the department must balance, successful implementation of readiness recovery plans may be at risk.

gov_report

en

Write a title and summarize: Severe leptospirosis features bleeding and multi-organ failure, leading to shock and death. Currently it is assumed that both exaggerated inflammation and immune suppression contribute to mortality in sepsis. Indeed, several proinflammatory cytokines are reported to be induced during leptospirosis. Toll-like receptors, which play an important role in the initiation of an innate immune response, are inhibited by negative regulators including the membrane-bound ST2 (mST2) receptor. Soluble ST2 (sST2) has been implicated to inhibit signaling through mST2. The aim of this study was to determine the extent of sST2 and (pro-) inflammatory cytokine release in patients with severe leptospirosis. In an observational study, 68 consecutive cases of severe leptospirosis were included. Soluble ST2 and cytokines (TNF-α, IL-1β, IL-6, IL-8, and IL-10) were repeatedly measured. To determine whether blood cells are a source of sST2 during infection, we undertook an in vitro experiment: human whole blood and peripheral blood mononuclear cells (PBMC) were stimulated with viable pathogenic Leptospira. All patients showed elevated sST2, IL-6, IL-8, and IL-10 levels on admission. Admission sST2 levels correlated with IL-6, IL-8, and IL-10. Thirty-four patients (50%) showed clinical bleeding. Soluble ST2 levels were significantly associated with bleeding overall (OR 2. 0; 95%CI: 1. 2–3. 6) and severe bleeding (OR 5. 1; 95%CI: 1. 1–23. 8). This association was unique, since none of the cytokines showed this correlation. Moreover, sST2 was associated with mortality (OR 2. 4; 95%CI: 1. 0–5. 8). When either whole blood or isolated PBMCs were stimulated with Leptospira in vitro, no sST2 production could be detected. Patients with severe leptospirosis demonstrated elevated plasma sST2 levels. Soluble ST2 levels were associated with bleeding and mortality. In vitro experiments showed that (white) blood cells are probably not the source. In this regard, sST2 could be an indicative marker for tissue damage in patients suffering from severe leptospirosis. Leptospirosis is a worldwide occurring zoonosis [1], reported to be fatal in up to 50% of cases [2]. The disease is caused by spirochetes that are spread by the urine of infected animals, for example rats, mice and cattle amongst others. Survival of Leptospira is enhanced in a warm and humid environment, where environmental circumstances are most favourable. Hence prevalence is higher in (sub) tropical countries. Severe leptospirosis is featured by bleeding complications and multi-organ failure, which can eventually lead to shock and even death. Necropsy reports confirm widespread haemorrhaging throughout the body, involving most vital organs and tissues [3]. This haemorrhaging could possibly be the result of capillary wall damage. Several proinflammatory cytokines, such as TNF-α and IL-12p40 are reported to be induced during infection with Leptospira [4], [5]. As well, elevated plasma concentrations of TNF-α have been associated with lethal outcome amongst leptospirosis patients [6], In a hamster model, late expression of the anti-inflammatory cytokines IL-4, TGF-β and IL-10 have been shown [7]. Currently it is assumed that both exaggerated inflammation and immune suppression contribute to an adverse outcome in sepsis [8]. ST2, also designated T1, Fit-1 and DER4, is thought to play a significant role in tuning the host inflammatory response. ST2 is a receptor that is present in two main forms, in the soluble secreted form (sST2) [9] and in a membrane-anchored form (ST2L) [10]. Both are encoded from the ST2 gene regulated by different promoters [11] and are members of the IL-1 receptor family. ST2 gene expression was identified originally in fibroblasts [9], [12]. Expression has also been detected in several other cells, including Th2 cells, mast cells and macrophages [13]–[16]. ST2L has been reported to attenuate downstream IL-1RI and TLR4 signalling by sequestering MyD88 and MAL (MyD88 adaptor-like) [17]. In contrast, previous work has demonstrated that interleukin (IL) -33 is able to activate NF-κB and MAP kinases by signaling through ST2L [18]. IL-33/ST2L signalling in mast cells and Th2 cells results in the production of Th2-associated cytokines, potentially balancing ongoing inflammatory Th1 responses [18]. The functional role of soluble ST2 has not yet been fully elucidated. Elevated concentrations of sST2 have been found in patients with inflammatory disorders associated with abnormal Th2 mediated responses, in for example, autoimmune diseases [19], asthma [20], idiopathic pulmonary fibrosis [21] and in patients with sepsis [22]. Moreover sST2 have also been proposed as a biomarker for heart failure [23] and elevated levels have been seen to be predictive for clinical outcome in acute myocardial infarction [24]. By using a soluble ST2-Immunoglobulin fusion protein, Sweet et al. demonstrated that this molecule was able to bind macrophages through a putative ST2 receptor, the expression of which was enhanced by LPS stimulation [25]. Furthermore this molecule was shown to suppress LPS-induced proinflammatory response (TNF-α, IL-6 and IL-12) in vitro and reduced inflammation and mortality in LPS challenged mice [25]. Administration of soluble ST2-Immunoglobulin fusion protein markedly reduced proinflammatory cytokine production and lethality in intestinal ischemia/reperfusion injury in mice [26]. The anti-inflammatory effect exerted by sST2-Fc was dependent on the elevated production of IL-10. Similar results were seen in hepatic ischemia/reperfusion injury [27]. sST2-Fc fusion protein administration also shown to have beneficial effects in a murine model of collagen-induced arthritis [28]. Asthmatic mice administered with sST2-Fc fusion protein or a soluble ST2 expressing vector showed attenuated production of the Th2 cytokines IL-4 and IL-5 [29], [30], whereas ST2L signaling resulted in the opposite. sST2 has therefore been proposed to act as a decoy receptor for IL-33 [31], [32]. To the best of our knowledge, in previous literature plasma levels of sST2 have not been documented in leptospirosis patients. Hence, in the present study we evaluate sST2, cytokine kinetics and their association with clinical events in a series of severe leptospirosis patients. The study protocol was approved by the medical ethic committees of both the Dr. Kariadi hospital- University of Diponegoro, Semarang, Indonesia and the Slotervaart Hospital in The Netherlands. Written informed consent was obtained from all included subjects. Consecutive cases of severe leptospirosis were included from February 2005 to September 2006 at the Dr. Kariadi hospital- University of Diponegoro, Semarang, Indonesia. Severe leptospirosis was defined as a hospitalized patient with high clinical suspicion of severe leptospirosis a positive LeptoTek Dri-Dot assay (Biomérieux), presenting with at least one of the following symptoms or signs jaundice, renal failure, thrombocytopenia and/or haemorrhaging.. Cases were confirmed by further laboratory testing. Blood samples were taken on hospital admission and during follow up. Plasma was worked up immediately and aliquots were stored at −70°C for further analyses. Twenty control (non-leptospirosis patients) samples were collected among healthy volunteers at the department of internal medicine of the Dr. Kariadi hospital- University of Diponegoro, Semarang, Indonesia. Soluble ST2 was measured by the commercially available ELISA (R&D systems, Minneapolis, MN). Tumor necrosis factor (TNF) -α, IL-1ß, IL-6, IL-8, IL-10, and IL-12p70 were determined using a cytometric beads array multiplex assay (BD Biosciences, San Jose, CA). The detection limits were as follows, TNF-α, IL-10 (2. 5 pg/ml); IL-1ß, IL-6, IL-8 (5 pg/ml); IL-12p70 (10 pg/ml); sST2 (15 pg/ml). Leptospirosis was confirmed by either a positive culture or microscopic agglutination test (MAT). Tests were considered positive for the MAT with a titre of ≥1∶320 on a single sample, seroconversion or a fourfold or higher increase of the titre in paired samples or a titre ≥1∶80 in a single sample from early deceased patients. To determine whether blood cells are an important source of sST2 during infection, we undertook an in vitro experiment. We used either human whole blood or peripheral blood mononuclear cells (PBMCs), which were then stimulated with Leptospira interrogans serovar Bataviae strain M, as this serovar is commonly found in the region. This was a fresh, low passage isolate obtained from the Leptospirosis Reference Center in Amsterdam, The Netherlands. For the in vitro experiments, bacteria were washed 3 times with RPMI 1640 (Gibco) and counted using a Helber Counting Chamber (Hawksley, Lancing, Sussex, UK) under darkfield microscopy and then resuspended at concentrations of 2. 5×107 till 2. 5×105 bacteria per ml. Shortly before starting the experiment, heparinized blood was sterilely drawn from multiple healthy donors and diluted 1∶1 in RPMI. PBMC were obtained using Lymphoprep™ (Axis-Shield) according to the manufacturer' s guidelines. Whole blood (50 µl per well) or PBMC were divided over each well of a 96-well plate before Leptospira concentrates were added. The concentration PBMC was equivalent to 50 µl whole blood per well (approximately 0. 5×109 monocytes). Plates were incubated for six hours at 37°C, 5% CO2. Following incubation the plates were centrifuged and supernatant was collected and stored at −70°C for further testing. All experiments were performed in quadruplicate. For the negative controls RPMI without bacteria was used. Continuous variables were presented as medians with corresponding interquartile ranges (IQR) and were statistically evaluated using the non-parametric Mann-Whitney U test. Correlation between soluble ST2, clinical characteristics and cytokine levels in patients were determined using the Spearman correlation coefficient (rho). Associations were calculated using a binary logistic regression analysis and were expressed as odds ratios (OR) and corresponding 95% confidence intervals (CI). An OR >1 indicates that the risk of a clinical event is higher with the increase of biomarker plasma levels and an OR of <1 indicates that the risk of a clinical event is lower with the increase of plasma levels. Associations were further analyzed using the receiver-operating-characteristic (ROC) approach by calculating the area under the ROC curve (AUC). The AUC reflects the probability that a patient with higher plasma levels has a higher chance of the event than a patient with lower plasma levels. Log transformation of the original variables was used to improve the goodness of fit of the model. A p-value of <0. 05 was considered to indicate statistical significance. All analyses were done using SPSS (version 15. 0, Chicago, Illinois). In total 68 leptospirosis patients were included, of which 49 (72%) were male. The median age (IQR) was 45 (34–55) years old. In total 16 patients (24%) did not survive, with a median (IQR) time to death of 3 days post hospital admission. On average patient' s symptoms had started at a median of 7 days pre hospital admission. Clinical manifestations/symptoms included jaundice (75%), thrombocytopenia (platelets <100×109: 65%), oliguria (19%) and anuria (4%). Median leucocyte, platelet, creatinine and bilirubin levels were: 15×109/L, 69×109/L, 412 µmol/L and 113 µmol/L respectively. All patients had MAT serologically confirmed leptospirosis, with the most frequently identified serogroups being Bataviae (19), Icterohaemorrhagiae (18) and Ballum (2). All patients showed elevated sST2, IL-6, IL-8 and IL-10 levels on admission, presented in Table 1. TNF-α, IL-1β and IL-12p70 levels taken at hospital admission were either very low or undetectable and were not significantly different from the healthy controls (data not shown). Patients that died from leptospirosis (n = 16) had significantly further elevated plasma levels on admission compared to the survivors, sST2 (p =. 006), IL-6 (p =. 003) and IL-8 (p =. 003). However, IL-10 (p =. 64) was not found to be significantly elevated. Figure 1 shows the dynamics of sST2, IL-6, IL-8 and IL-10. Circulating sST2 levels in the survivors showed a peak at day 0 after which levels gradually decreased and normalized on day 7. However, patients who died during their hospital stay displayed continuously high plasma levels of sST2 until death occurred. Table 2 shows that admission sST2 levels were significantly correlated with levels of IL-6 (rho 0. 45; p =. 001), IL-8 (rho 0. 72; p<. 0001), IL-10 (rho 0. 56; p<. 0001) and CRP (rho 0. 50; p<. 0001) also taken at admission. Admission sST2 levels resulted in moderate correlations with respiratory rate (rho −0. 25; p =. 04), platelets (rho −0. 25; p =. 04) creatinin (rho 0. 33; p =. 007), AST (rho 0. 46; p =. 001) levels and (severe) haemorrhaging (haemorrhaging: rho 0. 34; p =. 005, severe haemorrhaging: rho 0. 32; p =. 008). Since bleeding is an important feature of severe leptospirosis we were interested whether this event was also associated with sST2 levels. In total 34 patients (50%) showed signs of bleeding. We found mild haemorrhages (petechiae, ecchymoses and epistaxis) in 23 cases and severe haemorrhages (gastrointestinal, melaena, gum bleeding, hemoptysis and heamaturia) in 10 cases. To determine whether elevated sST2 levels were associated with bleeding, we performed a binary logistic regression analysis and calculated the area under the ROC curve (AUC), see Table 3. Elevated sST2 levels were significantly associated with overall haemorrhaging (mild and severe) (OR 2. 0; 95%CI: 1. 2–3. 6, p =. 01; AUC: 0. 70, p =. 006) and severe haemorrhaging (OR 5. 1; 95%CI: 1. 1–23. 8, p =. 04; AUC: 0. 76, p =. 009), but not with mild bleeding alone (OR 1. 3; 95%CI: 0. 76–2. 2, p =. 3; AUC: 0. 6, p =. 5). As we log-transformed the original variables, this means that for a ten-fold increase of plasma sST2 levels, the odds of developing mild or severe bleeding will be 2. 0 times higher, and the odds of developing severe bleeding 5. 1 times higher. None of the cytokines were significantly associated with (severe) haemorrhaging (see Table 3). The association between plasma levels sST2, cytokines and mortality was calculated using a binary logistic regression (OR, 95% CI) and a ROC approach (AUC). The odds of patients with leptospirosis dying increased by 2. 4 (95%CI: 1. 0–5. 8, p =. 05) with a ten-fold increase of plasma sST2 levels with an AUC of 0. 73 (p =. 006). As well the odds of patients with leptospirosis dying increased by 3. 2 (95%CI: 1. 4–7. 7, p =. 008) with an AUC of 0. 74 (p =. 003), with a ten-fold increase of plasma IL-6 levels. With a ten-fold increase of plasma IL-8 there was an odds of 6. 9 (95%CI: 1. 8–27, p =. 005) and an AUC of 0. 75 (p =. 003). The anti-inflammatory cytokine IL-10 failed to reach significance (OR 1. 3; 95%CI: 0. 5–3. 9, p =. 58; AUC: 0. 58, p =. 40), see Table 3. To evaluate whether blood cells are an important source of sST2 during infection, we undertook an in vitro experiment. We used a fresh viable pathogenic isolate of Leptospira interrogans serovar Bataviae strain M. When either human whole blood or isolated PBMCs were stimulated with different concentrations bacteria, we could not detect sST2 production after 6 hours incubation (Figure 2). The same held true for the negative controls. In contrast, high levels TNF-α were measured as dose dependent upon stimulation with viable Leptospira. This study reports elevated sST2 levels in patients with severe leptospirosis. Soluble ST2 levels correlated with other indicators of inflammation. A unique, significant association between sST2 and bleeding was observed. As well soluble ST2, IL-6 and IL-8 levels were all associated with poor outcome in leptospirosis patients. Previous work has reported elevated sST2 plasma levels in fifteen septic patients, but in this study no association with mortality was found [22]. Becerra et al. reported elevated sST2 levels in patients suffering from dengue fever, but in the convalescent samples sST2 levels were normalized [33]. Since all patients in this study survived and had only mild disease, no associations with regard to disease severity and outcome could be found. The data presented here extends these earlier studies, with findings of elevated sST2 levels during infection in a larger, homogeneous group of patients. Leptospirosis patients yielded elevated levels of IL-6 and IL-8 associated with mortality in the present study which were stronger than sST2. From the literature, several studies have found similar results presenting data on the association between cytokine levels and poor outcome in septic patients [34], [35]. However, in these studies the range of cytokine levels from survivors and non-survivors often overlapped, which means that although the cytokines are associated with poor outcomes, they are of little or no prognostic value [36]. In a study by Chierakul et al. elevated TNF-α and IL-12p40 levels were reported in 28 patients with mild leptospirosis [4]. The biologically active IL-12p70 heterodimer was detected in only 4 patients. An other study reported increased TNF-α levels in four out of eighteen leptospirosis patients [6]. In this small study, TNF-α was found to be associated with disease severity and poor outcome. In contrast, in the current work TNF-α, IL-1β and IL-12p70 concentrations were either very low or undetectable and did not differ from the controls. The fact that we could not confirm the association between poor outcome and TNF-α can be explained by the fact that our patients presented in late stage disease and TNF-α is considered to be an early response cytokine. It is interesting to speculate why (severe) bleeding was found to be associated with sST2 plasma levels. Weinberg et al. identified sST2 release in response to myocardial infarction and suggested that sST2 participates in the cardiovascular response to injury of the cardiomyocytes [37]. Disruption of the endothelial cell barrier, a possible explanation for the haemorrhages found in severe leptospirosis, exposes underlying fibroblasts. In this light, sST2 could be an indicative marker for tissue injury given the fact that serum stimulation of resting fibroblasts results in sST2 release [9]. Our in vitro experiments with pathogenic Leptospira showed that, at least in the early phase, blood is not the source of sST2 production. These findings were in line with previous findings of our group in which we found that membrane bound ST2 is upregulated on monocytes when whole blood is incubated with LPS, while sST2 remains undetectable in blood plasma after 24 hour whole blood LPS stimulation [38]. In conclusion, in patients with severe leptospirosis we demonstrated elevated plasma sST2 levels that normalized during follow-up and were associated with mortality. Interestingly sST2 was the only marker that was associated with (severe) bleeding. More research is warranted to elucidate the function of sST2 in the innate immune response to Leptospira and to evaluate its value as a marker for tissue damage in severely ill patients.

Title: Soluble ST2 Levels Are Associated with Bleeding in Patients with Severe Leptospirosis Summary: Leptospirosis is a bacterial disease that is mainly spread by rodents and other small mammals. Transmission frequently occurs in (sub-) tropical countries, where environmental circumstances are most favourable. Severe leptospirosis can cause bleeding and vital organ dysfunction. An exaggerated immune response is thought to play an important role in the pathophysiology of leptospirosis. Soluble ST2 (sST2) is thought to inhibit negative regulatory pathways of this response. Soluble ST2 is produced by cells that surround, for example, blood vessels, and several of these blood cells play an important part in the host immune response. In an observational study, we measured the extent of sST2 release in patients suffering from severe leptospirosis. We found that patients that died from leptospirosis displayed higher levels of sST2. Moreover, from this study we have seen that sST2 levels were associated with bleeding, whereas other markers of infection were not. In an experiment, we showed that (white) blood cells did not seem to be the source of sST2 production. Damage to blood vessels is likely to cause bleeding in leptospirosis patients, exposing sST2 producing cells like fibroblasts to the blood stream. Hence, we believe that sST2 may be used as a marker for tissue damage in patients suffering from severe leptospirosis.

lay_plos

en

Summarize: BACKGROUND OF THE INVENTION 1. Field of the Invention This invention relates to a barbecue or like cooking assembly made of heavy duty construction, but being specifically capable of being assembled or disassembled at a given outdoor location so as to facilitate initial installation and or transport the barbecue assembly between desired sites. 2. Description of the Prior Art Outdoor cooking, more commonly known as barbecuing or the like, has enjoyed increased popularity in recent years. Typically, the facilities used to accomplish such outdoor cooking are known as barbecue assemblies and can range in structure from portable, substantially lightweight units to more permanent heavy duty installations located in a fixed position outdoors. The portable or somewhat lightweight assemblies are commonly known as kettle type cookers and are formed from a metallic or heat resistant material and frequently are mounted on wheels or a movable support frame so as to allow easy positioning of the entire assembly into and out of an operative location, normally outdoors. While such portable or lightweight units are increasing in popularity due to their ease of positioning, etc., such units do not add to the overall attractiveness or aesthetic appearance of a given outdoor location, such as a patio, yard, pool deck, etc. One problem associated with the more permanent barbecue assemblies is their structural installation, which previous to the present invention, necessitated them being positioned at a permanent site rather than being capable of being removed, such as when the owners of a given home or like area move to a different locale. The referred to permanent structural installations are formed from a masonry, concrete, cementious material or the like and are permanently affixed to the ground or like supporting surface such that such facilities cannot be removed without being destroyed. The other advantages associated with the permanent facilities is generally a much larger capacity and, as set forth above, the overall improvement in the aesthetic appearance since the design of such permanent structures can be specifically adapted to cooperate with the surrounding environment or structure of a person&#39;s home, pool deck, etc. There is an obvious need, therefore, for a barbecue or like cooking assembly which has what may be referred to as a heavy duty construction, formed of a masonry, concrete or cementious material like substance yet which is defined by a plurality of components removably interconnected to one another so as to facilitate easy installation as well as a knock down or disassembly of the subject structure thereby enabling the structure to be moved from one site to another, such as when a user sells his home and moves to a different locale. Such a preferred barbecue assembly further has the advantage of essentially prefabricating the components at a given site and thereby enabling more of a mass production type of manufacturing technique in order that a plurality of such barbecue assemblies can be &#34;pre-made&#34; and brought to a given, on-site location for assembly as desired by the user. The overall cost of production and assembly as well as the time and skill involved in the constructing of such a preferred barbecue assembly is greatly enhanced. SUMMARY OF THE INVENTION This invention relates to a barbecue or like outdoor cooking assembly specifically comprising a plurality of removably attached and cooperating components which enable the subject barbecue assembly to be readily assembled and disassembled at a given preferred site. In addition, each of the aforementioned components may be pre-fabricated at a plant or other central location and collectively transported to a site of installation and assembly. By virtue of this type of construction, both the production costs and costs of installation may be greatly reduced. In addition, greater versatility is provided with the subject barbecue assembly over other barbecue assemblies which are, in effect, permanently installed or built at a given site of use. For example, when a user is moving or relocating to a different place of residence, the barbecue assembly may be disassembled and stored with relative ease and without the requirement of skilled labor or tooling. The disassembled components may therefore be transported to the new site of use and reassembled, again without the need for special tooling or skilled labor. As pointed out in greater detail hereinafter, the material from which the various components of the barbecue assembly are formed are preferably a stone like masonry, cementious material, or concrete type substance which is relatively heavy to insure its stability and also present the appearance of a permanent installation. More specifically, the plurality of cooperative components include a base initially mounted on the ground or other supporting surface at the site of the assembly and location of the formed barbecue assembly. Two spaced apart elongated support members each defining a side of the assembly have their lower end mounted on the base and extend upwardly therefrom in spaced apart substantially parallel relation to one another. A brace means serves to interconnect and maintain the two side support panels in the upright, spaced relation to one another. A platform is next removably positioned on the interior of the panels between such panels such that an opposite end of the platform is supported on a mounting flange integrally formed to the inner surface thereof and projecting outwardly therefrom. This platform is used to support the fuel for the fire as well as the fire itself or other comparable heat generating means and further defines the floor of what may be referred to as an at least partially enclosed interior of the barbecue assembly. A back panel is next removably connected adjacent the lower ends of the support panels and between such support panels in somewhat covering relation to a lower portion of a back opening initially extending between the support panels. Similarly and cooperatively, a rear panel is connected substantially between an upper end of the support panels and also in substantially covering relation to the back opening. The rear panel, just described, and the back panel, previously described, are cooperatively disposed so as to be substantially coplaner and collectively cover the back opening. Therefore, the at least partially enclosed interior of the assembly in which the fire, fuel or like heat source is located is at least partially defined by inner surfaces of upper portions of the support panels, the rear panel and a canopy structure which is removably mounted on top of the side support panels. The canopy is preferably structured in the form of a chimney assembly having an entrance opening and an exit opening. The entrance opening is somewhat larger and is disposed in overlying relation to the interior of the barbecue assembly so as to receive fumes and exhaust therefrom when the heat source is ignited. The exit opening is located at an upper or top end of the chimney structure and communicates with atmosphere for the venting of exhaust and fumes thereto. A lining means in the form of sheets, panels or the like of heat resistant material may be removably disposed in overlying relation to inner surfaces defining the boundaries of the at least partially enclosed interior of the barbecue assembly. Alternately, such heat resistant material may be affixed to and be a permanent part of the platform as well as the rear panel positioned as described above to also define the boundaries of the interior of the barbecue assembly. An important feature of the present invention is the existence of an adjustable and removably mounted grill means which is used to support the food to be cooked and also allow, adjustable positioning of the grill portion defined by one or more grill segments in a preferred position relative to the heat source as well as the floor on which the heat source, coals or like heat generating composition is disposed. Such a grill means includes a stanchion means for upright and operative support of the remainder of the grill assembly. A positioning means in the form of a crank arm extends transversely across the interior and includes depending support chains hanging therefrom and capable of being wrapped around the crank arm when such crank arm is rotated. The opposite ends of each of the support chains, cables or the like, are connected to the grill portion. Rotation of the crank arm in one of two opposite directions serves to either raise or lower the grill portion by wrapping or unwrapping the support chains about the crank arm as will become obvious. The grill portion or grill segments are mounted on a grill support frame and the frame itself is connected to the stanchion means in a manner so as to maintain declining, angular orientation of the grill portion regardless of its position relative to the fire. This angular orientation facilitates draining of any excess oil, grease, or the like into a grease catch defined by an elongated trough cooperatively structured to move with the grill portion. Accordingly, an important feature of the present invention is that all of the aforementioned components are easily disconnected from one another and may be made and/or constructed separately in a pre-fabricated style and packaged and transported to the site of installation or use as preferred by the user. Further, these components can be readily disassembled without the necessity of using any specialized tooling or skilled labor when the user desires to dismantle the subject barbecue assembly for transport to another site of use. BRIEF DESCRIPTION OF THE DRAWINGS For a fuller understanding of the nature of the present invention, reference should be had to the following detailed description taken in connection with the accompanying drawings in which: FIG. 1 is an exploded view of cooperative, removably components of the subject barbecue assembly. FIG. 2 is a perspective view in exploded form of additional components of the embodiment of FIG. 1. FIG. 3 is a perspective view in exploded form of yet additional components of the embodiments of FIGS. 1 and 2. FIG. 4 is a perspective view in exploded form of a grill assembly associated with the barbecue assembly of the present invention and an accompanying canopy structure. FIG. 5 is a front view of the subject invention in assembled form. FIG. 6 is a transverse sectional view along line 6--6 of the FIG. 5. FIG. 7 is a rear view along line 7--7 of FIG. 8. FIG. 8 is an end view along line 8--8 of FIG. 5. Like reference numerals refer to like parts throughout the several views of the drawings. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT As shown in the accompanying figures, the barbecue assembly is generally indicated as 10 and is shown in completely assembled form in FIGS. 5 through 8. However, one important feature of the present invention is the removable interconnection of the plurality of components defining the subject assembly in a manner that allows the assembly or disassembly of the various components so as to facilitate production, installation and dismantling when such is desired. With regard to FIGS. 1 through 4, the barbecue assembly 10 comprises a base as at 12 designed to be positioned on the ground or like supporting surface at the site of assembly where use of the subject barbecue assembly 10 is to take place. Two support structures more specifically defined by support panels 16 are mounted such that their lowermost ends 18 are positioned, as shown in FIG. 1, on an upper exposed surface of the base 12. Support panels have somewhat of an elongated configuration and, as shown, are disposed to define opposite sides of the assembly and are maintained in an upright, spaced apart substantially parallel relation to one another. Such preferred operative position of the support panels 16 occurs through provision of a brace means generally indicated as 20 in its disassembled form. More specifically, the brace means comprises a plurality of elongated iron or similar high strength metallic or like material as at 22, 24 and 26. Each of these brace members 22 through 26 have their opposite ends connected to connecting flanges or members as at 28 such that the brace members extend between and serve to interconnect the support panel 16 in their preferred, operative position as clearly shown. Removable interconnection of the opposite ends occurs by conventional nut and bolt type of connectors as at 30 or other equivalent type of connectors which facilitate both the attachment and detachment of the brace members 22, 24 and 26 in their intended, interconnecting position without the use of specialized tooling. Next, by means of assembly, a back panel as at 33 is disposed to overly or substantially cover a back opening generally indicated as 32 in FIG. 1 substantially adjacent a lower end or half of the spaced apart support panels 16 in the manner best shown in FIGS. 1, 5 and 7. This back panel is disposed interiorly of the brace member 24 and in somewhat sandwiched relation between a pair of interior mounting flanges as at 34 and 35. Such mounting flanges 34 and 35 (35 not shown for purposes of clarity) are more specifically defined by a mounting flange segment 34 and 35 which is an integral part of a horizontal segment as at 37 which are integrally connected to and extend outwardly from an inner surface of each of the support panels 16. The platform 40 therefore is removably mounted on the mounting flange segments 37 and 38 in a horizontal orientation so as to support coals, fuel or any heat generating composition thereon so as to substantially heat the enclosed interior as defined above. A rear panel generally indicated as 46 (see FIGS. 2 and 3) is the upper back opening as at 32&#39; (see FIG. 2) and is disposed on the interior of the brace member 26 in interconnecting relation to the interior upper ends of the support panels 16 as clearly shown in FIG. 3. With reference to FIG. 7, it is seen that the back panel 33 and the lower panel 46 thereby completely cover the back opening 32 and are separated by the horizontal orientation and positioning of the platform or fire floor 40. Additional features of the present invention include a lining means. This lining means is to protect the various components from heat which is generated, possibly for prolonged periods on the interior defined by the panels 16, platform 40 and rear panel 46. Such lining means may include heat resistant material permanently affixed to and movable with the floor 40 and the rear panel 46 and defining at least a portion of the exposed surface thereof. Such heat resistant material is indicated respectively as 48 and 49 on the platform 40 and the rear panel 46. In addition, the lining means includes two lining panels 50 and 52 which are insertable in overlying, covering relation to interior surface portions 16&#39; of the oppositely disposed, spaced apart support panel 16 as best shown in FIGS. 2 and 3. Exposed surfaces of these lining panels 50 and 52 have the heat resistant material as at 50&#39; fixedly and/or permanently secured thereto as shown. Therefore, the exposed surface of the interior of the assembly, most subject to the excessive heat generated by a combustible fuel source would be protected by the heat resistant material as at 48, 49 and 50&#39;. Another removable component is best shown in FIGS. 4 through 8 and includes a canopy 54 designed to be mounted generally on top of and in removable supported engagement with the uppermost ends of the support panels 16 as well as the rear panel 46. The canopy 54 is preferably in the form of a chimney structure having a somewhat hollow interior 60. The hollow interior 60 communicates with an entrance opening 56 disposed in direct overlying relation to the at least partially enclosed interior and an exit opening 58 (see FIG. 6) wherein the fumes or exhaust passing into the interior of the chimney 60 travels along the path of fluid flow defined thereby and exits into the atmosphere through the exit opening 58. Further, a cover as at 62 is provided in somewhat overlying but spaced relation to the exit opening 58 so as to restrict the entrance of rain water or other elements passing into the interior of the chimney 60 and entering into the substantially enclosed interior of the barbecue assembly adjacent to the heat source disposed on the floor or platform 40. As set forth above, the canopy 54 as well as the cover 62 are removable from their remaining components of the subject barbecue assembly and are of course detachable from one another. Yet another important feature of the present invention is best pictured in FIG. 4 with additional reference to FIGS. 2 and 3. This additional plurality of components comprises a grill means generally indicated as 70. The grill means includes a support frame 72 and a grill portion defined by at least one but preferably plurality of grill structures 74 and 76. Grill structure or structures 74, 76 rest on and are supported by the support frame 72. The grill means further includes a stanchion means generally indicated in FIG. 3 as 78 and represented in phantom lines in FIG. 4. Stanchion means includes two spaced apart elongated support elements or stanchion members 80 disposed within the enclosed interior by having their lowermost ends as at 80&#39; pass into receiving slots 81 formed in the floor or platform 40. Supplementary brace bar as at 82 may have its opposite ends fixedly and/or removably connected to the stanchion members 80 so as to maintain them in their spaced apart upright orientation as they extend upwardly from the floor or platform 40 towards the upper or open top of the support panel 16 and rear panel 46. The stanchion members 80 serve to rotatably support and have connected thereto a positioning means in the form of a crank arm or shaft 84 which is manually rotatable by a crank handle 86 and is rotatably affixed to the uppermost ends 80&#34; of the stanchion members 80. Receiving slots or openings 87 are formed in aligned relation on both the side panels 16 and the lining panels 50 and are indicated as 87 in both. Receiving slots engage the crank arm or shaft and allow rotation thereof relative to the support panels and/or lining panels as clearly apparent. Two depending support chains 90 have one end affixed to the crank arm 84 and may be rotated thereon or removed therefrom depending upon the direction of rotation of the crank shaft 84. The opposite or lowermost ends of the support chains 90 are connected as shown in FIG. 4 to the support frame 72. It should be apparent that rotation of the crank shaft 84 by manipulation by the crank handle 86 will cause a raising or lowering of the support frame 72 as well as the grill structures or segments 74 and 76 mounted thereon. Guide means as at 94 are further affixed to opposite ends of the support frame 72 and cooperate to slide along the length of the stanchion members 80 so as to maintain a preferred angular, declining orientation of the grill segments 74 and 76 as they extend from the rear panel 46 towards the front opening between the front longitudinal edges of the support panel 16 above the platform or floor 40. Such an angular declining orientation is best shown in FIG. 6. A removable elongated trough as at 96 is removably mounted in the holding members 98 also affixed and movable with the support frame 72 a best shown in FIG. 4. This elongated trough 96 defines a grease catch such that the declining angular orientation of a plurality of channels 75 defining, in part, the grill structure 74 and 76 will facilitate travel and collection of excess grease, oils or like debris passing from the food being cooked once it is placed on the grill segments or structures 74 and 76. While the specific structure of the channels 75 may vary, they are preferably in a somewhat V-shaped construction and, due to their angular orientation, will serve to collect the fat or oil from the food being cooked and allow it to pass, by gravity, off the front-most ends thereof as at 75&#39; and into the grease catch 96 defined by the trough 96. Now that the invention has been described,

Summary: A barbecue or outdoor grill or cooking assembly structured from a plurality of interlocking and cooperative components which are readily assembled and disassembled at a given site so as to allow the subject assembly to be easily installed and removed from a given location. The plurality of components define a substantially enclosed interior in which a grill assembly is adjustably positioned such that the grill portion thereof may be raised or lowered relative to a platform designed to support a fire bed or other heat generating source so as to regulate the heat applied to the food being cooked which is positioned on the adjustable grill portion of the grill assembly.

big_patent

en

Summarize: By. Paul Bentley. and Louise Eccles. and Ray Massey. Gatwick was facing a humiliating investigation last night after ruining Christmas for thousands of families. The airport was thrown into meltdown by a power cut on Christmas Eve, with more than 100 flights either cancelled or hugely delayed. Mutinous passengers told of ‘Third World’ conditions – they were left for up to 12 hours without heating, hot food or drink and had access to just one toilet. Scroll down for video... Mutinous passengers told of 'Third World' conditions at Gatwick airport, which is owned by an American private equity firm. The Civil Aviation Authority was last night considering a full investigation into the mayhem. MPs demanded to know why the country’s second-biggest airport – which is owned by an American private equity firm – had been unable to cope with flooding. They accused bosses at Global Infrastructure Partners of failing to invest at Gatwick while making bumper profits. The Civil Aviation Authority was last night considering a full investigation into the mayhem, which comes just two months after another power cut caused chaos at the West Sussex airport. It said it was already in touch with Gatwick chiefs and would be seeking a detailed report over ‘what could and should have happened’. With a flurry of compensation claims likely, the airport and the airlines were engaged in trying to shift the blame. Passengers were left for up to 12 hours without heating, hot food or drink and just one toilet to access. MPs accused Global Infrastructure Partners of failing to invest at Gatwick while making bumper profits. Pre-tax profits for Gatwick, which Global Infrastructure Partners bought for £1.46billion in October 2009, surged by 18 per cent to £127million in the first half of this year. Passengers at Gatwick were not the only victims of the 90mph Christmas storm:. Pre-tax profits for Gatwick, which Global Infrastructure Partners bought for £1.46billion in October 2009, surged by 18 per cent to £127million in the first half of this year. Global is also pitching for a £13billion investment to build a second runway. MPs demanded to know why the country's second-biggest airport had been unable to cope with flooding. After most passengers had moved on, these two continued to wait for the departure of their flight yesterday. John Mann, Labour chairman of the Treasury select committee, said: ‘It seems that this company has under-invested in contingency planning – despite raking in hundreds of millions of pounds of profits and ruining Christmas for hundreds of people. ‘It seems like they have been caught unprepared – and this is at a time when they are arguing for expansion. ‘What’s the point in expanding if they can’t cope with what they’ve already got? Some of these problems were entirely avoidable.’ Graham Stringer, a Labour member of. the Commons transport select committee, said: ‘What this shows is that. we need a lot more resilience in the system. We also need the company. behind Gatwick to put some of the profits back into making sure that. they can cope with unexpected weather events like this.’ The. Civil Aviation Authority, which regulates airports, said Gatwick could. now face an investigation and a fine if it is deemed to have failed. passengers. A woman waits at the airport with her baby (left) and police try to calm agitated passengers down (right) This was the scene at Gatwick Airport Station on Christmas Eve. A spokesman said it was awaiting reports from the airport and airlines involved, adding: ‘We may look at how the airport and airlines, which have a duty to look after passengers, were prepared. We will certainly look at those issues.’ But he stressed that it was the airlines who had a duty to look after their passengers in such a crisis. One senior airline executive, whose flights were badly hit, said: ‘Questions have got to be asked about Gatwick’s resilience to flooding. They knew from early morning there was a problem but kept saying the power would be back on. It wasn’t. ‘It was frustrating for passengers to see airport staff heading off as they were left stranded. They should have ensured they had more people.’ A Gatwick spokesman apologised to passengers, saying anti-flood work was in hand but the weather conditions had been extreme. The Civil Aviation Authority, which regulates airports, said Gatwick could now face an investigation and a fine if it is deemed to have failed passengers. A Gatwick spokesman apologised to passengers, saying anti-flood work was in hand but the weather conditions had been extreme

Summary: Airport was thrown into meltdown by power cut on Christmas Eve. More than 100 flights were either cancelled or hugely delayed. Passengers told of 'Third World' conditions after they were kept for up to 12 hours without heating, hot food or drink and with access to one toilet. 300,000 people were left without power yesterday, with tens of thousands facing more days in the dark;. Five people died in a series of car crashes and drownings;. Dozens of families were evacuated from their flooded homes;. Another storm was predicted on Friday with winds of up to 100mph.

cnn_dailymail

en

Summarize: Copyright 2017 Nexstar Broadcasting, Inc. All rights reserved. This material may not be published, broadcast, rewritten, or redistributed. El Paso, TX (KTSM) - Las Cruces Police have released a photo of two missing NMSU Students who were last seen in El Paso at a concert Friday night and haven't been seen or heard from since Saturday. According to LCPD, they learned that McKinnah Sinclair made a cash withdrawal at a Beverly Hills ATM on Monday. During a search of surveillance footage from the ATM, investigators learned that Sinclair and her roommate, Charlie Daniels, 19, were both seen on camera and do not appear to be traveling with anyone or being held against their will. The girls also appear to be wearing the same clothes in the surveillance footage as they were wearing at the concert in El Paso on Friday night. Daniels and Sinclair both came to El Paso on Friday for the Rare El Paso concert featuring DJ Carnage and El Paso rapper Evander Griim. Sinclair posted photos on her social media showing that the pair had VIP access to the concert. A Snapchat sent from one of the girls' accounts showed that they were allegedly in Juarez early Saturday as well. Family or friends have not heard from them since. Attempts to reach the pair via Facebook or cell phone have been unsuccessful. Police and family members are still concerned about their welfare and are hoping that they will reach out to authorities. A relative of one of the teens is in California and has also been in contact with the Los Angeles Police Department with hopes of narrowing down the search for the missing teens. The women are still considered missing and information on the two will remain in NCIC – the FBI’s National Crime Information Center clearinghouse – until they are contacted by police. Sinclair is 5-feet-2-inches tall and weighs approximately 125 pounds. She has black hair and brown eyes and was last seen wearing a black dress. Daniels is 5-feet-3-inches tall and weighs approximately 150 pounds. She has blonde curly hair and brown eyes. Daniels was last known to be wearing a black skirt and blue denim top. The women were last known to be in a red 2012 Ford Focus possibly driven by Daniels. The Ford Focus has New Mexico license plate 533-TAC. Anyone with information on the whereabouts of McKinnah Sinclair and Charlie Daniels is asked to immediately call their local law enforcement agency. 2 students went to a concert in West Texas, then they vanished Two students from New Mexico State University went to a concert in West Texas. By all accounts, it proved to be a great night. Then, they vanished. McKinnah Sinclair, 18, and her roommate, 19-year-old Charlie Daniels, posted photos from the show in El Paso, Texas, on Feb. 3, 2017. In the pictures and accompanying comments, the pair appear to be having a good time, dancing, posing with each other and several musicians. What happened after that, though, is a mystery. IDENTITY MYSTERY: Found dead in Michigan, the FBI thinks he's from South Texas Police in Las Cruces, N.M,, believe the two went to Juarez, Mexico, after show. Police say the pair may be in California, but aren't saying what led to that idea or why they may have gone west.. Latest Houston News Video (Story continues below...) Investigators think the students may be in danger, given the violence in Mexico in recent years. Family and friends have turned to Facebook to publicize the disappearances. Sinclair, a college cheerleader, is described as 5-feet-2-inches tall and weighing roughly 125 pounds. She has black hair and brown eyes. Sinclair was last seen wearing a black dress. REWARD OFFERED: Family seeks help in finding Texas man missing for three years Daniels is 5-feet-3-inches tall and weighs approximately 150 pounds. She has blonde curly hair and brown eyes. Daniels was last known to be wearing a black skirt and blue denim top. The two rode a red 2012 Ford Focus. Investigators think Daniels may have been driving. The car has New Mexico license plate 533-TAC. Anyone with information about the two women may call 911 or a local law enforcement agency. >>>Scroll through the gallery above to see details about McKinnah Sinclair and Charlie Daniels, as well as other missing persons cases in Texas.

Summary: Two female New Mexico State University students who went missing after attending a hip-hop concert in El Paso, Texas, last week have been spotted on surveillance video on Monday in Beverly Hills, Calif. The Las Cruces Police Department confirmed Wednesday that the women on the ATM surveillance video are McKinnah Sinclair, 18, and Charlie Daniels, 19, who were reported missing Tuesday after failing to return to their university or get in touch with family following Friday's concert. Police now say they're concerned for the teens' welfare, but believe they traveled to California on their own, the Las Cruces Sun-News reports. The teens have not gotten in touch with family or friends, and no one has been able to reach them via cell phone or social media. A family member of one woman is in Los Angeles and working with the LAPD in an attempt to find them. Police initially said they believed the teens, who are roommates, traveled to Juarez, Mexico, after the concert, the Houston Chronicle reports. El Paso Proud notes that the women, who withdrew cash from the ATM at which they were spotted, appear to be wearing the same clothes in Monday's surveillance images as they were wearing at Friday's concert, based on pictures they posted to social media from the concert.

multi_news

en

Summarize: Most Recent Developments President Obama's FY2014 budget request for Energy and Water Development was released in April 2013. The request totaled $34.9 billion. Overview The Energy and Water Development bill includes funding for civil works projects of the U.S. Army Corps of Engineers (Corps), the Department of the Interior's Central Utah Project (CUP) and Bureau of Reclamation (Reclamation), the Department of Energy (DOE), and a number of independent agencies, including the Nuclear Regulatory Commission (NRC) and the Appalachian Regional Commission (ARC). The Budget Control Act and Energy and Water Development Appropriations for FY2013 and FY2014 FY2013 discretionary appropriations were considered in the context of the Budget Control Act of 2011 (BCA, P.L. 112-25 ), which established discretionary spending limits for FY2012-FY2021. The BCA also tasked a Joint Select Committee on Deficit Reduction to develop a federal deficit reduction plan for Congress and the President to enact by January 15, 2012. Because deficit reduction legislation was not enacted by that date, an automatic spending reduction process established by the BCA was triggered; this process consists of a combination of sequestration and lower discretionary spending caps, initially scheduled to begin on January 2, 2013. The "joint committee" sequestration process for FY2013 requires the Office of Management and Budget (OMB) to implement across-the-board spending cuts at the account and program level to achieve equal budget reductions from both defense and nondefense funding at a percentage to be determined, under terms specified in the Balanced Budget and Emergency Deficit Control Act of 1985 (BBEDCA, Title II of P.L. 99-177, 2 U.S.C. 900-922), as amended by the BCA. For further information on the Budget Control Act, see CRS Report R41965, The Budget Control Act of 2011, by [author name scrubbed], [author name scrubbed], and [author name scrubbed]. The American Taxpayer Relief Act (ATRA, P.L. 112-240 ), enacted on January 2, 2013, made a number of significant changes to the procedures in the BCA that will take place during FY2013. First, the date for the joint committee sequester to be implemented was delayed for two months, until March 1, 2013. Second, the dollar amount of the joint committee sequester was reduced by $24 billion. Third, the statutory caps on discretionary spending for FY2013 and FY2014 were lowered. For further information on the changes to BCA procedures made by ATRA, see CRS Report R42949, The American Taxpayer Relief Act of 2012: Modifications to the Budget Enforcement Procedures in the Budget Control Act, by [author name scrubbed] Pursuant to the BCA, as amended by ATRA, President Obama ordered that the joint committee sequester be implemented on March 1, 2013. The accompanying OMB report indicated a dollar amount of budget authority to be canceled to each account containing non-exempt funds. The sequester will ultimately be applied at the program, project, and activity (PPA) level within each account. Because the sequester was implemented at the time that a temporary continuing resolution was in force, the reductions were calculated on an annualized basis and will be apportioned throughout the remainder of the fiscal year. Although full year FY2013 funding has been enacted, the effect of these reductions on the budgetary resources that will ultimately be available to an agency at either the account or PPA level remains unclear until further guidance is provided by OMB as to how these reductions should be applied. Table 1 includes budget totals for energy and water development appropriations enacted for FY2007 to FY2014. Table 2 lists totals for each of the bill's four titles. The following tables present the requested FY2014 funding for the major programs included in the Energy and Water Development appropriations bills. Because of the uncertainty involved in the sequestration of FY2013 funding, the requested amounts are compared to the funding appropriated for FY2012. The present report is a preliminary survey of the proposed FY2014 Energy and Water Development appropriations. A more comprehensive report on the FY2014 appropriation will follow. For a detailed description of these programs, see the CRS Report R42498, Energy and Water Development: FY2013 Appropriations.

Summary: The Energy and Water Development appropriations bill provides funding for civil works projects of the Army Corps of Engineers (Corps), for the Department of the Interior's Bureau of Reclamation (Reclamation) and the Department of Energy (DOE), and for a number of independent agencies. FY2013 Energy and Water Development appropriations were considered in the context of the Budget Control Act of 2011 (BCA, P.L. 112-25), which established discretionary spending limits for FY2012-FY2021. On March 26, 2013, the President signed H.R. 933, the FY2013 Defense and Military Construction, and Veterans Affairs, Full Year Continuing Appropriations Act (P.L. 113-6). The act funds Energy and Water Development accounts at the FY2012 enacted level for the rest of FY2013, with some exceptions. However, under BCA, an automatic spending reduction process, consisting of a combination of sequestration and lower discretionary spending caps, went into effect March 1, 2013. The effect of these reductions on the budgetary resources that will ultimately be available to an agency at the account level remains unclear until further guidance is provided by OMB as to how these reductions should be applied. President Obama's FY2014 budget request for Energy and Water Development was released in April 2013. For FY2014, as in previous years, the level of overall spending will be a major issue. On March 21, 2013, the House passed H.Con.Res. 25, setting FY2014 spending at $2.77 trillion. On March 23, the Senate passed S.Con.Res. 8, with a spending level for FY2014 of $2.96 trillion. Allocations for individual appropriations bills have not yet been set by the Appropriations Committees. In addition to overall funding levels, issues specific to Energy and Water Development programs include the distribution of appropriations for Corps (Title I) and Reclamation (Title II) projects that have historically received congressional appropriations above Administration requests; alternatives to the proposed national nuclear waste repository at Yucca Mountain, NV, which the Administration has abandoned (Title III: Nuclear Waste Disposal); and proposed FY2014 spending levels for Energy Efficiency and Renewable Energy (EERE) programs (Title III) that are more than 50% higher in the Administration's request than the amount appropriated for FY2012. This report is a preliminary summary of funding levels requested by the Administration for FY2014. For detailed discussion of issues involved in individual programs, see CRS Report R42498, Energy and Water Development: FY2013 Appropriations.

gov_report

en

Summarize: ----In the midst was seen A lady of a more majestic mien, By stature and by beauty mark'd their sovereign Queen. * * * * * And as in beauty she surpass'd the choir, So nobler than the rest was her attire; A crown of ruddy gold enclosed her brow, Plain without pomp, and rich without a show; A branch of Agnus Castus in her hand, She bore aloft her symbol of command. The Flower and the Leaf William de Wyvil and Stephen de Martival, the marshals of the field, were the first to offer their congratulations to the victor, praying him, at the same time, to suffer his helmet to be unlaced, or, at least, that he would raise his visor ere they conducted him to receive the prize of the day's tourney from the hands of Prince John. The Disinherited Knight, with all knightly courtesy, declined their request, alleging, that he could not at this time suffer his face to be seen, for reasons which he had assigned to the heralds when he entered the lists. The marshals were perfectly satisfied by this reply; for amidst the frequent and capricious vows by which knights were accustomed to bind themselves in the days of chivalry, there were none more common than those by which they engaged to remain incognito for a certain space, or until some particular adventure was achieved. The marshals, therefore, pressed no farther into the mystery of the Disinherited Knight, but, announcing to Prince John the conqueror's desire to remain unknown, they requested permission to bring him before his Grace, in order that he might receive the reward of his valour. John's curiosity was excited by the mystery observed by the stranger; and, being already displeased with the issue of the tournament, in which the challengers whom he favoured had been successively defeated by one knight, he answered haughtily to the marshals, "By the light of Our Lady's brow, this same knight hath been disinherited as well of his courtesy as of his lands, since he desires to appear before us without uncovering his face.--Wot ye, my lords," he said, turning round to his train, "who this gallant can be, that bears himself thus proudly?" "I cannot guess," answered De Bracy, "nor did I think there had been within the four seas that girth Britain a champion that could bear down these five knights in one day's jousting. By my faith, I shall never forget the force with which he shocked De Vipont. The poor Hospitaller was hurled from his saddle like a stone from a sling." "Boast not of that," said a Knight of St John, who was present; "your Temple champion had no better luck. I saw your brave lance, Bois-Guilbert, roll thrice over, grasping his hands full of sand at every turn." De Bracy, being attached to the Templars, would have replied, but was prevented by Prince John. "Silence, sirs!" he said; "what unprofitable debate have we here?" "The victor," said De Wyvil, "still waits the pleasure of your highness." "It is our pleasure," answered John, "that he do so wait until we learn whether there is not some one who can at least guess at his name and quality. Should he remain there till night-fall, he has had work enough to keep him warm." "Your Grace," said Waldemar Fitzurse, "will do less than due honour to the victor, if you compel him to wait till we tell your highness that which we cannot know; at least I can form no guess--unless he be one of the good lances who accompanied King Richard to Palestine, and who are now straggling homeward from the Holy Land." "It may be the Earl of Salisbury," said De Bracy; "he is about the same pitch." "Sir Thomas de Multon, the Knight of Gilsland, rather," said Fitzurse; "Salisbury is bigger in the bones." A whisper arose among the train, but by whom first suggested could not be ascertained. "It might be the King--it might be Richard Coeur-de-Lion himself!" "Over God's forbode!" said Prince John, involuntarily turning at the same time as pale as death, and shrinking as if blighted by a flash of lightning; "Waldemar!--De Bracy! brave knights and gentlemen, remember your promises, and stand truly by me!" "Here is no danger impending," said Waldemar Fitzurse; "are you so little acquainted with the gigantic limbs of your father's son, as to think they can be held within the circumference of yonder suit of armour?--De Wyvil and Martival, you will best serve the Prince by bringing forward the victor to the throne, and ending an error that has conjured all the blood from his cheeks.--Look at him more closely," he continued, "your highness will see that he wants three inches of King Richard's height, and twice as much of his shoulder-breadth. The very horse he backs, could not have carried the ponderous weight of King Richard through a single course." While he was yet speaking, the marshals brought forward the Disinherited Knight to the foot of a wooden flight of steps, which formed the ascent from the lists to Prince John's throne. Still discomposed with the idea that his brother, so much injured, and to whom he was so much indebted, had suddenly arrived in his native kingdom, even the distinctions pointed out by Fitzurse did not altogether remove the Prince's apprehensions; and while, with a short and embarrassed eulogy upon his valour, he caused to be delivered to him the war-horse assigned as the prize, he trembled lest from the barred visor of the mailed form before him, an answer might be returned, in the deep and awful accents of Richard the Lion-hearted. But the Disinherited Knight spoke not a word in reply to the compliment of the Prince, which he only acknowledged with a profound obeisance. The horse was led into the lists by two grooms richly dressed, the animal itself being fully accoutred with the richest war-furniture; which, however, scarcely added to the value of the noble creature in the eyes of those who were judges. Laying one hand upon the pommel of the saddle, the Disinherited Knight vaulted at once upon the back of the steed without making use of the stirrup, and, brandishing aloft his lance, rode twice around the lists, exhibiting the points and paces of the horse with the skill of a perfect horseman. The appearance of vanity, which might otherwise have been attributed to this display, was removed by the propriety shown in exhibiting to the best advantage the princely reward with which he had been just honoured, and the Knight was again greeted by the acclamations of all present. In the meanwhile, the bustling Prior of Jorvaulx had reminded Prince John, in a whisper, that the victor must now display his good judgment, instead of his valour, by selecting from among the beauties who graced the galleries a lady, who should fill the throne of the Queen of Beauty and of Love, and deliver the prize of the tourney upon the ensuing day. The Prince accordingly made a sign with his truncheon, as the Knight passed him in his second career around the lists. The Knight turned towards the throne, and, sinking his lance, until the point was within a foot of the ground, remained motionless, as if expecting John's commands; while all admired the sudden dexterity with which he instantly reduced his fiery steed from a state of violent emotion and high excitation to the stillness of an equestrian statue. "Sir Disinherited Knight," said Prince John, "since that is the only title by which we can address you, it is now your duty, as well as privilege, to name the fair lady, who, as Queen of Honour and of Love, is to preside over next day's festival. If, as a stranger in our land, you should require the aid of other judgment to guide your own, we can only say that Alicia, the daughter of our gallant knight Waldemar Fitzurse, has at our court been long held the first in beauty as in place. Nevertheless, it is your undoubted prerogative to confer on whom you please this crown, by the delivery of which to the lady of your choice, the election of to-morrow's Queen will be formal and complete.--Raise your lance." The Knight obeyed; and Prince John placed upon its point a coronet of green satin, having around its edge a circlet of gold, the upper edge of which was relieved by arrow-points and hearts placed interchangeably, like the strawberry leaves and balls upon a ducal crown. In the broad hint which he dropped respecting the daughter of Waldemar Fitzurse, John had more than one motive, each the offspring of a mind, which was a strange mixture of carelessness and presumption with low artifice and cunning. He wished to banish from the minds of the chivalry around him his own indecent and unacceptable jest respecting the Jewess Rebecca; he was desirous of conciliating Alicia's father Waldemar, of whom he stood in awe, and who had more than once shown himself dissatisfied during the course of the day's proceedings. He had also a wish to establish himself in the good graces of the lady; for John was at least as licentious in his pleasures as profligate in his ambition. But besides all these reasons, he was desirous to raise up against the Disinherited Knight (towards whom he already entertained a strong dislike) a powerful enemy in the person of Waldemar Fitzurse, who was likely, he thought, highly to resent the injury done to his daughter, in case, as was not unlikely, the victor should make another choice. And so indeed it proved. For the Disinherited Knight passed the gallery close to that of the Prince, in which the Lady Alicia was seated in the full pride of triumphant beauty, and, pacing forwards as slowly as he had hitherto rode swiftly around the lists, he seemed to exercise his right of examining the numerous fair faces which adorned that splendid circle. It was worth while to see the different conduct of the beauties who underwent this examination, during the time it was proceeding. Some blushed, some assumed an air of pride and dignity, some looked straight forward, and essayed to seem utterly unconscious of what was going on, some drew back in alarm, which was perhaps affected, some endeavoured to forbear smiling, and there were two or three who laughed outright. There were also some who dropped their veils over their charms; but, as the Wardour Manuscript says these were fair ones of ten years standing, it may be supposed that, having had their full share of such vanities, they were willing to withdraw their claim, in order to give a fair chance to the rising beauties of the age. At length the champion paused beneath the balcony in which the Lady Rowena was placed, and the expectation of the spectators was excited to the utmost. It must be owned, that if an interest displayed in his success could have bribed the Disinherited Knight, the part of the lists before which he paused had merited his predilection. Cedric the Saxon, overjoyed at the discomfiture of the Templar, and still more so at the miscarriage of his two malevolent neighbours, Front-de-Boeuf and Malvoisin, had, with his body half stretched over the balcony, accompanied the victor in each course, not with his eyes only, but with his whole heart and soul. The Lady Rowena had watched the progress of the day with equal attention, though without openly betraying the same intense interest. Even the unmoved Athelstane had shown symptoms of shaking off his apathy, when, calling for a huge goblet of muscadine, he quaffed it to the health of the Disinherited Knight. Another group, stationed under the gallery occupied by the Saxons, had shown no less interest in the fate of the day. "Father Abraham!" said Isaac of York, when the first course was run betwixt the Templar and the Disinherited Knight, "how fiercely that Gentile rides! Ah, the good horse that was brought all the long way from Barbary, he takes no more care of him than if he were a wild ass's colt--and the noble armour, that was worth so many zecchins to Joseph Pareira, the armourer of Milan, besides seventy in the hundred of profits, he cares for it as little as if he had found it in the highways!" "If he risks his own person and limbs, father," said Rebecca, "in doing such a dreadful battle, he can scarce be expected to spare his horse and armour." "Child!" replied Isaac, somewhat heated, "thou knowest not what thou speakest--His neck and limbs are his own, but his horse and armour belong to--Holy Jacob! what was I about to say!--Nevertheless, it is a good youth--See, Rebecca! see, he is again about to go up to battle against the Philistine--Pray, child--pray for the safety of the good youth,--and of the speedy horse, and the rich armour.--God of my fathers!" he again exclaimed, "he hath conquered, and the uncircumcised Philistine hath fallen before his lance,--even as Og the King of Bashan, and Sihon, King of the Amorites, fell before the sword of our fathers!--Surely he shall take their gold and their silver, and their war-horses, and their armour of brass and of steel, for a prey and for a spoil." The same anxiety did the worthy Jew display during every course that was run, seldom failing to hazard a hasty calculation concerning the value of the horse and armour which was forfeited to the champion upon each new success. There had been therefore no small interest taken in the success of the Disinherited Knight, by those who occupied the part of the lists before which he now paused. Whether from indecision, or some other motive of hesitation, the champion of the day remained stationary for more than a minute, while the eyes of the silent audience were riveted upon his motions; and then, gradually and gracefully sinking the point of his lance, he deposited the coronet which it supported at the feet of the fair Rowena. The trumpets instantly sounded, while the heralds proclaimed the Lady Rowena the Queen of Beauty and of Love for the ensuing day, menacing with suitable penalties those who should be disobedient to her authority. They then repeated their cry of Largesse, to which Cedric, in the height of his joy, replied by an ample donative, and to which Athelstane, though less promptly, added one equally large. There was some murmuring among the damsels of Norman descent, who were as much unused to see the preference given to a Saxon beauty, as the Norman nobles were to sustain defeat in the games of chivalry which they themselves had introduced. But these sounds of disaffection were drowned by the popular shout of "Long live the Lady Rowena, the chosen and lawful Queen of Love and of Beauty!" To which many in the lower area added, "Long live the Saxon Princess! long live the race of the immortal Alfred!" However unacceptable these sounds might be to Prince John, and to those around him, he saw himself nevertheless obliged to confirm the nomination of the victor, and accordingly calling to horse, he left his throne; and mounting his jennet, accompanied by his train, he again entered the lists. The Prince paused a moment beneath the gallery of the Lady Alicia, to whom he paid his compliments, observing, at the same time, to those around him--"By my halidome, sirs! if the Knight's feats in arms have shown that he hath limbs and sinews, his choice hath no less proved that his eyes are none of the clearest." It was on this occasion, as during his whole life, John's misfortune, not perfectly to understand the characters of those whom he wished to conciliate. Waldemar Fitzurse was rather offended than pleased at the Prince stating thus broadly an opinion, that his daughter had been slighted. "I know no right of chivalry," he said, "more precious or inalienable than that of each free knight to choose his lady-love by his own judgment. My daughter courts distinction from no one; and in her own character, and in her own sphere, will never fail to receive the full proportion of that which is her due." Prince John replied not; but, spurring his horse, as if to give vent to his vexation, he made the animal bound forward to the gallery where Rowena was seated, with the crown still at her feet. "Assume," he said, "fair lady, the mark of your sovereignty, to which none vows homage more sincerely than ourself, John of Anjou; and if it please you to-day, with your noble sire and friends, to grace our banquet in the Castle of Ashby, we shall learn to know the empress to whose service we devote to-morrow." Rowena remained silent, and Cedric answered for her in his native Saxon. "The Lady Rowena," he said, "possesses not the language in which to reply to your courtesy, or to sustain her part in your festival. I also, and the noble Athelstane of Coningsburgh, speak only the language, and practise only the manners, of our fathers. We therefore decline with thanks your Highness's courteous invitation to the banquet. To-morrow, the Lady Rowena will take upon her the state to which she has been called by the free election of the victor Knight, confirmed by the acclamations of the people." So saying, he lifted the coronet, and placed it upon Rowena's head, in token of her acceptance of the temporary authority assigned to her. "What says he?" said Prince John, affecting not to understand the Saxon language, in which, however, he was well skilled. The purport of Cedric's speech was repeated to him in French. "It is well," he said; "to-morrow we will ourself conduct this mute sovereign to her seat of dignity.--You, at least, Sir Knight," he added, turning to the victor, who had remained near the gallery, "will this day share our banquet?" The Knight, speaking for the first time, in a low and hurried voice, excused himself by pleading fatigue, and the necessity of preparing for to-morrow's encounter. "It is well," said Prince John, haughtily; "although unused to such refusals, we will endeavour to digest our banquet as we may, though ungraced by the most successful in arms, and his elected Queen of Beauty." So saying, he prepared to leave the lists with his glittering train, and his turning his steed for that purpose, was the signal for the breaking up and dispersion of the spectators. Yet, with the vindictive memory proper to offended pride, especially when combined with conscious want of desert, John had hardly proceeded three paces, ere again, turning around, he fixed an eye of stern resentment upon the yeoman who had displeased him in the early part of the day, and issued his commands to the men-at-arms who stood near--"On your life, suffer not that fellow to escape." The yeoman stood the angry glance of the Prince with the same unvaried steadiness which had marked his former deportment, saying, with a smile, "I have no intention to leave Ashby until the day after to-morrow--I must see how Staffordshire and Leicestershire can draw their bows--the forests of Needwood and Charnwood must rear good archers." "I," said Prince John to his attendants, but not in direct reply,--"I will see how he can draw his own; and woe betide him unless his skill should prove some apology for his insolence!" "It is full time," said De Bracy, "that the 'outrecuidance' [19] of these peasants should be restrained by some striking example." Waldemar Fitzurse, who probably thought his patron was not taking the readiest road to popularity, shrugged up his shoulders and was silent. Prince John resumed his retreat from the lists, and the dispersion of the multitude became general. In various routes, according to the different quarters from which they came, and in groups of various numbers, the spectators were seen retiring over the plain. By far the most numerous part streamed towards the town of Ashby, where many of the distinguished persons were lodged in the castle, and where others found accommodation in the town itself. Among these were most of the knights who had already appeared in the tournament, or who proposed to fight there the ensuing day, and who, as they rode slowly along, talking over the events of the day, were greeted with loud shouts by the populace. The same acclamations were bestowed upon Prince John, although he was indebted for them rather to the splendour of his appearance and train, than to the popularity of his character. A more sincere and more general, as well as a better-merited acclamation, attended the victor of the day, until, anxious to withdraw himself from popular notice, he accepted the accommodation of one of those pavilions pitched at the extremities of the lists, the use of which was courteously tendered him by the marshals of the field. On his retiring to his tent, many who had lingered in the lists, to look upon and form conjectures concerning him, also dispersed. The signs and sounds of a tumultuous concourse of men lately crowded together in one place, and agitated by the same passing events, were now exchanged for the distant hum of voices of different groups retreating in all directions, and these speedily died away in silence. No other sounds were heard save the voices of the menials who stripped the galleries of their cushions and tapestry, in order to put them in safety for the night, and wrangled among themselves for the half-used bottles of wine and relics of the refreshment which had been served round to the spectators. Beyond the precincts of the lists more than one forge was erected; and these now began to glimmer through the twilight, announcing the toil of the armourers, which was to continue through the whole night, in order to repair or alter the suits of armour to be used again on the morrow. A strong guard of men-at-arms, renewed at intervals, from two hours to two hours, surrounded the lists, and kept watch during the night.

Summary: The Disinherited Knight refuses to raise his visor before he receives his prize. Prince John and his men try to guess who he might be, and Prince John is nervous lest it be King Richard himself. The Knight does not speak as Prince John compliments him on his victory. Then the Knight is informed that he may choose the Queen of Love and of Beauty who is to preside over the next day of the tournament. The Knight chooses Rowena. This disappoints Prince John, who had hinted that the Knight should choose Alicia, daughter of his counselor, Waldemar Fitzurse. But the Prince is gracious and invites Rowena to the banquet that night. Cedric displeases the Prince by saying she will not attend, but will preside over the tournament the following day.

booksum

en

Summarize: Ben emphasized that although the main part of the job was testing quality and standards, having sex was only "a part of the job." Not only would the candidate have to rate the brothels on those criteria, he or she would also have to score their performance of the sex workers, which would be published on the website. Candidates must be university-educated, preferably in business or the hotel industry and have "practical experience of several years of brothel visits." Experience of escorts is an additional advantage, the ad on Kaufmich's website says. In addition, wannabe brothel testers must have a clean, neat appearance and health certificate, be communicative and enjoy working with people. Fluency in German and an additional language (preferably French) is an advantage. Safe sex must be used throughout testing, the website said. Ben told CNBC that, so far, the job had had around 150 applicants - mostly from Germany but also international applicants from Belgium and the Netherlands and also from U.K. The successful applicant will have to work in Berlin at first, he said, but would also test brothels in the whole of Germany. "The amount is not clear yet as the candidate first need to draft test procedures etc," he said. "So the job is a lot of planning - and a bit of praxis." Kaufmich.com is part of an international group of companies with more than 120 employees in Germany, China and Spain, "offering realistic development and career opportunities," it said. Prostitution and brothels are legal in Germany and sex workers pay taxes and have access to health insurance and social security benefits. In January, a draft law by the German government was set to strengthen the legal protection of sex workers, Deutsche Welle reported. A brothel in Berlin is seeking a university-educated, multilingual, quality control tester to check their employees and ensure their establishment offers a quality service, high standards of cleanliness, safe sex practices and value for money. The job specification is featured on Kaufmich (which means ‘Purchase Me’) - a social networking site for sex workers. It explains that either a man or woman would be suitable for the role within an international company, which apparently boasts more than 120 employees who work in Germany, Spain and China. Ideally, candidates will have a degree in business, practical experience of brothels, an ability to speak French and carry a full health certificate. The job spec also says, “You should enjoy having fun with people and you should not be afraid of contact.” The Kaufmich website was founded in 2009 by German entrepreneur Julius Dreyer and his two brothers. Between them the brothers are worth millions, having made their fortune with their internet startup TheNetCircle, a Shanghai-based company specialising in developing and supporting web communities. Having already founded popular German hook-up site Poppen, Dreyer launched Kaufmich to improve the prostitution industry by providing a free market for independent sex workers. The prostitution portal now ranks among Germany's top 200 websites and in the top 10 of adult sites, with 250,000 active members logging in each week. Keep up with this story and more by subscribing now Although it's essentially a marketing platform, Dreyer said his website is also useful for Germany's sex worker unions as it provides an online forum for prostitutes to discuss concerns such as taxation and other issues which are specific to their industry. “Our vision is to see sex work as an equal and fully accepted part of society,” he said. “We believe that all kinds of problems arise from sex workers being isolated and judged." In 2001, Germany passed a law which required sex workers be treated like any other workers, giving them the power to sue for better wages and have full access to benefits like health insurance and pensions. Prostitution remains a contentious issue in Germany, with abuse and sex trafficking a constant subject of debate. Local media reported last year that up to 200,000 prostitutes currently operate in the country, with 65-80% coming from countries like Romania and Bulgaria. Brothels are booming, with 400,000 women across Germany now employed in what some describe as “sex supermarkets”, which often span several floors of a building. In May 2013, German daily newspaper Der Spiegel labelled the legalisation of the industry as little more than “a subsidy program for pimps”. Last year Silvia Pantel, a member of parliament for the Christian Democratic Union, expressed concern that 90% of Germany’s sex workers are apparently forced into prostitution and warned Germany was in danger of becoming the world’s brothel capital.

Summary: "You should enjoy having fun with people and you should not be afraid of contact." Normally, a line like that in a help-wanted ad would raise red flags, but not so much in this case. A German social media company that specializes in the sex industry is looking for a brothel tester, reports Newsweek. The ideal applicant has a college degree, speaks more than one language, and has experience visiting brothels. The company-called Kaufmich, which roughly translates to "Buying me"-says the main point to rate safety and health standards and emphasizes that sex (and the ranking of sex workers) is "only a part of the job," reports CNBC. For the record, both men and women can apply.

multi_news

en

Write a title and summarize: Despite its role in homogenizing populations, hybridization has also been proposed as a means to generate new species. The conceptual basis for this idea is that hybridization can result in novel phenotypes through recombination between the parental genomes, allowing a hybrid population to occupy ecological niches unavailable to parental species. Here we present an alternative model of the evolution of reproductive isolation in hybrid populations that occurs as a simple consequence of selection against genetic incompatibilities. Unlike previous models of hybrid speciation, our model does not incorporate inbreeding, or assume that hybrids have an ecological or reproductive fitness advantage relative to parental populations. We show that reproductive isolation between hybrids and parental species can evolve frequently and rapidly under this model, even in the presence of substantial ongoing immigration from parental species and strong selection against hybrids. An interesting prediction of our model is that replicate hybrid populations formed from the same pair of parental species can evolve reproductive isolation from each other. This non-adaptive process can therefore generate patterns of species diversity and relatedness that resemble an adaptive radiation. Intriguingly, several known hybrid species exhibit patterns of reproductive isolation consistent with the predictions of our model. The evolutionary significance of hybridization has been a hotly debated topic for decades [1]. Homoploid hybrid speciation, speciation that occurs as a result of hybridization without a ploidy change [2,3], is generally thought to be an exceptionally rare outcome of hybridization, and there are indeed only a handful of well-supported cases of this phenomenon [4]. Though it is not uncommon for species’ genomes to exhibit evidence of past hybridization, hybrids are often thought to be weakly isolated from parental species, though few studies have explicitly investigated this. Empirical research on homoploid hybrid speciation over the last decade has primarily focused on the role of hybrid phenotypes in establishing reproductive isolation between hybrids and parental species [5–9]. Hybrids can have recombinant or transgressive traits that differentiate them from parental species. In some cases, these traits can allow hybrids to occupy new niches. For example, in Rhagoletis fruit flies, hybrid lineages have novel host preferences, potentially contributing to reproductive isolation between hybrids from parental species [10,11]. Similarly, if hybrid lineages have novel mate preferences, this can isolate hybrids from parental species via assortative mating, a mechanism which has been implicated in hybrid speciation in Heliconius butterflies ([8], and see [12] for a model of this process). This work has lead to the idea that novel hybrid phenotypes are key to hybrid speciation [13]. Despite several well-documented examples [6,8], it has been difficult to determine the evolutionary importance of hybrid speciation, in part because few theoretical models have been developed. The existing models of hybrid speciation simulate either positive selection on certain hybrid genotypes or inbreeding [9,12,14]. In one model [14,15], novel combinations of underdominant parental inversions can fix in hybrid populations, particularly if the novel inversion combination is under positive selection or if rates of inbreeding (selfing) are high (see Discussion). Though there is evidence that this process combined with ecological factors was involved in the formation of hybrid Helianthus sunflower species [5,6, 16], the basis for invoking positive selection on recombinant inversion genotypes is unclear. Later versions of this model incorporated ecological differentiation between hybrid and parental species and showed that hybrid speciation occurred frequently if hybrids had higher fitness than parental species in an unoccupied niche [9,17]. Though hybridization often generates novel traits [18–20] it is difficult to evaluate the likelihood that these traits will be more fit than parental types (ecologically or intrinsically), making it difficult to predict the importance of hybridization in generating new species by positive selection on hybrid genotypes. The genetic incompatibility of hybrids constitutes a key component of reproductive isolation between many species, and is the basis for the biological species concept. While previous models of hybrid speciation incorporated inversions [21], here we investigate the potential role of negative epistatic interactions, another important genetic mechanism of speciation. The first genetic model of speciation, described by Bateson, Dobzhansky and Muller (the BDM incompatibility model, S1 Fig., [22–24]), predicts that mutations at two genetic loci differentially accumulating along two lineages can negatively interact in their hybrids. Empirical research has shown that these types of negative epistatic interactions are remarkably common [25–29]; reviewed in [24,30,31]. Though the theory of genetic incompatibilities was originally formulated in the context of allopatrically diverging species, more recent research has investigated dynamics of these incompatibilities in the context of hybrid zones. Under the simplest BDM scenario, derived genotypes are presumed to be neutral, meaning that they have the same fitness as ancestral genotypes. When there is gene flow between species, neutral BDMs are predicted to fix for genotype combinations that are compatible with either parental species [32], rendering them ineffective barriers to gene flow [33,34]. However, incompatibilities may also frequently arise due to adaptive evolution or coevolution of pairs of loci along lineages (S1 and S2 Figs [24,32,35–37]). Such incompatibilities are more effective barriers to gene flow than neutral BDM incompatibilities ([38], see also [39]). In its initial description, the BDM model envisioned incompatibilities that cause complete hybrid inviability or sterility, but many negative epistatic interactions in interspecific crosses have more moderate effects on fitness (e. g. [40–42]), allowing hybrid populations to persist. With few exceptions, previous work on genetic incompatibilities has focused on their role in maintaining reproductive isolation between parental species. As a result, hybrid populations have primarily been modeled as tension zones, but incompatibilities may also have interesting dynamics within isolated hybrid populations (i. e. hybrid swarms). Here we present a new model in which reproductive isolation between hybrid and parental populations emerges as a consequence of selection against incompatibilities in a hybrid swarm. Selection on a single adaptive or coevolving incompatibility pair can result in the fixation of genotype combinations that contribute to isolation between the hybrid population and one or the other parental species. Here, we show that in the presence of multiple pairs of such incompatibilities, this process can result in the rapid evolution of reproductive isolation of hybrid populations from both parental species (Fig. 1). Two features of this model make it particularly plausible biologically. First, as noted above, negative epistatic interactions are common, providing ample raw material for our model. Second, hybrid populations in which hybrids are abundant are common in nature (e. g. [43–45]). Though ecological and sexual selection are important factors in the few well-documented cases of hybrid speciation [6,8], our results suggest that hybrids can evolve reproductive isolation as a result of selection against genetic incompatibilities alone. In the simplest model of a hybrid population, an equal mixture of individuals from both parental species form a new isolated population and mate randomly with respect to genotype (Figs. 1 and S3), such that the first mating event generates 50% F1 hybrids and 25% each parental species. Using theory of two-locus selection [46,47], hereafter the “deterministic two-locus model”, one can model the effect of selection at two polymorphic loci on gamete frequencies of a diploid sexual population (see Methods and S1 Text). This model describes the dynamics of two loci subject to any arbitrary fitness matrix. Here, we focus on fitness matrices for three types of incompatibilities that may commonly arise between species (S1 and S2 Figs; [30,35]): 1. BDM incompatibilities arising from neutral substitutions, 2. BDM incompatibilities arising from adaptive substitutions, and 3. BDM incompatibilities arising from coevolution between loci. Applying the two-locus selection model to these incompatibility types, one can see that the direction of fixation depends on the initial frequency of the parental alleles (f, see S3 and S4 Figs) and dominance at each locus (h, S4 Fig. ; see also [48]). This purely deterministic model of selection on hybrid incompatibilities is unrealistic because even large populations experience some degree of genetic drift. We thus extended the model to include genetic drift, which can affect the speed and direction of fixation of incompatibility pairs (S5 Fig.). For neutral BDM incompatibilities (S1 Fig.), this model does not predict fixation of genotypes incompatible with either parental species (S4 Fig.). In contrast, for coevolving or adaptive BDM incompatibilities (S1 Text, S1 and S2 Figs), the two-locus finite population model predicts that at equal admixture proportions (f = 0. 5), a single incompatibility pair has a 50% chance of fixing for either parental allele combination (Fig. 2, S2 Text, S1 Table). Interestingly, while genetic drift in small populations could accomplish the same thing (9), the process described here occurs rapidly in large populations and is driven by deterministic selection (Fig. 2). Given these dynamics, it is clear that large hybrid populations with two or more of these types of hybrid incompatibilities could, in principle, fix for one parental genotype at one incompatibility pair and the other parental genotype at the other incompatibility pair (Fig. 1). This outcome would result in reproductive isolation of the hybrid population from both parental species. With two codominant incompatibility pairs and equal admixture proportions, the probability that a hybrid population will become isolated can be predicted by a simple binomial. However the binomial prediction breaks down when there is variation in dominance, admixture proportions, or linkage between incompatibilities, and thus we explore these further by simulation. To investigate the dynamics of multiple incompatibility pairs, we simulated a large, randomly-mating and spatially isolated hybrid population with two pairs of unlinked hybrid incompatibility loci (see Methods; S3 Fig., setting m1 = m2 = 0). The fitness scheme used is that of a coevolutionary incompatibility model (S2 Fig.), assuming that incompatibilities are codominant (i. e. h = 0. 5), that fitness is symmetric with respect to the parental source of alleles (i. e. wij = wji) and that the cumulative fitness effects of multiple incompatibility pairs is multiplicative. If hybrid populations fixed for the parent species 1 genotype at one incompatibility pair and the parent species 2 genotype at the other, we considered the hybrid population as having evolved reproductive isolation from both parental species (albeit weaker than between the two parental species). While selection against hybrids will sometimes be so extreme that few hybrids will survive (or reproduce) in the population (see simulations below), selection against hybrids can also be more moderate, allowing hybrids to persist [41,45,49–53]. In simulations of this moderate selection scenario, reproductive isolation between hybrid and parental populations can evolve frequently and rapidly (Fig. 3). For example, for two incompatibility pairs with selection coefficients (s) of 0. 1,47±2% of simulated hybrid populations became isolated from both parental species within an average of ~200 generations. Exploring a range of s (0. 1–0. 5, S6 Fig., S2 Table), initial admixture proportions (f = 0. 3–0. 7, S7 Fig.), and population sizes (100–10,000 diploids, S3 Table), we conclude that, unless fitness of hybrids is low (i. e. F1 fitness <0. 5) or ancestry of the founding population is substantially skewed (>60% one parental species), reproductive isolation evolves rapidly and with surprisingly high probability (27±2% to 43±2% of the time; on average within 75 ± 16 to 258 ± 38 generations, see S3 Text). In the above simulations, we assume that selection on different hybrid incompatibility interactions is symmetrical (s1 = s2, S2 Fig.), but it is unlikely that selection is truly equal on different hybrid genotype combinations. When fitness is completely asymmetrical (i. e. s1 = 0 in S1 Fig., as for neutral BDM incompatibilities), only strong genetic drift can cause the fixation of genotype pairs that are incompatible with either parental species, as selection cannot do so (see S4, S8, S9 Figs, S4 Text). This reliance on genetic drift implies that this process will be slow unless an extreme bottleneck is invoked. In contrast, the dynamics of BDM incompatibilities resulting from adaptation within parental lineages can be quite different (S1 Fig.). Notably, while selection may also be highly asymmetric in such cases [38,54], derived alleles have higher fitness than ancestral alleles, allowing for the fixation of genotype combinations that are incompatible with both parental species. We find that isolation evolves with similar frequency under asymmetric selection as long as selection is strong relative to drift (S3 Text, S4 Table), because even weak selection will prevent the fixation of the ancestral genotype. Above we simulated codominant hybrid incompatibilities (h = 0. 5), but the two-locus model (S4 Fig.) shows that patterns of fixation are different depending on the value of h. In particular, when h is zero or unity, fixation is not strongly dependent on admixture proportions (S4 Fig.). When we simulate variation in dominance among incompatibility interactions (see S3 Text, S5 Table), we find that reproductive isolation between hybrid populations and parental species evolves with comparable frequency (42–48±2% vs 47±2% under the codominant scenario). Recent empirical studies have suggested that most species are distinguished by multiple hybrid incompatibilities [30,41,55–59]. Theoretically, barring extinction of the hybrid population (see simulations below), increasing the number of pairs of incompatibilities should increase the probability that a hybrid population will evolve isolation from both parental species. In order to illustrate this, we simulated 3–6 unlinked hybrid incompatibility pairs (S5 Text). As expected, increasing the number of hybrid incompatibilities increases the probability that the hybrid population will be isolated from each parental species by at least one incompatibility pair (>90% with 6 incompatibility pairs, Figs. 3, S6, S5 Text). We assume in most of our simulations that loci involved in hybrid incompatibilities are completely unlinked. As the number of incompatibilities increases, this becomes unlikely. Genetic linkage between loci involved in different epistatic interactions can reduce the frequency at which hybrid populations evolve isolation because alleles are more likely to fix for the same parental genotype (S10 Fig., S5 Text, S6 Table). Interestingly, when coevolving incompatibility loci are linked to a neutral BDM incompatibility, this does not significantly lower the frequency at which hybrid populations evolve reproductive isolation (S5 Text). Furthermore, linkage between coevolving incompatibilities and neutral BDM incompatibilities can more frequently result in fixation of neutral BDM incompatibilities for a parental genotype (16±2%), resulting in stronger isolation between hybrid and parental populations (S5 Text). The above simulations focus on simple models that show this process can occur in principle. To capture more biological realism in the number and types of incompatibilities, we simulated 20 incompatibility pairs with randomly determined genomic position and dominance, exponentially distributed selection coefficients (mean s = 0. 05) and variation in asymmetry of selection (see above and S5 Text). In these simulations, 95% of populations developed isolation from both parental species. On average, the hybrid population first evolved isolation from both parental species after ~250 generations and was isolated from each by 7 incompatibility pairs within 1000 generations. Since incompatibility pairs with the largest fitness effects tend to fix first, hybrid populations developed considerable reproductive isolation from parental species even before all incompatibilities were fixed in the population (Figs. 4 and S11). Overall, our simulations suggest that rapid evolution of reproductive isolation of hybrid populations is likely when parental species are separated by several hybrid incompatibility pairs. Reproductive isolation between hybrids and parental species is less likely to evolve as the fitness of hybrids decreases. For example, if we repeat the simulations above (i. e. the 20 incompatibility pairs with exponentially distributed selection coefficients), if s- = 0. 1, the average fitness of an F1 hybrid between the two parental species is 0. 38 and isolation evolves in only 56±2% of simulations. When s- = 0. 2, the average fitness of hybrids is 0. 1, and only 1. 4±0. 5% of simulated populations develop isolation and parental genotypes dominated in these populations. Thus, this process is unlikely to occur between species in which post-zygotic isolation is nearly complete. Similarly, if parental individuals in the simulated hybrid population mate assortatively with conspecifics, reproductive isolation between hybrids and parental species is significantly less likely to evolve (S6 Text). The reasons for this are two-fold: assortative mating prevents the formation of a large hybrid population, and parentals outcompete early generation hybrids that are still segregating for parental incompatibilities. We model a completely isolated hybrid swarm, but many hybrid populations experience gene flow with parental species. Ongoing migration may impede the evolution of reproductive isolation by preventing the fixation of genetic incompatibilities. To evaluate this, we simulated hybridization scenarios with ongoing migration (S3 and S13 Figs, 4Nm = 8–20). Even with substantial gene flow from parental populations, hybrid populations evolved reproductive isolation from them at high probability (i. e. 38±2% of simulations with two incompatibility pairs, s = 0. 1 and 4Nm = 8; S6 Text; S7 Table). In the above simulations, we assume that migration is symmetrical from both parental species, but asymmetrical migration may be common in hybrid zones (e. g. [60–62]). To explore how asymmetrical migration could influence our results, we varied asymmetry in migration rates (S6 Text). As expected, when migration rates were high and strongly asymmetrical (S12 Fig.), hybrid reproductive isolation from both parental species evolved infrequently. However, in less extreme cases, hybrid reproductive isolation was still observed frequently (e. g. >20% of simulations with 4Nm<20, S12 Fig.). It is interesting to consider the fact that chance plays an important role in the direction that incompatibility pairs fix. As a result, one would expect that two or more independently formed hybrid populations from the same pair of parental species could evolve isolation from each other. To demonstrate this effect, we simulated two hybrid populations formed from the same pair of parental species (S14 Fig.). In the absence of migration, the two hybrid populations evolved isolation from each other frequently (50±5%, as expected given two hybrid incompatibility pairs, see S6 Text; S8 Table). Remarkably, this outcome is still observed with relatively high gene flow between the two hybrid populations (24±4% with 4Nm = 8 and two hybrid incompatibility pairs, S6 Text; S8 Table). We describe a new model of the evolution of reproductive isolation of hybrid populations, a first step towards hybrid speciation. Unlike previous models of hybrid speciation, our model does not assume positive selection on hybrid genotypes or inbreeding, but rather deterministic selection against hybrid incompatibilities in randomly mating hybrid populations. With moderate selection (i. e. s≤0. 2) on two or more incompatibility pairs in an allopatric hybrid population, reproductive isolation from both parental species emerges with ~50% (or higher) probability. Hybrid reproductive isolation also evolves frequently with substantial levels of ongoing migration between hybrids and parental species (4Nm < 20 each parent). Another striking result of our simulations is the speed with which reproductive isolation evolves between hybrids and parental species. Depending on parameters, reproductive isolation can emerge in fewer than 100 generations with moderate selection (S3 Text). The idea that hybrid speciation can occur rapidly has been supported by experimental results [14,63,64] and to some extent by previous models of hybrid speciation [9,14]. Our model suggests that simple selection on incompatibilities in hybrid populations could also lead to rapid reproductive isolation on timescales much faster than expected for allopatric speciation due to the accumulation of neutral BDM incompatibilities. Given that epistatic incompatibilities are common, our results on the probability and speed of isolation suggest that this process may frequently occur in hybrid populations. Previous empirical work has emphasized the importance of ecological differentiation between hybrid and parental populations or positive selection on hybrid genotypes as a route to hybrid reproductive isolation [6,8–10,12,63,65]. The novel finding of our simulations is that reproductive isolation evolves readily in hybrid populations without positive selection on hybrids. However, the two are not mutually exclusive and ecological factors, which have been shown to underlie several cases of hybrid speciation [6,8, 63], may complement selection on genetic incompatibilities to further strengthen reproductive isolation. For example, in Helianthus, a combination of chromosomal rearrangements and novel hybrid phenotypes are important in distinguishing hybrid and parental species [6,66]. Like other models ([9,14]), our model predicts that isolation between hybrids and parental species is inherently weaker than isolation between the two parental species. We propose that fixation of incompatibilities could be a crucial step in initially limiting gene flow between hybrids and parental species, allowing for the development of other isolating mechanisms. For example, theoretical work predicts that reinforcement can develop even when selection against gene flow is moderate [67–70]. Previous models of hybrid speciation have incorporated species-specific inversions that are assumed to be underdominant. Under this “underdominant inversion” model, hybrid populations can fix for novel inversion combinations, resulting in isolation between hybrid and parental species [15]. Simulation results under this model have suggested that inbreeding [14] or positive selection on hybrid genotypes [9,14] is important for the evolution of hybrid reproductive isolation. However, past simulation efforts focused on hybrids in a tension zone, either with no spatial isolation from parental species [14] or with high migration rates from parental species [17]. To investigate the dynamics of the underdominant inversion model in situations where migration is more restricted, we simulate the underdominant inversion model in an isolated hybrid swarm scenario that is similar to our epistatic incompatibility model (S7 Text). Interestingly, we find that isolation evolves frequently under this model even without positive selection (~40% of simulations, see S7 Text). These results show that, in hybrid-dominated populations, the inversion model has similar behavior to our model of selection against negative epistatic interactions (S7 Text). Which mechanism of isolation is more prevalent in hybrid populations will depend on the frequency of hybrid incompatibilities of each type. Empirical evidence suggests that while underdominance can be a common isolating mechanism in plants (reviewed in [21]), negative epistatic interactions may be a more common mechanism of reduced hybrid fitness in animals [24]. It is important to note several factors that may influence how common our epistatic interactions model of hybrid speciation will be in natural populations. First, our model assumes that hybrids are abundant in a population and, while this appears to be reasonably common (see S6 Text; S9 Table), this is clearly not a feature of all hybrid zones. We also note that our model only represents fitness in terms of genetic incompatibilities and that hybrid populations can have lower fitness as a result of ecological or sexual selection. For example, in our simulations, we assumed random mating between hybrids and parentals. But when parental species exert negative sexual selection against hybrids, hybrid populations are significantly more likely to be outcompeted by parentals (S10 Table). There is substantial variation in the mating preferences of parentals for hybrids [71]. In two species of cyprinidontiform fishes, male and female parentals mate readily with hybrids [45,72,73], while mice discriminate against them [74]. This suggests that the likelihood of this process will depend in part on the biology of the hybridizing species. An additional consideration is that hybrid reproductive isolation is most likely to evolve during a particular window of divergence between parental species. When the fitness of hybrid populations is low (i. e. corresponding to high levels of divergence between parental species), they are more prone to extinction or displacement by parentals (S6 Fig., S5 Text). This suggests that the evolution of hybrid reproductive isolation through this mechanism is most likely to occur in a period of evolutionary divergence during which species have accumulated some hybrid incompatibilities but have not diverged to the point at which hybrids are largely inviable. The most detailed work characterizing genetic incompatibilities has been between Drosophila species, where hybrids generally have substantially reduced fitness compared to parents [56,57,75]. Hybrids between several other species studied to date, however, are affected by fewer incompatibilities or incompatibilities of weaker effects [26,55,59,76–79]. Such groups may be more likely to form hybrid populations, and should be the focus of future empirical research. In addition, even species that currently have strong isolation may have historically produced hybrid populations, though investigating ancient hybrid speciation by the mechanism we describe would be challenging. This is because if parental and hybrid lineages have diverged substantially since the time of initial hybridization it may not be possible to determine whether or not incompatibilities were initially derived from parental genomes. It is interesting to note that reduced frequency of reproductive isolation with increasing selection on hybrids can be mitigated to some extent by an increase in the total number of hybrid incompatibility pairs. In our simulations, we see a positive relationship between the number of interactions and the probability of developing reproductive isolation, and a negative relationship between the total strength of selection on hybrids and the probability of developing reproductive isolation (Figs. 3 and S6). This tradeoff suggests that reproductive isolation can evolve between hybrid and parental populations even when the fitness of hybrids is low (as in Figs. 3,4, and S6, keeping in mind that extinction occurs frequently when hybrid fitness is nearly zero). Similarly, our model is sensitive to skewed initial admixture proportions, but increasing the number of hybrid incompatibility pairs increases the probability that skewed hybrid populations will be isolated from both parental species by at least one incompatibility (S7 Fig.). For example, with two incompatibility pairs, the probability of isolation from both parental species in an ancestry-skewed population (65% parent 1) was 7% while with four incompatibility pairs the probability rose to 15%. In addition, because discrete populations in a cline often span a range of admixture proportions (e. g. [80–82]), it is likely that some hybrid populations will fall in the range where we predict that isolation can evolve. On the other hand, our results show that high levels of migration (as might be observed in continuous clines) can prevent isolation; future research should investigate the dynamics of this process in a range of hybrid zone structures. Finally, our model assumes that coevolving incompatibilities or BDM incompatibilities arising from adaptive evolution frequently occur between species. Accumulating evidence suggests that incompatibilities arising from coevolution may be common [30,36,83–86]. For example, in marine copepods, coevolution between cytochrome c and cytochrome c oxidase results in a reciprocal breakdown of protein function in hybrids [86]. In addition, the fact that many known incompatibility genes involve sexual conflict, selfish genetic elements, or pathogen defense suggests an important role for coevolution in the origin of incompatibilities [36,83,87,88]. Our model also applies to BDM incompatibilities that arise due to within-lineage adaptation, assuming that the fitness advantage of the derived alleles is not dependent on the parental environment. It is currently unknown whether incompatibilities are more likely to be neutral or adaptive. Though there is evidence for asymmetric selection on many hybrid incompatibilities [28,29,89], neutrality has not been established in these cases. Anecdotal evidence supports the idea that adaptive incompatibilities are common, since many of the genes underlying hybrid incompatibilities identified so far show evidence of positive selection within lineages [90], but the relative frequency of adaptive and neutral BDM incompatibilities awaits answers from further empirical research. Intriguingly, theoretical work also suggests that neutral BDM incompatibilities are unlikely to persist if there is gene flow between species [32]. The patterns predicted by our model are testable with empirical approaches. A large number of studies have successfully mapped genetic incompatibilities distinguishing species [25,26,41,56,57,79,91]. Ancestry at these sites can be determined in putative hybrid species, and the relative contribution of parental-derived incompatibilities to reproductive isolation can be determined experimentally. For some species, it may be possible to evaluate the dynamics of incompatibilities relative to the genetic background in experimentally generated hybrid swarms [92]. We predict that many hybrid populations exhibiting postzygotic isolation from parental species will have fixed incompatibility pairs for each parental species. Several cases of hybrid speciation report reduced fitness of offspring between parental and hybrid species consistent with the mechanism described here [6,16,53,93] and are promising cases for further empirical research. Strikingly, a recent study on Italian sparrows concludes that reproductive isolation between parental and hybrid species is partly due to the fixation of parental-derived incompatibilities [94]. An intriguing implication of our model is that independently formed hybrid populations between the same parental species can develop reproductive isolation from each other. The likelihood of this outcome increases with the number of incompatibility pairs. In sunflowers, empirical studies of ecologically-mediated hybrid speciation have identified multiple hybrid species derived from the same parental species [95]. It is interesting to note that selection against hybrid incompatibilities could generate the same pattern in replicate hybrid populations. In fact, this mechanism could generate a species phylogeny pattern similar to that expected from an adaptive radiation, with multiple closely related species arising in a relatively short evolutionary window. This finding is striking because our model does not invoke adaptation and suggests that non-adaptive processes (i. e. selection against incompatibilities) could also explain clusters of rapidly arising, closely-related species. To characterize evolution at hybrid incompatibility loci in hybrid populations without drift, we used the equations described by Karlin and others [46,47] to calculate changes in allele frequency as a result of two-locus selection. The frequency of gamete i at generation t is given by xi (t) =xi (t-1) wi*w-+ϵirDw14w-, (1) where ε1 = ε4 = -ε2 = -ε3 = -1, the marginal fitness of allele i, wi*=∑j=14xjwij, (2) the mean fitness of the population, w-=∑i=14∑j=14xixjwij, (3) w14is the fitness of a double heterozygote, r is the recombination rate and D is linkage disequilibrium between the two loci. These equations assume random mating, non-overlapping generations and that fitness depends only on two-locus genotype and not on whether the chromosome was maternally or paternally inherited (i. e. wij = wji). To model changes in allele frequencies over time, we developed a custom R script (available from github: https: //github. com/melop/twolocusmodel). Iterating through the change in allele frequencies each generation as a result of selection gives the expected patterns of fixation at incompatibility loci without genetic drift (S4 Fig. ; see also [48]). The deterministic two-locus model of fixation of hybrid incompatibilities does not realistically predict expected patterns in natural populations because even large populations will have some level of genetic drift. To model drift, we added multinomial sampling of N diploid individuals and recalculated allele frequencies each generation (available from github: https: //github. com/melop/twolocusmodel). Patterns of fixation incorporating genetic drift through multinomial sampling show similar dynamics to the model lacking genetic drift, with the exception of several equilibrium states specific to the latter (see S5 Fig., S2 Text). Exact results for more than two loci have proven difficult to obtain [96–99]. As a result, we developed a custom c++ program, called admix’em (github: https: //github. com/melop/admixem), to simulate more complex scenarios. The code allows one to specify the number and length of chromosomes and the genomic locations of hybrid incompatibilities and neutral markers. The current implementation assumes non-overlapping generations and diploid sexual individuals. When modeling linkage, we assume a uniform recombination rate and one recombination event per chromosome per meiosis. Unless otherwise specified, we model all pairs of hybrid incompatibility loci as unlinked. As we are interested in short-term dynamics, we do not implement mutation. Selection coefficients are assigned to particular allelic combinations according to a hybrid fitness matrix (see S1 and S2 Figs). Based on each individual’s genotype at the hybrid incompatibility loci, we calculate total individual fitness w, defined as the probability of survival of that individual. Total fitness across multiple incompatibility pairs is assumed to be multiplicative. Each female mates with one randomly selected male (but we also accommodate assortative mating, see S6 Text), and produces a Poisson distributed number of offspring with a mean = 2. After selection, if the carrying capacity (N) is not reached, additional offspring from the same mating events are drawn from a Poisson distribution with a new mean = (carrying capacity—current population size) /number of females. This process is repeated until carrying capacity is reached or females have no available gametes (set to a maximum of 10). A potential concern with this approach for maintaining a constant population size is that it could artificially preserve a hybrid population that would otherwise be ephemeral by continuing to sample offspring (up to 10 per female in our simulations). However, because parentals are present in each population (see below, at 50% frequency each parental species in the initial population), this allows for out-competition of hybrids by parentals when hybrid fitness is low. All reported results are based on 500 replicate simulations, which were conducted for 2000 generations. In the majority of simulations (except S3 and S4 Texts) the hybrid population is initially colonized by 500 individuals of each parental species. Hybrid and parental populations were modeled as spatially distinct with migration parameters between them; most simulations specified one hybrid population formed between two parental populations (S3 Fig.) but we also simulated a stepping-stone model and a model with multiple independently formed hybrid populations (S6 Text, S13–S14 Figs). In simulations with migration, the number of migrating individuals each generation was determined by drawing from a binomial distribution with a mean equal to the number of migrating individuals. Details on individual simulations and results can be found in the supporting text. Hybrid populations are considered to have evolved reproductive barriers from both parental species if they fix at least one incompatibility from each parental type; the strength of reproductive isolation between hybrids and parental species will depend on the selection coefficient and number of incompatibilities.

Title: Reproductive Isolation of Hybrid Populations Driven by Genetic Incompatibilities Summary: Understanding the origin of species is one of the central challenges in evolutionary biology. It has been suggested that hybridization could generate new species because hybrids can display novel combinations of traits that induce reproductive isolation from their parental species (called "hybrid speciation"). Existing models predict that this should only occur in special cases, and indeed there have been only few well-supported examples. We describe a new model of hybrid reproductive isolation that results from selection against genetic incompatibilities in hybrids, which are predicted to be common. Simulations reveal that hybrid populations rapidly and frequently become isolated from parental species by fixing combinations of genes that hinder successful reproduction with parental species. We propose that this process could be an important mechanism for the formation of new species.

lay_plos

en

Summarize: Image copyright Getty Images Image caption Francisco Rivera Ordonez is from a family of bullfighters A Spanish bullfighter has been referred to prosecutors after he posted a picture of himself training while carrying his baby daughter. Andalusia's Ombudsman for Children's office said it showed a "situation of unnecessary risk to a minor". Animal rights activists and others have branded Francisco Rivera Ordonez "irresponsible" and "an idiot". But fellow bullfighters have tweeted their support and shown pictures of other children around the animals. A caption accompanying the photograph, which was uploaded to Instagram on Monday, refers to the episode as the five month old's "debut". Mr Rivera has responded to the row by saying: "She is never going to be safer than she is in my arms." However, the Andalusian authorities said they "totally rejected" his actions and had referred the case to prosecutors. "We hope that such behaviour is not repeated and that the social media reaction ensures that it is not accepted as normal," the ombudsman's office said in a statement (in Spanish). Image copyright Twitter Image copyright Andres Sanchez/Twitter Image caption Matador Andres Sanchez posted this photo with his son in support of Mr Rivera The move followed a storm of criticism online. "Putting your daughter in danger, even if it is a calf, I don't understand," wrote one person quoted by El Pais. "If I were your wife, I'd kill you," read another message. British comedian Ricky Gervais, a well known animal rights campaigner and bullfighting critic tweeted that he "sorta fused animal abuse with child abuse" before deleting the post, according to El Pais. But he later tweeted that bullfighting was "mental, dangerous and cruel. With or without a baby". 'Respect our values' However, Mr Rivera has been staunchly defended by other bullfighters, who have posted their own images of them holding children in the ring. "What's the problem in showing our children a profession that we love and is filled with values?" tweeted bullfighter Manuel El Cordobés Díaz. "With my nephew in support of @paquirri74," tweeted Álvaro Oliver. "Respect our life, respect our values." "With my wife Elisabet Pinero's permission, I'm sending my support to @paquirri74 with this photo with Rodrigo taken three days ago," tweeted Andres Sanchez. However, the Spanish animal rights group Pacma tweeted that bullfighters were "entrenched in error" and were "violating moral principles". One of the country's most popular bullfighters, Mr Rivera is taking a break from professional fights since he was gored through the stomach by a bull in August 2015. His father, known across Spain as Paquirri, was gored to death by a bull in 1984, at the age of 36. Tweet with a location You can add location information to your Tweets, such as your city or precise location, from the web and via third-party applications. You always have the option to delete your Tweet location history. Learn more There are things you can't do with babies in public any more, at least without the risk of being flamed on social media. Like smoke in their faces. Or show them to a crocodile, as the late Steve Irwin did. Or dangle them off a balcony, as the late Michael Jackson did. To that growing list we can now add, fight a bull. A Spanish matador, dubbed the "David Beckham of bullfighting", has provoked outrage after posting a picture of himself on Instagram at work with his five-month-old daughter. To him, having his daughter on his hip while he practised on a young bull meant honouring a family tradition. Bullfighter sparks uproar in Spain over image with five-month-old daughter but responds: ‘There is no safer place for her’ There are everyday parenting dilemmas, and then there is this one: when fighting a large, wounded bull in a ring, is it appropriate to carry your five-month-old daughter in your arms? That question is at the centre of a spirited debate in Spain, where one of the country’s most famous bullfighters has come under fire after posting a photograph of himself doing just that. Francisco Rivera Ordóñez captioned the photo, posted on his Instagram feed, “Carmen’s debut”. But following widespread criticism from animal rights groups and public figures, the child protection agency in his native Andalucía has confirmed it is investigating whether he has broken any laws. The baby in the bullring – have you ever taken your child into an unsuitable workplace? Open thread Read more “It isn’t right in any circumstances to put a child at risk,” said Alfonso Alonso, the acting minister of social security. Rivera was also criticised by María José Sánchez, the equality minister, who said: “A fireman wouldn’t dream of taking a child to put out a fire nor would a football player run around with a child in their arms during a match.” Rivera insists he did not put his daughter at risk, saying: “There is no safer place for her to be than in my arms. This is Carmen’s debut, the fifth bullfighting generation in my family. My grandfather did the same with my father, my father with me and me with my daughter Cayetana, and now Carmen.” But appealing to his own family history may not offer the most obvious proof of bullfighting’s safety. His father, the famous torero Francisco Rivera Pérez, known as “Paquirri”, was fatally gored by a bull in 1984 at the age of 36, while Rivera himself underwent life-saving surgery last year after he was gored in the stomach during a fight. The animal rights group PACMA described his actions as shameful and said it was not the way to teach children respect for animals. There was also widespread criticism on social media in Spain and abroad. “Beautiful image of Fran Rivera taking his daughter to ‘work’ with the torture of innocent animals,” wrote one Twitter user. “If I were your wife, I would kill you,” commented another. The comedian and animal rights campaigner Ricky Gervais said the picture was “dangerous and cruel. With or without the baby”. But Rivera was defended by his fellow bullfighters, who took to social media to post photographs of themselves also holding their children in the ring. “What’s the problem in showing our children a profession that we love and is filled with values?” wrote Manuel Díaz, known as “El Cordobés”, alongside a picture of him carrying his young daughter. “With my nephew, in support of @Paquirri74 [Rivera] in respect of our life … our values …” wrote Alvaro Oliver. A third, Andres Sanchez, posted an image of himself with a bull and a small boy in his arms, saying: “With the support of my partner Elisabet Piñero sending my support to @Paquirri74 with this photo taken three days ago with Rodrigo.” Bullfighting remains an important cultural tradition for many Spaniards but it has attracted increasing criticism in recent years, with many seeing it as a cruel anachronism divorced from the country’s current economic reality. In November, a petition signed by more than 430,000 people was delivered to Spain’s ministry of education protesting at plans by the conservative government to introduce a two-year bullfighting course in state schools for students aged 15-17. “They want to perpetuate a tradition that is in decline … by teaching 15-year-old children to torture animals, making a mockery of the already damaged reputation of the Spanish education system,” wrote Carlos Moya Velázquez, the petition’s founder. It was Spain’s ‘national fiesta’. Now bullfighting divides its people Read more The ruling People’s party has long been an ally to bullfighting, and in 2013 it took the first steps towards having it classified a key part of the country’s cultural heritage, as figures showed the pastime was undergoing a historic decline. Rivera comes from a long line of bullfighters – aside from his father, his maternal grandfather, Antonio Ordóñez, was idolised by Hemingway and was the subject of his book The Dangerous Summer, while his great-grandfather, great uncle, brother and cousin were or are fighters. His first wife, Eugenia Martínez de Irujo, with whom he has an older daughter, is Duchess of Montoro and the daughter of the late Duchess of Alba, a colourful figure who was the world’s most titled aristocrat, according to the Guinness Book of Records. Carmen, the baby in the photograph, is the daughter of his second wife, Lourdes Beatriz Montes Parejo. There was an outcry among his fellow bullfighters when in 2009 Rivera was awarded a fine arts medal by the ministry of culture, which praised his “more aesthetic, poised and deep” technique. A number of his fellow fighters returned their medals to the ministry in protest, saying the ministry had “degraded the notion of bullfighting as an art”. Speaking to the New York Times at the time, Vicente Zabala de la Serna, a bullfighting critic for the newspaper ABC, said: “Rivera’s faced a lot of bulls, and for that he deserves credit. But he’s boring to watch; he has no aesthetic merit.”

Summary: Even if Spain celebrates "Take Your Child to Work Day" like we do, people are shocked over a matador's decision to bring his infant daughter into the bullfighting ring. Francisco Rivera Ordonez, called the "David Beckham of bullfighting" in the Sydney Morning Herald, is catching heat for an Instagram photo he posted showing him fighting a bull with his 5-month-old daughter in his arms, the Guardian reports. Titled "Carmen's debut," the pic has generated plenty of outrage, with people online calling Ordonez an "idiot" and "irresponsible," per the BBC. "If I were your wife, I'd kill you," one message read. Ricky Gervais, who the BBC notes is a staunch animal-rights advocate, tweeted: "Mental, dangerous & cruel. With or without a baby." The Andalusian child protective agency is now looking into Ordonez's antics, with an ombudsman office saying the pic showed a "situation of unnecessary risk to a minor." "A fireman wouldn't dream of taking a child to put out a fire, nor would a football player run around with a child in their arms during a match," a Spanish pol tells the Guardian. But Ordonez, who followed up with another pic of his own dad holding him as a child in the bullfighting ring, says Carmen is "the fifth bullfighting generation in my family" and that "there is no safer place for her to be than in my arms." (The BBC notes Ordonez's dad was gored to death by a bull at age 36.) Other bullfighters have been backing him up, posting their own pics to social media showing them in the field with their own kids. "What's the problem in showing our children a profession that we love and is filled with values?" one cape-clutching comrade wrote on Twitter.

multi_news

en

Write a title and summarize: Using a model for the dynamics of the full somatic nervous system of the nematode C. elegans, we address how biological network architectures and their functionality are degraded in the presence of focal axonal swellings (FAS) arising from neurodegenerative disease and/or traumatic brain injury. Using biophysically measured FAS distributions and swelling sizes, we are able to simulate the effects of injuries on the neural dynamics of C. elegans, showing how damaging the network degrades its low-dimensional dynamical responses. We visualize these injured neural dynamics by mapping them onto the worm’s low-dimensional postures, i. e. eigenworm modes. We show that a diversity of functional deficits arise from the same level of injury on a connectomic network. Functional deficits are quantified using a statistical shape analysis, a procrustes analysis, for deformations of the limit cycles that characterize key behaviors such as forward crawling. This procrustes metric carries information on the functional outcome of injuries in the model. Furthermore, we apply classification trees to relate injury structure to the behavioral outcome. This makes testable predictions for the structure of an injury given a defined functional deficit. More critically, this study demonstrates the potential role of computational simulation studies in understanding how neuronal networks process biological signals, and how this processing is impacted by network injury. Understanding networked and dynamic systems is of growing importance across the engineering, physical and biological sciences. Such systems are often composed of a diverse set of dynamic elements whose connectivity are prescribed by sparse and/or dense connections that are local and/or long-range in nature. Indeed, for many systems of interest, the diversity in connectivity and dynamics make it extremely challenging to characterize dynamics on a macroscopic network level. Of great interest in biological settings is the fact that such complex networks often produce robust and low-dimensional functional responses to dynamic inputs. Indeed, the structure of their large connectivity graph can determine how the system operates as a whole [1,2]. Neuronal networks, in particular, may encode key behavioral responses with low-dimensional patterns of activity, or population codes, as they generate functionality [3–8]. Unfortunately, all biological networks are susceptible to pathological and/or traumatic events that might compromise their performance. In neuronal settings, this may be induced by neurodegenerative diseases [9–11], concussions, traumatic brain injuries (TBI) [12–14] or aging. In this work, we extend a computational model to investigate behavioral impairments in the nematode C. elegans when the underlying neuronal network is damaged. Specifically, we consider how the low-dimensional population codes are compromised under the impact of an injury. Characterizing the resulting cognitive and behavioral deficits is a critical step in understanding the role of network architecture in producing robust functionality. A hallmark feature of damaged neuronal networks is the extensive presence of Focal Axonal Swellings (FAS). FAS has been implicated in cognitive deficits arising from TBI and a variety of leading neurological disorders and neurodegenerative diseases. For instance, FAS is extensively observed in Alzheimer’s disease [10,11], Creutzfeldt-Jakob’s disease [15], HIV dementia [16], Multiple Sclerosis [17,18] and Parkinson’s disease [19]. Most concussions and traumatic brain injuries also lead to FAS or other morphological changes in axons [20–25]. Such dramatic changes in axon geometry may disrupt axonal transport [26,27], and can potentially hinder the information encoded in neural spike train activity [28–30]. Injured axons thus provide an important diagnostic marker for the overwhelming variety of cognitive and behavioral deficits [9,28,31], in animals and humans [23,32–34]. The massive size of human neuronal networks and their complex activity patterns make it difficult to directly relate neuronal network damage to specific behavioral deficits. C. elegans, in contrast, has only 302 neurons, and its stereotyped connectivity (i. e. the worm’s “Connectome”) is known [35]. This relatively small neuronal network generates a limited and tractable set of functional behaviors (see Table 1 of [36]), with much of its locomotion/crawling behavior approximately confined to five observable motor states related to forward and backward crawling, omega turns, head sweeps and brief pause states. Furthermore, these behaviors are well described as a superposition of only a few principal component body-shape modes [37]. The combination of a fully-resolved neuronal network and a tractable low-dimensional output space makes C. elegans an ideal model organism for studying the impact of network damage on behavioral deficits. Indeed, it is the only such neuronal network model currently available allowing for such a direct translational study of network damage (injury) to behavioral responses. More precisely, computational models of C. elegans nervous system dynamics for the full or partial connectome successfully generate motorneuron outputs that can be related to behavior [38], allowing for interpretable outputs even without accounting for muscular, mechanical or environmental factors, e. g. [39]. We consider the model in [39], which applies a single-compartment membrane model to the full somatic connectome; neurons are approximated as passive linear units connected by linear gap junctions and nonlinear chemical synapses. Synaptic activation depends sigmoidally upon pre-synaptic voltage in equilibrium, and approaches this equilibrium value linearly in time. All neurons are approximated as identical, with order-of-magnitude parameter assignments, except for their connectivity data. Fig 1 (a) demonstrates a simulation of the putative forward crawling behavior identified in [39] within this model of C. elegans neural dynamics along with its projection onto principal component body-shape modes [37]. In this perspective, we understand forward crawling as corresponding to a limit cycle (i. e. a closed periodic trajectory) in the principal component space of simulated neural recordings. Extending this framework to damaged networks as in Fig 1 (c) allow us to explore how axonal pathologies lead to impaired functionality and behavioral deficits. Even in our idealized injury simulations, the network’s impaired activity displayed significant variability. This highlights one of the most challenging aspects of the field: the need for effective metrics to distinguish different types of behavioral deficits. We propose such a criterium by using techniques borrowed from statistical shape analysis to quantify distortions in the main features of dynamical activity. This metric is shown to be related to the functional outcome of an injury. We further apply classification trees to our results to relate functional deficits to specific patterns of FAS. This leads to experimentally-testable predictions about the effects of neuronal network-damage to the crawling motion of C. elegans and potentially new avenues for clinical diagnostics. Indeed, our studies show that network damage leads to a diversity of dynamical/behavioral deficits. We investigate how network distributed FAS as illustrated in Fig 1 (c) may affect its ability to generate desired responses to an input. Network features associated with behavioral outcomes are best understood in model organisms such as the C. elegans since it has a limited repertoire of functional responses that include forward and backward crawling, omega turns, head sweeps and brief pause states. Our focus in these studies will be on the behavior of forward crawling since a variety of experimental ablation studies have identified key neurons associated this functionality. For instance, stimulation of PLM neurons excites densely-connected interneurons, which in turn, activate motorneurons responsible for forward body motion [40]. Experimentally, optogenetic stimulation of the PLM neurons directly induces a forward motion response [41,42]. Details of the underlying neurocircuitry were found by a series of ablation studies, where the functional role of a neuron is evaluated by disconnecting it from the network and observing behavioral deficits [39,43]. The coordinated body motion of a crawling worm is well documented in videos and its postural dynamics were revealed by principal component analysis to consist of only a few dominant modes [37]. Specifically, the sinusoidal body-shape undulations which describe the worm’s forward motion is well-described by circular trajectories (limit cycles) on the phase-space of its first two principal components. An analogous mathematical form is present in the collective motorneuron dynamics following PLM stimulation [39]. This commonality suggests that observed behaviors do retain fundamental signatures of the underlying network dynamics. We show such a trajectory for (simulated) motorneuron responses to PLM excitation in Fig 1 (a). This low-dimensional representation captures 99. 3% of the total energy of the system, and can be artificially mapped to crawling body-shape modes. Although this mapping is still far from a mechanistic description of the worm’s coordinated body movement, we believe it captures important aspects of the crawling behavior. See the Methods section for details. Importantly, functional deficits of the C. elegans dynamics are understood as excursions/perturbations from the ideal limit cycle trajectory. Damaged networks will be shown to fail to produce the low-dimensional output codes necessary for generating the optimal forward crawling limit cycle. The robustness of the dynamical signatures (population codes) associated with behavior are investigated in injured neuronal networks. Our injury statistics and FAS models are drawn from state-of-the-art biophysical experiments and observations of the distribution and size of FAS. Fig 2 shows prototypical FAS injuries from stretching [26] and TBI in the optic nerve of mice [25]. Fig 2 (d) shows a histogram of the probability of injury and size of the FAS. These are used in our computational model [39]. In a simulated injury, we assign to each affected neuron an axonal swelling from the distribution in Fig 1 (b). Values are scaled by an (overall) injury intensity parameter μ, such that 1 + μ ∝ E swollen axon area healthy axon area (1) Fig 1 (c) exemplifies different injury settings: μ = 0 reproduces the original (uninjured) network, and lower/higher values of μ correspond to mild/severe injuries. The presence of axonal swellings ultimately distorts the forward-motion limit cycle dynamics. Fig 3 shows dynamical anomalies for different connectome injuries. Notice how they induce qualitatively different changes to the closed orbit regarding location, size and shape. Fig 3 (c) reproduces the specific simulated ablations from [39], leading again to different dynamical effects. A much larger ensemble of simulations (1,447 randomly-chosen injuries, as well as the code necessary to generate more) and their corresponding effects to fundamental low-dimensional structures are included in the Supporting Materials. Increasing values of μ typically shrink and shift the limit cycles within the plane. In all simulations, there was always a sufficiently high injury level in which μ * = {injured limit cycle collapses into a stable fixed point } (2) This occurs for instance, in Fig 3 (b) when μ = 3. 80. Recent blast injury studies on C. elegans show that many of the nematodes display temporary paralysis before recovering to crawling behaviors [45]. We would suggest that during the peak of the FAS, the injury levels on many of the nematodes are above μ*, thus leading to a collapse of a limit cycle to a fixed point where no motion is possible, i. e. it is in a paralyzed state. Despite their common statistical distribution, randomly drawn injuries induce qualitatively different changes in the shape of the limit cycle. Additional distorted sets are shown in the rows of Fig 4 (along with 1,447 random-injury simulation sets in the Supporting Materials). Thus, random injuries of equitable strength can lead to significantly different behavioral deficits. Importantly, the deformation of the two-dimensional limit cycle can be used to characterize such functional differences. To distinguish dynamical signatures of potentially different functional deficits, we evaluate the Procrustes Distance (PD) between healthy and injured limit cycles. The PD is an important tool from statistical shape analysis to measure the similarity between two shapes after discounting effects due to translation, uniform scaling, or rotation. Fig 4 depicts PD values for pairs of healthy/injured limit cycles as a function of injury level μ. All curves are plotted until the injured limit cycle collapses into a fixed point (μ = μ*), and the colored dots in the rightmost plots correspond to the same-colored limit cycles on the left plots. Recent experimental work which induced mild TBI in C. elegans found that increasing the number of shock waves to which the worm was exposed reduced the worm’s average speed and, in many cases, led to temporary paralysis [45]. The results of our simulations can be compared to these results: In Fig 5 we plot the location of the fixed points into which limit cycles collapse (the “endpoints”, occurring at injury level μ = μ*). We consider the following question: does the location of this endpoint (and thus the behavioral outcome of the injury) relate to the PD curve, and does it relate to the structure of the injury itself? Towards this end, we construct two simple classes of behavioral outcomes: endpoints which end in either the “upper” or “lower” part of the distribution (for which we label the endpoints as red and green, respectively). Panel (b) of Fig 5 shows the average PD curve for the two classes. They are qualitatively different: the average PD curve of “upper” endpoints is smoothly rising, whereas the average PD curve of “lower” endpoints has an extended declining region. Shown also are the average scaling factor and translation distance of the distorted cycles. Unlike the average PD curves, these change monotonically and are not distinct between classes. This suggests that the shape of the PD curve carries information about the functional outcome of the injury. We quantify this by fitting a classification tree to predict the endpoint class from the shape of the PD curve: this was found to predict endpoint class with a cross-validation error of 22. 0%. By comparison, randomly shuffling the labels leads to nearly double the cross-validation error, with an average of (44. 6 ± 1. 4) %. Of even greater interest is any possible relationship between injury structure and behavioral output which could, given a specific pattern of distorted dynamics, make predictions about the class of neural injury. To this end, we fit a classification tree to predict the endpoint class from the injury. Fig 6 shows a classification tree which predicts endpoint class with a cross-validation error of only 14. 6%. This is much less than the error from a random class, suggesting that we can meaningfully relate the structure of a specific injury to a specific behavioral outcome. Classification trees provide a highly interpretable and predictive method for making this connection, and make specific experimental predictions for the injuries corresponding to functional deficits. The dynamic model for the C. elegans connectome simulates its neuronal responses to stimuli with a number of simplifications aimed at keeping the number of parameters at a minimum: we use a fairly standard and simple single-compartment membrane equation, and treat all neurons as identical save for their connectivity. Many neurons in the network are nearly isopotential [46,47], and it is a common and reasonable simplification to model neurons via single-compartment membrane equations, with membrane voltages as the state variables for each neuron. Given this, Wicks et al. constructed a single-compartment membrane model for neuron dynamics [48], which we later extended to incorporate connection data for the full somatic connectome [39]. We assume that the membrane voltage dynamics of neuron i is governed by: C V i ˙ = - G c (V i - E c e l l) - I i G a p (V →) - I i S y n (V →) + I i E x t (3) The parameter C represents the whole-cell membrane capacitance, Gc the membrane leakage conductance and Ecell the leakage potential of neuron i. The external input current is given by I i E x t. Note that this is, essentially, a fairly standard single-compartment membrane equation [49], and its governing equations are formally identical to that used by Wicks et al. [48] except for our use of the full somatic connectome, our simplifying parameter assumptions, and minor differences in the treatment of synaptic dynamics taken from [50]. In all simulations within this paper, we set I i E x t to be constant for the PLM neuron pair and zero for all other neurons. This assures that densely connected interneurons will stimulate the motorneuron subcircuits responsible for forward crawling behavior. Neural interaction via gap junctions and synapses are modeled by the input currents I i G a p (V →) (gap) and I i S y n (V →) (synaptic). Their equations are given by: I i G a p = ∑ j G i j g (V i - V j) (4) I i S y n = ∑ j G i j s s j (V i - E j) (5) We treat gap junctions between neurons i and j as ohmic resistances with total conductivity G i j g. We assume that I i S y n is also modulated by a synaptic activity variable si, which represents the conductivity of synapses from neuron i as a fraction of their maximum conductivity. This is governed by: s i ˙ = a r ϕ (v i; β, V t h) (1 - s i) - a d s i (6) Here ar and ad correspond to rise and decay time, and ϕ is the sigmoid function ϕ (vi; β, Vth) = 1/ (1 + exp (−β (Vi − Vth) ) ). This form of sigmoidal activation is taken from [50]. Note that it can be shown (by setting s ˙ = 0) that, as in [48], the equilibrium value of si depends sigmoidally upon Vi. We keep all parameter values from [39] (see Table 1. The Connectome data, consisting of the number of gap junctions N i j g and number of synaptic connections N i j s, are taken from Varshney et al. [35] (as available on WormAtlas [51]). As in that study, we consider only the 279 somatic neurons which make synaptic connections (excluding 20 pharyngeal neurons, and 3 neurons which make no synaptic connections). Each individual synapse and gap junction is assigned an equal conductivity of g = 100pS (such that G i j g = g · N i j g and G i j s = g · N i j s). The values of cell membrane conductance and capacitance are affected by injuries, but in the uninjured case are set as equal for all neurons with values of Gc = 10pS and C = 1pF. Note that in uninjured simulations, all neurons are modeled as identical except for their connectivity and the assignment of them as excitatory or inhibitory (where Ej will have one of two values corresponding to these classes). The model is valuable because it generates a low-dimensional neural proxy for behavioral responses. Specifically, constant stimulation of the tail-touch mechanosensory pair PLM creates a two-mode oscillatory limit cycle in the forward motion motorneurons [39]. This same dynamical signature was revealed in video analysis of the body-shape of the crawling worm [37]. Thus the model is consistent with the observed biophysics. Specifically, we calculate this plane by first simulating the forward-motion motorneuron membrane voltages (class DB, VB, DD, VD) in response to a PLM Input of IPLML, IPLMR = 2 × 104 Arb. Units for the uninjured model. We take time snapshots these membrane voltages V → M (t), collect them into a matrix V, and take that matrix’s singular value decomposition. That is: V = [ V → M (t 0), V → M (t 1) … ] = P · Σ · Q T (7) where P and Q are unitary and Σ is diagonal. The columns of P are the principal orthogonal modes. As in [39], the first two of these modes (the first two columns of P) almost entirely capture the dynamics of the system within this subspace under constant PLM stimulation. Projection of the full-system dynamics onto this plane consists of projecting the system’s motorneuron dynamics onto these modes. Note that the single-compartment model which we employ ignores the spatial extent of neurons and specific location of each connection. Our simplified injury model therefore must treat injury as a whole-cell effect. Focal Axonal Swellings (FAS) increase the volume of an axon, which in turn, should alter the cell’s capacitance and leakage conductance within our model. If we approximate a neuron by a single cable of length l and constant cross-section a, we may assume that the circuit parameters will scale with the axonal volume, i. e., C ∝ a · l (8a) G c ∝ a · l (8b) When an axon swells, its healthy cross-sectional area aH will increase to some swollen value ai > aH. Thus we assume that the healthy values for capacitance C and conductance Gc will also change according to C i = C · (a i / a H) = C · (1 + μ · m i) (9a) G i c = G c · (a i / a H) = G c · (1 + μ · m i) (9b) We define the individual damage mi to neuron i as proportional to the relative excess area from swelling, i. e., mi ∝ (ai − aH) /aH. Values of mi are computed from the experimentally derived distributions in Fig 2. Specifically, we construct FAS from the axonal swelling data of Wang et al. [25], which used confocal microscopy to measure injury-induced swellings in the optic nerve of Thy1-YFP-16 mice. Taken together, these define an “injury vector” m →, which we then normalize to | | m → | | 2 = 1. After normalizing, the injury vector is then scaled by a global injury intensity defined as follows: μ = ⟨ a i / a H ⟩ - 1 ⟨ m i ⟩ (10) Mild traumatic brain injuries yield small values of μ indicating that the average area of swollen axons is small. Severe brain injuries yield high values of μ, indicating that large swellings are more common. We leave the PLM pair of neurons receiving input uninjured. All other neurons have their mi values assigned from the experimental statistical distributions. The governing equation for an injured neuron is now C V i ˙ = - G c (V i - E c e l l) - (I i G a p (V →) + I i S y n (V →) ) / (1 + μ · m i) (11) We can readily interpret the limiting cases: when μ ⋅ mi = 0, the original governing equation is recovered, and thus μ = 0 corresponds to the healthy case. When μ ⋅ mi is large, gap junction and synaptic currents have no effect. The neuron’s voltage decays exponentially to its leakage potential, effectively isolating it from the network. Note that our random assignment of swelling values neglects any spatial structure of the injury. This could be easily modified by using a distribution which depends on the spatial location of the neuron. Furthermore, this is a very simple model for neuronal swelling, in keeping with our simple model for neurons. It necessarily neglects the actual geometry of swelling. The use of a multi-compartment model would enable this in future studies. Ultimately, there is currently limited biophysical evidence for making more sophisticated models. As such, we have tried to capitalize on as many biophysical observations as possible so as to make a model that is consistent with many of the key experimental observations. We use MATLAB (version R2013a) to solve the system of neuronal dynamical equations via Euler’s method, using a timestep of 10−4s. We consider an ensemble of 1,447 different types of injury (set of targeted neurons), for which the global intensity μ may vary from 0 (uninjured) to a critical value μ*. When the intensity exceeds μ* (found by a bisection algorithm), the limit cycle collapses to a fixed point. To obtain intermediate values, we perform five simulations linearly spaced throughout (0,0. 9μ*) and ten additional simulations throughout (0. 9μ*, μ*). We classify the resulting injured trajectories as a Fixed Point or a Periodic Orbit according to the following criteria: Note that these criteria classify very small periodic orbits as fixed points, since their behaviors are very similar. The method may also classify sufficiently slow, long-timescale oscillatory transients as periodic. These tests ignore the first 5 seconds of simulation time (50,000 timesteps), chosen heuristically as a typical timescale of transient decay. After this initial wait, we check the criteria at the end of each subsequent 5 seconds of simulation time until convergence is detected. The results were not observed to be sensitive to the length of this interval. Stephens et al. [37] found that the forward crawling motion of C. elegans is well described by two principal component body-shape modes called eigenworm modes. When moving forward, the modes alternate within its phase space forming a limit cycle. Kunert et al. [39] also found a two-dimensional limit cycle, but for the collective motorneuron activity after PLM stimulation. They interpret this similar dynamical signature as a neuronal analog to the observed behavioral pattern. To interpret the distorted neural activity caused by our simulated injuries, we construct a map from the neuronal activity plane onto the eigenworm plane. The body-shape modes were extracted from Figure 2 (c) of [37]. We first calculate the optimal linear mapping of the healthy trajectory onto a circle (see Fig 3a). We then use this calibration for all other trajectories. This artificially translates anomalous neuronal responses to anomalous body motions. Our procedure has a number of limitations, for which we list a few: The lack of direct neuronal analogs for injured network modes limits our ability to interpret arbitrary impaired behavioral responses. Further computational work could also find neuronal proxies for additional behavioral modes so as to enable a more complete mapping. Recent work on blast injuries of worms [45] could potentially help extend the analysis by providing injured eigenworm mode projections. Procrustes Distance (PD) measures the dissimilarity between shapes, and in our context, we wish to compare the shape of the trajectories of the healthy neural responses (circular orbits in the phase plane) with the distorted ones produced after simulated injuries. For that, we use the function procrustes. m from MATLAB’s Statistics and Machine Learning Toolbox. We collect N data points from each trajectory and annotate their (x, y) coordinates in a (2 × N) shape matrix S. The PD between two distinct shapes SA and SB is given by P D = min b, R, c ∥ S B - b · S A · R + c → ∥ 2 (12) In other words, it finds the optimal (2D) rotation matrix R, scaling factor b > 0, and translation vector c → to minimize the sum of the squares of the distances between all points. Intuitively, it compares shapes discounting translation, rotation, or scaling. To calculate the PD curves as in Fig 4, we use the uninjured (μ = 0) limit cycle as our first shape SA. The second shape SB is the limit cycle calculated for each injury at the indicated value of μ. We pre-process the trajectories to extract data points only within a single period. Since injuries usually distort the trajectory length, we use MATLAB’s spline. m function to interpolate them and collect the same number of data points. Both limit cycles must also be phase-aligned, which we achieve by finding the phase that minimizes the Procrustes Distance. We hypothesize that both the injury itself and the PD curves contain meaningful signatures of behavioral outcomes of a given injury. For example, there is always a critical injury level μ = μ* in which the injured response collapses into a fixed point. Our artificial map suggests that this endpoint location corresponds to the shape of a paralyzed worm. We thus wish to relate endpoint location to (1) the shape of the PD curve, and to (2) the injury vector m →. For these purposes, we classified the endpoints simply by dividing the endpoint distribution along its major axis. Specifically, we take the distribution of endpoints in Fig 5, calculate the leading principal orthogonal mode (via taking the Singular Value Decomposition, as mentioned earlier), and classify the points by the value of their projection onto this mode (where we arbitrarily classify projection values ≥ −0. 01 as the “upper plane” and < −0. 01 as the “lower” plane). Given this definition, 63. 2% of the points lie within the upper plane, and 36. 8% lie in the lower plane. Note that all of the forthcoming analysis could be equally well applied to any other output feature, and so we choose this classification for its relative simplicity. We calculate the average PD curve within each class. Since the PD curves may have a different number of points, we first pre-process them. Specifically, we normalize the maximum μ and Procrustes Distance to 1 for all curves, and then interpolate them using MATLAB’s spline. m such that all curves have the same number of points. We then simply take the average and standard deviation to obtain the average curves shown within Fig 5. This figure also plots the average scaling and translation curves as a function of injury level, for each class. Scaling factors (i. e. the factor by which the size of the distorted limit cycle has decreased from the original cycle) are given as an output of MATLAB’s procrustes. m as used above. Translation distance is found by calculating the location of the mean of each distorted cycle, and then calculating the distance by which this mean is displaced from the origin. These curves are then normalized, interpolated and averaged, yielding the average curves in Fig 5. Note that, unlike the PD curves, translation and scaling are monotonic and not distinct between classes, and thus they do not carry the same information about the functional outcome of the injury. We use the ClassificationTree class from MATLAB’s Statistics Toolbox (version R2013a). Fitting and cross-validation are performed using the included methods ClassificationTree. fit and kfoldLoss with default settings (10 folds). The minimum leaf size was set by calculating cross-validation error over a range of minimum leaf sizes (see Fig 6b). For both PD curves and Injuries, cross-validation errors are optimal at a minimum leaf size of around 40. We use this minimum leaf size for all fits. The classification tree that uses normalized PD Curve Shapes to predict the endpoint class yield a cross-validation error of 22. 0%. We can compare this to the random case (i. e. the case where PD Curve Shape has no relationship to the class) by repeating this analysis with randomly shuffled class labels. For 100 trials with randomly-shuffled labels, the observed cross-validation error was 43. 8 ± 1. 4%. Injury vectors were also used to fit classification trees for predicting endpoint classes (see Fig 6). The cross-validation error of 14. 6% was significantly lower in this case, while the randomly-shuffled labels analysis returned a error of 44. 6 ± 1. 3% (consistent with the random error above). In both cases we observe that the cross-validation error is far below what we would expect if the data had no relation to the classes. Thus we can predict (with cross-validated accuracy exceeding 85%) the region into which the endpoint will fall given a specific injury. Moreover, the classification tree in Fig 6 is very simple to interpret and depends on only three neurons: ALML, AVM and SDQL. As per WormAtlas [51], all three of these neurons have sensory functions (ALML and AVM are mechanosensory; SDQL is an interneuron but is oxygen-sensing). Simulated injuries distort dynamical signatures in the network’s activity, such as limit cycles. Our Procrustes Distance metric quantifies how much the shape of the limit cycle is distorted, compared to the healthy cycle. Our results indicate that as different injuries evolve, this metric follows qualitatively different trends (as in Fig 4). In all trials, a sufficiently high injury level μ = μ* collapses the limit cycle into a stable fixed point. The shape of the PD curve helps inform the location of this fixed point (as in Fig 5). This suggests that the shape of the PD curve, as the injury evolves, may help predict the eventual behavioral outcome (e. g., the body shape the worm will assume during temporary paralysis). Thus we have prescribed a method to monitor the dynamics of the injured worm and the implications of the injury as it evolves. Finally, our classification trees divides neural injuries into two distinct classes of functional outcomes (i. e. endpoints in the “lower” or “upper” portions of the distribution). Its cross-validation predictive accuracy is over 85% and implicates only three specific neurons (ALML, AVM, and SDQL). This relationship between injury structure and behavioral outcome is simple, interpretable and testable. Such trees can be fit for arbitrary injured behaviors and could be used more broadly for any given model of injured full-Connectome dynamics. The metrics and methods described in this work can potentially be used to construct diagnostic tools capable of identifying a variety of cognitive deficits. Moreover, the severity of a TBI injury and/or neurodegenerative disease can be quantified by measuring its metric distance from the normal/healthy performance. Our work gives clear mathematical tools capable of formulating such diagnostic tools for assessing injuries and functional deficits. The present study has many limitations, many due to the lack of biophysical evidence required to build better models. For example, though we treat all neurons as identical passive, linear units, it is known experimentally that different neurons appear to exhibit different behaviors (for example, some neurons appear to be functionally bistable [55] and could be modeled as such, as in [56]). We predict the results of injuries only on the two “forward-motion” motorneuron modes, ignoring other modes potentially associated with impaired behaviors. Furthermore, the exact mapping of our motorneuron voltage modes onto these body-shape modes is ambiguous. The model lacks muscles and body features of the worm which limits our ability to make more general predictions. We also neglect external feedback mechanisms required for sustained and spontaneous forward motion, and assume that tail-touch neurons are constantly stimulated. It is uncertain how such feedback mechanisms would alter the trajectory. The order-of-magnitude parameter estimates of our model parameters also make direct quantitative comparisons difficult. We believe the merit of this study lies not so much on the specific results presented, but on the new directions and methodologies it opens for future work. In fact, computational and experimental studies on the effects of network injury are still at their infancy for C. elegans and other models. Many limitations of this work could be overcome with a more detailed model for the C. elegans neuronal network both before and after injury. Coupling this with an external, mechanical model would allow for more general predictions. This could be accomplished with simplified mechanical models for locomotion (such as in [56]) or with more complete, future “in-silica” models such as OpenWorm [57]. The development of such models, which do not ignore the spatial extent and shape of neurons, would allow for the study of the effects of injuring individual connections, or the effect of injuring individual neurons non-homogeneously. This study suggests that such modeling work should also consider how to model neural injuries, after which our analysis techniques could be applied directly. Experimental studies would not only test our model, but also in, in conjunction with our work, provide a new testbed for models of injured connectomic dynamics. Our Procrustes Distance metric, shown here to carry information about the eventual outcome of an injury, may also be useful in the real-time analysis of injury progression. Thus our study provides a way forward in monitoring behavioral outcomes of injured networks. Ultimately at present, limitations in biophysical measurements and neural recordings make it extremely difficult to identify more sophisticated underlying mechanisms responsible for dysfunctions in neural networks, especially when circuits display intrinsically complex behavior and functional activity. We believe the rapid advancement of recording technologies in neuroscience will significantly help refine the model presented here. Given that the modeling of neuronal networks is one of the most vibrant fields of computational neuroscience [49,58,59], our contribution provides a comprehensive study of how the effects attributed to FAS jeopardize the network functionality, opening new possibilities and objectives for the study of network architectures.

Title: Functionality and Robustness of Injured Connectomic Dynamics in C. elegans: Linking Behavioral Deficits to Neural Circuit Damage Summary: Neurodegenerative diseases such as Alzheimer's disease, Creutzfeldt-Jakob's disease, HIV dementia, Multiple Sclerosis and Parkinson's disease are leading causes of cognitive impairment and death worldwide. Similarly, traumatic brain injury, the signature injury of the Iraq and Afghanistan wars, affects an estimated 57 million people. All of these conditions are characterized by the presence of focal axonal swellings (FAS) throughout the brain. On a network level, however, the effects of FAS remain unexplored. With the emergence of models which simulate an organism's full neuronal network, we are poised to address how neuronal network performance is degraded by FAS-related damage. Using a model for the full-brain dynamics of the nematode Caenorhabditis elegans, we are able to explore the loss of network functionality as a function of increased neuronal swelling. The relatively small neuronal network generates a limited and tractable set of functional behaviors, and we develop metrics which characterize how these behaviors are impaired by network injuries. These metrics quantify the severity of TBI and/or neurodegenerative disease, and could potentially be used to construct diagnostic tools capable of identifying various cognitive deficits. Additionally, we apply classification trees to our results to make predictions about the structure of an injury from specific cognitive deficits.

lay_plos

en

Write a title and summarize: In northern Tunisia, the co-circulation of two related sand fly-borne phleboviruses, Toscana virus (TOSV) and Punique virus (PUNV) was previously demonstrated. In contrast to TOSV, a prominent human pathogen, there is no data supporting that PUNV is capable to infect and cause disease to humans. We studied the respective involvement of TOSV and PUNV in human infections in northern Tunisia through a seroprevalence study. The presence of TOSV and PUNV neutralising antibodies (NT-Ab) was tested in human sera collected from 5 districts of the governorate of Bizerte, and the titres of NT-Ab were estimated by microneutralisation (MN) assay. A total of 1,273 sera were processed. TOSV and PUNV NT-Ab were detected in 522 (41%) and 111 sera (8. 72%) respectively. TOSV seroprevalence varied from 17. 2% to 59. 4% depending on the district. Analysis of TOSV geometric mean titre values demonstrated a constant increase according to the age. The vast majority of sera containing NT-Ab were found to be more reactive toward TOSV than PUNV. Indeed, past infections with PUNV and TOSV were undisputable for 5 and 414 sera, respectively. PUNV may be capable to infect humans but at a low rate. TOSV is responsible for the vast majority of human infections by sand fly-borne phleboviruses in northern Tunisia. TOSV must be considered by physician and tested in diagnostic laboratories for patients with meningitis and unexplained fever in northern Tunisia. The risk of human infection with sand fly-transmitted viruses has been shown to cover extended geographic areas (southern Europe, Africa, Middle-East, central and western Asia) because of the presence of the sand fly vectors [1]. In countries bordering the Mediterranean basin, phlebotomine sand flies are involved in the transmission of several arthropod-borne viruses that belong to the genus Phlebovirus within the Bunyaviridae family. These sand fly-borne phleboviruses belong to three distinct serocomplexes: (i) the Sandfly fever Naples virus serocomplex including Toscana virus (TOSV) and related viruses (Naples, Tehran, Massilia, Granada, Punique…), (ii) the Sandfly fever Sicilian virus serocomplex including Sicilian virus and related viruses (Cyprus, Turkey…), and (iii) the Salehabad virus serocomplex including Salehabad virus and related viruses (Arbia, Adria…) [2]. Several of those viruses are recognised human pathogens (TOSV, Naples virus, Sicilian virus, Cyprus virus and Adria virus) [1], [3], [4], [5]. Recent studies (case reports, seroprevalence studies and virus isolation) indicate that TOSV circulates actively in the Mediterranean area. TOSV is the only sand fly-borne phlebovirus which has been undoubtedly identified as an aetiological agent of neuroinvasive infections such as meningitis, meningo-encephalitis or peripheral neurological manifestations [6], [7], [8]. In Northern Mediterranean countries, infections due to TOSV represent an important public health problem as it is one of the major viral pathogens involved in aseptic meningitis during the warm season, i. e. between April and October [9], [10], [11]. Recent discoveries of new sand fly-borne phleboviruses from Mediterranean countries has indicated that the viral diversity in genus the Phlebovirus is higher than initially suspected [12], [13], [14], [15]. In Tunisia, the recent isolation a new phlebovirus named Punique virus (PUNV), from phlebotomine sand flies collected in the north of the country raised the question of its potential implication as a human pathogen [13]. Indeed, PUNV is antigenically and genetically closely related to but distinct from TOSV, and subsequently, it was included in the species Sandfly fever Naples virus. However, there is currently no additional evidence suggesting that PUNV is capable to infect and cause disease to humans. Recently, TOSV was suspected to circulate in Tunisia based on serological study [16]. These serological findings were corroborated by the recent isolation of TOSV from sand flies collected in Northern Tunisia [17]. The objective of the present work was to evaluate and to compare the respective involvement of TOSV and PUNV through a seroprevalence study in human, among a population at risk for sand fly-transmitted diseases originated from Northern Tunisia, by using the two viruses in a comparative manner through a microneutralisation (MN) assay. Sera were collected from February to April, 2011, from out care patients visiting local hospitals for medical reasons that were not available to us and requiring blood analysis. These patients are originated from 5 districts (Mateur, Utique, Joumine, Sejenane and Ras Jabel) of the governorate of Bizerte, Northern Tunisia located in the vicinity of the site where TOSV and PUNV were isolated repeatedly from sand flies in 2008,2009,2010 (Figure 1) [13], [17]. This study was performed with leftovers of these samples. The tubes were anonymized and only the sex, age and district address were recorded. This study was approved by the ethical committees of the Pasteur Institute of Tunis under the agreement number IPT/UESV/19/2010, and of the Marseille Federation of Research No 48 under the number 13-008. The virus microneutralisation (MN) assay, previously described for phleboviruses [18], was adapted with minor modifications. Briefly, MN assay was performed in 96-well microtitre plates using Vero cells (ATCC CCL81). Two-fold serial dilutions from 1∶10 to 1∶80 were prepared for each serum and a volume of 50 µL was pipeted into 96-well plates, using an epMotion 5075 working station (Eppendorf). The two virus strains were (i) Toscana virus strain MRS2010-4319501 (GenBank accession nos KC776214–KC776216) isolated from a human case of meningitis in Southeastern France in 2010 [19], and (ii) Punique virus T101 isolated from Phlebotomus sp. in Tunisia in 2009 (Strain Tunisie2009T101). The two virus strains were titrated in Vero cells. A volume of 50 µL containing 100 TCID50 was added into each well except for the controls that consisted of PBS. The plate containing 100 TCID50 of virus and the four two-fold dilutions (1∶10 to 1∶80) of serum was incubated at 37°C for one hour. Then, a 50 µL suspension of Vero cells containing approximately 2. 105 cells in 5% foetal bovine serum was added to each well, and incubated at 37°C in presence of 5% CO2. After 5 days, the microplates were read under an inverted microscope, and the presence or absence of cytopathic effect was noted. The titre (no neutralisation, neutralisation at 1∶10,1∶20,1∶40 and 1∶80) was recorded. The threshold for positivity was defined as 1∶20. Differences in titres lower than four-fold dilutions were considered as not significantly different. Serum exhibiting paired results such as neg/≥1∶20,1∶10/1∶20,1∶10/≥1∶40, and 1∶20/≥1∶80 were indicative of a single infection against the virus corresponding to the highest dilution. Serum exhibiting paired results such as neg/1∶10, were considered as negative for both viruses. Serum exhibiting paired results such as 1∶20/1∶40, and 1∶40/1∶80 were indicative of past infection with both viruses. The GMT observed in MN with TOSV and PUNV were calculated respectively. Sera exhibiting an absence of neutralisation were attributed a score of 5. Sera exhibiting neutralising properties were attributed the reciprocal of the dilution (10,20,40 or 80). Dilutions ≥1∶160 were not tested since long range analysis (1∶10 to 1∶2560) of 100 randomly sorted sera indicated that titres ≥160 were seldom observed. A total of 1,273 sera (corresponding to 345 men and 928 women, sex ratio 0. 37) were collected. The median age was 53 years (range: 2–97). They consisted of 86,484,244,240, and 219 sera collected from the districts of Jounine, Mateur, Ras Jabel, Sejenane, and Utique, respectively (Figure 1). Detailed characteristics of the tested sera are presented in Table 1. Neutralising antibodies against TOSV (TOSV NT-Ab) were detected in a total of 522 sera (41%): 96 had titre 10,116 had titre 20,165 had titre 40, and 145 had titre 80 (Table 2). Neutralising antibodies against PUNV (PUNV NT-Ab) were detected in a total of 111 sera (8. 72%): 99 had titre 10,11 had titre 20,0 had titre 40 and 1 had titre 80 (Table 2). Results are presented in Table 2 and detailed analysis is given as Text S1. According to a 1∶20 cut-off for positivity and four-fold dilutions of difference, only five sera (bolded values in table 2) reflected indisputable infection by PUNV, and a total of 414 sera (stared values in table 2) possessed TOSV NT-Ab demonstrating infection by TOSV. For 144 sera (underlined values in table 2), possible cross-neutralisation between PUNV NT-Ab and TOSV NT-Ab precluded definitive interpretation and conclusion. These results suggested that the presence of TOSV NT-Ab may be responsible for PUNV cross-neutralisation. As shown in Table 3, PUNV MN titres are tightly correlated with previous immunisation against TOSV, due to cross-neutralisation. In contrast, TOSV MN titres are poorly impacted by PUNV MN GMT, suggesting that the presence of TOSV MN NT-Ab can be, in a large majority of cases, unequivocally attributed to TOSV infection (Table 4). Detailed results of TOSV are presented globally for the 1,273 sera and for each region individually in Table 5, respectively. At titre 10,41% of sera contained antibodies capable to neutralise TOSV. Among all districts of the Governorate of Bizerte, seroprevalence rates varied from 17. 2% to 59. 4%. The lowest seroprevalence rates were observed in the Ras Jabel district; the two districts of Sejenane and Joumine exhibited intermediate rates (30% and 40. 7%); the highest rates were observed in the districts of Mateur and Utique (50. 2% and 59. 4%). The proportions of sera capable to neutralise TOSV at titre 10 were maintained when analysis was performed at titres 20,40 or 80. GMT analysis by age group is presented in Figure 2. In Utique and Joumine districts, the number of individuals in group 0–20 was too small to be compared with other age groups. So those two points were not drawn in Figure 2. However, those individuals were taken into account for analysis of the global population. Analysis of GMT values on the global population (irrespective to the district) demonstrated a constant increase according to the age. Similar trends were observed in the Mateur, Sejenane and Ras Jabel regions, independantly. In Utique and Joumine regions, the GMT values were stable and decreased in the oldest group. These differences with global population and other districts are not due to the size of this age group; it might be due to a bias in the tested population which is not representative of the global population. In the Mediterranean area, several phleboviruses are circulating as demonstrated by virus isolation and/or molecular detection in sand flies, and some of them (e. g. TOSV, Naples virus and Sicilian virus) are recognised human pathogens [20]. TOSV is the leading cause of CNS infection in Southern European countries [9], [11]. Interestingly, the US military medical literature reported the occurrence of sandfly fever in Northern Tunisia, namely in the regions of Tunis, Ferryville, Mateur and Bizerte during WWII in the US forces stationed in North Africa during the summer of 1943 [21]. The recent discovery of novel sand fly-borne phleboviruses (Massilia virus, Granada virus, Punique virus) that are antigenically and genetically closely related but clearly distinct from TOSV demonstrated that at least two of these viruses can co-circulate in a same geographic area [14], [17]. These findings call for further investigation to elucidate the potential effect of these newly discovered phleboviruses on human health in these areas. Although it is known that TOSV can infect humans and cause a variety of clinical syndromes including neuro-invasive diseases, there is no or very limited data about the capacity of these newly discovered viruses to infect humans and to cause diseases. In Tunisia, PUNV strains have been isolated from Phlebotomus pernicisosus and Phlebotomus longicuspis collected from the district of Utique where TOSV strains have been also isolated [13], [17]. Therefore, the demonstration of co-circulation questioned their respective role (if any) in human infections due to sand fly-borne phleboviruses in Northern Tunisia. Both viruses belong to the same virus species, Sandfly fever Naples, and consequently it is difficult to distinguish between them by using broadly reactive serological tests, such as inhibition hemagglutination assay, complement fixation assay, enzyme-linked immunosorbent assay (ELISA) or indirect immunofluorescence assay [6], [13], [18], [22], [23], [24]. Indeed, serological cross-reactivity in a function of viral antigenic closeness: the more similar the viruses, the more cross-reactive the antibodies. The recent report of the presence of IgM and IgG reactive against TOSV using ELISA test indicates that either TOSV or an antigenic relative (such as PUNV) is involved in human infection in Northern Tunisia [16], [25]. However, the lack of discrimination of ELISA cannot solve the problem of cross-reactivity and thus cannot indisputably involve TOSV as the etiologic agent of the CNS infections. The growing evidence that distinct but antigenically related sand fly-borne phleboviruses circulate in certain countries such as Spain (TOSV and Granada virus), France (TOSV and Massilia virus), and Tunisia (TOSV and PUNV) [9], [10], [13], [14], [15], [17] pointed out to the cross-reactivity by using ELISA, IFAT and subsequently lead to conducting studies using neutralisation test which are the only assay with suitable discriminative capacity [6], [18], [26]. To attempt the determination of the respective role of TOSV and PUNV in human infection, a sero-epidemiological study concerning a population living in endemic areas for visceral leishmaniasis originated from Northern Tunisia was performed. A total of 1,273 sera were tested using MN assay, with the two viruses independently. In agreement with other studies [27], [28], we determined an “a priori” cut-off value at titre 20, and analysed our results according to the observed MN titre. The vast majority of sera containing NT-Ab were found to be more reactive toward TOSV than to PUNV. Previous infection by PUNV or a closely related antigenic variant was undisputable for 5 sera. By contrast, previous infection by TOSV was undisputable for 414 sera. This demonstrates that although the two viruses are present in sand fly populations, TOSV is involved at a much higher frequency in human infection than PUNV. Interestingly, virus studies conducted on sand flies trapped in the same regions suggested that TOSV circulates at lower level than PUNV, since the latter was detected and isolated 6 times versus 2 times for TOSV of a total of 8,206 sand flies trapped during 3 successive seasons from 2008 to 2010 [13], [17]. Our results indicate that PUNV (or closely related antigenic variants) can infect humans, but it occurs seldom in a region where the virus circulates at high level in sand fly populations. It should be underlined that this does mean that PUNV is not capable to cause human disease, but only that it is involved at a much lower rate in human infections than TOSV in this region of Tunisia. The clinical presentation associated with PUNV (mild, similar or drastically different from TOSV infection) in humans is currently unknown. Thus, its possible medical interest deserves further investigations (e. g., by investigating summertime undetermined febrile illness in the regions where the virus circulates). Seroprevalence rates of TOSV NT-Ab observed in this study (global rate 41%, 17. 2% to 59. 4% depending on the district) are much higher than those (2–25%) reported in countries of southern Europe such as Portugal, Spain, France, Italy, Greece and Turkey [27], [29], [30], [31], [32], [33]. Only few studies reported a seroprevalence higher than the one observed in Tunisia: in the Tuscany region, a seroprevalence of TOSV of 77. 2% was reported among a population at high-risk (forestry workers) [32]; in Greece seroprevalence rates ranging from 39% to 51. 7% were reported in several islands [34]. Although this study was not performed with a panel of sera representative of the population, it suggests that TOSV circulates at much higher frequency than in southern Europe. Similar studies should be performed in other regions of Tunisia, but also in other North African countries to better characterize this trend. Analysis of GMT values on the global population demonstrated a constant increase according to the age. Similar result were reported in other studies concerning various populations from endemic countries, where both anti-TOSV seroreactivity and TOSV-specific antibody prevalence increased significantly with age [27], [34], [35]. This trend indicates that TOSV infection can occur at any age of the life, and that repeated infections could play a role in sustained and increasing immunity as reflected by neutralising antibodies. These results deserve further confirmation by studies addressing much larger populations covering wider geographic areas. In conclusion, this study conducted in Northern Tunisia showed: (i) TOSV is responsible for the vast majority of human infections by sand fly-borne phleboviruses, (ii) PUNV, a recently discovered sand fly-transmitted phlebovirus that co-circulates with TOSV, is capable of infecting humans but at a low rate, (iii) important variations among seroprevalences are observed depending on the geographic area, and thus on environmental factors, and (iv) TOSV should be considered as an important pathogen and that needs to be included in all virological diagnostic concerning patients with meningitis and unexplained febrile illness originated from Northern Tunisia.

Title: Co-Circulation of Toscana Virus and Punique Virus in Northern Tunisia: A Microneutralisation-Based Seroprevalence Study Summary: In northern Tunisia, two different pheboviruses are known to circulate in sand fly population, Toscana virus (TOSV) and Punique virus (PUNV). In contrast to TOSV, a prominent human pathogen, there is no data supporting that PUNV is capable to infect humans and to cause a disease. We studied the respective involvement of TOSV and PUNV in human infections in northern Tunisia through a seroprevalence study. Because TOSV and PUNV are antigenically and genetically closely related, it is difficult to distinguish between them by using broadly reactive serological tests, such as enzyme-linked immunosorbent assay (ELISA). Thus, we developed a method of microneutralisation assay using the two viruses in a comparative manner. A total of 1,273 sera were processed. We provide first evidence to support (i) that Punique virus may be capable to infect humans but at a low rate, (ii) that TOSV, the most prevalent arbovirus in Southern Europe, is responsible for the vast majority of human infections by sand fly-borne phleboviruses in northern Tunisia. Therefore, it is important to consider TOSV as an important pathogen that needs to be included in all virological diagnostic concerning patients with meningitis and unexplained febrile illness originated from Northern Tunisia.

lay_plos

en

Summarize: Martin A Makary, professor 1, Michael Daniel, research fellow 1 1Department of Surgery, Johns Hopkins University School of Medicine, Baltimore, MD 21287, USA Correspondence to: M A Makary mmakary1{at}jhmi.edu Medical error is not included on death certificates or in rankings of cause of death. Martin Makary and Michael Daniel assess its contribution to mortality and call for better reporting The annual list of the most common causes of death in the United States, compiled by the Centers for Disease Control and Prevention (CDC), informs public awareness and national research priorities each year. The list is created using death certificates filled out by physicians, funeral directors, medical examiners, and coroners. However, a major limitation of the death certificate is that it relies on assigning an International Classification of Disease (ICD) code to the cause of death.1 As a result, causes of death not associated with an ICD code, such as human and system factors, are not captured. The science of safety has matured to describe how communication breakdowns, diagnostic errors, poor judgment, and inadequate skill can directly result in patient harm and death. We analyzed the scientific literature on medical error to identify its contribution to US deaths in relation to causes listed by the CDC.2 Emotions tend to run high in hospitals, and patients or patients’ loved ones can be rude to medical professionals when they perceive inadequate care. But berating your child’s doctor could have harmful — even deadly — consequences, according to new research. The findings by University of Florida management professor Amir Erez and doctoral student Trevor Foulk reinforce their prior research that rudeness has “devastating effects on medical performance,” Erez said. A Johns Hopkins study estimated that more than 250,000 deaths are attributed to medical errors in the U.S. annually—which would rank as the third-leading cause of death in the U.S., according to statistics from the Centers for Disease Control and Prevention. Some errors could be explained by a doctor’s poor judgment due to a chronic lack of sleep. Those types of circumstances, according to prior research from Erez and Foulk, account for about 10 to 20 percent of the variance in practitioner performance. The effects of rudeness, Erez said, account for more than 40 percent. “[Rudeness] is actually affecting the cognitive system, which directly affects your ability to perform,” Erez said. “That tells us something very interesting. People may think that doctors should just �?get over’ the insult and continue doing their job. However, the study shows that even if doctors have the best intentions in mind, as they usually do, they cannot get over rudeness because it interferes with their cognitive functioning without an ability to control it.” In a previous study, Erez and Foulk examined the effects of rudeness from a colleague or authority figure on individual medical professionals. This study analyzed team performance and the effects rudeness has when it comes from a patient’s family member. In the new study, 39 neonatal intensive care unit teams (two doctors and two nurses) from Israel simulated five scenarios where they treated infant medical mannequins for emergency situations such as severe respiratory distress or hypovolemic shock. An actress playing the baby’s mother scolded certain teams while the control groups experienced no rudeness. Erez and Foulk found that the teams that experienced rudeness performed poorly compared to the control groups. The teams that encountered rudeness were deficient in all 11 of the study’s measures, including diagnostic accuracy, information sharing, therapy plan, and communication, over the course of all five scenarios showing that the negative effects last the entire day. To combat the effect of rudeness, the researchers included “interventions” for selected teams. Some teams participated in a pre-test intervention which consisted of a computer game based on a cognitive-behavioral attention modification method intended to raise the threshold of the participants’ sensitivities to anger and aggression. Other teams participated in the post-test intervention, which consisted of team members writing about the day’s experience from the perspective of the baby’s mother. Erez and Foulk found no difference in the performances of the control groups and the teams that played the computer game. The teams recognized the mother’s rudeness —both midway and after the simulation — but were not affected by it. “It’s really shocking how well it worked,” Erez said. “They were basically immunized from the effects of rudeness.” Conversely, the post-test intervention, which research has shown to be extremely successful for victims of trauma, actually had a negative effect on teams. “What is really concerning is that, at midday, these teams recognized the mother was rude to them,” Erez said. “But at the end of the day, they did not. So not only did it not work, but it caused them to not recognize rudeness later.” Considering the researchers’ findings and the large number of deaths attributed to medical errors, teaching medical professionals to handle rudeness more effectively should be a priority for the medical community. “In the medical field, I don’t think they take into account how social interactions affect them,” said Erez, “but it’s something they’re starting to pay attention to. The purpose of this research was to identify what’s going on here. Now that we’ve found serious effects, we need to find more realistic interventions.” Dr. Arik Riskin, a professor of Neonatology at the Technion, Israel Institute of technology, and Peter Bamberger, a professor of management at Tel Aviv University in Israel, also collaborated on this research. The study, “Rudeness and Medical Team Performance,” appears in the January issue of Pediatrics. Rude parents can rattle medical staff enough to compromise the quality of care their critically ill child receives, a new study suggests. Medical teams in a neonatal intensive care unit made worse decisions during simulated emergency scenarios if they had been treated rudely by an actress playing the role of an angry family member, the researchers found. Exposure to rudeness helped explain about 40 percent of the variance in good medical decision-making between different teams in the study, said co-author Amir Erez. He is a professor with the University of Florida Warrington College of Business. “There is a lot of concern about medical errors, but the medical field is not paying attention at all to the effect that social interactions can have on performance,” Erez said. “They need to pay attention to this, because this could potentially save lives.” But, the researchers also found that doctors and nurses could “inoculate” themselves against potential rudeness by taking part in computer training that decreased their emotional sensitivity, Erez said. In the study, four medical teams at an Israeli teaching hospital had to perform a full day’s worth of five emergency scenarios. Three of the teams started their day confronted by a “mother” who accused them of misdiagnosing her child. The fourth team served as a “control” group, and was not exposed to rudeness. The actress told the teams, “I knew we should have gone to a better hospital where they don’t practice Third World medicine!” and threatened to move the child to another hospital. One team received no preparation for this encounter. But, the second team took part in a 20-minute computer game beforehand that exposed them to angry and happy faces, providing feedback that made them less sensitive to hostile emotions. The members of the third team were asked to write a narrative about the rude event after it had occurred, to possibly diminish any lasting effect it might have on them. Earlier studies have shown that rudeness from an authority figure can affect a medical team’s performance, and this study revealed that rudeness from a parent can also cause doctors and nurses to make poor decisions, Erez said. However, the computerized training beforehand erased this effect, by subconsciously raising the team’s tolerance for negative emotions, he added. “When we raised the threshold of people’s sensitivity to anger, they didn’t perform less well than the control group,” Erez said. Writing a narrative about the rude event had no benefit on performance, possibly because the exercise affected participants on a conscious rather than subconscious level, Erez suggested. The study was published online Jan. 10 in the journal Pediatrics. These findings show that doctors and nurses are human beings vulnerable to the effects of harsh emotions, said Dr. Brian Alverson, chairman of the American Academy of Pediatrics’ section on hospital medicine. “The reality is when we as humans are emotional, logical cognitive thought is a lot more difficult,” said Alverson, an associate professor of pediatrics at Brown University in Providence, R.I. “When you’re being emotionally attacked, it’s harder to sit there and crunch the numbers quick.” Dr. Jessica Madden, a neonatologist with the Cleveland Clinic, added that the problem is made worse by the fact that intensive care unit teams often work in high-stress environments with colleagues they barely know. “We’re continually working with teams who come together who really haven’t worked together before,” Madden said of neonatal intensive care units. “They can literally be meeting for the first time to take care of a sick baby.” Training currently focuses on communication within the newly formed team, “but it doesn’t factor in that with the patient-centered care model, we do have the parents with us,” Madden said. “That’s another layer of stress and worry that’s going on as we try to focus.” However, Alverson is concerned that extrapolating the study findings -- for example, by applying them to other units not faced with split-second life-and-death decisions -- could lead doctors and administrators to shrug off real and lasting problems in each hospital’s system. “When families come in and act rude, the majority of the time it’s because of something we’ve done. [For example,] we left them five hours in an ER waiting room without talking to them,” Alverson said. “It’s an opportunity lost where we could be looking at ourselves and asking how we can conduct our practice so people are happier.”

Summary: If you think being tough with your child's doctor is the right way to ensure better care, think again. A new study out of the University of Florida suggests that rude parents can cause serious, even deadly, consequences. Researchers who staged emergency situations in a neonatal intensive care unit at an Israeli hospital found that doctors and nurses performed significantly worse when confronted with an actress playing an angry mother. While there is much concern about medical errors, the third-leading cause of death in the US, medical professionals are "not paying attention at all to the effect that social interactions can have on performance," co-author Amir Erez tells HealthDay. The new findings, he adds, "could potentially save lives." In the study, four medical teams were assigned to treat infant dummies during day-long emergency situations including respiratory distress and shock. An actress playing a rude mom harangued three of the teams first thing in the morning, accusing them of doling out "Third World" care and threatening to seek treatment elsewhere. The fourth team served as a control group and was spared the hostility. The teams exposed to rudeness underperformed in all of the study's 11 measures throughout the day. But researchers found they could "immunize" doctors to rudeness by prepping them ahead of time with computer games that desensitized them to sharp emotions. In the end, the lesson is that doctors and nurses are people, too, and find it harder to work when they're "being emotionally attacked," says an American Academy of Pediatrics rep.

multi_news

en

Write a title and summarize: SECTION 1. TREATMENT OF CERTAIN AMOUNTS RECEIVED BY A COOPERATIVE TELEPHONE COMPANY. (a) Nonmember Income.-- (1) In general.--Paragraph (12) of section 501(c) of the Internal Revenue Code of 1986 (relating to list of exempt organizations) is amended by adding at the end the following new subparagraph: ``(E) In the case of a mutual or cooperative telephone company (hereafter in this subparagraph referred to as the `cooperative'), 50 percent of the income received or accrued directly or indirectly from a nonmember telephone company for the performance of communication services by the cooperative shall be treated for purposes of subparagraph (A) as collected from members of the cooperative for the sole purpose of meeting the losses and expenses of the cooperative.'' (2) Certain billing and collection service fees not taken into account.--Subparagraph (B) of section 501(c)(12) of such Code is amended by striking ``or'' at the end of clause (iii), by striking the period at the end of clause (iv) and inserting ``, or'', and by adding at the end the following new clause: ``(v) from billing and collection services performed for a nonmember telephone company.'' (3) Conforming amendment.--Clause (i) of section 501(c)(12)(B) of such Code is amended by inserting before the comma at the end thereof ``, other than income described in subparagraph (E)''. (4) Effective date.--The amendments made by this subsection shall apply to amounts received or accrued after December 31, 1996. (5) No inference as to unrelated business income treatment of billing and collection service fees.--Nothing in the amendments made by this subsection shall be construed to indicate the proper treatment of billing and collection service fees under part III of subchapter F of chapter 1 of the Internal Revenue Code of 1986 (relating to taxation of business income of certain exempt organizations). (b) Treatment of Certain Investment Income of Mutual or Cooperative Telephone Companies.-- (1) In general.--Paragraph (12) of section 501(c) of such Code (relating to list of exempt organizations) is amended by adding at the end the following new subparagraph: ``(F) In the case of a mutual or cooperative telephone company, subparagraph (A) shall be applied without taking into account reserve income (as defined in section 512(d)(2)) if such income, when added to other income not collected from members for the sole purpose of meeting losses and expenses, does not exceed 35 percent of the company's total income. For the purposes of the preceding sentence, income referred to in subparagraph (B) shall not be taken into account.'' (2) Portion of investment income subject to unrelated business income tax.--Section 512 of such Code is amended by adding at the end the following new subsection: ``(d) Investment Income of Certain Mutual or Cooperative Telephone Companies.-- ``(1) In general.--In determining the unrelated business taxable income of a mutual or cooperative telephone company described in section 501(c)(12)-- ``(A) there shall be included, as an item of gross income derived from an unrelated trade or business, reserve income to the extent such reserve income, when added to other income not collected from members for the sole purpose of meeting losses and expenses, exceeds 15 percent of the company's total income, and ``(B) there shall be allowed all deductions directly connected with the portion of the reserve income which is so included. For purposes of the preceding sentence, income referred to in section 501(c)(12)(B) shall not be taken into account. ``(2) Reserve income.--For purposes of paragraph (1), the term `reserve income' means income-- ``(A) which would (but for this subsection) be excluded under subsection (b), and ``(B) which is derived from assets set aside for the repair or replacement of telephone system facilities of such company.'' (3) Effective date.--The amendments made by this subsection shall apply to amounts received or accrued after December 31, 1996.

Title: A bill to amend the Internal Revenue Code of 1986 with respect to the treatment of certain amounts received by a cooperative telephone company Summary: Amends the Internal Revenue Code with respect to the tax-exempt status of a mutual or cooperative telephone company to provide that 50 percent of the income received from a nonmember telephone company for services by the cooperative shall be treated as collected from members of the cooperative for the sole purpose of meeting the losses and expenses of the cooperative. Excludes, in determining the income of a cooperative: (1) billing and collection services performed for a nonmember telephone company; and (2) certain reserve income that does not exceed 35 percent of the company's total income. Subjects a portion of such reserve income to unrelated business income tax.

billsum

en

Summarize: Northwestern will be wearing these very special uniforms against Michigan on Nov. 16. Having been beaten down by the ubiquity of one-off unis, it's hard to get upset about the asymmetrical patriotic mishmash. It's even tough to muster up outrage over the fact that just 10 percent of proceeds from jerseys sold will actually go to the Wounded Warrior Project. (Along with 100 percent of the proceeds from an auction of game-worn jerseys.) But isn't "flag covered in blood" a little on-the-nose for something honoring a group that operates programs for injured veterans? The uniforms are ass-ugly, but that's almost a given when Under Armour's creativity is allowed to run wild. Instead of player names, the nameplates on the jerseys will be one of seven "core values": courage, duty, integrity, honor, country, service, and commitment. Notable, considering Northwestern's school colors and the fact that the Wounded Warrior Project presumably contains a lot of Purple Heart recipients: There's not a stich of purple in this thing. More photos, via the university: Warrior and Spouse Vow Peace, Protection, and Prosperity During Couples Project Odyssey SAVANNAH, Ga., Jan. 14, 2019 -- Sidney Brady and his wife, Elizabeth, are no strangers to the stresses of marriage and raising a family. Adding another level of complexity, Sidney copes with post-traumatic stress disorder (PTSD) stemming from his deployment during Operation Enduring Freedom. Returning home, Sidney registered with Wounded Warrior Project® (WWP) to get involved with Project Odyssey®, a program that helps with combat stress. "When dealing with my PTSD, I know things can get out of control," said Sidney, an Army veteran. "I get very anxious, angry, and frustrated and simply want to avoid everything and everybody." Sidney recognizes the way he coped with PTSD placed an unhealthy strain on his relationship with his wife and children, and it changed the entire dynamic of their home life. The Northwestern football program and Under Armour have teamed up in a classy effort to raise awareness for the Wounded Warrior Project. The Wildcats will wear patriotic red, white and blue uniforms on Nov. 16 when they host Michigan, as noted by #B1GCats Football on Twitter: First Look: Northwestern will wear this uniform against Michigan (11/16) in coordination with the @wwpinc #B1GCats pic.twitter.com/ZiciGmz96e — #B1GCats Football (@NUFBFamily) November 4, 2013 The school is doing this as a way to honor and highlight the non-profit organization's goal of empowering the nation's wounded military men and women. The sharp-looking uniforms feature the American flag on the helmet, shoulder pads and across the legs. Instead of players' names on the back of the jerseys, there will be one of seven "core value embellishments," as noted by NUSports.com: Duty, Honor, Courage, Commitment, Integrity, Country and Service. Photo Credit: Under Armour After the contest versus Michigan, the in-game jerseys will be auctioned off at NUSports.com, with all proceeds going directly to the Wounded Warrior Project, according to the report. Additionally, the school is selling replica jerseys to the public, and 10 percent of the proceeds from those sales will go to the project, as noted by the school on Twitter: 100% of special WWP game-worn jersey auction goes to @wwpinc. Replicas available NOW have 10% donation http://t.co/cSqDhYcCfe #B1GCats — Northwestern Sports (@NU_Sports) November 4, 2013 The men and women who sacrifice their freedom by serving in the military far too often go unheralded for their exploits. Those who return home after injuring themselves in the line of duty deserve even more gratitude and praise, and any chance we have to honor them, we should. Photo credit: Under Armour Under Armour and Northwestern did an outstanding job of putting together a uniform that not only looks good but also reflects the sacrifices made by the men and women who are supported by the Wounded Warrior Project. Whether you are a Northwestern supporter or not, there's no doubt we can all appreciate and applaud this move. It's a win-win for everyone involved, and it's a great way to honor the people responsible for maintaining the freedoms we enjoy here in America. Follow me on Twitter @JesseReed78

Summary: Northwestern football players will don flag-inspired uniforms for their Nov. 16 game to honor wounded vets-but they're already apologizing for the gear. That's because it appears to be bloodstained, the AP reports via the Washington Post. In fact, it's a "distressed pattern on both the stars and stripes that was inspired by the appearance of a flag that has flown proudly over a long period of time," says a rep for the team, who apologized "for any misinterpretation." The jerseys will be auctioned after the game, with proceeds going to the Wounded Warrior Project. That's a "classy" move for a great cause, opines Bleacher Report, but "isn't 'flag covered in blood' a little on-the-nose for something honoring a group that operates programs for injured veterans?" asks Deadspin.

multi_news

en

Write a title and summarize: During lytic Kaposi’s sarcoma-associated herpesvirus (KSHV) infection, the viral endonu- clease SOX promotes widespread degradation of cytoplasmic messenger RNA (mRNA). However, select mRNAs, including the transcript encoding interleukin-6 (IL-6), escape SOX-induced cleavage. IL-6 escape is mediated through a 3’ UTR RNA regulatory element that overrides the SOX targeting mechanism. Here, we reveal that this protective RNA element functions to broadly restrict cleavage by a range of homologous and non-homologous viral endonucleases. However, it does not impede cleavage by cellular endonucleases. The IL-6 protective sequence may be representative of a larger class of nuclease escape elements, as we identified a similar protective element in the GADD45B mRNA. The IL-6 and GADD45B-derived elements display similarities in their sequence, putative structure, and several associated RNA binding proteins. However, the overall composition of their ribonucleoprotein complexes appears distinct, leading to differences in the breadth of nucleases restricted. These findings highlight how RNA elements can selectively control transcript abundance in the background of widespread virus-induced mRNA degradation. A number of viruses restrict host gene expression to reduce competition for resources and dampen immune responses. This ‘host shutoff’ phenotype can be triggered through a range of mechanisms that operate at nearly every stage of the gene expression cascade. Viruses whose host shutoff strategies involve the induction of widespread mRNA decay include the alpha and gammaherpesviruses, vaccinia virus (VACV), influenza A virus (IAV), and SARS coronavirus (SCoV) [1–5] In each of the above cases, mRNA degradation is induced via one or more internal endonucleolytic cleavages in the target mRNA or, in the case of VACV, direct removal of the mRNA 5’ cap [5–9]. This is invariably followed by exonucleolytic degradation of the cleaved fragment (s) by components of the mammalian RNA decay machinery such as Xrn1 [1,10,11]. The viral strategy contrasts with basal mRNA degradation in eukaryotes, which is a tightly regulated process that initiates with gradual shortening of the poly (A) tail, followed by removal of the 5’ cap prior to exonucleolytic degradation of the transcript body [12]. Although eukaryotes encode endonucleases, they are generally restricted to a highly specific set of targets. For example, mRNAs containing premature stop codons are cleaved by the Smg6 endonuclease during the translation-linked quality control process of nonsense mediated decay (NMD) [13]. No-go decay is another form of quality control activated in cases of ribosome stalling, although the specific endonuclease that cleaves the mRNA remains unknown [14,15]. The use of endonucleases during quality control enables more rapid removal of aberrant mRNAs from the translation pool, as their inactivation is not reliant on the prior rate limiting steps of deadenylation and decapping. In this regard, virus-induced mRNA decay resembles the cellular quality control mechanisms, but with significantly expanded scope. One of the well-studied viral endonucleases is the SOX protein encoded by ORF37 of Kaposi’s sarcoma-associated herpesvirus (KSHV). During lytic KSHV replication, SOX is expressed with delayed early kinetics and its nuclease activity significantly reduces cytoplasmic mRNA levels [16]. SOX is conserved throughout the herpesvirus family, but only gammaherpesviral SOX homologs display ribonuclease activity in cells [16–18]. Perhaps surprisingly, its activity is not restricted to host mRNAs, and studies with the SOX homolog from murine gammaherpesvirus 68 (MHV68) indicate that SOX activity helps fine tune viral mRNA levels in a manner important for the in vivo viral lifecycle [19,20]. Although most mRNAs are subject to cleavage by SOX, a recent degradome-based sequencing analysis together with studies on individual endogenous and reporter mRNAs revealed that SOX cleavage sites are defined by a degenerate RNA motif [10,21]. The SOX-targeting motif can be located anywhere within an mRNA and may be present multiple times [10,21]. The observation that a targeting motif is present on SOX cleaved mRNAs suggests that transcripts lacking this element should escape cleavage. Indeed, RNAseq analyses indicate that approximately one-third of mRNAs are not depleted by SOX [22,23]. Studying these ‘escapees’ in aggregate is complicated, however, by the fact that multiple mechanisms can promote apparent escape. These include lack of a targeting motif, indirect transcriptional effects, and active evasion of cleavage [22,24–28]. This latter phenotype, termed dominant escape, is particularly notable as it involves a specific RNA element whose presence in the 3’ UTR of an mRNA protects against SOX cleavage, regardless of whether the RNA contains a targeting motif. The one known example of dominant escape derives from the host interleukin-6 (IL-6) transcript [26,27,29]. IL-6 expression is required for survival of B cells infected with KSHV, and the virus engages a number of strategies to drive production of this cytokine [30–38]. The IL-6 mRNA is directly refractory to SOX cleavage and thus remains robustly induced during host shutoff due to the presence of a specific ‘SOX resistance element’ (SRE) [26,29]. Even in the absence of infection, reporter mRNAs bearing the IL-6 SRE remain stable in SOX-expressing cells, an observation that has helped delineate features of this novel RNA element required for the protective phenotype [26,27]. The IL-6 SRE was fine mapped to a 200 nt sequence within the 3’ UTR, which was subsequently shown to assemble an ‘escape complex’ of at least 8 cellular RNA binding proteins involved in protection [26,27]. How this complex functions to restrict SOX recognition remains largely unknown, although nucleolin (NCL) plays an essential role. NCL is partially relocalized from the nucleolus to the cytoplasm during lytic KSHV infection, where it binds the SRE using its RNA recognition motif and engages in protein-protein interactions related to escape with its carboxyl-terminal RGG domain [27]. The IL-6 SRE is the first described ribonuclease escape element and much remains to be learned about its function, as well as whether other related elements exist that protect their associated mRNA. Here, we reveal that the IL-6 SRE is broadly protective against a diverse group of viral endonucleases, suggesting an underlying commonality in the mechanism by which these host shutoff factors recognize their mRNA targets. It is not indiscriminately protective, however, as host quality control endonucleases are not blocked by the IL-6 SRE. We then identify a second, novel SRE within the GADD45B mRNA, which displays some physical and functional similarities to the IL-6 SRE. Collectively, these findings suggest that a diversity of nuclease escape elements exist, and that their characterization may lead to new insights into the control of mRNA fate in both infected and uninfected cells. The 3’ UTR of IL-6 contains a transferrable 200 nt SRE that protects its associated mRNA from SOX-induced degradation [26,27]. The SRE also protects mRNA from cleavage by the unrelated vhs endonuclease encoded by herpes simplex virus type 1 (HSV-1), hinting that this RNA element may restrict endonuclease targeting in a broader capacity [27]. To test this hypothesis, we assessed whether the presence of the SRE impacted the ability of a panel of homologous and heterologous mRNA-specific viral endonucleases to degrade a target mRNA. In addition to HSV-1 vhs, these included homologs of KSHV SOX from the related gammaherpesviruses Epstein-Barr virus (EBV; BGLF5) and murine gammaherpesvirus 68 (MHV68; muSOX), as well as the heterologous host shutoff endonuclease from influenza A virus (IAV; PA-X) [3,17,39]. As anticipated, the control GFP mRNA was readily degraded in 293T cells co-transfected with plasmids expressing each of the viral endonucleases as measured by RT-qPCR (Fig 1A). However, addition of the IL-6 derived SRE to the 3’ UTR of GFP (GFP-IL-6-SRE) prevented each of the viral endonucleases from degrading this mRNA (Fig 1B). Fusion of a size matched segment of the IL-6 3’ UTR lacking the SRE to GFP (GFP-IL-6 ΔSRE) reinstated cleavage of the GFP reporter by the viral endonucleases (Fig 1B). These data confirm that the protection conferred by the SRE is not specific to SOX-induced cleavage, but functions more broadly to restrict mRNA cleavage by a diverse set of mammalian virus host shutoff endonucleases. Cleavage sites for IAV PA-X have yet to be determined, but the other endonucleases do not appear to target mRNA in the same location or using the same sequence features, including the SOX homologs [1,9, 21,40,41]. Thus, the IL-6 derived SRE is unlikely to function through steric occlusion of a common cleavage site. We instead considered the possibility that the SRE functions like an RNA ‘zip code’, directing its associated transcript to a location in the cell inaccessible to endonucleases. To test this hypothesis, we used RNA fluorescence in situ hybridization (FISH) to monitor how the presence of the IL-6 SRE impacted the localization of its associated mRNA. Six phage MS2-derived stem-loops were introduced upstream of the SRE or ΔSRE segment of the IL-6 3’ UTR in the pcDNA3 luciferase reporter, enabling visualization of the RNA in transfected 293T cells using a Cy3-labeled RNA probe directed against the MS2 sequences [42]. We verified that the presence of the stem-loops did not prevent the escape of the SRE-containing reporter or degradation of the ΔSRE reporter in SOX-expressing cells (S1 Fig). There was no distinguishable difference in the localization of the SRE and ΔSRE containing mRNAs, both of which were present relatively diffusely throughout the cell (Fig 1C). The FISH signal was specific to transfected cells, as we observed no fluorescence in neighboring untransfected cells nor autofluorescence from transfected cells lacking the Cy3 probes (Fig 1C). Although these data to not exclude the possibility that the SRE-containing transcript became sequestered into micro-aggregates or other structures not visible at this level of resolution, they do not support relocalization as the driver of escape from viral endonuclease cleavage. We next considered whether the inability to cleave an IL-6 SRE-containing transcript was specific to viral endonucleases or similarly extended to host endonucleases. Although basal cellular mRNA decay is carried out by exonucleases, host quality control pathways involve endonucleases to promote rapid clearance of aberrant mRNA [43–45]. We applied two strategies to monitor the activity of the SRE against host endonucleases. The first was to use a nonsense mediated decay (NMD) target containing a premature termination codon (PTC) 100 amino acids into the body of an RFP reporter mRNA (dsRed2-PTC) [10]. The NMD pathway detects PTCs during translation and directs cleavage of the mRNA by the Smg6 endonuclease [46]. Depletion of Smg6 from 293T cells using siRNAs restored dsRed2-PTC mRNA levels to those of the control dsRed2 transcript, confirming that this was an NMD substrate degraded by Smg6 (Fig 2A and 2B). We then fused the IL-6 derived SRE to the 3’ UTR of dsRed2-PTC (dsRed2-PTC-SRE) or, as a control, the size matched region from the IL-6 3’ UTR lacking the SRE (dsRed2-PTC-ΔSRE) and measured the levels of each mRNA by RT-qPCR in 293T cells (Fig 2C). In contrast to the viral endonucleases, the SRE did not impair Smg6-mediated cleavage of its target mRNA, as all three PTC-containing transcripts were similarly degraded (Fig 2A & 2C). The second strategy to monitor host endonuclease activity was to express the nsp1 protein from SARS coronavirus. Nsp1 is not itself a nuclease, but it binds the 40S ribosome and causes it to stall on the mRNA, thus activating cleavage of the mRNA by an as yet unknown cellular endonuclease via a mechanism reminiscent of no-go decay [47,48]. Although the endonuclease involved in this pathway has not been established, it is known not to be Smg6 and thus this enabled evaluation of a distinct host endonuclease [48]. Nsp1 was co-transfected with the GFP-SRE or GFP-ΔSRE reporter into 293T cells, and depletion of the GFP transcript was measured by RT-qPCR. Similar to the NMD substrate, the SRE did not prevent degradation of the GFP mRNA in nsp1-expressing cells (Fig 2D). Collectively, these results suggest that the IL-6 derived SRE confers broad protection against viral but not cellular endonucleases. Given that the host endonucleases require ongoing translation for target recognition, these data also confirm that the SRE does not pull its associated mRNA out of the translation pool. To determine whether this property of broad inhibition of viral endonucleases was restricted to the IL-6 SRE, we sought to identify other SRE-bearing transcript (s). Based on our previous finding that the IL-6 SRE required binding by a complex of cellular proteins including NCL, we mined a published RNAseq dataset for transcripts that were not depleted in SOX expressing 293T cells and were known to be bound by NCL [22,49–51]. A transcript that fit these criteria was growth arrest and DNA damage-inducible 45 beta (GADD45B). Notably, the GADD45B mRNA was also previously shown to escape degradation in HSV-1 vhs-expressing cells, further suggesting it might contain an SRE [52–54]. We first examined whether the GADD45B mRNA was resistant to host shutoff upon lytic reactivation of a KSHV-positive B cell line (TREX-BCBL1) and a renal carcinoma cell line stably expressing the KSHV BAC16 (iSLK. 219). Both TREX-BCBL1 and iSLK. 219 cells harbor a doxycycline (dox) -inducible version of the major viral lytic transactivator RTA that promotes entry into the lytic cycle upon dox treatment [55,56]. Unlike the GAPDH mRNA, which is degraded by SOX upon lytic reactivation, the GADD45B mRNA levels remained unchanged both in reactivated TREX-BCBL1 and iSLK. 219 cells as measured by RT-qPCR (Fig 3A & 3B). We also confirmed that, unlike the GAPDH mRNA, the endogenous GADD45B mRNA was not depleted upon transfection of KSHV SOX or HSV-1 vhs into 293T cells (Fig 3C). Finally, we noted that siRNA-based depletion of GADD45B from iSLK. 219 cells resulted in decreased efficiency of lytic KSHV reactivation as well as reduced expression of representative delayed early (ORF59) and late (K8. 1) viral genes, suggesting that GADD45B expression is important for the KSHV lytic cycle (S2 Fig). Recently, we showed that KSHV SOX cleaves its targets at a specific but degenerate RNA motif [21]. Thus, the failure of SOX (or perhaps vhs) to degrade the GADD45B mRNA could either be due to the absence of such a targeting motif (e. g. passive escape), or to the presence of a specific protective element like the IL-6 SRE (e. g. dominant escape). To distinguish these possibilities, we constructed chimeras between GFP, which has a well-characterized SOX cleavage element, and the GADD45B 5’ UTR, 3’ UTR, or coding region (CDS), each of which were cloned downstream of the GFP coding region (Fig 3D). Co-transfection of the GFP-fused GADD45B 3’ UTR construct with SOX into 293T cells did not lead to degradation of this mRNA, whereas the GFP-GADD45B 5’ UTR or CDS fusions were readily degraded in SOX-expressing cells (Fig 3E). Thus, similar to the IL-6 3’ UTR, the GADD45B 3’ UTR contains a protective sequence that prevents SOX cleavage of an established target mRNA. To refine which GADD45B sequence encompassed the SRE, we initially looked for similarities between the GADD45B 3’ UTR and the IL-6 SRE using Clustal W alignment. While there were no stretches of significant sequence identity between the two RNAs, the last ~200nt of the GADD45B 3’UTR had the highest similarity (~46%) to the IL-6 SRE (S3 Fig). We therefore fused this putative SRE segment of the GADD45B 3’ UTR to GFP (GADD45B-SRE), and found that it was sufficient to confer nearly the same level of protection from SOX as the full GADD45B 3’ UTR in transfected 293T cells (Fig 4A). Thus, similar to IL-6, the GADD45B 3’ UTR contains a ~200 nt SRE (henceforth termed G-SRE). We next sought to determine whether these two SREs could adopt a common secondary structure. RNAfold-based predictions showed that the 3’-most segment of both SREs form a long stem-loop protruding structure with at least one bulge near the middle of the stem, whereas the other regions of the SREs did not fold into any similar high-confidence structures (Fig 4B). To validate this predicted SRE stem loop structure experimentally, we applied in-line probing, an RNA cleavage assay in which base-paired or structurally constrained nucleotides are protected from spontaneous phosphodiester bond hydrolysis [57]. Results from the cleavage reaction (S4 Fig) largely confirmed the RNAfold predictions, apart from a small variation in the IL-6 hairpin. We then tested whether this structure is required for either IL-6 SRE or G-SRE function by changing two conserved TT nucleotides located directly adjacent to the bulge in each hairpin structure to GG (SRE_GG; mutated residues marked with asterisks Fig 4B). We also separately mutated the AA residues predicted to base pair with these nucleotides on the other side of the loop to CC (SRE_CC). Both the SRE_GG and the SRE_CC mutations in the IL-6 or GADD45B GFP fusions resulted in partial degradation of these mRNAs upon SOX expression in 293T cells, suggesting that disruption of that portion of the SRE hairpin impaired the protective capacity of each SRE (Fig 4C & 4D). Notably, combining these mutations together (SRE_GG+CC), which should restore the secondary structure of the stem-loop, rescued the fully protective phenotype in SOX expressing cells (Fig 4C & 4D). This suggests that, at least for this region of each SRE, RNA structure rather than the specific sequence is important for protection against SOX cleavage. Using an in vitro RNA-pulldown based strategy, we previously determined that the IL-6 SRE assembles a specific ribonucleoprotein (RNP) ‘escape’ complex that is critical for its ability to mediate protection from cleavage by SOX [26,27]. Given the partial similarities in length, sequence, and structure between the IL-6 SRE and the G-SRE, we hypothesized that they might also assemble a similar set of RNPs to mediate their protective function. Indeed, it had already been established that both transcripts bind NCL [27,49]. We therefore performed Comprehensive Identification of RNA binding Proteins by Mass Spectrometry (ChIRP-MS) to compare the set of proteins bound in vivo to the IL-6 and GADD45B 3’UTRs in transfected 293T cells (Fig 5A). Briefly, ChIRP-MS involves purifying an RNA of interest along with its associated proteins from crosslinked, sonicated cells using specific RNA probe-based capture, then identifying the bound proteins by MS [58]. Control probes directed against GFP were included to identify nonspecific interactions, which were then filtered out of the dataset. Using ChIRP-MS, we identified 195 proteins associated with the GADD45B 3’UTR and 245 proteins associated with the IL-6 3’UTR, of which 124 were in common between the two sets (S1 Table & S5 Fig). Many of the proteins previously identified as bound to the IL-6 SRE (Fig 5B, gray nodes; [27]) were also recovered using ChIRP-MS for the IL-6 3’ UTR and were similarly associated with the GADD45B 3’ UTR (S2 Table & Fig 5B, purple nodes). We sought to independently validate a subset of these common interactors by western blot following ChIRP (Fig 5C). Again, we recovered NCL and HuR (also known as ELAVL1), two proteins that were previously identified as important for IL-6 escape from SOX degradation [26,27]. We also confirmed hnRNPU, a protein that binds the IL-6 SRE but is not required for escape of the IL-6 SRE from SOX [27]. However, other IL-6 SRE-bound proteins required for its escape function were not detected on the GADD45B 3’ UTR by ChIRP-western blot, including IGF2BP1, STAU1, ZC3HAV1, YTHDC2, NPM1, and hnRNPD (Fig 5C). The fact that IGF2BP1 and NPM1 were recovered in the GADD45B and IL-6 ChIRP-MS experiments but not in the ChIRP-western blots likely reflects differences in sensitivity between MS and western blotting. To further validate the interactions with NCL, HuR, and hnRNPU, we immunoprecipited (IP) each endogenous protein from 293T cells and performed RT-qPCR to measure the level of co-precipitating endogenous GADD45B RNA. We observed a >5-fold enrichment of GADD45B mRNA over the mock (IgG) IP for both NCL and HuR, although we were not able to detect an association with hnRNPU in this assay (Fig 5D). We confirmed that the interaction occurs on the GADD45B 3’UTR by performing the IPs from cells transfected with a GFP reporter fused to either the GADD45B 5’ UTR or 3’ UTR (Fig 5E). The structurally compromised mutant GADD45B 3’UTR_GG described in Fig 4B failed to interact with NCL and HuR, confirming that the stem-loop structure in the SRE is important for protein binding (Fig 5E). Collectively, these data suggest that while there is some overlap between the sequence, structure, and RNA binding proteins associated with the GADD45B and IL-6 SREs, these elements likely assemble distinct RNP complexes and thus may function in a related but non-identical manner. Depletion of either HuR or NCL impairs the ability of the IL-6 derived SRE to protect its associated mRNA from degradation by SOX [26,27]. Given that both proteins are also bound by the G-SRE, we evaluated whether they were similarly important for G-SRE-mediated escape. We individually depleted each protein from 293T cells using siRNAs targeting HuR or NCL (or control non-targeting siRNAs), then measured the ability of SOX to degrade the GFP-GADD45B-3’UTR reporter by RT-qPCR (Fig 6A & 6B). Similar to the IL-6 SRE, depletion of HuR eliminated the protective capacity of the G-SRE, leading to degradation of the GFP-GADD45B-3’UTR mRNA in SOX-expressing cells (Fig 6A). Surprisingly however, depletion of NCL did not impair the protective effect of the G-SRE in SOX-expressing cells (Fig 6B). Finally, we used the GFP-GADD45B-3’UTR reporter to evaluate whether the G-SRE conferred protection from cleavage by the panel of viral endonucleases described in Fig 1. Using the same experimental set up as was used for the IL-6 derived SRE reporter, we observed that while the GADD45B 3’ UTR protected against SOX and vhs, it was unable to protect against degradation by muSOX, BGLF5, and PA-X (Fig 6C). Furthermore, it did not protect against cleavage by the nsp1-activated host endonuclease (Fig 6C). Thus, although the IL-6 and GADD45B derived nuclease escape elements exhibit a number of similarities, they are distinct in both their RNP complex requirements and in the breadth of nucleases they restrict. Viruses extensively interface with the host gene expression machinery to promote their own RNA and protein synthesis and to control the cellular response to infection. In this regard, they have proven to be invaluable tools to dissect mechanisms of gene regulation. Here, we reveal that a ~200 nt sequence present in the 3’ UTR of the cellular IL-6 mRNA functions as a broad-acting, virus-specific endonuclease escape element, and identify a similar element in the GADD45B 3’ UTR. Although these two SREs are not identical in their protective capacity, they display some sequence and putative structural similarities and are both functionally dependent on HuR binding. We hypothesize that these may therefore be representative members of a new type of RNA regulatory element engaged during viral endonuclease-triggered mRNA decay. Determining whether other such elements exist in mammalian or viral mRNAs is an important future goal, as is deciphering conditions under which such elements impact RNA fate in uninfected cells. The IL-6 and GADD45B SREs display relatively limited sequence similarity but have at least one structurally important stem-loop in common. Thus, RNA structure appears to be a central component of an SRE and is likely to influence recruitment or arrangement of proteins involved in escape. This is in line with the fact that RNP assembly can be more heavily impacted by structural fidelity than primary sequence recognition [59]. We hypothesize that there is a core set of proteins required for SRE function, such as HuR, but that individual SREs recruit distinct accessory factors that dictate the conditions or mechanism by which that SRE protects against nuclease targeting. In this regard, we have not found significant overlap between known HuR mRNA targets and mRNAs that are not downregulated by SOX [22]. This is in agreement with the fact that many of the SRE bound proteins have a breadth of roles in controlling RNA fate beyond conferring nuclease escape [60–64]. SRE activity may be further impacted by the cellular context and neighboring regulatory features, particularly in the case of tightly controlled transcripts. The 3’ UTR of IL-6, for example, is targeted by several cellular endonucleases including MCPIP1 [65–67], which has recently been reported to be inhibited during de novo KSHV infection [68]. The above features underscore the importance of characterizing multiple SREs to parse out specific protein requirements, but also present challenges for the identification of SREs, as they cannot be easily predicted. Indeed, it has taken more than a decade from the first report of IL-6 escaping SOX-induced host shutoff to identify a second SRE-containing mRNA [29]. The observation that the IL-6 SRE in particular acts against diverse viral endonucleases but does not impact host endonucleases has important implications for understanding target recognition by these host shutoff factors. First, it suggests that there are key commonalities to how the viral endonucleases are recruited to mRNAs, and that these features are distinct from those involved in cellular endonuclease recruitment. The viral endonucleases recognize translation competent mRNAs, but do not require ongoing translation for cleavage [10]. While vhs is recruited to a 5’ cap proximal location due to its interaction with a eIF4H, the SOX homologs do not respond to particular location cues on their target mRNA, and instead recognize a degenerate target motif that can be positioned anywhere [10,21,69–71]. PA-X has been suggested to bind RNA processing factors in the nucleus, but how it recognizes cytoplasmic mRNA targets remains unknown [72]. By contrast, the cellular NMD and no-go decay quality control pathways show a clear dependence on translation for target recognition, and mRNA cleavage occurs at the site of the error or translation stall [13]. The observation that neither the IL-6 nor GADD45B SREs impede these cellular endonucleases indicates that SREs are not inhibitory to translation. Furthermore, our FISH data do not support mRNA relocalization or sequestration as a driving feature of SRE-mediated escape. We instead hypothesize that the SRE somehow occludes one or more factors required for recruitment of the viral endonucleases. This could occur via long-range interactions with mRNA cap-associated proteins, which we previously showed can take place for the IL-6 SRE [27]. The fact that the GADD45B SRE restricts against a more limited set of host shutoff factors argues against a single factor requirement. However, it is possible that there are multiple binding sites on one factor that are more comprehensively blocked by the IL-6 SRE. Independent of the mechanisms involved, nuclease escape elements could be developed as tools to broadly inhibit viral endonucleases without disrupting normal RNA decay pathways. How might viruses benefit from maintaining the expression of IL-6 and GADD45B during infection? The requirement for IL-6 during KSHV infection is well documented [30–38], but the role of GADD45B may be more nuanced. While we demonstrated that it escapes host shutoff during lytic KSHV infection and appears important for viral reactivation in the iSLK. 219 model, GADD45B expression is repressed by viral miRNAs during latency to avoid its cell cycle arrest and pro-apoptotic functions [73]. However, GADD45B has a number of additional activities that could be necessary for the viral lytic cycle. These include promoting DNA demethylation and Retinoblastoma (Rb) inactivation, processes that are important for a number of DNA viruses, including KSHV [74–79]. If our hypothesis that there are numerous SREs throughout the transcriptome is correct, it is likely that individual viruses require only a subset of these host genes for replication. Other mRNAs may collaterally escape simply because they contain SREs that functionally mimic those present in the ‘required’ mRNAs. In this regard, the fact that a given mRNA escapes degradation by multiple viral endonucleases does not necessarily indicate that expression of that gene is broadly required for infection. Finally, it is important to bear in mind that the SREs discovered thus far are cellular elements that assemble cellular proteins—and thus presumably play host-directed roles in the regulation of their associated transcripts. It may therefore be the case that some SRE-bearing mRNAs function in an antiviral capacity. Exploring possible virus-host evolutionary interplay for SREs remains an exciting prospect for future studies. The KSHV-positive B cell line bearing a doxycycline-inducible version of the major lytic transactivator RTA (TREX-BCBL-1) [55] was maintained in RPMI medium (Invitrogen) supplemented with 10% fetal bovine serum (FBS; Invitrogen), 200 μM L-glutamine (Invitrogen), 100 U/ml penicillin/streptomycin (Invitrogen), and 50 μg/ml hygromycin B (Omega Scientific). Lytic reactivation was induced by treatment with 20 ng/ml 2-O-tetradecanoylphorbol-13-acetate (TPA; Sigma), 1 μg/ml doxycycline (BD Biosciences), and 500 ng/ml ionomycin (Fisher Scientific) for 48h. 293T cells (ATCC) were grown in DMEM (Invitrogen) supplemented with 10% FBS. The KHSV-infected renal carcinoma cell line iSLK. 219 bearing doxycycline-inducible RTA was grown in DMEM supplemented with 10% FBS [56]. KSHV lytic reactivation of the iSLK. 219 cells was induced by the addition of 0. 2 μg/ml doxycycline (BD Biosciences) and 110 μg/ml sodium butyrate for 48 h. For DNA transfections, cells were plated and transfected after 24h when 70% confluent using linear PEI (polyethylenimine). For small interfering RNA (siRNA) transfections, 293T cells were reverse transfected in 12-well plates by INTERFERin (Polyplus-Transfection) with 10 μM of siRNAs. siRNAs were obtained from IDT as DsiRNA (siRNA SMG6: hs. Ri. SMG6. 13. 1; siRNA NCL: hs. Ri. NCL. 13. 1; siRNA HuR ELAVL1#1: hs. Ri. ELAVL1. 13. 2; siRNA ELAVL1#2: hs. Ri. ELAVL1. 13. 3). 48h following siRNA transfection, the cells subjected to DNA transfection as indicated. The GADD45B 5’UTR and CDS were obtained as G-blocks from IDT and cloned into a pcDNA3. 1 plasmid downstream of the GFP coding sequence. GADD45B 3’UTR was cloned from a pDest-765 plasmid (kindly provided by J. Ziegelbauer) into a pcDNA3. 1 plasmid downstream of the GFP coding sequence. The GFP-IL-6 3’UTR, SRE and ΔSRE fusion constructs were described previously [27]. The dsRed2 and dsRed2-PTC reporters were described elsewhere [10]. The SRE and ΔSRE were PCR amplified from the GFP reporters and cloned downstream of the dsRed2 ORF. Point mutations were introduced with the Quickchange site directed mutagenesis protocol (Agilent) using the primers described in S3 Table. Stellaris FiSH probes recognizing MS2 and GAPDH labeled with Quasar 570 Dye (MS2: SMF-1063-5; GAPDH: SMF-2026-1) were hybridized in 293T cells following manufacturer’s instructions available online at www. biosearchtech. com/stellarisprotocols. Briefly, 293T cells were grown on coverslips and transfected with either an empty vector control or the MS2-SRE or MS2ΔSRE constructs. 24h later, cells were washed, fixed in 4% formaldehyde and permeabilized in 70% ethanol. Probes (12. 5μM) were then hybridized for >5h at 37°C in Vanadyl ribonucleoside (10μM), formamide (10%), saline sodium citrate (SSC), dextran (10%) and BSA (0. 2%). DAPI was added for the last hour to stain cell nuclei. Coverslips were washed in SSC and mounted in Vectashield mounting medium (VectorLabs) before visualization by confocal microscopy on a Zeiss LSM 710 AxioObserver microscope. ChIRP was carried out according to a protocol published previously [58] with minor modifications. Briefly, 293T cells were transfected with the GFP-GADD45B 3’UTR plasmid and 24h later cells were crosslinked in 3% formaldehyde for 30 minutes, quenched in 125mM Glycine, washed with PBS and the pellet was flash frozen. Pellets were then lysed in fresh ChIRP Lysis Buffer [Tris pH 7. 4 50mM, EDTA 10mM, SDS 1%], sonicated, and cell debris was removed by centrifugation at (14,000rpm for 10 min). Two mL of hybridization buffer was added to each sample along with 100pmol of the indicated probes (see S3 Table for sequences). Hybridization was carried out for 4-12h. After adding streptavidin beads to the samples for 1h, samples were washed and reverse crosslinked at 65°C overnight. For western blotting, beads were resuspended in 4X loading buffer, boiled for 30 minutes and resolved by SDS-PAGE. For mass spectrometry, recovered proteins from two independent biological replicates were gel extracted and subjected to LC-MS/MS at the UC Berkeley Vincent J. Coates Proteomics/Mass Spectrometry Laboratory. RNA was synthesized by Dharmacon (SRE-HP #CTM-299208, GADD45-HP- #CTM-299209). Approximately 1ug of RNA was 5’ end-labeled and purified on an 8M urea gel. Samples were then ethanol precipitated in presence of glycogen, washed in 70% ethanol and dissolved in 20 μL of DEPC-treated water. Reactions were carried out with ~1uL of purified RNA (~100,000cpm). In-line probing was performed following a standard procedure [57]. Briefly, in-line probing assays were carried for 40h in 2X in-line buffer [100 mM Tris⋅HCl, pH 8. 3,40 mM MgCl2,200 mM KCl] and quenched by adding the same volume of RNA loading Buffer [95% formamide, 10 mM EDTA and 0. 025% xylene cyanol]. The no-reaction (NR) treatment, RNase T1 (T1) and partial base hydrolysis (–OH) ladders were prepared as 20μL reactions and quenched with 20 μL RNA loading buffer. Dried gels were exposed on a phosphorimager screen and scanned using a Typhoon laser-scanning system (GE Healthcare). Total RNA was harvested using Trizol following the manufacture' s protocol. cDNAs were synthesized from 1 μg of total RNA using AMV reverse transcriptase (Promega), and used directly for quantitative PCR (qPCR) analysis with the DyNAmo ColorFlash SYBR green qPCR kit (Thermo Scientific). Signals obtained by qPCR were normalized to 18S. Cells were crosslinked in 1% formaldehyde for 10 minutes, quenched in 125mM glycine and washed in PBS. Cells were then lysed in low-salt lysis buffer [NaCl 150mM, NP-40 0. 5%, Tris pH8 50mM, DTT 1mM, MgCl2 3mM containing protease inhibitor cocktail and RNase inhibitor] and sonicated. After removal of cell debris, specific antibodies were added as indicated overnight at 4°C. Magnetic G-coupled beads were added for 1h, washed three times with lysis buffer and twice with high-salt lysis buffer (low-salt lysis buffer except containing 400mM NaCl). Samples were separated into two fractions. Beads containing the fraction used for western blotting were resuspended in 30μL lysis buffer. Beads containing the fraction used for RNA extraction were resuspended in Proteinase K buffer (NaCl 100mM, Tris pH 7. 4 10mM, EDTA 1mM, SDS 0. 5%) containing 1μL of PK (Proteinase K). Samples were incubated overnight at 65°C to reverse crosslinking. Samples to be analyzed by western blot were then supplemented with 10μL of 4X loading buffer before resolution by SDS-PAGE. RNA samples were resuspend in Trizol and were processed as described above. Lysates were resolved by SDS-PAGE and western blotted with the following antibodies at 1: 1000 in TBST (Tris-buffered saline, 0. 1% Tween 20): rabbit anti-EST1A/SMG6 (Abcam), rabbit anti-NCL (Abcam), rabbit anti-HuR (Millipore), rabbit anti-actin (Abcam), rabbit anti-IGF2BP1 (Abcam), rabbit anti-YTHDC2 (Abcam), rabbit anti-hnRNPU (Abcam), rabbit anti-ZC3HAV1 (Abcam), rabbit anti-hnRNPD (Abcam), rabbit anti-STAU1 (Pierce), mouse anti-NPM1 (Abcam), rabbit anti-GADD45 (Abcam), mouse anti-GAPDH (Abcam), mouse anti-ORF59 (Adv biotechnologies), or rabbit anti-K8. 1 (PRF&L, inc). Primary antibody incubations were followed by HRP-conjugated goat anti-mouse or goat anti-rabbit secondary antibodies (Southern Biotechnology, 1: 5000). All results are expressed as means ± S. E. M. of experiments independently repeated at least three times. Unpaired Student' s t test was used to evaluate the statistical difference between samples. Significance was evaluated with P values as follows: * p<0. 1; ** p<0. 05; *** p<0. 01.

Title: Nuclease escape elements protect messenger RNA against cleavage by multiple viral endonucleases Summary: The ability of viruses to control the host gene expression environment is crucial to promote viral infection. Many viruses express factors that reduce host gene expression through widespread mRNA decay. However, some mRNAs escape this fate, like the transcript encoding the immunoregulatory cytokine IL-6 during KSHV infection. IL-6 escape relies on an RNA regulatory element located in its 3'UTR and involves the recruitment of a protective protein complex. Here, we show that this escape extends beyond KSHV to a variety of related and unrelated viral endonucleases. However, the IL-6 element does not protect against cellular endonucleases, revealing for the first time a virus-specific nuclease escape element. We identified a related escape element in the GADD45B mRNA, which displays several similarities with the IL-6 element. However, these elements assemble a largely distinct complex of proteins, leading to differences in the breadth of their protective capacity. Collectively, these findings reveal how a putative new class of RNA elements function to control RNA fate in the background of widespread mRNA degradation by viral endonucleases.

lay_plos

en

Write a title and summarize: In humans and rodents, stress promotes habit-based behaviors that can interfere with action–outcome decision-making. Further, developmental stressor exposure confers long-term habit biases across rodent–primate species. Despite these homologies, mechanisms remain unclear. We first report that exposure to the primary glucocorticoid corticosterone (CORT) in adolescent mice recapitulates multiple neurobehavioral consequences of stressor exposure, including long-lasting biases towards habit-based responding in a food-reinforced operant conditioning task. In both adolescents and adults, CORT also caused a shift in the balance between full-length tyrosine kinase receptor B (trkB) and a truncated form of this neurotrophin receptor, favoring the inactive form throughout multiple corticolimbic brain regions. In adolescents, phosphorylation of the trkB substrate extracellular signal-regulated kinase 42/44 (ERK42/44) in the ventral hippocampus was also diminished, a long-term effect that persisted for at least 12 wk. Administration of the trkB agonist 7,8-dihydroxyflavone (7,8-DHF) during adolescence at doses that stimulated ERK42/44 corrected long-lasting corticosterone-induced behavioral abnormalities. Meanwhile, viral-mediated overexpression of truncated trkB in the ventral hippocampus reduced local ERK42/44 phosphorylation and was sufficient to induce habit-based and depression-like behaviors. Together, our findings indicate that ventral hippocampal trkB is essential to goal-directed action selection, countering habit-based behavior otherwise facilitated by developmental stress hormone exposure. They also reveal an early-life sensitive period during which trkB–ERK42/44 tone determines long-term behavioral outcomes. Goal-directed actions are defined as behaviors directed towards achieving a specific outcome. By contrast, habits are stimulus elicited and insensitive to action–outcome relationships. Individuals who experience early-life stress have an increased incidence of behaviors that can lead to addiction and obesity as adults, and Patterson et al. [1] provided evidence that these behaviors may result from an overreliance on outcome-insensitive habits. In rats, chronic stressor exposure similarly biases behavioral response strategies towards habits [2], and the primary glucocorticoid corticosterone (CORT) is sufficient to induce habit biases in both rats and mice [3]. Exogenous glucocorticoids similarly enhance habit-based learning and memory in humans [4]. And like early-life stress [1], prenatal stress in humans and maternal separation in neonatal rats also induce inflexible habit behavior [5,6]. Despite these convergences across species, how elevated glucocorticoids, particularly during specific developmental periods, cause long-term biases towards habit-based behavior remains unclear. To address this issue, we elevated CORT in mice during a timespan equivalent to early adolescence in humans, which induced habit biases in adulthood. We hypothesized that adolescent CORT exposure may have long-term behavioral consequences by impacting tyrosine kinase receptor B (trkB), the high-affinity receptor for Brain-derived Neurotrophic Factor (BDNF), in corticolimbic regions. We were motivated by evidence that corticohippocampal trkB levels increase during early postnatal development and adolescence [7] and are stress sensitive [8]. Our investigations focused on the ventral hippocampus (vHC), medial prefrontal cortex (mPFC), striatum, and amygdala, brain regions implicated in action–outcome decision-making—that is, in selecting behaviors based on expected consequences, rather than familiar habit-based strategies [9–13]. Specifically, inactivation of the mPFC or connected regions of the striatum causes failures in selecting actions based on their outcomes or on outcome value [9–13]. Similar behavioral impairments follow amygdala inactivation (in particular, inactivation of the basolateral compartment [13]). Meanwhile, vHC inactivation disrupts goal encoding in the mPFC [14,15], and the vHC appears to route contextual and task-relevant information to the mPFC and amygdala in order to influence reward-related decision-making and response selection [16,17]. Habit biases that occur due to disruptions in corticolimbic networks may be associated with depression-like behavior. Depressive rumination in humans can be habit-like—stimulus elicited, resistant to change, and precipitated by stressor exposure [18]. A sense of helplessness in depression has also been conceptualized as a habit-based weakness in awareness of action–outcome contingency [19]. To investigate habit biases following adolescent CORT exposure, we used an instrumental contingency degradation procedure in which a familiar behavior was uncoupled from reward. To investigate depression-like behavior, we turned to the progressive ratio task, a classical assay of reward-related motivation. Using these separable strategies, our findings suggest that vHC trkB is necessary for goal-directed action (occluding habits) and that compromised trkB signaling induces habit-based and depression-like behavior. They also reveal a sensitive period during which enhancing ERK42/44 activity during adolescence can interfere with CORT-induced habit-based and depression-like behavior later in life. In both humans and rodents, glucocorticoid exposure can induce biases towards habit-based behavior, at the expense of goal-directed action [3,4]. Furthermore, stressor exposure during early developmental periods appears to confer long-term habit biases across rodent–primate species [1,5, 6]. Despite these homologies, mechanisms remain unclear. To address these issues, we exposed mice to CORT in the drinking water from postnatal day (P) 31–42, equivalent to early adolescence in humans [20]. The timing of experimental events is provided in Table 1, and timelines are also provided in the figures. We first confirmed that exogenous CORT exposure elevated blood serum CORT late in the active period (that is, nighttime) when mice had been active and ingesting CORT for several h. Notably, levels did not differ between CORT-exposed and control groups during the early active period when mice were just waking (interaction F (1,27) = 22. 3, p < 0. 001) (Fig 1a). This pattern indicates that exogenous CORT disrupts typical diurnal changes in blood serum CORT levels. Correspondingly, adrenal and thymus glands atrophied during the CORT exposure period, as expected (t8 = 5. 7, p < 0. 001; t8 = 4. 24, p = 0. 003) (Fig 1b). Also as expected, gland weights recovered when exogenous CORT was removed (t10 = −0. 25, p = 0. 8; t10 = 0. 099, p = 0. 9) (Fig 1b). Despite this recovery, break point ratios in a progressive ratio test, an assay of reward-related motivation, were reduced in mice with a history of CORT exposure (t9 = 2. 39, p = 0. 04) (Fig 1c). This pattern is consistent with amotivation in depression and provides evidence of long-term behavioral consequences of adolescent CORT exposure. We next compared our oral CORT exposure procedure to daily forced swim stress. Forced swimming increased blood serum CORT as expected, although this effect appeared to habituate with repeated exposure (F (2,20) = 4. 0, p = 0. 04) (Fig 1d). Nonetheless, adolescent stressor exposure decreased progressive ratio break points, as with the oral CORT procedure (t13 = 3. 56, p = 0. 003) (Fig 1e). Another well-characterized consequence of repeated stressor exposure is the elimination of dendritic spines on pyramidal mPFC neurons [21]. Thus, as another experiment validating our CORT exposure method, we enumerated dendritic spines on excitatory deep-layer pyramidal neurons in the mPFC using thy1-yellow fluorescent protein (YFP) –expressing transgenic mice. Spines were eliminated in the anterior-most sections (interaction F (1,73) = 4. 9, p = 0. 03) (Fig 1f). The effect size (Cohen’s d) was 0. 92, signaling that approximately 80% of dendrites in CORT-exposed mice had fewer dendritic spines than the control mean. Dendritic spines were also reconstructed in 3D, revealing increased volume following CORT (main effect F (1,72) = 6. 2, p = 0. 02) (Fig 1g). This phenomenon could not be accounted for by an increase in the head size (Fs < 1) (Fig 1h), suggesting that CORT induced dysmorphic spines with aberrantly large necks. This pattern was detected even several weeks following CORT exposure (S1 Fig). Lastly, we exposed adult mice with a history of adolescent CORT treatment to the forced swim test. In this test, attempting to escape has been termed “active coping, ” while immobility has been termed “passive coping” [22]. Prior CORT exposure did not impact baseline immobility scores; however, an acute stressor challenge prompted an active coping style in control mice, reducing immobility. CORT-exposed mice were, by comparison, more immobile, favoring a passive response (CORT × stress F (1,21) = 6. 3, p = 0. 02) (Fig 1i). Thus, exposure to exogenous CORT in adolescence modified stressor reactivity in adulthood. Having characterized our model, we next determined whether the same subchronic CORT exposure procedure would impact habit biases. We first trained control and CORT-exposed mice to nose poke 2 separate recesses for food reinforcers. We detected no side biases nor group differences in instrumental response acquisition rates (F (1,15) = 2. 7, p = 0. 12; interaction F (9,135) = 1. 6, p = 0. 12) (Fig 2a). We next decreased the likelihood that 1 response would be reinforced. A “goal-directed” response strategy is to then preferentially engage the remaining behavior, which remains likely to be reinforced, while habit-based responding is insensitive to action–outcome contingency [23]. In this case, mice engage both responses (both “non-degraded” and “degraded”) equivalently. Following an initial test, both groups inhibited the response that was unlikely to be reinforced in a goal-directed (nonhabitual) fashion (main effect F (1,15) = 11. 6, p = 0. 004; no interaction) (test 1, Fig 2b). Response rates were also lower overall in the CORT-exposed mice, consistent with diminished break point ratios in the progressive ratio test (Fig 1c). With additional training using random interval (RI) schedules of reinforcement that can bias responding towards habits, mice with a history of CORT exposure indeed assumed habit-based strategies, failing to differentiate between the behaviors that were more (or less) likely to be reinforced. Meanwhile, control mice differentiated between the responses, retaining goal-oriented response strategies (interaction F (1,13) = 6. 0, p = 0. 03) (test 2, Fig 2b). Thus, subchronic CORT exposure in adolescence causes a bias towards habit formation in adulthood. Notably, we discovered the same patterns when we tested female, rather than male, mice (S2 Fig). In separate mice, test 2 occurred in a distinct context. In this case, both groups generated the response that was likely to be reinforced (main effect F (1,12) = 16. 7, p = 0. 001; no interaction) (Fig 2c). Thus, adolescent CORT-induced habits were context dependent. Next, we assessed whether subchronic CORT exposure similarly impacted adult mice. CORT exposure decreased body weights as expected (Table 2). While instrumental response rates during training were generally lower than in our younger cohorts, control versus CORT-exposed groups did not differ (Fs < 1) (Fig 2d). And unlike with subchronic CORT exposure in adolescence, both groups consistently generated the response most likely to be reinforced in a goal-directed fashion (main effect test 1: F (1,12) = 8. 4, p = 0. 01; main effect test 2: F (1,12) = 36, p < 0. 001; no interactions) (Fig 2e). Thus, adolescents were more vulnerable to the habit-inducing influence of elevated glucocorticoids. Insensitivity to instrumental contingencies is commonly associated with insensitivity to reinforcer value. However, when we tested the same mice for sensitivity to reinforcer devaluation, we found no impairment in response inhibition following ad libitum access to the reinforcer pellets prior to test (“devalued” condition), relative to prefeeding with regular chow (“non-devalued” condition) (main effect F (1,26) = 28, p < 0. 001; no interaction) (Fig 2f). Thus, subchronic CORT exposure during adolescence, but not adulthood, induced failures in selecting actions based on their consequences. This failure was context dependent, while value-based action selection was intact. In a final experiment, we exposed adolescent mice to CORT, then trained them to respond for food reinforcers following a prolonged, 4-wk washout period. This procedure doubled the “recovery” period following CORT and matched the age of testing in our adult CORT-exposed population. Mice acquired the nose poke responses without group differences (F (1,21) = 2. 7, p = 0. 12; interaction Fs < 1. 2) (Fig 2g). Mice were sensitive to action–outcome contingency degradation at test 1, as in all other groups (main effect F (1,21) = 5. 8, p = 0. 03; no interaction) (Fig 2h). In a second test, CORT-exposed mice again preferentially generated the response most likely to be reinforced; however, this preference decayed (group × response × time interaction F (1,20) = 4. 2, p = 0. 05) (Fig 2h). Thus, adolescent CORT-exposed mice recovered some function with a prolonged washout period (as opposed to our shorter washout period tested above), but habitual response biases remained detectable nearly 1 mo following exposure. The transition from goal-directed to habit-based modes of response has been characterized as a decline in behavioral control by specific prefrontal cortex (PFC) -limbic structures (e. g., Fig 3a), in favor of sensorimotor circuits [11–13,23–25]. Within the hippocampus, the ventral compartment provides the primary inputs to the PFC [26]. For these reasons, we assessed levels of the stress-sensitive neurotrophin receptor trkB and phosphorylation of its substrate ERK42/44 in a mPFC–vHC–amygdala–striatal network. Results are reported in Table 3. Key findings are also displayed graphically. Specifically, adolescent CORT exposure decreased the ratio of full-length trkB/trkB. t1 in the mPFC (t12 = 4. 3, p < 0. 001) (Fig 3b). This pattern was not anatomically selective—in both the vHC and amygdala, developmental CORT also decreased trkB/trkB. t1 ratios (main effect of CORT F (1,23) = 10. 7, p = 0. 003) (Fig 3c, top), as was also observed in the ventral striatum (t10 = 3. 9, p = 0. 003) (Table 3). CORT elevated overall levels of trkB. t1 in the vHC (interaction F (1,21) = 5. 8, p = 0. 025) (Fig 3c, bottom) and ventral striatum (t10 = −2. 3, p = 0. 046) (Table 3), but only in the vHC were levels of phosphorylated (active) ERK42/44 also decreased by CORT (Fig 3d; Table 3). Of note, phosphorylated ERK (p-ERK) levels were also generally higher in the vHC than the amygdala (p-ERK42 F (1,18) = 16. 4, p < 0. 001; p-ERK44 F (1,18) = 8. 5, p = 0. 009) (Fig 3d). To determine whether this effect was long lasting, we immunoblotted for p-ERK42/44 in the vHC 12 wk following adolescent CORT exposure, again revealing lower phosphorylated levels of both ERK isoforms (p-ERK42: t18 = 2. 7, p = 0. 01; p-ERK44: t18 = 3, p = 0. 008) (Fig 3e). We next tested adult mice exposed to CORT. CORT again decreased amygdalo–hippocampal ratios of full-length trkB/trkB. t1 (main effect F (1,18) = 9. 4, p = 0. 007) and also elevated trkB. t1 (main effect F (1,20) = 21. 2, p < 0. 001) (Fig 3f); however, we identified no effect of CORT on p-ERK42/44 (main effects and interactions p > 0. 18) (Fig 3g). Thus, a unique consequence of subchronic CORT exposure in adolescence appears to be the elevation of trkB. t1 and concurrent suppression of p-ERK42/44 within the vHC. Next, we attempted to block adolescent CORT-induced habits with the trkB agonist 7,8-dihydroxyflavone (7,8-DHF). We first aimed to identify a dose range that stimulated p-ERK42/44 in the vHC. Three and 10 mg/kg, intraperitoneal (i. p.), induced ERK42 phosphorylation (F (2,38) = 3. 9, p = 0. 03) (Fig 4a), though p-ERK44 levels were not affected (F (2,38) = 1. 7, p = 0. 2) (Fig 4b). 7,8-DHF also blocked the chronic p-ERK42 deficit due to CORT exposure (Table 4) while having no long-term consequences for adrenal and thymus gland weights (S1 Table), and the 10 mg/kg dose increased levels of the postsynaptic marker, postsynaptic density 95 (PSD95) (F (2,24) = 4. 8, p = 0. 02) (Fig 4c). Next, separate mice were exposed to CORT during early adolescence, and half were treated with 7,8-DHF (3 mg/kg) from P39–47, overlapping with the end of the CORT exposure period and extending into late adolescence [20] (Fig 4d). As adults, mice acquired the nose poke responses with no group differences (main effect CORT and 7,8-DHF Fs < 1; CORT × 7,8-DHF interaction F (1,19) = 3. 8, p = 0. 065; all other interactions Fs ≤ 1. 1) (Fig 4e). Following an initial instrumental contingency degradation test, all groups preferentially generated the response most likely to be reinforced in a goal-directed fashion as in our experiments described above (main effect F (1,20) = 24. 6, p < 0. 001; no interaction) (test 1, not shown). With more training, CORT-exposed mice developed habit-based behavior, also as expected, but critically, 7,8-DHF blocked CORT-induced habit biases (CORT × response interaction F (1,19) = 7. 2, p = 0. 015; 7,8-DHF × response interaction F (1,19) = 5. 3, p = 0. 03) (test 2, Fig 4f). This effect of 7,8-DHF was also detectable in female mice (S2 Fig). We next tested these mice in the forced swim test. As in Fig 1, prior CORT did not impact immobility in the absence of stressor exposure in adulthood. However, a history of 7,8-DHF treatment reduced time spent immobile, an antidepressant-like effect that was notably detectable multiple weeks following treatment (main effect of 7,8-DHF F (1,20) = 8. 3, p = 0. 008; no interaction) (Fig 4g). The reduction in time spent immobile could not obviously be attributable to general hyperactivity following 7,8-DHF treatment (S2 Table). We also quantified responding on a progressive ratio schedule of reinforcement. 7,8-DHF dose-dependently blocked CORT-induced deficits in break point ratios, and this blockade was detectable when either total responses or break points were compared (interactions F (2,56) = 3. 9, p = 0. 03; F (2,54) = 3. 4, p = 0. 04). Break points are shown (Fig 4h). To summarize, adolescent CORT exposure increases levels of trkB. t1 and decreases p-ERK42/44 in the vHC and also induces biases towards habit-based behaviors. These biases are blocked by the putative trkB agonist 7,8-DHF at doses that increase p-ERK42 in vHC. To determine whether selectively elevating trkB. t1 and decreasing p-ERK42/44 in the vHC is sufficient to recapitulate the behavioral effects of CORT exposure, we overexpressed Trkb. t1 in the vHC and a major projection target, the central nucleus of the amygdala (CeA) (Fig 5a). vHC-targeted infusions were mostly restricted to the ventral Cornu amonis (CA) 1 region, with some spread into the intermediate hippocampus (Fig 5a; see also S3 Fig). Amygdala-targeted infusions were largely contained within the CeA as intended (Fig 5a; see also S3 Fig). Seven mice were excluded due to mistargeted infusions infecting white matter tracts, and control green fluorescent protein (GFP) -expressing mice did not differ and were combined. At the infusion site, p-ERK42/44 levels were reduced by 15% in Trkb. t1-expressing mice relative to mice expressing GFP (t13 = 2. 6, p = 0. 02) (Fig 5b), mimicking the long-term consequences of adolescent CORT exposure (compare to Fig 3d). Mice acquired the food-reinforced instrumental responses without group differences (Fs ≤ 1) (Fig 5c). GFP-expressing control mice were sensitive to instrumental contingency degradation, preferentially engaging the response most likely to be reinforced. By contrast, Trkb. t1 overexpression induced inflexible habits, indicated by a failure to respond in a selective fashion following instrumental contingency degradation (interaction F (2,34) = 5. 6, p = 0. 008) (Fig 5d). Thus, Trkb. t1 overexpression recapitulated the long-term effects of adolescent CORT exposure. Next, we expanded these studies, deviating from our protocol used thus far, to assess whether Trkb. t1 overexpression in the vHC also interfered with the ability to “break” habits. We accordingly trained separate mice using an RI schedule of reinforcement. Instrumental response acquisition curves are segregated according to whether the action–outcome contingency associated with each response would ultimately remain intact or be “degraded, ” highlighting equivalent response rates throughout (Fs < 1) (Fig 5e). We modified our typical instrumental contingency degradation procedure to determine whether responses could be inhibited once habits formed. Specifically, we exposed mice to alternating training sessions in which 1 response was reinforced or the contingency between the other response and its outcome was degraded. Initially, mice responded equivalently during these 2 types of training sessions, exhibiting habit-based behavior. With repeated testing, control mice were ultimately able to inhibit the response that was unlikely to be reinforced. By contrast, response strategies in Trkb. t1-overexpressing mice were unchanged and habit-based (group by contingency interaction F (1,32) = 6. 6, p = 0. 02) (Fig 5f). Thus, Trkb. t1 overexpression caused significant behavioral inflexibility. Finally, we also confirmed that vHC Trkb. t1 overexpression decreased break point ratios in a progressive ratio test (t16 = 2. 8, p = 0. 01) (Fig 5g), as with adolescent CORT exposure. This finding is consistent with evidence that vHC-targeted knockdown of the trkB ligand BDNF also induces depression-like behavior [28]. Adolescent CORT exposure also induced a long-term bias towards habit-based response strategies. Specifically, mice were initially able to select actions (left/right nose poke) based on their consequences (food), but with repetition, these behaviors assumed habitual qualities such that they were insensitive to response–outcome contingency. Subchronic CORT exposure did not impact adult mice, indicating that adolescents are more vulnerable to developing CORT-induced habits. Moreover, when we doubled the “recovery” period duration following adolescent CORT exposure, all mice could initially select actions based on their consequences, but response preferences faded over time in CORT-exposed mice. We interpret this as uncertainty in response selection, resulting in a deferral to familiar, habit-based behaviors that are insensitive to response–outcome associations. Behavioral insensitivity to response–outcome contingency is often associated with insensitivity to reinforcer value [23]. This was not the case here, however, in that all mice reduced response rates following prefeeding with the reinforcer pellets, which decreases their value. Why might this be? One possibility is that subchronic CORT exposure particularly impacted hippocampal function. Lesions of the entorhinal cortex, a primary input to the hippocampus, reduce sensitivity to response–outcome contingencies but not reinforcer value, as with CORT here [37,38]. This may be because organisms form an association between the context and response–outcome contingency during training. When that contingency is later violated, the hippocampus detects the discrepancy between “the context where I typically work for reward” and noncontingent pellet delivery and facilitates response inhibition. This model predicts that response strategies should be intact if instrumental contingency degradation occurs in a contextually distinct environment relative to the training environment, which was indeed the case here. In contrast, behavioral sensitivity to reinforcer devaluation is context-independent because it relies on an animal’s ability to prospectively calculate reinforcer value. Accordingly, it is unaffected by entorhinal cortex lesions [37,38], while lesions/inactivation of other structures, such as the dorsal mPFC, basolateral amygdala, and dorsomedial striatum impair sensitivity to both response–outcome contingency and reinforcer value [23]. Based on these findings, we next quantified levels of the stress-sensitive neurotrophin receptor trkB in the vHC and other regions that counter habit-based behavior (dorsal mPFC, amygdala, dorsomedial striatum, and ventral striatum; see [11–13,23]). CORT caused widespread modifications in the ratio of full-length: truncated isoforms, favoring the inactive isoform. (Indeed, of the brain regions tested, only the dorsomedial striatum was spared.) This is significant because trkB. t1 dimerization with full-length trkB reduces the receptor’s ability to stimulate ERK42/44, PI3-kinase, and PLCγ. trkB. t1 is also linked to neurodegeneration [39] and excitotoxicity [40]. Additionally, increasing trkB. t1 decreases cell-surface levels of full-length trkB, further reducing opportunities for trkB-mediated signaling [41]. TrkB. t1 levels remained particularly robust in the vHC even following the CORT exposure period. These findings are in general agreement with prior investigations using social [42] (though not physical [43]) stress. Also, transgenic mice overexpressing Trkb. t1 are insensitive to classical antidepressants [44], further motivating us to investigate whether direct trkB stimulation could have antidepressant-like properties following CORT. Indeed, 7,8-DHF given during adolescence (P39–47) corrected CORT-induced habit behavior and amotivation and increased mobility in the forced swim test, an antidepressant-like effect. 7,8-DHF derivatives also have antidepressant-like consequences in adult mice [45,46] and restore the reinforcing properties of cocaine following stress [47], but ours is the first evidence, to our knowledge, of antidepressant-like efficacy in adolescents. And importantly, effects were detectable well beyond the treatment period. How might adolescent 7,8-DHF treatment confer long-term benefits? Enhancing trkB-mediated signaling could correct the suppressive effects of stressor or CORT exposure on neurogenesis in the vHC or restore BDNF–trkB interactions in the hippocampus, both of which would be associated with antidepressant-like efficacy [29,48,49]. Also of note, vHC innervation of the anterior mPFC develops during adolescence [50]. We found that adolescent CORT exposure caused dendritic spine elimination in the anterior mPFC. Additionally, remaining spines were irregularly enlarged, as also occurs following Trkb ablation [51]. Future studies could determine whether these modifications result from aberrant vHC input and whether 7,8-DHF corrects abnormalities. Finally, while we find a robust p-ERK42/44 response to repeated 7,8-DHF injections, the ability of acute application to stimulate trkB, ERK42/44, and other factors has been questioned [52]. Identifying off-target actions of 7,8-DHF could reveal novel mechanisms by which acute application benefits animal models of depression (e. g., [46]) and Alzheimer disease (discussed in [52]). Despite broad-spread changes in trkB: trkB. t1 ratios following subchronic CORT exposure, p-ERK42/44 was detectably reduced only in the vHC of adolescent CORT-exposed mice. These findings led us to overexpress Trkb. t1 in the vHC, reducing local p-ERK42/44 and causing habit-based behavior. Trkb. t1 overexpression impairs both long-term potentiation and long-term depression ([53,54], but see [55]) and reduces BDNF [56], which could potentially account for a transition away from hippocampal-dependent action selection to habit-based behaviors, which are instead associated with dorsolateral striatal and cortical sensorimotor systems [11–13,23,25]. The vHC innervates the CeA [57] and likely provides BDNF, given that the CeA expresses little Bdnf mRNA but abundant BDNF from non-cortical sources, and among the highest levels of amygdalar trkB [58]. Axonal BDNF transport can be trkB-dependent [59]; thus, we hypothesized that vHC Trkb. t1 overexpression may render the CeA BDNF-deficient and that Trkb. t1 overexpression in the CeA may similarly influence decision-making strategies. Indeed, Trkb. t1 overexpression in the posterior CeA caused a deferral to habit-based strategies. This finding provides novel evidence that the healthy posterior CeA is involved in selecting behaviors according to their consequences. This may occur via regulation of appetitive arousal, rather than encoding specific action–value information per se [60]. By contrast, the anterior (and not posterior) CeA is essential to habit-based behavior, potentially due to interactions with the dorsolateral striatum [61]. Importantly, trkB. t1 is expressed in neurons [40,62,63] and glia [64–66]. Lentiviruses, as used here, preferentially infect excitatory neurons, but moderate glial infection would be anticipated [67]. Future investigations could elucidate cell-type–specific effects of Trkb. t1 overexpression. Also, it is notable that we did not overexpress Trkb. t1 in the mPFC. We were motivated by evidence that selective reduction of its ligand BDNF in this region fails to induce habit-based behavior [3,68]. mPFC-selective Bdnf knockdown does cause depression-like amotivation, however, and targeted BDNF infusions provide partial recovery from CORT-induced amotivation [3]. Thus, systemic 7,8-DHF treatment here may have ameliorated CORT-induced depression-like amotivation by acting in multiple brain regions, not strictly the vHC. To summarize, subchronic CORT exposure in adolescence imbalances trkB/trkB. t1 throughout several brain regions and selectively decreases vHC p-ERK42/44. A Trkb. t1 overexpression procedure that reduces p-ERK42/44 recapitulates CORT-induced behavioral abnormalities. Interestingly, the “pro-habit” effects of vHC Trkb. t1 overexpression were not age dependent, given that viral vector infusion at both P31 and P56 induced behavioral inflexibility. We argue that adolescents are not necessarily uniquely vulnerable to Trkb. t1 overexpression but are rather more vulnerable to a corticosteroid-induced triggering of neurobiological factors associated with depression-like and habit-based behaviors (in this case, the concomitant elevation of trkB. t1 and reduction in p-ERK42/44 in the vHC). Group-housed wildtype C57BL/6 mice (Jackson Labs) were used, except for dendritic spine imaging experiments, in which case mice were thy1-YFP–expressing (C57BL/6 background) [69]. Mice were provided a 12-h light cycle (0800 on) and food and water ad libitum except during instrumental conditioning when body weights of all mice were reduced to 90%–93% of baseline to motivate food-reinforced responding. Mice were males unless otherwise explicitly noted. The timing of experimental events is provided in Table 1, and timelines are also provided in the figures. Procedures were approved by the Emory University Institutional Animal Care and Use Committee, licenses 2000973,2002802, and 4000010, and the Guide for the Care and Use of Laboratory Animals in Research. In cases of euthanasia, mice were deeply anesthetized with isoflurane prior to rapid decapitation. CORT hemisuccinate (4-pregnen-11β 21-DIOL-3 20-DIONE 21-hemisuccinate; Steraloids) was dissolved in tap water (25 μg/ml free base) according to an established protocol [3,29,30]. Mice were given CORT in place of normal drinking water. Water bottles were weighed daily, and mice were weighed every other day (Table 2). Average doses (mg/kg) of CORT were calculated by normalizing daily consumption values per cage to the total body weight of the animals in the same cage. Every 3 d, water bottles were emptied and refilled with fresh water or newly-prepared CORT solution. Mice were exposed to CORT from P31–42 or 56–67 (in 1 cohort, P68 due to experimental error), resulting in approximately 5–9 mg/kg/d. These periods correspond to early adolescence and early adulthood in rodents [20]. Mice were euthanized at the end of the CORT exposure period, or they experienced a 2-, 4-, or 12-wk washout period as indicated. To compare blood serum CORT levels between CORT-exposed versus stressor-exposed mice, naive mice were exposed to forced swim stress at P31 or daily from P31–42. Mice were placed in a glass cylinder (24 cm × 15. 5 cm diameter) filled to 10 cm with 22–25°C water in a dimly lit room. After 6 min, mice were allowed to dry in a warm cage lined with paper towels before being returned to the home cage. Water was changed between mice. Control mice were handled but not exposed to swim stress. Groups were also housed separately. Mice were weighed every other day (Table 2). We collected trunk blood at P31 or P42. Mice were briefly anaesthetized with isoflurane and then decapitated either early in the active, dark cycle (2000 h) or late in the active cycle (0600 h). In the case of swim stress, mice were euthanized 30 min following swimming [70]. Blood was centrifuged in chilled Eppendorph tubes at 4°C for 30 min, and serum was extracted. CORT levels were analyzed in duplicate by ELISA (Assay Designs) in accordance with manufacturer’s instructions with the exception of the extraction step, which was excluded. Adrenal and thymus glands were extracted following euthanasia by midline dissection and weighed in pairs. A widely documented consequence of repeated stressor exposure is the elimination of dendritic spines in the mPFC. As part of our efforts to test the possibility that our CORT exposure procedure recapitulated aspects of stressor exposure, brains from YFP-expressing mice were collected at the end of CORT exposure at P42 and submerged in chilled 4% paraformaldehyde for 48 h, then transferred to 30% w/v sucrose. Brains were sectioned into 40 μm-thick sections at −15°C. Dendrites on deep-layer mPFC neurons, prelimbic/medial orbital compartments, were imaged using confocal microscopy and reconstructed in 3D using Imaris software. Methods are described elsewhere [71], the only modification being that a Leica TSC SP8 microscope was used. Eight dendrites/mouse, 16–25 μm in length and located between Bregma +1. 98–+1. 70, were imaged and reconstructed by a single blinded rater/experiment. In our adolescent population, dendritic spine densities were more variable than expected based on our prior investigations of prelimbic cortical neurons [3,7, 35], and unblinding revealed considerable variance based on rostrocaudal positioning. Most dendrites (73%) were imaged at roughly Bregma +1. 94 or +1. 78. Thus, we next compared dendritic spine densities and morphological metrics by 2-factor (CORT × anatomical position) analysis of variance (ANOVA), total = 4–8 dendrites/mouse, considering each dendrite an independent sample. Values +/− 2 standard deviations from the mean were considered outliers and excluded, and the results of these comparisons are reported here. To investigate long-term consequences of adolescent CORT exposure, dendritic spines were imaged and classified from mice exposed to CORT during adolescence, then behaviorally tested in adulthood (methods described immediately below). Mice were food-restricted and trained to nose poke for 20-mg grain-based food reinforcers (Bio-Serv Precision Pellets) using Med-Associates conditioning chambers equipped with 2 nose poke recesses and a food magazine. Training was initiated with a fixed ratio 1 (FR1; also called “continuous reinforcement”) schedule of reinforcement; 30 reinforcers were available for responding on each aperture (60 reinforcers/session). Sessions ended when mice acquired all reinforcers or at 70 min. 5–7 training sessions were conducted (1/d). Unless specified, response acquisition curves represent both responses/min; there were no response biases throughout. To assess decision-making strategies, a modified version of classical instrumental contingency degradation was used, as in our prior reports (e. g., [3,35,72]). In a 25-min “non-degraded” session, 1 nose poke recess was occluded, and responding on the other was reinforced using a variable ratio 2 schedule of reinforcement. In a 25-min “degraded” session, the opposite aperture was occluded, and responding on the available aperture produced no programmed consequences. Instead, reinforcers were delivered into the magazine at a rate matched to each animal’s reinforcement rate on the previous day (that is, food pellets were delivered independently of the animal’s actions). Thus, responding on 1 aperture became significantly less likely to be reinforced than the other. The order of the sessions and which response–outcome contingency was “degraded” were counterbalanced. The following day, a 5-min probe test was conducted in extinction. Both apertures were available. Mice that are sensitive to instrumental contingencies preferentially generate the response that is likely to be reinforced, a goal-directed response strategy; meanwhile, mice that have developed habits are insensitive to instrumental contingency degradation and generate both familiar responses equally, habitually (for further discussion of this task, see [23]). Following test 1, responding was reinstated using an RI30-sec schedule of reinforcement for 4 d to promote the formation of stimulus–response habits [73]. 30 reinforcers were again available (60 reinforcers/session, 1 session/d). Sessions ended when mice acquired all reinforcers or at 70 min. Then, the 3-day contingency degradation and probe test protocol was repeated (“test 2”). In a separate experiment, mice were trained to nose poke using FR1 and then RI30 schedules of reinforcement. Then, mice were tested in the contingency degradation procedure 3 times (1 session/d) to quantify the development of response inhibition. To determine whether insensitivity to instrumental contingency degradation was context dependent, we utilized a “context shift” [72]: the “non-degraded” and “degraded” training sessions and probe test 2 occurred in unique chambers located in a separate room in the laboratory relative to training and test 1. The chambers were contextually distinct (containing a recessed lever and distinct odors) and configured differently (nose poke ports and house light located on different walls). Following instrumental contingency degradation, nose poking was reinstated using an RI30 schedule of reinforcement during 3 daily training sessions. Then, prefeeding devaluation was used to assess value-based response selection. Mice were placed individually in empty shoebox-style cages for a 1-hr habituation period. Then, mice were allowed access for 30 min to either standard chow or the food pellets used during instrumental conditioning. Immediately following this prefeeding, mice were placed in the conditioning chambers, and responding in a probe test conducted in extinction was measured for 10 min. This procedure was repeated the following day with the opposite food item. Prefeeding with the reinforcer pellets, but not standard chow, reduces response rates if mice select actions based on outcome value. Mice consumed more reinforcer pellets than chow during the prefeeding period; thus, we tested mice in a third condition in which the number of pellets available to each mouse was matched to the amount of chow that the group consumed during the prior prefeeding period. Subsequent response rates during the probe test did not differ (that is, when the pellets were restricted or not), and those following restricted access—controlling the amount of food ingested—are shown. All intake data are provided in S3 Table. In separate mice tested in the instrumental contingency degradation procedure, nose poke responding on 1 recess was reinstated using an FR1 schedule for 2 50-min sessions (1/d). Then, responding on a progressive ratio schedule, in which the response requirement increased by 4 with each reinforcer delivery, was measured. Sessions ended after 180 min or when mice executed no responses for 5 min. The “break point ratio” refers to the highest number of responses: reinforcers generated. Following instrumental conditioning, mice were fed ad libitum. Within 1 wk, mice were placed in a glass cylinder (24 cm × 15. 5 cm diameter) filled to 10 cm with 25°C water, as previously used to detect an increase in immobility following CORT [29]. Ten-min sessions were videotaped under dim light, and time spent immobile, defined as only movements necessary to keep the head above water, was scored by a single blinded rater. In 1 experiment, an acute stressor (19 hr water deprivation) preceded the forced swim test in half of the group; “unstressed” mice in this experiment were left undisturbed. It is important to note that while mice in this report had ad libitum food access at the time of forced swim testing, they had all experienced modest food restriction during instrumental conditioning experiments; this could conceivably influence mobility scores (for review, [74]). Following forced swim testing, locomotor activity was monitored for 24 hr using a custom-built Med-Associates locomotor monitoring system equipped with 16 photocells. Locomotor activity was quantified in photobeam breaks across the 24-hr period, which were summed into 6-hr bins (S2 Table). 7,8-DHF (Sigma; dissolved in 17% dimethylsulfoxide (DMSO) and saline; 3-10mg/kg [46]) was administered i. p. daily from P39-47. This period overlapped with the end of the adolescent CORT exposure period and was determined based on pilot studies. Control mice received 17% DMSO and saline. Mice were euthanized at the end of the CORT exposure procedure; 12 wk following CORT (and following instrumental contingency degradation testing); or 30 min following the last of 8 daily injections of 7,8-DHF. Mice were briefly anaesthetized by isoflurane and euthanized by rapid decapitation. Brains were extracted and frozen at −80°C. Brains were sectioned into 1-mm sections using a chilled brain matrix, and the mPFC, vHC, amygdala, dorsomedial striatum, and ventral striatum were extracted using a 1-mm tissue core by a single experimenter. Tissues were homogenized by sonication in lysis buffer (200 μl: 137 mM NaCl, 20 mM tris-Hcl [pH = 8], 1% igepal, 10% glycerol, 1: 100 Phosphatase Inhibitor Cocktails 2 and 3 [Sigma], 1: 1,000 Protease Inhibitor Cocktail [Sigma]), and stored at −80°C. Protein concentrations were determined using a Bradford colorimetric assay (Pierce). Equal amounts of protein were separated by SDS-PAGE on 7. 5% gradient tris-glycine gels (Bio-rad). Following transfer to PVDF membrane, blots were blocked with 5% nonfat milk for 1 hr. Membranes were incubated with primary antibodies at 4°C overnight and then in horseradish peroxidase secondary antibodies for 1 hr. Immunoreactivity was assessed using a chemiluminescence substrate (Pierce) and measured using a ChemiDoc MP Imaging System (Bio-rad). Densitometry values were normalized to the control sample mean from the same membrane in order to control for fluorescence variance between gels. vHC and amygdala samples were loaded on the same gels to allow for comparisons within and between brain regions and tested at least twice. Primary antibodies were anti-trkB (Rb, Cell Signaling, 4603s, lot 3; 1: 375), anti-ERK42/44 (Rb, Cell Signaling, 9102s, lot 26; 1: 2,000), anti-p-ERK42/44 (Ms, Cell Signaling, 9106s, lot 43; 1: 1,000), and anti-PSD95 (Rb, Cell Signaling, 3450s, lot 2; 1: 1,000). In our initial comparisons of vHC–amygdala ERK42/44, a loading control (GAPDH; Ms, Sigma, G8795, lot 044M4808V; 1: 5,000) was additionally applied to further confirm equivalent loading. Naïve mice were infused with a lentivirus expressing a CMV promoter and truncated trkB receptor isoform, Trkb. t1, with an HA tag (titer = 5. 8 × 108 iu/ml; virus described in [75,76]). Control mice were infused with lenti-GFP, also bearing a CMV promoter. Mice were anaesthetized with ketamine/xylazine and placed in a digitized stereotaxic frame (Stoelting). The scalp was incised, skin retracted, bregma and lambda identified, the head leveled, and stereotaxic coordinates corresponding to the vHC or CeA were located (−3. 0 AP/−4. 0 DV/±2. 75 ML and −1. 5 AP/−4. 9 DV/±3. 0 ML, respectively). Viral vectors were infused over 5 min, with 0. 5 μl/side. Needles were left in place for 5 additional min prior to withdrawal and suturing. Three wk later, instrumental conditioning began. Following testing, fixed brain tissue was imaged for GFP or immunostained for HA as described [76]. Mice were infused at P31 or P56 at the same coordinates; timing did not impact behavioral outcomes. Tissue sections from mice expressing viral vectors were blocked in a PBS solution containing 2% normal goat serum, 1% bovine serum albumin (BSA), and 0. 3% Triton X-100 (Sigma) for 1 hr at room temperature. Sections were then incubated in a primary antibody solution containing 0. 3% normal goat serum, 1% BSA, and 0. 3% Triton X-100 at 4°C for 48 hr. p-ERK42/44 (Rb, Cell Signaling, 9102s, lot 26; 1: 400) served as the primary antibody. Sections were incubated in secondary antibody solution containing 0. 5% normal goat serum and 0. 3% Triton X-100, with Alexa Fluor 633 (1: 200; Life Technologies) serving as the secondary antibody. Sections were imaged on a Nikon 4550s SMZ18 microscope with settings held constant. Integrated intensity (normalized to the size of the sampling area) was measured where HA or GFP staining was also detected. Sections were compared in 2 cohorts, and fluorescence values were normalized to the control mean from each respective cohort. We analyzed 1–10 sections from each mouse, with each animal contributing a single mean value to statistical analysis. Body weights, blood serum CORT, gland weights, response rates, response counts, break point ratios, and densitometry values were compared by 2-tailed ANOVA or t test using SPSS with p < 0. 05 considered significant. Following interactions, post hoc comparisons utilized Tukey’s HSD tests, and results are indicated graphically. In mice bearing Trkb. t1-expressing viral vectors, exclusions due to mistargeted infusions and the combination of control groups resulted in considerably uneven sample sizes (reported in the captions); thus, we compared these groups using type III ANOVA. Statistical approaches to comparing dendritic spine densities and morphologies are outlined in the corresponding section above. Values lying >2 standard deviations above the means were considered outliers and excluded.

Title: Regulation of actions and habits by ventral hippocampal trkB and adolescent corticosteroid exposure Summary: Stress can impair the ability of individuals to select actions based on their consequences, promoting instead the acquisition of habits-automatic behaviors that are insensitive to action-outcome relationships. Stress in adolescence can have particularly long-lasting consequences, affecting behavior and mood regulation even in adulthood. Here, we show that adolescent mice exposed to a stress hormone developed biases towards habits and amotivation (a symptom of depression) in adulthood. We investigated the role of the stress-sensitive tyrosine kinase receptor B (trkB) receptor, a protein that regulates synaptic strength and plasticity in the mammalian nervous system. This receptor was modified by adolescent experience throughout multiple brain regions, but the changes were particularly long lasting in the ventral hippocampus-a brain region involved in mood regulation. Experimentally reducing the activity of the receptor recapitulated the behavioral abnormalities induced by the stress hormone. Meanwhile, pharmacological stimulation of the receptor corrected these abnormalities and had long-lasting antidepressant-like effects that persisted even after drug treatment ended. Thus, pharmacological interventions that augment trkB activity may be particularly efficacious in treating neurobehavioral deficits in adolescents exposed to chronic stress.

lay_plos

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Vermont Wilderness Act of 2006''. SEC. 2. DEFINITIONS. In this Act: (1) Secretary.--The term ``Secretary'' means the Secretary of Agriculture, acting through the Chief of the Forest Service. (2) State.--The term ``State'' means the State of Vermont. TITLE I--DESIGNATION OF WILDERNESS AREAS SEC. 101. DESIGNATION. In accordance with the Wilderness Act (16 U.S.C. 1131 et seq.), the following areas in the State are designated as wilderness areas and as components of the National Wilderness Preservation System: (1) Certain Federal land managed by the United States Forest Service, comprising approximately 28,491 acres, as generally depicted on the map entitled ``Glastenbury Wilderness--Proposed'', dated March 2006, which shall be known as the ``Glastenbury Wilderness''. (2) Certain Federal land managed by the United States Forest Service, comprising approximately 12,437 acres, as generally depicted on the map entitled ``Joseph Battell Wilderness--Proposed'', dated March 2006, which shall be known as the ``Joseph Battell Wilderness''. (3) Certain Federal land managed by the United States Forest Service, comprising approximately 4,223 acres, as generally depicted on the map entitled ``Breadloaf Wilderness Additions--Proposed'', dated March 2006, which shall be known as the ``Breadloaf Wilderness''. (4) Certain Federal land managed by the United States Forest Service, comprising approximately 2,171 acres, as generally depicted on the map entitled ``Lye Brook Wilderness Additions--Proposed'', dated March 2006, which shall be known as the ``Lye Brook Wilderness''. (5) Certain Federal land managed by the United States Forest Service, comprising approximately 797 acres, as generally depicted on the map entitled ``Peru Peak Wilderness Additions--Proposed'', dated March 2006, which shall be known as the ``Peru Peak Wilderness''. (6) Certain Federal land managed by the United States Forest Service, comprising approximately 42 acres, as generally depicted on the map entitled ``Big Branch Wilderness Additions--Proposed'', dated March 2006, which shall be known as the ``Big Branch Wilderness''. SEC. 102. MAP AND DESCRIPTION. (a) In General.--As soon as practicable after the date of enactment of this Act, the Secretary shall file a map and a legal description of each wilderness area designated by section 101 with-- (1) the Committee on Resources of the House of Representatives; (2) the Committee on Agriculture of the House of Representatives; and (3) the Committee on Agriculture, Nutrition, and Forestry of the Senate. (b) Force of Law.--A map and legal description filed under subsection (a) shall have the same force and effect as if included in this Act, except that the Secretary may correct clerical and typographical errors in the map and legal description. (c) Public Availability.--Each map and legal description filed under subsection (a) shall be filed and made available for public inspection in the Office of the Chief of the Forest Service. SEC. 103. ADMINISTRATION. (a) Administration.--Subject to valid rights in existence on the date of enactment of this Act, each wilderness area designated under this section shall be administered by the Secretary in accordance with-- (1) the Federal Land Policy and Management Act of 1976 (43 U.S.C. 1701 et seq.); and (2) the Wilderness Act (16 U.S.C. 1131 et seq.). (b) Fish and Wildlife.--Nothing in this title affects the jurisdiction of the State with respect to wildlife and fish on the public land located in the State, including the stocking of fish in-- (1) lakes and ponds in the State that the State has historically stocked; and (2) rivers and streams in the State to support the Connecticut River Atlantic Salmon Restoration Program. (c) Trails.-- (1) In general.--The Forest Service shall permit the use of minimum tools and traditional, trail-specific methods to mark and maintain-- (A) the Appalachian National Scenic Trail; (B) the Long Trail; (C) the Catamount Trail; and (D) associated trails and structures of the Trails specified in this subsection, as generally depicted on the map entitled ``Trails within the Green Mountain National Forest Wilderness Areas'' and dated April 2006. (2) Catamount trail relocation and completion.--For the segment of the Catamount Trail that is located in the Lye Brook Wilderness, the Secretary-- (A) may waive the requirements described in paragraph (1); and (B) shall assist the efforts of the Catamount Trail Association to relocate and complete the construction of the Catamount Trail. TITLE II--MOOSALAMOO NATIONAL RECREATION AREA SEC. 201. DESIGNATION. Certain Federal land managed by the United States Forest Service, comprising approximately 16,890 acres, as generally depicted on the map entitled ``Moosalamoo National Recreation Area--Proposed'', dated March 2006, are designated as the ``Moosalamoo National Recreation Area''. SEC. 202. MAP AND DESCRIPTION. (a) In General.--As soon as practicable after the date of enactment of this Act, the Secretary shall file a map and a legal description of the national recreation area designated by section 201 with-- (1) the Committee on Resources of the House of Representatives; (2) the Committee on Agriculture of the House of Representatives; and (3) the Committee on Agriculture, Nutrition, and Forestry of the Senate. (b) Force of Law.--A map and legal description filed under subsection (a) shall have the same force and effect as if included in this title, except that the Secretary may correct clerical and typographical errors in the map and legal description. (c) Public Availability.--Each map and legal description filed under subsection (a) shall be filed and made available for public inspection in the Office of the Chief of the Forest Service. SEC. 203. ADMINISTRATION OF NATIONAL RECREATION AREA. (a) In General.--Subject to valid rights existing on the date of enactment of this Act, the Secretary shall administer the Moosalamoo National Recreation Area in accordance with-- (1) laws (including rules and regulations) applicable to units of the National Forest System; and (2) the objectives described or specified in the Green Mountain National Forest Land and Resource Management Plan-- (A) to provide a showcase for multiple use management of the National Forest System; (B) to provide outstanding educational and interpretation opportunities in the areas of ecological processes and forest management; (C) to provide for public enjoyment of the area for outdoor recreation and other benefits; and (D) to manage for the other resource values present in the Area, in a manner that does not impair the public recreation values and other special attributes of the Area. (b) Fish and Wildlife.--Nothing in this title affects the jurisdiction of the State with respect to wildlife and fish on the public land located in the State. (c) Escarpment and Ecological Areas.--Nothing in this title prevents the Secretary from managing the Green Mountain Escarpment Management Area and the Ecological Special Areas, as described in the Green Mountain National Forest Land and Resource Management Plan. (d) Comprehensive Management Plan.-- (1) In general.--Not later than 18 months after the date of enactment of this Act, the Secretary shall develop and submit a comprehensive management plan for the Area designated by section 201 of this title to-- (A) the Committee on Resources of the House of Representatives; (B) the Committee on Agriculture of the House of Representatives; and (C) the Committee on Agriculture, Nutrition, and Forestry of the Senate. (2) Administration.--In conducting the reviews and preparing the comprehensive management plan required by paragraph (1), the Secretary shall-- (A) provide for full public participation; and (B) consider the views of interested agencies, organizations, and individuals.

Title: A bill to designate certain National Forest System land in the State of Vermont for inclusion in the National Wilderness Preservation system and designate a National Recreation Area Summary: Vermont Wilderness Act of 2006 - Designates as wilderness areas and components of the National Wilderness Preservation System certain lands in Vermont to be known as the Glastenbury Wilderness, Joseph Battell Wilderness, Breadloaf Wilderness, Lye Brook Wilderness, Peru Peak Wilderness, and Big Branch Wilderness. Designates specified federal land as the Moosalamoo National Recreation Area. Directs the Secretary of Agriculture, acting through the Chief of the Forest Service, to develop and submit to specified congressional committees a comprehensive management plan for the Area.

billsum

en

Summarize: The troubled life and demise of Vincent van Gogh follows a well-known trajectory: the precocious genius, the art world’s indifference, the onset of angst and madness, and then, tragically, his suicide at age 37. Or so we thought. But according to the groundbreaking research of Pulitzer Prize-winning biographers Steven Naifeh and Gregory White Smith, the painter didn’t shoot himself: he was killed. When they first exposed this theory in their 2011 biography Van Gogh: The Life, it was viciously attacked and contested. Rewriting history is not an easy task. Now, in a thrilling article published in the December issue of Vanity Fair, the writers substantiate even further their controversial theory, which challenges the deep-seated assumptions about the (now) revered Dutch artist. According to Naifeh and White Smith’s research, van Gogh was shot accidentally by a man called René Secrétan, who broke a lifetime of silence after seeing Vicente Minnelli’s van Gogh biopic Lust for Life (1956), in which the painter is depicted as killing himself in the woods surrounding the French town of Auvers, just outside Paris. Secrétan confessed he had led a gang of teenage hooligans who enjoyed getting drunk and bullying the tortured artist. Although he never admitted to having shot van Gogh, Secrétan did declare that he used to dress up as Buffalo Bill and brandish a malfunctioning pistol he got from the keeper of the Ravoux Inn, where the painter lived. According to Naifeh and White Smith, two days before van Gogh’s death (July 29, 1890), a stray bullet shot from afar hit the painter in the abdomen while he was out in the fields of Auvers. Because it didn’t hit his vital organs, it took over 29 agonizing hours to kill him. None of the reports of his death mention the word suicide, only that he had “wounded himself.” No one admitted to having found the gun, and the doctors could not really make sense of his wounds. A few days before the shooting, van Gogh had placed a large order of paints, and on the morning of the day he died, he had sent an upbeat letter to his brother Theo, with an optimistic take on the future. Crucially, no suicide note was ever found. Why did the suicide version take such a strong hold, then? Well, it simply provided a more logical narrative. Van Gogh’s earlobe episode, which had happened two years earlier, plus his history of nervous breakdowns and alcoholism, made him the perfect artist maudit: a troubled, unpredictable, erratic genius. Even friends of the artist, such as the painter Émile Bernard, liked to sensationalize van Gogh’s exploits. “My best friend, my dear Vincent, is mad,” he told an art critic in 1889. “Since I have found out, I am almost mad myself.” The police investigated the death, but according to Naifeh and White Smith, no records survive. The suicide rumors, thus, provided a “better story,” and gained momentum throughout the 20th century by the sheer force of hearsay. The version that Naifeh and White Smith provide doesn’t alter the fact that van Gogh had a tragic and premature death that could have been avoided. But it shows us a new picture of the painter: the picture of someone with hopes, who believed in his art, and who died by accident. If only he could have seen how his paintings would come to be regarded (see “Chinese Film Magnate Buys Van Gogh for $62 Million”). Follow artnet News on Facebook: By DeAgostini/Getty Images. A lone figure tramps toward a field of golden wheat. He carries a canvas, an easel, a bag of paints, and a pained grimace. He sets up his kit and begins to paint furiously, rushing to capture the scene of the swirling wheat as a storm approaches. Murderous crows attack him. He flails them away. As the wind whips the wheat into a frenzy, he races to add the ominous clouds to his canvas. Then the threatening crows. When he looks up, his eyes bug out with madness. He goes to a tree and scribbles a note: “I am desperate. I see no way out.” Gritting his teeth in torment, he reaches into his pocket. Cut to a long shot of the wheat field churning in the storm. The sudden report of a gun startles a passing cart driver. The music swells. “The End” appears against a mosaic of famous paintings and a climactic crash of cymbals. It’s a great scene, the stuff of legend: the death of the world’s most beloved artist, the Dutch painter Vincent van Gogh. Lust for Life was conceived in 1934 by the popular pseudo-biographer Irving Stone and captured on film in 1956 by the Oscar-winning director Vincente Minnelli, with the charismatic Kirk Douglas in the principal role. There’s only one problem. It’s all bunk. Though eagerly embraced by a public in love with a handful of memorable images and spellbound by the thought of an artist who would cut off his own ear, Stone’s suicide yarn was based on bad history, bad psychology, and, as a definitive new expert analysis makes clear, bad forensics. In 2001, when we visited the Van Gogh Foundation archives, in Amsterdam, for the first time, we had no inkling of the surprise that lay at the end of our 10-year effort to write the definitive biography of Vincent van Gogh. The only bias we brought with us that day was “Please, God, let him be straight!” Our 1998 biography of Jackson Pollock had drawn a lot of flak for its conclusion that the legendarily macho painter had homosexual yearnings (on which he occasionally acted). The evidence was overwhelmingly convincing; how could we not address it? Nevertheless, some critics denounced “the accusation” as an outrageous slur. They even argued that we had brought out the pink in Pollock because we were gay, on some sort of posthumous recruitment drive. Preposterous as this was, we didn’t want to go through the gauntlet again. (Spoiler alert: Vincent was most definitively straight.) The archives occupy an old town house next door to the Van Gogh Museum. We had been warned to expect a chilly reception. Van Gogh is a national hero. Who were we? For starters, Pulitzer Prize or no, we spoke not a word of Dutch. Nevertheless, the two archivists, Fieke Pabst and Monique Hageman, welcomed us warmly. Before long, they were bringing us stacks of folders, offered with a smile and a few encouraging words, such as “We thought you might find these interesting, too.” We spent weeks copying file after file, many of which contained documents only in Dutch, which we would later have to have translated. It took about five years of such efforts before the museum conferred on us the rare privilege of a visit to “the Vault.” Somewhere in the bowels of the Van Gogh Museum (the location has since changed) there was a large, windowless room with concrete walls and cruel warehouse lighting. Against the walls were stacks of the high-tech aluminum “crates” used to transport the museum’s treasures to exhibitions around the world. The senior curator for drawings, Sjraar van Heugten, unlocked the Vault door and took us inside. He slid a Solander box onto a tabletop and opened it to reveal a stack of drawings that Van Gogh had made early in his career. The letters were there, too. The actual letters. We held them in our (gloved) hands. On the top of a filing cabinet stood a copper bowl featured in one of his most famous still lifes. Over there, the plaster nude figure that appeared in dozens of drawings and paintings. Suddenly, we realized we were surrounded not just by the products of his imagination but by the objects of his daily life, and we felt the almost religious spell attached to him. But, meanwhile, our digging in the archives was beginning to undermine one of the pillars of that faith: the story of how the artist died. Van Gogh himself wrote not a word about his final days. The film got it wrong: he left no suicide note—odd for a man who churned out letters so profligately. A piece of writing allegedly found in his clothes after he died turned out to be an early draft of his final letter to his brother Theo, which he posted the day of the shooting, July 27, 1890. That letter was upbeat—even ebullient—about the future. He had placed a large order for more paints only a few days before a bullet put a hole in his abdomen. Because the missile missed his vital organs, it took 29 agonizing hours to kill him. None of the earliest accounts of the shooting—those written in the days immediately after the event—mentioned suicide. They said only that Van Gogh had “wounded himself.” Strangely, the townspeople of Auvers, the picturesque community near Paris where he stayed in the last months of his life, maintained a studied silence about the incident. At first, no one admitted having seen Van Gogh on his last, fateful outing, despite the summer crowding in the streets. No one knew where he would have gotten a gun; no one admitted to finding the gun afterward, or any of the other items he had taken with him (canvas, easel, paints, etc.). His deathbed doctors, an obstetrician and a homeopathist, could make no sense of his wounds. And, anyway, what kind of a person, no matter how unbalanced, tries to kill himself with a shot to the midsection? And then, rather than finish himself off with a second shot, staggers a mile back to his room in agonizing pain from a bullet in his belly? The chief purveyor of the suicide narrative was Van Gogh’s fellow artist Émile Bernard, who wrote the earliest version of artistic self-martyrdom in a letter to a critic whose favor he was currying. Two years earlier, he had tried the same trick when Van Gogh cut off part of his ear. Bernard spun a completely invented account of the event that thrust himself into the sensational tale. “My best friend, my dear Vincent, is mad,” he gushed to the same critic. “Since I have found out, I am almost mad myself.” Bernard was not present at the time of Vincent’s fatal shooting, but he did attend the funeral. If later accounts are to be believed—and they often are not—the police briefly investigated the shooting. (No records survive.) The local gendarme who interviewed Vincent on his deathbed had to prompt him with the open question “Did you intend to commit suicide?” To which he answered (again, according to later accounts) with a puzzled equivocation: “I think so.” That account, like almost all the other “early accounts” of Van Gogh’s botched suicide, rested mainly on the testimony of one person: Adeline Ravoux, the daughter of the owner of the Ravoux Inn, where Van Gogh was staying in Auvers, and where he died. Adeline was 13 at the time. She did not speak for the record until 1953. When she did, she mostly channeled the stories her father, Gustave, had told her half a century earlier. Her story changed constantly, developing dramatic shape, and even dialogue, with each telling. Around the same time, another witness stepped forward. He was the son of Paul Gachet, the homeopathic doctor who had sat for a famous portrait by Van Gogh. Paul junior was 17 at the time of the shooting. He spent most of the rest of his life inflating his own and his father’s importance to the artist—and, not incidentally, the value of the paintings father and son had stripped from Vincent’s studio in the days after his death. It was Paul junior who introduced the idea that the shooting had taken place in the wheat fields outside Auvers. Even Theo’s son, Vincent (the painter’s namesake and godson), who founded the museum, dismissed Gachet Jr. as “highly unreliable.” By the time these belated reports appeared, of course, Bernard’s suicide story had been mainlined into Van Gogh biography through the illicit back channel of Stone’s fictionalized page-turner. So how did the legend of suicide survive with so little to support it? It helped that Van Gogh died at the right time. The art world was finally turning his way. In fact, an apoplectically laudatory review of his work had appeared in a prominent Paris magazine just months before his death. The timing didn’t quite fit the narrative of despairing suicide, but that genie had left the bottle. Boosted by the gripping tale of his final act of martyrdom, Van Gogh’s celebrity took off like a rocket. Lust for Life just filled in the trajectory. The movie received a banquet of rave reviews, a bouquet of Oscar nominations, and one win (for Anthony Quinn, as a stoic, supportive, truth-defying Paul Gauguin). Eventually, we worked up the courage to share our skepticism about the suicide legend with friends at the museum. To our surprise, their reaction was muted: reserving judgment but definitely intrigued. One senior scholar even ventured some support for our doubts. “Your case is very strong,” he mused. “There are several things that puzzle one if you want to explain suicide… He showed no intention of ‘stepping out.’ ” We found out later that another museum researcher had already expressed his own suspicions about the suicide story. In 2006 he brought them to the attention of a senior official, who advised him to abandon that line of inquiry as “too controversial.” If Van Gogh didn’t shoot himself, who did shoot him? In 1890, René Secrétan was the 16-year-old son of a Paris pharmacist whose family summered in Auvers. In Paris, René’s lycée education admitted him to bourgeois society. In Auvers, it gave him license to bully. He said he modeled his behavior on his hero, Wild Bill Cody, whose Wild West Show René had seen in Paris the year before. He bought a souvenir costume (fringed buckskin, cowboy hat, chaps) and accessorized it with an old, small-caliber pistol that looked menacing but often misfired. He found an easy target in the strange Dutchman named Vincent. By the time René arrived for the summer, Van Gogh was already the object of rumor and ridicule. He trudged through town with his mangled ear and awkward load, setting himself up to paint anywhere he pleased. He drank. He argued fiercely in an unintelligible tumble of Dutch and French. Unlike René, whose father was a powerful figure in the summer community, Vincent had no friends. Using his brother Gaston, an aesthete, as his front man, René artfully slipped into the vacuum. He cozied up to the lonely painter at his café conversations with Gaston about art. He paid for another round of drinks. Afterward, René would mock the strange Dutchman to amuse his merry band of mischief-minded summer boys. René let Vincent eavesdrop on him and his friends when they imported “dancing girls” from Paris. He shared his pornography collection. He even posed for some paintings and a drawing. Meanwhile, he conspired with his followers to play elaborate pranks on the friendless tramp they called Toto. They put hot pepper on his brushes (which he often sucked when deep in thought), salted his tea, and sneaked a snake into his paint box. There it was, all in the files: the details mostly in a late-life narrative from the cowboy himself, René. But every detail checked out with the other eyewitness accounts from Auvers. And it didn’t say anything new, really. Vincent had faced similar bullying and ridicule in every place he ever painted. And there was this: a long-neglected account by a woman from a distinguished Auvers family who had broken with the community omertà to say that Van Gogh was far from the wheat field at the time the fatal shot was fired. He was, according to her, on the road that led to the Secrétan family villa. René later became a respected French banker and businessman, distinguished himself as a marksman and hunter, and retired as a country gentleman. Outraged by Kirk Douglas’s portrayal of Toto as a cleaned-up, larger-than-life hero (“grotesque,” he called it), René took his last opportunity to set the record straight. Granted, it was not an airtight case. Not surprisingly, René denied having had any role in Van Gogh’s shooting, other than providing the dodgy gun. (“It worked when it wanted,” René joked. It was just “fate” that it wanted to the day it shot Van Gogh.) He said he had already left Auvers when the incident happened (oddly rushing off in the middle of the season). But it was a lot sturdier base for a case than the suicide theory. We even had a kind of corroboration from an august, unexpected source. The eminent scholar John Rewald had traveled to Auvers in the 1930s and interviewed locals when the painter’s death was still in living memory. Later, he confided to many people, including at least one on the record, a rumor he had heard there: that some “young boys” had shot Vincent accidentally. The boys never came forward, he was told, because they feared being accused of murder, and Vincent chose to protect them as a final act of martyrdom. In the end, we put our support for the new theory into a legal-brief-like appendix at the end of our book. We labeled it “an alternate circumstantial explanation” and argued that it better fit the few firmly known facts about the shooting, and the even fewer reliable accounts, than the traditional suicide story. That seemed sufficiently cautious. But not cautious enough. The book received wide attention in the press: mostly great reviews, many gratifying superlatives, a brief appearance on the New York Times best-seller list, and deals for a dozen international editions (in almost as many languages). In short, it was taken seriously by many thoughtful people. But angle-crazy, on-deadline newspaper editors (especially in the U.K.) cut through the book, all 900 pages of it, and went straight to the appendix. VAN GOGH MURDERED! the headlines screamed. PAINTER SLAIN BY TEENAGERS. Among Van Gogh’s constellation of fans, however, many refused to let the legend die. They raced to the Internet to register their grievance. “It can’t be right,” one said in response to our years of research. “This isn’t the Vincent van Gogh that I know from Starry, Starry Night.” Some in the much smaller circle of Van Gogh scholars, art historians, curators, experts, and specialists weren’t too happy, either. Many had done years of research and writing that was deeply embedded in the old narrative. They didn’t just disagree with our new reading; they were enraged by it. We called them “the Flame-Keepers.” We met with one for tea at Claridge’s, in London. A specialist on Van Gogh’s years in England, he grandly stirred his blend and pronounced our theory “just dead wrong.” Another specialist, with whom we shared a stage at the opening of a Van Gogh exhibition in Denver, was so choked with indignation that he refused even to discuss the subject when the audience raised it. Through it all, to its credit, the museum maintained an appropriate academic restraint, posting on its Web site only a polite demurral: “All things considered, it would be premature to rule out suicide as the cause of death.” Two years later, the Flame-Keepers finally struck back. In 2013, two scholars affiliated with the museum, Louis van Tilborgh and Teio Meedendorp, published a critical review in The Burlington Magazine, a British art journal. (The journal invited us to respond but did not ultimately publish our written response.) The reviewers’ defense of the suicide narrative rested almost entirely on a new reading of the scant surviving forensic evidence. Their unlikely source was a small pamphlet self-published by an Auvers town historian in the months after the first sensational headlines about our book’s theory of the death hit the French media. The pamphlet’s author claimed to have identified the long-missing suicide weapon. Oddly, he ignored the eyewitness description of Van Gogh’s wound given by the attendant physician, Paul Gachet Sr., who was interviewed on the subject in the 1920s. He relied instead on a description given in the late 1950s by the “highly unreliable” Paul junior (who never saw the wound) and an analysis of it by unnamed “ballistics experts.” We had consulted numerous medical and forensic experts in putting together our book’s reconstruction of Van Gogh’s fatal wounding. But now we had a competing analysis that we could take to an appropriate umpire. Dr. Vincent Di Maio had already enjoyed a long and distinguished career as one of the world’s leading handgun forensic experts when, only weeks after we contacted him, he came to national attention as a key witness in the trial of George Zimmerman, the neighborhood-watch coordinator of a gated community in Sanford, Florida, who fatally shot 17-year-old Trayvon Martin, an African-American high-school student, in February 2012. At our request (and waiving any fee), Dr. Di Maio agreed to compare the forensic evidence as presented in our book to the “new” account relied on by the Van Tilborgh-and-Meedendorp article. Their review made much of Paul junior’s description of the wound as having a “brown and purple halo around [it].” The purple halo, according to the two art historians, proved that “the gun must have been fired at very close range … and was caused by the bullet’s impact.” The brownish ring, they said, “indicated that the barrel of the gun was close to the chest, because it was caused by powder burns.” In order to leave such a trace, they concluded, “the impact area would have to have been bared” (presumably by Vincent). “Or did someone else ask him to lift up his shirt?” they added wryly. Dr. Di Maio differed on almost every point. That “purple halo”? It had nothing to do with the proximity of the gun barrel to Vincent’s body. “In fact, this is subcutaneous bleeding from vessels cut by the bullet and is usually seen in individuals who live awhile,” Di Maio wrote in his report. “Its presence or absence means nothing.” As for Van Tilborgh and Meedendorp’s other “aha” clue—the “brownish ring”—it was simply “an abrasion ring and seen around virtually all entrance wounds,” according to Di Maio. “It just indicates an entrance.” Finally, where the two art historians deduced that the brownish ring was “a trace” of powder burns and therefore Vincent must have bravely bared his torso before firing the fatal shot “with the barrel close to [his] chest,” Dr. Di Maio gives the powder burns a far more prominent role but paints a far less dramatic picture of the scene. Even if one were to accept Van Tilborgh and Meedendorp’s account of the wound, he wrote, “it would be extremely difficult to shoot oneself in this location [i.e., on the left side] with the left hand. The easiest way would involve putting one’s fingers around the back of the grip and using the thumb to fire the gun. One might grasp the gun with the right hand to steady it… Using one’s right hand is even more absurd. You would have to put the right arm across the chest and again place one’s fingers on the back of the grip and use the thumb to fire the gun. One might then grasp the gun with the left hand to steady it.” Van Gogh was, in fact, right-handed. But in either scenario, Di Maio observed, “one would have ‘powder burns’ on the palm of the hand grasping the body of the gun.” He noted that handgun cartridges in 1890 were loaded with black powder because smokeless powder had only recently been developed (1884) and was used only in a few military rifles. “Black powder is extremely dirty,” Di Maio wrote. “On burning, 56% of its mass is solid residue. Close range wounds from black powder are extremely dirty.”

Summary: Back in 2011, a pair of biographers argued that the accepted theory of Vincent Van Gogh's death may have been wrong. He didn't commit suicide, they suggested; instead, it was a local teen who killed him. Their theory was met with some serious pushback, but they stand behind it, and they're offering more evidence in Vanity Fair. The article, by Steven Naifeh and Gregory White Smith, notes scant evidence in favor of a suicide: Why, for instance, would a suicidal person shoot himself in the stomach, leading to a long, painful death? What's more, they argue, accounts supporting the suicide theory come from questionable sources, including a girl who was only 13 at the time, and didn't tell her story publicly for decades. The Vanity Fair piece also focuses on the work of noted forensics expert Dr. Vincent Di Maio, who worked on George Zimmerman's trial. Di Maio finds, based on accounts of Van Gogh's injuries, that the muzzle of the gun that shot the artist "was more than a foot or two away (closer to two rather than one)." He concludes that, "in all medical probability, the wound incurred by Van Gogh was not self-inflicted." So why has the suicide account survived so long? At Artnet, Lorena Muñoz-Alonso suggests it's because it's a good story. His "earlobe episode... plus his history of nervous breakdowns and alcoholism made him the perfect artist maudit: a troubled, unpredictable, erratic genius."

multi_news

en

Summarize: WARNING: This audio may not be reproduced. Mel Gibson made up to 30 “terrorizing” phone calls to his ex-lover, Oksana Grigorieva, on the same night she walked out on their volatile three-year relationship, she has told law enforcement investigators. Included in the barrage was eight profanity-laced voicemail messages the clearly irrational Lethal Weapon star left on Oksana’s answering machine at her home. PHOTOS: Celebrity Death Threats RadarOnline.com has exclusively obtained those tapes — which are more evidence in three separate law enforcement investigations. Listen to the blockbuster recordings below. The rantings are a twisted mix of more misogynistic insults and rage as Mel again ripped into the mother of his illegitimate child, at one stage labeling her “f*cking disloyal and f*cking weak” and “such a f*cking sl*t”. PHOTOS: Mel & Oksana’s First Hollywood Appearance In one tirade that lasted just over two minutes, Mel dropped a staggering 23 F-bombs. In another bizarre message, that lasted just 13 seconds, the words coming out of his mouth barely sounded like words. EXCLUSIVE PHOTOS: See The First Photos of Mel and Oksana In a Passionate Embrace On The Beach Oksana has told investigators, who are probing the Oscar-winning actor/director for domestic abuse, that she was “terrorized by a stream of harassing and threatening telephone calls” from Mel after she fled his Malibu mansion, on February 18 this year. “She estimated that from the time she arrived at the Sherman Oaks home, after she escaped from his house, that she received approximately 30 calls from 8pm to 6am,” said a source, familiar with the case. “Mel told her he wanted to keep her up all night.” PHOTOS: Oksana Through The Years As she attempted to care for the couple’s daughter Lucia, who was just three-months-old at the time, Oksana was unable to answer all the calls and allowed to go to her message-bank. “You have f*cked me up,” Mel said, in one message captured on her machine. He went on: “You have f*cked me up. You have f*cked me up. I did nothing but help you. But you f*cking shat on me like a low-life sl*t.” What Oksana recorded will provide investigators an insight into Mel’s state of mind. PHOTOS: Celebrity Racist Rants In another message, he taunted the mother-of-two: “Just making sure you’re awake, if you were trying to sleep. Because I am awake — and you deserve to be.” “Don’t ever sleep again,” he repeated, later. “Don’t sleep as long as I don’t sleep.” In the space of 17 minutes, from 2:29am to 2:46am, a seething and scorned Mel made five calls to Oksana. Seemingly paranoid, he also accused Oksana of wanting to destroy him and “see me die” because “subconsciously that is your whole f*cking aim,” as he claimed. WORLD EXCLUSIVE PHOTOS: Bruised & Battered Oksana Grigorieva After Brawl With Mel Gibson A furious Mel also warned how mean he could be — “have I testified the title mean yet” — and delivered the Russian singer/ pianist his assessment of her musical talents — “it’s ordinary… it’s NOT extraordinary”. He said bluntly, “I’d like to see you play a concert sometime. You make mistakes all over with live performances. You can’t do it. “Haven’t seen you not f*ck it up yet. It’s flawless, you understand. You have to be f*cking flawless. PHOTOS: Timothy Dalton Goes To See Oksana “You are not in that league. So give it up. Do what you’re good at. Whatever the f*ck that is. Oh, I know what that is. Deception!” The messages also provide a window into the events which led to the explosive end to their relationship. As RadarOnline.com revealed as part of our headline-making investigation, Oksana walked out on Mel after a tree-planting ceremony in honor of their daughter Lucia, who was three-months-old at the time. At the event, Mel and Oksana buried their daughter’s placenta in the backyard. PHOTOS: Oksana Shows Off Her Post Baby Body In one message, at 2:31am, Mel told Oksana she was “a sour faced bitch” at the ceremony, at which his one-time love supposedly smiled at a maintenance worker. “Do you think it was tricky to get that f*cking tree in the hole, the placenta and organize that sh*t?” Mel asked. “Do you know how much f*cking time and money went into that? “You were down there looking like a spoiled c*nt.” PHOTOS: Mel’s Ex Oksana Grigorieva Beefs Up Security The first voice message was left at 10:27pm and the last at 3:06am, RadarOnline.com has learned. Here’s how the sequence went down: February 18, 22:27pm MG: Arghhh. Arghhhhhh. Arghhhhh. Argh. Argh. I called. February 19, 12:40am MG: Edith is not to work at your house. If she does, I will fire her. I will not pay her for any hours at your house. OK? She only works at my house. Alright? I don’t want her at your house or I will fire her. You know I will do it. I fire people all the time. You will have to find some other f*cker but you will have to pay for it yourself. She works at my house. She is my employee. Just thought I would mention that right now. If you want to call me back, I think we should discuss the terms of separation, don’t you? Don’t you think? Yes? Yes, let’s do it. I won’t smoke either, just to f*ck with you. I want to really badly. You would love me to. Because you want to destroy me and see me die. I know subconsciously that is your whole f*cking aim, is to ruin me. But I won’t let you. Alright. You selfish bitch. Alright. February 19, 2.29am MG: Whore. Answer the f*cking phone. F*cking bitch. February 19, 2.31am MG: You were a sour faced bitch today. Do you think it was tricky to get that f*cking tree in the hole, the placenta and organize that sh*t? Do you know how much f*cking time and money went into that? Did you thank me? Did you even have a f*cking smile on your face? F*ck no. You were down there looking like a spoilt c*nt. You don’t give f*ck do you. You really a shallow bitch. Everything about you stinks and I am seeing it real, loud and clear. F*ck yeah. Fuck y*ah. February 19, 2.37am MG: Oh. Just making sure you’re awake, if you were trying to sleep. Because I am awake — and you deserve to be. Yeah. February 19, 2.39am MG: Have I testified the title mean yet? I think so. OK, I will stop being mean now. I will stop being mean because that’s me. You call mean, you will get mean. You call me something I’m not you will get it in spades. Remember that and I don’t give a f*ck if you ever call me again or not. February 19, 2.46am MG: See, you can see I am not available for use anymore, you can see the well has dried up and you just take off, you just leave, take off, because I am finished for you right? Because I can’t give anymore, right? To your personal cause. You. I can’t do it anymore. So you’re out of here from the sinking ship. That’s your MO, isn’t it baby? Hmmm? That’s your MO. I will believe that because it seems to be the truth. February 19, 3.06am MG: It is to me. F*cking disloyal and f*cking weak. You’re f*cking blind. F*cking thankless. Such a f*cking slut. F*ck you. F*ck you. Don’t ever sleep again. Don’t sleep as long as I don’t sleep. Don’t sleep. F*cking get sick. You f*ck me up. You have f*cked me up. You have f*cked me up. You have f*cked me up. I did nothing but help you. But you f*cking shat on me like a low-life sl*t. Which is now what I am convinced you are. F*ck I am angry at you. You are a waste of time. I am angry at you. What a waste of my f*cking time. F*ck you. You f*cking ordinary c*nt. You are just f*cking ordinary. That goes for the talent too — it’s ordinary. It’s NOT extraordinary. It’s pretty f*cking common. I’d like to see you play a concert sometime. You make mistakes all over with live performances. You can’t do it. So touring is out of the question for you because you will f*ck it up. You have not yet f*cked up yet live. Haven’t seen you not f*ck it up yet. It’s flawless, you understand. You have to be f*cking flawless. You don’t know how to do that. You are not in that league. So give it up. Do what you’re good at. Whatever the f*ck that is. Oh, I know what that is. Deception! Sheriff’s detectives have opened a criminal probe into Oksana’s claim that Mel punched her twice in the left temple and mouth as she held their infant daughter, Lucia, at his Malibu home on January 6. Mel’s camp has vehemently denied that the volatile actor ever hurt Oksana or little Lucia. The Department of Children and Family Services is also investigating while a judge, in another matter, oversees the former couple’s civil battle over custodial rights. RELATED: ALL OF THE MEL GIBSON TAPES MEL AUDIO TAPE #1: Mel’s Racist Rant MEL AUDIO TAPE #2: Mel Gibson Admits Hitting Oksana, Threatens To Kill Her MEL AUDIO TAPE #3: Another Mel Gibson Slur Caught On Tape In Crazed Rage MEL AUDIO TAPE #4: Out Of Control Mel Gibson Says He’ll Burn Down House After Demanding Sex MEL AUDIO TAPE #5: Mel Gibson Completely Loses It: ‘B*tch, C*nt, Wh*re, Gold Digger!’ MEL AUDIO TAPE #6: The Tape That Could Destroy Mel: “No One Will Believe You”, He Says After She Charges: “You Hit The Baby” MEL AUDIO TAPE #7: Mel Gibson’s Twisted Rant Includes Jealous Rage Over Timothy Dalton What's Behind Mel Gibson's Pathological Ranting? Email This As we hear more and more expletive-laden crazy-pants rants from Mel Gibson we have to wonder whether Mel has lost that little voice inside his head that tells him he has crossed a line, or whether he ever had that little voice in the first place. Maybe the answer is that he just can't help himself. Experts tell us that Mel's continued verbal diarrhea is pathological and deeply ceded in psychological issues. "Mel is driven by his sexual frustration, fear of abandonment, and disillusionment at the realization that Oksana doesn't love him, but is merely a gold-digger," explains psychiatrist Dr. Carole Lieberman, M.D. As we hear more and more expletive-laden crazy-pants rants from Mel Gibson we have to wonder whether Mel has lost that little voice inside his head that tells him he has crossed a line, or whether he ever had that little voice in the first place.Maybe the answer is that he just can't help himself.Experts tell us that Mel's continued verbal diarrhea is pathological and deeply ceded in psychological issues."Mel is driven by his sexual frustration, fear of abandonment, and disillusionment at the realization that Oksana doesn't love him, but is merely a gold-digger," explains psychiatrist Dr. Carole Lieberman, M.D. The latest Gibson recording released by Radar Online, has Gibson going after his baby mama Oksana Grigorieva's ex boyfriend, none other than James Bond, Timothy Dalton.In the new tape, mad Mel says: "Did you get my last message about me being a bad father, and Tim being a great dad now?"Oksana says "no" and Gibson continues, saying: "You didn't hear that one? Well, you should go and (expletive) him (Dalton), you know, you fickle (expletive), because I don't care."And that's the nice part of the conversation. After hearing seven of mad Mel's recordings, it really does seem like he has no control over what comes out of his mouth and that in some sick and twisted way, he's actually enjoying what he's doing."He seems to be getting some kind of gratification by talk, talk, talking," says life coach and relationship expert Tracey Steinberg. "It seems as though he has a lot of anger and resentment and he doesn't know how to express himself in a constructive and healthy way to people who want to help him. So instead he lashes out at the person who least wants to help him and the angry cycle continues.Steinberg's advice to Mel, to put an end to his viral venting: "He would be better off treating himself to a nice vacation with people who care about him."But psychology expert and "Cult of Celebrity" author Cooper Lawrence sees a darker side to Gibson's gabbing. Se believes he is fulfilling an acquired situational narcissism that has struck the star as he approaches the twilight of his career."No one is kissing his ass anymore. He's not a big star. The anger that comes with that causes his lashing out. This is no different than when Alec Baldwin called his daughter a little pig," Lawrence explains. "Mel can't shut up because he feels the need to constantly validate himself and he is doing that through his anger. These narcissists lash out impulsively and cant stop themselves. He is out of control. A sane person would have stopped before it reached this point." Click to email this to a friend (Opens in new window) Click to share on Pinterest (Opens in new window) Click to share on Tumblr (Opens in new window) Click to share on Google+ (Opens in new window) Click to share on Twitter (Opens in new window) Mel Gibson is viewed as an excellent father to his 8-month-old daughter Lucia by the Department of Children and Family Services, RadarOnline.com has learned exclusively. DCFS launched an investigation as Mel, 54, and Oksana Grigorieva, 40, trade allegations in their bitter breakup and the Oscar-winning star is accused of punching his ex while she held their daughter. PHOTOS: Mel Gibson’s Greatest Movie Roles But RadarOnline.com has learned that at this point Mel is in no danger of losing access to his daughter, and in fact is viewed as an excellent father who has a strong relationship with Lucia. “The Department of Children and Family Services believes Mel has a wonderful relationship with his infant daughter Lucia,” a source close to the actor told RadarOnline.com. DCFS visited Gibson at his home last week, as RadarOnline.com was first to report. PHOTOS: Mel Gibson & Oksana Grigorieva At Edge Of Darkness Premiere “They have a very healthy father-daughter relationship,” the source said. “He is very involved with her. “Mel is a great father to her and this is why there have been no changes as far as his visits with her are concerned.” It’s good news for Gibson, who is being investigated by the L A. County Sheriff’s Department on domestic violence charges. His ex has produced powerful evidence indicating he hit her on January 6. EXCLUSIVE PHOTOS: See The First Photos of Mel and Oksana In a Passionate Embrace On The Beach Oksana’s mouth was damaged and she suffered a concussion. RadarOnline.com exclusively published photographs of her damaged teeth and bruising on the left side of her head. RadarOnline.com confirmed that Gibson was interviewed by the Sheriff’s department on Sunday but refused to talk about the domestic violence case. His Fifth Amendment right against self incrimination helped his lawyer limit the scope of the interview. EXCLUSIVE PHOTO of Oksana After She Says Mel Punched Her The best news for Gibson so far is that DCFS believes Lucia is safe with him. “Mel has been lamenting that he made a mistake in ending his marriage to Robyn,” the source close to the actor told RadarOnline.com. “Robyn kept him together. As far as DCFS is concerned Mel is an outstanding father. Lucia is safe emotionally and physically with Mel, and that is the only concern for officials.” PHOTOS: Mel & Ex-Wife Robyn Despite some media reports that it was Gibson’s idea to have a volunteer monitor his visitation with Lucia, RadarOnline.com has learned it was the DCFS’s suggestion. “The idea was actually from the social workers as a way to try and help the situation,” the source close to Mel said. “There is such heightened tension surrounding the care of Lucia that if she had an accident… now there will be an independent witness to alleviate any potential issues.” EXCLUSIVE VIDEO: Mel & Oksana Talk To Radar In Happier Times DCFS will continue to monitor the ongoing custody battle, RadarOnline.com has learned. The agency will conduct more interviews with people connected to caring for Lucia. Mel and Oksana -- The Placenta Factor TMZ has learned that on the day Oksana Grigorieva recorded Mel Gibson's infamous rant, the two had engaged in a special ceremony that included their daughter's... and a tree.Hours before Mel lost his cool on the phone on February 18, he and Oksana were in the backyard of his Malibu mansion... watching as a gardener planted a Santa Lucia fir tree in honor of their daughter Lucia.But that's not all that went in the ground that day -- sources close to Oksana tell us the couple also buried the placenta from the birth of their then 3-month-old daughter... a tradition in some parts of Australia... where Mel grew up.We're told Mel did this placenta ceremony for all of his children.The source also says during the ceremony the gardener made an innocent comment and Oksana smiled at him. We're told that's what set Mel off.As we first reported, Mel then accused Oksana of having an affair with the gardener... and that's when all hell broke loose. These are the shocking photos that provide powerful evidence against Mel Gibson. Oksana Grigorieva had deep bruises around her left eye after she claims Mel Gibson punched her in the head twice – and RadarOnline.com has exclusively obtained the blockbuster photographs of her injuries. EXCLUSIVE PHOTOS: Bruised & Battered Oksana These pictures are crucial evidence in the investigation against Gibson on domestic violence charges and provide strong support for Oksana’s accusations that Mel punched her as they argued at his home on January 6. Oksana told authorities she was holding her baby Lucia when Mel struck her in the mouth and the head, near the left temple. RadarOnline.com has learned that the photographs were taken the morning after the brutal confrontation. They show obvious bruising around Oksana’s left eye and also redness. The bruising extends from below Oksana’s left eye to her forehead. The area around her left eye appears to be swollen. These never-before-seen pictures are key components of three separate investigations, RadarOnline.com has confirmed. PHOTOS: Oksana Through The Years RadarOnline.com exclusively obtained the evidence photos which are the second set of photos taken to document Oksana’s injuries in the aftermath of the brutal January 6 brawl at Mel’s Malibu mansion. They form powerful evidence for Oksana’s allegations, especially when coupled with photographs she took of her damaged mouth. Oksana also has photographs of her damaged mouth. Those pictures were taken a day before these new ones and it is clear from the documentation that the bruising and swelling around her eye has become pronounced overnight, which is consistent with this type of injury. The veneer from Oksana’s upper left front tooth was snapped off and the veneer on her upper right tooth was cracked. Dental experts agree that only tremendous force could cause that type of damage. PHOTOS: Celebrity Racist Rants Mel denies hitting Oksana and his lawyers have told cops she tried to extort him. But these new photos provide Oksana with more powerful evidence against the man she dated for three years, especially when coupled with text messages and audio tapes, as revealed on RadarOnline.com. In addition, Oksana, 40, also has a strong affidavit from her dentist about the extent of her injuries. And, as RadarOnline.com reported exclusively, Oksana was diagnosed with a concussion after visiting Dr. Arthur Gordon, who could now be a powerful witness for her. The Los Angeles County Sheriff’s Department has these images as part of its investigation into the actor for domestic violence. PHOTOS: Celebrity Death Threats It was also included in Oksana’s declaration to the court in the estranged couple’s vicious custody battle over their eight-month-old daughter Lucia — and was also presented to the Department of Children and Family Services, RadarOnline.com has learned exclusively. PHOTOS: Mel & Oksana’s First Hollywood Appearance Oksana has told police that after Mel punched her she fell back on the bed, while holding their baby. She says he then choked her with his forearm, pressing it into her throat and putting his free hand over her mouth. EXCLUSIVE PHOTOS: See The First Photos of Mel and Oksana In a Passionate Embrace On The Beach As RadarOnline.com revealed, two days after the brawl, Oksana told a doctor she started experiencing excruciating headaches after the incident. When questioned why she did not seek immediate medical treatment, RadarOnline.com has learned Oksana told authorities: “I was unable to go a hospital that night because I had no one to care for the children.” PHOTOS: Mel & Oksana At Pre-Oscar Bash RELATED: ALL OF THE MEL GIBSON TAPES MEL AUDIO TAPE #1: Mel’s Racist Rant MEL AUDIO TAPE #2: Mel Gibson Admits Hitting Oksana, Threatens To Kill Her MEL AUDIO TAPE #3: Another Mel Gibson Slur Caught On Tape In Crazed Rage MEL AUDIO TAPE #4: Out Of Control Mel Gibson Says He’ll Burn Down House After Demanding Sex MEL AUDIO TAPE #5: Mel Gibson Completely Loses It: ‘B*tch, C*nt, Wh*re, Gold Digger!’ MEL AUDIO TAPE #6: The Tape That Could Destroy Mel: “No One Will Believe You”, He Says After She Charges: “You Hit The Baby”

Summary: Just hours before going off on that taped rant that's emblazoned in our minds, Mel Gibson and Oksana Grigorieva had been enjoying a peaceful ceremony together...planting their daughter's placenta. It's an Australian tradition, TMZ reports, and all was well until Grigorieva smiled at the gardener, causing Gibson to flip out and accuse her of having an affair with him. "Do you think it was tricky to get that f*cking tree in the hole, the placenta and organize that sh*t?" Mel said later in one of 30 phone calls he made to Oksana after she walked out, Radar reports. The rest of his phone calls, including eight voicemails, are more of the same: He calls her "such a f*cking sl*t" and the like. In one two-minute message, he dropped 23 F-bombs. Despite the scary rants, Child Protective Services has reportedly deemed Gibson an excellent father, a source tells Radar. The gossip site also has photos it claims are of Grigorieva after Gibson allegedly beat her. Oh, and click here to read about the psychological issues that may be fueling Mel's rage.

multi_news

en

Write a title and summarize: Non-coding RNAs have important roles in regulating physiology, including immunity. Here, we performed transcriptome profiling of immune-responsive genes in Drosophila melanogaster during a Gram-positive bacterial infection, concentrating on long non-coding RNA (lncRNA) genes. The gene most highly induced by a Micrococcus luteus infection was CR44404, named Induced by Infection (lincRNA-IBIN). lincRNA-IBIN is induced by both Gram-positive and Gram-negative bacteria in Drosophila adults and parasitoid wasp Leptopilina boulardi in Drosophila larvae, as well as by the activation of the Toll or the Imd pathway in unchallenged flies. We show that upon infection, lincRNA-IBIN is expressed in the fat body, in hemocytes and in the gut, and its expression is regulated by NF-κB signaling and the chromatin modeling brahma complex. In the fat body, overexpression of lincRNA-IBIN affected the expression of Toll pathway -mediated genes. Notably, overexpression of lincRNA-IBIN in unchallenged flies elevated sugar levels in the hemolymph by enhancing the expression of genes important for glucose retrieval. These data show that lncRNA genes play a role in Drosophila immunity and indicate that lincRNA-IBIN acts as a link between innate immune responses and metabolism. The fruit fly Drosophila melanogaster (D. melanogaster) is a widely used model system in immunological studies [1]. Drosophila has an elegant innate immune response that includes both the cellular and the humoral arms [2,3]. Activation of the cellular immune response involves mechanisms such as recognition, phagocytosis, encapsulation and the killing of parasites [4,5]. The humoral immune response is based on microbial recognition primarily by peptidoglycan recognition proteins leading to the production of antimicrobial peptides (AMPs) [6–9]. The humoral immune response is mainly mediated by two evolutionarily conserved NF-κB signaling pathways, the Toll and the Immune deficiency (Imd) pathway [10–12]. Recently, it has become evident that beside the protein coding genes that positively or negatively regulate the humoral and cellular innate immune responses, there is a multitude of short and long non-coding RNA genes that affect innate immune responses [13–16]. In between and within protein coding genes in the genome, there are thousands of uncharacterized non-coding RNA genes. Small non-coding RNAs (<200 nucleotides) are considered to have more of a “housekeeping RNA” role. However, the functions of long non-coding RNA (lncRNA, >200 nucleotides) genes are more diverse [17]. Although the number of lncRNAs is still a matter of debate, recent meta-analyses posit the human genome to give rise to >60,000 lncRNAs, albeit the majority is probably expressed at low levels [18,19]. In fruit flies, there are fewer lncRNAs in the genome and the ratio of lncRNAs to protein coding genes is lower than in humans [20]. The current lncRNA numbers can be found in the NONCODE Version v5. 0 database (www. noncode. org). The expression patterns of lncRNAs are highly specific to tissue, developmental stage and environmental conditions (reviewed in [14,15]) and they are thought to have tightly controlled biological roles. Recent studies have indicated that lncRNAs play an important functional role in innate immune responses, and specifically in innate immune cells. In mammals, lncRNA genes are expressed in monocytes, macrophages, dendritic cells, neutrophils, T-cells and B-cells [13]. A growing list of lncRNA genes, for example LincRNA-Cox2 [21], Lethe [22], PACER [23] and TNFα regulating hnRNPL interacting lncRNA (THRIL) [24], has been found to control gene expression in immune cells [13]. To study the role of lncRNA genes in the Drosophila immune response, we performed transcriptome analysis in D. melanogaster upon a bacterial infection with the Gram-positive Micrococcus luteus (M. luteus), giving particular emphasis to long non-coding RNA (lncRNA) genes. The most responsive of all transcripts was the lncRNA gene CR44404, which was upregulated 1300-fold upon a M. luteus infection. Here, we show that CR44404 is highly induced by both Gram-positive and Gram-negative bacteria in Drosophila adults and by a parasitoid wasp infection in Drosophila larvae. Because of the inducible nature of the CR44404 gene, we named it lincRNA-IBIN (Induced By INfection). Finally, we show that lincRNA-IBIN acts as a link between innate immune responses and metabolism by modulating the expression of genes regulating carbohydrate and peptide metabolism and affecting glucose levels in the hemolymph. To investigate the importance of long non-coding RNAs in Drosophila immunity, we carried out a transcriptome analysis (RNAseq) of flies 24h after infection with the Gram-positive M. luteus in comparison to age and sex-matched uninfected controls. The RNA sequencing method used in this study recognizes polyadenylated non-coding RNAs, which are thought to represent the majority of long non-coding RNAs, although also ones without poly-A tails exist [25,26]. Prior to the transcriptome analysis, one of the Toll pathway target genes IM1 (Immune induced molecule 1), was measured from females and males upon M. luteus infection. IM1 was robustly induced in both male and female Drosophila (S1A Fig), and males were chosen for the transcriptome analysis. LYS-type peptidoglycan containing Gram-positive bacteria are known to induce the classical Toll pathway target genes including a number of antimicrobial peptides (AMPs) (e. g. [27]). As expected, AMPs were strongly upregulated in the transcriptome analysis upon a M. luteus infection, including Dro, Mtk, Drs, and multiple IMs (Fig 1A, S1 Table). Noteworthy, the highest upregulation in infected flies was seen in a previously unannotated long non-coding RNA gene, CR44404 (Fig 1A). The baseline expression of CR44404 is very low, and upon a M. luteus infection, it is induced by about 1300-fold. The induction of CR44404 expression was also shown to be comparable between males and females upon M. luteus infection (S1B Fig). Besides CR44404, there were only 15 other lncRNAs that were more than 3-fold upregulated upon infection (Fig 1B, S2 Table). While findings from vertebrates indicate that lncRNAs have wide and important functions in immune responses [13–16], cancer and metabolism [28,29], the role of lncRNAs in Drosophila immunity has only begun to emerge. CR44404 was chosen for further analysis based on its intriguing expression pattern. CR44404 is 228 nucleotides long (genomic loci 2R: 17,671,068.. 17,671,295 [+]) and it is located between two protein coding genes; P32 and CG30109. Therefore, CR44404 is classified as a long non-coding intergenic RNA (lincRNA) molecule. Although CR44404 is very close to the protein-coding gene P32, the genes do not overlap. To confirm that CR44404 is an independent transcript, the expression levels of the adjacent genes were examined in the transcriptome analysis. Neither P32 nor CG30109 were affected by infection in the same way as CR44404, the expression of which was ~1300-fold upon a M. luteus infection. Instead, P32 (1. 17-fold) and CG30109 (1. 27-fold) were not significantly induced by M. luteus infection at 24h time point, indicating that CR44404 is expressed independently from them. CR44404 is polyadenylated; it has a highly conserved cleavage signal sequence AAUAA towards the end of the full-length transcript. CR44404 does not contain open reading frames and based on the NCBI domain search tool [30], it does not contain any predicted protein domains. According to RNA secondary structure predictions, CR44404 is multibranched (contains 3–4 GC-rich branches) and contains a variable amount of smaller (hairpin) loops connected to a bigger loop (S2 Fig). Based on the high expression of CR44404 upon infection and its genomic location, we named the gene lincRNA-Induced By INfection (lincRNA-IBIN). As lincRNA-IBIN was shown to be strongly induced by Gram-positive bacteria 24h p. i, we next infected male flies with either the Gram-positive M. luteus or the Gram-negative Enterobacter cloacae (E. cloacae) to measure the gene expression kinetics of lincRNA-IBIN during multiple time points ranging from 0-24h after infection (Fig 1C). This revealed that lincRNA-IBIN is also induced by Gram-negative bacteria, and in both infections, the induction occurred within the first hours of infection and gradually increased towards the 24h time point (Fig 1C). To further study the role the Toll pathway and the Imd pathway [10,11], in the expression of lincRNA-IBIN, we knocked down MyD88 (an adaptor protein functioning downstream of the Toll receptor in the Toll pathway), cactus (a negative regulator of the Toll pathway) and Relish (an Imd pathway NF-κB factor). Thereafter, we infected the flies with M. luteus or E. cloacae and measured the lincRNA-IBIN RNA levels. Upon a M. luteus infection, the expression of lincRNA-IBIN was shown to be dependent on the expression of MyD88, i. e the functional Toll pathway (Fig 1D). Knocking down MyD88 upon a E. cloacae infection had no effect on the expression of lincRNA-IBIN (Fig 1E), whereas knocking down Relish or using the RelishE20 null mutant inhibited the expression of lincRNA-IBIN, showing that it requires a functional Imd pathway in this context (Fig 1E). Knocking down Relish or using the RelishE20 null mutant upon a M. luteus infection did not inhibit the expression of lincRNA-IBIN (Fig 1D). The role of the Toll pathway activation to the expression of lincRNA-IBIN was further confirmed in uninfected flies by knocking down the inhibitor of the κB factor cactus, which strongly induced the expression of lincRNA-IBIN (Fig 1F). Also, during the larval stage, lincRNA-IBIN was induced by the ectopic expression of the constitutively active form of the Toll receptor, Toll10b (Fig 1G) and by overexpression of the Imd molecule with the ubiquitous da-GAL4 driver (Fig 1H). Next, we tested if the Osa-containing Brahma (BAP) complex is needed for the expression of the lincRNA-IBIN. The BAP complex is a group of protein-coding genes working together in remodeling chromatin [31], and the complex has previously been reported to affect the Toll pathway-induced Drs-luc reporter in vitro in Drosophila [32,33]. Interestingly, when osa expression was knocked down, lincRNA-IBIN expression was strongly inhibited upon both a M. luteus (Fig 1I) and a E. cloacae (Fig 1J) infection. The knockdown of another BAP complex component brahma (brm) also reduced lincRNA-IBIN expression upon both infections (Fig 1I and 1J). Moreover, because lincRNA-IBIN is strongly induced by a bacterial infection in Drosophila adults, indicating a role in the humoral immune response, we next studied whether lincRNA-IBIN is also induced during the cellular immune response by infecting Drosophila larvae with Leptopilina boulardi (L. boulardi) parasitoid wasps. Also in this context, the expression of lincRNA-IBIN was strongly induced (Fig 2). In conclusion, lincRNA-IBIN seems to have a rather broad role in the immune response, being induced by a bacterial infection in flies and by parasitoid wasps in larvae. The M. luteus -mediated induction of lincRNA-IBIN expression was shown to be dependent on the Toll pathway, whereas the E. cloacae -mediated induction requires the Relish/Imd pathway. In each studied case, lincRNA-IBIN expression was dependent on a functional BAP complex. This type of unspecific induction via both NF-κB pathways is rather uncommon in Drosophila and argues for a general immunity related function for lincRNA-IBIN. To understand the role of lincRNA-IBIN in Drosophila immunity, we investigated where lincRNA-IBIN was expressed and whether its effects were tissue-specific. Since lincRNA-IBIN expression is strongly infection-inducible, we reasoned that it is most likely expressed in immune-responsive tissues (the fat body and hemocytes, the Drosophila blood cells). Wasp infection of Drosophila larvae led to the induction of lincRNA-IBIN expression in the fat body and hemocytes (Fig 2A and 2B). Like in flies, osa RNAi in larval hemocytes (HH> osaIR) and fat bodies (C564> osaIR) kept the expression of lincRNA-IBIN close to the basal level (Fig 2A and 2B). Because lincRNA-IBIN is a short gene and very strongly induced upon infection like AMPs, we next investigated whether lincRNA-IBIN is secreted into the plasma in similar manner as AMPs (Fig 2C). First, we confirmed that hemocytes and plasma were separated by centrifugation (S3 Fig). We also checked the expression of a hemocyte specific gene Hemolectin (Hml) and a fat body-specific gene Larval serum protein 1 alpha (Lsp1α) in each tissue sample (Fig 2C, i and ii). A Hml signal was detected in the hemocyte fraction, whereas Lsp1α levels were high in fat body samples but not in hemocytes or in the plasma (Fig 2C, i and ii). We did not detect lincRNA-IBIN in the plasma fraction in large quantities (Fig 2C, iii). Pin-pointing the cellular localization of a lncRNA reveals typically more about its function than does the structure of the RNA. A RNA FISH (RNA Fluorescent In Situ Hybridization) protocol was performed with 3rd instar larval hemocytes. Uninfected w1118 larval hemocytes were used as a control for imaging the basal expression level and localization of lincRNA-IBIN (Fig 2D, ii). Hemocytes from larvae overexpressing lincRNA-IBIN1 (HH>lincRNA-IBIN1) and infected with L. boulardi were used to induce the expression of lincRNA-IBIN (Fig 2D, iii), and they showed that lincRNA-IBIN (pink labelling) was primarily expressed in the nuclear compartment (blue labelling) of the cell. Therefore, we conclude that lincRNA-IBIN is expressed in immune responsive tissues, is not secreted into the plasma in large amounts and its cellular localization is mainly nuclear. This suggests that the function of lincRNA-IBIN may be in the regulation of gene expression, which is typical for lncRNAs [34–36]. To study the function of lincRNA-IBIN in uninfected and infected flies, we generated UAS-lincRNA-IBIN overexpression fly lines. Two of the generated lines, lincRNA-IBIN1 and lincRNA-IBIN7, were selected for the following experiments. lincRNA-IBIN overexpression in the lincRNA-IBIN1 and lincRNA-IBIN7 lines was induced using the C564-GAL4 driver, which is expressed strongly in the fat body [37,38] (Fig 3A). lincRNA-IBIN expression in uninfected flies was significantly increased in both overexpression lines (Fig 3A, white bars), with higher expression levels in the lincRNA-IBIN7 line. 24 h after a M. luteus infection, the effect of the overexpression on the expression of lincRNA-IBIN was masked by the overwhelming endogenous expression of lincRNA-IBIN (Fig 3A, black bars). To study the effect of the long-term exposure of flies to elevated levels of lincRNA-IBIN, we monitored the lifespan of flies overexpressing lincRNA-IBIN with the C564-GAL4 driver and controls. To ensure maximal lincRNA-IBIN expression, flies were cultured at +29°C for the duration of the experiment. Neither one of the lincRNA-IBIN overexpression lines (lincRNA-IBIN1 and lincRNA-IBIN7) showed a statistically significant difference in the lifespan between flies overexpressing lincRNA-IBIN and controls (S4 Fig). As lincRNA-IBIN was the most strongly induced gene upon a M. luteus infection, we first investigated whether overexpressing lincRNA-IBIN affected the survival of the flies against a septic infection with Gram-positive bacteria. For the survival experiment, we chose lincRNA-IBIN7 flies as these produced the highest overexpression without an infection. We first infected lincRNA-IBIN7 flies with M. luteus to prime the Toll pathway. 24h later, the flies were infected with the more pathogenic bacteria, Enterococcus faecalis (E. faecalis) [39]. Overexpression of lincRNA-IBIN7 (C564-GAL4>lincRNA-IBIN7) improved the survival of the flies from the infection compared to the flies not overexpressing lincRNA-IBIN (Fig 3B). MyD88 (a positive regulator of the Toll pathway) and cactus (a negative regulator of the Toll pathway) knock-down flies were used as controls. This indicates that lincRNA-IBIN positively affects immunity against the pathogenic Gram-positive bacteria E. faecalis. Next, we investigated whether lincRNA-IBIN regulates the central feature of the fly immune defense against Gram-positive bacteria, namely the production of AMPs via the Toll pathway. The expression of the Toll pathway mediated genes was monitored in flies overexpressing lincRNA-IBIN and controls after exposure to M. luteus for 24 hours (Fig 3C and 3D). lincRNA-IBIN overexpression using both the lincRNA-IBIN1 and lincRNA-IBIN7 lines with the C564-GAL4 driver resulted in significantly elevated levels of IM1 upon infection (Fig 3C). The expression of Drosomycin was elevated in C564>lincRNA-IBIN7 flies, whereas in the lincRNA-IBIN1 line the trend was similar, yet not significant (Fig 3D). As expected, MyD88 knockdown decreased the expression of IM1 and Drosomycin upon infection, whereas cactus knockdown caused a strong induction of IM1 and Drosomycin expression also in the uninfected flies (Fig 3C and 3D). To address the importance of lincRNA-IBIN in a situation where the expression of endogenous lincRNA-IBIN is prevented, we utilized the following experimental approach. Upon an E. cloacae infection, lincRNA-IBIN expression is fully dependent on Relish (Fig 1E). Relish RNAi flies do not produce endogenous lincRNA-IBIN upon an E. cloacae infection, but in the Relish RNAi flies combined with the lincRNA-IBIN7 construct, lincRNA-IBIN is overexpressed (Fig 3E). Next, we monitored the survival of Relish RNAi flies and Relish RNAi flies with the lincRNA-IBIN7 construct from an E. cloacae infection (Fig 3F). Fig 3F demonstrates that lincRNA-IBIN overexpression provides protection against an E. cloacae infection. lincRNA-IBIN overexpression does not itself induce antimicrobial peptides (Fig 3G and 3H), indicating that the protection is independent of the AMPs. Taken together, lincRNA-IBIN overexpression enhances the expression of target genes of the Toll pathway. Upon infection, lincRNA-IBIN overexpression gave flies a survival advantage. However, this is not due to the induction of AMPs itself, but results from a mechanism that prompts further investigation. As shown in Fig 2, lincRNA-IBIN is expressed in immunogenic tissues in the fly, such as the fat body and hemocytes. Next, we examined the role of lincRNA-IBIN overexpression in the cellular response, i. e. the hemocytes. Phagocytic plasmatocytes are the main hemocyte type in uninfected larvae. Lamellocytes, which are formed upon a parasitoid wasp infection, function in the encapsulation of the wasp eggs and larvae [5,40,41]. To further investigate if lincRNA-IBIN has a role in two major components of the cellular immune response, namely the increase in hemocyte numbers and differentiation of lamellocytes, we utilized the hemocyte reporters (msnCherry, eaterGFP) to detect hemocytes with flow cytometer. The combination of the reporters with the hemocyte (MeHH> for short, see materials and methods) and fat body (MeC564>) drivers enabled us to detect the hemocytes and overexpress lincRNA-IBIN in these tissues. Driving lincRNA-IBIN expression in hemocytes (MeHH>lincRNA-IBIN) resulted in an increase in total hemocyte numbers in uninfected larvae (S5A Fig), but did not induce ectopic lamellocyte formation (S5A’ Fig). lincRNA-IBIN overexpression in the fat body (MeC564>lincRNA-IBIN) did not have an effect on hemocytes (S5B–S5B’ Fig). lincRNA-IBIN could enhance the proliferation of hemocytes or their release from a reservoir located in segmental bands under the larval cuticle, called the sessile compartment [42,43]. To that end, we imaged whole larvae and checked for the existence of sessile bands. We did not observe any noticeable loss of sessile bands that could explain the increased hemocyte numbers (S5C Fig). In L. boulardi-infected larvae, there was a slight decrease in the numbers of hemocytes in the lincRNA-IBIN7 line (S5A Fig), but lamellocytes were not affected (S5A’ Fig). Taken together, the overexpression of lincRNA-IBIN in hemocytes increases the hemocyte numbers, but does not affect hemocyte differentiation, in unchallenged Drosophila larvae. To identify the downstream pathways and targets of lincRNA-IBIN, we performed transcriptome profiling of flies overexpressing (OE) the lincRNA-IBIN7 construct with the C564-GAL4 driver. lincRNA-IBIN OE and control flies were either infected with M. luteus or E. cloacae, or they were left uninfected. In uninfected lincRNA-IBIN OE flies, lincRNA-IBIN expression was induced 166-fold (Fig 4A (472±33 normalized number of reads for C564>IBIN vs. 2. 8±0. 62 normalized number of reads for w, IBIN). Also in this transcriptome analysis, target genes of the Toll pathway were induced in M. luteus-infected flies, and lincRNA-IBIN OE further elevated their levels (S3 Table). Candidate target genes under lincRNA-IBIN regulation were searched for in the uninfected lincRNA-IBIN7 transcriptome data using a cut-off value of 2 for fold change. Genes with induced expression level from medium to high (>10 reads) in the treatment of interest were included in the analysis. Based on this criteria, 45 genes (including lincRNA-IBIN) were upregulated (S4 Table) and 21 genes were downregulated (S5 Table) in unchallenged lincRNA-IBIN OE flies. The top upregulated genes included one of the copies of Major heat shock 70 kDa protein, Hsp70Bb (32. 9-fold), Niemann-Pick type C-2 (Npc2e, 29. 6-fold) and Amyrel (6. 8-fold; S4 Table). Among the most downregulated genes were εTrypsin (5. 3-fold) and βTrypsin (3. 2-fold) both involved in proteolysis (S5 Table). A cluster analysis of the up- and downregulated genes revealed two major gene clusters, both of which are involved in metabolism (Fig 4B). Eight out of forty-five genes upregulated in lincRNA-IBIN overexpressing flies belong to a carbohydrate metabolism/glycoside hydrolase gene cluster, and six out of twenty-one downregulated genes belong to a proteolysis / peptidase S1 gene cluster (Fig 4B). To investigate the identified metabolism related gene clusters in more detail, we plotted normalized read values of selected genes including all the treatments (uninfected, lincRNA-IBIN7 OE, E. cloacae and M. luteus infections with and without lincRNA-IBIN7 OE; Fig 4C & 4D). As shown in Fig 4C, overexpression of lincRNA-IBIN7 in uninfected flies causes the upregulation of six maltase genes (Mal-A1, Mal-A6, Mal-A7, Mal-A8, Mal-A2, Mal-B1), whose function is to catalyze the hydrolysis of maltose (disaccharide) to glucose units (monosaccharide). In addition, lincRNA-IBIN7 overexpression increased the expression of amylases (Amy-p, Amy-d, Amyrel), which hydrolyze dietary starch into disaccharides. tobi (target of brain insulin) and Gba1a (Glucocerebrosidase 1a) are also involved in sugar metabolism, and were elevated by lincRNA-IBIN7 overexpression (Fig 4C). Of note, the expression of some of these genes involved in carbohydrate metabolism was also elevated upon M. luteus and E. cloacae infections (Fig 4C, blue and orange bars). This demonstrates that enhanced sugar metabolism is needed to fight infections as shown before [44–46], and indicates that lincRNA-IBIN is involved in providing this metabolic switch. In contrast, many genes involved in peptide and protein catabolism were downregulated upon lincRNA-IBIN7 overexpression and infection (Fig 4D). The enhanced (S6B and S6C Fig) or downregulated (S6D Fig) expression of selected metabolic genes upon lincRNA-IBIN overexpression (S6A Fig) was confirmed by qPCR also with the other lincRNA-IBIN overexpressing fly line, lincRNA-IBIN1. According to the Flybase high throughput expression data (www. flybase. org), all the identified metabolism genes are almost exclusively expressed in the midgut. Therefore we next analyzed whether lincRNA-IBIN is expressed in the adult midgut in response to septic injury. To ensure maximal induction of lincRNA-IBIN, we infected adult flies by pricking them with E. cloacae, and 24h later dissected the midgut tissues of the infected flies and controls. An E. cloacae infection induced the expression of lincRNA-IBIN also in the adult midgut (Fig 4E). Furthermore, strong expression of the C564-GAL4 driver in the adult midgut was demonstrated (S7A Fig), indicating that besides the fat body, lincRNA-IBIN is also overexpressed in the midgut when the driver C564-GAL4 is used (S7B Fig). This is in line with the observed transcriptional changes when the overexpression of lincRNA-IBIN was driven using the C564-GAL4 driver. To further study changes in glucose metabolism during an infection, we measured glucose and trehalose levels from the hemolymph 24h after a septic injury with E. cloacae. Hemolymph from uninfected and infected flies (50 flies in each sample) was collected for the analysis (Fig 4F). An infection induced an increase in the glucose level in circulating hemolymph (Fig 4G), whereas the level of circulating trehalose was unaltered (S7C Fig). This suggests that increasing the hemolymph glucose level is important for the immune response. Next, to investigate the role of lincRNA-IBIN on the hemolymph glucose level, hemolymph from flies overexpressing lincRNA-IBIN7 with the C564-GAL4 driver and controls (w; lincRNA-IBIN7) was collected as described (Fig 4F). In addition to an infection (Fig 4G), also lincRNA-IBIN7 overexpression caused a statistically significant increase in the glucose level in circulating hemolymph (Fig 4H). In conclusion, these data imply that a septic infection with Gram-negative bacteria enhances the transcription of genes involved in carbohydrate metabolism, which leads to elevated sugar levels in the hemolymph. lincRNA-IBIN regulates in part this metabolic shift to ensure sufficient energy resources for the needs of the immune cells and tissues. Drosophila melanogaster has been one of the most fruitful models for studying the immune response [1]. For example, identification of the regulators of the signaling cascades of innate immunity in Drosophila has greatly advanced our understanding of the control of mammalian immune responses [3,47]. Today, key pathways and proteins controlling the immune reactions in Drosophila are well documented [10,11,48,49]. However, while findings in vertebrates indicate that lncRNAs have wide and important functions in immune responses [13–16], cancer and metabolism [26,27], the role of lncRNAs in Drosophila immunity has only begun to emerge. Based on our Drosophila transcriptome analysis, only few lncRNA genes were up- or downregulated in response to an infection with the Gram-positive LYS-type peptidoglycan containing bacteria M. luteus. However, expression of the gene CR44404, named as lincRNA-IBIN (Induced By INfection), was highly upregulated during a M. luteus infection in flies. lincRNA-IBIN expression was also induced by the Gram-negative DAP-type peptidoglycan containing bacteria E. cloacae, indicating that activation of either the Toll or the Imd pathway induces its expression. As an infection with the parasitoid wasp L. boulardi also induced the expression of lincRNA-IBIN, this indicates that lincRNA-IBIN might have a general role in immunity. The expression patterns of lncRNAs have been found to be highly specific for tissue, developmental stage and context (reviewed in [14,15]). When studying the expression levels of lincRNA-IBIN in larvae, the highest expression levels were found in the fat body. lincRNA-IBIN was also expressed in hemocytes, but was not secreted in considerable amounts into the plasma. The basal level of lincRNA-IBIN expression in these tissues was very low. However, the lincRNA-IBIN response to an infection was fast, as already at two hours after a bacterial infection the expression of lincRNA-IBIN was highly induced. This shows similar expression kinetics to AMPs and further argues for an important function for lincRNA-IBIN in immunity. The functional importance of lincRNA-IBIN was studied by overexpressing it in the fat body and in hemocytes with the UAS-GAL4-system. Overexpressing lincRNA-IBIN locally in the fat body resulted in elevated levels of the antimicrobial peptide Drosomycin and another Toll pathway target, IM1, upon a M. luteus infection. lincRNA-IBIN overexpression also led to enhanced resistance against an infection with Gram-positive bacteria. To study the function of lincRNA-IBIN further, we performed a full transcriptome analysis of uninfected and infected flies overexpressing lincRNA-IBIN. The most upregulated gene in lincRNA-IBIN overexpressing flies was Hsp70Bb. The main function of the Hsp70 proteins, like other heat shock proteins, is to maintain the proper trafficking and folding of proteins [50]. In addition, Hsp70 expression has been shown to be induced by the Gram-negative Erwinia carotovora carotovora [51] and by medium from γ-irradiated Escherichia coli bacteria [52]. As a stress-responsive gene, the upregulation of Hsp70Bb could indicate that lincRNA-IBIN overexpressing flies are experiencing stress. However, no other heat shock genes were induced in lincRNA-IBIN OE flies, indicating that a general stress response is unlikely. Another highly upregulated gene in lincRNA-IBIN overexpressing flies was Npc2e. Npc2e binds microbial components, and it has been indicated to play a role in the Imd pathway [53]. In our data, Npc2e was also upregulated after E. cloacae and M. luteus infections (S4 Table), but these changes were not significant after an FDR correction. Importantly, the lincRNA-IBIN OE transcriptome analysis revealed two main gene clusters, which were affected by lincRNA-IBIN overexpression, namely glycoside hydrolases (upregulation) and peptidases and proteases (downregulation). Inflammatory responses from infection to cancer involve changes in metabolic pathways [54,55]. The activated immune cells switch from oxidative phosphorylation toward aerobic glycolysis; this is a well-known phenomenon in cancer cells called the Warburg effect, and it is also recognized as important for immune cells upon an infection [44,56,57]. The metabolic switch toward aerobic glycolysis leads to increased glucose consumption [58]. In Drosophila, the polysaccharide starch can be hydrolyzed into the disaccharide maltose and further on into the monosaccharide glucose by maltases. lincRNA-IBIN overexpression elevated the expression of multiple maltase genes, indicating that lincRNA-IBIN has a role in enhancing the catabolism of starch. Here we showed that besides the fat body cells and hemocytes, lincRNA-IBIN was also expressed in the Drosophila gut upon infection, which is the main site of starch metabolism. lincRNA-IBIN overexpression with the C564-GAL4 driver, which is also strongly induced in the midgut, led to elevated levels of free glucose in adult hemolymph providing an energy source for immune cells. lincRNA-IBIN did not seem to affect the insulin signalling pathway, which in humans, and in flies, controls peripheral as well as central nervous system -related aspects of metabolism [59,60]. Glucose and trehalose are the major circulating sugars in Drosophila, and the majority of the total sugar in the hemolymph is trehalose [61]. lincRNA-IBIN overexpression enhanced the expression of glycoside hydrolases and led to slightly elevated levels of hemolymph glucose, but not trehalose. Therefore, lincRNA-IBIN may improve the retrieval of glucose from dietary sugars from the gut, for example by enhancing the expression of maltases. More elevated glucose levels were seen by a septic infection. It is likely that upon infection, also other factors influence the elevation of glucose levels compared to lincRNA-IBIN overexpression alone; for example, the enhanced release of glucose from glycogen storages upon infection has been shown [44,46]. The expression of genes related to proteolysis was downregulated upon lincRNA-IBIN overexpression, indicating that the uptake of amino acids from food is reduced. Immune responses are tightly regulated as prolonged inflammation is costly to the host [62,63]. Dionne and coworkers showed that flies infected with Mycobacterium marinum undergo a process resembling wasting, where the flies progressively lose metabolic stores in the form of fat and glycogen and become hyperglycemic [45]. Hence, there must be delicately controlled mechanisms for the direct control of energy allocation to the immune response upon infection or inflammation. Here, we have characterized lincRNA-IBIN as one of the potential regulators of this switch. It is important to notice, however, that we have used UAS/GAL4-based overexpression of lincRNA-IBIN to study its function. We trust that this artificial overexpression system provides valid information about the effect of lincRNA-IBIN on its target genes, but one cannot exclude that some of the observed effects may be caused by non-physiological lincRNA-IBIN expression. For example, overexpressing a short RNA molecule, such as lincRNA-IBIN, may trigger antiviral immune responses. However, the normal life span and the lack of elevated expression of known virus infection-responsive genes such as Vago, AGO2 or Sting [64–66] in lincRNA-IBIN OE flies argues against a non-specific viral response. However, the more definite conclusion about the role of lincRNA-IBIN in Drosophila immunity will require the generation of a loss-of-function mutant. lincRNA-IBIN mutant flies would also be essential to address whether lincRNA-IBIN is required for the observed metabolic changes during an infection and to address if lincRNA-IBIN is required for normal innate immunity in Drosophila. lincRNA-IBIN, like most lncRNAs, demonstrates low evolutionary sequence conservation, and the lack of homologous sequences prevented the use of similar sequences for the identification of a function for lincRNA-IBIN. lncRNAs are composed of domains that permit either protein binding and/or base-pairing with RNA or DNA sequences [34,67–70]. Based on a secondary structure prediction, it is difficult to estimate whether lincRNA-IBIN interacts with protein, DNA or RNA molecules. The primary functions of lncRNAs can be traced according to their cellular localization. Based on our RNA fluorescent in situ hybridization analysis, lincRNA-IBIN was mostly localized within the nucleus. The nuclear localization suggests that lincRNA-IBIN localizes to its genomic target site (s) through RNA-DNA or RNA-protein interactions in the chromatin, where it could modulate chromatin regions or the expression of target genes by functioning as a guide, decoy or a scaffold for interacting molecules. An overview of lincRNA-IBIN functions is presented in Fig 5. Taken together, lincRNA-IBIN has a role in both humoral and cellular innate immune pathways in larvae and adults. The basal expression level of lincRNA-IBIN is very low and it responds rapidly to an infection, but further studies are required to fully understand its role in different infection contexts. lincRNA-IBIN is expressed in immune responsive tissues and its expression is regulated by NF-κB signaling and the chromatin modeling BAP complex. In the gut, lincRNA-IBIN has a role in the activation of glycoside hydrolases. Finally, expression of lincRNA-IBIN elevates the levels of free glucose in the hemolymph. Based on our findings we postulate that lincRNA-IBIN has an important role in the metabolic switch required to provide additional glucose for immune cells during a systemic infection in Drosophila. The UAS-GAL4 -based system in Drosophila was utilized in most experiments to achieve the silencing or overexpression of genes in the F1 progeny [71]. The brm (transformant ID #37720), osa (#7810), MyD88 (#25399) and Relish (#108469) UAS-RNAi lines, and the isogenized w1118 flies (w1118iso) that were used as controls, were obtained from the Vienna Drosophila Resource Center (www. vdrc. at). cactus UAS-RNAi flies (5848R-3) were obtained from the National Institute of Genetics Fly Stock Center in Japan. RelishE20 mutant flies were a kind gift from prof. Dan Hultmark. The Imd overexpression line that overexpresses the Imd protein under the control of UAS, was originally a kind gift from prof. Jules Hoffmann. The constitutively active Toll10b mutant [72] was originally obtained from the Bloomington Drosophila Stock Center at Indiana University. C564-GAL4 flies, driving the expression of a UAS-construct in the fat body [37,38,73] and some other tissues, were a kind gift from Prof. Bruno Lemaitre (Global Health Institute, EPFL, Switzerland). The Daughterless-GAL4 (Da-GAL4) flies drive the expression of a UAS-construct ubiquitously [74]. The combination of the HmlΔ-GAL4 (w1118; P{Hml-GAL4. Δ}2P{wUAS-2xEGFP}AH2) driver [75] and the He-GAL4 (P{He-GAL4. Z}) driver [76] (HH-GAL4) was used to drive the expression of the UAS-constructs in hemocytes [77]. The GAL4 drivers were backcrossed into the w1118 background that was used as a control in crosses without a GAL4-driver. The hemocyte reporter lines eaterGFP (for plasmatocytes) [78] and MSNF9mo-mCherry (for lamellocytes, hereafter called msnCherry) [79] were obtained from Robert Schulz’s laboratory. The lines were recombined to create the msnCherry, eaterGFP reporter line. The msnCherry, eaterGFP reporter was further crossed with C564-GAL4 to obtain msnCherry, eaterGFP; C564-GAL4 (MeC564> for short). msnCherry, eaterGFP; HmlΔ-GAL4; the He-GAL4 (MeHH>) line was a kind gift from I. Anderl. To create lincRNA-IBIN overexpressing fly lines, the full-length gene for lincRNA-IBIN was cloned into the EcoRI and BcuI (SpeI) restriction sites in the pUAST vector using the following primers (with restriction sites underlined): CR44404_F: TAAGCAGAATTCCACAATCTAAAGTTAACTTGCC and CR44404_R: CACACAACTAGTGTTTATTTTCTTTCTATGGTTG. The produced plasmids were injected into the w1118 background in Best Gene Inc., USA (thebestgene. com). Ten lines producing red-eyed transformants were generated, and two lines (lincRNA-IBIN1 and lincRNA-IBIN7) with good overexpression of lincRNA-IBIN were selected for experiments. For the experiments, 10–15 virgin females were crossed with 5–7 males per vial containing mashed-potato, syrup and yeast-based fly food medium. Crosses were kept at +25°C and flies transferred daily into fresh vials. The vials with eggs were transferred to +29°C after one day of egg laying and kept there until the experiments at the larval or adult stage unless otherwise stated. Test groups and controls were kept at the same conditions at all times. After testing that target genes of the Toll pathway were induced in a similar manner in the progeny male and female flies, male flies were used for the transcriptome analysis with and without a M. luteus infection. The expression of CR44404 was tested in both female and male flies and found to be equivalent, after which male flies were used in all of the subsequent experiments. For the lifespan experiment, lincRNA-IBIN overexpressing flies (lincRNA-IBIN1 and lincRNA-IBIN7 lines) were crossed with C564> driver flies at +25°C. After one day, the eggs were transferred to develop at +29°C for a maximum lincRNA-IBIN overexpression for the entire lifespan of the flies. Twice a week, the number of the flies was recorded and the flies transferred to fresh food. Micrococcus luteus (M. luteus) was cultured on Luria-Bertani (LB) agar plates under Streptomycin selection (final concentration 100 μg/ml) and left to grow at 29°C for 2–3 days. Enterobacter cloacae (E. cloacae) was cultured on LB agar plates under Nalidixic acid selection (final concentration 15 μg/ml) and the plates were incubated overnight at 37°C. The concentrated bacterial culture used for pricking the flies was prepared by collecting the colonies from the plate into 100μl of 50% glycerol in phosphate buffered saline (PBS; 137 mmol/l NaCl, 2. 7 mmol/l KCl, 10 mmol/l Na2HPO4,1. 8 mmol/l KH2PO4). Enterococcus faecalis (E. faecalis) was cultured in Brain-Heart-Infusion (BHI) medium and incubated at 37°C with shaking (225 rpm) overnight. The absorbance of the E. faecalis bacterial culture grown overnight was measured with a spectrophotometer at 600nm after which it was diluted 1: 25 in 5 ml of BHI medium and left to grow for 2–3 hours at 37°C with shaking (225 rpm) until the absorbance at 600nm was 0. 75. Then 2 ml of the bacterial culture was centrifuged at 700 x g for 5 min and the supernatant was discarded. The pellet was resuspended into 100 μl of 50% glycerol in PBS and the bacterial concentrate was used for pricking the flies. For bacterial infections, 0–2 day old male flies were collected and placed at +29°C for 48h, after which a septic injury to the flies was caused by pricking them in the thorax with a thin sharp tungsten wire dipped into a concentrated bacterial culture. For the activation of the Toll pathway, flies were infected with M. luteus (Gram-positive bacteria) and incubated for 24h at 25°C. For measuring AMP expression levels, infected flies and non-infected controls were incubated at 25°C for the duration of the infection, harvested, and their RNAs were extracted as described below. For survival experiments, M. luteus infected flies (24h, 25°C) were subsequently infected with E. faecalis and incubated at RT. The survival of the flies was monitored for 48h, as described earlier [39]. To activate the Imd pathway, the flies were infected with the Gram-negative bacterium E. cloacae, and the flies were incubated at 25°C for the duration of the infection. 2nd instar larvae were infected with strain G486 of L. boulardi parasitoid wasps by placing 20 female wasps in vials with larvae. After two hours at room temperature, the wasps were removed and the larvae were transferred back to +29°C. 48 hours later the larvae were dissected to collect the hemocytes, plasma and fat bodies. The infection status of the larvae was checked by visually confirming the presence of L. boulardi eggs or larvae. For the first transcriptome analysis (Fig 1A and 1B), total RNAs from uninfected or M. luteus -infected (24h p. i.) w, osaIR male flies were extracted with the TRI reagent. For the second transcriptome analysis (Fig 4), total RNAs were extracted from uninfected male flies with lincRNA-IBIN overexpression (C564>lincRNA-IBIN7), uninfected controls (w1118, lincRNA-IBIN7), M. luteus -infected lincRNA-IBIN OE and control flies (24 h p. i.) and E. cloacae -infected lincRNA-IBIN OE and control flies (6 h p. i.). All the sample groups were crossed at the same time and kept in the same conditions until collection. The resulting RNA samples were DNase treated with the RapidOut DNA removal kit (Thermo Scientific). The quality of the total RNA samples was ensured with the Advanced Analytical Fragment Analyzer and found to be good. Total RNA samples were pure, intact and all samples were of similar quality. The preparation of the RNA libraries and Illumina HiSeq 2500 sequencing were carried out in the Finnish Microarray and Sequencing Centre (Turku, Finland). The RNA libraries were prepared according to the Illumina TruSeq Stranded mRNA Sample Preparation Guide (part # 15031047): Firstly, the poly-A containing RNA molecules were purified using a poly-T oligo attached to magnetic beads. Following purification, the RNA was fragmented into small pieces using divalent cations under an elevated temperature. The cleaved RNA fragments were copied into first strand cDNA using reverse transcriptase and random primers. Strand specificity was achieved by replacing dTTP with dUTP in the Second Strand, followed by second strand cDNA synthesis using DNA Polymerase I and RNase H. The incorporation of dUTP in second strand synthesis quenches the second strand during amplification, because the polymerase used in the assay is not incorporated past this nucleotide. The addition of Actinomycin D to First Stand Synthesis Act D mix (FSA) prevents spurious DNA-dependent synthesis, while allowing RNA-dependent synthesis, improving strand specificity. These cDNA fragments then have the addition of a single' A' base and subsequent ligation of the adapter: the Unique Illumina TruSeq indexing adapter was ligated to each sample during the adapter ligation step for later pooling of several samples in one flow cell lane. The products were then purified and enriched with PCR to create the final cDNA library. Typically, the RNAseq library fragments are in the range of 200–700 bp and the average size of the fragments is 250–350 bp. The samples were normalized, pooled for the automated cluster preparation and sequenced with an Illumina HiSeq 2500 instrument using TruSeq v3 sequencing chemistry. Paired-end sequencing with a 1 x 50 bp read length was used, followed by a 6 bp index run. The technical quality of the HiSeq 2500 run was good and the cluster amount was as expected. In both transcriptome analyses, the reads obtained were aligned against the Drosophila melanogaster reference genome (BDGP6 assembly, downloaded from the Illumina iGenomes website and originally derived from Ensembl). The reads were associated with known genes based on RefSeq annotations derived from UCSC database and the number of reads associated with each gene was counted using the featureCount method. The counts were normalized using the TMM normalisation method of the edgeR R/Bioconductor package. The number of reads is represented as RPKM values (Reads Per Kilobase of exon per Million reads mapped). RPKM = total gene reads / [mapped reads (millions) x total length of gene exons (kb) ]. Genes with expression values (read number) of less than 0. 125 across the treatments were considered to be expressed at low levels and excluded from the analysis. For extracting RNA from whole flies or larvae, 3 x 5 individuals per phenotype were collected and snap-frozen on dry ice or in liquid nitrogen. For RNA extraction from the fat body, fat bodies from 3rd instar larvae were dissected with forceps under a stereomicroscope and washed by dipping them three times into a 20 μl drop of 1 x PBS. In total, three biological replicates were prepared and pools of whole fat bodies from ten larvae per each biological replicate were used. Samples were snap-frozen in liquid nitrogen and stored at -80°C until RNA extraction. For RNA extraction from hemocytes and plasma, 55–60 larvae per replicate were washed, placed in a drop of 1 x PBS on a multiwell glass slide and dissected with forceps to release hemolymph. To separate hemocytes and plasma from hemolymph, suspensions were centrifuged at 2500 x g for 10 min, after which the plasma was carefully pipetted into a clean tube. Hemocytes and plasma samples were snap-frozen in liquid nitrogen and stored at -80°C until RNA extraction. For RNA extraction from adult guts, flies were dipped in 70% ethanol and dissected on a glass slide in 15 μl of 1 x PBS. The midgut region of the gut was separated and washed in a second drop of 1 x PBS. Guts from 10 flies per sample were pooled and centrifuged at 2000 x g for 2 min, after which PBS was removed and guts snap-frozen in liquid nitrogen and stored at -80°C until extraction. To start the RNA extraction, a sufficient amount of the TRI reagent (MRC, Fisher Scientific) was added to the frozen whole flies, larvae or tissues. Whole flies, larvae, fat body and gut tissues were quickly thawed and homogenized in the TRI reagent using a micropestle (Fisher Scientific). Hemocytes were homogenized in the TRI reagent by pipetting up and down for a minimum of ten times. Plasma samples were quickly thawed and suspended in the TRIzol LS reagent (Thermo Fisher Scientific) by pipetting up and down ten times. Thereafter, total RNAs were extracted according to the manufacturer’s (TRI reagent or TRIzol LS) instructions. RNA pellets were dissolved in nuclease-free water, and the RNA concentrations and the purity were determined by a Nano-Drop 2000 (Thermo Scientific) measurement. Quantitative real-time PCR (qRT-PCR) was carried out with the iTaq Universal SYBR Green One-step kit (Bio-Rad, Hercules, CA, USA) using total RNAs (approximately 40 ng/sample) as templates. RpL32 or ND-39 was used as a housekeeping gene to normalize differences in RNA amounts between samples. In the experiments presented in Fig 3C, the amounts were standardized to 40 ng of total RNA/sample. This is because no products/mRNA from genes that are considered to have a housekeeping role are normally found in the plasma. Expression levels of genes in the test groups and controls were measured within the same qRT-PCR experiment. If the samples within an experiment did not fit in one 96-well plate, a reference sample was measured in all plates to make internal normalization between plates possible. In the qRT-PCR experimental figures, one uninfected control sample (indicated in the figure legend) was set to 1, to calculate fold-induction values. The primers used are listed in Table 1. Individual 3rd instar wasp-infected and uninfected msnCherry, eaterGFP; C564>lincRNA-IBIN (MeC564>lincRNA-IBIN), msnCherry, eaterGFP; HmlΔ>; He > lincRNA-IBIN (MeHH>lincRNA-IBIN) and control larvae were placed in a 20 μl drop of cold 8% BSA in 1 x PBS and dissected carefully with forceps. Carcasses were removed and the bled hemolymph was pipetted into a vial with 80 μl of 8% BSA in 1 x PBS. Ten larvae were dissected per cross and each cross was replicated three times. The samples were run with a BD Accuri C6 flow cytometer (BD, Franklin Lakes, NJ, USA), using a gating strategy established in [80]. In short, GFP-positive cells were detected in the FL1 (510/15 BP filter) and mCherry-positive cells in the FL3 (610/20 BP filter). GFP-only, mCherry-only and non-labelled hemocytes were used to establish the gates. Some of the GFP fluorescent signal was detected in the non-primary FL3 detector, and this was corrected for by subtracting 9% from the signal. To check how well centrifuging separated the hemocyte and plasma fractions, five late 3rd instar HH>GFP larvae were bled in 100 μl of 1 x PBS. The vials were centrifuged for 10 minutes at 2500 g at +4°C. The supernatant containing the plasma was pipetted into another vial (~90 μl) and the hemocyte pellet was re-suspended in 90 μl of 1 x PBS. Plasma and hemocyte samples were run with a flow cytometer and the numbers of GFP-positive hemocytes in both fractions were determined. Late 3rd instar larvae were gently washed in a drop of water with a brush, dried on a piece of tissue paper and placed on a glass slide dorsal side facing up in a drop of 70% ice-cold glycerol. A coverslip was placed on the larvae and they were stored at +4°C overnight. The next day, the immobilized larvae were imaged with a Zeiss AxioImager M2 with Apotome 2, with an EC Plan Neofluar 5x/0. 16 objective. A Colibri LED light source was used to excite GFP (LED 470 nm) and mCherry (LED 555 nm) and images were captured with an AxioCam HRm CCD camera. Images were processed with ImageJ (Version: 2. 0. 0-rc-59/1. 51j) and Adobe Photoshop CS4. Ten larvae per cross were imaged. For detecting the cellular localization of lincRNA-IBIN, the RNA fluorescence in situ hybridization (RNA FISH) method with Cy3-tagged probes labeling the lincRNA-IBIN molecules was used. Late 3rd instar male larvae were washed in a drop of water with a brush and the hemolymph of two larvae per sample type (four biological replicates) was carefully bled out from the larvae in 20 μl of ice-cold 1 x PBS on a multiwell glass slide well, avoiding contamination from other tissues. Hemocytes were left to adhere for one hour in a humidified chamber at RT. Samples were fixed with cold 3. 7% paraformaldehyde in 1 x PBS for 5–10 min and washed with 1 x PBS for 3 x 5 min. Samples were permeabilized with 1 x PBS + 0. 1% Triton X-100 for 5 minutes and washed with 1 x PBS until there was no foam, and the mask around the wells was dried carefully with a tissue paper. The samples were blocked with 3% BSA in 1 x PBS at +4°C o/n. The RNA FISH protocol was performed by using the QuantiGene ViewRNA Assay (Affymetrix) and the probes for lincRNA-IBIN and RpL32 for Drosophila are now available in their catalog. For the hybridization of lincRNA-IBIN and RpL32 probes (control) and a negative “no probe” control, pre-warmed diluents and humidified chambers were used, and the incubator temperature (+40°C) was monitored. The Working Probe Set Solution was prepared by diluting each probe set 1: 100 in Probe Set Diluent QF: 20 μl drops were prepared for each sample by combining 0. 2 μl of Probe Set and 19. 8 μl of Probe Set diluent QF. The previous solution was aspirated from the wells and replaced with 20 μl of the Working Probe Set Solution and the samples were incubated in humidified chambers for three hours at +40°C. Working Probe Set Solution was aspirated and the wells were washed three times with Wash Buffer (this was used in all the washes). 20 μl of PreAmplifier Mix solution per sample was prepared by diluting PreAmplifier Mix 1: 25 in Amplifier Diluent QF and added to samples and incubated at +40°C for 30 min. After washing three times, Amplifier Mix solution was prepared by diluting Amplifier mix 1: 25 in pre-warmed Amplifier Diluent QF, added to the samples and incubated at +40°C for 30 min. After three washes, the Label Probe Mix Solution was prepared by diluting Label Probe Mix 1: 25 in Label Probe diluent QF, added to the samples and incubated at +40°C for 30 min. Samples were washed three times and were left for 10 min in the wash buffer for the final wash. The samples were mounted with 20 μl of ProLong Gold Antifade Mountant with DAPI (Thermo Fisher Scientific). Cover glasses were pressed on and the slides were left to harden overnight in the dark, transferred to +4°C for a day and imaged. The samples were imaged with a Zeiss LSM 780 confocal microscope with a Plan Apochromat 63 x/1. 4 oil immersion objective. A pulsed diode laser was used to excite DAPI (405 nm) and a diode laser (561 nm) was used to excite Cy3 for imaging lincRNA-IBIN and RpL32. Images were captured using a Quasar spectral GaAsP PMT array detector and camera allowing fast spectral imaging. Images were processed with ImageJ (Version: 2. 0. 0-rc-59/1. 51j) and Adobe Photoshop CS4. lincRNA-IBIN overexpressing (C564>lincRNA-IBIN7) and control flies (w1118, lincRNA-IBIN7) were allowed to eclose for 2 days, collected in fresh vials and kept at 29°C for two days prior to collecting the hemolymph. For experiments with infected and uninfected flies, w1118 flies were collected as above. w1118 flies were kept in fresh vials at 25°C for one day, after which half of them were infected by septic injury with a E. cloacae -contaminated needle. Flies were kept at 25°C for another 24 h prior to collecting the hemolymph. The hemolymph was collected by pricking the flies in the thorax with a thin sharp tungsten wire sterilized in 70% ethanol. Pools of 50 pricked flies were collected on ice in 0. 5 ul microtubes with small holes punctured in them and placed in 1. 5 μl microtubes. The flies were centrifuged at 5000 x g for 5 min, after which 0. 8 μl of hemolymph was collected from the bottom of the 1. 5 ml tube and diluted 1: 100 in Trehalase Buffer (TB; 5 mM Tris pH 5. 5,137 mM NaCl, 2. 7 mM KCl). The samples were snap-frozen in liquid nitrogen and stored at -80°C. Glucose and trehalose were analyzed using a colorimetric assay (Sigma Glucose (GO) assay kit, GACO20) based on the glucose oxidase (GO) enzyme following the protocol described in [81]. First, a trehalase stock was prepared by diluting 3 μl of porcine trehalase (Sigma-Aldrich; T8778-1UN) with 1 ml of TB. Samples were heat-inactivated for 5 min at 70°C, and divided into two 40 μl aliquots; one treated with an equal amount of trehalase stock to break down trehalose into free glucose, and the other left untreated by adding an equal amount of TB only. The samples were then incubated at 37°C overnight. Glucose standards were prepared by diluting 16 μl of a 1 mg/ml glucose stock solution with 84 μl of TB. 2-fold standard dilution curves were generated. Next morning, a 30 μl aliquot of each sample, the dilution series and a blank were loaded onto a 96-well plate and 100 μl of the GO reagent (GAGO20 Glucose assay kit, Sigma-Aldrich) was added. The plate was sealed with parafilm and incubated at 37°C for one hour. To stop the reaction, 100 μl of 12 N sulfuric acid (H2SO4) was added on the samples, after which the absorbance at 540 nm was measured using the Wallac Envision 2104 Multilabel Reader (PerkinElmer). The amount of glucose and trehalose (glucose + trehalose—glucose) in the samples were determined according to the glucose standard curve. To verify that the C564-GAL4 driver is expressed in the guts of adult flies, C564>GFP males and females were dissected in a drop of 1 x PBS and their guts were removed. The guts were checked for GFP expression using a stereomicroscope fluorescence adapter (NIGHTSEA, MA, USA) with a Royal blue LED (440–460 nm) for excitation and a 500 nm long-pass filter. Images were captured with Nikon DS-Fi2 camera. The first transcriptome analysis (Fig 1A and 1B) data was analyzed using the R package Limma. The package uses a modified t-test to generate an FDR (false discovery rate) corrected p-value (adjusted p-value) for each comparison. In the second transcriptome data analysis, the comparison between lincRNA-IBIN overexpression and controls (Fig 4A, S4 Table and S5 Table) was done using a two-tailed t-test (unequal variances assumed) with a 5% false discovery rate (FDR) correction using the Benjamini-Hochberg method [82]. In Fig 4B, genes that had a normalized read number >10 in the treatment of interest and an expression fold change >2 were included in the cluster analysis performed with the DAVID Bioinformatics resources 6. 8 (https: //david. ncifcrf. gov) [83,84] online tool. For Fig 4C and 4D, pairwise comparisons between uninfected control sample and different treatments were carried out using a two-tailed t-test assuming unequal variances. Statistical analyses of gene expression by qRT-PCR results were carried out using a two-tailed t-test for two samples assuming equal variances. Statistical analyses of fly survival experiments were carried out using the log-rank (Mantel-Cox) test with Prism 6 (GraphPad). Data on hemocyte quantifications and types were plotted and analyzed with R version 3. 3. 2 (2016-10-31), Copyright 2015 The R Foundation for Statistical Computing. Data were analyzed using analysis of variance (ANOVA) followed by Tukey’s HSD post hoc test when requirements for normality and homoscedasticity were met, and in other cases a non-parametric Kruskal-Wallis rank sum test followed by Dunn’s post hoc test were applied. The level of statistical significance was established as p < 0. 05.

Title: Immune-inducible non-coding RNA molecule lincRNA-IBIN connects immunity and metabolism in Drosophila melanogaster Summary: Drosophila melanogaster is a powerful genetic model for studying the innate immune mechanisms conserved from flies to humans. With recent methodology, such as whole transcriptome analyses, novel non-protein coding genes in addition to protein coding genes are being increasingly identified. These long and short non-coding RNA genes are located between and within protein coding genes in the genome, and their functions are largely uncharacterized. In humans, such RNA genes have been shown to affect numerous physiological processes including immune responses. In Drosophila, very few non-coding RNA genes have so far been characterized in detail. In this study, we have identified and characterized an immune-inducible long non-coding RNA gene, lincRNA-IBIN. lincRNA-IBIN is induced by exposure to bacteria as well as the parasitoid wasp, Leptopilina boulardi, suggesting a general role in humoral and cellular innate immunity. Accordingly, forced expression of lincRNA-IBIN enhances the expression of genes involved in carbohydrate catabolism and elevates hemolymph glucose levels in Drosophila. These results indicate that lincRNA-IBIN acts as a link between immunity and metabolism in Drosophila. As research in Drosophila has often resulted in the identification of evolutionarily conserved mechanisms also in mammals, it remains to be studied whether long non-coding RNA genes regulate metabolism upon an infection also in humans.

lay_plos

en

Summarize: Background Funded at $8 billion to nearly $10 billion annually, MDA’s BMDS is the largest research development program in the Department of Defense’s budget. Since the 1980s, DOD has spent more that $100 billion on the development and early fielding of this system and it estimates that continued development will require an additional $50 billion between fiscal years 2008 and 2013. Since 2002, MDA has worked to fulfill its mission through its development and fielding of a diverse collection of land-, air-, sea-, and space-based assets. These assets are developed and fielded through nine BMDS elements and include the Airborne Laser (ABL); Aegis Ballistic Missile Defense (Aegis BMD); BMDS Sensors; Command, Control, Battle Management, and Communications (C2BMC); Ground-based Midcourse Defense (GMD); Kinetic Energy Interceptors (KEI); Multiple Kill Vehicles (MKV); Space Tracking and Surveillance System (STSS); and Terminal High Altitude Area Defense (THAAD). To develop a system capable of carrying out its mission, MDA, until December 2007, executed an acquisition strategy in which the development of missile defense capabilities was organized in 2-year increments known as blocks. Each block was intended to provide the BMDS with capabilities that enhanced the development and overall performance of the system. The first 2-year block, known as Block 2004, fielded a limited initial capability that included early versions of the GMD, Aegis BMD, Patriot Advanced Capability-3, and C2BMC elements. The agency’s second 2-year block– Block 2006– culminated on December 31, 2007 and fielded additional BMDS assets. This block also provided improved GMD interceptors, enhanced Aegis BMD missiles, upgraded Aegis BMD ships, a Forward-Based X-Band-Transportable radar, and enhancements to C2BMC software. On December 7, 2007, MDA’s Director approved a new block construct that will be the basis for all future development and fielding, which I will discuss in more detail shortly. To assess progress during Block 2006, we examined the accomplishments of nine BMDS elements that MDA is developing and fielding. Our work included examining documents such as Program Execution Reviews, test plans and reports, production plans, and Contract Performance Reports. We also interviewed officials within each element program office and within MDA functional directorates. In addition, we discussed each element’s test program and its results with DOD’s Office of the Director, Operational Test and Evaluation. In following up on transparency, accountability, and oversight issues raised in our March 2007 report, we held discussions with officials in MDA’s Directorate of Business Operations to determine whether its new block structure improved accountability and transparency of the BMDS. In addition, we reviewed pertinent sections of the U.S. Code to compare MDA’s current level of accountability with federal acquisition laws. We also interviewed officials from the Office of the Under Secretary of Defense for Acquisition, Technology, and Logistics and DOD’s Joint Staff to discuss the oversight role of the new Missile Defense Executive Board (MDEB). Additionally, we reviewed the MDEB charter to identify the oversight responsibility of the board. Fielded Capability Increased, but Less than Planned at Higher Cost MDA made progress in developing and fielding the BMDS during 2007. Additional assets were fielded and/or upgraded, several tests met planned objectives, and other development activities were conducted. On the other hand, fewer assets were fielded than originally planned, some tests were delayed, and the cost of the block increased by approximately $1 billion. To stay within the revised budget despite increasing contractor costs, MDA deferred some budgeted work to future blocks. Such deferrals, coupled with a planning methodology used by some contractors that could obscure cost reporting, prevent us from determining the full cost of Block 2006. MDA was able to meet most test objectives despite delays in several elements’ test schedules. Neither we nor DOD could evaluate the aggregate performance of fielded assets because flight testing to date has not generated sufficient data. An evaluation of aggregate performance would also have to consider that (1) some parts in fielded interceptors identified as potentially problematic have not been replaced yet, and (2) tests done to date have been developmental in nature and do not provide sufficient realism for DOD to determine if the BMDS is suitable and effective for battle. Fielding of Assets and Cost During Block 2006, MDA increased its inventory of BMDS assets while enhancing the system’s performance. It fielded 14 additional Ground-based interceptors, 12 Aegis BMD missiles designed to engage more advanced threats, 4 new Aegis BMD destroyers, 1 new Aegis BMD cruiser, and 8 Web browsers and 1 software suite for C2BMC. In addition, MDA upgraded half of its Aegis BMD ship fleet, successfully conducted four Aegis BMD and two GMD intercept tests, and completed a number of ground tests to demonstrate the capability of BMDS components. Although MDA fielded an increased capability, it was unable to deliver all assets originally planned for Block 2006. The Sensors element was the only Block 2006 element to meet all of its original goals set in March 2005 while the remaining elements––GMD, Aegis BMD, C2BMC––were unable to meet all of their original quantity goals. Sensors delivered a second FBX-T in January 2007 while the GMD element fielded 14 of 15 Ground- Based interceptors originally planned during Block 2006. Last year, we reported that MDA delayed the partial upgrade of the Thule early warning radar—one of GMD’s original goals-- until a full upgrade could be accomplished. Additionally, the Aegis BMD element delivered 4 additional Destroyers and 1 new Cruiser as originally planned, but did not meet its original goal for missile deliveries––delivering 12 of 19 SM-3 missiles planned for the block. C2BMC also did not deliver two of the three software suites originally planned for Block 2006. MDA’s Block 2006 program of work culminated with higher than anticipated costs. In March 2007, we reported that MDA’s cost goal for Block 2006 increased by approximately $1 billion because of greater than expected GMD operations and sustainment costs and technical problems. If the contractors continue to perform as they did in fiscal year 2007, we estimate that at completion, the cumulative overrun in the contracts could be between about $1.9 billion and $2.8 billion. To stay within its revised budget, MDA deferred some work it expected to accomplish during the block. When work is deferred, its costs are no longer accounted for in the original block. In other words, if work planned and budgeted for Block 2006 was deferred to Block 2008, that work would be counted as a Block 2008 cost. Because MDA did not track the cost of the deferred work, the agency could not make an adjustment that would have matched the cost with the correct block. Consequently, we were unable to determine the full cost of Block 2006. Another reason why it is difficult to determine the actual cost of Block 2006 is a planning methodology employed by MDA prime contractors that can obscure the full cost of work. Contractors typically divide the total work of a contract into small efforts in order to define them more clearly and to ensure proper oversight. Work is planned into types of work packages including: (1) level of effort– work that contains tasks of a general or supportive nature and does not produce a definite end product and (2) discrete—work that has a definable end product or event. When work is discrete, delivery of the end product provides a sound basis for determining actual contractor performance. When discrete work is instead planned as level of effort, the contractor’s performance becomes less transparent because work is considered complete when the time planned for it has expired, whether or not the intended product has been completed. Earned value management does not recognize such variances in completing scheduled work and to the extent more work has to be done to complete the product, additional costs could be incurred that are not yet recognized. Many of MDA’s prime contractors plan a large percentage of their work as level of effort. MDA officials agree that its contractors have improperly planned discrete work as level of effort, and are taking steps to remedy the situation. We also observed that while several contractors had difficulty with controlling costs, during fiscal year 2007, MDA awarded approximately 90 percent or $579 million of available award fee to its prime contractors. In particular, contractors developing the ABL and Aegis BMD Weapon System were rated as performing very well in the cost and/or program management elements and received commensurate fees, even though earned value management data showed that their cost and schedule performance was declining. Although DOD guidance discourages the use of earned value performance metrics in award fee criteria, MDA includes this––one of many factors for consideration in rating contractors’ performance––in several of its award fee plans. The agency recognizes that there is not always a good link between its intentions for award fees and the amount of fee being earned by its contractors. In an effort to rectify this problem, the agency has begun to revise its award fee policy to align agency practices more closely with DOD’s current policy that better links performance with award fees. Testing and Performance of Fielded Capability Most test objectives were achieved during 2007, although several BMDS programs experienced setbacks in their test schedules. The MKV, KEI, and Sensors elements were able to execute all scheduled activities as planned. The Aegis BMD, THAAD, ABL, STSS, and C2BMC elements experienced test delays, but all were able to achieve their primary test objectives. GMD successfully completed an intercept with an operationally representative interceptor and a radar characterization test. A second intercept test employing the SBX radar has been delayed because a target malfunction delayed the execution of the first intercept test. The SBX capability is important as it is a primary sensor to be used to engage ballistic missiles in the midcourse phase of flight. As of yet, this capability has not been verified through flight testing. As we reported in March 2007, MDA altered its original Block 2006 performance goals commensurate with the agency’s reductions in the delivery of fielded assets. For several reasons, information is not sufficient to assess whether MDA achieved its revised performance goals. First, MDA uses a combination of simulations and flight tests to determine whether performance goals are met. However, too few flight tests have been completed to ensure the accuracy of the models and simulations predictions. Second, confidence in the performance of the BMDS is reduced because of unresolved technical and quality issues in the GMD element. For example, the GMD element has experienced the same anomaly during each of its flight tests since 2001. This anomaly has not yet prevented the program from achieving any of its primary test objectives, but to date neither its source nor solution has been clearly identified. Program officials plan to continue their assessment of test data to determine the anomaly’s root cause. The performance of some fielded GMD assets is also questionable because they contain parts identified by auditors in MDA’s Office of Quality, Safety, and Mission Assurance as less reliable or inappropriate for use in space that have not yet been replaced. MDA has begun to replace the questionable parts in the manufacturing process and to purchase the parts for retrofit into fielded interceptors. However, it will not complete the retrofit effort until 2012. Finally, tests of the GMD element have been of a developmental nature, and have not included operationally representative test geometries in which GMD will perform its mission. MDA has added operational test objectives to its developmental test program, but the objectives are mostly aimed at proving that military personnel can operate the equipment. The lack of data has limited the operational test and evaluation Director’s annual BMDS assessment to commenting on aspects of tests that were operationally realistic and thus has prevented the Director from determining whether the system is suitable and effective for the battlefield. Key Steps Taken to Enhance BMDS Oversight, But More Can Be Done Since its initiation in 2002, MDA has been given a significant amount of flexibility. While this flexibility allows agile decision making, it lessens the transparency of MDA’s acquisition processes, making it difficult to conduct oversight and hold the agency accountable for its planned outcomes and costs. As we reported in March 2007, MDA operates with considerable autonomy to change goals and plans, which makes it difficult to reconcile outcomes with original expectations and to determine the actual cost of each block and of individual operational assets. In the past year, MDA has begun implementing two initiatives—a new block construct and a new executive board—to improve transparency, accountability, and oversight. These initiatives represent improvements over current practices, although we see additional improvements MDA can make. In addition, Congress has directed that MDA begin buying certain assets with procurement funds like other programs, which should promote accountability for and transparency of the BMDS. New Block Structure Offers Improvements, but Does Not Resolve All Issues In 2007, MDA redefined its block construct to better communicate its plans and goals to Congress. The agency’s new construct is based on fielding capabilities that address particular threats as opposed to the previous biennial time periods. MDA’s new block construct makes many positive changes. These include establishing unit cost for selected block assets, incorporating into a block only those elements or components that will be fielded during the block, and abandoning the practice of deferring work from block to block. These changes should improve the transparency of the BMDS program and make MDA more accountable for the investment being made in missile defense. For example, the actual cost of each block can be tracked because MDA will no longer defer work planned for one block, along with its cost, to a future block. In addition, MDA plans to develop unit cost for selected BMDS assets–– such as THAAD interceptors–– so that cost growth of those assets can be monitored. In addition, the agency plans to request an independent verification of these unit costs and report significant cost growth to Congress. However, MDA has not yet determined all of the assets that will report a unit cost or how much a unit cost must increase before it is reported to Congress. Although improvements are inherent in MDA’s proposed block construct, the new construct does not resolve all transparency and accountability issues. For example, MDA officials told us that the agency does not plan to estimate the full cost of a block. Instead, the cost baseline reported to Congress will include all prior costs of the block and the expected budget for the block for the 6 years included in DOD’s Future Years Defense Plan. Costs beyond the 6th year of the plan will not be estimated. Once baselined, if the budget for a block changes, MDA plans to report and explain those variations to Congress. Because the full cost of each block will not be known, it will be difficult for decision makers to compare the value of investing in each block to the value of investing in other DOD programs or to determine whether a block is affordable over the long term. Other DOD programs are required to provide the full cost estimate of developing and producing their weapon system, even if the costs extend beyond the Future Years Defense Plan. Another issue yet to be addressed is whether the concurrent development and fielding of BMDS assets will continue. Fully developing an asset and demonstrating its capability prior to production increases the likelihood that the product will perform as designed and can be produced at the cost estimated. To field an initial capability quickly, MDA accepted the risk of concurrent development and fielding during Block 2004. It continued to do so during Block 2006 as it fielded assets before they were fully tested. For example, by the end of Block 2004, the agency realized that the performance of some ground-based interceptors could be degraded because the interceptors included inappropriate or potentially unreliable parts. As noted earlier, MDA has begun the process of retrofitting these interceptors, but work will not be completed until 2012. Meanwhile, there is a risk that some interceptors might not perform as designed. MDA has not addressed whether it will accept similar performance risks under its new block construct or whether it will fully develop and demonstrate all elements/components prior to fielding. MDA has not addressed whether it will transfer assets produced during a block to a military service for production and operation at the block’s completion. Officials representing multiple DOD organizations recognize that transfer criteria are neither complete nor clear given the BMDS’s complexity. Without clear transfer criteria, MDA has transferred the management of only one element—the Patriot Advanced Capability-3—to the military for production and operation. For other elements, MDA and the military services have been negotiating the transition of responsibilities for the sustainment of fielded elements—a task that has proven to be time consuming. Although MDA documents show that under its new block construct the agency should be ready to deliver BMDS components that are fully mission-capable, MDA officials could not tell us whether at the end of a block MDA’s Director will recommend when management of components, including production responsibilities, will be transferred to the military. New Executive Board Offers Improved, but Not Full, Oversight Oversight improvement initiatives are also underway for MDA. In March 2007, the Deputy Secretary of Defense established a Missile Defense Executive Board (MDEB) to recommend and oversee implementation of strategic policies and plans, program priorities, and investment options for protecting the United States and its allies from missile attacks. The MDEB is also to replace existing groups and structures, such as the Missile Defense Support Group. The MDEB appears to be vested with more authority than the Missile Defense Support Group. When the Support Group was chartered in 2002, it was to provide constructive advice to MDA’s Director. However, the Director was not required to follow the advice of the group. According to a DOD official, although the Support Group met many times initially, it did not meet after June 2005. This led to the formation of the MDEB. Its mission is to review and make recommendations on MDA’s comprehensive acquisition strategy to the Deputy Secretary of Defense. It is also to provide the Under Secretary of Defense for Acquisition, Technology and Logistics, with a recommended strategic program plan and a feasible funding strategy based on business case analysis that considers the best approach to fielding integrated missile defense capabilities in support of joint MDA and warfighter objectives. The MDEB will be assisted by four standing committees. These committees, who are chaired by senior-level officials from the Office of the Secretary of Defense and the Joint Staff, could play an important oversight role as they are expected to make recommendations to the MDEB, which in turn, will recommend courses of action to the Under Secretary of Defense and the Director, MDA as appropriate. Although the MDEB is expected to exercise some oversight of MDA, it will not have access to all the information normally available to DOD oversight bodies. For other major defense acquisition programs, the Defense Acquisition Board has access to critical information because before a program can enter the System Development and Demonstration phase of the acquisition cycle, statute requires that certain information be developed. However, in 2002, the Secretary of Defense deferred application of DOD policy that, among other things, require major defense programs to obtain approval before advancing from one phase of the acquisition cycle to another. Because MDA does not yet follow this cycle, and has not yet entered System Development and Demonstration, it has not triggered certain statutes requiring the development of information that the Defense Acquisition Board uses to inform its decisions. For example, most major defense acquisition programs are required by statute to obtain an independent verification of life-cycle cost estimates prior to beginning system development and demonstration, and/or production and deployment. Independent life-cycle cost estimates provide confidence that a program is executable within estimated cost. Although MDA plans to develop unit cost for selected block assets and to request that DOD’s Cost Analysis Improvement Group verify the unit costs, the agency does not yet plan to do so for a block cost estimate. Statute also requires an independent verification of a system’s suitability for and effectiveness on the battlefield through operational testing before a program can proceed beyond low-rate initial production. After testing is completed, the Director for Operational Test and Evaluation assesses whether the test was adequate to support an evaluation of the system’s suitability and effectiveness for the battlefield, whether the test showed the system to be acceptable, and whether any limitations in suitability and effectiveness were noted. However, a comparable assessment of the BMDS assets being fielded will not be available to the MDEB as MDA conducts primarily developmental tests of its assets with some operational test objectives. As noted earlier, developmental tests do not provide sufficient data for operational test officials to make such an assessment of BMDS. MDA will also make some decisions without needing approval from the MDEB or any higher level official. Although the charter of the MDEB includes the mission to make recommendations to MDA and the Under Secretary of Defense for Acquisition, Technology and Logistics on investment options, program priorities, and MDA’s strategy for developing and fielding an operational missile defense capability, the MDEB will not necessarily have the opportunity to review and recommend changes to BMDS blocks. MDA documents show that the agency plans to continue to define each block of development without requiring input from the MDEB. According to a briefing on the business rules and processes for MDA’s new block structure, the decision to initiate a new block of BMDS capability will be made by MDA’s Director. Also cost, schedule, and performance parameters will be established by MDA when technologies that the block depends upon are mature, a credible cost estimate can be developed, funding is available, and the threat is both imminent and severe. The Director will inform the MDEB as well as Congress when a new block is initiated, but he will not seek the approval of either. Finally, there will be parts of the BMDS program that the MDEB will have difficulty overseeing because of the nature of the work being performed. MDA plans to place any program that is developing technology in a category known as Capability Development. These programs, such as ABL, KEI, and MKV, will not have a firm cost, schedule, or performance baseline. This is generally true for technology development programs in DOD because they are in a period of discovery, which makes schedule and cost difficult to estimate. On the other hand, the scale of the technology development in BMDS is unusually large, ranging from $2 billion to about $5 billion dollars a year—eventually comprising nearly half of MDA’s budget by fiscal year 2012. The MDEB will have access to the budgets planned for these programs over the next five or six years, each program’s focus, and whether the technology is meeting short term key events or knowledge points. But without some kind of baseline for gauging progress in these programs, the MDEB will not know how much more time or money will be needed to complete technology maturation. MDA’s experience with the ABL program provides a good example of the difficulty in estimating the cost and schedule of technology development. In 1996, the ABL program believed that all ABL technology could be demonstrated by 2001 at a cost of about $1 billion. However, MDA now projects that this technology will not be demonstrated until 2009 and its cost has grown to over $5 billion. MDA Directed to Use Procurement Funding In an effort to further improve the transparency of MDA’s acquisition processes, Congress has directed that MDA’s budget materials delineate between funds needed for research, development, test and evaluation; procurement; operations and maintenance; and military construction. Congress gave MDA the flexibility to field certain assets using research, development, test and evaluation funding which allowed MDA to fund the purchase of assets over multiple years. Congress recently restricted MDA’s authority and required MDA to purchase certain assets with procurement funds. Using procurement funds will mean that MDA will be required to ensure that assets are fully funded in the year of their purchase, rather than incrementally funded over several years. Additionally, our analysis of MDA data shows that incremental funding is usually more expensive than full-funding, in part, because inflation decreases the buying power of the dollar each year. For example, after reviewing MDA’s incremental funding plan for THAAD fire units and Aegis BMD missiles, we analyzed the effect of fully funding these assets and found that the agency could save about $125 million by fully funding their purchase and purchasing them in an economical manner. Upcoming Report Our annual report on missile defense is in draft and with DOD for comment. It will be issued in final by March 15, 2008. In that report, we are recommending additional steps that could build on efforts to further improve the transparency, accountability, and oversight of the missile defense program. Our recommendations include actions needed to improve cost reporting as well as testing and evaluation. DOD is in the process of preparing a formal response to the report and its recommendations. Mr. Chairman, this concludes my statement. I would be pleased to respond to any questions you or members of the subcommittee may have. Contacts and Staff Acknowledgments For questions about this statement, please contact me at (202) 512-4841 or Francisp@gao.gov. Individuals making key contributions to this statement include David Best, Assistant Director; LaTonya D. Miller; Steven B. Stern; Meredith Allen Kimmett; Kenneth E. Patton; and Alyssa Weir. This is a work of the U.S. government and is not subject to copyright protection in the United States. It may be reproduced and distributed in its entirety without further permission from GAO. However, because this work may contain copyrighted images or other material, permission from the copyright holder may be necessary if you wish to reproduce this material separately.

Summary: Funded at $8 billion to $10 billion per year, the Missile Defense Agency's (MDA) effort to develop and field a Ballistic Missile Defense System (BMDS) is the largest research and development program in the Department of Defense (DOD). The program has been managed in 2-year increments, known as blocks. Block 2006, the second BMDS block, was completed in December 2007. By law, GAO annually assesses MDA's progress. This testimony is based on GAO's assessment of MDA's progress in (1) meeting Block 2006 goals for fielding assets, completing work within estimated cost, conducting tests, and demonstrating the performance of the overall system in the field, and (2) making managerial improvements to transparency, accountability, and oversight. In conducting the assessment, GAO reviewed the assets fielded; contractor cost, schedule, and performance; and tests completed during 2007. GAO also reviewed pertinent sections of the U.S. code, acquisition policy, and the charter of a new missile defense board. We have previously made recommendations to improve oversight in the areas that MDA has recently taken action. We also have a draft report that is currently with DOD for comment that includes additional recommendations. In the past year, MDA has fielded additional and new assets, enhanced the capability of some existing assets, and achieved most test objectives. However, MDA did not meet the goals it originally set for the block. Ultimately, MDA fielded fewer assets, increased costs by about $1 billion and conducted fewer tests. Even with the cost increase, MDA deferred work to keep costs from increasing further, as some contractors overran their fiscal year 2007 budgets. Deferring work obscures the cost of the block because such work is no longer counted as part of Block 2006. The cost of the block may have been further obscured by a way of planning work used by several contractors that could underestimate the actual work completed. If more work has to be done, MDA could incur additional costs that are not yet recognized. MDA also sets goals for determining the overall performance of the BMDS. Similar to other DOD programs, MDA uses models and simulations to predict BMDS performance. We were unable to assess whether MDA met its overall performance goal because there have not been enough flight tests to provide a high confidence that the models and simulations accurately predict BMDS performance. Moreover, the tests done to date have been developmental in nature, and do not provide sufficient realism for DOD's test and evaluation Director to determine whether BMDS is suitable and effective for battle. GAO has previously reported that MDA has been given unprecedented funding and decision-making flexibility. While this flexibility has expedited BMDS fielding, it has also made MDA less accountable and transparent in its decisions than other major programs, making oversight more challenging. MDA, with some direction from Congress, has taken significant steps to address these concerns. MDA implemented a new way of defining blocks--its construct for developing and fielding BMDS increments--that should make costs more transparent. For example, under the newly-defined blocks, MDA will no longer defer work from one block to another. Accountability should also be improved as MDA will for the first time estimate unit costs for selected assets and report variances from those estimates. DOD also chartered a new executive board with more BMDS oversight responsibility than its predecessor. Finally, MDA will begin buying certain assets with procurement funds like other programs. This will benefit transparency and accountability, because to use procurement funding generally means that assets must be fully paid for in the year they are bought. Previously, MDA has been able to pay for assets incrementally using research and development funds. Some oversight concerns remain, however. For example, MDA does not plan to estimate the total cost of a block, nor to have a block's costs independently verified--actions required of other programs to inform decisions about affordability and investment choices. Also, the executive board faces a challenge in overseeing MDA's large technology development efforts and does not have approval authority for some key decisions made by MDA.

gov_report

en

Summarize: The hearing for an Army intelligence analyst accused of leaking thousands of military reports and diplomatic cables to WikiLeaks is scheduled to hear classified evidence from prosecutors in a secret session Monday morning at Ft. Meade, Md. The presiding officer for Army Pfc. Bradley Manning's hearing, Lt. Col Paul Almanza, approved the prosecution request Sunday afternoon following a closed-door session where the government apparently laid out what classified evidence it wanted to present and why it was important to the case. When Almanza reopened the courtroom, he explained what he had concluded about the need for the secret evidence. "I determined that the classified evidence is properly classified, that protecting classified information is an overriding interest that outweights the value of an open proceeding [and determined] that no lesser means than closure can protect that overriding interest," Almanza said. Manning's lawyer, David Coombs, stated that the decision to close the hearing came over the objections of the defense. Just after the closure decision Sunday, Almanza heard testimony from an Army investigator who was the first to tie Manning to the leaks in a concrete way. Special Agent David Shaver said data on computers used by Manning at a forward operating base in eastern Iraq showed someone signed in under his user profile performed searches that seemed "out of place," such as searches for Wikileaks, the group's founder Julian Assange, the country of Iceland, the Associated Press reported. In addition, Manning's computer contained 10,000 diplomatic cables as well as evidence of searches for information about Guantanamo, Shaver said according to the AP. Manning's supervisors who've testified at the hearing, which began on Friday, have said there would be no work-related reason for most or all of those searches, though one officer said he actually sent Manning and other analysts the link to the diplomatic cable database because it might aid their analysis of threats in Iraq. The defense was expected to cross-examine Shaver this morning before the hearing goes into secret session. Blogger Kevin Gosztola of Firedoglake.com tweeted Monday that Shaver would be the first witness in the closed session. It was unclear if there might be others. The prosecutors, defense attorneys and Manning are allowed in the courtroom during the closed session, Almanza said. He also said representatives of "other government agencies" would be allowed to remain even as the press and public were removed from the courtroom and video feed to a filing center nearby was cut. The Army has not responded to a request to identify which agencies have special access to the courtroom. Read more about: Iraq, Transparency, First Amendment, Classified Information, Leaks, Army, Wikileaks, Bradley Manning, Military Justice, Courts Martial, Classified Information Procedures Act 1 of 5. U.S. Army Private Bradley Manning is seen in a courtroom sketch during his Army Article 32 hearing in the courthouse at Fort Meade, Maryland, December 16, 2011. FORT MEADE, MD (Reuters) - A key witness was excused from testifying in the case against Army intelligence analyst Bradley Manning on Sunday after he invoked his right against self-incrimination at a hearing about the largest leak of classified documents in U.S. history. Sergeant First Class Paul Adkins invoked his right against self-incrimination as he began answering questions at a proceeding to determine whether there was sufficient evidence to court-martial the 24-year-old Manning on charges including aiding the enemy, which carries life imprisonment. Manning is charged with downloading massive data files from the military's classified network when he was a U.S. Army intelligence analyst in Iraq, and providing them to anti-secrecy website WikiLeaks. The defense has portrayed Adkins, at the time a master sergeant in charge of security at the facility where Manning worked, as someone who should have recognized the private's troubled emotional state and acted to revoke the security clearance that gave him access to classified U.S. documents. Manning's attorney, David Coombs, argued that Adkins should not be excused because he was not under criminal investigation in the case, but the prosecution declined to grant him immunity to testify and he was excused. A second intelligence analyst who worked with Manning, Warrant Officer 1 Kyle Balonek, also invoked his right against self-incrimination and was excused from testifying on Sunday. He was one of the most experienced analysts in the unit. Coombs argued on Saturday that Manning had displayed warning signs of emotional instability before his alleged wrongdoing and struggled with his gender identity. In one incident, Manning "got furious and upset, flipped a table during the outburst" and sent a computer crashing to the ground, Coombs said. Manning had to be restrained over fears he was headed for a weapon. Captain Casey Fulton, an Army intelligence officer who worked in the same secure facility as Manning, testified that another time she saw him curled up on the floor with his arms around his knees as Adkins spoke to him. SHOULD HAVE BEEN DENIED ACCESS Fulton also testified that later that night she overheard a commotion in which Manning allegedly struck a female superior, which was also reported to Adkins and resulted in Manning being moved to work in the supply division. As it cross-examined prosecution witnesses on Sunday, the defense team continued to suggest that Manning should not have had access to classified documents, given his emotional state. Fulton, who used Manning in her work preparing for the Iraqi election, rejected suggestions that supervision of lower-level analysts like Manning was lax. "It's impossible to supervise 100 percent of the time," she said. "There's a limited amount of supervisors and you can't supervise everyone at every second of the day. (You) trust that they'll safeguard the material the way they've been taught." Sergeant Chad Madaras, who worked in the same facility as Manning during the day and used the same computer, acknowledged that soldiers regularly used classified computers to play music, movies and video games. Those recordings, movies and video games were kept on a classified network drive - where Fulton testified first seeing a helicopter gunsight video released by WikiLeaks last year. The video shows a 2007 U.S. helicopter attack that killed a dozen people in Iraq, including two Reuters journalists. U.S. investigators say they have found a rewritable CD with that video in Manning's possession. Captain Thomas Cherepki, an information systems manager who oversaw networks at Manning's facility, said intelligence analysts like Manning had to have the ability to copy information from their classified machines onto discs to share data with each other and with locals. DEFENSE FOCUS ON MENTAL STATE "There was no technical restriction put in place by me or any of my soldiers to prevent that from happening," he said. "The only thing that would prevent that, in my view is trust that the soldier would do what's right." The prosecution has portrayed Manning as a well-trained analyst who understood his responsibilities but violated them. The defense has tried to sidestep the question of blame and focus instead on his mental state. Manning's brigade chief, Captain Steven Lim, on Saturday testified that Adkins had received an email in April 2010 in which Manning said he suffered from a gender identity disorder that was affecting his life, work and ability to think. The email included a photo of Manning as a woman. Lim said Adkins did not tell him about the email until after Manning's arrest. Manning, it was disclosed during the proceedings, has created a female alter-ego online, Breanna Manning. Manning was arrested last year after disclosing his data thefts to former hacker Adrian Lamo, who turned him in to U.S. authorities. In Internet chats with Lamo, Manning said he would bring CDs to his workplace and load them with downloaded data from the military's Secret Internet Protocol Router Network, known as SIPRNet, Lamo told Reuters in a previous interview. In his Web chats with Lamo, Manning appeared to acknowledge giving materials to WikiLeaks founder Julian Assange. He wrote to Lamo: "I'm a high profile source... and I've developed a relationship with Assange," according to details of the chats confirmed by Lamo to Reuters. (Writing by David Alexander; editing by Vicki Allen and Todd Eastham) Army investigators found nearly half a million field reports from Iraq and Afghanistan on a computer memory card among the belongings of Pfc. Bradley Manning, with a note suggesting that an unnamed recipient "sit on this information" while deciding how best to distribute it, according to testimony Monday. The note called the reports "possibly one of the more significant documents of our time" and said they would remove "the fog of war" and reveal "the true nature of 21st century asymmetric warfare," Army special agent David Shaver told the officer leading a preliminary hearing at Fort Meade. Manning, 24, is accused of giving hundreds of thousands of classified documents to WikiLeaks while serving as an intelligence analyst in Iraq. He is charged with aiding the enemy and violating the Espionage Act. On the fourth day of the hearing, members of the Army Computer Crimes Investigative Unit described how they examined military and personal computers used by Manning, and what they found. Military computers showed evidence of downloads from servers at the State Department and the Defense Department, they said. Investigators found four detainee assessments from Guantanamo Bay under Manning's user profile. A personal computer contained logs from chats about releasing government information, IP addresses associated with WikiLeaks and what appears to be contact information for group founder Julian Assange, they said. After two days of arguing that Manning was a troubled soldier who should not have been given access to classified materials, his defense team appeared to shift course Monday, suggesting there was no proof that Manning was behind the downloads or the chats. Shaver acknowledged that the military computers were secure workstations from which analysts were authorized to view material from the State Department and the Defense Department and that more than one analyst was assigned to the computers. He said that more than 100,000 diplomatic cables couldn't be connected to Manning, and that 10,000 that were found on his computer didn't match the cables published by WikiLeaks. Investigator Mark Johnson, who examined Manning's personal MacBook Pro, said it was set to boot up without a password — meaning, he acknowledged, he can't say for certain that Manning was responsible for the chats, the IP addresses or Assange's details found on his computer. "I cannot put somebody at the keyboard, no," Johnson said. Manning, wearing the standard green Army camouflage uniform also worn by prosecutors and his military attorneys, sat quietly through the testimony. He has appeared at ease through the first four days of the hearing, talking with his attorneys, taking notes and occasionally smiling. The Army convened the Article 32 hearing to determine whether the case against Manning should proceed to a court-martial. Lt. Col. Paul Almanza, the investigating officer presiding over the hearing, will weigh testimony and arguments before making a recommendation to Maj. Gen. Michael Linnington, the commander of the Military District of Washington. Aiding the enemy is a capital offense, but Army prosecutors say they will not seek the death penalty. If convicted, Manning could be sentenced to life in prison. Twice on Monday, Almanza cleared the courtroom to hear testimony from Shaver on classified information. Among those excluded were an attorney for the Center for Constitutional Rights, which is representing WikiLeaks and Assange. Baher Azmy, legal director for the New York-based nonprofit, said the hearing has been "more restrictive than those at Guantanamo." "We have a compelling interest in monitoring the hearing, given both that Manning stands accused of providing evidence of war crimes to our clients, and that the proceedings are clearly closely linked to a grand jury in Virginia reported to be issuing subpoenas for information on our clients," Azmy said in a statement. Manning supporters say footage of an Apache helicopter attack that he is alleged to have released appears to show evidence of a war crime.

Summary: Bradley Manning's pretrial hearing was closed to the public today, with media and spectators forced out of the courtroom so that an Army special agent who had examined Manning's computers could testify about classified information. The move drew criticism from WikiLeaks supporters, particularly the Center for Constitutional Rights, which is representing WikiLeaks and Julian Assange in other cases, the Baltimore Sun reports; the nonprofit's legal director said the hearing has been "more restrictive than those at Guantanamo." The defense objected to the closure, according to Politico, but the presiding officer said that "protecting classified information is an overriding interest that outweighs the value of an open proceeding." It's not the first time testimony has gone unheard; yesterday two witnesses took the fifth, according to Reuters, including Sgt. First Class Paul Adkins, who ran security at the facility where Manning worked. The defense has argued that Adkins should have recognized Manning's disturbed mental state and revoked his clearance.

multi_news

en

Summarize: CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims the benefit of U.S. Patent Application Ser. No. 61/871,456 filed Aug. 29, 2013, the disclosure of which is incorporated herein by reference. BACKGROUND [0002] This invention relates generally to tools, devices and improved methods for providing intermaxillary fixation. The benefits of intermaxillary fixation, rigidly connecting the upper jaw to the lower jaw, are well known to promote healing of jaw fractures. Intermaxillary fixation is a common treatment to stabilize jaws for oral, plastic, maxillofacial, ENT and trauma surgeries. Further, intermaxillary fixation has been disclosed as a preferred stabilization method for the short term treatment of facial fractures in non-surgical settings, such as on the battlefield by military corpsmen. [0003] The general process of fixing the upper and lower jaw together for medical purposes has been in place for decades. Early efforts for intermaxillary fixation were rudimentary, generally ineffective, often exacerbated patient discomfort, and often failed to achieve desired results. An early process for intermaxillary fixation included the steps of boring holes through the patient&#39;s upper and lower gums, passing a wire through the holes and then twisting the wire to join the upper jaw to the lower jaw. That process required boring several holes through the patient&#39;s gums. Later efforts have included a variety of apparatuses and processes that include drilling holes, placing bolts, screws or anchors in to the patient&#39;s gums, jaw bones and palate. Although such processes increase the possibility of patient discomfort, infection and long-term bone and tissue damage, they are sometimes necessary to effectively fix the patient&#39;s jaws together. [0004] These methods have improved over the years including the device disclosed and described in U.S. Pat. No. 8,414,581 to Shah et al. Contemporary treatment methods tend to use non-invasive procedures when possible. The development of the Shah device was a significant advancement in the art in that it uses arch bars that fit adjacent to the outer surface of the patient&#39;s upper and lower teeth and are then fastened in place using a plurality of pliable zip or cable ties that connect the arch bars to individual teeth. Interarch receptacles provided on both the upper and lower arch bars can then be fastened together using reverse zip ties or double-ended flexible straps (described herein) thus holding the upper and lower jaw together. In many situations, this device eliminates the need for a physician to drill in to the patient&#39;s gum, palate or jaw to fix the upper and lower jaws together. The use of arch bars and zip tie connectors allows for easy and quick installation, removal and repair of the device. [0005] However, the Shah device works best when patients have substantially all of their teeth. When patients present with substantial trauma to their jaw and teeth or have multiple teeth removed or missing, then the interarch bar may not have enough support on the remaining teeth to be an effective treatment. Likewise, for patients that have dentures or no teeth whatsoever, the Shah device may be ineffective as disclosed and described in the previously referenced Shah patent. [0006] Accordingly, it is beneficial to provide a treatment that utilizes, to the extent possible, the noninvasive treatment disclosed in the previously referenced Shah patent, along with tools, devices and procedures that facilitate intermaxillary fixation when a patient has less than all of their teeth, dentures or no teeth at all. While the elimination of bone screws, drilling, boring and wire placement is a desirable goal, some of the historic techniques can be used in conjunction with more modern techniques and devices to substantially lessen the invasiveness of the intermaxillary fixation process. SUMMARY OF THE INVENTION [0007] The instant invention is intended to overcome certain limitations that are present in the noninvasive intermaxillary fixation devices, such as the Shah device. More specifically, the invention is intended to meet the needs of patients who do not have enough teeth for the intermaxillary fixation arch bar system to work effectively and in instances where the patient presents with dentures, partial teeth or no teeth at all. The inventive tools, devices and methods disclosed herein utilize the best features of arch bar fixation devices, such as that disclosed by Shah, with some traditional methods that can be effective in those circumstances described. [0008] For example, a patient presenting with most of their teeth, but lacking teeth in one specific area of their mouth, a relatively common occurrence from trauma sustained in vehicle collisions or resulting from a sports injury, interarch bars can be used in those areas of the mouth where most of the teeth are present. However, in the area where teeth are not present, there would be insufficient stability to support an arch bar connected with an interarch receptacle and a strap with serrations. [0009] When described herein the female end of a zip or cable tie may be referred to as ratchet head, or as an interarch receptacle. Both terms refer to the case having a port through it for receiving a flexible strap. A flexible retention member or pawl is disposed inside the port of the ratchet head or interarch receptacle, as is commonly found with the female end of a zip or cable tie. The male end of a zip or cable tie may be referred to as a flexible strap. The flexible straps are provided with ratchet teeth or serrations. Some embodiments of the flexible strap are attached at one end to a ratchet head forming the common cable or zip tie. Some embodiments of the flexible straps are attached at one end to an inventive washer described in relation to the figures. Some embodiments of the flexible straps have two male ends, each with a section of ratchet teeth oriented in opposing directions, which may be referred to as a double-ended flexible strap. Each end of the double-ended flexible strap may be inserted into opposing interarch receptacles to fix the patient&#39;s jaws together, as is described in more detail in relation to the figures. The various embodiments of the flexible straps are inserted through the port on the ratchet head, thereby engaging the ratchet teeth on the flexible strap with the pawl and allowing insertion of the flexible strap but not its removal from the port. In some embodiments the flexible straps are flexible along their length, in one or both axes perpendicular to the longitudinal axis of the strap, so that they may be bent, curved or twisted in simple or compound curves as necessary. In some embodiments the flexible straps have limited extensibility or compressibility parallel to their longitudinal axis. [0010] In another embodiment of the invention, a unique hanger assembly provides a ratchet head, similar to those found on the Shah arch bar assembly, which can be connected to a screw fastened in to the patient&#39;s jaw bone. As shown in FIG. 1, a washer, or preferably, a slotted washer incorporated into a hanger can be placed onto the bone screw and secured in place by the screw head as the screw is inserted and tightened. The preferred washer includes an integrally formed ratchet head or interarch receptacle. In some embodiments, the screw would be positioned opposite an arch bar attached to existing teeth on the opposing jaw, so that the ratchet head would be presented opposite to an interarch receptacle mounted on the arch bar fastened to the existing teeth. The ratchet head may then be secured to the interarch receptacle using a double-ended flexible strap. [0011] For example, if the patient presented with no teeth on the left upper jaw but with teeth on the lower left jaw, an arch bar, similar to the Shah device, can be fastened to the lower teeth. At least one bone screw would be mounted into the upper left jaw bone of the patient opposite each arch bar receptacle provided on the arch bar fastened to the left lower teeth. An inventive washer assembly, an embodiment of which is depicted in FIGS. 1A, 1 B, and 1 C, may either be placed on the screw and simultaneously mounted with the bone screw, or slipped over the bone screw in the case of a slotted washer, and then secured in place by tightening the bone screw. The ratchet head incorporated into the washer assembly may be oriented so that a double-ended flexible strap can be inserted into both the ratchet head attached to the upper jaw, and to the interarch receptacle attached to the lower jaw so that when the patient&#39;s jaws are closed together the double-ended flexible strap holds the opposing arch bar receptacles and associated arch bar (on the lower teeth) in place. [0012] In situations where multiple teeth are missing from both the upper and lower jaw of the patient, it may be necessary to use multiple bone screws on both the upper and lower jaw to present enough ratchet heads or interarch receptacles so that the patient&#39;s jaws are maintained in the preferred rigid closed position by the flexible straps. [0013] In another embodiment of an intermaxillary fixation accessory, the innovative washer for fastening to a bone screw may also be attached to a flexible strap, an embodiment of which is shown in FIG. 1C. When a bone screw is positioned opposite an interarch receptacle or a washer hanger assembly attached to the other jaw, the male end of the flexible strap may be inserted into the opposing receptacle to secure the two bone screws and thus the two jaws. A physician may alternate using the washer hanger assembly with either a washer with attached flexible strap or another washer hanger assembly and a double-ended flexible strap, as is most suitable for the application and circumstances. [0014] In some embodiments the bone screw must be inserted through the washer prior to placing the bone screw in the jaw. In other embodiments, the washer component is a slotted washer that has one end of its slot large enough to pass over the head of the bone screw and the other end of the slot small enough that it will not pass over the head of the bone screw. This allows the bone screw to be placed in the jaw and then the washer passed over the screw head and then manipulated so that the narrow portion of the slot underlies the head of the screw such that it cannot be removed without loosening or removing the bone screw. This also allows the washer assembly to be removed from the bone screw without fully removing the screw, in instances where the fastening assembly must be adjusted or replaced. Substantial care must be taken when applying washers with bone screws to not unduly compress gum tissue as doing so can cause permanent damage to the patient&#39;s gums. [0015] Another novel tool for intermaxillary fixation is a flexible strap-compatible bone screw. As shown in FIGS. 2A, 2 B, 2 C, and 2 D, the bone screw includes a threaded shaft and an elongated driving head for engagement with a driving tool as is common in the practice of seating bone screws. The driving head includes a ratchet head. The ratchet head may be integrally formed with the head of the bone screw or inserted into a cavity in the head of the bone screw. In some embodiments the ratchet head is inserted into and frictionally retained in a cavity or opening extending laterally through the elongated driving head of the screw. In some embodiments, the ratchet head may include a small ledge or other retention member along one edge of the case thereof to further support and retain the ratchet head in place. In other embodiments, as shown in FIG. 2D, the ratchet head may be formed with at least one lip or protrusion that engages a portion of the head of the bone screw to prevent the ratchet head from passing through the cavity in the head of the bone screw. [0016] The inventive screw is installed in a traditional manner by driving the threaded portion of the shaft in to the bone of the patient. In an embodiment with the ratchet head incorporated into the head of the bone screw, the openings of the ratchet head are aligned as needed for clamping the jaws together, and are often oriented in an up and down orientation, with respect to the jawline of the patient. A flexible strap is inserted into the ratchet head. When the bone screw is mounted in the lower jaw, the orientation of the ratchet head and flexible strap is reversed. [0017] In another embodiment the ratchet head is not integrally formed with the bone screw and must be inserted into the cavity in the head of the bone screw. When this embodiment of the bone screw is installed in the jaw of a patient, the openings of the cavity and the optional retaining ledge are oriented generally toward the opposite jaw. The ratchet head is then installed into the cavity. Any protrusions on the ratchet head are disposed away from the opposing jaw so that the pulling force exerted by the flexible strap will pull the ratchet head farther into the cavity in the bone screw. In some circumstances, bone screws are presented in both the upper and lower jaw and are substantially aligned. A double-ended flexible strap may be provided and inserted into the ratchet heads on both bone screws. Thus, as the double-ended flexible strap is pulled upward through the ratchet head in the top bone screw and downward through the ratchet head in the lower bone screw, the patient&#39;s jaws are forced together. [0018] For those instances where a patient presents with upper, lower or both upper and lower dentures, the full interarch bar fixation assembly may not be effective because the dentures do not afford the stability necessary for good intermaxillary fixation. It is desirable, however, to fix the jaw in place with the dentures inserted so that as jaw bones heal they are healed in the configuration, orientation and spacing necessary to accommodate post-procedure denture usage that is appropriate and patient friendly. Fixing the jaws together without the dentures in place would likely result in improper post-procedure denture fit because the bone alignment would be different from the bone alignment at the time the dentures are originally fitted. [0019] Some current methods for intermaxillary fixation when a patient has dentures involve an elaborate process of wiring the dentures in place. For the lower dentures, a hole is generally made between the patient&#39;s gum and cheek tissue oriented downward and passing along the patient&#39;s jaw, exiting under the chin. A second hole is then bored upward through the floor of the patient&#39;s mouth adjacent the inner edge of the jaw and gums. This bore is generally made with a pointed or sharp instrument such as an awl or trochar. The dentures are then placed over the patient&#39;s gums and a wire is inserted through the hole between the patient&#39;s cheek and gum, passed downward below the patient&#39;s chin and then back upward and through the bore that is interior the patient&#39;s jaw bone. The wire is passed over the dentures and twisted or otherwise secured to itself so that the dentures are pulled downward on to the patient&#39;s gum and retained rigidly in place. A plurality of these circum-mandibular wires may be necessary to rigidly fix the lower dentures in place. In some cases this requires two sets of holes on either side of the patient&#39;s mouth, and in practice as many as four to six sets of holes may be used. [0020] For dentures on the upper jaw, multiple bone screws through the patient&#39;s hard palate can be used to secure the dentures in place. In the alternative, holes can be bored in the upper gum to allow wires to pass through these holes in the piriform aperture adjacent to the nose, and these wires are then tied around the circum-mandibular wires (wires around the lower jaw). Another alternative is to fix screws into the patient&#39;s upper jaw and then fastening wires to the screws which are then secured to bone screws in the lower jaw bone or, in some instances, to additional wires passed through holes drilled in the gum line (circummandibular wires). [0021] The use of wires to tie the dentures in place is not desirable because of the difficulty in positioning the wires, the propensity of the wires to cause sores within the patient&#39;s mouth and for the ends of the wires to gouge patient&#39;s jaws, cheek, tongue and the like. Moreover, as is well known, the use of wires in a patient&#39;s mouth often results in injuries to the physician, orthodontist and other medical staff during placement, adjustment and removal. One of the inventive devices that overcomes many of these limitations and drawbacks is an improved zip tie assembly that can be substituted for the wires in the process described above. In one instance, shown in FIG. 4, a flexible strap is presented that has a dissection tip at one end of the strap. This dissection tip allows the strap to be pushed through the tissues. The dissection tip is preferably formed from extremely rigid and sharp plastic, but can have an integrated metal cutting end formed from materials commonly found in scalpels, needles and the like. In some embodiments the dissection tip is sharp enough to easily pass through tissue, but not so sharp that it severs nerves and vessels. In some embodiments the dissection tip is molded to the flexible strap but is easily removed by cutting apart the plastic portion of the flexible strap adjacent the tip. [0022] In practice, the dissection tip of the flexible strap is used in a similar manner to an awl or trochar for creating tissue access for wire placement. The flexible strap is pushed, passed or guided through the tissue adjacent the gum and then passed through a small incision made below the patient&#39;s chin and then back up through the tissue thereby encircling the lower jaw and any associated dentures or dental blocks. Likewise, for application on an upper jaw of a patient, bores through the patient&#39;s gum, such as commonly used for that application are formed. A flexible strap can then be positioned through the bore around the jaw and fastened to a ratchet head on the other end of the flexible strap to hold the upper dentures in place. Multiple bores with multiple fasteners may be necessary to firmly secure dentures to the patient&#39;s upper gums. Once the dentures are fastened in place, the upper and lower jaws can be fixed together by traditional means, or by fastening interarch bars to the upper and lower teeth, whether natural or dentures, and then using an interarch bar attachment assembly such as that disclosed in the Shah patent. Alternatively, the innovative washer attachment system described herein may be utilized for intermaxillary fixation once the dentures are secured in place. [0023] In those instances when a patient presents with no teeth whatsoever and dentures are not provided or otherwise available, another embodiment of the invention may be used to securely fix the patient&#39;s jaws. As described above, it is not desirable to fix the patient&#39;s upper and lower jaws together for bone healing when there are no teeth or dentures present. Doing so results in improper jaw bone alignment during the healing process and may make it difficult, if not impossible, for subsequent use of dental implants or dentures. In other embodiments of the invention, as shown in FIGS. 3A, 3 B, 6 A, and 6 B, a unique set of dental blocks has been designed and developed to support the jaws and provide the proper spacing. One dental block is suitable for placement for the upper teeth, shown in FIG. 3A, and the other block is designed for the lower teeth as shown in FIG. 3B. The blocks are comprised of rigid or semi-rigid plastic portion that is sized to simulate the patient&#39;s teeth and a soft, formable or malleable portion, sometimes formed from plastic, that engages the patient&#39;s gum when the block is in place. When in place, the dental block holds the upper and lower jaw apart a sufficient distance such that when broken jaw bones are healed, suitable space has been provided between the jaw bones for proper placement of dental implants or dentures. In some embodiments, a single dental block may contact both upper and lower gums for a patient with no teeth. [0024] As shown in FIGS. 3C, 3 D, 6 A, and 6 B, each dental block is provided with multiple receptacles for receiving the male portion of a zip tie. The dental block is held in place using methods described above for securing dentures in place. The upper dental block may include screw holes for fastening the block in place with screws placed in the patient&#39;s palate. Once the dental blocks are fixed in place, double-ended flexible straps can be used in the receptacles on the dental blocks to fasten the upper and lower jaws together. [0025] Another inventive tool is a unique trochar or awl that is provided with a unique retention member at or substantially near the blade or dissection tip of the awl. The retention member is configured to engage and frictionally retain a knob provided on another embodiment of the flexible strap which may be used as a circum-mandibular strap. In some embodiments, a slot may be presented in the blade of the awl to engage a pin attached to the circum-mandibular strap being placed through tissue contemporaneously with advancement of the awl through the tissue. The awl is used in a manner similar to a trochar or awl would be used to form a path around the patient&#39;s jaw for securement of dentures or a dental block as described above. Once the circum-mandibular cable has been placed around the patient&#39;s jaw as described, the cable is disconnected from the awl by simply disengaging the pin on the strap from the retention member. BRIEF DESCRIPTION OF DRAWINGS [0026] FIG. 1A is a perspective view of an embodiment of an intermaxillary fixation accessory. [0027] FIG. 1B is an exploded perspective view of an embodiment of the Intermaxillary fixation accessory of FIG. 1A. [0028] FIG. 1C is a perspective view of an embodiment of a pair of opposed intermaxillary fixation accessories. [0029] FIG. 2A is a perspective view of an embodiment of a bone screw for intermaxillary fixation with a ratchet head. [0030] FIG. 2B is a top perspective view of the embodiment of the bone screw of FIG. 2A. [0031] FIG. 2C is a side perspective view of the embodiment of the bone screw of FIG. 2A. [0032] FIG. 2D is a partial exploded view of an embodiment of the bone screw and ratchet head of FIG. 2A. [0033] FIG. 3A is a perspective view of an embodiment of an upper dental block for intermaxillary fixation. [0034] FIG. 3B is a perspective view of an embodiment of a lower dental block for intermaxillary fixation. [0035] FIG. 3C is a perspective view of an embodiment of upper and lower dental blocks for intermaxillary fixation. [0036] FIG. 3D is another perspective view of an embodiment of the upper and lower dental blocks for intermaxillary fixation. [0037] FIG. 3E is a perspective view of an embodiment of a ratchet head with clip component. [0038] FIG. 3F is a bottom perspective view of an embodiment upper dental block shown in FIG. 3A. [0039] FIG. 3G is a bottom perspective view of an embodiment of the lower dental block shown in FIG. 3B. [0040] FIG. 3H is a perspective view of an embodiment of a dental block. [0041] FIG. 3I is a perspective view of the embodiment of a dental block of FIG. 3H. [0042] FIG. 4 is a partial perspective view of an embodiment of a circum-mandibular strap with ratchet head and serrations and a blade for piercing tissue in certain procedures for intermaxillary fixation. [0043] FIG. 5A is a perspective view of an embodiment of a tool for piercing tissue and inserting a circum-mandibular strap. [0044] FIG. 5B is a perspective view of an embodiment of the tool of FIG. 5A and a modified circum-mandibular strap attached to the tool. [0045] FIG. 5C is a detailed perspective view of a portion of the embodiment of the tool and strap shown in FIG. 5B. [0046] FIG. 6A is a top perspective view of an additional embodiment of a dental block. [0047] FIG. 6B is a bottom perspective view of an additional embodiment of a dental block. DETAILED DESCRIPTION OF THE INVENTION [0048] Referring now generally to the drawings, the instant invention relates to devices to improve intermaxillary fixation for patients who do not have all, or any, of their teeth. The inventive devices and methods disclosed herein may be utilized separately or in conjunction with arch bar fixation devices described in the Shah patent to provide intermaxillary fixation for patients missing some or all of their teeth. [0049] In various embodiments of the devices disclosed herein, various ratchet components and straps with ratchet teeth are described. In the depicted embodiments, the straps are provided on one surface with a gear rack section provided with a plurality of ratchet teeth or serrations. A first or male end of the strap may have a narrowing or pointed end or a blunt end. The strap itself may be a flat tape, have a circular cross-section, or other similar shapes. The strap is preferably formed from a flexible but strong material. In some embodiments, a second end of the strap is provided with a ratchet head with a port through the head. Inside the port, a pawl is provided to engage ratchet teeth disposed on the strap. When the first end of the strap is inserted through the port in the ratchet head, the ratchet teeth engage the pawl to allow the strap to be pulled through the port but not to be retracted from the port. [0050] For clarity, the second end with the ratchet head, sometimes referred to as the female end, of a zip tie or strap may be referred to herein as an interarch receptacle and the first or male end may be referred to as a flexible strap provided with ratchet serrations or teeth. It should be understood that the interarch receptacle includes a port and a flexible retention member, or pawl, as is commonly found with the ratchet head, or female end, of a cable or zip tie. [0051] Some embodiments of the flexible straps are attached at one end to an inventive washer described in relation to the figures. Some embodiments of the flexible straps have two male ends, each with a section of ratchet teeth oriented in opposing directions, which may be referred to as a double-ended flexible strap. Each end of the double-ended flexible strap may be inserted into opposing interarch receptacles or ratchet heads to fix the patient&#39;s jaws together, as is described in more detail in relation to the figures. The various embodiments of the flexible straps are inserted through the port on the ratchet head, thereby engaging the ratchet teeth on the flexible strap with the pawl and allowing insertion of the flexible strap but not its removal from the port. In some embodiments the flexible straps are flexible along their length in one or both axes perpendicular to the longitudinal axis of the strap, so that they may be bent, curved or twisted in simple or compound curves as necessary. In some embodiments the flexible straps have limited extensibility or compressibility parallel to their longitudinal axis. [0052] As best shown in FIGS. 1A and 1B, a first embodiment of an intermaxillary fixation accessory is a unique hanger assembly 100 that provides an interarch receptacle or ratchet head 102 for connecting to a bone screw 104 to be fastened into a patient&#39;s jaw bone. The screw 104 includes a threaded shaft 105 and a driving head 107 at one end of the threaded shaft 105. A receptacle hanger 101 comprises an interarch receptacle or ratchet head 102 and a washer 106 attached to ratchet head 102 by spacer bar 108. In some embodiments the washer 106 is elongated or slotted and is provided with a hole 109. When in use the shaft 105 of bone screw 104 is disposed through the hole 109 in washer 106 and washer 106 is disposed adjacent to head 107 of bone screw 104. The spacer bar 108 separates the ratchet head 102 a predetermined distance from the washer 106. The port of the ratchet head 102 is disposed substantially perpendicular to the washer so that a flexible strap secured in the ratchet head extends substantially perpendicular to a bone screw inserted through the hole in the washer. [0053] When installed in a patient&#39;s mouth, the bone screw 104 is fastened into the jaw bone of the patient in a location where one or more teeth are missing. The installed hanger assembly 100 disposes the ratchet head 102 adjacent to the areas of missing teeth so that an interarch receptacle on an arch bar may be secured to the ratchet head 102 and thus to the jaw. In some embodiments, bone screw 104 may be provided with a bearing area 103 disposed on the shaft 105 of the bone screw 104 adjacent to the head 107. The bearing area provides a surface for contact with the washer 106 to allow the washer to rotate smoothly. The surface of bearing area 103 may be flat, concave, convex or textured as desired. [0054] As shown in the previously referenced Shah patent, interarch receptacles are positioned along the arch bar for the receipt and retention of a flexible strap or the male end of a zip tie. In use, the inventive receptacle hanger 101 is positioned on the patient&#39;s jaw opposite an interarch receptacle, or zip tie receptacle, mounted on the arch bar or ratchet head attached to another bone screw 104 on the opposing jaw of the patient. [0055] For example, if the patient presented with no teeth on the left upper jaw but has teeth on the lower left jaw, an arch bar may be fastened to the lower teeth. A bone screw 104 could be mounted in to the upper left jaw bone of the patient opposite the interarch receptacles presented on the arch bar fastened to the left lower teeth. In some embodiments the washer 106 of the receptacle hanger 101 may be placed over the threaded shaft 105 on the screw 104 and simultaneously mounted with the bone screw 104. In other embodiments the slotted or wide portion of the washer 106 may be slipped over the driving head 107 of the bone screw 104 after it has been secured in the patient&#39;s jaw bone. The interarch receptacle 102 is generally oriented so that a zip tie or flexible strap having reversed teeth at opposite ends can be inserted in to both the interarch receptacle and the opposed ratchet head 102 so that when the patient&#39;s jaws are closed together the zip tie or flexible strap holds the opposing arch bar receptacle and ratchet head 102 and associated arch bar (on the lower teeth) in place. [0056] In situations where multiple teeth are missing from both the upper and lower jaw of the patient, it may be necessary to use multiple bone screws 104 and receptacle hangers 101 on both the upper and lower jaw to present enough ratchet heads so that the jaws are maintained in the preferred rigid closed position by the flexible straps. [0057] Referring now to FIG. 1C, in some embodiments of the invention a flexible strap 110 with integral washer 112 is utilized. The innovative washer 112 is similar in shape and configuration to embodiments of washer 106, and is attached to or integrally formed as part of a first end 111 of flexible strap 110. The flexible strap 110 is provided with ratchet serrations 113 on at least one surface thereof for engaging the ratchet head 102. When the bone screws 104 are disposed in opposing jaw bones of a patient, washers 112 and 106 may be engaged on the bone screws 104 as described in relation to FIG. 1. The second end 114 of flexible strap 110 is inserted in the opposite ratchet head 102 and pulled until the jaws are in a closed position to hold the patient&#39;s jaws together. A physician may alternate using a bone screw with either a washer 112 or a receptacle hanger 101 as appropriate in the circumstances. [0058] Referring now to FIGS. 2A-2D, in another embodiment of an intermaxillary fixation accessory, a zip tie compatible or flexible strap compatible bone screw 200 is utilized for intermaxillary fixation. The bone screw 200 includes an elongated driving head 202 for engagement with a driving tool and a threaded shaft 204. The elongated driving head 202 extends upwardly from the shaft 204 of the bone screw, and the depicted embodiment of the head 202 is generally cylindrical but may also have a hexagonal or other shaped cross-section. In the depicted embodiment the top surface 203 of the driving head 202 is provided with structures for engaging a driving tool such as a square or phillips screw driver, while in other embodiments the shape of driving head 202 may be capable of engagement by a tool such as a wrench. Within the elongated driving head 202 a ratchet head is provided for receiving a flexible strap. The ratchet head may be integrally formed as part of the elongated driving head 202, or it may be removable as depicted in FIGS. 2A-2D. [0059] In some embodiments, the driving head 202 includes a cavity 206 for receiving a removable ratchet head 208. The cavity 206 is an opening laterally through the elongated driving head 202 of the bone screw 200 in to which a ratchet head 208 may be inserted. The ratchet head 208 may be frictionally retained, adhered or otherwise secured in cavity 206. The cavity 206 may include a small ledge or other retention member along one edge 211 of the cavity 206 to further engage and retain the ratchet head 208 in place. In some embodiments, the ratchet head 208 may be formed with at least one lip or protrusion 210 that engages the driving head 202 adjacent the cavity 206 to prevent the ratchet head 208 from passing through the cavity 206. In some embodiments, ratchet head 208 may also be provided with slots or flanges 212 to engage the edge 211 of cavity 206 to engage and retain the ratchet head 208 in cavity 206. [0060] The bone screw 200 is installed by driving the threaded shaft 204 into the bone of the patient. The openings of the cavity 206 are preferably oriented in a vertical position with respect to the jawline of the patient. When the screw 200 is installed in the jaw of a patient, the ratchet head 208 is disposed in cavity 206 with protrusion 210 disposed generally on the side of driving head 202 away from the opposite jaw. A flexible strap such as 110 is then installed into the ratchet head 208 by passing one end of the flexible strap through the ratchet head 208. When the other end of the flexible strap is attached to another interarch receptacle, ratchet head, or bone screw and tightened to hold the jaws of the patient together, the flexible strap will pull interarch receptacle 208 into cavity 206 maintaining protrusion 210 securely against the edge of cavity 206. The protrusion 210 engages a portion of the driving head 202 adjacent to the cavity 206 such as edges 211 and prevents the ratchet head 208 from passing through the cavity 206. Where opposing screws are presented in both the upper and lower jaw, a reversing zip tie or double-ended flexible strap, where the teeth on one end of the flexible strap are reversed from the teeth on the other end, is provided. The teeth disposed in opposite directions allow each end of the double-ended flexible strap to be inserted into opposing interarch receptacles or ratchet heads for securing the opposite jaws together. This double-ended flexible strap is positioned within and manipulated through the ratchet head 208 and secured by the ratchet inside the ratchet head 208 engaging the teeth on the flexible strap. As the reversing zip tie or double-ended flexible strap is pulled through the ratchet head 208 and through the opposed interarch receptacle or ratchet head, the patient&#39;s jaws are forced together and secured in a closed position. [0061] In those instances when a patient presents with no teeth whatsoever on one or both jaws, and dentures are not provided or are otherwise not available, a different problem must be overcome. It is not desirable for bone healing to fix the patient&#39;s upper and lower jaws together when there are no teeth or dentures present. Doing so results in improper jaw bone alignment during the healing process and may make subsequent use of dental implants or dentures difficult, if not impossible. To overcome this problem, an inventive set of dental blocks (sometimes referred to as dental splints) 300 has been designed and developed, an embodiment of which is depicted in FIGS. 3A-3D. [0062] An upper dental block 302, shown in FIGS. 3A and 3F, is suitable for replacement of the upper teeth and a lower dental block 304, shown in FIGS. 3B and 3G, is designed for replacement of the lower teeth. The blocks 302 and 304 may be comprised of substantially rigid portion or plate 306 designed to take the place of the patient&#39;s teeth and a soft, formable, malleable, or flexible or compressible portion 308 (shown in FIGS. 3C and 3D ) that engages the patient&#39;s gum when the blocks 302 and 304 are in place. The general shape of the blocks 302 and 304 are semi-arcuate when viewed from above. In some embodiments they comprise a substantially semi-circular front portion with substantially linear wings extending substantially tangentially to the circumference of the semi-circular portion. In some embodiments the plate 306 is substantially flat and extends perpendicularly to the outside plate 301. In some embodiments an inside plate 317 is provided adjacent to the inside edge of plate 306 and substantially perpendicular to the plate 306. The inside plate 317 and outside plate 301 generally run around the inner and outer periphery, respectively, of the patient&#39;s gums. [0063] Blocks 302 and 304 may be provided in various sizes to fit different patient&#39;s bites. When in place, the dental blocks 302 and 304 hold the upper and lower jaws apart a sufficient distance such that when the jaw bones heal, suitable space has been provided between the jaw bones for proper placement of dental implants or dentures. If a patient has teeth on one jaw but not on the other, only one of blocks 302 and 304 may be necessary. [0064] In some embodiments, each dental block 302 and 304 is provided with multiple receptacles or ratchet heads for receiving the male end of a zip tie or a flexible strap. In some embodiments, the ratchet heads or receptacles may be fixedly or pivotally attached directly to the blocks 302 and 304 at various locations around the outside plate 301 of each block 302 and 304. In the embodiment shown in FIGS. 3A-3D, an attachment rail 303 is provided on each dental block 302 and 304. The rail 303 extends around the outside plate 301 of the dental blocks 302 and 304. In the depicted embodiment, the rail 303 is supported slightly separated from the outside plate 301 by a plurality of posts 305. In other embodiments the rail 303 may be continuously connected to outside plate 301 or may be formed on or attached to discrete segments of outside plate 301. Rail 303 has a generally rectangular cross-section, but may be provided with beveled or rounded edges as depicted in the figures, or may be circular in cross-section. [0065] Rail 303 provides a means of attaching a plurality of ratchet heads or receptacles 310 to the rail for attaching the dental blocks 302 and 304 to a patient&#39;s jaws and to the other dental block. In the depicted embodiment, bores, holes or indentations 307 are provided at numerous locations along the length of rail 303. If indentations that do not extend completely through rail 303 are provided at locations 307, a corresponding indentation may be provided on the inside surface of rail 303 facing the outside plate 301. In some embodiments holes 307 will extend completely through rail 303. In some embodiments, receptacles 310 may be provided with screws or locking pins for inserting into holes 307. In other embodiments, such as that shown in FIGS. 3C and 3D, receptacles or ratchet heads 310 may be provided with clip elements that clip over the rail 303 and engage the holes 307 from one or both sides with protrusions on the clip. The rail 303 with a plurality of receptacle mounting locations 307 allows for the positioning of the receptacles to be configured based on the circumstances and condition of the patient&#39;s teeth, gums and jaws. [0066] The upper edge 309 of the outside plate 301 of lower dental block 304 may be provided with various undulations, lower portions, higher portions, raised portions, or indentations along the length of the outside plate 301. Similar undulations, raised portions or indentations may be provided on lower edge 311 of upper dental block 302. The varying shape of the upper edge 309 and lower edge 311 may be designed to interact with the patient&#39;s teeth and the other dental block to create and maintain space for the patient&#39;s tongue and passageways between the dental blocks for airways, tubes, circum-mandibular straps, and other medical devices when the two blocks are in contact at the outside plates. [0067] Referring now to FIG. 3C, an embodiment of the upper dental block 302 and the lower dental block 304 are depicted. A plurality of clip on receptacles or ratchet heads 310 have been attached to the rail 303 and a double-ended flexible strap 313 inserted into two opposing receptacles to prevent separation of the dental blocks 302 and 304. Other double-ended flexible straps 313 would also be inserted at other locations with receptacles 310. As can be seen in this figure, the clip on receptacles 310 are clipped on to the rail with the clip disposed away from the direction of force on the flexible strap that will be inserted into the receptacle. This orients the ratchet within the receptacle 310 in the necessary direction to engage the teeth on the flexible strap. [0068] The dental blocks 302 and 304 are held in place using methods described herein for securing dentures in place, some of which are depicted in FIG. 3D. The upper dental block may include screw holes 312 for fastening the block in place with screws placed in the patient&#39;s palate. The holes 312 may be in an extension of plate 306 or an additional plate 318 attached to the inside wall 317 of the upper dental block 302. [0069] Unique circum-mandibular straps 314 may be used to secure the lower dental block 304 in place. The circum-mandibular straps 314 are placed by methods similar to known methods of wiring lower dentures in place for intermaxillary fixation procedures. For securing the lower dental block 304 with circum-mandibular straps 314, as best shown in FIG. 3D, a hole is generally made between the patient&#39;s gum and cheek tissue oriented downward and passing along the patient&#39;s jaw, exiting under their chin. A second hole is then bored upwardly through the floor of the patient&#39;s mouth adjacent the inner periphery of the gum. This bore is generally made with a pointed or sharp instrument such as an awl or trochar. The lower dental block 304 is then placed over the patient&#39;s lower gums so that the gums engage and support the soft insert 308. Although not shown in FIG. 3C, a soft insert 308 is also provided on the lower surface of dental block 304 for contacting the lower gums of the patient. The circum-mandibular straps 314 are inserted through the hole between the patient&#39;s cheek and gum downward below the patient&#39;s chin and then back up through the bore that is interior the patient&#39;s gums. The circum-mandibular straps 314 are passed over the dental block 304 so that the dental block is pulled downward on to the patient&#39;s gum and retained rigidly in place. The male end of the circum-mandibular strap is then inserted into the ratchet head disposed on the other end thereof, and secured by the pawl and ratchet teeth on the strap. This procedure generally requires at least two circum-mandibular straps 314, one on either side of the patient&#39;s mouth. As previously described, the dental blocks may be provided with grooves on edges 309 and 311 into which the circum-mandibular straps 314 are seated to prevent unwanted shifting, sliding or other movement of the circum-mandibular straps 314 along the dental blocks once they have been placed. [0070] Two perspective views of a similar embodiment of the dental block 302 is depicted in FIGS. 3H and 3I. Similar numbers identify similar components of the depicted dental block. The embodiment depicted in FIGS. 3H and 3I may be used on either jaw and two of the depicted dental blocks may be used simultaneously on both jaws. [0071] Referring now to FIG. 3D, in some embodiments a ratchet head or receptacle 310 is attached to one of the dental blocks 302 and 304 and may be secured to the jaw by a double-ended flexible strap 313 connected to a bone screw 104 and receptacle hanger 101 or a flexible strap compatible bone screw 200, with the bone screw 104 or 200 fixed in the patient&#39;s jaw. In some embodiments, the patient&#39;s jaws may be secured to one another using a bone screw 104 and receptacle hanger 101 fixed in one jaw, and bone screw 104 fixed in the other jaw, with a flexible strap 110 with integral washer 112 secured on the bone screw 104 and inserted into the receptacle hanger 101 attached to the opposing jaw. [0072] Once the dental blocks are fixed in place, reverse zip ties or double-ended flexible straps 313 can be used in the receptacles 310 on the opposing dental blocks or opposing teeth to fasten the upper and lower jaws together. The edge 311 of upper block 302 may include an upper arcuate opening 315 and the lower block 304 may include a substantially similar, but opposing lower arcuate opening 316 so that when the dental blocks are in place, an annular opening is formed for access to the patient&#39;s mouth for cleaning, suction and the like, or in some instances, the placement of a breathing tube. [0073] Referring now to FIG. 3E, an embodiment of a ratchet head 310 for use with a rail 303 is depicted. The ratchet head includes ratchet body 319 which contains the opening and pawl for receiving and retaining a flexible strap. A clip portion or member 320 extends from the side of the ratchet body 319 and fits around rail 303 so that it may be clipped on to the rail 303 at the desired location. The clip portion 320 contains two protrusions 321 that engage the holes 307 on rail 303 to secure the ratchet head 310 in place on the rail 303. The protrusions 321 may be sloped (as shown in the figures) or otherwise shaped to allow them to be clipped onto the rail but to resist removal of the clip portion 320 from the rail 303. [0074] One of the inventive intermaxillary fixation accessories that can be used to place circum-mandibular straps 314 is an improved zip tie assembly or strap, one embodiment of which is shown in FIG. 4. The zip tie or circum-mandibular strap 400 has a dissection tip 402 at the terminus of a first or male end 401 of the strap 400. This dissection tip 402 may be conical or blade-shaped and sharp enough to allow the first end of the strap 400 to be pushed through the tissues surrounding a patient&#39;s jaws. In some embodiments the tip 402 is preferably integral to the strap 400 and formed from plastic that can be provided with a sharp edge, if needed, to facilitate advancement of tip 402 through tissue. In some embodiments the tip 402 may be separate from and attached to the male end of strap 400. In some embodiments, the dissection tip 402 may be made of metal and molded onto the plastic of the zip tie. A sharp blade may take the place of the dissection tip 402 for some applications. [0075] In some embodiments, the male end 401 of strap 400 may have one or more sections 404 with a thinner profile or smaller cross-section than other portions of the strap 400 to ease insertion of the strap 400 through the patient&#39;s tissue. Between the sections 404 of the strap 400, some embodiments incorporate sloping sections 406 gradually narrowing the thickness or cross-section of strap 400 as it approaches the dissection tip 402. [0076] Strap 400 is provided on one surface with a gear rack section 408 provided with a plurality of ratchet teeth 410. The second end of strap 400 is provided with ratchet head 412 with a port 414 through the head 412. Inside the port 414 a pawl 416 is provided to engage ratchet teeth 410. In some embodiments, the other ratchet heads described herein contain similar elements. As with the other straps used in the depicted embodiments of the invention, when the first end 401 of strap 400 is inserted through the port 414 in the ratchet head 412, the ratchet teeth 410 engage pawl 416 to allow the strap to be pulled through port 414 but not to be retracted from the port 414. [0077] In practice, the dissection tip 402 of the strap 400 is used like an awl or trochar for wire placement. The strap 400 may be pushed through the tissue adjacent the gum and then passed below the patient&#39;s chin, creating a small loop and then back up through the tissue so the strap 400 encircles the jaw and any associated dentures or dental block. As the strap 400 is pushed through the tissue, dissection tip 402 cuts the tissue sufficiently to allow the strap 400 through the tissue. [0078] Another inventive tool, as shown in FIGS. 5A, 5 B, and 5 C, is a unique tool 500 that is provided with a handle 502, a shaft 504 and a unique retention member 506 at or substantially near the blade or dissection tip 508 of the tool 500. In one embodiment, the retention member 506 is configured to engage and retain a knob or pin 512 provided near the first end of an embodiment of circum-mandibular strap 510. In the depicted embodiment, the retention member 506 is provided with a retention slot 514 formed at or near the blade 508. The blade 508 may be wider than the flexible strap in some embodiments. Further, the retention member 506 may include a nodule or detent 516 within the slot 514 to further engage and retain the knob 512 of the circum-mandibular strap 510. The tool 500 is used in a manner similar to a trochar or awl to form holes in the patient&#39;s jaw or adjacent tissues for placing straps as described above to secure dentures or a dental block. As the blade end 508 advances through tissue, it pulls the first end of the circum-mandibular strap 510 through the tissue so that it is placed simultaneously as the tool 500 is advanced. Once the circum-mandibular strap 510 has been placed through the patient&#39;s jaw as described above, the knob 512 is disengaged from the slot 514 on the retention member 506. Tool 500 may then be retracted back through the hole in the patient&#39;s jaw, leaving the strap 510 in place. The knob 512 or the end of strap 510 where knob 512 is attached, may be cut off the strap 510 so that the remainder of the strap 510 may be inserted into and secured by ratchet head 412. [0079] Referring now to FIGS. 6A and 6B, an additional embodiment of a dental block is depicted. This embodiment is a single piece dental block that may be used with patients that have no teeth on either upper or lower jaws. The dental block 600 is provided with a rigid plate 602 shaped in the approximate shape of the human jaw for receiving the gums of a patient. Cushions 604 and 606 are provided on the top and bottom of the block 602 to cushion the gums of the patient. An outer plate 608 is attached to the rigid block 602. A rail 610 is attached to the outer surface of plate 608. In some embodiments, the rail 610 may be integrally formed with the plate 608 or may be separated from plate 608 by a gap and supported by posts 612. Rail 610 is provided with holes or indentations 614 similar to holes 307 described in relation to an earlier figure. In some embodiments, the plate 602 may comprise two slightly separated upper and lower plates attached to the outside plate 608. In some embodiments, plates 602 may have inner plates 618 and 620 attached to the inner edge thereof. [0080] The general shape of the block 600 is semi-arcuate when viewed from above. In some embodiments the block comprises a substantially semi-circular front portion with substantially linear wings extending substantially tangentially to the circumference of the semi-circular portion. In some embodiments the plate 602 is substantially flat and extends perpendicularly to the outside plate 608. In some embodiments the inside plates 618 and 620 are provided adjacent to the inside edge of plate 602 and substantially perpendicular to the plate 602. The inside plates 618 and 620 and outside plate 608 generally run around the inner and outer periphery, respectively, of the patient&#39;s gums. [0081] In some embodiments, a port 616 may be provided through the dental block 602. The port 616 may be used to suction the patient&#39;s mouth, insert tubes for air, nutrition or other needs, or other similar purposes. [0082] As shown in FIGS. 3C and 3D, ratchet heads 310 may be attached to rail 610 and used to attach the dental block to the upper and lower jaws of a patient using the various bone screws and other accessories described herein. [0083] Many different arrangements of the various components depicted, as well as components not shown, are possible without departing from the spirit and scope of the present invention. Embodiments of the present invention have been described with the intent to be illustrative rather than restrictive. Alternative embodiments will become apparent to those skilled in the art that do not depart from its scope. A skilled artisan may develop alternative means of implementing the aforementioned improvements without departing from the scope of the present invention. [0084] It will be understood that certain features and subcombinations are of utility and may be employed without reference to other features and subcombinations and are contemplated within the scope of the claims. Not all steps listed in the various figures need be carried out in the specific order described.

Summary: Novel tools, accessories and methods for fixing a patient&#39;s upper and lower jaws together with flexible straps are disclosed. The tools are intended to either allow placement of a flexible strap to bind items to the teeth, or for using a flexible strap to fasten the upper and lower jaw into place, among other purposes. These accessories include a washer with a ratchet head for mounting on a bone screw, a bone screw with integrated ratchet head, dental blocks for use with the bone screws and washers, a flexible strap provided with a dissection tip for forcing the strap through tissue, and combinations thereof, and tools for inserting flexible straps through the gums, among other tools and accessories.

big_patent

en

Summarize: CDC Director Dr. Thomas Frieden began his grilling Thursday on Capitol Hill with a stark admission that his agency is still searching for ways to combat the Ebola virus as it burrows into the United States. 'We're always open to ideas for what we can do to keep Americans safe,' Frieden said in his opening statement, in a startling departure from his prepared remarks in the face of a hostile and impatient panel in a House Energy and Commerce subcommittee. 'We would consider any options to better protect Americans,' he said later during the hearing's Q&A period. Frieden's statements will not inspire already-shattered public confidence. The first Ebola patient identified on U.S. soil, Thomas Eric Duncan, was misdiagnosed. Two nurses caring for him have since contracted the body-destroying hemorrhagic fever – one of whom got on a flight with the CDC's blessing a day before she was hospitalized. SCROLL DOWN FOR VIDEO. Taking on fire: CDC chief Thomas Frieden (center) has come to represent an agency labeled incompetent on Capitol Hill as Ebola takes hold and spreads. Circus: A Capitol Hill hearing room was overrun by photographers and reporters on Thursday as the CDC's top man faced questions. An uncomfortable Frieden parried with members of Congress for more than two hours, projecting little confidence and insisting at every turn that he was open to new ideas. The excruciating hearing came as three members of Congress and a sitting governor are calling for Frieden's resignation and the White House began the torturous process of throwing him under the disease-control bus on Thursday afternoon, saying that Frieden is 'taking responsibility' for his agency's screw-ups. White House Press Secretary Josh Earnest told reporters that the CDC director was responsible – implying that President Barack Obama is not. 'You have seen, at least in a couple instances, Dr. Frieden taking responsibility' for the CDC's widely panned response, he said. That plan included stepped-up Ebola screenings at five major U.S. airports – announced a week ago but only put in place on Thursday. Airports in New York, New Jersey, Atlanta, Chicago and Washington, D.C. are affected. Frieden was on the hottest seat in the hearing room after his agency's officials told one of the infected nurses that she could travel Monday on a commercial airplane – even though she treated the first patient and worked alongside the other nurse, who had already tested positive. The woman, Amber Vinson, traveled to Ohio to help with plans for her wedding and returned to Dallas on a Frontier Airlines plane. The news that she had spent time in Cleveland, and that three of her relatives work at Kent State University, sent the region into panic mode. Schools and hospitals are on lock-down across Cuyahoga and surrounding counties. And one store visited by her friends has been closed until it can be assessed. 'My understanding is that she did contact the CDC,' Frieden conceded Thursday, responding to questions from the House panel while saying he did not participate in the call. 'I have not seen the transcript of the conversation,' he added, casting blame on Vinson. 'My understanding is that she reported no symptoms to us.' It has been reported that she told the CDC she had a slightly raised temperature of 99.5F - but the CDC only classes anything above 100.4F as a fever. Frieden confessed the CDC is still not sure how Vinson and her co-worker, Nina Pham, contracted the Ebola virus. 'While we do not yet know exactly how these transmissions occurred,' he said, 'they demonstrate the need to strengthen the procedures for infection-control protocols which allowed for exposure to the virus.' 'She reported no symptoms to us': Frieden shifted blame for his agency's approval of an Ebola-exposed nurse to fly on a commercial jet. White House Press Secretary Josh Earnest said Frieden is 'taking responsibility' for the flawed Ebola containment plan, suggesting that the Office of the President will be insulated from the backlash. Nurses Nina Pham (left) and Amber Vinson (right) cared for Thomas Duncan, whose case of Ebola was the first diagnosed in the US. They have both subsequently landed in isolation themselves with the viral infection. 'Protocol' problems: Dallas nurse Briana Aguirre told the TODAY show that she and other health care workers who came into contact with patient Thomas Duncan wore hazmat suits with large gaps near the neck. Dr. Daniel Varga, the chief clinical officer at Texas Presbyterian Hospital, also testified that his staff hadn't yet cracked the mystery. 'That's correct,' he said. Pham will be transferred soon from Dallas to a National Institutes of Health facility's special isolation unit in Washington, D.C. The nurses episode, along with the Obama administration's insistence that air travel must continue between the U.S. and the three hardest-hit African countries – Liberia, Sierra Leone and Guinea – had Republican lawmakers hopping mad. 'People are scared. We need all hands on deck. We need a strategy,' barked Michigan Rep. Fred Upton, who chairs the full Energy and Commerce Committee. 'We need to protect the American people, first and foremost.' 'This is not a drill,' he said, 'a fact that the doctors and nurses working on the front lines understand. People’s lives are at stake, and the response so far has been unacceptable.' Pennsylvania Rep. Tim Murphy, who helms the Oversight and Investigations Subcommittee, said the stakes 'couldn't be any higher.' 'The number of Ebola cases in West Africa is doubling about every three weeks. The math still favors the virus, even with the recent surge in global response,' he added. 'With no vaccine or cure, we are facing down a disease for which there is no room for error. We cannot afford to look back at this point in history and say we could have done more.' Dr. Anthony Fauci, who leads the National Institute of Allergy and Infectious Diseases, provided little reason for enthusiasm. 'We are still in the early stages of understanding how infection with the Ebola virus can be treated and prevented,' Fauci admitted in a written statement. 'People are scared. We need all hands on deck,' said Rep. Fred Upton, a Michigan Republican. 'This is not a drill' Horror: 9,000 west Africans have been diagnosed with Ebola and health authorities expect it to ultimately kill 70 per cent of those it infects. Arizona Congressman Paul Gosar demanded Frieden's resignation Thursday afternoon. 'CDC Director Thomas Frieden has failed to lead and has shown gross incompetence in his actions or lack thereof to prevent the spread of Ebola domestically,' Gosar said in a statement. 'We cannot afford such mistakes when American lives are at risk. That is why I am calling for the immediate resignation of Director Friedan (sic).' He joined fellow Republican Rep. Tom Marino of Pennsylvania, who said late Wednesday that the 'false sense of security' the CDC has offered 'is exactly the opposite of the CDC director’s primary responsibilities – to communicate clearly and honestly.' 'I have no ill will towards him personally but he should resign his position effective immediately,' Marino said. After Thursday's hearing, South Dakota Sen. John Thune and Florida Gov. Rick Scott both called on Frieden to get the axe. Their comments came during conservative radio host Laura Ingraham's Thursday broadcast. As of October 12 the World Health Organization reported 8,997 confirmed Ebola cases in Africa and 4,493 documented deaths. So far the U.S. has seen only three confirmed cases, one of which claimed the patient's life.That man, Thomas Duncan, was a Liberian national who traveled to Dallas in September. A clinician at Texas Presbyterian Hospital failed to note that he had come from an Ebola-stricken country, and he was sent home with antibiotics to treat his fever. Days later he returned and was placed in isolation until his death on Oct. 8. SHOCK: Dr. Daniel Varga (on video monitor), chief clinical officer of Texas Health Resources, said Thursday that Texas Presbyterian Hospital staff had no targeted Ebola containment training. Angry Americans responded Thursday to Frieden's casual statement that the CDC is still looking for suggestions about how to tackle the Ebola crisis. 'All hands on deck': President Barack Obama said Wednesday after a two-hour cabinet meeting that the US government is fully engaged to battle the infection and stop it from spreading widely. Varga, the hospital administrator, admitted on Wednesday that his organization erred in turning Duncan away at first. 'Unfortunately, in our initial treatment of Mr. Duncan, despite our best intentions and a highly skilled medical team, we made mistakes,' he told Congress. 'We did not correctly diagnose his symptoms as those of Ebola. We are deeply sorry.' Varga testified Thursday via video link. After acknowledging that he had distributed the CDC's Ebola protocol to the hospital's department in the early days of Ebola's African resurgence, he stunned the hearing room by admitting that his staff had no specialized training to prepare. Briana Aguirre, a Dallas nurse who helped treat Duncan, told NBC's Today show on Thursday that the CDC's Ebola protocols didn't help her and her coworkers cover up adequately in the hospital. Her and others' hazmat suits, she said, had large gaps between the bodysuit and the headpiece, exposing several inches of their necks. 'We never talked about Ebola,' she said. 'We were never told what to look for.' The hospital had hosted an optional seminar on Ebola, but there was no hands-on training included. When she realized her zipped-up hazmat suit didn't fully protect her, Aguirre said, 'I threw a fit. I just couldn't believe it, in the second week of an Ebola crisis at my hospital, the only gear they were offering us allowed our necks to be uncovered.'

Summary: Congressmen in hearing were hopping mad at CDC screwups and White House promises. Obama spokesman cast blame at CDC director Thomas Frieden's feet and says he's 'taking responsibility' Arizona and Pennsylvania congressmen want Frieden fired, along with South Dakota senator and Florida's governor. He testified along with National Institute of Allergy and Infectious Diseases chief Anthony Fauci. Officials in charge of Texas hospital that misdiagnosed Thomas Eric Duncan admitted his staff got no specialized Ebola training. White House said Frieden - not Obama - was 'taking responsibility'

cnn_dailymail

en

Write a title and summarize: There are many situations where relatives interact while at the same time there is genetic polymorphism in traits influencing survival and reproduction. Examples include cheater-cooperator polymorphism and polymorphic microbial pathogens. Environmental heterogeneity, favoring different traits in nearby habitats, with dispersal between them, is one general reason to expect polymorphism. Currently, there is no formal framework of social evolution that encompasses genetic polymorphism. We develop such a framework, thus integrating theories of social evolution into the evolutionary ecology of heterogeneous environments. We allow for adaptively maintained genetic polymorphism by applying the concept of genetic cues. We analyze a model of social evolution in a two-habitat situation with limited dispersal between habitats, in which the average relatedness at the time of helping and other benefits of helping can differ between habitats. An important result from the analysis is that alleles at a polymorphic locus play the role of genetic cues, in the sense that the presence of a cue allele contains statistical information for an organism about its current environment, including information about relatedness. We show that epistatic modifiers of the cue polymorphism can evolve to make optimal use of the information in the genetic cue, in analogy with a Bayesian decision maker. Another important result is that the genetic linkage between a cue locus and modifier loci influences the evolutionary interest of modifiers, with tighter linkage leading to greater divergence between social traits induced by different cue alleles, and this can be understood in terms of genetic conflict. Traditional theories of social evolution in structured populations use reproductive value to describe the fitness effects of variation in helping and harming traits [1–4]. They are applied to population structures such as the two sexes [1], juveniles and adults [3], dispersers and non-dispersers [5], and high- and low-quality individuals [4]. Individuals can, depending on their state, vary in their phenotype, which corresponds to a reaction norm [4], but genetic polymorphism in social traits is not explicitly included in the theory. Although it is recognized that frequency dependence is compatible with social evolution theory [6], questions of the emergence and maintenance of genetic polymorphism in social traits have not been given full attention. This absence is striking, as the possibility of such genetic polymorphism has attracted much interest. Examples of studies in the laboratory and the field span from work on cheater-cooperator polymorphisms [7–15] to investigations of genetic variation in microbial pathogens [16,17]. The possibility that population structure contributes to polymorphism also has support [18–22]. It is already well understood that a social trait, such as an individual’s investment in helping, can evolve to different equilibria depending on the relatedness in social groups in different habitats, with more helping in habitats where there is higher relatedness. We use the concept of genetic cues to extend this insight to situations where there is dispersal between habitats and where the social trait is influenced by several, linked or unlinked, genetic loci. The basic idea of genetic cues [23–26] is that alleles can function as statistical predictors of coming selective conditions for an individual. As a consequence of selection, allele frequencies can differ between local environments, such that possessing particular alleles correlates with local conditions in a manner analogous to environmental cues. Using this insight one can integrate genetic polymorphism into theories of conditional phenotype determination. If the environmental heterogeneity includes characteristics that are important for social evolution, like the size or composition of social groups, the heterogeneity could favor genetic polymorphism in social traits. If so, there will be a correlation between gene frequencies and social characteristics, and genes can act as cues of relatedness. To illustrate this general idea we develop a specific model with two habitats. We show that alleles at a cue locus can provide information about social circumstances, such as within-group relatedness and opportunities for cooperation, and that epistatic modifiers of the phenotypic effects of a genetic polymorphism can evolve to make use of this information. We also show that the evolutionary interests of epistatic modifiers can differ depending on their degree of linkage to a polymorphic locus, and we interpret this phenomenon in terms of genetic conflict. There are two habitats, each containing a large number of groups. They are formed and dissolved by colonization followed by social interaction and the production of offspring that disperse, and again colonization. A group in habitat i, where i = 1,2, is founded by Ni haploid individuals, randomly derived from a pool of dispersers in that habitat. To implement variation between habitats in average within-group relatedness, group members reproduce asexually following founding, forming Ni haploid offspring group members, such that each founding group member has an equal and independent chance of producing each of the Ni offspring (model details are given in S1 Text). A smaller Ni thus corresponds to higher relatedness. For a pair of group members, the probability of being identical by descent since founding is r i = 1 N i, (1) which follows [27] and [28]. The offspring group members engage in a social interaction, for instance a public goods game [29], and produce dispersing offspring in proportion to the payoff in the game. An individual’s phenotype z represents an investment (strategy) in the game, and we assume 0 ≤ z ≤ 1. The payoff to an individual with phenotype z in habitat i is a function w i (z, z ¯) of z and the average investment z ¯ of the individual’s group. As a convenient example we will use w i (z, z ¯) = W i + b i z ¯ - c i z 2, where the benefit b i z ¯ is proportional to the average investment and the cost ci z2 is assumed to increase quadratically with the individual’s investment. For polymorphic populations the group compositions will vary, and we are particularly interested in the expected payoff in habitat i to a randomly chosen rare mutant player of the game with phenotype z′, in a population where the resident phenotypes z1 and z2 occur with frequencies pi1 and pi2 (where pi1 + pi2 = 1). We write this as w ¯ i ′ = E [ w i (z ′, z ¯) | z 1, z 2, p i 1, p i 2 ]. (2) Because a new group is founded by random dispersers, those groups containing mutant strategies will predominantly be founded by one mutant and Ni − 1 resident types. Some basic aspects of the model are illustrated in Fig 1. To study the invasion of mutant traits, we need the derivative of the expected mutant payoff, which we write as d i k = ∂ w ¯ i ′ ∂ z ′ z ′ = z k = b i N i 1 + (N i - 1) r i - 2 c i z k, (3) for habitat i and phenotype zk, i = 1,2, k = 1,2. We study evolutionary change of a dimorphism z1, z2 by examining the invasion of mutant modifiers. Let x1 and x2 denote two alleles at the cue locus. In the resident population, the genetic cue xk induces the phenotype zk, and nik is the number of individuals in habitat i with phenotype zk at a population dynamical equilibrium. The epistatic effect of a mutant modifier is that xk instead induces the phenotype z k ′. Letting n i k ′ denote the (small) number of mutant modifiers in habitat i with phenotype z k ′ (i. e., linked to cue allele xk), we can write down a population projection matrix for the mutant invasion. The invasion fitness of the mutant modifier is F (z 1 ′, z 2 ′; z 1, z 2) = log λ, (4) where λ is the leading eigenvalue of the population projection matrix. Here we give an overview of the derivation of this matrix (details are given in S1 Text). For simplicity, we assume that individuals are haploid over most of the life cycle. However, to explore the consequences of recombination between cue and modifier loci, we introduce sexual reproduction by assuming there is a brief sexual phase in the dispersal pool in a habitat. This involves diploid individuals and crossing over, with a recombination rate ρ between cue and modifier loci, to produce the haploid individuals that found the groups as described above. Mating is random with respect to the dispersal pool and occurs before the forming of groups in the habitat. As a census point, we specify the population composition at a time after the sexual phase, when groups have formed and the public goods game is about to start. The sequence of events in the life cycle, starting right after the census point, is as follows: (i) public goods game with offspring production in proportion to payoff, (ii) within- and between-habitat migration of these offspring, forming a dispersal pool in each habitat, (iii) mating and recombination, and (iv) the next episode of group formation, including one asexual generation. By putting these events together, one can write down the matrix (see S1 Text). Using the population dynamics we can also determine the region of coexistence of two phenotypes z1 and z2 for different sets of parameters, by determining when each phenotype can invade a monomorphism of the other (the condition is given in equation (S16) in S1 Text). We compute a selection gradient from the invasion fitness Eq (4) using standard methodology of matrix population models [30]. Because we average over the group compositions Eq (2), our analysis is consistent with the structured population approach to adaptive dynamics [31], and it can also be seen as a direct fitness methodology for social evolution theory [1,3], also referred to as a personal fitness methodology [6]. In order to check our analytical results, and to illustrate the effects of genetic conflict between cue and modifier loci, we have run individual-based evolutionary simulations corresponding to our model assumptions. As a genotype-phenotype mapping in these simulations, we used a sigmoid function z = 1 1 + exp - a 0 - a g x (5) of a ‘liability’ a0 + agx, where x is the effect of an allele at the genetic cue locus, and a0 and ag are parameters that are genetically determined by modifier loci (details are given in S1 Text). To compute evolutionary equilibria numerically, we developed a C++ program that follows a path of small steps through z1 z2–space, each of which increase the invasion fitness Eq (4), until reaching an equilibrium. We used the Eigen C++ library [32] to compute eigenvalues. For the individual-based evolutionary simulations, we developed C++ programs that directly implemented the sequence of events in the life cycle, using pseudo-random numbers to handle stochastic events, such as recombination and mutation. In the simulations, we used a total populations size of 40 000 and time periods of 40 000 full life cycles or more. We use the methodology of adaptive dynamics and matrix population modeling [30,33] to compute the derivative of invasion fitness for a mutant modifier. The details of the derivation are given on pp. 8–10 of S1 Text, and here we focus on the interpretations in terms of information in a cue. The genetic cue provides information to an individual about its current habitat. The prior probability of being in habitat i is qi = ni/ (n1 + n2), where ni = ni1 + ni2 is the number of individuals in habitat i at a population dynamical equilibrium and nik is the number of individuals in habitat i with phenotype zk. For an allele at a modifier locus, the probability of being in habitat i, conditional on being linked to allele xk at the cue locus is q i k = p i k q i p 1 k q 1 + p 2 k q 2 = n i k n 1 k + n 2 k, (6) where pik = nik/ni. The selection gradient is the derivative of invasion fitness Eq (4) with respect to mutant traits, and can be written ∂ F ∂ z k ′ z k ′ = z k = V 1 k d 1 k p k q 1 k + V 2 k d 2 k p k q 2 k. (7) To interpret this expression, note that q1k and q2k are the respective probabilities of being in habitat 1 or 2, conditional on being linked to cue allele xk. The factor pk = (n1k + n2k) / (n1 + n2) is a ‘dilution factor’ that appears because the mutant z k ′ is only expressed in individuals with cue allele xk. The d1k and d2k are the derivatives of the expected payoff Eq (2) in habitats 1 and 2 with respect to the mutant trait, and are given in Eq (3). Finally Vik is the reproductive value of an offspring of a player in habitat i with cue allele xk. From the manner in which the conditional probability qik appears in the expression, we can conclude that the selection gradient describes changes in payoff to a ‘Bayesian decision maker at the modifier locus’. Eq (7) is an extension of the direct fitness approach of social evolution theory to situations with genetic polymorphism at the cue locus. Note that this selection gradient refers to the invasion of mutant modifiers, and not to the invasion of alleles at the cue locus, except for the special case of full linkage (ρ = 0), for which cue and modifier form a unit. Completing the life cycle, through migration, mating and recombination, and group formation, we can express Vik in terms of reproductive values vjl at our census point: V i k = v 11 ϕ 1 h 11 k m 1 i + v 21 ϕ 2 h 21 k m 2 i + v 12 ϕ 1 h 12 k m 1 i + v 22 ϕ 2 h 22 k m 2 i. (8) Here, mji is the rate of migration from habitat i to j. The ‘cue inheritance’ is described by h j l k = (1 - ρ) δ l k + ρ p j l, (9) so that with probability 1 − ρ the cue allele is passed to offspring and with probability ρ the offspring receives its cue allele through recombination with a random individual in the dispersal pool. Finally, ϕj is the probability for an individual in the dispersal pool in habitat j to become a founding group member. We must also examine whether or not polymorphism can be maintained at the cue locus. This needs to be investigated as a separate question, by determining when each of the phenotypes z1 and z2 can invade a monomorphism of the other. The condition for this is given in equation (S16) in S1 Text. Fig 2 shows how the migration rate m between habitats and the recombination rate ρ between cue and modifier loci influence dimorphic evolutionary equilibria, i. e. phenotypes where the selection gradient Eq (7) vanishes. The blue and red curves indicate phenotypes z1 and z2 suited to habitats with low and high relatedness. The selection gradient is illustrated in Fig 3 for a few values of m and ρ, and the shaded regions in this figure show where a polymorphism at the cue locus is maintained. In this example, the only difference between habitats is the number of founders of a social group, with N1 = 20 in habitat 1 and N2 = 2 in habitat 2, so it is appropriate to interpret the genetic cue as a cue of relatedness. As seen in Fig 2, there is an interaction between the migration rate and the recombination rate, such that for very low migration rate (m = 0. 01) the recombination rate has little influence on the equilibrium dimorphism, whereas for a higher migration rate (m = 0. 10) the difference between z1 and z2 varies considerably from tight linkage to free recombination. For even higher rates of between-habitat migration, genetic polymorphism is not maintained at the cue locus, regardless of the cue-modifier recombination rate ρ, and the outcome is instead a monomorphism. For the parameter values in Fig 2, this happens for m = 0. 15 or higher. The divergence between z1 and z2 depends on ρ, as in Figs 2 and 3, because modifier alleles with different linkage to cue alleles have different demographic futures, and thus different evolutionary interests. A fully linked mutant modifier will remain more concentrated in one of the habitats, which tends to favor specialization to that habitat, whereas an unlinked one will fairly quickly become evenly distributed over cue alleles and habitats, which tends to favor less specialized phenotypes. This difference in evolutionary interest between modifiers follows the logic of genetic conflicts [34], in the sense that the invasion of a loosely linked modifier, reducing the divergence between phenotypes, creates the context for the invasion of a more tightly linked modifier that reverses this effect. The outcome of genetic conflicts can depend on such things as the of the availability of mutations, the genetic architecture of a trait, and the strength of selection. For modifiers of polymorphic effects, genetic conflicts can have the further consequence of changing selection acting on the additive effects of alleles at a locus from stabilizing to disruptive, potentially giving rise to selectively maintained polymorphism at that locus. For instance, for the case of m = 0. 10 in Fig 2, unlinked modifiers favor a very small divergence between z1 and z2, but once this outcome has been achieved, the selection on alleles at other loci with additive effects on z becomes disruptive (just as originally for the cue locus itself). Genetic polymorphism might then be transferred from an original cue locus to a new locus. How this can happen is illustrated by the individual-based simulations in Fig 4. The genotype-phenotype mapping Eq (5) from the genetic cue x to the trait z has been changed from that in Fig 2, where the parameter a0 was fixed, to one where both parameters a0 and ag are genetically determined and can evolve. In Fig 4A, a0 and ag are each determined by a single locus, either fully linked or unlinked to each other and to the cue locus. When m is small or when ρ = 0, the outcome of the individual-based simulations remains in agreement with the predictions from the selection gradient Eq (7), but for m = 0. 10 and ρ = 0. 5, the outcome is instead the same as that for m = 0. 10 and ρ = 0 (Fig 4B). The reason is that, starting with polymorphism at the cue locus, ag evolved to become small, reducing the divergence between the phenotypes from Eq (5), which in turn gave rise to disruptive selection on a0, causing polymorphism to evolve at that locus, while the polymorphism at the original cue locus collapsed. The end result was that the locus coding for a0 became a polymorphic cue locus, with phenotypes z1, z2 in accordance with the evolutionary interests of fully linked modifiers of this new polymorphism (Fig 4B). Other conceivable evolutionary outcomes of disruptive selection on a0 are shown in Fig 4C and 4D. In Fig 4C, 5 unlinked loci have small positive effects on a0 and 5 have small negative effects, and each of these loci became polymorphic in the simulation, while at the same time the original genetic cue locus remained polymorphic. The overall effect was a fairly broad distribution of values for the investment z. In Fig 4D, the maximum expression at the loci with positive and negative effects was controlled by two separate unlinked loci, and one of these became polymorphic, giving rise to a bimodal distribution of values of z. In these examples, a notable amount of genetic variation in z evolved, but the width and shape of the distribution of z depended on the details of the genetic architecture of the trait. In all cases, an individual gains information about its current habitat from its genotype, and one can show that the clearcut polymorphism in Fig 4B is the most informative, with progressively less information on average in Fig 4C and 4D, as illustrated in Fig 5. The latter cases are intermediate between the evolutionary interests of fully linked and unlinked modifiers. We have shown how adaptively maintained genetic polymorphism can be integrated into social evolution theory by making use of the concept of genetic cues. The selection gradient we derived (in eq (7) ) parallels the direct, or personal, fitness approach to social evolution in class-structured populations [3,6], with the distinction that the presence of a cue allele in an individual’s genotype, rather than a phenotypic state, defines the class structure. In our model, individuals use strategies that are conditional on a genetic cue, but our general approach can incorporate a combination of genetic, environmental and transgenerational cues [26,35]. Just as is the case in standard social-evolution theory, relatedness enters into our model as a description of the genetic structure of social groups. The structure refers to genetic variation at epistatic modifier loci, rather than at genetic cue loci, so the relatedness parameter ri in the pay-off derivative Eq (3) refers to rare mutants at a modifier locus. This is in accordance with the general idea of treating genetic variation at a cue locus as input to a developmental or ‘decision-making’ system, and then to examine long-term evolution of the developmental system [24,26]. The value of this perspective is that it guides the analysis and interpretation by forming a link to the study of conditional strategies, such as the study of phenotypic plasticity. The different ways in which individuals gain information about themselves and their social partners has figured importantly in the study of social evolution [2]. For instance, migrant individuals arriving in a local population have different expectations of relatedness to their neighbors than non-dispersers [5]. The possibility that individuals can recognize kin through similarity in genetically polymorphic traits has been carefully investigated, with the conclusion that kin recognition can evolve in spatially structured populations [36–38]. Yet another possibility is that individuals estimate their degree of inbreeding, and thus how likely they are to be related to their neighbors, using their relative homozygosity as an indicator of local relatedness [39]. Our analysis of genetic cues of relatedness contributes to this general emphasis on the role of information, but differs from the other examples through an affinity to the study of local adaptation in the face of gene flow, which has been given much attention in evolutionary ecology but rather little in theories of social evolution. We found that the genetic linkage between cue and modifier loci can influence the evolutionary outcome (Figs 2 and 3), and this gives rise to genetic conflicts. Genes unlinked to a genetic cue locus tend to favor phenotypes that are less specialized to particular habitats compared to tightly linked genes, because unlinked genes become adapted to exist in all habitats, be transferred between them, and to use the information in a genetic cue to adjust the phenotype in an optimal way for this situation. Tightly linked genes, on the other hand, might be selected to perform well in only one of the habitats, even at the expense of performance in another habitat. The reason is that a modifier allele tightly linked to a cue locus allele can become concentrated to one of the habitats, with the other habitat acting as a sink, to which little adaptation takes place [40,41]. Our results on the role of genetic conflicts in giving rise to disruptive selection at modifier loci (Fig 4) extends the previous understanding of genetic conflicts when there is adaptively maintained genetic polymorphism [24]. Disruptive selection in heterogeneous environments can maintain genetic polymorphism [42], and genetic cue polymorphism is an example of this general phenomenon. So, if unlinked or loosely linked modifiers of a genetically polymorphic locus evolve to reduce or eliminate the divergence between phenotypes, there will be disruptive selection at loci with additive effects on the phenotype in question. Theoretical modeling has found that disruptive selection tends to favor genetic architectures where polymorphism is concentrated to a single locus [23,43], but as we have shown, constraints on the set of genotype-phenotype mappings can lead to intermediate outcomes between a single-locus polymorphism and polygenic variation where each locus has a small effect (Fig 4). A basic question for evolutionary theory is whether evolutionary change can be seen as optimizing some form of fitness for the organism or individual [44]. Our analysis of genetic conflicts throws new light on this issue. It is reasonable to regard unlinked modifiers of effects at a polymorphic locus as representing the evolutionary interest of the organism, because unlinked, small-effect mutant modifiers share their demographic future with the organism. Our results in Fig 4—that disruptive selection can act to diminish the control exercised by unlinked modifiers over the degree of phenotypic specialization—illustrate how individual optimization might be circumvented when there is genetic polymorphism. Furthermore, our individual-based simulations with multilocus genetic architectures resulted in evolutionary outcomes that were intermediate between the evolutionary interests of linked and unlinked modifiers (Figs 4C, 4D, 5C and 5D). This fits with the general idea of the organism as a compromise between different evolutionary interests [45,46]. In conclusion, our framework broadens the scope of social evolution theory, by accounting for adaptively maintained genetic variation in heterogeneous environments and by incorporating evolutionary outcomes over the range from genetic specialism to generalism. Many instances of interactions between relatives in nature are likely to be found somewhere between the extremes of such a spectrum. A major insight from our work is that positions along this spectrum can correspond to the degree of genetic linkage between polymorphic loci and epistatic modifiers of the phenotype in question. Our analysis thus delivers potentially testable predictions about the evolution of epistasis between modifiers and polymorphic loci and can inspire empirical investigation of the importance of genetic cues of relatedness.

Title: Genes as Cues of Relatedness and Social Evolution in Heterogeneous Environments Summary: The theory of kin selection explains the evolution of helping when relatives interact. It can be used when individuals in a social group have different sexes, ages or phenotypic qualities, but the theory has not been worked out for situations where there is genetic polymorphism in helping. That kind of polymorphism, for instance cheater-cooperator polymorphism in microbes, has attracted much interest. We include these phenomena into a general framework of social evolution. Our framework is built on the idea of genetic cues, which means that an individual uses its genotype at a polymorphic locus as a statistical predictor of the current social conditions, including the expected relatedness in a social group. We allow for multilocus determination of the phenotype, in the form of modifiers of the effects of the alleles at a cue locus, and we find that there can be genetic conflicts between modifier loci that are tightly linked versus unlinked to the cue locus.

lay_plos

en

Summarize: STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT [0001] This Application claims priority by U.S. Provisional Application No. 61/997,468 with a Filing Date of Jun. 2, 2014. REFERENCE TO SEQUENCE LISTING IN A TABLE, OR A COMPUTER PROGRAM LISTING COMPACT DISK APPENDIX [0002] Not applicable. BACKGROUND OF THE INVENTION [0003] The present invention generally relates to an apparatus to hold cylindrical and odd shaped objects that are in daily use in both at rest, or static and in motion. [0004] Existing prior art examples include U.S. Pat. No. 1,014,004—Irwin, U.S. Pat. No. 3,746,179—Paumgardhen, U.S. Pat. No. 6,334,562—Ament et al, U.S. Pat. No. 8,006,846—Robertson, and U.S. Pat. No. 8,573,002—Ledoux et al, all have limitations in terms of versatility, interchangeability, an in adaptability for a variety of uses. [0005] U.S. Pat. No. 1,014,004—Irwin, specifically discloses a single bottle holder with a flexible strap with hook attachment means only. [0006] U.S. Pat. No. 1,991,306—Woolsey, discloses a generic article holder. [0007] U.S. Pat. No. 3,746,179—Paumgardhen, specifically provides for supporting in a flexible vertical band a plurality of cylindrical objects, such as wine bottles. [0008] U.S. Pat. No. 4,444,358—Spohn et al, specifically discloses a fluid reservoir container bracket and holder for an automobile solvent bottle. [0009] U.S. Pat. No. 5,370,288—Field, discloses an adjustable loop-type holder. [0010] U.S. Pat. No. 5,950,844—Taylor, discloses a support apparatus with an elastic cord feature. [0011] U.S. Pat. No. 6,220,557—Ziayiek et al, discloses a mounting bracket for a specific circular shaped object. [0012] U.S. Pat. No. 6,334,562—Ament et al, specifically discloses a stowage device for a range of different shaped objects contained in a receiving net attached to a flat surface primarily intended for use in motor vehicles. [0013] U.S. Pat. No. 7,429,023—Morrow, discloses a bracket for deck support. [0014] U.S. Pat. No. 8,006,846—Robertson, specifically provides for retaining medical vials in a portable carrying case using elastic cords and with a plurality of spaced divider walls. [0015] U.S. Pat. No. 8,573,002—Ledoux et al, specifically discloses a portable cooler configuration wherein objects, such as bottles, are retained and secured in a vertical configuration by means of reconfigurable dividers separating the objects. [0016] US 2005/0023312—Steinberg, discloses a vehicle cargo restraint and storage device. [0017] There are a number of US Design Patents that have features for supporting bracket configurations and these include, U.S. Pat. No. Des 401,838,—Beauchemin, U.S. Pat. No. D 590,697—Townley, U.S. Pat. No. D 633,781—Wood, U.S. Pat. No. 699,549—Giessmann et al, and U.S. Pat. No. D 715,790—Conomos et al. [0018] The aforementioned prior art devices such as those disclosed above are adequate for the basic purposes as in the instant invention and are uniformly deficient with their capability to provide comprehensive, simple, efficient, and practical means of securing and holding in place cylindrical and odd shaped objects for a variety of applications. [0019] To address the particular limitations in the prior art, the instant invention provides a novel arrangement for providing a flexible, adaptable and versatile means for holding in place and securing cylindrical and odd shaped objects in a variety of applications. [0020] Therefore a comprehensive device was needed to provide a means to overcome the limitations in the existing prior art examples. BRIEF SUMMARY OF THE INVENTION [0021] This instant invention provides for the a flexible component storage system in place of fixed rack systems provided by existing component storage systems. [0022] The essence of the instant invention is to meet the following basic requirements: 1. hold and retain in place, bike and sports bottles of varying size and dimensions. 2. hold and retain in place, baby bottles of varying size and dimensions. 3. providing minimal receptacle outline, and minimizing cabinet damage due to simplicity of rack attachments. 4. providing minimalist overall styling without any rattling when objects are placed. 5. comprising water resistant and easy handling facilities for retaining a multiplicity of objects. 6. securing method ensures components are held tight by the retaining cords, elastic bands, cords, stretchable materials, so that attachments stay strong over time. 7. means of securing brackets are compatible with retaining cords, elastic bands, cords of different length. [0030] The essential element common to all the embodiments included in the instant invention is novel feature of a novel right angled bracket with specific openings and slots, and novel elastic cord used in conjunction with other elements using Commercial Off The Shelf (COTS) to form a cost effective and efficient means to accomplish the stated objectives of the instant invention of providing a versatile means of storing and securing a variety of objects. [0031] The various disclosed embodiments of the instant invention have in common the capability of securing and retaining a plurality of objects in a plurality of storage configurations. BRIEF DESCRIPTION OF THE DRAWINGS [0032] Various features, aspects, and advantages of the present invention will become apparent with reference to the following FIGS. 1 to 5. [0033] FIG. 1 shows a typical view of the inventive concept with the principal principle component of a novel angled bracket. [0034] FIG. 2 shows the custom made elastic retaining cord. [0035] FIG. 3 shows a typical embodiment of the instant invention for retaining objects, such as plastic bottles stored and secured to a flat surface. [0036] FIG. 4 shows the novel angled bracket using COTS fasteners. [0037] FIG. 5 shows an example of an application of the instant invention. LIST OF REFERENCE NUMBERS FOR THE ELEMENTS IN THE DRAWINGS [0038] 10 in FIG. 1 shows the essential element configuration of the instant invention in the form of a right angled bracket manufactured from plastic, glass reinforced plastic, metal or other load bearing materials. [0039] 12 in FIG. 1 shows the shorter face of the item 10. [0040] 14 in FIG. 1 shows the longer face of item 10. [0041] 16 in FIG. 1 shows circular corners at each end of items 12 and 14. [0042] 18 of item 12 in FIG. 1 shows a plurality of elongated slots in one face of the right angled bracket 10 to provide a means for inserting COTS screws and fasteners to secure item 10 to a flat surface. [0043] 20 in FIG. 1 shows plurality of angular slots in 14 formed in a diagonal manner at an angle of approximately 45 degrees to a horizontal plane. [0044] The angular slots 20 in FIG. 1 are further configured with circular openings 22 at one end of the angular slots in a manner to facilitate the placement for receiving customized components such as retaining cords, elastic bands, cords, flexible strap and other stretchable materials. [0045] 24 in FIG. 2 are items considered in the COTS category used for securing, fastening, and screws and similar fittings used to attach item 10 to a flat surface. [0046] 26 in FIG. 2 shows novel arrangement of unique retaining cords, elastic bands, cords, stretchable materials. [0047] The retaining cord, band 26 in FIG. 2 is in the form of two parallel and opposing cords, bands. [0048] 30 in FIG. 3 are cross-bracing ties dividing item 26 retaining cords, bands loops. [0049] The combination of the unique right angled bracket item 10 in combination with the unique elastic cord items 26, 32, 34 in FIG. 2, forms the basis of a novel storage system 28. DETAILED DESCRIPTION OF THE INVENTION [0050] The instant invention is novel in that it provides a plurality of configurations for retaining and securing objects in a range of settings, such as refrigerators, enclosed cabinets, and free standing surfaces such as for example, recreation vessel decks, patio decks. [0051] The invention in the multiplicity of embodiments disclosed all comprise the novel right angled item 10, and unique and novel elastic continuous cord, band item 26 which are used with a series of COTS components for a range of inventive concept embodiments. [0052] The unique right angled bracket item 10 is capable of being made from a range of metallic and non-metallic materials including but not limited to ferrous, non-ferrous, plastic, glass reinforced plastic, and fiber glass. [0053] The unique right angled bracket item 10 is capable of being manufactured in a range of method including but not limited to drop forging, cold forging, metal pressing, and loss-wax or investment casting processes. [0054] The unique right angled bracket item 10 is also capable of being supplied in the range of materials disclosed and also being covered in materials to prevent corrosion and erosion wear and tear with coatings including but not limited to plastics, glass reinforced plastic and fiber glass. [0055] In a further embodiment of the instant invention, a metallic backing plate 30 is provided secured to a flat surface by COTS fasteners, and thereby enabling the unique bracket item 10 in metallic material to be fastened thereto by magnetic action. [0056] The unique elastic cord item 26 is capable of being manufactured in a range of methods including but not limited to elastic cord core item 32 with a series of covering materials item 34 in the form of plastic, PVC, fiber glass or equal smooth corrosion resistant materials and providing for different color configurations. [0057] The unique elastic retaining cord item 26 as disclosed is capable of resisting loads up to 30 pounds force with an extension/elongation not exceeding 3 inches. [0058] The overall length of the elastic retaining cord item 26 is non-limiting and is application dependent. For example, a domestic refrigerator application an overall length of between 1.5 and 2.0 foot would be appropriate, whereas for a larger setting of a recreation vehicle kitchen area, a length of between 2.0 and 3.0 foot would be practical. [0059] In a further embodiment of the instant invention the means of attaching the brackets 10 to a flat surface is by means of a secured metallic back-plate to the flat surface by means of COTS fasteners, and providing magnetized bracket 10 for attachment thereto the back-plate. [0060] In a further embodiment of the instant invention the means for attaching the elastic retaining cord 26 can be by means of heavy duty plastic or equal material suction cups by adhesive to the brackets 10 in for example to a smooth flat surface such as the inside of a refrigerator door. [0061] The invention disclosed in the range of embodiments herein all provide a readily attachable and removable apparatus in kit form that can be readily be applied to a multitude of configurations. [0062] The invention provides the user with the means for securing and retaining a variety of objects of cylindrical and irregular shapes. [0063] The invention provides unique and novel free standing applications readily adaptable in a plurality of configurations. [0064] The instant invention operates by employing the principles of elastic force applied to a range of cylindrical and other objects against a range of surfaces. [0065] The instant invention meets the following user needs and requirements: 1. Can function as a daily storage for household, recreation and utility items of cylindrical and odd shapes. 2. Provides a safe product that is child/user friendly as it has no sharp edges. 3. Has a design that is intrinsically simple and minimalist in concept. 4. Provides for a product that provides with a customized coating that is both functional and visually attractive. 5. Provides for interchangeability of the major components of bracket and elastic cord, bands. 6. Accomplishes an apparatus that secures and retains a plurality of shaped products in a static state. 7. Provides for the capability to be used in a variety of settings including bicycle, sport boats and recreational vehicles. 8. Provides the ability to retain a variety of shaped objects taught and the retaining cord, band stays strong and functional over an extended period of operation. 9. Provides for a bracket and retaining cord, band configuration that cover different cord lengths. 10. Provides for an overall storage system that does not require adhesive attachment means. 11. Provides for the safe and secure storage of objects such as, baby sippy cups, all manner of bottles, and sports items such as sneakers, sports shoes, workshop tools. etc. [0077] The application of the invention can easily described in the following discrete operational steps: 1. needs to be able to function as a daily storage use item, which means the elastic elastic band, cord, item 26 and retaining brackets item 10 are interchangeable. 2. needs to be a safe product with no sharp edges that would harm children or adults. 3. needs to be minimalist and simple design. 4. needs to have a coating and finish to prevent scratching,.abuse, moisture and wipe able. 5. needs to have interchangeable brackets, such as unique 10. [0083] It will be evident that the instant invention has a plurality of applications for storing, retaining and providing easy access for cylindrical and odd shaped objects in a variety practical applications in a number of settings as enumerated in the following; 1. The unique storage system 28 is capable for storage of items on flat surfaces in refrigerating units in homes, offices, and in recreational applications including but not limited to boast, yachts, RV&#39;s, trucks, aircrafts, and automobiles. 2. The unique storage system 28 is capable of being used for storing workshop tools, wine bottles, baby bottles, and other cylindrical and odd shaped objects. 3. The unique storage system 28 is capable of utilization in commercial store settings for displaying sale items such as shoes, athletic sneakers, and a range of liquid containers including but not limited to sun tan spray bottles/containers, cosmetic spray bottles/containers, candy and snack items in cylindrical containers. [0087] It will further be understood from the foregoing description that various modifications and changes can be incorporated based on the specification description and the accompanying drawings are intended for the purposes of illustration only and should not be construed in a limiting sense.

Summary: The invention provides for an apparatus to hold and secure cylindrical and odd shaped objects of varying size, comprising a novel bracket configuration and novel elastic cord component and used in conjunction with COTS (Commercial Off The Shelf) components in the form of conventional set screws and fasteners. In this manner, the inventive concept provides for means for securing cylindrical and odd shaped objects in household, commercial receptacles, cabinets, including refrigerators, storage units, and additionally, for securing objects in marine and recreational vehicles, and sports bikes, sports marine crafts, and other such sports vehicles.

big_patent

en

Summarize: BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a single multi-purpose pliers-type hand tool of particular use to fishermen for gripping, holding, compressing and flattening things or materials, for punching holes in materials and for cutting malleable or other solid or tubular materials. 2. Description of the Prior Art While fishing, fishermen often find that they need a tool for grasping and holding hooks, lures and other fishing equipment. Fishermen also frequently need a device for cutting wire leaders, &#34;pencil lead&#34; weights, etc. Many fishermen satisfy these needs by carrying a common needlenose pliers with straight side cutters among their fishing equipment. However, for some purposes such a tool is inadequate. In drift fishing, fishermen frequently use a type of weight known as &#34;pencil lead&#34;, either solid-core pencil lead, which is essentially just lead wire, or hollow-core pencil lead, which is tubular lead wire. Usually, pencil lead comes in rolls and is cut to a length suitable to the needs of fishing a particular water. There are several means of connecting pencil lead to a fishing line. Hollow-core pencil lead is designed to enable the fisherman to insert the line into the hollow core of the pencil lead and crimp the lead against the line to hold it in place. However, when hollow-core lead is cut to length with the straight-edge cutter on a common needlenose pliers, the hollow core is crimped shut, requiring additional effort and often another tool to reopen the core so that the lead may be used as intended. Although electricians wire strippers in various forms will cut hollow-core lead without crimping it, such a specialized tool has no other use to fishermen. Solid-core pencil lead is most often attached to fishing line by surgical tubing. One method employs a costly and bulky three-way swivel, which is highly visible to fish, to attach the tubing between the main line and leader. Such an arrangement becomes easily fouled, causing increased loss of terminal tackle, and must be changed whenever the lead diameter is changed. Another method involves passing the line through surgical tubing and inserting the lead, relying on friction to hold the tubing and lead in place. When the lead becomes fouled, however, the tubing slides down the line to the lure, again causing the loss of terminal tackle. Precut solid-core pencil lead is available which has a hole in one end for tying the lead to the fishing line. This lead is expensive, however, and cannot be snapped to a line or leader with a snap swivel because it is too thick at the hole. Such precut lead is also too short for some purposes and not long enough for others. It would be preferable if the fisherman could, while fishing, cut and form his own solid-core lead with a flattened and punched end for receiving a snap swivel, but no single tool is available for this purpose. Specialty tools exist which could perform one or more of the above operations. However, to perform all such operations, the fisherman would be burdened with several different tools, which is cumbersome and inconvenient, particularly for making sinkers while fishing. Thus, there is a need for a single tool which combines all of the above-described capabilities and others commonly needed by the fisherman. This need is unsatisfied by the tools of the prior art. U.S. Pat. No. 18,206 shows a combination tool which includes a punch and features not needed by a fisherman. It has neither the gripping and compressing capabilities of pliers, nor wire-cutting capabilities. It also lacks the capability of cutting hollow-core pencil lead in the manner of the present invention. U.S. Pat. No. 276,793 includes, in addition to features not shown in the present invention, a pliers, a punch and a wire-cutting means, but does not have the ability to cut hollow-core pencil lead without compressing it. In addition, the tool is inconveniently shaped for the purposes of a fisherman, including carrying it easily while fishing. U.S. Pat. No. 318,006 shows a combination fuse-cutter capsetter whose utility is limited to the specific purpose of cutting fuses and setting caps. It does not have the capabilities of being used as a pliers or compressing pencil lead or cutting hollow-core pencil lead in the manner provided by the present invention. U.S. Pat. No. 572,808 covers a tool for miners and blasters&#39; use. Although this tool has pliers-like jaws, it is provided with longitudinal grooves on the jaws&#39; meeting faces and knives are secured therein for cutting fuses and is therefore inadequate for the holding and compressing functions of the present invention. In addition, the punch provided on this tool, like the punch in U.S. Pat. No. 318,006, above, is an awl-like structure unsuited for punching holes in flattened metal. U.S. Pat. No. 1,431,421 is another blasting fuse implement of specialized design unsuitable for the needs of fishermen. In particular, it lacks both the gripping and compressing capabilities of pliers and it lacks a punch. The straight-edge cutter, the only cutter on this device, is not of a type suitable for cutting metal. U.S. Pat. No. 1,970,983 refers to a pliers which is actually a form of scissors for cutting and forming a type of electrical conduit. Specialized as it is, the tool will not fulfill the needs of a fisherman, nor does it provide a punch or half-moon cutters. U.S. Pat. No. 2,097,735 shows a sewing machine tool. Although this tool combines features of pliers, punch and cutting edges, it does so in a specialized manner which provides for cutting and punching belts in a simultaneous mode. It provides neither the half-moon cutters needed for cutting hollow-core pencil lead nor tapered needle-nose jaws with scored surfaces suitable for gripping fishhooks. In addition, the punch appears to be unsuitable for punching lead sinker material. There is a fencing pliers (no known patent) which is designed for use in construction of wire fences. It combines special pliers jaws for pulling fence staples, a hammer on the outer side of one jaw, and a staple-pulling hook on the outer side of the other jaw, wire shears adjacent to the pivot and means for grasping wire between the handle adjacent to the pivot so that wire may be stretched around a fence post. Fence pliers lack both the punch and half-moon cutters of the present invention. In addition, the pliers jaws are unsuited for grasping hooks and other fishing equipment. Accordingly, there is a need for a combination tool for fishermen, which provides the gripping and compressing capabilities of a needle-nosed or similar pliers with both straight-edge and half-moon cutters and with a punch. Further, there is a need for these capabilities to be combined in a single light-weight tool which is easily carried and used by fishermen while fishing. SUMMARY OF THE INVENTION The present invention is a fisherman&#39;s pliers having elongated tapered jaws with a flat inner meeting face on each jaw which is suitable for grasping or holding objects or for compressing objects between flat surfaces in the jaws. The tool also features a straight-edge cutter and a half-moon cutter suitable for cutting hollow-core pencil lead without destroying the hollow characteristics of the lead. The tool also features a punch suitable for punching a variety of materials, including malleable metal. The objects of the invention include: 1. The ability to firmly grasp and hold hooks, lures, leaders and other fishing devices; 2. the ability to compress or flatten pencil lead sinker material and other malleable materials; 3. the ability to cut solid-core pencil lead, leaders, wire and hooks; 4. the ability to cut hollow-core pencil lead without closing the hollow core; 5. the ability to punch holes in flattened pencil lead and other materials; and 6. combining all the above-described capabilities in a single tool which may easily be carried in a tackle box, creel or pocket. The foregoing objects, features and advantages of the present invention will become more apparent in the following detailed description which proceeds with reference to the accompanying drawing. BRIEF DESCRIPTION OF THE DRAWING In the drawing: FIG. 1 shows a perspective view of the preferred embodiment of fisherman&#39;s pliers. FIG. 2 shows, in perspective, an alternative preferred embodiment of fisherman&#39;s pliers. FIG. 3 shows the jaws portion of the pliers of FIG. 1 in side elevation. FIG. 4 shows a cross section of the jaws of FIG. 3 taken along the plane 4--4. FIG. 5 shows the pliers of FIG. 1 in use to flatten pencil lead in two alternative positions in the pliers. FIG. 6 shows the pliers of FIG. 1 in use to punch a hole in flattened pencil lead. FIG. 7 shows the pliers of FIG. 1 in use to cut hollow-core pencil lead. DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS FIG. 1 Embodiment In the drawing, FIG. 1 shows a needle-nosed fisherman&#39;s pliers 11 comprising two mutually-pivotable crossed members 13, 15, each including a handle section 17, 18, respectively, and a needle-nosed jaw section 23, 25, respectively. The members 13, 15 intersect at a pivot 19. The jaw section 25 of member 15 has, proceeding from a flat tip 21 toward the handle section 18, a flat meeting face 27 comprising a grooved or checkered gripping surface portion 31, and a die hole 35 within a smooth compression surface portion 29. Continuing toward the handle section 18, jaw section 25 includes a straight-edge cutter 39, a half-moon cutter 41, the pivot 19, and, on the handle side of such pivot, a second smooth flat surface portion 30 (not shown) lying adjacent to handle section 18. Similarly, jaw section 23 of member 13 has features cooperative with the aforementioned features of jaw section 25, as follows, proceeding from its tip 22 toward its handle 17: a flat meeting face 26 having a grooved or checkered gripping surface portion (not shown) and a smooth compression surface portion (not shown) in positions corresponding to the positions of like portions of jaw section 25 for cooperation therewith; a cylindrical punch pin 33 having a flat head 34 projecting generally normally from the meeting face 26 and sized and positioned for cooperation with die hole 35; a straight-edge cutter 38 for cooperation with cutter 39; and a half-moon cutter 43 for cooperation with similar cutter 41. A second smooth flat surface portion 28 lies rearwardly of pivot 19 adjacent to handle section 17. Referring to FIG. 3, the cylindrical die hole 35 extends inwardly through the jaw section 25 from meeting face 27 and normal to the flat meeting face 27 through jaw section 25. It is positioned in jaw section 25 so as to receive the punch pin 33 when jaw sections 23, 25 are closed, so that pin 33 and hole 35 cooperate to form a punch 33, 35. In the preferred embodiment pin 33 and hole 35 are positioned on their respective meeting faces 26, 27 opposite their respective handle sections 17, 18 approximately two-thirds of the distance from the axis of pivot 19 to pliers tips 21, 22 and are centered laterally. For greater leverage, the punch 33, 35 may be placed closer to pivot 19 or placed on the second flat surface portions 28, 30 adjacent to the handles 17, 18. Any references herein to the meeting faces 26 and 27 shall be deemed to include the flat surface portions 28 and 30, respectively. For punching flattened lead it is unnecessary for the punch pin 33 to fit tightly into the die hole 35. Therefore, in the preferred embodiment, the punch 33, 35 is constructed to loose tolerances enabling the straight-sided punch pin 33 to enter the straight-sided die hole 35 without conflict when the jaw sections are closed together. This feature enables pliers 11 to be simply and inexpensively manufactured. Referring to FIG. 4, each of the jaw sections 23, 25 contains a semi-cylindrical channel 37 immediately adjacent to the pivot 19 whose axis parallels the axis of pivot 19. The channels 37 extend along their axes almost through their respective jaw sections 23, 25, leaving a thin wall 36 along one side of each jaw section 23, 25. The edge of each wall 36 at the meeting face 26, 27 of each jaw section 23, 25 is sharpened to form the straight-edge cutters 38, 39, best seen in FIG. 1. In FIGS. 3 and 4, at the line 4--4, a circular hole 40 has been drilled through the portion of the straight-edge cutters 38, 39 nearest the pivot 19 such that a diameter of the hole 40 lies along the straight-edge cutters 38, 39. The hole 40 is then countersunk about its axis from both sides of the walls 36 by drilling the walls 36 to a depth sufficient to provide sharp half-moon cutting edges 41, 43 in each jaw section 23, 25, as shown in FIG. 4. Alternatively, the hole 40 can be countersunk from only one side of the walls 36 to obtain sharp, half-moon cutting edges 41, 43 by drilling the walls 36 to a slightly greater depth than is shown in FIG. 4, thereby simplifying manufacture of fisherman&#39;s pliers 11. FIG. 2 Embodiment FIG. 2 shows an alternative embodiment of fisherman&#39;s pliers 111. Pliers 111 are essentially the same as pliers 11 except that a channel 137 similar to the channel 37 of FIGS. 1, 3 and 4 is provided in each member 113, 115 between the pivot 119 and the handles 117, 118 in lieu of the second flat surface portions 28, 30. The walls 136 are drilled and countersunk to form half-moon cutters 141, 143 essentially identical to the half-moon cutters 41, 43 of pliers 11. Placing the half-moon cutters 141, 143 on the handle side of the pivot 119 has the advantage of leaving a somewhat longer straight-edge cutter 138, 139 on the opposite side of pivot 119. This arrangement also makes it slightly easier for the user to align objects in the pliers 111 for cutting. Fisherman&#39;s pliers 11 or 111 are sized to fit comfortably in a fisherman&#39;s pocket or creel. In one example, the length of such pliers 11 or 111 is 61/2 inches. OPERATION In operation, fisherman&#39;s pliers 11 or 111 may be used in any manner in which ordinary needle-nose or similar pliers would be used. In addition, such pliers may be used for cutting solid-core pencil lead sinkers 60 using the straight-edge cutters 38, 39. Sinkers 60a are then flattened at the end by compressing the sinker 60a between opposed flat smooth surface portions of the meeting faces 26, 27 in the pliers 11, as shown in FIG. 5. Once the lead is flattened, a hole in the sinker 60b is created in the flattened region by use of the punch 33, 35, as shown in FIG. 6. Thereafter sinker 60b can be snapped through its hole to a small snap swivel, which in turn is tied into the fishing line, preferably with the line and leader knotted to opposite eyelets of the swivel. Hollow-core pencil lead 70 is cut by placing it between the half-moon cutter 41, 43 and compressing the handles 17, 18 as shown in FIG. 7. Fishing line is inserted into the hollow core of the pencil lead 70 and then clamped in place by compressing the end into which the line has been inserted between opposing meeting faces 26, 27 of pliers 11. Having illustrated and described the principles of our invention by what is presently, a preferred embodiment thereof, and alternative embodiments, it should be apparent that such embodiments may be modified in arrangement and detail without departing from such principles. We claim all such modifications within the true spirit and scope of the following claims.

Summary: A fisherman&#39;s pliers combines in a single tool the gripping, holding, compressing and flattening features of a needlenose or similar pliers with a hole punch and with both straight edge and half-moon metal cutters, whereby hollow and solid so-called &#34;pencil lead&#34; sinker material can be prepared efficiently while fishing for attachment as a sinker to a fishing line.

big_patent

en

Summarize: GOP presidential candidate John Kasich didn’t score many points with New York pizza lovers Wednesday when he ate his slice with a knife and fork. Mr. Midwestern Manners resorted to silverware Wednesday at Gino’s Pizzeria in Howard Beach, Queens, where he went for lunch following a town hall meeting at a nearby church. The Ohio governor cut off a big bite and picked up the cheesy goodness with a fork. Mayor Bill de Blasio was widely mocked when he did the same thing last year on Staten Island. But Kasich seemed to realize his faux pas: He finished the rest of the slice with his hands. Later, he went behind the counter to greet staff, and handed out free pizza to startled customers. Republican presidential hopeful John Kasich bit into culinary controversy this week when he turned down a Wisconsin dessert and used a fork to eat pizza in New York. Kasich’s first food faux pas came on Tuesday, when he declined to try frozen custard at a 65-year-old Milwaukee-area establishment, a week before the Badger State’s primary. “I have a young, beautiful, smart wife, so I have to stay thin,” Kasich told a couple outside Kopp’s Frozen Custard, in Greenfield, Wisconsin. They told him abstaining from the custard might cost him at the ballot box. "It’s big in Wisconsin,” Richard Warren, a 58-year-old Glendale, Wisconsin, resident who works in IT and plans to vote for Kasich next week, told the governor. "It might mean votes.” His wife added: "Custard does mean votes.” It was the first time in recent memory a politician had come to the shop and not tasted the frozen confection, a Kopp's employee told ABC News. Local politicians to presidents make a habit of partaking in local cuisine across the country, from craft beers to famous hamburgers and greasy diner food. In New York City today, Kasich threw his diet to the wind, finishing off two slices of pizza, part of a third slice and a portion of a sausage dish. “A man’s got to eat!” he told ABC News, weeks before New Yorkers head to the polls. The politics of pizza can provide days of fodder for late-night talk-show hosts, as they did when New York City Mayor Bill de Blasio used a knife and fork to eat New York pizza two years ago – a major gaffe in the Big Apple. And today, Kasich followed in his footsteps, ever so briefly using a fork to eat his first bite of pizza at Gino’s Pizzeria and Restaurant, in Queens. He used his hands to eat the rest of his pizza, before donning an apron and serving free slices to patrons. Pressed on the fork snafu, Kasich defended his technique. “I was eating pizza before you were born!” he said. At least one of Kasich's competitors has done the same. Donald Trump, the Republican frontrunner, used utensils when eating pizza in New York's Times Square in 2011. He called the food exemplary. “I am going to declare this place great!” he said, fist-bumping a restaurant employee. The sausage was awesome! The pizza, great!” Presidential Candidate John Kasich eats a piece of pizza at Gino's Pizzeria and Restaurant on March 30, in the Queens borough of New York City. Getty Kasich defends eating pizza with fork: It was'scalding hot, OK?' During a stop at a pizza joint in New York on Wednesday, John Kasich drew the mock ire of locals and reporters on Twitter as he used a fork. On Thursday, Kasich explained himself. "Look, look, the pizza came scalding hot, OK? And so I use a little fork," the governor of Ohio told ABC's "Good Morning America." "You know what? My wife who is on spring break with my daughters said, ’I'm proud of you. You finally learned how to use a utensil properly.’ But I mean — not only did I eat the pizza, I had the hot sausage. It was fantastic." Kasich, apparently recognizing his error, finished up using his hands, although he did not fold over the slice, as is customary. "But here's what I've learned — I came to New York, there were like 100 press people there. Get ready, John, because I'll be spending a lot of time in New York," he joked, referring to himself in the third person. "New Yorkers eat their pizza a certain way. Not just New Yorkers, but around the world," co-host Robin Roberts told Kasich, as laughter erupted off-camera. Kasich replied in jest, "Listen — I was eating pizza before that reporter was born." The Midwestern governor is not the only presidential candidate who has been criticized for his form. In 2011, while dining at a Famous Famiglia pizza joint in Manhattan with Sarah Palin, Queens native Donald Trump came under fire for using a fork. "This way you can take the top of the pizza off, you're not just eating the crust. I like not to eat the crust so that we keep the weight down at least as good as possible," the businessman said in a YouTube video. That response followed a verbal thrashing by Jon Stewart on "The Daily Show," with the host joking, "Based on how you eat pizza, Donald, I'd like to see your long-form birth certificate. I don't think you were really born in New York."

Summary: John Kasich will have to do better if he wants to win over New York voters in next month's primary. The Ohio governor went to a Queens pizza shop on Wednesday and committed a local faux pas: He used a fork when eating a slice, reports ABC News. This prompted reaction along the lines of this headline in the New York Post: "WTF is wrong with John Kasich?" Kasich then had to explain himself on Good Morning America on Thursday morning. "Look, look, the pizza came scalding hot, OK? And so I use a little fork." Other politicians who have caught flak over this include Bill DeBlasio and, as Politico notes, none other than Donald Trump back in 2011, who explained that he was avoiding the crust to keep his weight down.

multi_news

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Measuring and Evaluating Trends for Reliability, Integrity, and Continued Success Act''. SEC. 2. DATA SYSTEMS AND REQUIREMENTS. Subpart 1 of part A of title I of the Elementary and Secondary Education Act of 1965 is amended by adding at the end the following: ``SEC. 1120C. DATA SYSTEMS AND REQUIREMENTS. ``(a) In General.--A State that receives funds under this part shall, not later than 4 years after the date of the enactment of this section, develop and implement a longitudinal data system, which shall include public charter schools, that meets the requirements of this section. ``(b) Advisory Committee.-- ``(1) In general.--In developing the data system described in subsection (a), each State that receives funds under this section shall form a committee to advise the State on the development and implementation of such system. Such committee shall be established within 6 months of the date of enactment of this section. ``(2) Membership.--Each individual serving on the committee established under paragraph (1) shall be selected by the State and have sufficient experience in and knowledge of the development, implementation, maintenance, and use of such data systems. In establishing the membership of the committee, each State shall ensure that individuals on such committee have the following backgrounds and experience: ``(A) Operating unions that represent teachers. ``(B) Teaching in public elementary and secondary schools. ``(C) Administering programs under this Act. ``(D) Operating or representing businesses. ``(E) Civil rights. ``(F) Academic and research. ``(c) Essential Elements.--The data system required by subsection (a) shall include the following elements: ``(1) A unique statewide student identifier that remains stable and consistent across time. ``(2) Student-level enrollment, demographic, and program participation information, including information on individual students' membership in the groups described under section 1111(b)(2)(C), school, grade, classroom level, enrollment, and attendance. ``(3) The ability to match individual students' scores on academic assessments required under this Act from year to year. ``(4) Information described in paragraph (2) on students that have not participated in the academic assessments required under section 1111(b)(3) and the reasons such students did not participate. ``(5) Student-level data on the entrance and exit of the education system of each student, including first time grade enrollment, grade level retention, verified transfer status, dropout rates, receipt of established diploma or nonstandard diploma, receipt of a GED, incarceration, and death. ``(6) A statewide audit system to ensure the quality, validity, and reliability of data in such system. ``(7) A unique statewide teacher identifier that remains consistent over time and matches all student records described in this subsection to the appropriate teacher. ``(8) Student-level transcript information, including information on courses completed and grades earned. ``(9) Ability to link information from preschool through grade 12, including that of students with disabilities, to data systems in higher education, and to gather information on college enrollment, placement, persistence, and attainment, and ability to link data systems to data from workforce development, unemployment insurance, child welfare, juvenile justice, and military services information systems. ``(d) Other Element.--The data system required by subsection (a) may include student-level data on participation in and performance on college admissions and placement assessments. ``(e) Requirements.--The data system required by subsection (a) shall be developed and implemented to ensure the following: ``(1) The privacy of student records, consistent with the Family Educational Rights and Privacy Act of 1974 (20 U.S.C. 1232g). ``(2) Effective data architecture and storage, including standard definitions and formatting, and warehousing, including the ability to link student records over time and across databases and to produce standardized or customized reports for use by local educators and policymakers, that-- ``(A) is based on informational needs at the classroom, school, local educational agency, State, and Federal levels; ``(B) includes, at a minimum, all data elements required for reporting under this Act; ``(C) allows for longitudinal analysis of student achievement growth and program evaluations; and ``(D) supports analyses and research to evaluate the effectiveness of education related programs and initiatives. ``(3) Interoperability among software interfaces utilized to input, access, and analyze the data of such system. ``(4) Interoperability with the other State and local systems developed and implemented pursuant to this section. ``(5) Interoperability with the system linking migratory student records required under part C. ``(6) Electronic portability of data and records. ``(7) Professional development for those that use and operate such system. ``(8) Researcher access to the data in such system, consistent with the Family Educational Rights and Privacy Act of 1974 (20 U.S.C. 1232g). ``(9) The data described in subsection (c)(7) shall not be used in a manner that reduces the rights or remedies of employees under any other Federal, State, or local law or under any collective bargaining agreement or memorandum of understanding. ``(f) Preexisting Data Systems.--A State that developed and implemented a longitudinal data system prior to the date of the enactment of this section may use that system for the purpose of this section, if the system otherwise meets the requirements of this section. ``(g) Certification.--Prior to the implementation of the data system required by subsection (a), a State shall submit an independently conducted audit to the Secretary certifying that the data system developed and proposed to be implemented by the State pursuant to this section meets the requirements of this section. ``(h) Authorization of Appropriations.--For the purposes of meeting the requirements of this section, there are authorized to be appropriated $150,000,000 for fiscal year 2008 and each of the 3 succeeding fiscal years. ``(i) Allocation.--After reserving funds under subsection (j), from the funds appropriated under subsection (h), each State shall receive an allocation. In making such allocation, the Secretary shall allocate 50 percent of such funds in a manner that provides an equal amount to each State. The remainder of such funds shall be allocated to each State based on each State's enrollment of students in kindergarten through grade 12, compared to all States. ``(j) Application.--The Secretary shall allot the funds described in subsection (i) after the State submits an application for such funds at such time, in such manner, and containing such information, as the Secretary may require. ``(k) Penalties.--Where any State is found not to have made substantial progress toward implementation of such a system three years after the date of the enactment of this section, the Secretary may withhold up to 25 percent of the State's funds reserved under section 1004. ``(l) Allowable Uses of Funds.--After the Secretary's certification of the State's data system pursuant to subsection (e), the State may use the funds received under this section to-- ``(1) maintain, operate, and upgrade its data systems; ``(2) provide data integrity training at the school and local educational agency levels to address technology maintenance needs at the school and district levels, privacy policies (including training related to the Family Educational Rights and Privacy Act of 1974), data integrity issues, report planning and processes; ``(3) provide professional development to teachers, office personnel, and school and district administrators on how to appropriately collect, report, and use data; ``(4) develop processes to analyze and disseminate best practices, strategies, and approaches regarding pedagogical advancement that will leverage the data system to enhance teaching and learning, including creating opportunities for individualized instruction; ``(5) align statewide longitudinal data systems with local student information management systems and curriculum management systems, instructional management systems, or learning management systems; or ``(6) conduct and publicly report on the findings of data analyses to identify and fill areas in need of improvement in policy and instructional practice. ``(m) Reservation for State Education Data Center.-- ``(1) In general.--From funds appropriated under subsection (g), the Secretary shall reserve 1 percent, but no more than $2,000,000, for the purpose of awarding a grant to one or more nonprofit entities to support the operation of a State education data center. ``(2) Application.--A nonprofit entity that desires a grant under this subpart shall submit an application to the Secretary at such time, in such manner, and accompanied by such information as the Secretary may require. The Secretary shall award such grant through a competitive process. Each application for a grant shall-- ``(A) provide an assurance that the entity will seek private, non-Federal funds, in addition the funds awarded under this subsection, to support the operation of the State education data center; ``(B) include a plan for continued financial support of such center by private, non-Federal funds; and ``(C) describe the experience and knowledge pertaining to education data system development, implementation and use that the entity will employ to operate such center. ``(3) Uses of funds.--An entity which receives grant funds under this subsection shall use such funds to-- ``(A) provide technical assistance to the States in the development, implementation and user of State education longitudinal data systems required under this section; ``(B) disseminate best practices on the development, implementation, and use of such systems; and ``(C) serve as a central repository for education and school safety related data required under this Act. ``(4) Public access.--An entity which receives grant funds under this subsection shall make such data publicly available, consistent with the Family Educational Rights and Privacy Act of 1974 (20 U.S.C. 1232g).''.

Title: To amend the Elementary and Secondary Education Act of 1965 to provide for the use of longitudinal data systems Summary: Measuring and Evaluating Trends for Reliability, Integrity, and Continued Success Act - Amends the Elementary and Secondary Education Act of 1965 to require each state receiving school improvement funds to implement, within four years of this Act's enactment, a pre- through high-school longitudinal data system that includes: (1) a unique and consistent statewide student identifier; (2) the ability to track student participation and performance over time; (3) a unique and consistent statewide teacher identifier that matches student records to the appropriate teacher; and (4) the ability to link its data to data from higher education, workforce development, unemployment insurance, child welfare, juvenile justice, and military services information systems. Allots funds to states to operate, upgrade, and optimize the use of their data systems. Reserves funds for competitive grants to nonprofit entities to support a state education data center.

billsum

en

Summarize: BACKGROUND OF THE INVENTION [0001] The present invention relates to a golf club head, more particularly to a wood-type golf club head having a hollow structure configured to increase the carry distance. [0002] Wood-type hollow golf club heads having various shapes have been proposed. [0003] With respect to the position of the center of gravity of the head, there is a tendency that, when the size of the golf club head in the back-and-forth direction is increased, the distance of the center of gravity from the club face is also increased. Since the club face is usually provided with a loft angle larger than 0 degree, the sweet spot height increases with the increase in the distance of the center of gravity. This will increase the likelihood that the golf ball hits a lower part of the club face under the sweet spot, and the backspin is increased due to the gear effect. As a result, the ball flight tends to become so called “ballooning” or “rising” trajectory due to too much backspin and a relatively low launching angle. Thus, the carry distance becomes short. [0004] When the size of the head in the toe-heel direction is increased, the distance between the center of gravity and the axis of the club shaft tends to increase accordingly. Therefor, there is a tendency that even at the time of impact the head can not return to the right address position where the club face is at right angle to the target line (trajectory) of the ball, and so called “ball gripping” or “ball holding” on the club face becomes insufficient. As a result, the ball flight tends to become slice. Thus, the directionality of flying of the ball is not good. Further, as the air resistance of the head becomes increased, the drag during swing increases to decrease the head speed. Thus, the carry distance becomes short. SUMMARY OF THE INVENTION [0005] It is therefore, an object of the present invention to provide a golf club head in which, by optimizing the head shape in relation to the position of the sweat spot, an optimum trajectory can be obtained to increase the carry distance and the ball holding can be improved to improve the directionality of flying of the ball. [0006] According to the present invention, a wood-type golf club head having a hollow structure having a head length L (mm), a head depth W (mm) and a sweet spot height H (mm) which satisfy [0000] 0.80 ≦W/L≦ 1.0 and [0000] H≦ 76×( W/L )−31. [0007] Definitions [0008] In this application, the dimensions refer to the values measured under the standard state of the club head unless otherwise noted. [0009] The standard state of the club head is such that the club head is set on a horizontal plane HP so that the axis CL of the clubshaft is inclined at the lie angle beta while keeping the axis CL on a vertical plane VP 1, and the club face 2 forms its loft angle alpha with respect to the horizontal plane HP. Incidentally, in the case of the club head alone, the center line of the shaft inserting hole 7 can be used as the clubshaft axis CL. [0010] The sweet spot SS is the point of intersection between the club face 2 and a straight line N drawn normally to the club face 2 passing the center G of gravity of the head. [0011] The sweet spot height H is the height of the sweet spot measured vertically from the horizontal plane HP. [0012] The back-and-forth direction is a direction parallel with the straight line N projected on the horizontal plane HP. [0013] The heel-and-toe direction is a direction parallel with the horizontal plane HP and perpendicular to the back-and-forth direction. [0014] The head length L is the distance of a point T measured perpendicularly to and from the clubshaft axis CL of the shaft inserting hole 7, and the point T is on the surface of the head on the toe-side and farthest from the axis CL. [0015] The head depth W is the distance of a point B measured perpendicularly to and from a plane FP, and the plane FP is defined as being tangent to the club face 2 at the sweet spot SS, and the point B is on the surface of the head on the backside and farthest from the plane FP. [0016] The distance GL of the center G of gravity is the distance of the center G of gravity measured perpendicularly to and from the clubshaft axis CL. [0017] The term “wood-type golf club” used in this application is meant for at least number 1 to 5 woods having a loft angle of not less than 7.0 degrees, but not more than 20 degrees. BRIEF DESCRIPTION OF THE DRAWINGS [0018] FIG. 1 is a front view of a wood-type golf club head according to the present invention. [0019] FIG. 2 is a top view thereof. [0020] FIG. 3 is a cross sectional view taken along line A-A of FIG. 2 showing an embodiment of the present invention. [0021] FIG. 4 is a cross sectional view similar to FIG. 3 showing another embodiment of the present invention. [0022] FIG. 5 is a cross sectional view similar to FIG. 3 showing still another embodiment of the present invention. [0023] FIG. 6 is a partial cross sectional view of the sole portion for explaining a structure and a way of setting a separate weight member. [0024] FIGS. 7 and 8 are a schematic top view and a schematic right side view of the head for explaining a way of setting another example of the separate weight member. [0025] FIG. 9 is a perspective view of a face plate. DESCRIPTION OF THE PREFERRED EMBODIMENTS [0026] Embodiments of the present invention will now be described in detail in conjunction with the accompanying drawings. [0027] Wood-type golf club head according to the present invention has a hollow shell structure 1 a. [0028] The hollow shell structure 1 a comprises: a face portion 3 whose front face defines a club face 2 for striking a ball; a crown portion 4 intersecting the club face 2 at the upper edge 2 a thereof; a sole portion 5 intersecting the club face 2 at the lower edge 2 b thereof; and a side portion 6 between the crown portion 4 and sole portion 5 which extends from a toe-side edge 2 c to a heel-side edge 2 d of the club face 2 through the back face BF of the club head. [0029] At the heel side end of the crown portion 4, there is formed a hosel portion 1 b be attached to an end of a club shaft (not shown) inserted into the shaft inserting circular hole 7. [0030] In the case of a wood-type club head for number 1 wood, it is preferable that the head volume is set in a range of not less than 350 cc, more preferably not less than 360 cc still more preferably not less than 380 cc in order to increase the moment of inertia and the depth of the center of gravity. However, to prevent an excessive increase in the club head weight and deteriorations of swing balance and durability and further in view of golf rules or regulations, the head volume is preferably set in a range of not more than 470 cc, more preferably not more than 460 cc. [0031] The mass of the club head 1 is preferably set in a range of not less than 180 grams, more preferably not less than 185 grams in view of the swing balance and rebound performance, but not more than 220 grams, more preferably not more than 215 grams in view of the shot directionality and traveling distance of the ball. [0032] The loft angle alpha is set in a range of from not less than 7.0 degrees, preferably not less than 7.5 degrees, more preferably not less than 8.0 degrees, but not more than 20 degrees, preferably not more than 19.0 degrees, more preferably not more than 18.0 degrees. [0033] As to the materials for the head, it is possible that the club head 1 partially includes nonmetallic materials, e.g. fiber reinforced resins, ionomer resins and the like. In this embodiment, however, the club head 1 is made of one or more metal materials. For example, stainless steels, maraging steels, pure titanium, titanium alloys, aluminum alloys and the like can be used. [0034] According to the present invention, the ratio (W/L) of the head depth W (mm) to the head length L (mm) is set in a range of from 0.80 to 1.0. [0035] Through experimental tests conducted by the inventor, it was found that: when the ratio (W/L) is less than 0.80, as the head length L becomes long for the head depth W, it becomes difficult to rotate the head back to the accurate address position during swing, and as a result, miss shots such as slice shot are induced. Further, the distance GL of the center G of gravity increases and the ball holding becomes insufficient, which further induce a slice shot. Thus, the directionality is deteriorated. Moreover, there is a tendency that the user feels the head as being undersized, therefore, the head can not give the user a sense of ease when addressed to the ball. [0036] In the present invention, since the ratio (W/L) is not less than 0.80, the club head can rotate and return to the accurate address position at impact, and as a result, the directionality can be improved. From this point of view, it is desirable that, by relatively decreasing the head length L, the ratio (W/L) is set in a range of not less than 0.82, more preferably not less than 0.85. [0037] Contrary, when the ratio (W/L) is over 1.00, as the head length L becomes short for the head depth W, there is a tendency that the head rotates beyond the accurate address position during swing, and as a result, hook shots are induced. Therefore, the ratio (W/L) is not more than 1.0, preferably not more than 0.98, more preferably not more than 0.95, still more preferably not more than 0.93. [0038] In this embodiment, it is preferable that the distance GL is set in a range of from 36 to 41 mm. [0039] By setting the ratio (W/L) as above, it becomes possible to proved the club head 1 with an appropriate weight distribution, which makes it easy to achieve the preferable range (36 to 41 mm) for the distance GL [0040] If the absolute value of the head length L is too small, as the distance GL becomes decreased, a hook shot is liable to occur. Further, the head can not provide a sense of easy when addressed to the ball and it becomes difficult to meet the ball. Contrary if the head length L is too large, the ball holding is liable to be deteriorated. Therefore, the head length L is set in a range of not less than 95 mm, preferably not less than 100 mm, more preferably not less than 105 mm, but not more than 140 mm, preferably not more than 135 mm, more preferably not more than 130 mm. [0041] If the absolute value of the head depth W is too small, as the depth of the center G of gravity (namely, the length of the straight N) becomes decreased, the directionality is liable to deteriorate. Further, the head can not provide a sense of easy when addressed. Contrary, if the absolute value of the head depth W is too large, the sweet spot height tends to be increased, and as a result, the backspin increases and the ball flight becomes a ballooning trajectory to decrease the carry distance. Therefore, the head depth W is set in a range of not less than 80 mm, preferably not less than 85 mm, more preferably not less than 90 mm, but not more than 130 mm, preferably not more than 125 mm, more preferably not more than 120 mm. [0042] From the results of experimentally tests carried out by the inventor, it was also found that, by specifically limiting the sweet spot height H in relation to the above-mentioned ratio (W/L), a ballooning trajectory is prevented and therefore, the carry distance can be increased. According thereto, it is desirable to determine the sweet spot height H (mm) so as to satisfy the following conditional expression (1), preferably expression (2), more preferably expression (3): [0043] H≦ 76×( W/L )−31 (1) [0000] H≦ 76×( W/L )−34 (2) [0000] H≦ 76×( W/L )−39 (3) [0000] It is preferable that the sweet spot height H is as low as possible in view of the prevention of the ballooning trajectory. But, if the sweet spot SS becomes distant from the average impact points of the average golfers (pints ranging from the center of the club face to 3 mm above), the rebound performance is liable to deteriorate. In this embodiment, therefore, it is preferable that the sweet spot height H is not less than 25 mm, but, not more than 45.0 mm, preferably not more than 40.0 mm, more preferably not more than 39.0 mm, still more preferably not more than 38.0 mm. [0044] If the distance in the back-and-forth direction between the sweet spot SS and the clubshaft axis CL is too small, the distance in the back-and-forth direction between the center G of gravity and the axis CL (and the angle delta between line z and plane VP 1 in FIG. 2 ) becomes increased. Therefore, there is a tendency that the head turns over the right address position at impact and a hook shot is liable occur. Further, the head 1 also becomes easy to rotate around a horizontal axis extending in the toe-heel direction, and as a result, the ball is liable to hit a lower part of the club face 2, which increases the backspin. [0000] Therefore, the distance Q of the sweet spot SS measured perpendicularly to and from the above-mentioned vertical plane VP 1 including the axis CL is preferably set in a range of from not less than 0.060 times, more preferably not less than 0.070 times, still more preferably not less than 0.080 times the head depth W. [0045] However, if the distance Q is more than 0.25, the air resistance of the head increases because the position of the club shaft shifts backward as the distance Q increases and the air resistance increases as the club shaft shifts backward. Therefore, the distance Q is preferably set in a range of from not more than 0.25 times, more preferably not more than 0.22 times, still more preferably not more than 0.20 times the head depth W. [0046] In this embodiment, the absolute value of the distance Q is preferably set in a range of from not less than 5.0 mm, more preferably not less than 7.0 mm, still more preferably not less than 9.0 mm, but, not more than 25 mm, more preferably not more than 22 mm, still more preferably not more than 20 mm. [0047] FIGS. 3, 4 and 5 each show an example of the configuration to decrease the sweet spot height H while increasing the (W/L). [0048] In FIG. 3, the crown portion 4 is relatively flattened by providing a large radius Rc of curvature, and the maximum thickness D (or height) of the head is decreased. [0049] In the vertical plane VP 2 including the straight N, the radius Rc of curvature of the outer surface of the crown portion 4 is preferably set in a range of from not less than 150 mm, more preferably not less than 180 mm, still more preferably not less than 200 mm, but, preferably not more than 500 mm, more preferably not more than 450 mm. [0050] Further, the maximum thickness D of the club head is preferably set in a range of from not more than 65 mm, more preferably not more than 63 mm, still more preferably not more than 60 mm, but, not less than 45 mm, more preferably not less than 50 mm. [0051] In FIG. 4, the side portion 6 is gradually decreased in the vertical height from the front to the back, and the height h at the extreme rear end point B is set in a range of not more than 45% but not less than 20% of the maximum thickness D of the club head. The crown portion 4 is provided with a convex curvature. [0052] In FIG. 5, the crown portion 4 is provided with a concave curvature. [0053] In addition to these designs shown in FIGS. 3-5, [0054] to reduce the weight of the head in the crown portion 4 and/or side portion 6 by using light weight materials having a relatively low specific gravity, e.g. metal materials such as magnesium alloys and aluminum alloys, resins such as engineering plastics and fiber reinforced resins; [0055] to reduce the weight of the head in the crown portion 4 and/or side portion 6 by decreasing the wall thickness thereof; [0056] to provide one or more unclosed openings in the crown portion 4 ; [0057] to decrease the amount of protrusion of the hosel portion 1 b ; can be also employed. [0058] In the case that the crown portion 5 and/or side portion 6 is decreased in the thickness, it is desirable to reduce the thickness to a small range of 0.3 to 0.5 mm by press molding a rolled metal sheet since it is difficult to reduce the thickness less than 0.6 or 0.7 mm by casting the meta material. [0000] In order to weld such thin metal plates, plasma welding, especially laser welding is preferred. Further, soldering, adhesive bonding and the like can be used. [0059] Furthermore, the following designs to lower the mass distribution of the head can be used: [0060] to flatten the sole portion 5 by providing the outer surface with a large radius Rs of curvature ( FIG. 1 ); [0061] to increase the thickness of the sole portion 5 wholly or partially; and [0062] to provide a separate weight member 10. [0063] FIG. 6 shows a way of setting a weight member 10 in the hollow shell structure 1 a. [0064] FIGS. 7 and 8 show a way of setting a weight member 10 outside the hollow shell structure 1 a. [0065] The weight member 10 is made from a material having a larger specific gravity than that of the hollow shell structure 1 a, especially the material of the sole portion 5. For example, stainless steels, brass, tungsten, tungsten alloys and the like can be used. [0066] In FIG. 6, a weight member 10 is fixed to the sole portion 5. By placing the weight member 10 near the club face 2, the sweet spot height H can be effectively reduced. [0067] In this example, to mount the weight member 10, the sole portion 5 is provided with a socket protruding into the hollow shell, and the weight member 10 is put in the socket. To fix the weight member, caulking, adhesive agent and the like can be utilized. [0068] In FIGS. 7 and 8, the weight member 10 is an arched round bar extending from the toe to the heel along the side portion 6, leaving a space therebetween. The ends 10 a and 10 b are fixed to the side portion 6 at the toe and heel. Such weight member 10 can increase the depth of the center of gravity, while decreasing the sweet spot height. Comparative Tests: [0069] Golf club heads having a head volume of 460 cc and a loft angle of 10 degrees were made based on the structure shown in FIGS. 1-3, and tested as follows. [0070] Each of the heads is composed of a hollow main body (m) having a front opening, and a face plate (f) attached to the hollow main body so as to cover the front opening. [0071] As shown in FIG. 9, the face plate (f) defines the face portion 3 and a turnback 11 is provide around the face portion 3 so as to extend backward from the edge of the club face 2. The amount of the backward extension F of the turnback was 10 mm excepting a part near the hosel portion. [0000] The face plate (f) was a casting of a titanium alloy Ti-5.5Al-1Fe (“Super Ti—X 51AF” Nippon steel corporation). The hollow main body (m) was a casting of a titanium alloy Ti-6Al-4v. The hollow main body (m) was fixed to the face plate (f) by laser welding. [0072] In the sole portion, as shown in FIG. 6, a weight member 10 made of sintered compact of a tungsten nickel alloy having a specific gravity of 12 was fixed thereto. The weight member put in a socket was fixed to the sole portion by means of caulking and an adhesive. [0073] The total weight of the club head was 205 grams. [0074] The sweet spot height H was varied by changing the thicknesses of the sole portion and side portion and the position and mass of the weight member. [0075] The specifications are shown in Table 1. [0076] In the comparison tests, the club heads were attached to identical shafts to make wood clubs having a total length of 44.75 inches. [0077] Using each club, ten right-handed golfers having handicap ranging from 5 to 20 hit golf balls six times per person. [0078] The average carry distance was computed for each club from the sixty shots. [0079] Further, the deviation (yard) of the point of fall of the struck ball from the target line of the ball was measured, providing that the value is −(minus) when the point of fall is right of the target line, and +(plus) when left of the target line. And the average deviation was computed for each club from the sixty shots. Usually, it is required that the absolute value of the average is at most 10 yards. When the absolute value is less than 5, the directionality of the head is regarded as very good. [0080] As to easiness of swing the club, and sense of ease when addressed to the ball, each head was evaluated into five ranks (5: very good, 4: Good, 3: Average, 2: Baddish, 1: Bad) by the ten golfers. The average value was computed for each club from the evaluations by the ten golfers. [0081] The test results are shown in Table 1. [0000] TABLE 1 Ex. 1 Ex. 2 Ex. 3 Ex. 4 Ex. 5 Ex. 6 Ref. 1 Ref. 2 Head Head depth W (mm) 102 107 112 107 112 112 100 121 Head length L (mm) 128 122 118 122 118 118 133 110 ratio(W/L) 0.80 0.88 0.95 0.88 0.95 0.95 0.75 1.10 Sweet spot height H (mm) 29.0 35.0 40.0 31.0 37.0 33.0 29.0 45.0 Distance GL (mm) 41 39 37 39 37 36 43 38 Distance Q (mm) 18 18 18 18 18 18 18 18 Ratio(Q/W) 0.18 0.17 0.16 0.17 0.16 0.16 0.18 0.15 Test results Carry distance (yard) 240 239 236 247 241 249 236 232 Deviation (yars) −4.2 +1.8 +3.1 +2.4 +3.8 +4.6 −12.3 +18.6 Sense of ease 3.1 4.0 4.4 4.1 4.5 4.4 1.8 4.2 Easiness of swing 2.9 3.6 4.2 3.7 4.3 4.3 2.7 4.0 [0082] From the test results, it was confirmed that the heads according to the present invention can be improved in the carry distance, deviation (directionality), easiness of swing, and sense of ease when addressed from a comprehensive standpoint.

Summary: A wood-type golf club head has a hollow shell structure having a head length L (mm), a head-depth W (mm) and a sweet spot height H (mm) which satisfy: 0.80≦W/L≦1.0 and H≦76x(W/L)−31. The head length L is the distance between the clubshaft axis CL and a point T farthest from the clubshaft axis CL. The head depth W is the distance between a plane FP tangent to the sweet spot SS and a point B farthest from the plane FP.

big_patent

en

Write a title and summarize: Apical–basal polarity is essential for the formation and function of epithelial tissues, whereas loss of polarity is a hallmark of tumours. Studies in Drosophila have identified conserved polarity factors that define the apical (Crumbs, Stardust, Par-6, atypical protein kinase C [aPKC]), junctional (Bazooka [Baz]/Par-3), and basolateral (Scribbled [Scrib], Discs large [Dlg], Lethal [2] giant larvae [Lgl]) domains of epithelial cells. Because these conserved factors mark equivalent domains in diverse types of vertebrate and invertebrate epithelia, it is generally assumed that this system underlies polarity in all epithelia. Here, we show that this is not the case, as none of these canonical factors are required for the polarisation of the endodermal epithelium of the Drosophila adult midgut. Furthermore, like vertebrate epithelia but not other Drosophila epithelia, the midgut epithelium forms occluding junctions above adherens junctions (AJs) and requires the integrin adhesion complex for polarity. Thus, Drosophila contains two types of epithelia that polarise by fundamentally different mechanisms. This diversity of epithelial types may reflect their different developmental origins, junctional arrangement, or whether they polarise in an apical–basal direction or vice versa. Since knock-outs of canonical polarity factors in vertebrates often have little or no effect on epithelial polarity and the Drosophila midgut shares several common features with vertebrate epithelia, this diversity of polarity mechanisms is likely to be conserved in other animals. Most animal organs and tissues are composed of epithelial cells that adhere laterally to each other to form sheets that act as barriers between compartments. The formation of epithelial monolayers depends on the coordinated polarisation of each cell along its apical–basal axis, and this polarity underlies all aspects of epithelial biology [1,2]. For example, the function of epithelia as barriers to fluids and pathogens depends on the correct positioning of the occluding cell–cell junctions (septate junctions [SJs] in invertebrates and tight junctions in vertebrates), whereas the adhesion between cells depends on the lateral localisation of cadherin-dependent adherens junctions (AJs). Much of our understanding of how epithelial cells polarise comes from studies of Drosophila melanogaster that have identified a conserved set of epithelial polarity factors that define different cortical domains along the apical–basal axis of the cell. The apical domain is specified by the transmembrane protein Crumbs, the adaptor protein Stardust, and the Par-6/atypical protein kinase C (aPKC) complex; the boundary between the apical and lateral domains is defined by Bazooka (Baz, Par-3 in other organisms), which positions the apical-most lateral junction; and the rest of the lateral domain is marked by Scribbled (Scrib), Discs large (Dlg), and Lethal (2) giant larvae (Lgl) [3]. Null mutations in any of these factors disrupt epithelial polarity in the primary epithelium that forms from the cellular blastoderm of the Drosophila embryo and gives rise to most of the structures of the larva and adult [4–11]. Similarly, loss of any of these genes disrupts the secondary epithelium formed by the follicle cells that surround the developing oocyte [12–14]. In each tissue, Baz seems to play a pivotal role in positioning the apical AJs and in localising the apical factors, which then exclude Baz from the apical domain [15–19]. The identity of the apical and lateral domains is then maintained by mutual antagonism between apical and lateral factors [20,21]. The requirement for some of these factors becomes less stringent in polarised epithelia as they mature. For example, Crumbs is particularly important in epithelial tissues that are remodelling their cell junctions as they undergo morphogenetic rearrangements, and Scrib, Dlg, and Lgl are not required to maintain polarity in mid-embryogenesis, as the Yurt group of lateral proteins takes over the antagonism of the apical factors, although Scrib and Dlg are still required for the formation of the SJs [20–24]. Epithelial cells are thought to have evolved at the origin of multicellularity, as cells first started to adhere to each other to form sheets, suggesting that apical–basal polarity is an ancient invention that is controlled by a conserved mechanism [25]. In support of this view, all of the canonical epithelial factors in Drosophila are conserved in vertebrates and localise to the equivalent cortical domains [26–33]. Knock-downs or knock-outs of some of these factors impair polarity in certain contexts, such as in Xenopus embryonic blastomeres and in some cultured cell lines [34–37]. In most cases, however, knock-outs of canonical polarity factors have little or no effect on polarity or cause unrelated phenotypes. For example, mice homozygous for a null mutation in PAR-3 die in mid-gestation from a heart defect caused by a failure of the epicardial cell migration, but other embryonic epithelia appear to form normally [38]. Similarly, knock-out of PAR-3 in mouse mammary stem cells disrupts the morphogenesis of the mammary gland but not the ability of the cells to polarise [39,40]. Finally, Scrib functions as a planar cell polarity gene in mice but has no obvious effect on apical–basal polarity [41]. Although this lack of polarity phenotypes in mammals could be a result of redundancy between paralogues, it raises the possibility that at least some vertebrate epithelia polarise by different mechanisms from the model Drosophila epithelia. In support of this view, many mammalian epithelia require integrin adhesion to the basement membrane to orient their polarity, whereas the well-characterised Drosophila epithelia do not [42–44]. Furthermore, vertebrate epithelial cells have an inverted arrangement of junctions compared to insect epithelia: the apical junction in vertebrates is the occluding, tight junction, which forms at the apical/lateral boundary above a lateral zonula adherens (ZA), whereas insect cells form lateral SJs, below an apical ZA [45–47]. The possibility that the polarisation of some epithelia is independent of the canonical polarity system prompted us to ask if all Drosophila epithelia polarise in the same way. We therefore examined polarity in the Drosophila adult midgut epithelium, which is mainly absorptive rather than secretory and is endodermal in origin, unlike the well-characterised epithelia, which are secretory and arise from the ectoderm or mesoderm [48]. The adult midgut is a homeostatic tissue in which basal intestinal stem cells (ISCs in Fig 1F) divide to produce new cells that integrate into the epithelium to replace dying enterocytes (ECs), which are shed into the gut lumen. This has the advantage that one can generate homozygous mutant stem cell clones in heterozygotes at the late pupal or adult stage to produce clonal patches of mutant ECs in the adult midgut without disrupting the development of the tissue. Our results reveal that the polarisation of the midgut epithelium does not require any of the canonical polarity factors and has several features in common with vertebrate epithelia, making it a useful model for investigating alternative polarity pathways. The midgut is a typical epithelium with an apical brush border marked by F-actin (Fig 1A) and phospho-Moesin (pMoe) (Fig 1B) as well as Myosin IA (Fig 1E) and an apical domain marked by Myosin 7a (Fig 1C). However, our analysis led us to rediscover an interesting property of this epithelium: the smooth SJs, which form the occluding barrier to paracellular diffusion, form at the apical side of the lateral domain, above AJs, which are diffusely distributed over the lateral domain [49–52] (Fig 1D and 1F). This is the opposite way around compared to other Drosophila epithelia, in which the AJs condense to form a ZA around the apical margin of the cell, with the SJs, if present, positioned more basally in the lateral membrane. The organisation of junctions in the midgut therefore resembles the junctional arrangement in mammals, in which the occluding tight junctions form above the AJ. In secretory epithelia, the Crumbs/Stardust complex defines the apical and marginal region and anchors the Par-6/aPKC complex in this domain [5,9, 53]. Apical Crb and aPKC then exclude Baz/Par-3 to define the apical/lateral boundary by positioning the apical AJs [17–19]. This raises the question of whether these factors mark the same positions or the same structures when the junctions are reversed in the midgut. Crumbs is not detectable in the adult midgut epithelium, as has previously been observed in the embryo [4] (Fig 2A). We used the mosaic analysis with a repressible cell marker (MARCM) technique [54] to generate positively marked clones in the adult midgut epithelium for null mutations in crumbs or stardust (crb8F–105, crb11A22; sdtk85). The adults were then dissected 8 to 10 days after clone induction to allow the stem cells, which divide about once a day, to go through multiple divisions because this rules out any perdurance of wild-type proteins expressed before the clones were induced. However, clones of crb and sdt null mutations give no obvious phenotypes (Fig 2B, S1A, S1D and S1E Fig). Overexpression of Crumbs expands the apical domain in other Drosophila epithelia [55]. By contrast, ectopic expression of Crumbs in the adult midgut epithelium does not affect EC polarity and the Crumbs protein does not localise apically, concentrating instead in the basal labyrinth (BL), an extensive set of tubular membrane invaginations from the EC basal surface (Fig 2C). Baz/Par-3 is also not detectable in ECs, although it is expressed in the ISCs, in which it localises apically as previously reported [56] (Fig 2D). MARCM clones homozygous for baz null alleles (baz815–8; baz4) occur at a similar frequency to wild-type clones and contain a normal number of cells, arguing against a role for Baz in asymmetric stem cell division, consistent with the view that these divisions are random and largely symmetric [57]. More importantly, baz null mutant ECs integrate into the epithelium and develop normal apical–basal polarity, in contrast to other epithelia in Drosophila (Fig 2E, S1B, S1C and S1F Fig). Baz-green fluorescent protein (GFP) localises apically and to the AJs when ectopically expressed in the midgut epithelium, consistent with binding to the Par-6/aPKC complex and to E-cadherin complexes (Fig 2F). However, ectopic Baz expression has no effect on the polarity of the ECs or on the formation of an apical SJ. Both aPKC and Par-6 are expressed in the midgut and localise apically, as they do in all other epithelia (Fig 3A and 3B). In most polarised cells, the apical localisation of the Par-6/aPKC complex depends on Baz/Par-3, and in epithelia, this also requires Crumbs and Stardust [2]. Consistent with our observation that these proteins are absent from ECs, neither Baz nor Crb are required for the localisation of Par-6, indicating that the latter must be targeted apically by a distinct mechanism (S1A and S1B Fig). Surprisingly, the apical domain forms normally in par-6Δ226 and aPKCk06043 mutant clones, and the morphology of the cells is unaffected (Fig 3C, S1H and S1J Fig). Although aPKCk06043 is considered a null allele, the corresponding P element insertion does not disrupt the shorter isoforms of aPKC. Thus, it is conceivable that some aPKC activity remains in aPKCk06043 homozygous mutant cells. We therefore used CRISPR to generate a complete null, aPKCHC, a frameshift mutation resulting in a premature stop codon and a truncation of aPKC at amino acid 409, which is located in the middle of the kinase domain (S1L Fig). Homozygous aPKCHC clones also show no phenotype, forming normal actin-rich brush borders and SJs, confirming that aPKC is dispensable for EC polarity (Fig 3D and 3E). Nevertheless, Par-6 is lost from the apical domain in aPKCk06043 clones and aPKC is not apical in par-6Δ226 clones, showing that their localisations are interdependent (Fig 3F and 3G). Thus, the Par-6/aPKC complex still marks the apical domain of the midgut epithelium but is not required for its formation or maintenance. The lateral polarity factors Scrib, Dlg, and Lgl are all expressed in the midgut and colocalise with each other to the SJs, marked by the conserved SJ component, Coracle [58] (Fig 1B and 1C, S2A Fig). Since the SJs form at the apical side of the lateral membrane in the midgut, in the position occupied by the AJs in other Drosophila epithelia, these proteins mark a conserved structure rather than a conserved position. The lateral epithelial polarity factors are required for the formation of pleated SJs in the embryo [20,21,59]. However, the smooth SJs form normally in scrib, dlg, and lgl mutant clones or when these factors are depleted by RNA interference (RNAi) (Fig 4A and 4C, S2B Fig). The apical domain is also unaffected in scrib, dlg, and lgl mutant or knock-down cells, in contrast to other epithelia in which apical factors are mislocalised to the basolateral domain (Fig 4E and 4F, S2C and S2D Fig). In stage 13 embryos, the Yurt complex excludes apical factors from the lateral membrane in place of Scrib, Dlg, and Lgl [23,24]. We therefore also examined the role of Yurt in the midgut. Yurt localises to the SJs, as it does in the embryo, but yurt mutant clones still polarise normally and form SJs that recruit Lgl (Fig 5). Finally, we examined Par-1, which localises laterally in other epithelia in which it plays a role in localising AJs through phosphorylation of Baz and in organising the microtubule cytoskeleton [60,61]. Par-1 is expressed in the ISCs, in which it localises laterally but is not detectable in the ECs. Consistent with its lack of expression, par-19 mutant ECs show normal apical–basal polarity (S3A and S3B Fig). Thus, all the canonical epithelial polarity factors are dispensable for the polarisation of the midgut epithelium, even though Par-6, aPKC, Scrib, Dlg, Lgl, and Yurt are expressed and localise to equivalent positions to secretory epithelia. The relationships between the lateral factors has been difficult to assess in other epithelia because mutants in scrib, dlg, and lgl give rise to round, unpolarised cells without an identifiable lateral domain [11]. We took advantage of the normal EC polarisation in these mutants to investigate the interdependence of their recruitment to the SJs. Neither Dlg nor Lgl are recruited to SJs in cells depleted of Scrib by RNAi (Fig 4B and S2D Fig). Scrib localises normally in dlg mutant clones, whereas both Scrib and Dlg localise normally to the SJs in lgl mutant clones (Fig 4C–4F). Thus, there is a simple hierarchical relationship between these factors in the midgut epithelium, in which Scrib is required to recruit Dlg, which is needed for Lgl localisation. The surprising observation that none of the classical epithelial polarity factors are required for the apical–basal polarisation of the midgut epithelium raises the question of how polarity is generated and maintained. Given the similar junctional arrangement to mammalian epithelia, we addressed whether polarity in midgut ECs depends on integrin-dependent adhesion to the extracellular matrix, as it does in several mammalian epithelia [42–44]. Components of the integrin adhesion complex, such as the α-integrin Mew and the essential cytoplasmic adaptor proteins Talin (Drosophila Rhea) [63] and Kindlin (Drosophila Fit 1 [64]; Fit 2 is not detectable expressed in the midgut) are highly localised to the basal side of the midgut epithelium (Fig 6A). The expression of two α-integrins and two β-integrins in the midgut complicates the genetic analysis of their function, so we focused on the cytoplasmic components of the integrin adhesion complex. Clones of cells homozygous for null alleles of rhea (rhea79a and rheaB128) detach from the basement membrane and fail to polarise, forming irregularly shaped cells that do not form SJs or an apical domain (Fig 6B). Most rhea mutant cells remain within the epithelial layer, below the SJs of the wild-type cells, probably because they do not form SJs themselves (Fig 6B and S4A Fig). Despite their inability to polarise and integrate into the epithelium, the mutant cells still appear to differentiate: they become polyploid, the size of their nuclei is not significantly different from that of wild-type cells (rhea nuclear long axis: 6. 0 μm ± 1. 0 μm versus heterozygous cells: 6. 9 μm ± 0. 9 μm), and they express the marker for differentiating ECs, Pdm1 [65] (Fig 6B). Cells mutant for both Fit1 and Fit2 show a similar phenotype to Talin mutants. Mutant cells have normal nuclear dimensions (Fit1 Fit2 nuclear long axis: 6. 6 μm ± 1. 2 μm versus heterozygous cells: 6. 9 μm ± 1. 0 μm) and express Pdm1 but fail to localise apical markers or form SJs (Fig 6C and S4B Fig). The ISCs lie beneath the epithelium and differentiating ECs must therefore integrate into the epithelium from the basal side, inserting between the SJs of the flanking ECs while maintaining an intact barrier. We therefore examined the effects of mutations in the core SJ components Tsp2a and Mesh [51,52]. More than 90% of mutant cells fail to integrate through the SJs of the neighbouring wild-type cells, and the clones form clusters on the basal side of the epithelium (Fig 7A, S3A and S4C Figs). Nevertheless, the mutant cells still appear to differentiate normally, as shown by their nuclear size (Tsp2a nuclear long axis: 6. 0 μm ± 0. 9 μm versus heterozygous cells: 6. 6 μm ± 0. 8 μm) and Pdm1 expression (S4D Fig). Wild-type cells start to form an apical domain as they integrate, before they have a free apical surface, as shown by the enrichment of apical components such as Myo7a (arrowhead in Fig 7B). By contrast, apical markers only weakly localise in cells mutant for SJ components and never form a clear apical domain, even if the cells are extruded from the apical side of the epithelium (Fig 7B and 7C). Thus, the midgut epithelium appears to polarise in a basal to apical manner, in which adhesion to the ECM is required for the formation of the SJs and the SJs are needed for the formation of the apical domain (Fig 7D). Our results reveal that the intestinal epithelium polarises by a fundamentally different mechanism from other Drosophila epithelia, as none of the classical epithelial polarity genes are required for its apical–basal polarisation. This cannot be attributed to redundancy between paralogues, as might be the case in vertebrates, because all of the polarity factors are single-copy genes in Drosophila. Thus, our observations provide strong evidence against the idea that there is a universal system for polarising epithelial cells. Nevertheless, a core set of the polarity factors (Par-6, aPKC, Scrib, Dlg, and Lgl) is expressed in the midgut epithelium, and these proteins localise to the equivalent positions to other Drosophila epithelia. Thus, they may still serve important functions in the midgut epithelium that are not essential for the overall apical–basal polarisation of the cells. Given that all other epithelia in Drosophila use the canonical polarity pathway, our observations raise the question of why the midgut epithelium is different. This is unlikely to reflect the fact that the midgut is absorptive rather than secretory, as secretory cells in the midgut, such as the enteroendocrine (ee) cells and the acid-secreting copper cells, polarise in the same way as the ECs (S1J and S1K Fig). One key difference between the midgut epithelium and other epithelia is that it is the only epithelial tissue of endodermal origin in the fly, whereas all other epithelia are ectodermal or mesodermal. Thus, it is possible that endodermal epithelia are intrinsically different in the way that they polarise. In support of this view, it has recently been found that PAR-3, PAR-6, and aPKC are degraded in the invaginating endomesoderm of the Cnidarian Nematostella vectensis and are not required for this tissue to form an epithelium [67]. Thus, the difference between endodermal and ectodermal polarity systems may have evolved before the origin of Bilateria. The Drosophila midgut arises from the cellular blastoderm of the embryo and initially polarises in the same way as other embryonic epithelia before it undergoes an epithelial-to-mesenchymal transition (EMT) under the control of the endodermal GATA family transcription factor, Serpent [68]. Serpent drives EMT at least in part by inhibiting the transcription of crumbs and stardust and might therefore contribute to the switch in polarity mechanisms. However, Serpent is turned off as the midgut primordium migrates and is not expressed when the cells reform an epithelium to generate the midgut tube. Indeed, continued expression of Serpent blocks the cells from re-epithelising after migration. Thus, a pulse of Serpent expression may trigger the switch in polarity mechanisms, perhaps through downstream transcription factors, but Serpent itself prevents epithelial polarisation. A second important difference between the adult midgut epithelium and other epithelia in Drosophila is its reversed arrangement of occluding junctions and AJs, with apical SJs forming above lateral AJs. In other Drosophila epithelia, Baz plays a key role in concentrating the AJs at the apical margin of the lateral membrane to form the ZA [69]. Thus, the absence of Baz in midgut ECs may contribute to the absence of an apical ZA. This cannot be the only factor making the midgut different, however, as ectopic expression of Baz in midgut ECs does not alter the position of the SJs. One reason why the SJs may have evolved to form above the AJs in the midgut is that this places the barrier to paracellular diffusion apically, thereby preventing the contents of the gut lumen from accessing the lateral sides of the cell, which is presumably important because the gut is full of digestive enzymes and potential pathogens. Other Drosophila epithelia that face the external environment—such as the epidermis, trachea, foregut, and hindgut—secrete an impermeable cuticle, which provides a protective covering to prevent pathogens from accessing the cell surface [70]. The development of the typical arthropod cuticular exoskeleton may therefore have freed these epithelia from the need to place their occluding junctions apically, allowing the apical positioning of the ZA. The third important difference between the midgut epithelium and other epithelia is that the ECs polarise in a basal-to-apical direction as they integrate into the epithelium, whereas all other Drosophila epithelia polarise in an apical-to-basal direction. For example, the primary embryonic epithelium forms during cellularisation, as the furrow canals grow in from the apical surface of the embryo between the nuclei, while the follicle cells polarise in response to an apical cue from the germ line [14,71]. Thus, it is possible that the mechanism by which cells polarise depends on the order in which they generate the basal, lateral, and apical domains. Since the midgut is the only endodermal epithelium in Drosophila, the only epithelium with apical SJs, and the only epithelium that polarises from basal to apical, it is not possible to determine which of these characteristics underlies its alternative mechanism of cell polarisation, and this will require analysis in other organisms with a greater diversity of epithelial cell types. Whatever the reason for the alternative polarity mechanism in the Drosophila midgut epithelium, its polarity is much more similar to that of well-characterised vertebrate epithelia than other Drosophila epithelia. Firstly, the midgut and vertebrate epithelia have apical occluding junctions above lateral AJs, whereas other Drosophila epithelia have a reversed arrangement of junctions. Secondly, the midgut epithelium does not require the canonical epithelial polarity factors that are essential in other Drosophila epithelia, and this also seems to be the case in some vertebrate epithelia, although this may be due to redundancy between paralogues. Thirdly, the midgut epithelium and a number of vertebrate epithelia depend on signals from the integrin adhesion complex to polarise correctly [42–44]. These similarities suggest that the Drosophila midgut epithelium may prove a better in vivo model for at least some types of vertebrate epithelia. It will therefore be important to determine whether vertebrates also contain distinct types of epithelia whose polarity is controlled by different factors. w1118 or y2 or OreR flies were used as wild type unless otherwise specified. Other stocks used in this study were as follows: The following stocks were used to generate (positively labelled) MARCM [54] clones: Negatively marked clones on the X chromosome were generated using the following stock: Standard procedures were used for Drosophila husbandry and experiments. Flies were reared on standard fly food supplemented with live yeast at 25 °C. For the conditional expression of UAS responder constructs (e. g., RNAi) in adult flies, parental flies were crossed at 18 °C and the resulting offspring reared at the same temperature until eclosion. Adult offspring were collected for 3 days and then transferred to 29 °C to inactivate the temperature-sensitive GAL80 protein. To generate MARCM or GFP-negative clones, flies were crossed at 25 °C and the resulting offspring subjected to heat shocks either as larvae (from L2 until eclosion) or as adults (5–9 days after eclosion). Heat shocks were performed at 37 °C for 1 h (twice daily). Flies were transferred to fresh food vials every 2–3 days and kept at 25 °C for at least 9 days after the last heat shock to ensure that all wild-type gene products from the heterozygous progenitor cells had turned over. For this study, all (midgut) samples were obtained from adult female flies. Samples were dissected in PBS and fixed with 8% formaldehyde (in PBS containing 0. 1% Triton X-100) for 10 min at room temperature. Following several washes with PBS supplemented with 0. 1% Triton X-100 (washing buffer), samples were incubated in PBS containing 3% normal goat serum (NGS, Stratech Scientific Ltd, Cat. #005-000-121; concentration of stock solution: 10 mg/ml) and 0. 1% Triton X-100 (blocking buffer) for 30 min. This fixation method was only used for samples in which F-actin was stained with fluorescently labelled phalloidin, as phalloidin staining is incompatible with heat fixation. The heat fixation protocol is based on a heat–methanol fixation method used for Drosophila embryos [82]. Samples were dissected in PBS, transferred to a wire mesh basket, and fixed in hot 1X TSS buffer (0. 03% Triton X-100,4 g/L NaCl; 95 °C) for 3 s before being transferred to ice-cold 1X TSS buffer and chilled for at least 1 min. Subsequently, samples were transferred to washing buffer and processed for immunofluorescence stainings. After blocking, samples were incubated with the appropriate primary antibody/antibodies diluted in blocking buffer at 4 °C overnight. Following several washes, samples were incubated with the appropriate secondary antibody/antibodies either at room temperature for 2 h or at 4 °C overnight. Samples were then washed several times in washing buffer and mounted in Vectashield containing DAPI (Vector Laboratories) on borosilicate glass slides (No. 1. 5, VWR International). All antibodies used in this study were tested for specificity using clonal analysis (MARCM) or RNAi. Primary antibodies: Mouse monoclonal antibodies: anti-Dlg (4F3), anti-Cora (c615. 16), anti-αSpec (3A9), anti-Arm (N2 7A1), anti-Talin (A22A, E16B), anti-Pros (MR1A), anti-Crb (Cq4), anti-Nrv (Nrv5F7), anti-Mys (CF. 6G11). All monoclonal antibodies were obtained from the Developmental Studies Hybridoma Bank and used at 1: 100 dilution. Rabbit polyclonal antibodies: anti-pEzrin (NEB Cat. #3726S, 1: 200 dilution); anti-Lgl (Santa Cruz Biotechnoloy Inc., d-300, Cat. #SC98260,1: 200 dilution); anti-aPKC (Santa Cruz Biotechnoloy Inc., Cat #SC216,1: 100 dilution); anti-βHSpec [83] (gift from C. Thomas, The Pennsylvania State University, USA, 1: 1,000 dilution); anti-Baz [6] (gift from A. Wodarz, University of Cologne, Germany, 1: 200 dilution); anti-Par6 [84] (gift from D. J. Montell, UCSB, USA, 1: 500 dilution); anti-Mesh [51] and anti-Tsp2A [52] (gift from M. Furuse, 1: 1,000 dilution); anti-Scrib [85] (gift from C. Q. Doe, University of Oregon, USA, 1: 1,000 dilution); anti-Pdm1 [86] (gift from F. J. Diaz-Benjumea, Centre for Molecular Biology" Severo Ochoa" (CBMSO), Spain, 1: 1,000 dilution); anti-Cno [87] (gift from M. Peifer, UNC, USA, 1: 1,000 dilution). Other antibodies used: chicken anti-GFP (Abcam, Cat. #ab13970,1: 1,000 dilution); guinea pig anti-Yurt [88] (gift from U. Tepass, University of Toronto, Canada, 1: 1,000 dilution); guinea pig anti-Myo7a [89] (gift from D. Godt, University of Toronto, Canada, 1: 1,000 dilution); guinea pig anti-Shot [90] (1: 1,000 dilution); rat anti-Mesh [51] (gift from M. Furuse, 1: 1,000 dilution). Secondary antibodies: Alexa Fluor secondary antibodies (Invitrogen) were used at a dilution of 1: 1,000. Alexa Fluor 488 goat anti-mouse (#A11029), Alexa Fluor 488 goat anti-rabbit (#A11034), Alexa Fluor 488 goat anti-guinea pig (#A11073), Alexa Fluor 488 goat anti-chicken IgY (#A11039), Alexa Fluor 555 goat anti-rat (#A21434), Alexa Fluor 555 goat anti-mouse (#A21422), Alexa Fluor 555 goat anti-rabbit (#A21428), Alexa Fluor 568 goat anti-guinea pig (#A11075), Alexa Fluor 647 goat anti-mouse (#A21236), Alexa Fluor 647 goat anti-rabbit (#A21245), Alexa Fluor 647 goat anti-rat (#A21247). Only cross-adsorbed secondary antibodies were used in this study to eliminate the risk of cross-reactivity. F-Actin was stained with phalloidin conjugated to Rhodamine (Invitrogen, Cat. #R415,1: 500 dilution). Images were collected on an Olympus IX81 (40× 1. 35 NA Oil UPlanSApo, 60× 1. 35 NA Oil UPlanSApo) using the Olympus FluoView software Version 3. 1 and processed with Fiji (ImageJ). Endogenously tagged aPKC with EGFP fused to the N-terminus was generated by CRISPR-mediated homologous recombination. In vitro synthesised gRNA [91] to a CRISPR target approximately 60 nucleotides downstream from the aPKC start codon (target sequence GAATAGCGCCAGTATGAACATGG) and a plasmid donor containing the ORF of EGFP as well as appropriate homology arms (1. 5 kb upstream and downstream) were coinjected into nos-Cas9–expressing embryos (Bloomington #54591; also known as CFD2) [92]. Single F0 flies were mated to y w flies and allowed to produce larvae before the parent was retrieved for PCR analysis. Progeny from F0 flies in which a recombination event occurred (as indicated by PCR) were further crossed and analysed to confirm integration. Several independent EGFP-aPKC lines were isolated. Recombinants carry the EGFP coding sequence inserted immediately downstream of the endogenous start codon and a short linker (amino acid sequence: Gly-Ser-Gly-Ser) between the coding sequence for EGFP and the coding sequence for aPKC. Homozygous flies are viable and healthy. We used the CRISPR/Cas9 method [91] to generate a null allele of aPKC. sgRNA was in vitro transcribed from a DNA template created by PCR from two partially complementary primers: forward primer: 5′-GAAATTAATACGACTCACTATAggattacggcatgtgtaaggGTTTTAGAGCTAGAAATAGC-3′; reverse primer: 5′- AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3′. The sgRNA was injected into Act5c-Cas9 embryos [92]. Putative aPKC mutants in the progeny of the injected embryos were recovered, balanced, and sequenced. The aPKCHC allele contains a small deletion around the CRISPR site, resulting in one missense mutation and a frameshift that leads to stop codon at amino acid 409 in the middle of the kinase domain, which is shared by all isoforms (S1L Fig). The aPKCHC allele was subsequently recombined onto FRTG13 to generate MARCM clones. No aPKC protein was detectable by antibody staining in both midgut and follicle cell clones, and follicle cells homozygous for aPKCHC display a phenotype that is indistinguishable from that observed in follicle cells homozygous for the aPKCK06403 allele. The proportions of rhea, Fit, and Tsp2a mutant cells inside the epithelial layer were calculated as follows: images were taken of different regions of several midguts containing MARCM clones stained with an apical marker. Cells that were above the neighbouring cells or had a clear apical domain were counted as ‘cells NOT inside the layer’, whereas cells without a detectable free apical surface were counted as ‘cells inside the layer’. Data were analysed with Graphpad Prism software. The graph in S4A Fig shows the average percent of cells inside the layer ± SD%. The nuclear long axis of rhea, Fit, and Tsp2a mutant clones was manually measured in 20 random mutant cells (stained with DAPI, excluding obvious ISCs) and 20 surrounding heterozygous cells using Fiji. All experiments were repeated multiple times with independent crosses: Baz-EGFP (4 independent experiments), EGFP-aPKC (9 independent experiments), Mew-YFP (5 independent experiments), Par6-EGFP (4 independent experiments), Crb-EGFP (5 independent experiments), Fit1-EGFP (4 independent experiments), Myo31DF-YFP (4 independent experiments), MyoIA[ts] > UAS-Scrib-RNAi (11 independent experiments), MyoIA[ts] > UAS-Crb (6 independent experiments), and MyoIA[ts] > UAS-Baz-GFP (3 independent experiments). The phenotypes of homozygous mutant clones were analysed in multiple guts from independent experiments as follows: baz4 (13 independent experiments, 3,078 mutant cells analysed); baz815-8 (4 independent experiments, 734 cells analysed); aPKCk06043 (8 independent experiments, 3,681 mutant cells analysed); aPKCHC (9 independent experiments, 15,984 mutant cells analysed); par6Δ226 (4 independent experiments, 2,558 mutant cells analysed); crb11A22 (4 independent experiments, 1,478 mutant cells analysed); crb8F105 (5 independent experiments, 3,288 mutant cells analysed); lgl4 (6 independent experiments, 6,790 mutant cells analysed); dlg114 (5 independent experiments, 3,092 mutant cells analysed); rhea79a, rheaB28, rheaB128 (4 independent experiments for each genotype, 184 mutant cells analysed in total); Fit118Fit283 (7 independent experiments, 608 double mutant cells analysed); Fit118 (4 independent experiments, 854 mutant cells analysed); ilk54 (5 independent experiments, 65 mutant cells analysed); Tsp2a1-2, Tsp2a2-9, and Tsp2a3-3 (7,4, and 6 independent experiments, respectively; a total of 1,205 Tsp2a mutant cells were analysed); and meshf04955 (5 independent experiments, 643 mutant cells analysed).

Title: An alternative mode of epithelial polarity in the Drosophila midgut Summary: The Drosophila midgut is lined by a single-layered epithelium that acts as a barrier to the environment while allowing for nutrient uptake and related physiological processes. To fulfil these roles, midgut epithelial cells are highly polarised, with a pronounced asymmetric distribution of cellular components. Previous work in Drosophila revealed a conserved set of factors governing cell polarity, and it is thought that this network of proteins underlies all examples of polarity in Drosophila (and other organisms). Here, we demonstrate that the epithelial cells in the Drosophila midgut are not polarised by these canonical polarity factors but instead rely on the integrin adhesion complex. Thus, there are two types of epithelia in Drosophila that polarise using fundamentally different mechanisms. This diversity may reflect a difference in developmental origin (endodermal versus ectodermal), a difference in junctional arrangement, or the direction in which the respective cells polarise. Since knock-outs of canonical polarity factors often have little or no effect on epithelial polarity in vertebrate model systems, this diversity of polarity mechanisms might be conserved in other organisms.

lay_plos

en

Summarize: Actus Quintus. Scena Prima. Enter with Drumme and Colours, Edmund, Regan. Gentlemen, and Souldiers. Bast. Know of the Duke if his last purpose hold, Or whether since he is aduis'd by ought To change the course, he's full of alteration, And selfereprouing, bring his constant pleasure Reg. Our Sisters man is certainely miscarried Bast. 'Tis to be doubted Madam Reg. Now sweet Lord, You know the goodnesse I intend vpon you: Tell me but truly, but then speake the truth, Do you not loue my Sister? Bast. In honour'd Loue Reg. But haue you neuer found my Brothers way, To the fore-fended place? Bast. No by mine honour, Madam Reg. I neuer shall endure her, deere my Lord Be not familiar with her Bast. Feare not, she and the Duke her husband. Enter with Drum and Colours, Albany, Gonerill, Soldiers. Alb. Our very louing Sister, well be-met: Sir, this I heard, the King is come to his Daughter With others, whom the rigour of our State Forc'd to cry out Regan. Why is this reasond? Gone. Combine together 'gainst the Enemie: For these domesticke and particular broiles, Are not the question heere Alb. Let's then determine with th' ancient of warre On our proceeding Reg. Sister you'le go with vs? Gon. No Reg. 'Tis most conuenient, pray go with vs Gon. Oh ho, I know the Riddle, I will goe. Exeunt. both the Armies. Enter Edgar. Edg. If ere your Grace had speech with man so poore, Heare me one word Alb. Ile ouertake you, speake Edg. Before you fight the Battaile, ope this Letter: If you haue victory, let the Trumpet sound For him that brought it: wretched though I seeme, I can produce a Champion, that will proue What is auouched there. If you miscarry, Your businesse of the world hath so an end, And machination ceases. Fortune loues you Alb. Stay till I haue read the Letter Edg. I was forbid it: When time shall serue, let but the Herald cry, And Ile appeare againe. Enter. Alb. Why farethee well, I will o're-looke thy paper. Enter Edmund. Bast. The Enemy's in view, draw vp your powers, Heere is the guesse of their true strength and Forces, By dilligent discouerie, but your hast Is now vrg'd on you Alb. We will greet the time. Enter. Bast. To both these Sisters haue I sworne my loue: Each iealous of the other, as the stung Are of the Adder. Which of them shall I take? Both? One? Or neither? Neither can be enioy'd If both remaine aliue: To take the Widdow, Exasperates, makes mad her Sister Gonerill, And hardly shall I carry out my side, Her husband being aliue. Now then, wee'l vse His countenance for the Battaile, which being done, Let her who would be rid of him, deuise His speedy taking off. As for the mercie Which he intends to Lear and to Cordelia, The Battaile done, and they within our power, Shall neuer see his pardon: for my state, Stands on me to defend, not to debate. Enter.

Summary: The battle between England and France is about to begin. Regan has made Edmund the general of her forces. As the scene opens she speaks to Edmund about her love for him; but she also questions him about Goneril. Edmund denies any interest in her and professes undying love and loyalty to Regan. Regan still warns him about the guile of her sister. Albany and Goneril arrive with their army. Goneril, noticing the rapport between Regan and Edmund, decides that she would rather lose the battle than allow her sister to win Edmund. Albany declares that his sole intention in the battle is to repel the invasion of Britain. Edgar comes in and gives Albany the letter from Goneril, written to Edmund; it is the one he had received from Oswald. He leaves before Albany opens the letter. Edmund enters, says that the battle is about to begin and asks for Albany's presence on the battlefield. Albany exits, leaving Edmund alone on the stage. Edmund unfolds his evil plans in a soliloquy. If Goneril does not first kill her husband, he plans to send Albany into battle, making sure that he is killed there. He will also have the King and Cordelia captured during the battle. His plan is to kill Lear and become the King of England himself. He is unsure who should be his queen. Having made advances to both Regan and Goneril, he knows they are both enamored with him. He also knows if he marries one, it will make the other very angry. If both sisters remain alive, his difficulty will be great; therefore, he must soon choose and act.

booksum

en

Write a title and summarize: SECTION 1. SHORT TITLE; TABLE OF CONTENTS. (a) Short Title.--This Act may be cited as the ``National Class Action Act of 2003''. (b) Table of Contents.--The table of contents for this Act is as follows: Sec. 1. Short title; reference; table of contents. Sec. 2. Coupon settlements in class action cases. Sec. 3. Federal district court jurisdiction for national class actions. Sec. 4. Removal of national class actions to Federal court. Sec. 5. Effective date. SEC. 2. COUPONS SETTLEMENTS IN CLASS ACTION CASES. (a) In General.--Part V of title 28, United States Code, is amended by inserting after chapter 113 the following: ``CHAPTER 114--CLASS ACTIONS ``Sec. ``1711. Definitions. ``1712. Coupons settlements. ``Sec. 1711. Definitions ``In this chapter, the following definitions shall apply: ``(1) Class.--The term `class' means all of the class members in a class action. ``(2) Class action.--The term `class action' means any civil action-- ``(A) filed in a district court of the United States under rule 23 of the Federal Rules of Civil Procedure; or ``(B) any civil action that is removed to a district court of the United States that was originally filed under a State statute or rule of judicial procedure authorizing an action to be brought by 1 or more representatives on behalf of a class. ``(3) Class counsel.--The term `class counsel' means the persons who serve as the attorneys for the class members in a proposed or certified class action. ``(4) Class members.--The term `class members' means the persons (named or unnamed) who fall within the definition of the proposed or certified class in a class action. ``Sec. 1712. Coupons settlements ``(a) Contingent Fees in Coupon Settlements.--If a proposed settlement in a class action provides for a recovery of coupons to a class member, the portion of any attorney's fee to be paid to class counsel based on the recovery of the coupons shall be based on the value to class members of the coupons that are redeemed. ``(b) Other Attorney's Fee Awards in Coupon Settlements.-- ``(1) In general.--If a proposed settlement in a class action provides for a recovery of coupons to a class member, and a portion of the recovery of the coupons is not used to determine the attorney's fee to be paid to class counsel, the attorney's fee shall be based upon the amount of time class counsel expended working on the action. ``(2) Court approval.--Any attorney's fee under this subsection shall be subject to approval by the court and shall include an appropriate attorney's fee for obtaining equitable relief, including an injunction, if applicable. Nothing in this subsection shall be construed to prohibit application of a lodestar with a multiplier method of determining attorney's fees. ``(c) Attorney's Fee Awards Calculated on a Mixed Basis in Coupon Settlements.--If a proposed settlement in a class action provides for an award of coupons to a class member and also provides for equitable relief, including injunctive relief-- ``(1) that portion of the attorney's fee to be paid to class counsel that is based upon a portion of the recovery of the coupons shall be calculated according to subsection (a); and ``(2) that portion of the attorney's fee to be paid to class counsel that is not based upon a portion of the recovery of the coupons shall be calculated according to subsection (b). ``(d) Settlement Valuation Expertise.--In a class action involving the awarding of coupons, the court may in its discretion, upon the motion of a party, receive expert testimony from a witness qualified to provide information on the actual value of the settlement. ``(e) Judicial Scrutiny of Coupon Settlements.--In a class action that provides for a recovery of coupons to a class member, the court may approve a proposed settlement only after a hearing to determine whether, and making a written finding that, the settlement is fair, reasonable, and adequate for class members.''. (b) Technical and Conforming Amendment.--The table of chapters for part V of title 28, United States Code, is amended by inserting after the item relating to chapter 113 the following: ``114. Class Actions........................................ 1711''. SEC. 3. FEDERAL DISTRICT COURT JURISDICTION FOR NATIONAL CLASS ACTIONS. (a) In General.--Chapter 85 of title 28, United States Code, is amended by adding at the end the following: ``Sec. 1370. National class actions ``(a) In addition to the jurisdiction conferred under this chapter, a district court of the United States shall have jurisdiction over a class action in which \1/3\ or fewer of the members of all proposed plaintiff classes in the aggregate are citizens of the State in which the action was originally filed. ``(b) A district court of the United States may, in the interests of justice, decline to exercise jurisdiction over a class action in which greater than \1/3\ but less than \2/3\ of the members of all proposed plaintiff classes in the aggregate are citizens of the State in which the action was originally filed based on consideration of-- ``(1) whether the claims asserted involve matters of State or local interest; ``(2) whether the claims asserted will be governed by laws other than those of the State in which the action was originally filed; ``(3) whether the forum for the class action was chosen frivolously or in bad faith; ``(4) whether the number of citizens of the State in which the action was originally filed in all proposed plaintiff classes in the aggregate is substantially larger than the number of citizens from any other State, and the citizenship of the other members of the proposed class is dispersed among a substantial number of States; and ``(5) whether the State claims asserted by class members of the State in which the action was filed would be preempted by a Federal class action. ``(c) A district court of the United States shall not exercise jurisdiction over a class action in which-- ``(1) \2/3\ or more of the members of all proposed plaintiff classes in the aggregate are citizens of the State in which the action was originally filed; ``(2) the primary defendants are States, State officials, or other governmental entities against whom the district court may be foreclosed from ordering relief; or ``(3) the number of members of all proposed plaintiff classes in the aggregate is less than 100. ``(d) Citizenship of proposed class members in subsection (a), (b), and (c) shall be determined on the date of filing the proposed class action in Federal district court or State court. ``(e) This section shall not apply to any class action that soley involves a claim-- ``(1) concerning a covered security as defined under 16(f)(3) of the Securities Act of 1933 (15 U.S.C. 77p(f)(3)); ``(2) that relates to the internal affairs or governance of a corporation or other form of business enterprise and that arises under or by virtue of the laws of the State in which such corporation or business enterprise is incorporated or organized; or ``(3) that relates to the rights, duties (including fiduciary duties), and obligations relating to or created by or pursuant to any security (as defined under section 2(a)(1) of the Securities Act of 1933 (15 U.S.C. 77b(a)(1)) and the regulations issued thereunder). (f) Nothing in this section shall be construed to limit Federal jurisdiction over any class action that meets diversity of citizenship requirements under section 1332.''. (b) Clerical Amendment.--The table of sections at the beginning of chapter 85 of title 28, United States Code, is amended by adding at the end the following: ``1370. National class actions.''. SEC. 4. REMOVAL OF NATIONAL CLASS ACTIONS TO FEDERAL COURT. (a) In General.--Chapter 89 of title 28, United States Code, is amended by adding at the end the following: ``Sec. 1453. Removal of national class actions ``(a) A class action over which a district court would have jurisdiction under section 1370 may be removed to a district court of the United States, in accordance with this chapter, by-- ``(1) any defendant without the consent of all defendants; or ``(2) any plaintiff class member who has intervened, seeks to be designated as a representative class member, and is not a named or representative class member without the consent of all members of such class. ``(b) The Federal district court which receives a class action removed in accordance with this section shall make a determination regarding the jurisdiction of the proposed class action before deciding a motion to transfer to any other court under-- ``(1) section 1391; or ``(2) section 1407. ``(c) Section 1446 (relating to a defendant removing a case) shall apply to a plaintiff removing a case under this section, except that the application of section 1446(b) (relating to the 30-day filing period requirement) shall be met if a plaintiff class member files notice of removal not later than 30 days after the receipt by such class member, through service or otherwise, of the initial written notice of class action. ``(d) This section shall not apply to any class action that solely involves a claim-- ``(1) concerning a covered security (as defined under section 16(f)(3) of the Securities Act of 1933 (15 U.S.C. 77p(f)(3)); ``(2) that relates to the internal affairs or governance of a corporation or other form of business enterprise and that arises under or by virtue of the laws of the State in which such corporation or business enterprise is incorporated or organized; or ``(3) that relates to the rights, duties (including fiduciary duties), and obligations relating to or created by or pursuant to any security (as defined under section 2(a)(1) of the Securities Act of 1933 (15 U.S.C. 77b(a)(1)) and the regulations issued thereunder).''. (b) Clerical Amendment.--The table of sections at the beginning of chapter 89 of title 28, United States Code, is amended by adding at the end the following: ``1453. Removal of national class actions.''. SEC. 5. EFFECTIVE DATE. The amendments made by this Act shall apply to any civil action commenced on or after the date of enactment of this Act.

Title: A bill to provide for class action reform, and for other purposes Summary: National Class Action Act of 2003 - Amends the Federal judicial code to require: (1) the portion of any attorney's fee paid to class counsel based on a recovery of coupons in a class action settlement to be based on the value to class members of the coupons redeemed; and (2) the attorney's fee in such a settlement otherwise to be based upon the amount of time class counsel expended working on the action, subject to court approval. Grants a U.S. district court jurisdiction over a class action in which one-third or fewer of the members of all proposed plaintiff classes in the aggregate are citizens of the State in which the action was originally filed. Lists grounds under which a U.S. district court may decline to exercise jurisdiction over a class action in which greater than one-third but less than two-thirds of the members of the plaintiff class are citizens of the State in which the action was originally filed. Bars a U.S. district court from exercising jurisdiction over a class action (with exceptions) in which: (1) two-thirds or more of the members of all proposed plaintiff classes are citizens of the State in which the action was originally filed; (2) the primary defendants are States, State officials, or other governmental entities against whom the district court may be foreclosed from ordering relief; or (3) the number of members of all proposed plaintiff classes in the aggregate is less than 100. Allows a class action over which a district court would have jurisdiction under this Act to be removed to a U.S. district court by any: (1) defendant without the consent of all defendants; or (2) plaintiff class member who has intervened, seeks to be designated as a representative class member, and is not a named or representative class member without the consent of all members of such class.

billsum

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Let Wall Street Pay for the Restoration of Main Street Act of 2009''. SEC. 2. FINDINGS. Congress finds the following: (1) Our Nation continues to be hamstrung by a recession that led to the current jobless recovery and record deficits. (2) The unemployment rate is now 10.2 percent and most economists expect it to climb higher. (3) The Federal deficit has reached $1,400,000,000,000 for 2009. (4) The jobless recovery suggests that the Federal Government must continue to prime the economy, but the record deficit is a real obstacle. (5) Following their $700,000,000,000 bailout, Wall Street is now enjoying a resurgence in profits and bonuses. (6) A robust economy needs more than Wall Street profits. Main Street America is strengthened by good paying jobs for all Americans, not just Wall Street bankers. (7) To restore Main Street America, a small securities transaction tax on Wall Street should be invested in job creation for Main Street America. (8) A securities transaction tax on Wall Street has a negligible impact on the average investor and pension funds. (9) This transfer tax would be assessed on the sale and purchase of financial instruments such as stocks, options, and futures. A quarter percent (0.25 percent) tax on financial transactions could raise approximately $150,000,000,000 a year. (10) The United States had a transfer tax from 1914 to 1966. The Revenue Act of 1914 (Act of Oct. 22, 1914 (ch. 331, 38 Stat. 745)) levied a 0.2 percent tax on all sales or transfers of stock. In 1932, Congress more than doubled the tax to help financial recovery and job creation during the Great Depression. (11) Half the revenue generated by this transaction tax will be used to directly reduce the deficit. (12) Half of the revenue generated by this transaction tax will deposited in a Job Creation Reserve to fund the creation of good paying jobs and put Americans back to work rebuilding our Nation. SEC. 3. JOB CREATION RESERVE FOR INVESTMENTS IN MIDDLE CLASS JOBS. (a) In General.--For budgetary purposes, half the additional Federal receipts by reason of the enactment of this Act shall be held in a separate account to be known as the ``Job Creation Reserve''. The Job Creation Reserve shall be available to offset the additional costs from the Surface Transportation Authorization Act of 2009 and subsequent legislation to fund job creation in the United States provided that the subsequent legislation-- (1) promotes jobs that pay at least the median wage of the United States; (2) promotes manufacturing and other jobs we are losing to unfair overseas competition; and (3) prohibits any recipient of the Troubled Asset Relief Program from directly benefitting from any funds in this reserve. (b) Procedure for Adjustments.-- (1) Budget committee chairman.--After the reporting of a bill or joint resolution, or the offering of an amendment thereto or the submission of a conference report thereon, providing funding for the purposes set forth in subsection (a) in excess of the amounts provided for those purposes for fiscal year 2010, the chairman of the Committee on the Budget of the applicable House of Congress shall make the adjustments set forth in paragraph (2) for the amount of new budget authority and outlays in that measure and the outlays flowing from that budget authority. (2) Matters to be adjusted.--The adjustments referred to in paragraph (1) are to be made to-- (A) the discretionary spending limits, if any, set forth in the appropriate concurrent resolution on the budget; (B) the allocations made pursuant to the appropriate concurrent resolution on the budget pursuant to section 302(a) of the Congressional Budget Act of 1974; and (C) the budget aggregates contained in the appropriate concurrent resolution on the budget as required by section 301(a) of the Congressional Budget Act of 1974. (3) Amounts of adjustments.--The adjustments referred to in paragraphs (1) and (2) shall not exceed half the receipts estimated by the Congressional Budget Office that are attributable to this Act for the fiscal year in which the adjustments are made. SEC. 4. DEFICIT REDUCTION. It is the Sense of Congress that half the additional Federal receipts by reason of the enactment of this Act shall not be expended and therefore reduce the Federal deficit. The Committee on the Budget shall clearly report this deficit reduction in the committee report for the budget resolution. SEC. 5. RECOUPMENT OF WALL STREET BAILOUT. (a) In General.--Chapter 36 of the Internal Revenue Code of 1986 is amended by inserting after subchapter B the following new subchapter: ``Subchapter C--Tax on Securities Transactions ``Sec. 4475. Tax on securities transactions. ``SEC. 4475. TAX ON SECURITIES TRANSACTIONS. ``(a) Imposition of Tax.-- ``(1) Stocks.--There is hereby imposed a tax on each covered transaction in a stock contract of 0.25 percent of the value of the instruments involved in such transaction. ``(2) Futures.--There is hereby imposed a tax on each covered transaction in a futures contract of 0.02 percent of the value of the instruments involved in such transaction. ``(3) Swaps.--There is hereby imposed a tax on each covered transaction in a swaps contract of 0.02 percent of the value of the instruments involved in such transaction. ``(4) Credit default swaps.--There is hereby imposed a tax on each covered transaction in a credit default swaps contract of 0.02 percent of the value of the instruments involved in such transaction. ``(5) Options.--There is hereby imposed a tax on each covered transaction in an options contract with respect to a transaction described in paragraph (1), (2), (3), or (4) of-- ``(A) the rate imposed with respect to such underlying transaction under paragraph (1), (2), (3), or (4) (as the case may be), multiplied by ``(B) the premium paid on such option. ``(b) Exception for Retirement Accounts, etc.--No tax shall be imposed under subsection (a) with respect to any stock contract, futures contract, swaps contract, credit default swap, or options contract which is held in any plan, account, or arrangement described in section 220, 223, 401(a), 403(a), 403(b), 408, 408A, 529, or 530. ``(c) Exception for Interests in Mutual Funds.--No tax shall be imposed under subsection (a) with respect to the purchase or sale of any interest in a regulated investment company (as defined in section 851) or of any derivative of such an interest. ``(d) By Whom Paid.-- ``(1) In general.--The tax imposed by this section shall be paid by-- ``(A) in the case of a transaction which occurs on a trading facility located in the United States, such trading facility, or ``(B) in any other case, the purchaser with respect to the transaction. ``(2) Withholding if buyer is not a united states person.-- See section 1447 for withholding by seller if buyer is a foreign person. ``(e) Covered Transaction.--The term `covered transaction' means any purchase or sale if-- ``(1) such purchase or sale occurs on a trading facility located in the United States, or ``(2) the purchaser or seller is a United States person. ``(f) Administration.--The Secretary shall carry out this section in consultation with the Securities and Exchange Commission and the Commodity Futures Trading Commission.''. (b) Credit for First $100,000 of Stock Transactions Per Year.-- Subpart C of part IV of subchapter A of chapter 1 of such Code is amended by inserting after section 36A the following new section: ``SEC. 36B. CREDIT FOR SECURITIES TRANSACTION TAXES. ``(a) Allowance of Credit.--In the case of any purchaser with respect to a covered transaction, there shall be allowed as a credit against the tax imposed by this subtitle for the taxable year an amount equal to the lesser of-- ``(1) the aggregate amount of tax imposed under section 4475 on covered transactions during the taxable year with respect to which the taxpayer is the purchaser, or ``(2) $250 ($500 in the case of a joint return). ``(b) Aggregation Rule.--For purposes of this section, all persons treated as a single employer under subsection (a) or (b) of section 52, or subsection (m) or (o) of section 414, shall be treated as one taxpayer. ``(c) Definitions.--For purposes of this section, any term used in this section which is also used in section 4475 shall have the same meaning as when used in section 4475.''. (c) Withholding.--Subchapter A of chapter 3 of such Code is amended by adding at the end the following new section: ``SEC. 1447. WITHHOLDING ON SECURITIES TRANSACTIONS. ``(a) In General.--In the case of any outbound securities transaction, the transferor shall deduct and withhold a tax equal to the tax imposed under section 4475 with respect to such transaction. ``(b) Outbound Securities Transaction.--For purposes of this section, the term `outbound securities transaction' means any covered transaction to which section 4475(a) applies if-- ``(1) such transaction does not occur on a trading facility located in the United States, and ``(2) the purchaser with respect to such transaction in not a United States person.''. (d) Conforming Amendments.-- (1) Section 6211(b)(4)(A) of such Code is amended by inserting ``36B,'' after ``36A,''. (2) Section 1324(b)(2) of title 31, United States Code, is amended by inserting ``36B,'' after ``36A,''. (3) The table of subchapters for chapter 36 of the Internal Revenue Code of 1986 is amended by inserting after the item relating to subchapter B the following new item: ``Subchapter C. Tax on securities transactions.''. (4) The table of sections for subchapter A of chapter 3 of such Code is amended by adding at the end the following new item: ``Sec. 1447. Withholding on securities transactions.''. (5) The table of sections for subpart C of part IV of subchapter A of chapter 1 of such Code is amended by inserting after the item relating to section 36A the following new item: ``Sec. 36B. Credit for securities transaction taxes.''. (e) Effective Date.--The amendments made by this section shall apply to transactions occurring more than 180 days after the date of the enactment of this Act.

Title: To amend the Internal Revenue Code of 1986 to impose a tax on certain securities transactions to fund job creation and deficit reduction Summary: Let Wall Street Pay for the Restoration of Main Street Act of 2009 - Amends the Internal Revenue Code to impose an excise tax on certain securities transactions, including transactions in stocks, futures, swaps, credit default swaps, and options. Exempts transactions for securities held in tax-exempt retirement accounts, health savings accounts, educational accounts, and regulated investment companies. Allows the purchaser of securities a credit against the excise tax for the lesser of the tax incurred or $250 ($500 for married couples filing joint tax returns). Requires withholding of excise tax amounts by the transferor of securities subject to the tax. Requires one-half of the tax revenues raised by this Act to be held in a separate Job Creation Reserve account to offset additional costs from the Surface Transportation Authorization Act of 2009 and subsequent legislation to fund job creation. Expresses the sense of Congress that one-half of the tax revenues raised by this Act shall be used to reduce the federal deficit.

billsum

en

Summarize: TECHNICAL SCOPE [0001] The present invention relates to a device for discharging a product. In particular, the product can be a bone cement or bone substitute. The device is, however, suitable for other highly viscous, tough masses. PRIOR ART [0002] Syringe-like containers are frequently used in order to discharge a flowable product to its destination. A piston is present in the container. In order to discharge the product out of the container, the piston is advanced in a distal direction. In the simplest case, the piston is connected to a piston rod which comprises a thumb-rest. In order to discharge the product, the user presses the thumb-rest with his thumb in the distal direction, whilst he holds the container between his index finger and middle finger. However, the discharged amount is not easily able to be controlled in this manner. A relatively large force, which sometimes cannot be applied by the user or can only be applied with difficulty, is additionally required in the case of highly viscous, tough products such as bone cement. [0003] Consequently, instead of providing a piston rod, it is known to provide a pressing-out spindle which is in threaded engagement with a counter piece that is fixed to the container. The piston is then advanced as a result of a helical movement of the pressing-out spindle. As a result, the product can be discharged in a very controlled manner and with little expenditure of force. [0004] However, it is laborious when starting up to pre-screw the pressing-out spindle to begin with until the actual discharging operation starts. It is consequently known to realize the counter piece such that it is able to be moved in a targeted manner into engagement and out of engagement with the pressing-out spindle. As a result, first of all it is possible to advance the pressing-out spindle simply axially without engaging with the counter piece until the force required for this increases significantly in order only then to produce a threaded engagement. [0005] These types of devices are known, for example, from U.S. Pat. No. 4,832,692 or WO 2004/060468. In the case of said devices, the threaded engagement is produced by an actuating lever being pivoted in relation to the container. In U.S. Pat. No. 7,530,970 the threaded engagement is produced as a result of actuating a laterally arranged push button. In the case of the devices of EP 0 565 045 A1 and WO 01/93787 A2, the threaded engagement is produced by an element being rotated relative to the container about the container axis. In the case of the device of U.S. Pat. No. 6,106,496 a frame is displaced relative to the container in order to produce the threaded engagement. [0006] A further device of the named type is provided by Summit Medical Ltd. under the designation “MiniMix™ Precision Delivery Syringe”. In the case of said product, the threaded engagement is produced by an element which is arranged on the container being displaced in the proximal direction, i.e. against the operating direction. [0007] However, the handling of the named devices is not always intuitive. Additionally, at least some of the named devices are constructed in a relatively complicated manner and are correspondingly expensive to produce and are prone to error. [0008] It is also known to produce bone cement by mixing a solid component (powdery in the majority of cases) with a liquid component directly in the syringe-like container. Combined mixing and discharging devices have become known for this purpose where a mixing element is arranged in the container. Such a mixing and discharging device is provided, for example, in WO 2012/174670. In the case of the device disclosed there, the mixing element is connected to a mixing rod which is guided right through the piston to the outside. On its proximal end, the mixing rod is connected to an actuating ring. In order to mix the product, the user takes hold of the actuating ring and with this moves the mixing rod relative to the container. In order then to discharge the product, the user removes the actuating element from the mixing rod and pushes a hollow threaded spindle onto the mixing rod. So that the actuating element is able to be removed from the mixing rod, the mixing rod comprises a predetermined breaking point at which a proximal region of the mixing rod including the actuating ring is able to be broken off. As an alternative to this, the actuating ring is connected to the mixing rod by means of a screw connection and can be unscrewed from the mixing rod. [0009] A disadvantage of a predetermined breaking point is that when the mixing rod is broken off there is a risk of injury. As a rule, the function of the predetermined breaking point is not self-explanatory, which is why training is often necessary. In addition, the predetermined breaking point weakens the mixing rod such that there is the risk of the mixing rod breaking unintentionally even during the mixing process. A disadvantage of a screw connection is that it is laborious and time-consuming to unscrew the actuating ring from the mixing rod. The time required to do this is usually not available in an operating room. In addition, there is the risk of the bone cement starting to harden during this time before it is discharged. REPRESENTATION OF THE INVENTION [0010] In a first aspect, the present invention provides a discharging device where a pressing-out spindle with an external thread is first of all able to be displaced axially in relation to a counter piece with an internal thread before the threaded engagement is secured. In this case, the threaded engagement is to be secured in a particularly simple manner, and the operation of the discharging device when securing the threaded engagement is to be particularly intuitive. [0011] Such a discharging device is provided in claim 1. Further embodiments are provided in the dependent claims. [0012] A device for discharging a product is therefore provided, said device comprises: [0013] a container which forms a reservoir for the product; [0014] a piston which delimits the reservoir in a proximal direction and which is displaceable in a distal direction relative to the container in order to discharge the product out of the reservoir; [0015] a pressing-out spindle in order to exert a pressing-out force on the piston in the distal direction, wherein the pressing-out spindle comprises an external thread; and [0016] a counter piece which is arranged on a proximal end region of the container or is formed integrally with the container and is fixed in relation to the container at least in the proximal direction and with reference to rotations, having an internal thread which is configured for the purpose of forming a threaded engagement with the external thread of the pressing-out spindle, [0017] wherein the counter piece comprises one or several threaded segments which are outwardly deflectable in a lateral direction in order to release the threaded engagement, and [0018] wherein the device comprises a securing element which is arranged on the pressing-out spindle and which is pushable onto the counter piece in the distal direction in order to prevent release of the threaded engagement by the securing element impeding the threaded segments from deflecting in a lateral manner. [0019] The discharging device according to the invention makes it possible to secure the threaded engagement between the pressing-out spindle and the counter piece in a very simple manner. As a result of the securing element being arranged on the pressing-out spindle, it is not disturbing the handling of the discharging device before the pressing-out spindle is inserted. The securing element being pushed onto the pressing-out element in the distal direction makes the handling of the device very simple and intuitive. The device is able to be manufactured in a very cost-efficient manner as a result of its simple construction. [0020] Directions are used in this document as follows: The distal direction or more generally the longitudinal direction is defined by the direction of movement of the piston when the product is being discharged. The proximal direction is opposite to the distal direction. A lateral direction is designated as a direction which runs transversely to the longitudinal direction. A lateral direction which runs at an angle of approximately 90° with respect to the longitudinal direction is also designated as a radial direction. [0021] In a preferred manner, each of the threaded segments is configured on an elastically deflectable spring arm which extends with its free end in the proximal direction. However, it is also conceivable, for example, for the threaded segments to be pre-loaded inwardly with a spring force by separate spring elements or the threaded segments to be provided so as to be laterally movable without any action of a spring force. [0022] In a preferred manner, the counter piece forms a linear latching connection with the pressing-out spindle prior to the pushing-on of the securing element such that the pressing-out spindle is insertable into the counter piece in the distal direction by distally directed threaded flanks of the external thread sliding over proximally directed threaded flanks of the internal thread. However, it is also conceivable for the threaded segments of the counter piece to only engage with the external thread of the pressing-out spindle when the securing element is pushed onto the counter piece, and for the pressing-out spindle to be able to be displaced freely beforehand in relation to the counter piece. [0023] In order to ensure a latching connection which allows a movement only in one direction, the external thread can be configured as a buttress thread, having proximally directed threaded flanks which are steeper than the distally directed threaded flanks. In other words, the proximally directed threaded flanks enclose a larger angle with the longitudinal direction than the distally directed threaded flanks. The angle which the distally directed threaded flanks enclose with respect to the longitudinal direction in this case is preferably between 15° and 45°. The angle which the proximally directed threaded flanks enclose with respect to the longitudinal direction is accordingly in a preferred manner at least 60°, in particular in a preferred manner at least 80°, in a particularly preferred manner approximately 90°. The angle can exceed 90° when the thread forms undercuts. [0024] In order to facilitate handling, it is preferred that the securing element is fixable on the pressing-out spindle prior to being pushed onto the counter piece. The fixing can be effected, for example, as a result of a simple frictional connection or as a result of latching-in. When the pressing-out spindle comprises a handle on its proximal end, it is preferred that the securing element is fixable on the pressing-out spindle in the region of the handle. In a preferred manner, the securing element is guided on the pressing-out spindle. Preferably it cannot be removed from the pressing-out spindle whilst the pressing-out spindle is inserted into the counter piece. In a particularly simple embodiment, the securing element is sleeve-shaped and surrounds the pressing-out spindle. The securing element can widen toward its distal end in order to facilitate being pushed onto the counter piece. [0025] The device can be, in particular, a combined mixing and discharging device. For this purpose, the device can additionally comprise: [0026] a mixing element which is movable in the reservoir in order to intermix a product received therein, wherein the mixing element is movable preferably both in the longitudinal direction and in a rotating manner; [0027] a mixing rod which penetrates the piston, wherein the mixing rod comprises a distal end and a proximal end, and wherein the distal end of the mixing rod is connected to the mixing element, and wherein the pressing-out spindle is pushable onto the mixing rod from the proximal end. [0028] In a second aspect, the present invention provides a combined mixing and discharging device where a mixing rod is guided by a piston and an actuating element is arranged releasably on the proximal end of the mixing rod. In this case, the actuating element is able to be removed from the mixing rod in a particularly secure, simple and intuitive manner. [0029] For this purpose a device for mixing and discharging a product is provided, which device comprises: [0030] a container which forms a reservoir for the product; [0031] a piston which delimits the reservoir in a proximal direction and which is displaceable in a distal direction relative to the container in order to discharge the product out of the reservoir; [0032] a mixing element which is movable in the reservoir in order to intermix a product received therein; [0033] a mixing rod which penetrates the piston, wherein the mixing rod comprises a distal end and a proximal end, and wherein the distal end of the mixing rod is connected to the mixing element; and [0034] an actuating element which is connected to the proximal end of the mixing rod by means of a releasable positive-locking or frictional connection and is removable from the mixing rod as a result of releasing the positive-locking or frictional connection, as well as [0035] a locking element which is movable on the actuating element between a locking position and a release position, wherein the locking element prevents release of the positive-locking or frictional connection in the locking position, whilst in the release position it enables release of the positive-locking connection. [0036] In the locking position the locking element therefore secures a positive-locking or frictional connection between the mixing rod and the actuating element. The actuating element can be released from the mixing rod as a result of simply moving the locking element into the release position and releasing the positive-locking or frictional connection. This means it is no longer necessary to break off the mixing rod, with all the disadvantages linked thereto. Compared to a threaded connection, the handling is made a lot easier. [0037] In preferred embodiments, the actuating element comprises one or several connecting structures which form the releasable positive-locking or frictional connection with the mixing rod, wherein the connecting structures are outwardly deflectable in a lateral direction in relation to the mixing rod in order to release the positive-locking or frictional connection. In the locking position then, the locking element impedes the connecting structures from deflecting outward in a lateral manner. In particular, the connecting structures can include one or several elastic spring legs which are deflectable outwardly in a lateral manner and extend in the distal direction along the mixing rod. This makes possible a particularly simple and elegant connection between the mixing rod and the actuating element. [0038] In order to produce a positive-locking connection, it is possible to provide a latching lug which is directed inward in a lateral manner on at least one of the connecting structures. In this case, in a preferred manner the mixing rod comprises one or several lateral latching indentations, wherein in each case a positive-locking connection is formed by one latching lug and one latching indentation. As an alternative to this, however, it is also conceivable, for example, for only a frictional connection, which is secured by the locking element, to exist between the connecting structures and the proximal end of the mixing rod. [0039] In a particularly simple embodiment, the locking element forms a sleeve which, in the locking position, rests laterally on the connecting structures in order to prevent the connecting structures from deflecting laterally, and which, in the release position, enables the connecting structures to deflect laterally. [0040] In a preferred manner, the locking element is displaceable relative to the actuating element from the locking position into the release position by a movement in the proximal direction. This results in a particularly intuitive operation when the actuating element is to be removed as the actuating element together with the locking element is then also removed in the proximal direction. [0041] The actuating element can comprise a handle region which is configured for the purpose of being gripped by a hand of a user (for example in the form of a classic handle) and/or for receiving at least one finger of the hand (for example in the form of a ring). In particular, the handle region can comprise the form of a ring, the size of which is chosen such that it is suitable to receive at least one finger of the hand, in particular the index finger. The locking element is then preferably arranged distally from the handle region on the actuating element. The locking element can comprise a lateral flange region which is arranged such that it is possible for the user to pull the locking element on the flange region in the proximal direction toward the handle region of the actuating element by way of one or several fingers of the same hand without releasing the handle region. [0042] In order to prevent unintentional release of the actuating element, it is preferred when, in the locking position, the locking element is held on the actuating element as a result of a releasable frictional or positive-locking connection, wherein the releasable frictional or positive-locking connection is releasable by overcoming an increased minimum force which acts in the direction of the release position. [0043] In order to facilitate the discharging of the product once the actuating element has been removed, the device can additionally comprise: [0044] a pressing-out spindle in order to exert a pressing-out force on the piston in the distal direction, wherein the pressing-out spindle comprises an external thread and is pushable onto the mixing rod from the proximal end of the mixing rod once the actuating element has been removed from the mixing rod; and [0045] a counter piece which is arranged on a proximal end region of the container or is formed integrally with the container and is fixed in relation to the container at least in the proximal direction and with reference to rotations, having an internal thread which forms a threaded engagement with the external thread of the pressing-out spindle. [0046] In order to facilitate the subsequent pushing-on of a pressing-out element, it is preferred when the mixing rod does not widen at its proximal end. [0047] In a third aspect, the present invention provides a discharging device where the contents of the device are protected particularly well against heating up as a result of the hand heat of a user. [0048] For this purpose, a device for discharging a product is provided which comprises: a container which comprises a peripheral wall which delimits a reservoir for the product; [0049] a piston which delimits the reservoir in a proximal direction and which is displaceable in a distal direction relative to the container in order to discharge the product from the reservoir, wherein on the outside the container comprises insulating projections which protrude from the peripheral wall in order to reduce thermal contact with the interior of the container when a user takes hold of the container by the peripheral wall. [0050] The insulating projections can include in particular insulating ribs. In a preferred manner these extend along a longitudinal direction of the container. [0051] The first, second and third aspects of the invention can be realized independently of one another or in arbitrary combination with one another. BRIEF DESCRIPTION OF THE DRAWINGS [0052] Preferred embodiments of the invention are described below by way of the drawings which serve purely for explanation and are not to be interpreted in a restricting manner, in which drawings: [0053] FIG. 1 shows a perspective view of a mixing and discharging device according to a preferred exemplary embodiment of the present invention; [0054] FIG. 2 shows a side view of parts of the mixing and discharging device of FIG. 1 ; [0055] FIG. 3 shows a central longitudinal section of the parts of FIG. 2 ; [0056] FIGS. 4-7 show a central longitudinal section of parts of the mixing and discharging device of FIG. 1 in different stages of use; [0057] FIG. 8 shows a central longitudinal section of a view of a detail of FIG. 4 ; and [0058] FIG. 9 shows a central longitudinal section of a view of a detail of FIG. 5. DESCRIPTION OF PREFERRED EMBODIMENTS [0059] FIG. 1 shows a preferred exemplary embodiment of a mixing and discharging device 1 according to the present invention. FIGS. 2 and 3 show a side view and a central longitudinal section of parts of said mixing and discharging device. [0060] The mixing and discharging device 1 comprises a container 10 which forms a syringe body. With its peripheral wall 12, the container 10 delimits a cylindrical reservoir 11 which defines a longitudinal direction by way of its cylinder axis. Insulating ribs 13 which extend parallel to the longitudinal direction are configured on the outside surface of the peripheral wall 12. Said insulating ribs 13 serve for the purpose of reducing the transmission of body heat to the peripheral wall 12 when a user takes hold of the container 10 with his fingers. As a result, a product that is accommodated in the reservoir 11 is protected from excessive heating. Two oppositely situated lateral holding flanges 14 are formed in a proximal end region on the container 10 in order to hold the container 10 between the index finger and middle finger of one hand of the user. [0061] A piston 20 is arranged in the container 10 so as to be displaceable along the longitudinal direction, the piston 20 abutting in a sealing manner with a sealing element 21 on its circumference against the inside surface of the peripheral wall 12. As a result, the piston 20 defines the reservoir 11 in a fluid-tight manner in a proximal direction P. [0062] At its distal end, the container 10 comprises a distal removal opening, the size of which is such that the cross section of the reservoir 11 is not tapered at the distal end. An external thread, onto which a closure 90 is screwed, is formed on the peripheral wall 12 of the container 10 in the region of the removal opening. The closure 90 comprises a discharging spout 91, the cross section of which is smaller than the cross section of the reservoir 11. The discharging spout 91 is initially closed by a screw-connected sealing plug 92. [0063] A mixing element 60 is arranged in the reservoir 11 between the piston 20 and the closure 90. The mixing element 60 is configured in a manner that is known per se. It can comprise several arms, for example, which extend radially outward proceeding from a central hub and are connected to short arcuate segments at their free ends. The mixing element 60 is connected to a mixing rod 61. In the present example, the mixing element 60 is formed integrally with the mixing rod 61 ; obviously, however, it is also conceivable for the mixing element 60 and the mixing rod 61 to be separate parts which are connected together, for example, by a screw-type or latching connection. The piston 20 comprises a central longitudinal bore, and the mixing rod 61 extends right through said longitudinal bore. As a result, the mixing rod 61 penetrates the piston 60 in the axial direction. At its proximal end, the mixing rod 61 is connected in a positive-locking but releasable manner to a ring-shaped actuating element 70. The manner in which the positive-locking connection is produced and released will be described in more detail below. A locking element 80 prevents the positive-locking connection between the mixing rod 61 and the actuating element 70 being unintentionally released. [0064] The mixing and discharging device 1 additionally includes a hollow pressing-out spindle 30 as a separate element which is provided with an external thread 31. At its proximal end, the pressing-out spindle 30 is provided with a handle 32 which serves for the purpose of rotating the pressing-out spindle about its longitudinal axis. At its distal end, the pressing-out spindle 30 comprises a distal end region 33 which comprises an outside diameter that is smaller than that of the external thread 31. [0065] A counter piece 40 for the pressing-out spindle 30 is arranged at the proximal end of the container 10. In the present example, the counter piece 40 is formed integrally with the container 10 ; the counter piece 40 can also be manufactured as a separate piece and be connected subsequently to the container 10. The counter piece 40 has the form of a threaded sleeve which is divided into segments by several axially extending incisions. Each of the segments forms an elastically outwardly deflectable spring arm 41, on the proximal free end of which an inwardly pointing threaded segment 42 is formed. [0066] The mixing and discharging device 1 additionally comprises a securing sleeve 50 which is arranged on the pressing-out spindle 30 in the region of the handle 32. The function of the securing sleeve 50 will be explained in more detail below. The securing sleeve 50 widens slightly in its distal end region 51. The securing sleeve 50 is frictionally connected to the pressing-out spindle 30 on its proximal end and, as a result, is held on the pressing-out spindle 30 so as to be releasable. [0067] Initially, the mixing and discharging device 1 is situated in the state in FIGS. 1-3. Beforehand, two components of a product, which are subsequently to be mixed together, have been filled into the reservoir 11. To this end, the user takes hold of the actuating element 70 and with this moves the mixing rod 61 in the axial direction and at the same time back and forth in the circumferential direction. As a result, the mixing element 60 is moved in a corresponding manner in the reservoir 11 and thus mixes the components. [0068] In order to discharge the finished product, the user first of all removes the actuating element 70, as is shown in FIG. 4. To this end, the user inserts his thumb into the ring-shaped actuating element 70 and pulls the locking element 80 with the index finger and middle finger in the proximal direction P. As a result, the connection between the mixing rod 61 and the actuating element 70 is released, as will be explained in more detail below in conjunction with FIG. 8. [0069] The user then pushes the pressing-out spindle 30 in the distal direction D onto the mixing rod 61. In this case, the distal end region 33 of the pressing-out spindle 30 first of all passes into the region of the counter piece 40. On account of its reduced diameter, the distal end region 33 can be easily pushed between the threaded segments 42 until the external thread 31 of the pressing-out spindle 30 contacts the threaded segments 42. The distally directed threaded flanks of the external thread 31 now slide over the proximally directed threaded flanks of the threaded segments 42 and as a result deflect the threaded segments 42 radially outward. Accordingly, the spring arms 41 spring elastically outward. As soon as the threaded segments 42 engage with the external thread 31, the spring arms 41 spring back inward again. In all, a linear latching connection between the pressing-out spindle 30 and the counter piece 40 is formed in this manner. [0070] The user then advances the pressing-out spindle 30 axially in the distal direction D until the pressing-out spindle 30 abuts against the proximal end of the piston 20 with its distal end region 33. This state is shown in FIG. 5. From this moment, a significantly increased counter force acts against the pressing-out spindle 30 advancing any further in a linear manner. The linear latching connection between the counter piece 40 and the pressing-out spindle 30 prevents the pressing-out spindle 30 from being able to be pulled back. [0071] In order to secure the threaded connection between the pressing-out spindle 30 and the counter piece 40, the user now pushes the securing sleeve 50 on the pressing-out spindle 30 forward in the distal direction D until the securing sleeve 50 laterally encompasses the counter piece 40. This is shown in FIG. 6. In this case, the widened distal end region of the securing sleeve 50 facilitates the pushing of the securing sleeve 50 onto the counter piece 40. The securing sleeve 50 then rests laterally on the spring arms 41 and, as a result, prevents the spring arms 41 being able to continue to be deflected outward. [0072] In order to press the product out of the reservoir 11, the user first of all removes the sealing plug 92. The user then rotates the threaded spindle 30 in the clockwise direction by the handle 32 and thus screws the threaded spindle 30 into the container 10 in the distal direction D. As a result, the piston 20 is advanced in the distal direction D and presses the product right through the discharging spout 91 out of the reservoir 11. The state at the end of the discharging operation is shown in FIG. 7. [0073] The connection between the piston rod 61 and the actuating element 70 is now explained in more detail by way of FIG. 8. The fastening element 70 comprises an actuating region in the form of a ring 76 and a fastening region 71 which extends in the distal direction D from the ring 76. The fastening region 71 comprises two radially opposite connecting structures in the form of spring legs 72 which, proceeding from the ring 76, extend in the distal direction D parallel to the longitudinal axis. Each of the two springs legs comprises a latching lug 74 on the inside. The spring legs 72 together delimit a gap 73 into which the proximal free end of the mixing rod 61 is insertable. [0074] The mixing rod 61 comprises at its proximal free end two oppositely situated latching indentations 62 which are complementary to the latching lugs 74 of the fastening region 71. When the free end of the mixing rod 61 is pushed into the gap 73, the spring legs 72 spring outward until the latching lugs 74 engage in the latching indentations 62 and thus produce a positive-locking connection between the mixing rod 61 and the actuating element 70. In this case, the positive-locking connection acts both in the axial direction and the circumferential direction, i.e. the actuating element 70 is fixed on the mixing rod 61 both with reference to axial movements and with reference to rotations about the longitudinal axis. [0075] Said positive-locking connection is secured by the sleeve-like locking element 80. FIGS. 1-3 show the locking element 80 situated in a locking position in which it prevents the spring legs 72 from deflecting in a lateral manner. As a result, the locking element 80 prevents the positive-locking connection between the mixing rod 61 and the actuating element 70 being released. In the locking position, the locking element is fixed in a frictional locking manner on the actuating element 70 by means of a radially outwardly protruding holding bead 75. In FIG. 8, the locking element 80, in contrast, is situated in a release position in which it makes it possible for the spring legs 72 with the latching lugs 74 to deflect in a lateral manner and consequently for the positive-locking connection to be released, by the actuating element 70 being removed from the mixing rod 61 in the proximal direction P. In order to be able to move the locking element 80 into the release position in a simple and intuitive manner, the locking element 80 comprises oppositely situated flange regions 81 which are configured for the purpose of being pulled in the proximal direction by means of the index and middle fingers of one hand, the index finger of which is situated in the ring 76. On account of the holding bead 75, a certain minimum resistance has first of all to be overcome before the locking element 80 can be moved into the release position. [0076] FIG. 9 shows an enlarged view of the connection between the pressing-out spindle 30 and the counter piece 40. As has already been explained above, the counter piece 40 forms a sleeve which is subdivided by axial incisions into several sleeve segments which act as spring arms 41. On its free end, each of the spring arms 41 comprises a threaded segment 42. The threaded segment comprises a steep distal flank 43, which forms an angle of 90° to the longitudinal direction, as well as a flat proximal flank 44, which forms an angle of approximately 30° to the longitudinal direction. The flanks of the external thread 31 on the outside circumference of the pressing-out spindle 30 are configured in a complementary manner hereto. The distally directed flanks 34 are configured correspondingly flatter than the proximally directed flanks 35. In this way, the pressing-out spindle 30 can be advanced axially in the distal direction in relation to the counter piece 40. In this case, the external thread 31 and the threaded segments 42 form a linear latching connection where the flat distally directed flanks 34 of the external thread 31 slide over the flat proximally directed flanks 44 of the threaded segments 42, whilst the steep proximally directed flanks 35 of the external thread 31 together with the steep distally directed flanks 43 of the threaded segments 42 prevent the pressing-out spindle 30 from being pulled back. [0077] Diverse modifications are obviously possible without departing from the scope of the present invention. In particular, the combination shown here of pressing-out spindle 30, counter piece 40 and securing sleeve 50 can also be used in the case of a discharging device without a mixing element 60 and mixing rod 61. Conversely, the manner in which the actuating element 70 is held on the mixing rod 61 by means of a locking element 80 can be used independently of a certain pressing-out element. The individual elements can also be designed differently to how they are shown here as an example. Thus, for example, the pressing-out spindle 30 can comprise a differently designed handle and can be formed differently at its distal end. Instead of a single-start thread, a double-start or multiple-start thread is also conceivable. The counter piece 40 can also be designed differently. Thus, the counter piece does not forcibly have to be sleeve-shaped, and not all the segments of the counter piece need to form spring arms. The securing sleeve 50 can comprise a form other than that shown here as long as it is suitable to impede parts of the counter piece 40 from deflecting outward. The container 10 does not forcibly need to comprise insulating ribs. If insulation is desired, other types of insulating structures can also be present on the container wall 12. Insulating projections can also be advantageous in the case of other types of syringe-like containers. The container can also be designed differently on its distal end to as shown here and in particular can be provided with a different type of closure. LIST OF REFERENCES [0000] 1 Mixing and discharging device 10 Container 11 Reservoir 12 Peripheral wall 13 Insulating rib 14 Holding flange 20 Piston 21 Sealing element 30 Pressing-out spindle 31 External thread 32 Handle 33 Distal end region 34 Distally directed flank 35 Proximally directed flank 40 Counter piece 41 Spring arm 42 Threaded segment 43 Distally directed flank 44 Proximally directed flank 50 Securing sleeve 51 Distal end region 60 Mixing element 61 Mixing rod 62 Latching indentation 70 Actuating element 71 Fastening region 72 Spring leg 73 Gap 74 Latching lug 75 Holding bead 76 Ring 80 Locking element 81 Flange region 90 Closure 91 Discharging spout 92 Sealing plug

Summary: A mixing and discharging device ( 1 ) has a syringe-like container ( 10 ), in which a plunger can be moved. A press-out spindle ( 30 ) having an external thread ( 31 ) interacts with a counterpart ( 40 ) by means of a thread engagement. The counterpart comprises one or more thread segments, which can be deflected outward in order to release the thread engagement. A securing element ( 5 ) can be slid onto the counterpart ( 40 ) in a distal direction in order to prevent a release of the thread engagement. A mixing rod ( 61 ) extends through the plunger ( 20 ). An operating element ( 70 ) is connected to the proximal end of the mixing rod by means of a releasable form closure or force closure. A locking element ( 80 ) can be moved between a locking position and a release position. In the locking position, the locking clement prevents a release of the form closure or force closure. Insulating ribs ( 13 ) minimise the input of heat into the interior of the container due to touching.

big_patent

en

Write a title and summarize: The primary visual cortex (V1) is pre-wired to facilitate the extraction of behaviorally important visual features. Collinear edge detectors in V1, for instance, mutually enhance each other to improve the perception of lines against a noisy background. The same pre-wiring that facilitates line extraction, however, is detrimental when subjects have to discriminate the brightness of different line segments. How is it possible to improve in one task by unsupervised practicing, without getting worse in the other task? The classical view of perceptual learning is that practicing modulates the feedforward input stream through synaptic modifications onto or within V1. However, any rewiring of V1 would deteriorate other perceptual abilities different from the trained one. We propose a general neuronal model showing that perceptual learning can modulate top-down input to V1 in a task-specific way while feedforward and lateral pathways remain intact. Consistent with biological data, the model explains how context-dependent brightness discrimination is improved by a top-down recruitment of recurrent inhibition and a top-down induced increase of the neuronal gain within V1. Both the top-down modulation of inhibition and of neuronal gain are suggested to be universal features of cortical microcircuits which enable perceptual learning. Since Plato' s Allegory of the Cave (360 BC) and Kant' s Critique of Pure Reason (1787), it is often suggested that our perception of objects in the outer world can never tell us what they really are. “If men had green glasses in place of their eyes, they would perceive the objects as green, and never be able to tell whether this color was intrinsic to the objects or just of our perception” (letter of Heinrich von Kleist to his fiancée Wilhelmine von Zengen, 22 March 1801, in which he describes Kant' s ideas, http: //www. kleist. org [in German]). In a contemporary neuroscientific version of the empiricist' s position, one may argue that the perception of visual objects is always distorted by the nonlinearities in the visual pathway, and in particular by the intrinsic circuitry of primary visual cortex (V1). In fact, any visual input is filtered by the neuronal processing in V1 before reaching consciousness. For instance, collinear edges are enhanced by the intrinsic V1 circuitry [1], and our brightness perception will never match the physical luminance. Nevertheless, perceptual training without teacher feedback may still improve our brightness discrimination abilities [1], casting certain doubts about the strict empirical view. How then is it possible to reach more veridical perceptions by just “pure reason, ” i. e., by intrinsically adapting the cortical dynamics without being told about the mismatch between percept and true physical quality? We show in a model that top-down modulation of V1 during unsupervised perceptual learning can suppress intrinsic nonlinearities in V1. The top-down suppression leads to a faithful neuronal representation of the sensory input. The underlying neuronal mechanisms are elaborated in an example of brightness discrimination. In this example, a flanking light bar which is closely aligned in prolongation of a test bar acts as a visual context. This flanking bar biases the brightness perception of the test bar. In the presence of the flanking bar, the test bar is perceived to be brighter than it actually is. Clearly, this enhanced brightness perception is helpful when extracting collinear line elements against some noisy background [2,3]. However, when the task consists of comparing the brightness of the test bar with a displaced single reference bar, then the collinear flank distorts the brightness comparison [4]. The brightness of the test bar is overestimated because the underlying neuronal population representing the test bar within V1 is recurrently excited by the corresponding population representing the collinear flanking bar [1]. We show that top-down input can remove this contextual bias by activating recurrent inhibition within V1. The recurrent inhibition cancels the lateral excitation and linearizes the brightness representation of the test bar, allowing for a faithful perception. An additional top-down induced gain increase in V1 further enhances the sensitivity to brightness differences. Perceptual learning, i. e., the change of perception following sensory experiences, is typically explained as a modification of either the feed-forward synaptic pathway to V1 [5–7], or recurrent connections within V1 [8–11] triggered by repeated practicing. Because these synaptic modifications would affect any input stream through V1, however, perceptual learning would inevitably deteriorate the information processing in other situations. Although negative transfer of learning to other tasks is known to appear (see, e. g., [12]), perceptual learning is typically task-specific and does not deteriorate perception in other tasks; see, e. g., the reviews [13,14]. While improving in brightness discrimination between a context-modulated test bar and a displaced reference bar, for instance, the edge detection capability is expected to not suffer. In fact, the mutual enhancement of collinear light bars is advantageous for extracting lines in a noisy scene, as required for contour integration in everyday scenes [4]. Hence, models of perceptual learning have to explain how improvement on one task is possible without interference with others. An intriguing possibility is that perceptual learning might be based on modifying a task-dependent top-down input to sensory areas, as opposed to a permanent change of the bottom-up input stream [15–17]. Taking up this idea we show how top-down signaling from a higher cortical area to V1 could modify the neuronal processing in this lower area, consistent with both electrophysiological recordings in V1 and psychophysical experiments on perceptual learning. We first modeled the in vivo experiment which reveals a nonlinear facilitation of V1 neurons triggered by collinear flankers in their extra-classical receptive field (see [18] and Figure 1). According to this experiment, the response of a V1 neuron to a light bar in its receptive field is stronger when an additional collinear bar is present nearby. This second flanking bar alone does not evoke any response as it is outside the receptive field. However, if it appears together with the one within the receptive field, the response is almost doubled (Figure 1A). The same nonlinear response properties are also present in the model neuron (Figure 1B). This receives direct input from the stimulus within its receptive field, but only indirect input from the collinear flank outside the receptive field (Figure 2A). The indirect, lateral input by itself may only drive the neuron towards firing threshold, not above. Together with the direct, supra-threshold input, however, it visibly adds to the response of the model neuron. Because the full model network is recurrent and includes a positive feedback loop (Figure 2A), a quantitative description of the different neuronal responses requires some formal treatment. A minimal network model consists of two mutually excitatory neuronal populations, the first of which is directly driven by the test bar, and the second by the flanking bar. To reveal the main idea, we identify each of these populations with a single prototypical neuron reflecting the dynamics of the whole population. In a further simplification, the firing rates of these two prototypical neurons representing the test and flanking bar (f1 and f2, respectively) are considered to be threshold-linear functions of the total synaptic inputs, where g (=1) is the neuronal gain, xi the feedforward input of the corresponding light bar, wij the lateral synaptic strength from neuron j to neuron i (with i ≠ j), and θ the firing threshold. The brackets [z]+ = max (0, z) denote the identity function with cut-off at 0. Although the full model takes account of the neuronal dynamics (see Materials and Methods), the steady-state considerations presented here and below are enough to understand the results. When stimulus 1 (test bar) is presented alone, say with input strength x1 = 2θ, neuron 1 will respond alone with strength f1 = θ, provided that the synaptic strength from neuron 1 to neuron 2 (w21) is not too strong. In turn, if only stimulus 2 (flanking bar) is presented, neuron 1 will not respond because the second neuron (which then fires with f2 = θ) will not drive neuron 1 above threshold (say that w12 = w21 ≈ 0. 5). However, when both stimuli are present (x1 = x2 = 2θ), the two neurons mutually excite each other and their firing rate is roughly doubled (fi = g (xi − θ) / (1 − gwij) ≈ 2θ, for both i = 1,2). This formally explains the strong response increase to two collinear light bars extending across and beyond the receptive field (Figure 1A and 1B). Although the mutual excitation between the collinear edge detectors is beneficial for extracting lines, it may be detrimental for other tasks such as brightness discrimination. How is it possible to suppress the perceptual distortions imposed by the recurrent V1 circuitry? Cutting off or permanently modifying the lateral connections through learning is not a solution since otherwise the facilitation effect would be lost when needed to extract line segments in a noisy surrounding. However, it is possible to compensate for the lateral excitation in V1 by a top-down recruitment of inhibition. Different wirings are conceivable which yield a cancellation of the lateral excitation. Recurrently connected feedback inhibition through tightly coupled inhibitory networks is a characteristic cortical architecture [19–21], and it is particularly challenging to test whether such a circuitry may also serve for suppressing the facilitation. In fact, by driving recurrent inhibition within V1, each neuron can be inhibited by approximately the same amount as it is facilitated by its surrounding excitatory neurons. Since this recurrent inhibition is enabled by the top-down input, the suppression can transiently be turned on when required by the task, without leaving long-lasting modifications of the intrinsic V1 circuitry. To test these ideas, we considered a population of inhibitory neurons driven by both excitatory neuronal populations within V1 and some task population in a higher cortical area. Again, each population is identified by a prototypical neuron. We assume that the firing rate of the inhibitory neuron is a threshold-linear function of the total input with gain one, where f1 + f2 is the total firing rate of the V1 neurons representing the test bar and the flank,, is the effective postsynaptic rate at the synapse projecting from the task neuron to the inhibitory neuron, and θinh is the firing threshold for inhibition (Figure 2B1). We further assume that the top-down synapses undergo short-term synaptic depression such that the effective postsynaptic current becomes the same for any strong presynaptic firing rate [22,23]. Whenever the top-down firing rate from the task neuron is turned on, say with ftask > 25 Hz, then the effective postsynaptic rate reaches some saturation value. We chose the strength of synaptic depression such that this saturating rate roughly cancels the firing threshold, ≈ θinh. Due to saturation, this approximate equality remains true even when the top-down firing rate ftask is strengthened after perceptual learning. Hence, when the top-down drive is strong, the firing rate of the inhibitory neuron (Equation 2) gets linearized, If the inhibitory neuron recurrently projects to the two excitatory neurons with strength k, the latter receive the additional inhibitory current −kfinh = −k (f1 + f2). Adding this to the total postsynaptic current of the excitatory V1 neurons (Equation 1) leads to the recurrent firing rate equations Next we assume that the strength of the inhibitory and the recurrent excitatory synapses are roughly equal in absolute strength, k = wij. The additional drive from the collinear flank is then canceled by the recurrent inhibition, simplifying Equation 4 to fi = g [xi−kfi−θ]+. Solving this equation for the postsynaptic firing rates fi then yields The reasoning shows that the response of each excitatory V1 neuron in the presence of strong top-down input is approximately a threshold-linear function of the feed-forward input, independent of the firing rate of the other neurons (Equation 5). The recruitment of recurrent inhibition virtually breaks up the excitatory recurrent circuitry (symbolized by Figure 2B2). As a consequence, a particular V1 output neuron in the presence of strong top-down input will only respond to a light bar in its classical receptive field, and it is only marginally affected by an additional light bar in its non-classical surround (Figure 1C). This suppression of the surround modulation induced by focal attention is partially confirmed by single cell recordings in monkeys (it was confirmed to be the case for two monkeys before learning, and it became pronounced for one of the two monkeys after learning, see [18]). Before being ready to explain the perceptual learning results, we need to introduce an additional feature to our model network. Unsupervised training and focal attention has been shown to improve brightness discrimination in two specific ways: (i) the bias imposed by a collinear light bar is suppressed and (ii) the sensitivity to brightness discrimination is enhanced [1,4]. While bias suppression could be explained by the suppression of the recurrent feedback (Equations 1 to 5), the sensitivity enhancement could be explained by an additional gain increase of V1 neurons. One candidate neuron for a top-down induced gain increase would be the layer 2/3 (L2/3) pyramidal neurons within V1, the “input neurons” in our model network. However, a gain increase in these neurons would roughly be canceled by the simultaneous suppression through recurrent inhibition we are postulating. In fact, a look at Equation 5 shows that the gain of the local V1 microcircuitry in the presence of the top-down suppression, α = g/ (1 + kg), saturates quickly when increasing the gain g of the neuronal transfer function. To at least overcome the effective reduction of the circuitry gain when recruiting inhibition (acting through k), we still assume that the top-down input to the L2/3 pyramidal neurons increases their gain g. This gain increase is modeled by a nonlinearly increasing and saturating function of the top-down frequency ftask, similarly to the one measured in vitro [24]. For instance, a top-down activated gain increase from g0 = 1 to g1 = 2 keeps the original network gain α constant when co-activated with recurrent inhibition (α0 = g0 = 1 and α1 = g1/ (1 + kg1) = 1 with k = 0. 5). To nevertheless achieve a net gain increase of the whole network, we assume that L2/3 neurons feed through layer 5 (L5) pyramidal neurons before projecting to higher cortical areas (see, e. g., [25,26]). We incorporate a top-down gain increase also in these L5 pyramidal neurons (Figure 3A1). Consistent with the experimental findings [24], the gain of the L5 pyramidal neurons, denoted by gx̃, is again modeled by a monotonically increasing and saturating function of the top-down firing rate ftask. The overall circuitry gain α then has the form While for top-down input ftask < 8. 5 Hz we have a gain gx̃ = 1 of the L5 pyramidal neuron, we get an additional gain factor gx̃ = 1. 5 for ftask = 10 Hz and gx̃ ≈ 3. 3 for ftask = 45 Hz, for instance. The top-down recruitment of inhibition and the top-down gain increase are the two key elements which explain perceptual learning in the brightness discrimination task considered in [1,18]. In this task, a subject (human or monkey) has to judge whether one of four randomly chosen test bars is brighter or dimmer than a reference bar (Figure 3A). A preceding cue indicates whether the subject has to attend to one (focal attention) or all four test bar locations simultaneously (distributed attention, Figure 3A1). To investigate the effect of collinear light bars onto brightness perception, collinear flanks were placed outside each of the four test bars in half of the stimulus presentations (Figure 3A2). No feedback on the correctness of the brightness decision was given, neither in the experiment nor in the model. The model architecture consists of three V1 pyramidal neurons in L2/3 (again each representing a population of those) with receptive fields at the position of the relevant test bar, the flanking bar, and the reference bar, respectively (Figure 3B1). The neurons responding to the test and flanking bar are recurrently connected through direct excitation and shared inhibition, while the neuron responding to the reference bar is indirectly inhibited only by its own drive. Attention acts through a task population in a higher cortical area which itself modulates the gain of the L2/3 and L5 pyramidal neurons and drives the inhibitory neurons within V1 towards firing thresholds. As compared with the top-down induced gain increase, the top-down drive of the inhibitory neuron is assumed to saturate earlier by means of synaptic depression (see inset of Figure 2B1). The decision about the brightness difference between test and reference bar is modeled as a stochastic function of the difference between the L5 output activities fx̃test − fx̃ref, as it can be implemented with a classical decision making network [27]: the more fx̃test exceeds fx̃ref, the more likely will the test bar be judged to be brighter than the reference bar (see Figure 3B2). We assume that the comprehension of the task by the subject implies the selection of an appropriate decision network in a higher cortical area. This decision network combines the potentially distorted, but relevant, inputs from the lower area, fx̃test and fx̃ref, while suppressing the irrelevant input from the flank neuron, fx̃flank. We assume that without external feedback about the outcome of the decisions, these bottom-up connections to the decision network are not modified. Prior to brightness discrimination training, the top-down input in the case of distributed attention is too weak to activate inhibition within V1. The top-down drive is therefore also too weak to suppress the recurrent excitation between the test and the flanking bar (cf. Equation 1). Due to the unbroken recurrent excitation, the flanking bar enhances the V1 activity and shifts the brightness perception of the test bar towards higher values (facilitation, see also Figure 1B). This brightness shift implies a bias in brightness discrimination in favor of the test bar as compared with the reference bar (Figures 4A1 and 5A1, before learning). Perceptual learning in our model consists of increasing the drive from attentional centers to the task population through Hebbian modification of the synaptic strength watt (Figure 3B1). Because in the case of distributed attention the attentional input is only weak, say = 16 Hz, and because we assume that before learning the synaptic strength is weak as well, = 0. 5, the task neuron is barely activated, = ≈ 8 Hz. During training, long-term potentiation (LTP) of the attention-to-task synapse (watt, Figure 3B1) steadily increases towards = 1. 0. At the lower area, the increasing firing rate of the task neuron then drives the inhibitory neuron towards threshold (→ θinh, see Equation 2). As a consequence, the intrinsic V1 circuitry is suppressed (cf. Equation 5) and the perceptual bias is reduced (Figures 4A1 and 5A1). Simultaneously to the recruitment of inhibition, the training-based increase of the top-down input during distributed attention,, leads to a gain increase of the L2/3 pyramidal neurons from g0 = 1. 0 to g1 ≈ 2 and in the layer 5 pyramidal neurons from gx̃0 = 1. 0 to gx̃1 ≈ 3 (cf. Equation 6). This gain increase causes the threshold in brightness discrimination to drop (Figures 4A2 and 5A2). Both the reduced brightness facilitation and the reduced discrimination threshold in the case of distributed attention closely reproduce the experimental observations (Figures 4B and 5B). In the case of focal attention, the facilitation and discrimination threshold are already reduced before learning and do not substantially decrease further during the learning process (Figures 4B and 5B). In our model, this arises because focal attention drives the task neuron considerably above the critical frequency for synaptic depression and also above the gain modulation threshold, even before learning (= ≈ 24 Hz). As a consequence, inhibition and gain increase are present right from the beginning, reflecting the corresponding high performance in brightness discrimination. The performance does not further improve during learning due to saturation effects. Because synaptic depression limits the drive of the inhibitory neuron, the bias in brightness discrimination is not further reduced. Similarly, because the gain increase saturates with strong top-down input, the discrimination threshold does not further decrease, in full agreement with the psychophysical data (Figures 4 and 5). While in our model the unsupervised learning is purely top-down driven, an external feedback may additionally modulate bottom-up pathways to the decision network in the higher cortical area. Assuming that the decision circuitry for distributed and focal attention is the same also for learning with feedback, we would expect interferences between the modifications of the bottom-up and top-down pathways. Since subjects are not aware of their progress during learning [1], it is in fact likely that the same readout circuitry is used for distributed and focal attention. An interference induced by the plasticity in the bottom-up and top-down pathways is indeed observed in the model. The teacher feedback is used to modify the synaptic strengths of all three types of L5 inputs to the decision network, fx̃test, fx̃flank, and fx̃ref (Figure 3B1). We apply a specific form of reinforcement learning to these synapses, an error-correcting learning rule which changes the synaptic strengths only when a wrong decision occurs. Upon missing reward, the synapses are modified in an anti-Hebbian way: if the postsynaptic neuron was erroneously active, the activated synapses weaken, and if the postsynaptic neuron was erroneously silent, the activated synapses strengthen. These correction steps enhance the chance that with the next presentation of the same stimulus the decision network will correctly respond—as far as this is possible in the presence of the brightness distortion imposed by the intrinsic V1 circuitry. Simulations show that the facilitation bias is rapidly reduced in the initial phase (Figure 6A). This early progress is enabled by the fast learning of the feed-forward synapses onto the decision network, as compared with the slow learning of the attention-to-task synapses considered before. Because distributed and focal attention are randomly interleaved, the synaptic strengths on the decision network converge to an average between the optimal strength for distributed and focal attention. To compensate for the intrinsic network bias in V1, the fast feed-forward learning causes the facilitation to undershoot in the presence of focal attention, while staying positive in the presence of distributed attention (Figure 6A, up to 11 weeks). The simultaneous top-down learning eventually leads to a suppression of the perceptional bias, and facilitation slowly vanishes for both attentional states (in contrast to the learning scenario without external feedback, see Figure 4A1 and Figure 4B1). The top-down model of perceptual learning has several advantages over models which either change the lateral connections within the sensory area, or which change the feed-forward (bottom-up) connections to a read-out population. First, models which intrinsically change the early stimulus representation [8–11] can explain perceptual learning only at the expense of a degradation on other tasks. A task-specific top-down input, instead, can specifically suppress or enhance a certain pre-wiring without interference with other tasks. Second, models which explain perceptual learning by only adapting the read-out connections to a higher cortical area [5,6, 17] have the problem that the specific sensory information required to solve the task may have been suppressed by nonlinearities in the early sensory area, and no learning in the subsequent read-out connections could recover this information. Although these models could explain the task-specificity of perceptual learning by switching the read-out populations for different tasks [7,17], it remains unclear how such a switch should be implemented in neuronal terms. One option would be that the cognitive representation of the task in a higher cortical area would gate the activity to the appropriate read-out population while suppressing the other inappropriate read-out units. However, such a gating would again involve top-down projections, and it appears to be simpler to directly modulate the early stimulus representation by such a top-down signal. Besides solving the task-switching problem, a task-dependent top-down modulation might also explain the longevity of perceptual learning which is not disturbed by repeated practicing of other tasks (see [16] and the review [29]). The top-down modulation is also consistent with the observation that perceptual learning in monkeys did neither change the receptive field size [30] nor the orientation tuning in V1 [31] during the performance of the trained task. We assume that a cognitive understanding of the task implies the selection of a task population in a higher cortical area with appropriate top-down projections to V1. Similarly, we assume that a decision population in a higher cortical area is selected which is driven by appropriate projections from V1. Such a pre-wiring must exist because no feedback from the external world about the performance in the perceptual task is given which may first shape the required synaptic connectivity. The synaptic top-down template encompasses the drive of the inhibitory populations together with the drive to the apical trees of the pyramidal neurons in V1. The bottom-up template selects a read-out network in some higher cortical area with an appropriate weighting of the feed-forward input. Both selection processes could themselves emerge from experience-dependent synaptic modifications during development [32] or during learning. For instance, it is conceivable that during the exposure to similar tasks, certain synaptic templates emerged based on intrinsic reinforcement signals or on a Hebbian type of synaptic plasticity [15,16]. These templates might be acquired subconsciously or even without explicitly performing a task [33]. The top-down modulation of the intrinsic V1 circuit during a task allows attention to operate through the same top-down template. In our model, the task neuron projecting down to V1 is directly driven by attention, making attention itself task-specific (Figure 3B1). Without external feedback, perceptual improvement is only possible in the case of weak, distributed attention (Figure 4B). Since learning in this case consists of strengthening the top-down template, it can be mimicked by increasing the attentional drive. In fact, the performance for distributed attention after learning reached the same level as for focal attention before learning. Learning with focal attention is not further possible because the common top-down pathways saturate. However, additional feedback on the correctness of the response may further lead to a fast reduction in the decision bias by modifying the readout synapses targeting the decision center (compare Figure 6A with Figure 4A1). In general, the fast initial progress often seen in perceptual learning [29] may reflect the adjustment of bottom-up connections to higher cortical areas, while the slow components of learning may follow the adjustment of top-down connections. We hypothesize that perceptual learning is always accompanied by a top-down modulation of the lower sensory area. The top-down input may act in a twofold manner on the sensory area: (i) it may suppress (or enhance) the lateral connectivity by driving inhibition and (ii) it may modulate the gain of the pyramidal neurons. In functional terms, these top-down templates will (i) “de-contextify” (or “contextify”) the stimulus representation to suppress (or enhance) the perceptual bias and (ii) sharpen the stimulus representation to improve the discrimination sensitivity. Depending on the task, the two ingredients may be of different importance. If perceptual learning mainly consists in lowering some discrimination threshold such as in hyper-acuity tasks [16], a top-down gain increase may be enough. If perceptual learning includes the suppression or enhancement of intrinsic nonlinearities such as in context-enabled contrast discrimination [8,34] or in a bisection task [35], the modulation of the intrinsic circuitry will become crucial. Recent research has started to uncover these top-down templates [22,32,36], similarly to the uncovering of the bottom-up templates in terms of the neuron' s (bottom-up) receptive fields. To implement the suppression of the flanking bar, we made use of a population of electrically coupled interneurons which inhibits a group of pyramidal neurons and receives feedback from these. Such a negative feedback circuitry represents a universal building block of the neocortex [19–21]. The same global inhibition can also enable competition among the pyramidal cells when operating in a high gain regime. This competition may enable winner-take-all behavior as it is used for decision making [27]. In fact, our decision network in the higher cortical area could be implemented by a similar local microcircuit used to linearize V1 and consisting of two (self-) excitatory populations which are both recurrently connected through the same inhibitory population (see Figure 2B1). As we were showing, the same canonical microcircuitry can be modulated to yield the suppression of brightness facilitation. While the top-down recruitment of recurrent inhibition is one way to suppress lateral excitation, other local architectures in V1 yielding the desired suppression are also conceivable. The psychophysical phenomena alone are not constraining enough to postulate a unique neuronal implementation of the suppression effect. To make our additional model assumptions transparent, we recall the three psychophysical results the model explains. (1) Repeated practicing can reduce the facilitation in brightness discrimination induced by a flanking bar. (2) Focal attention without practicing can equally reduce facilitation, but the effects of perceptual training and focal attention do not add up when they are combined. (3) Similarly, repeated practicing and focal attention each may decrease the brightness discrimination threshold, but their combination does not lead to a further decrease. An explanation of these phenomena requires at least three neuronal mechanisms operating on the early sensory area. (1) To account for the cancellation of lateral excitation during learning, we need to postulate some specific inhibition which is instantiated by the learning process. (2) Because focal top-down attention is equally effective in canceling lateral excitation as slow perceptual learning is, we also postulate a direct top-down recruitment of this inhibition. (3) Since the reduction in the brightness discrimination threshold is equivalent to an increase in the signal-to-noise ratio, we postulate a multiplicative enhancement of the sensory signal in the early representation. Again, because the threshold reduction can be induced by attention, the multiplicative modulation must be governed by a higher cortical center. Hence, the top-down recruitment of inhibition in V1 together with the top-down modulation of the neuronal gain represent the minimal number of assumptions which can account for the psychophysical data. Our two additional assumptions that the top-down drive should roughly match the threshold for inhibition, and that the synaptic strength of the feedback inhibition should roughly match the synaptic strength of the lateral excitation, are a consequence of explaining the suppression effect by means of recurrent inhibition. Other ways of implementing the top-down suppression may not need these additional assumptions. For a generalization of the suppression mechanism to multiple neurons and for alternative wirings, see below and Figure S1. As a first alternative explaining the top-down suppression, we may consider the scenario of non-recurrent lateral inhibition. Each excitatory neuron which laterally projects to a target neuron is postulated to also project through an inhibitory companion neuron onto the same target neuron. Without top-down input, the companion neuron is silent, but in the presence of a top-down depolarization it inhibits the target neuron as strongly as this is excited, effectively canceling the lateral excitation. Besides being highly specific, such a wiring suffers from the same problem of fine-tuning (see Figure S1). As a second alternative, all excitatory lateral connections onto the target neuron might first be funneled through a specific population of excitatory neurons before they effectively excite the target neuron. This additional population just has to linearly feed through the excitatory input. But top-down input can now easily inhibit this population and cut off any lateral excitation, without affecting the activity of the source neurons. Although this version would require less tuning of inhibition, it makes an even stronger assumption on the lateral excitatory wiring. One advantage of the non-recurrent inhibition, though, is that it would not require the additional top-down gain increase at the intermediate layer 5 neurons (Figure 3B1). In reality, the different local suppression mechanisms discussed above might act in parallel. Whatever the specific implementation is, the top-down modulation of the suppression mechanism (s) remains an appealing paradigm to explain the reduction in brightness facilitation with perceptual training. The fact that top-down input may operate in different ways to achieve the same result reflects the generality and flexibility of this concept. Alternative mechanisms exist also to implement the top-down gain modulation, here required to explain the reduction in the brightness-discrimination threshold. In addition to the suggested dendritic calcium currents [24], other mechanisms on the level of a single neuron [37–39] or of a recurrent network [40] are conceivable which may yield an appropriate top-down gain modulation. The suggested mechanisms underlying the suppression of the perception bias and the reduction of the discrimination threshold would permit a specific pharmacological modulation of perceptual learning (see also [41]). (1) Any experimental manipulation which would modulate the top-down input would have behavioral implications. For instance, blocking GABA receptors in vivo in monkeys by local perfusion or in humans by medications would prevent the top-down suppression. After unsupervised practicing, the brightness facilitation for both attentional states would then be still as high as the original facilitation for distributed attention before practicing. (2) A more specific test of the model would be to activate GABAB receptors by Baclofen to prevent the gain increase of L5 pyramidal neurons [42,43]. As a consequence, the discrimination threshold would remain high (Figure 6B), while brightness facilitation may still get suppressed. An interesting option is to lower the excitability of human V1 by repetitive transcranial magnetic stimulation (rTMS) [44]. rTMS may recruit inhibition and block the gain increase through GABAA and GABAB receptor activation. Again, this is expected to increase the discrimination threshold while the facilitation may still get suppressed. (3) Finally, learning in the presence of an external feedback may help to disentangle the contribution of bottom-up and top-down inputs. A teacher feedback may lead to a complete suppression of the facilitation by the flanking bar (Figure 6A). Such a further reduction of the perception bias would be consistent with the effect of the teacher feedback in context-dependent orientation discrimination [17]. However, although the discrimination threshold was further reduced by a teacher feedback in a Vernier task [45], it was not reduced in the orientation discrimination task [17] nor in our model for brightness discrimination (simulations, unpublished data). In the model, the differential effect of the teacher feedback on the perception bias and the discrimination threshold arises because the teacher signal is assumed to only affect learning in the decision circuitry of the higher cortical area, and not the representation network within the lower sensory area. To account for Weber' s law stating that perception scales logarithmically with the stimulus intensity, the inputs xi into V1 encoding the test, flank and reference bar are chosen to be logarithmic functions of the stimulus brightness, xi = 35log (Li + 1. 5), where Li (i = 1,2, 3) denotes the luminance of the test, flank, and reference bar, respectively. The luminance values are set to match the luminance ratios of test bar and the flank bar to the reference bar used in the experiments [1,18]. The reference bar luminance is fixed to Lref ≡ L3 =4, and the test bar luminance is one out of the seven different brightness levels Ltest ≡ L1 = 1,2, …, 7 (arbitrary units). The luminance of the flanking bar is always slightly above the one of the test bar, Lflank = Ltest + 0. 05, as chosen in the brightness discrimination experiment (Figure 3A). The firing rates of the prototypical excitatory L2/3 neurons (each representing homogeneous neuronal population) are characterized by with [z]+ = max (0, z), a time constant τ = 20 ms, and a gain g which is a monotonically increasing function of the top-down firing rate ftask as described below. The prototypical L2/3 pyramidal neuron encoding the test bar (i = 1) and flank bar (i = 2), respectively, receives the total input current Ii = xi +wijfj + λftask − kfinh (i, j ∈ {1,2}, i ≠ j), where xi is the feed-forward input, wij the lateral synaptic strength, λ = 0. 2 the dendritic attenuation factor for the top-down input projecting to the distal dendrite, and k the strength from the lateral inhibition. The dynamics of the two prototypical inhibitory neurons are defined by with a time constant τinh = 5ms (for other parameter values see the caption of Figure 1). For the inhibitory neuron which is related to the excitatory L2/3 neurons representing the test and flanking bar, the total input current is given by Iinh = f1 + f2 + wtask (Figure 3B1). Here, wtask denotes the synaptic strength of the top-down input to the inhibitory neurons (Figure 3B1) and is the synaptic release rate undergoing short-term depression (see Figure 1 and the definition below). Setting = wtask and dfinh/dt = 0 in Equation 8 yields the steady state firing rate finh = [f1 + f2 + − θinh]+ (cf. also Equation 2 in the main text). The firing rate of the L2/3 neuron which encodes the reference stimulus (f3 ≡ fref) is governed by the dynamics (Equation 7) with input current I3 = x3 − kfinh. The corresponding inhibitory neuron is again governed by Equation 8, but with an input current Iinh = f3 + wtask, i. e., with f1 + f2 replaced by f3 (with i = 1,2, 3 standing for “test”, “flank”, and “ref”, respectively). Finally, the task neuron is driven by an attentional neuron with a firing rate fatt. This attentional input is weak in the case of distributed attention, = 16 Hz, and strong in the case of focal attention, = 48 Hz. The firing rate of the task neuron is proportional to the attentional input, ftask = wattfatt, with watt being the synaptic strength from the attentional center to the task neuron. This top-down weight watt undergoes slow Hebbian modifications (see Equation 14 below). The top-down input from the task neuron to V1 changes the gain of the L2/3 and L5 pyramidal neurons. The gain g of the L2/3 neurons increases with ftask according to with c = 2. 4, θg = 8. 5 Hz, and τg = 0. 8s. L5 pyramidal neurons receive a single bottom-up somatic input from their co-aligned L2/3 neurons and a top-down dendritic input from the task neuron. The overall somatic current to a L5 neuron is Ĩi = fi + λftask (i = 1,2, 3), where λ = 0. 2 is the dendritic attenuation factor and i = 1,2, 3 standing for “test”, “flank”, and “ref”, respectively. The firing rate of the L5 neurons is determined by with the same time constant τ and threshold θ as for the L2/3 pyramidal neurons (i as above). Similarly, the gain gx̃ monotonically increases with ftask according to the same right-hand side of Equation 9, but with the parameter values c = 1. 2 and τg = 0. 4s and θg = 8. 5Hz. This parameter choice leads to a gain function which is twice as steep and saturates at twice the level of the corresponding function for L2/3 pyramidal cells (M. Larkum, unpublished data, see also [24]) We introduced synaptic short-term depression in the top-down projection to the inhibitory neurons (Figure 2B1, inset). The synaptic release rate at these connections is given by the product of the release probability and the presynaptic firing rate, = prelftask. The release probability itself is a dynamic variable and is proportional to the vesicle recovery probability, prel = uprec, with proportionality constant u interpreted as a fraction of transmitter use per release. The dynamics of the vesicle recovery probability is given by where τrec is the vesicle recovery time constant, see [23] or [46]. We set u = 0. 4 and τrec = 0. 1s. In the steady state the release rate becomes and it is reached with an effective time constant τrec/ (1 + uτrecftask). For presynaptic frequencies ftask beyond the critical input frequency fcrit = 1/ (uτrec) (=25 Hz), the release rate saturates at the same value (of 25 Hz). Synaptic depression in the top-down connection to the inhibitory neurons is introduced to achieve a constant drive at high top-down frequencies. According to Equation 8 and its subsequent remarks, the steady state firing rate for the recurrent inhibition among the test and flanking neurons in layer 2/3 is see also Equation 2. To obtain the linearized firing rate in Equation 3, finh = f1 + f2, the effective top-down input wtask must roughly match the firing threshold θinh. This requires that the postsynaptic current generated by the top-down input remains approximately constant. Such a constant drive is in fact achieved by synaptic short-term depression for ftask ≫ fcrit, as expressed by Equation 12. To obtain the match wtask ≈ θinh, for large presynaptic firing rates we set wtask = 1. 9 θinhuτrec. To take account of the temporal processing during the experiment underlying Figure 4, we run the network with the same schedule for the stimulus presentation as in the experiments [1,18]. For each presentation, the attentional condition (focal/distributed), the contextual condition (flank/no flank), and the luminance of the test bar (Li, see above) are randomly chosen. A virtual “attentional cue” (Figure 3A1) turns on top-down input from the attentional center to the task center, or (Figure 3B1), representing either “distributed” or “focal” attention and remains active throughout the stimulation protocol up to the final decision. 1. 5 s after the attentional onset, the stimulus is flashed for 0. 1 s. Each stimulus consists of a reference bar and a test bar with or without flank. The decision about the brightness difference between test and reference bar is drawn 0. 9 s after stimulus offset based on the activities of the L5 pyramidal neurons at that time. In the case of unsupervised learning (i. e., without feedback), the total postsynaptic current entering in the decision function is given by Idec = fx̃test − fx̃ref (Figure 3A2). To mimic noisy neuronal decision making [27], the decision ydec = 1 (test bar judged to be brighter than reference bar) is chosen with probability p = p (Idec) = 0. 5 (1 + erf (Idec/d) ), and the decision ydec = 0 with probability 1 − p, where d = 2/15 and erf (x) is the standard error function. After the decision making, the neuronal firing rates are reset to 0 and short-term synaptic depression is put to the recovered state prec = 1. A “trial” consists of three (in the experiment it was one to six) stochastically independent stimulus presentations including decision making. To compare with the experiment [1,18], we trained our model network with 600 (in the experiment it was 500–800) trials per “week”. During the stimulation protocol, the strength of the attention-to-task synapse watt (Figure 3B1) changes according to the Hebbian rule with a factor η = 3·10−8 s, an initial value watt = 0. 5, and hard bounds for watt at 0 and 1. The modification threshold θM (t) is itself slowly following the postsynaptic firing rate ftask according to with an adaptation time constant τθ = 60s, a proportionality constant α = 0. 8, and an initial value of θM = 10Hz. In the unsupervised learning scenario, watt steadily increased until it reached the upper bound 1 after roughly 10,000 trials (17 weeks). All differential equations were integrated with forward-Euler using a time step of dt = 0. 3 ms. In the case of supervised learning (as underlying Figure 6A), the current entering in the decision network is given by Idec = wx̃testfx̃test + wx̃flankfx̃flank + wx̃reffx̃ref, where the wx̃i reflect the weights emerging from the L5 pyramidal neurons (Figure 3B). In addition to the top-down weight watt (Equations 14 and 15), we modified the bottom-up weights wx̃i (with i = 1,2, and 3 standing for “test”, “flank”, and “ref”, respectively) according to the perceptron learning rule [47]: whenever the output of the decision unit was correct, no modification of the wx̃i was made, while otherwise the synapses change in an anti-Hebbian way. Formally, we consider a reward signal R with R = 1 if the network decision ydec is correct, and R = 0 otherwise (where “correct” means that ydec = 1 if the test bar is brighter than the reference bar, Ltest > Lref, and ydec = 0 if the test bar is equal or less bright than the reference bar, Ltest ≤ Lref). The synaptic strength wx̃i is then changed according to with learning rate q = 0. 0001, a modification threshold θ̃M = 0. 5, and i = 1,2, and 3 standing for “test”, “flank”, and “ref”, respectively. Because we assume that the choice of the decision network is appropriate for an unbiased discrimination, we choose initial weights wx̃test = 0. 5, wx̃flank = 0. 0, and wx̃ref = −0. 5. The average reward R increases throughout the simulations from 0. 5 towards roughly 0. 9. To enhance the undershoot of the learning curve for focal attention, only 15% of the presentations were with focal attention and 85% with distributed attention. During the learning procedure, the top-down weight watt is subject to the dynamics in Equation 14 and Equation 15 and steadily increases to a value of 0. 74 at the end of the learning process (12,000 trials). The brightness facilitation (shift in brightness perception of the test bar induced by the presence of the flanking bar) and the discrimination threshold (just distinguishable brightness difference relative to the absolute brightness) were extracted from the psychometric curves described below using the probit method (cf. [1] and [48]). After each block of 600 trials, stimuli presented under the same attentional and contextual conditions (focal/distributed, flank/no flank) and the same brightness were pooled together. For each pair of attentional and contextual condition, the ratio of positive responses to a particular test luminance, Ltest, was plotted against the logarithm of the relative luminance, log (Ltest/Lref). The four sets of 2-D data points were fitted by a “normal cumulative distribution function” (approximating the decision probability p as a function of the logarithmic relative luminance), yielding the psychometric response curves for the different conditions. Facilitation was identified by the left shift (at the 50% correctness level) of the fit for the flank relative to the non-flank condition. The detection threshold was identified by the maximal slope of the fitting curve for the no-flank condition.

Title: Perceptual Learning via Modification of Cortical Top-Down Signals Summary: Perceptual learning improves sensory stimulus discrimination by repeated practicing. The improved stimulus discrimination is often thought to arise either from modified stimulus representation in the sensory cortex, or from modified readout from the sensory cortex by higher cortical units. Both explanations, the modified sensory representation and the modified readout, have their advantages and disadvantages. Modifying the stimulus representation within the early sensory cortex may lead to an improvement on one discrimination task, but may have long-lasting negative effects on another task. Modifying the task-specific readout by a higher cortical area, on the other hand, prevents this undesirable interplay between tasks. However, it may be difficult for the readout units to compensate for stimulus distortions produced by interactions in the sensory cortex. Here we show that top-down modulation of the early stimulus representation combines the benefits of task specificity and of eliminating inherent distortions. The task specificity naturally arises from distinct task representations in the higher cortical areas which, by top-down signaling, reversibly improve the task-related representation of sensory stimuli. Based on a visual brightness discrimination task, we show that modifying top-down projections alone can explain psychophysical and electrophysiological data on perceptual learning.

lay_plos

en

Summarize: CROSS REFERENCE TO RELATED APPLICATIONS [0001] The present application claims priority priority under 35 U.S.C. 120 to Provisional Patent Application Serial No. 60/303,196 filed in the United States Patent and Trademark Office on Jul. 5, 2001 of which is incorporated herein by reference in its entirety. BACKGROUND OF THE INVENTION [0002] Beneficial microorganisms can be fed to animals raised for human consumption, for the purpose of suppressing deleterious organisms or directly promoting the animal&#39;s growth. The Association of American Feed Control Officials (AAFCO) lists 41 probiotic microorganisms that are recommended for direct-feeding to animals. Official Publication (1989), Association of American Feed Control Officials Incorporated. 27 of these microorganisms (65% of the total) are classified as lactic acid-producing bacteria. Lactic acid-producing bacteria had been previously mentioned as having probiotic activity. However, only five species of Bacillus bacteria were on the list, and Bacillus laterosporus was not mentioned. [0003] U.S. Pat. No. 5,045,314 discusses that certain strains of Bacillus laterosporus may control nematodes in ruminant animals, including goats. But such use was not mentioned for poultry, as they are not generally affected by nematode parasites. Twenty-seven strains of B. laterosporus are discussed, but only four, including strain ATCC 64, possessed nematicidal effect, and such effect was enhanced significantly by heat or enzyme treatment of the B. laterosporus, which caused activation of a specific toxin compound. There is, therefore, no suggestion or motivation to use any strain of Bacillus laterosporus for growth promotion in poultry, where nematodes are not considered a problem. [0004] U.S. Pat. No. 5,283,059, Suzuki et al., discusses producing a stabilized Bacillus cereus animal feed preparation in pellet form that contains a complex carbohydrate such as cornstarch and Bacillus spores. The stabilizing effect is attained by heating the mixture of starch and Bacillus spores to 60-75° C. to gelatinize the starch, followed by a relatively complex preparation process involving spray drying, pulverization, granulation and pelleting. [0005] U.S. Pat. No. 4,919,936, Iwanami et al., discloses a strain of Bacillus subtilis (FERM BP-1096) that improves weight gain in mice, piglets, calves, rainbow trout, layer chickens, and broiler chickens. The benefit to broiler chickens was reported to be 11 points of feed conversion (one point is considered a change of one unit in the second decimal position), but the feed contained up to 1×10 6 cells/gram of Bacillus subtilis and was fed daily to the chickens for the entire growing period of 56 days. More effective feed conversion with less frequent administration of lesser amounts of bacteria is clearly desirable. [0006] Other publications discussing probiotics include Fuller, R., Probiotics—The Scientific Basis, Chapman &amp; Hall, 1992; and Doi, R. H. and McGloughin, M., Biology of Bacilli, Butterworth-Heinemann, 1992. [0007] Recently, efforts have been made to market dried fecal contents from specific pathogen free chickens as probiotic products. The principle is to inoculate young chicks with such cultures (referred to as “competitive exclusion” or “CE cultures”) and create, within the chick&#39;s intestinal tract, a barrier of nonpathogenic fecal microorganisms that prevent or inhibit the colonization of pathogens, such as Salmonella. The problem with this approach is that particular probiotic CE cultures cannot be reproduced in a reliable manner in the feed. The fecal material may contain from 10-50 microbial strains, or more, and it is unknown which of these strains are protective or how to maintain them in the proper concentration from batch-to-batch. [0008] U.S. Pat. Nos. 2,906,622 and 2,942,977 discuss growth stimulating agents. The &#39;622 patent discusses use of two strains of bacillus subtilis, both of which produce subtilin, and other growth stimulating agents which exhibit the same antibiotic effects as subtilin and stimulate the growth of chicks and other animals when added to feed. The &#39;977 patent discusses use of other strains of b. subtilis having the ability to: (i) produce growth stimulating factors, (ii) grow rapidly and efficiently under artificial culture conditions, and (iii) produce antibiotic agents, but not subtilin, bacitracin, or any of the other antibiotics which have been shown to be produced by antibiotic-producing members of the genus Bacillus. Neither patent discusses use of compositions comprising a non-lactic acid-producing bacteria having a similarity index of 0.5 or higher to Bacillus laterosporus. [0009] To date, therefore, feeding of Bacillus laterosporus to chickens has not been disclosed or suggested. SUMMARY OF THE INVENTION [0010] The invention includes administering to poultry the spores or live cells of Bacillus laterosporus, preferably strain CM-33 (deposited at the American Type Culture Collection (“ATCC”), P.O. Box 1549, Manassas Va. 20108, under accession No. PTA-3952), to cause one or more of: (i) weight gain, (ii) increased feed conversion to mass, and (iii) decreased mortality. Spores may be preferred as they may be more marketable than live cells, due to their longer shelf-life. Spores can be obtained by ultra-filtration, centrifugation, spray-drying, freeze-drying, or combinations thereof. [0011] The spores of this CM-33 strain have a similarity index (based on cellular fatty acid analysis) of 0.763 to spores of Bacillus laterosporus, in an analysis wherein two samples with a similarity index above 0.5 are considered closely comparable. Administration of spores of strain CM-33 to broiler chickens at relatively low dose rates ranging from about 0.5 to about 8 million spores/bird/day, causes a substantial improvement in feed conversion and associated improvements in weight gain and mortality reduction. The hardiness and ease of spore production of strain CM-33 and similar strains permits administration by simple low cost methods, such as by incorporating it into feed, or adding it to drinking water. [0012] The mechanism by which the CM-33 strain achieves its beneficial effects is not known. It is postulated that it may produce an antibiotic substance within the chicken&#39;s intestinal tract or in the litter environment, or it may colonize areas of the intestinal tract and competitively exclude deleterious microorganisms, or it may produce some nutrient factor that stimulates growth, or it may operate by some other mechanism. [0013] The spores of strain CM-33 can be administered in suspension with drinking water, preferably chlorine-free water, which suspension may also include other additives and ingredients. It has been found to be further advantageous to sub-divide the total of colony forming units (“cfu”) into daily doses of about 2 million cfus per bird, over 40 days of the poultry growth cycle. [0014] The invention and methods of making and using it are described further below. BRIEF DESCRIPTION OF THE DRAWING [0015] [0015]FIG. 1 is a table that contains the cellular fatty acid (CFA) analysis for Bacillus laterosporus, strain CM-33. DETAILED DESCRIPTION OF THE INVENTION [0016] A. Preparing a strain CM-33 Spore Suspension [0017] In preparing spores of Bacillus laterosporus strain CM-33, a suitable microbiological medium is first selected. Both tryptic soy broth (TSB) and Schaeffer&#39;s Sporulation Medium, as referenced in Biology of Bacilli (Doi, et al. Butterworth-Heinemann, 1992), are suitable growth media. The medium is sterilized in baffled Erlenmeyer flasks at 121° C. under 15 psig for 30 minutes, or until rendered sterile. The Erlenmeyer flasks should be under-filled to optimize aeration during shaking. About 200 ml of medium is preferred for use in a 4 liter Erlenmeyer flask. [0018] The flask is fitted with a sterile filter cap that allows the contents to breath without becoming contaminated. The sterile medium is inoculated from a slant culture on tryptic soy agar, preferably by having a slant medium with good colony growth melted and poured into the Erlenmeyer flask. The inoculated medium is then shaken on a rotary orbital shaker at 100-200 rpm at 32° C. for 48 hours. The CM-33 strain will typically be 90% sporulated within 48 hours, displaying a viable spore count of about 10 8 /ml. The resulting spore suspensioncan be administered to poultry without further preparation. If the spore suspension is not used within one week of preparation, it should be refrigerated at 5° C. until ready for use. Spore suspensions held at 5° C. have a half-life of about two months. [0019] The Bacillus laterosporus spores may also be purified or concentrated using methods such as ultra-filtration, centrifugation, spray-drying or freeze-drying to generate a packaged product. Such preparations may be more marketable due to their longer shelf-life, but freshly-prepared suspensions should be equally efficacious. [0020] The spores may be present in a composition that includes water, or water and additives and excipients that do not have a deleterious effect on the action of the spores, or water, additives and excipients and other ingredients conventionally used in spore preparations. The composition may, optionally, also include other feed additives, including nutrient organic compounds and trace minerals or vitamins, antibiotics, growth factors and adjuvants. The composition may also include, optionally, a mixture of vegetative cells of non-lactic acid-producing bacteria, preferably having a similarity index of 0.5 or higher compared to Bacillus laterosporus type strain. [0021] Preparation of spores of other strains of Bacillus laterosporus which improve growth or feed conversion in poultry may be prepared by similar methods. Preparation of vegetative cells of strain CM-33 or other strains may be prepared by methods well known in the art. [0022] B. Characterization of Strain CM-33 [0023] [0023] Bacillus laterosporus, strain CM-33 has been characterized morphologically and physiologically and these results are summarized in Table A below and in FIG. 1. TABLE A Bacillus laterosporus strain CM-33 Morphological Data: Gram positive rod-slender and motile, length 2-6 um, width &lt; 1 um. Sporangium-not swollen. Endospores are oval and cradled by canoe-shaped parasporal body. Endospores located sub-middle. Rods may curve and become spindle-shaped when they produce endospores. Physiological Data: (+= positive, n = negative) Parameter Result Anaerobic growth + Catalase + Growth at 65° C. n Starch hydrolysis n Gelatin liquification n Casein hydrolysis + Glucose (acid, no gas) + Mannitol n Glycerol n Arabinose n Xylose n Citrate utilization n Growth at &lt; pH 5.7 n Growth in 7% NaCl n Nitrate reduction + Methyl red test + Oxidase + Trehalose (acid, no gas) + Lactose n Sucrose n Fructose + Urea hydrolysis n Esculin hydrolysis + Arginine utilization + Phenylalanine deamination n [0024] [0024]FIG. 1 displays the cellular fatty acid (CFA) analysis for Bacillus laterosporus, strain CM-33, listing the retention times (RT column) and areas under the peaks (area column) for the fatty acids present in an extract of the Bacillus cells. The CM-33 strain was sub-cultured twice and analyzed using the MIDI/Hewlett Packard Microbial Identification System (MIS). The data was obtained on high-resolution gas chromatography and the analysis, taken in total, represents a biochemical fingerprint of the organism. The profile obtained was compared to the profile of the type strain for that species by computer analysis. The similarity index shown at the bottom of the profile (0.763) represents the percent agreement with Bacillus laterosporus type strain. A Similarity Index of 0.500 or higher is considered a close comparison. [0025] C. Administration to Poultry [0026] The spores or cells of the Bacillus laterosporus strain CM-33 can be administered to poultry by a number of methods, including by spraying an aqueous suspension thereof onto poultry feed, or mixing it with the poultry drinking water. In the latter method, measured quantities of the aqueous spore suspension are added, daily, to the watering system, either manually or by metering pump. The dose of spores per bird can be varied as the bird grows, although it is preferred to feed a standardized dose (fixed number of spores/bird/day) for a specific number of days during the growth period. It is not necessary to feed the spores to the poultry from day one (i.e., chick placement) through harvest (day 42-52). For purposes of economy, feeding of the spores can begin from about day 10 to about day 23 and proceed to harvest. In a preferred embodiment, spores are fed starting at about day 10 and continued daily for 40 days. If harvest is projected to be less than 50 days, the spore feeding is started at a corresponding number of days earlier so that the birds are fed spores for 40 days. The preferred dose range for Bacillus laterosporus, strain CM-33, spores is from about 0.5 million cfu/bird/day to about 8 million cfu/bird/day (representing a total dose administration of 20 to 320 million cfu over the life of a bird), and more preferably about 2 million cfu/bird/day. The cfu determination was made by plate count on tryptic soy agar incubated for 72 hours at 32° C. [0027] The spores are preferably administered mixed with commercial, nutrient enriched, corn-soy diets. The simultaneous use of growth-promoting antibiotics may be contra-indicated, but may be acceptable, depending on the specific antibiotic and the quantities used. For example, coccidiostats (such as that known under the trade designation “Coban”) do not adversely affect the CM-33 spores and can be used simultaneously. If it is necessary to use antibiotics which inhibit CM-33 strain in the starter diet, the spores can be started when the switch to grower feed (without antibiotics) is made. [0028] For chickens, it is preferred that 2 million cfu of CM-33 spores are fed to each bird each day for at least 40 days, typically from day 10 to day 50. When 2 million spores are fed daily for 40 days, a total dose of 80 million spores per bird is administered. This relatively low dose results in a substantial benefit in growth (19 points of feed conversion were achieved with this dosage, see Example I below, where each point of feed conversion represents a 0.01 increase in F/G (explained below)). Lactic acid-producing bacteria have been administered to chickens at total dose rates in excess of 500 million to 1 billion cfu, with less improvement in feed conversion (see Fuller, R., Probiotics—The Scientific Basis, Chapman &amp; Hall, 1992). [0029] Compositions of strain CM-33 suitable for poultry feed may include a variety of optional ingredients, e.g., vitamins and minerals, growth factors, adjuvants, and the like. Although these are not required, and may not increase weight gain or decrease food consumption. Vitamin additives may also be included, for example, one or more of pantothenic acid, pyridoxine, riboflavin, thiamin, 25-hydroxy vitamin A, B12, C,D, E, biotin, choline, folacin, niacin, and vitamin K. Mineral additives may be included, for example, one or more of magnesium, potassium, sodium, copper, iodine, iron, manganese calcium, phosphorous, selenium, chlorine and chromium pincolinate. The concentration of the vitamins and minerals will depend upon the animal being treated but, in general, will be between about 0.01% and about 5% by weight of the feed dry matter. [0030] Compositions including strain CM-33 may also include other substances, for example, one or more of keratinocyte growth factor, nerve growth factor, vascular endothelial growth factor, somatotropin, insulin-like growth factor (IGF-I or IGF-II), epidermal growth factor, transforming growth factor, bombesin, fibroblast growth factor, granulocyte-macrophage colony stimulating factor and erythropoietin. Such compositions may also contain a steroid or hormone including one or more of estrogens, glucocorticoids, insulin, glucagon, gastrin, calcitonin and somatotropin. The high moisture material may further contain an antibiotic including one or more of lincomycin, virginiamycin, bacitracin, BMD (bacitracin methylenedisalicylate), and others. Such compositions may also include one or more of a natural or synthetic antioxidant such as BHA (butylated hydroxyanisole), vitamin C or glutathioneethoxyquin, tocopherol, BHT (butylated hydroxytoluene); a receptor, transfer factor, chelator or complexing agent which modifies release rates of nutrients or other bioactive compounds; an immunoactive agent such as immunoglobulins, antigens, killed cells, attenuated strains, toxins, adjuvants, cytokines, vaccines and other immunomodulators; or a palatability modifier or intake regulator such as food coloring, grit, oyster shell, whole seeds or grains. These substances can be used alone or in combination with one another. The concentration of these additives will depend upon the animal being treated but, in general, if used at all, will be included at about 0.0001% and about 10% by weight of the dry matter, and more preferably between about 0.001% and about 7.5%, most preferably between about 0.01% and about 5%. [0031] Substances useful as palatability modifiers or intake regulators in addition to those mentioned above include triglycerides, clonidine, gums and hydrolyzed gums such as guar gum, xanthan gum or algin; fish products such as fishmeal and fish oils; spices such as sage, thyme, cloves, and the like; gastrin antagonists; cholecystokinin antagonists; amino acids such as methionine, tyrosine, phenylalanine, and the like; naloxone; pancreatic polypeptide; norepinephrine; melatonin antagonists; and thyroid hormones such as thyroxine, T3, T4, and the like. [0032] Adjuvants that can be incorporated into such compositions can be of several different types, e.g., oils, peptides, polypeptides, microbiologically-derived substances, lectins, polysaccharides, and proteins, and various nucleic acids. Microbiologically-derived substances include materials produced by, or which are cellular components of, microorganisms such as bacteria, fungi including yeasts, and the like. [0033] Vaccines useful for administration to poultry with the strain CM-33 include those effective against common diseases in poultry such as Newcastle&#39;s Disease, Marek&#39;s Disease, infectious bursal disease, infectious bronchitis, enteritis and coccidiosis. These vaccines include, for example, Newcastle&#39;s vaccine, Marek&#39;s Disease vaccine, infectious bursal disease vaccine, infectious bronchitis vaccine and CocciVac.RTM. Such vaccines can be administered to young birds orally, via yolk sac injection, subcutaneously, in ovo, or via inhalation by mist or spray. [0034] Strains of Bacillus laterosporus other than CM-33 could be prepared and administered by similar methods and in similar compositions, with similar additives, to those described above. [0035] The benefit of administration of Bacillus laterosporus to poultry is exemplified below. EXAMPLE I Effects of Strain CM-33 Administration to Chickens [0036] [0036] Bacillus laterosporus strain CM-33 spores were prepared in TSB shake flasks (200 ml in a 4 liter baffled flask) inoculated from a melted TSA slant culture and incubated for 48 hours at 32° C. with constant 100 rpm orbital agitation. This resulted in a spore suspension containing 200 million viable spores per ml. The spore suspension was administered to broiler chickens at the rate of 2 million cfu/bird/day beginning at day 10 of a bird&#39;s life and continuing through day 50 at which time the birds were harvested. This represents a total dose of 2 million cfu/day×40 days, or 80 million total cfus during the life of the bird. 2000 birds, 1000 controls and 1000 treated, were involved in the test. An antibiotic-free corn-soy ration was fed with the additive Coban incorporated as the coccidiostat. Spore suspensions were manually applied by pipette to the bird&#39;s water supply, with adjustment every fifth day for any increased water consumption. Mortality counts were recorded daily and feed conversion and final weights were computed at harvest. The results are presented in Table I. TABLE I Results-Example I Test Control # chickens 1,000 1,000 Avg. mortality 6.8% 9.5% Avg. final weight 2.20 kg 2.06 kg F/G* 2.12 2.31 EXAMPLE II Low Dose Study [0037] [0037] Bacillus laterosporus, strain CM-33, spores were prepared in TSB shake flasks (200 ml in a 4 liter baffled flask) inoculated from a melted TSA slant culture and incubated for 48 hours at 32° C. with constant 100 rpm orbital agitation. This resulted in a spore suspension containing 150 million viable spores per ml. The spore suspension was administered to broiler chickens at the rate of 0.5 million cfu/bird/day beginning at day 10 of a bird&#39;s life and continuing through day 50, at which time the birds were harvested. This represents a total dose of 0.5 million cfu/day for 40 days, or a total of 20 million cfus during the life of a bird. 2000 birds were involved—1000 controls and 1000 treated. An antibiotic-free corn-soy ration was fed with Coban. Spore suspensions were manually applied by pipette to the bird&#39;s water supply, with adjustment every fifth day for any increased water consumption. Mortality counts were recorded daily, and feed conversion and final weights were computed at harvest. The results are presented in Table II. TABLE II Results-Example II Test Control No. chickens 1,000 1,000 Avg. mortality 8.6% 9.8% Avg. final weight 2.10 kg 2.02 kg F/G 2.28 2.34 EXAMPLE III High Dose Study [0038] [0038] Bacillus laterosporus strain CM-33 spores were prepared in TSB shake flasks (200 ml in 4 liter baffled flasks) inoculated from a melted TSA slant culture and incubated for 48 hours at 32° C. with constant 100 rpm orbital agitation. This resulted in a spore suspension containing 250 million viable spores per ml. The spore suspension was then administered to broiler chickens at the rate of 8 million cfu/bird/day beginning at day 10 of a bird&#39;s life, and continuing through day 50, at which time the birds were harvested. This represents a total dose of 8 million cfu/day for 40 days, or a total of 320 million cfus during the life of a bird. 2000 birds were involved—1000 controls and 1000 treated. An antibiotic-free corn-soy ration was fed with Coban. Spore suspension was manually applied by pipette to the bird&#39;s water supply, with adjustments every fifth day for any increased water consumption. Mortality counts were recorded daily, and feed conversion and final weights were computed at harvest. The results are presented in Table III. TABLE III Results-Example III Test Control No. chickens 1,000 1,000 Avg. mortality 6.2% 9.0% Avg. final weight 2.21 kg 2.08 kg F/G 2.08 2.28 EXAMPLE IV Shortened Dosing Period [0039] [0039] Bacillus laterosporus strain CM-33 spores were prepared in TSB shake flasks (200 ml in 4 liter baffled flasks) inoculated from a melted TSA slant culture and incubated for 48 hours at 32° C. with constant 100 rpm orbital agitation. This resulted in a spore suspension containing 190 million viable spores per ml. The spore suspension was administered to broiler chickens at the rate of 2 million cfu/bird/day beginning at day 23 of a bird&#39;s life and continuing through day 48, at which time the birds were harvested. This represents a total dose of 2 million cfu/day for 25 days, or 50 million cfus administered during the life of the bird. 1,300 birds were involved—700 controls and 600 treated. An un-medicated corn-soy ration was fed to the birds. The spore suspension was manually applied by pipette to the bird&#39;s water supply, with adjustments every fifth day for any increased water consumption. Mortality counts were recorded daily, and feed conversion and final weights were computed at harvest. The results are presented in Table IV. TABLE IV Results-Example IV Test Control No. chickens 600 700 Avg. mortality 6.7% 9.3% Avg. final weight 2.21 kg 2.06 kg F/G 2.30 2.46 EXAMPLE V Dry Feed Application [0040] [0040] Bacillus laterosporus strain CM-33 spores were prepared in TSB shake flasks (200 ml in 4 liter baffled flasks) inoculated from a melted TSA slant culture and incubated for 48 hours at 32° C. with constant 100 rpm orbital agitation. This resulted in a spore suspension containing 240 million viable spores per ml. The spore suspension was sprayed onto broiler chicken feed one hour prior to feeding the chickens, providing an amount equal to 2 million spores/bird/day administered with the first feeding in the morning. The spore suspension was diluted in sufficient chlorine-free water to facilitate even distribution over the feed and assure that all treated chickens received the specified dose. The amount of water used was about 1.5%, by weight, of the feed. The feed, so treated with spores, was fed from day 10 of the bird&#39;s life to day 50, at which time the birds were harvested. This represents a total dose of 2 million cfu/day for 40 days, or 80 million cfus during the life of the bird. There were 2000 birds involved with the test—1000 controls and 1000 treated. An antibiotic-free corn-soy ration was fed with Coban. Mortality counts were recorded daily, and feed conversion and final weights were computed at harvest. The results are presented in Table V. TABLE V Results-Example V Test Control No. chickens 1,000 1,000 Avg. mortality 6.2% 9.0% Avg. final weight 2.21 kg 2.08 kg F/G 2.08 2.28 EXAMPLE VI Trial Using Commercial Production [0041] [0041] Bacillus laterosporus, strain CM-33, spores were prepared in a 2,000 liter fermentor using Schaeffer&#39;s Sporulation Medium. The medium was sterilized at 121° C. for 30 minutes, cooled to 32° C. and inoculated at 1% by volume with a shake flask culture of Bacillus laterosporus, strain CM-33. The fermentor was then agitated at 150 rpm while sterile air was sparged into the liquid culture at a rate of 500 liters of air per minute. Temperature was maintained at 32° C. for 45 hours. This resulted in a spore suspension containing 300 million viable spores per ml. The spore suspension was then administered to broiler chickens at the rate of 2 million cfu/bird/day, beginning on day 12 of a bird&#39;s life and continuing through day 52, at which time the birds were harvested. This represents a total dose of 2 million cfu/day for 40 days, or 80 million cfus during the life of the bird. 8,100 birds were involved with the test—3,200 controls and 4,900 treated. A corn-soy ration containing Coban was fed to the birds. The spore suspension were applied by metering pump to the bird&#39;s water supply, with adjustments daily for increased water consumption. Mortality counts were recorded daily, and feed conversion and final weights were computed at harvest. The results are presented in Table VI. TABLE VI Results-Example VI Test Control No. chickens 4,900 3,200 Avg. mortality 2.67% 3.69% Avg. final weight 2.60 kg 2.50 kg F/G 1.90 2.06 [0042] A summary of the results of Examples I-VI are presented in in Table VII. TABLE VII Summary Table for Examples I-VI (C = Control, T = Test) EXAMPLE Mortality- Weight- F/G- Mortality- Weight- F/G- # C C C T T T I 9.5 2.06 2.31 6.8 2.20 2.12 Preferred Dosing—80 million cfu total dose—F/G improvement = 19 points II 9.8 2.02 2.34 8.6 2.10 2.28 Low Dose Study—20 million cfu total dose—F/G improvement = 6 points III 9.0 2.08 2.28 6.2 2.21 2.0 High Dose Study—320 million cfu total dose—F/G improvement = 20 points IV 9.3 2.06 2.46 6.7 2.21 2.30 Shortened Dosing—50 million cfu total dose—F/G improvement = 16 points V 8.8 2.14 2.27 6.1 2.24 2.16 Dry Feed Application—80 million cfu total dose—F/G improvement = 11 points VI 3.69 2.50 2.06 2.67 2.60 1.90 Commercial Trial—80 million cfu total dose—F/G improvement = 16 points [0043] It can be seen that in Example I, the relative benefit (on the basis of F/G improvement for cfus administered) of the administration of strain CM-33 is maximized by the application, in chlorine-free drinking water, of 80,000,000 cfu/bird, beginning at day 10 and dosed daily at 2,000,000 cfu/bird for 40 days. [0044] The invention includes numerous variations, modifications and alterations of the embodiments and methods described in the specification above, and the scope of the invention is not defined or limited by this specification or by the examples, but is defined only in the claims that follow, and includes all equivalents of the subject matter of the claims.

Summary: Disclosed is a process for improving feed conversion and weight gain in poultry, including chickens, wherein Bacillus laterosporus, or any microorganism with a similarity index, based on its cellular fatty acid profile, of greater than 0.5 to Bacillus laterosporus (including Bacillus laterosporus strain CM-33 (ATCC Accession No. PTA-3952)) is administered to poultry. Strain CM-33 of Bacillus laterosporus was isolated from soil and has a similarity index of 76% to Bacillus laterosporus. The administration of strain CM-33 is preferably divided into daily doses of about 2.0 million colony forming units (cfu)/day and continued for about 40 days of the growth cycle. The cells or spores can be administered through the bird&#39;s drinking water or by other methods, including spraying them onto the bird&#39;s feed.

big_patent

en

Summarize: [0001] This application claims the benefit of U.S. Provisional Application No. 60/557,852, filed Mar. 30, 2004. TECHNICAL FIELD [0002] This invention relates generally to cotton harvesting machines including a cotton receiver for receiving and holding harvested cotton, and more particularly, to an expandable accumulator for a cotton receiver, which can be deployed to increase the capacity of a precompacting area of the receiver, and which can be folded or stored when not in use. BACKGROUND ART [0003] Commonly, cotton harvesting machines can unload harvested cotton into a container such as a trailer known as a boll buggy in the field, while remaining in the rows for harvesting the cotton plants. Essentially, a boll buggy is a container open on the top that is pulled by a tractor or other vehicle up to the cotton harvesting machine while in the field. The harvesting machine can be stopped and the boll buggy pulled alongside the cotton receiver, and the cotton in the receiver unloaded into the boll buggy. The cotton harvesting machine can then resume harvesting and the boll buggy is typically transported to a standard module builder located in an accessible location such as the end of the rows, and unloaded. As a result, the harvesting machine does not have to come out of the rows to unload when full. Newer cotton harvesting machines which compact and form or package the cotton into a unitary body or module as the cotton is conveyed into a cotton receiver on the machine, are typically required to unload the cotton module or compacted body of cotton at the end of the rows, or a location where the module or compacted body of cotton can be picked up by a module truck or the like for transport to the gin for processing. The end of the rows provides a suitable location, as the terrain is typically relatively level. It is undesirable to unload a module or compacted body of cotton in the field, as the field contains stalks and the ground is uneven as a result of being formed into raised beds for the plants. [0004] A typical modern cotton harvesting machine with an on-board module building and/or packaging capability can produce a compacted module or body of cotton that can weigh between about 8,000 and about 11,000 pounds, depending upon crop conditions. Conventional cotton harvesting machines typically can hold a maximum of about 10,500 pounds. This large capacity allows both machines to make one or more passes in the field depending on row length and yield (pounds of cotton per acre). Conventional cotton harvesting machines can unload at any time, either in the field into a boll buggy, or at the end of the rows by driving up to a module maker and unloading the cotton into it. In contrast, for maximum efficiency, a cotton harvesting machine which can package or compact cotton into a unitary module or body, is desirably unloaded when the module or body is completely formed. Partial modules or bodies should only be unloaded when finishing up a field, and these should still be unloaded at the end of the rows in what is known as the turn row where the cotton harvesting machine turns around to enter new rows for harvesting the cotton therefrom. Therefore, because of widely varying row lengths and yield conditions, there is a need for cotton harvesting machines to have the capability to hold cotton above the compactor apparatus to allow the operator to continue to harvest cotton until the end of a swath of rows or other suitable location for unloading, is reached. [0005] Therefore, what is sought is apparatus and a method which overcomes the problems and provides the capability set forth above. SUMMARY OF THE INVENTION [0006] What is disclosed is a cotton accumulator for the cotton receiver of a harvesting machine, capable of receiving and holding harvested cotton at a location separate from that in which the cotton is compacted or otherwise formed into a unitary body or module, and then, after a compacted body or module of cotton is unloaded, will allow the collected cotton to fall or be conveyed into the lower compacting region for formation by compactor apparatus into the next compacted body or module. [0007] The accumulator will preferably have a capability to be movable between a deployed position providing the sought after cotton holding capacity, and a stored position when not in use and for transport. The accumulator is preferably located in association with the upper region of the cotton receiver, in a precompacting area above the compactor apparatus, such that the compactor apparatus can serve to hold the cotton in the accumulator as compacted cotton in the receiver already is compacted or formed into a unitary body or module can be completed and unloaded. The accumulator can be moved between its deployed and stored positions using any suitable apparatus, such as one or more drivers, such as a fluid cylinder, winch, or mechanical actuator. The accumulator can also be moved between its positions by movement of the compactor apparatus, which can be of conventional, well known construction. The accumulator can be deployed manually, by operator action, or automatically, as desired or required. BRIEF DESCRIPTION OF THE DRAWINGS [0008] FIG. 1 is a side view of a cotton harvesting machine including a cotton accumulator in a deployed position according to the invention; [0009] FIG. 2 is a simplified side view of a cotton receiver of the machine of FIG. 1, showing the accumulator in its deployed position above a cotton receiver of the machine and the flow of cotton therein; [0010] FIG. 3 is another simplified side view of the cotton receiver, showing the accumulator in its stored position; [0011] FIG. 4 is another simplified side view of the receiver with the accumulator in its stored position, showing airborne conveyance of cotton into the interior of the receiver; [0012] FIG. 5 is a fragmentary side view of the receiver, showing the accumulator in its stored position, and a representative mechanism for moving the accumulator between its stored position and deployed position; and [0013] FIG. 6 is another fragmentary side view of the receiver showing the accumulator moved to its deployed position by the mechanism of FIG. 5. DETAILED DESCRIPTION OF THE INVENTION [0014] Referring now to the drawings, in FIG. 1 a cotton harvesting machine 10 is shown, including a cotton accumulator 12 constructed and operable according to the teachings of the present invention on a cotton receiver 14 of the machine. Harvesting machine 10 includes a plurality of harvesting units 16 arranged in an array across a forward end 18 of machine 10 for harvesting cotton from plants as machine 10 is moved in the forward direction along rows of the plants (not shown). The harvested cotton is conveyed by air flows through an array of ducts 20 extending upwardly and rearwardly from units 16 to a precompacting area 22 of cotton receiver 14, as denoted by arrows A, in the well known conventional manner. [0015] Referring also to FIGS. 2, 3 and 4, cotton receiver 14 is shown. Cotton receiver 14 is a structure of rectangular shape, including an interior compacting chamber 24 defined by a floor 26, forward and rearward end walls 28 and 30, and opposing side walls including a side wall 32 shown. End walls 28 and 30, and the side walls including side wall 32, extend upwardly from floor 26 to precompacting area 22 which defines a generally upwardly facing opening, which is occupied and enclosed by cotton accumulator 12. Cotton accumulator 12, end walls 28 and 30, and the side walls are preferably constructed of an air permeable material, such as a mesh or perforated sheeting having holes or openings therein adequate for dissipation of air flow therethrough, but which will retain the cotton conveyed into compacting chamber 24 as denoted by arrows A. [0016] Compactor apparatus 34 is shown in the upper region of interior compacting chamber 24. Compactor apparatus 34 includes side-to-side extending cross bars 36 adjacent end walls 28 and 30 which extend through vertical slots 38 through the side walls, including side wall 32, and are supported by a support structure 40, including a pair of fluid cylinders 42 located beside the side walls, for moving compactor apparatus 34 upwardly and downwardly within chamber 24, as denoted by arrow B in each of the figures. A substantially complete compacted body of cotton or module 44 is shown in each of FIGS. 2, 3 and 4 for illustration of usage of accumulator 12. Essentially, in operation, as cotton denoted by arrows A is conveyed into interior chamber 24, compactor apparatus 34 will be operated to move in the upward and downward direction denoted by arrow B, against the collected cotton to compact the cotton against floor 26 to gradually build a compacted body or module as represented by module 44. As explained above, a completed compacted cotton module such as module 44 can have a weight of between about 8,000 and 11,000 pounds, and will be relatively large, having dimensions corresponding to those of compacting chamber 24. It is an important objective of the use of compacting apparatus such as apparatus 34 and the making of compacted bodies and modules of cotton, such as module 44, to reduce manpower and handling, and facilitate transport of the cotton from the field to the gin for processing. Currently, compacted bodies of cotton, such as module 44, are preferably unloaded from machines, such as harvesting machines 10, on a level surface, such as the ground at the end of the rows of a cotton field, to facilitate picking up and loading the cotton onto trucks used for transporting it. Cotton fields usually include rows of raised beds separated by spaces or channels for carrying irrigation water, and after picking typically include stubble and/or intact plants, which make an undesirable surface onto which to unload a compacted body or module of cotton, as it would greatly inhibit pickup and loading onto a transport truck. As a result, it is desirable to limit unloading to times when machine 10 has completed a swath of rows of cotton, at the turn row where the machine is turned around to proceed along a new swath of rows through the field. However, it has been often found that the interior compacting chamber such as chamber 24 of machine 10 will be filled, and/or a compacted body or module such as module 44 completed, before the end of the rows is reached. This is a problem as without extra cotton carrying capacity, the harvesting operation must be interrupted, the machine moved to a suitable unloading location, unloaded, and returned to the harvesting operation, or the completed module unloaded at an undesirable location in the field. [0017] Cotton accumulator 12 overcomes the problems and shortcomings set forth above by providing added cotton receiving capacity to precompacting area 22 of cotton receiver 14. In FIGS. 1 and 2, cotton accumulator 12 is shown in a deployed position with a rearward end 46 thereof extended upwardly, denoted by arrow C in FIG. 2, for increasing the interior volume of precompacting area 22 above compactor apparatus 34 for receiving cotton conveyed therein as denoted by arrows A, the cotton being held above module 44 by the compactor apparatus 34. As a result, the harvesting operation can continue and the harvesting machine moved to a convenient and suitable unloading location such as the end of the rows being harvested, without interruption of the harvesting process. Then, after the body of cotton or module, such as module 44 is unloaded, the cotton collected in accumulator 12 above compactor apparatus 34 can be allowed to fall into, or be moved or conveyed into, the lower portion of chamber 24 for compaction into a compacted body or module in the above-described manner. Here, it should be noted that compactor apparatus such as apparatus 34 will typically include one or more rotatable augers capable of conveying cotton on top of apparatus 34 into the compacting chamber located therebelow, as is well known in the art. Such augers can be actuated to convey the cotton from accumulator 12 into the lower region of the chamber. [0018] The embodiment of cotton accumulator 12 can have a variety of interior capacities, as required or desired for a particular application. The capacity of accumulator 12 shown is illustrated by dotted crosshatching and is shown having a triangular or wedge sectional shape, but could likewise have other shapes including a more rectangular shape, or a more curved or rounded shape. Accumulator 12 is shown in FIGS. 3 and moved downwardly to a stored position contained at least substantially within precompacting area 22 of receiver 14 when its use is not required. As shown in FIG. 4, in this position, cotton can be conveyed into receiver 14 in the conventional manner as denoted by arrows A for compaction by compactor apparatus 34. The illustrated embodiment of accumulator 12 has an upper wall 48 which is generally flat and covers the forward-to-rearward and side-to-side extent of accumulator 12. Accumulator 12 includes a pair of side walls extending downwardly from upper wall 48, as illustrated by side wall 50, the side walls having a wedge shape which tapers divergently in the rearward direction. A rearward end wall 52 extends between upper wall 48 and the side walls including side wall 50 for enclosing the rearward end of accumulator 12. Side walls 50 and end wall 52 can be of suitable construction, for holding cotton, including of a suitable mesh material or sheet material including holes therethrough for the passage of air but not the cotton, or of an alternative material including a solid sheet metal, or the like. Accumulator 12 has a forward end 54 which in this embodiment is pivotally connected to a forward end of receiver 14 in a suitable manner, for instance, by one or more hinges 56 to allow movement of accumulator 12 between its deployed and stored positions. Suitable seals can be provided as required between the lower periphery of accumulator 12 and walls 28, 30 and 32. [0019] Accumulator 12 can be manually moved between its deployed and stored positions, or automatically moved using a suitable actuator or mechanism such as one or more fluid cylinders, a winch, or the like. FIGS. 5 and 6 illustrate one exemplary embodiment of a mechanism 58 for moving accumulator 12 between its stored position ( FIG. 5 ) and its deployed position ( FIG. 6 ). Mechanism 58 includes an arm 60 mounted by pivot 62 to the side of receiver 14. Arm 60 includes a first end portion 64 pivotally connected to a rod 66 of a fluid cylinder 68, and an opposite end portion 70 including a roller which contacts a downwardly facing surface of a plate 72 mounted along the side edge of accumulator 12. Fluid cylinder 68 is pivotally connected to the side of cotton receiver 14 and when extended will pivot arm 60 about pivot 62 to pivotally move accumulator 12 about hinge 56 to the deployed position as shown in FIG. 6. Similarly, when fluid cylinder 68 is retracted, arm 60 will be pivoted in the opposite direction to move accumulator 12 to its stored position as shown in FIG. 5. Here, it should be noted that mechanism 58 is but one of any number of mechanisms that could be utilized for moving accumulator 12 between its deployed and stored positions, and therefore is in no way to be considered as limiting. [0020] It will be understood that changes in the details, materials, steps, and arrangements of parts which have been described and illustrated to explain the nature of the invention will occur to and may be made by those skilled in the art upon a reading of this disclosure within the principles and scope of the invention. The foregoing description illustrates the preferred embodiment of the invention; however, concepts, as based upon the description, may be employed in other embodiments without departing from the scope of the invention. Accordingly, the following claims are intended to protect the invention broadly as well as in the specific form shown.

Summary: A cotton receiver for a cotton harvesting machine and a method of operation of the same. The receiver includes a cotton compacting chamber, a precompacting area above the chamber, and an accumulator deployable upwardly from the precompacting area to increase the cotton holding capacity thereof. Compactor apparatus is located in the compacting chamber and is configured for holding cotton thereabove separate from cotton therebelow. The compactor apparatus is movable downwardly against cotton therebelow for compacting it into a unitary body or module, including while holding cotton thereabove, and is controllably operable for conveying cotton held thereabove downwardly therethrough, subsequent to unloading a completed compacted body of cotton.

big_patent

en

Write a title and summarize: The only property of reinforcement insects are commonly thought to learn about is its value. We show that larval Drosophila not only remember the value of reinforcement (How much?), but also its quality (What?). This is demonstrated both within the appetitive domain by using sugar vs amino acid as different reward qualities, and within the aversive domain by using bitter vs high-concentration salt as different qualities of punishment. From the available literature, such nuanced memories for the quality of reinforcement are unexpected and pose a challenge to present models of how insect memory is organized. Given that animals as simple as larval Drosophila, endowed with but 10,000 neurons, operate with both reinforcement value and quality, we suggest that both are fundamental aspects of mnemonic processing—in any brain. What are the fundamental capacities of insect brains? To date, little use has been made of insect memory experiments to reveal these capacities, in particular regarding reinforcement. For example, after experiencing an odor with a sugar reward, fruit flies (Drosophila melanogaster) approach that odor in a later test. All the known circuitry (Heisenberg, 2003; Perisse et al., 2013) of such learned search behavior suggests that this is because the odor has acquired positive value; that is, that the flies are expecting to find ‘something good’ in its vicinity (Heisenberg, 2003; Gerber and Hendel, 2006; Schleyer et al., 2011; Perisse et al., 2013). Likewise, Drosophila can associate an odor with an electric-shock punishment. This supports their learned escape in a later test because they may expect ‘something bad’ with the odor. In other words, the only feature of reinforcement processing that insects are granted is value. We show that larval Drosophila are in a defined sense richer than this in their mnemonic capacity: they also recall of what particular quality that good or bad experience was. Given the numerical simplicity of the larval brain, this is suggested to be a more basic property of brains than hitherto assumed. To address this question, we exploit an established assay for Pavlovian conditioning (Gerber et al., 2013) that allows reinforcers of various strength and quality to be used. In this Petri dish assay, larvae are placed onto a tasteless agarose substrate. This substrate is supplemented with a fructose sugar reward—if odorant A is presented. Odorant B is presented without the reward (A+/B). For a companion group of larvae, contingencies are reversed (A/B+). In a binary choice test, the larvae then systematically approach the previously rewarded odorant (Figure 1—figure supplement 1). This behavior, quantified as a positive associative performance index (PI) (Figure 1A), can best be grasped as a memory-based search for reward: if the test is performed in the presence of fructose, the learned approach is abolished (Figure 1A) (Gerber and Hendel, 2006; Schleyer et al., 2011) (olfactory behavior per se is not affected: see below). This is adaptive as learned search behavior is indeed obsolete in the presence of a sought-for item. We have previously shown (Schleyer et al., 2011) that regardless of the absolute concentration of fructose, such an abolishment is seen if the fructose concentration in the test substrate is equal to or higher than that used in training. This means that learned behavior is based on a relative assessment: the larvae recall how strong the training reward was and compare this remembered strength to the current testing situation. Only if that comparison promises a gain (remembered strength > current strength) do they search for what they can thus expect to gain at the odor source. We note that widely applied formal learning models of the Rescorla-Wagner type (Rescorla and Wagner, 1972) propose that memory acquisition will only occur if something new and unexpected happens, specifically if the experienced reward is stronger than predicted on the basis of memory (current strength > remembered strength). Thus, the same two pieces of information are compared during memory acquisition on the one hand and the expression of learned search behavior on the other hand—yet in a ‘swapped’ way. This can inform the animals respectively about what is new or what there is to be gained. Here, we ask whether these processes are integrated across different qualities of reward into one common scale of appetitive value or whether separate systems exist to confer mnemonic specificity for the ‘quality’ of reward. 10. 7554/eLife. 04711. 003Figure 1. Reward processing by quality and value. (A) Larvae are trained to associate one of two odors with either 2 M fructose or 10 mM aspartic acid as reward. Subsequently, they are tested for their choice between the two odors—in the absence or in the presence of either substrate. For example, in the left-most panel, a group of larvae is first (upper row) exposed to n-amyl acetate (blue cloud) together with fructose (green circle), and subsequently (middle row) to 1-octanol (gold cloud) without any tastant (white circle). After three cycles of such training, larvae are given the choice between n-amyl acetate and 1-octanol in the absence of any tastant (lower row). A second group of larvae is trained reciprocally, that is, 1-octanol is paired with fructose (second column from left, partially hidden). For the other panels, procedures are analogous. Aspartic acid is indicated by brown circles. (B) Data from (A) plotted combined for the groups tested on pure agarose (‘Mismatch’ in both value and quality), in the presence of the respectively other reward, or of the training reward. Learned search behavior towards the reward-associated odor is abolished in presence of the training reward because both reward value and reward quality in the testing situation are as sought-for (‘Match’ in both cases), yet search remains partially intact in the presence of the other quality of reward, because reward value is as sought-for (‘Match’) but reward quality is not (‘Mismatch’). Please note that value-memory is apparently weaker than memory for reward quality, and is revealed only when pooling across tastants. Sample sizes 15–19. Shaded boxes indicate p < 0. 05/6 (A) or p < 0. 05/3 (B) from chance (one-sample sign-tests), asterisks indicate pairwise differences between groups at p < 0. 05/3 (A) or p < 0. 05/2 (B) (Mann–Whitney U-tests). DOI: http: //dx. doi. org/10. 7554/eLife. 04711. 00310. 7554/eLife. 04711. 004Figure 1—figure supplement 1. Preference scores for the reciprocally trained groups of Figure 1. Sample sizes: 15–19. Shaded boxes indicate pairwise differences between groups (p < 0. 05/6, Mann–Whitney U-tests). For a detailed description of the sketches, see legend of Figure 1. DOI: http: //dx. doi. org/10. 7554/eLife. 04711. 00410. 7554/eLife. 04711. 005Figure 1—figure supplement 2. (A, B) Larvae are trained in a one-odor version of the learning paradigm, using different concentrations of aspartic acid as reward. Increasing the concentration increases the associative performance index. For the highest concentration used, levels of learned behavior are not different from those obtained with 2 M fructose as reward. (B) Preference scores underlying the associative performance indices in (A). Sample sizes: 11–17. Shaded boxes in (A) indicate difference from chance (p < 0. 05/4, one-sample sign-tests), in (B) pairwise differences between groups (p < 0. 05/4, Mann–Whitney U-tests). Asterisk: difference between groups (p < 0. 05, Kruskal–Wallis test). For a detailed description of the sketches, see legend of Figure 1. DOI: http: //dx. doi. org/10. 7554/eLife. 04711. 005 We introduce aspartic acid, a proteinogenic amino acid, as a novel quality of reward (Figure 1—figure supplement 2). Concentrations of aspartic acid and fructose are chosen such that their reward value is equal (Figure 1A). This allows us to study the larvae under test conditions that are of equal reward value but that either match or do not match the ‘quality’ of reward that has been employed during training. If the larvae merely searched for a reward of remembered value, learned search behavior should cease in both cases—because current strength matches remembered strength in both cases. If reward quality were the sole determinant for learned search, in contrast, learned search should be abolished only when test and training substrate match in quality, but should remain intact when quality does not match. If the larvae searched for a reward specified both by its value and by its quality, scores in the mismatch case should be partially abolished: in that case, the reward' s value is as sought yet its quality is not. We find that learned search is fully abolished when the training and test reward match in both value and quality but remains partially intact (by 68%) if there is a mismatch in reward quality between training and test (Figure 1A, B). We conclude that after odor-fructose training the larvae approach the odor both in search of something ‘good’ (value) and in search of what is specifically fructose (quality of reward). Likewise, after odor-aspartic acid training, they search both for something ‘good’ and for aspartic acid. In other words, if during the test the larvae, for example, have sugar anyway but remember where aspartic acid can be found, they will still go for aspartic acid in addition. Regarding the aversive domain, pairing an odor with quinine as punishment leads to aversive memory (Gerber and Hendel, 2006; Schleyer et al., 2011; El-Keredy et al., 2012; Apostolopoulou et al., 2014). In this case, learned behavior can best be understood as an informed escape that is warranted in the presence but not in the absence of quinine. Accordingly, in the presence but not in the absence of quinine one observes that the larvae run away from the previously punished odor (Gerber and Hendel, 2006; Schleyer et al., 2011; El-Keredy et al., 2012; Apostolopoulou et al., 2014) (see also Niewalda et al., 2008; Schnaitmann et al., 2010; Eschbach et al., 2011; Russell et al., 2011 for reports using other aversive reinforcers and/or adult flies). Notably and in accordance with our earlier results in the appetitive domain (Schleyer et al., 2011), such learned escape does not merely depend on the concentration of quinine in the test; rather, learned escape lessens as the quinine concentration in the test is reduced relative to that in training (Figure 2—figure supplement 1). Given that high-concentration salt can also serve as punishment (Gerber and Hendel, 2006; Niewalda et al., 2008; Russell et al., 2011), we ask whether an odor-quinine memory is specific in prompting escape from quinine—but not from salt. For concentrations of quinine and salt that are of equal value as punishment, this is indeed the case (Figure 2A) (Figure 2—figure Supplement 2); likewise, odor-salt memories are specific in prompting learned escape from salt but not from quinine (for a summary see Figure 2B). Such specificity shows that larvae have a memory specific to the quality of punishment, a memory that can specifically be applied in the appropriate situation. We stress that the present results do not provide proof of the absence of aversive ‘common currency’ value processing. Indeed, in cases of unequal punishment value, larvae may use this information (Eschbach et al., 2011). 10. 7554/eLife. 04711. 006Figure 2. Punishment processing by quality. (A) Larvae are trained to associate one of two odors with either 5 mM quinine (red circle) or 4 M sodium chloride (purple circle) as punishment and asked for their choice between the two odors—in the presence of either substrate. The larvae show learned escape from the punishment-associated odor only if a matching quality of punishment is present during the test as compared to training. (B) Data from (A) combined according to ‘Match’ or ‘Mismatch’ between test- and training-punishment. We note that value-memory would reveal itself by negative scores upon a match of punishment value despite a mismatch in punishment quality, which is not observed (right-hand box plot, based on second and fourth box plot from A). Sample sizes: 25–32. Shaded boxes indicate p < 0. 05/4 (A) or p < 0. 05/2 (B) from chance (one-sample sign-tests), asterisks indicate pairwise differences between groups at p < 0. 05/3 (A) or p < 0. 05 (B) (Mann–Whitney U-tests). For a detailed description of the sketches, see legend of Figure 1. DOI: http: //dx. doi. org/10. 7554/eLife. 04711. 00610. 7554/eLife. 04711. 007Figure 2—figure supplement 1. Quinine memory includes quinine strength. (A) Larvae are trained to associate one of two odors with a quinine punishment, using either a low (light red) or a high (dark red) concentration of quinine. Learned escape behavior is expressed if the testing conditions are as ‘bad’ as the training-punishment, or worse. In other words, neither the value of the training-punishment alone nor the value of the testing situation alone, determines the levels of learned behavior—but a comparison of them does. (B) Preference scores underlying the associative performance indices in (A). Sample sizes: 22–23. Shaded boxes in (A) indicate p < 0. 05/5 from chance (one-sample sign-tests), in (B) pairwise differences between groups at p < 0. 05/5 (Mann–Whitney U-tests). Asterisks in (A) indicate pairwise differences between groups at p < 0. 05/3 (Mann–Whitney U-tests). For a detailed description of the sketches, see legend of Figure 1. DOI: http: //dx. doi. org/10. 7554/eLife. 04711. 00710. 7554/eLife. 04711. 008Figure 2—figure supplement 2. Preference scores for the reciprocally trained groups of Figure 2. Sample sizes: 25–32. Shaded boxes indicate differences between groups (p < 0. 05/4, Mann–Whitney U-tests). For a detailed description of the sketches, see legend of Figure 1. DOI: http: //dx. doi. org/10. 7554/eLife. 04711. 008 Taken together, within both the appetitive and aversive domain, experiencing an odor with a taste reinforcement can establish an associative olfactory memory that is specific to the quality (fructose, aspartic acid, quinine, high-concentration salt) of taste reinforcement. The experimental twist to reveal such quality-of-reinforcement memory is accomplished by flagrantly breaking the first rule of associative memory research: namely never, ever, to test for learned behavior in the presence of the reinforcer. We would like to stress that innate olfactory behavior per se is not affected by the presence of any of the tastant reinforcers (Hendel et al., 2005; Schleyer et al., 2011) (Figure 3). Also, the mere presence of any given tastant reinforcer during the memory test is not a critical determinant for whether learned behavior is observed: learned behavior can be observed (or not) in the presence of any of the tastant reinforcers in this study—what matters is how closely it matches the one used during training in quality and/or in value (Figures 1B and 2B). 10. 7554/eLife. 04711. 009Figure 3. Innate odor preference is not influenced by taste processing. Larvae are tested for their olfactory preference regarding (A) n-amyl acetate (blue cloud), (B) 1-octanol (gold cloud), or (C) for their choice between n-amyl acetate and 1-octanol. This is done in the presence of pure agarose (white circle), 2 M fructose (green circle), 10 mM aspartic acid (brown circle), 5 mM quinine (red circle), or 4 M sodium chloride (purple circle). We find no differences in odor preferences across different substrates (p > 0. 05, Kruskal–Wallis tests). Sample sizes: 20–26. DOI: http: //dx. doi. org/10. 7554/eLife. 04711. 009 The mushroom bodies, a third-order ‘cortical’ (Tomer et al., 2010) brain region in insects, are canonically proposed to feature distinct regions harboring appetitive and aversive olfactory memory traces, respectively (Heisenberg, 2003; Perisse et al., 2013; see also Schleyer et al., 2011) (Figure 4A, B). Only recently has the possibility of different neuronal substrates underlying different qualities of reinforcement come to be considered. These studies have so far not yielded a double dissociation between different dopaminergic mushroom body input neurons for different qualities of reinforcement: For the aversive domain Galili et al. (2014) suggested that the set of dopaminergic mushroom body input neurons responsible for heat-punishment in adult Drosophila is nested within that for electric-shock punishment. Similarly, electric-shock punishment and punishment with the insect repellent DEET appear to be signaled towards the mushroom body by largely if not completely overlapping sets of dopamine neurons (Das et al., 2014). For the appetitive domain, a set of dopaminergic mushroom body input neurons (included in the 0104-Gal4 strain) that was previously found to be required for sugar-learning in adult Drosophila (Burke et al., 2012) turned out to be dispensable for water-reward learning (Lin et al., 2014). Whether in turn dopaminergic mushroom body input neurons included in the R48B04 strain, which were discovered by Lin et al. (2014) to be required for water-reward learning, are dispensable for sugar-learning remains to be tested. 10. 7554/eLife. 04711. 010Figure 4. Working hypotheses of reinforcement processing by value-only or by value and quality in larval Drosophila. (A) Simplified overview (based on e. g., Heisenberg, 2003; Perisse et al., 2013). Odors are coded combinatorially across the olfactory sensory neurons (OSN, blue). In the antennal lobe, these sensory neurons signal towards local interneurons (not shown) and projection neurons (PN, deep blue). Projection neurons have two target areas, the lateral horn (LH, orange) mediating innate approach, and the mushroom body (MB, yellow). Reinforcement signals (green and red for appetitive and aversive reinforcement, respectively) from the gustatory system reach the mushroom body, leading to associative memory traces in simultaneously activated mushroom body neurons. In the present analysis, this sketch focuses selectively on five broad classes of chemosensory behavior, namely innate odor approach, learned odor search and escape, as well as appetitive and aversive innate gustatory behavior. The boxed region is displayed in detail in (B–C). The break in the connection between mushroom body output and behavior is intended to acknowledge that mushroom body output is probably not in itself sufficient as a (pre-) motor signal but rather exerts a modulatory effect on weighting between behavioral options (Schleyer et al., 2013; Menzel, 2014; Aso et al., 2014). (B) Reinforcement processing by value (based on e. g., Heisenberg, 2003; Schleyer et al., 2011; Perisse et al., 2013): a reward neuron sums input from fructose and aspartic acid pathways and thus establishes a memory allowing for learned search for ‘good’. In a functionally separate compartment, a punishment neuron summing quinine and salt signals likewise establishes a memory trace for learned escape from ‘bad’. This scenario cannot account for quality-of-reinforcement memory. (C) Reinforcement processing by both value and quality: in addition to a common, value-specific appetitive memory, fructose and aspartic acid drive discrete reward signals leading to discrete memory traces in at least functionally distinct compartments of the Kenyon cells, which can be independently turned into learned search. For aversive memory, there may be only quality-specific punishment signals. This scenario is in accordance with the present data. DOI: http: //dx. doi. org/10. 7554/eLife. 04711. 010 Thus, the nuanced memory of at least two qualities of appetitive and two qualities of aversive taste reinforcers as shown in the present study is unexpected. Appropriate to such nuanced memories, the mushroom bodies show a fairly complex substructure, even in larval Drosophila. At least 10 mushroom body regions are recognized, defined by the tiled innervation of input and output neurons (Pauls et al., 2010b). Our behavioral data suggest that at least five such tiles of the mushroom body would be required to accommodate learned search for fructose or aspartic acid, learned escape from quinine or from high-concentration salt and in addition a less specific appetitive value-memory (Figure 4C). Clearly the things worth remembering for a larva include many more than these five (Niewalda et al., 2008; Pauls et al., 2010a; Eschbach et al., 2011; Khurana et al., 2012; Rohwedder et al., 2012; Diegelmann et al., 2013). Likewise, the behavioral repertoire of larvae may be considerably greater than thought (Vogelstein et al., 2014). Using our current approach, it will now be possible to systematically determine the limits of specificity in the processing of reinforcement quality. This may reveal signals of intermediate specificity to inform the animals about, for example, edibility, caloric value, proteinogenic value, suitability for pupariation, toxicity, or even acutely and situationally modulated matters of concern (Simpson et al., 2015). We note that the distinction between fructose and aspartic acid memory implies that the sensory neurons mediating the rewarding effects of these stimuli cannot be completely overlapping and that the sensory neurons mediating the punishing effects of quinine and high-concentration salt likewise cannot (for reviews of the taste system in Drosophila, see Cobb et al., 2009; Gerber et al., 2009). For identifying these neurons, it is significant that they may be distinct from those mediating innate choice behavior (Apostolopoulou et al., 2014; König et al., 2014). In the vertebrate literature, the processing of reward by value has been regarded as a matter of sophistication because an integrated, higher-order value signal can be generated from sensorially distinct qualities of reward (e. g., Lak et al., 2014). On the other hand, reward expectations can apparently also be processed in a quality-specific manner (e. g., Dickinson and Balleine, 1994; Watanabe, 1996). In terms of the minimally required number of cells, the processing by reinforcer quality is more demanding than value-only processing (Figure 4B, C). The fact that even the humble, 10,000-neuron brain of a larva operates with both reward value and quality may suggest that they both represent fundamentally important, indispensable aspects of reward processing. We used third-instar feeding-stage larvae from the Canton-Special wild-type strain, aged 5 days after egg laying. Flies were maintained on standard medium, in mass culture at 25°C, 60–70% relative humidity and a 12/12 hr light/dark cycle. Before each experiment, we removed a spoonful of food medium from a food vial, collected the desired number of larvae, briefly rinsed them in distilled water, and started the experiment. For experiments, we used Petri dishes of 90-mm inner diameter (Sarstedt, Nümbrecht, Germany) filled with 1% agarose (electrophoresis grade; Roth, Karlsruhe, Germany). As reinforcers fructose (FRU; CAS: 57-48-7; Roth, Karlsruhe, Germany), aspartic acid (ASP; CAS: 56-84-8; Sigma–Aldrich, Seelze, Germany), quinine (QUI; CAS: 6119-70-6; Sigma–Aldrich), or sodium chloride (SAL; 7647-14-5; Roth, Karlsruhe, Germany) were used in concentrations given in the results section. As odors, we used n-amyl acetate (AM; CAS: 628-63-7; Merck, Darmstadt, Germany), diluted 1: 50 in paraffin oil (Merck, Darmstadt, Germany) and 1-octanol (OCT; CAS: 111-87-5; Sigma–Aldrich). Prior to experiments, odor containers were prepared: 10 µl of odor substance was filled into custom-made Teflon containers (5-mm inner diameter with a lid perforated with seven 0. 5-mm diameter holes). Before the experiment started, Petri dishes were covered with modified lids perforated in the center by 15 holes of 1-mm diameter to improve aeration. For training, 30 larvae were placed in the middle of a FRU-containing dish with two odor containers on opposite sides, both filled with AM. After 5 min, larvae were displaced onto an agarose-only dish with two containers filled with OCT, where they also spent 5 min. Three such AM+/OCT training cycles were performed, in each case using fresh dishes. In repetitions of the experiment, in half of the cases training started with a reinforcer-added dish (AM+/OCT) and in the other half with an agarose-only dish (OCT/AM+). For each group of larvae trained AM+/OCT (or OCT/AM+, respectively), a second group was trained reciprocally, that is, AM/OCT+ (or OCT+/AM, respectively). Following training, larvae were transferred to a test Petri dish that, as specified for each experiment, did or did not contain a reinforcer and given the choice between the two trained odors. After 3 min, larvae were counted and a preference score calculated as: (1) Preference = (#AM − #OCT) /#Total. In this equation, # indicates the number of larvae on the respective half of the dish. Thus, PREF values are constrained between 1 and −1 with positive values indicating a preference for AM and negative values indicating a preference for OCT. From two reciprocally trained groups of animals, we calculated an associative performance index (PI) as: (2) Performance Index = (PreferenceAM+/OCT − PreferenceAM/OCT+) /2. Thus, performance index values can range from 1 to −1 with positive values indicating appetitive and negative values indicating aversive conditioned behavior. Preferences and performance indices for other reinforcers were calculated in an analogous way. A group of 30 experimentally naïve larvae were placed on a Petri dish filled with pure agarose (PUR) or agarose containing FRU, ASP, QUI, or SAL. Animals were given the choice between an odor-filled and an empty Teflon container; as odor, either AM or OCT was used. After 3 min, the position of the larvae was scored to calculate their preference as: (3) Preference = (#AM − #EM) /#total (this equation was used in Figure 3A). (4) Preference = (#OCT − #EM) /#total (this equation was used in Figure 3B). To measure choice, one container was loaded with AM and the other with OCT and preference calculated as: (5) Preference = (#AM − #OCT) /#total (this equation was used in Figure 3C). Preference values and performance indices were compared across multiple groups with Kruskal–Wallis tests. For subsequent pair-wise comparisons, Mann–Whitney U-tests were used. To test whether values of a given group differ from zero, we used one-sample sign tests. When multiple tests of the same kind are performed within one experiment, we adjusted significance levels by a Bonferroni correction to keep the experiment-wide error rate below 5%. This was done by dividing the critical p value 0. 05 by the number of tests. We present our data as box plots which represent the median as the middle line and 25%/75% and 10%/90% as box boundaries and whiskers, respectively.

Title: Learning the specific quality of taste reinforcement in larval Drosophila Summary: Actions have consequences; positive consequences or rewards make it more likely that a behavior will be repeated, while negative consequences or punishments can stop a behavior occurring again. Neuroscientists commonly refer to such rewards and punishments as'reinforcement'. Fruit flies that are given a reward of sugar when they experience an odor will move towards the odor in later tests. However, in 2011, research revealed that if the flies were given at least the same amount of sugar in the tests as they were rewarded with during the earlier training, the flies stopped moving towards the odor. This suggests that fruit flies can recall how strong a reward was in the past and compare this remembered strength to the current reward on offer; fruit flies will only continue searching if they expect to gain a larger reward by doing so. Insects were commonly thought to only learn the amount or 'value' of reinforcement, but not recall what kind or 'quality' of reward (or punishment) they had experienced. Now Schleyer et al. -including some of the researchers involved in the 2011 work-challenge and extend this notion and show that fruit fly larvae can remember both the value and quality of rewards and punishments. Fruit fly larvae were trained to expect a reward of sugar when exposed to one odor and nothing when exposed to a different odor. Consistent with the previous results, the larvae moved towards the first odor in the tests where no additional reward was provided. Moreover, the larvae did not move towards the odor in later tests if an equal or greater amount of sugar was provided during the testing stage. Schleyer et al. then took larvae that had been trained to expect a sugar reward and gave them a different, but equally valuable, reward during the testing stage-in this case, the reward was an amino acid called aspartic acid. These experiments revealed that most of the larvae continued to move towards the sugar-associated odor in search of the sugar reward. This indicates that the larvae were able to remember the quality of the reward, namely that it was sugar rather than aspartic acid. Schleyer et al. performed similar experiments, and observed similar results, when using two different punishments: bitter-tasting quinine and high concentrations of salt. These findings show that experiencing an odor along with taste reinforcement could set up a memory specific to the quality of reinforcement in fruit fly larvae. Given the numerical simplicity of a larva' s brain-which contains only 10,000 neurons-it is likely that other animals can also recall both the value and quality of a reward or punishment. However, understanding how such specificity comes about should be easier in the larva' s simple brain.

lay_elife

en

Summarize: BACKGROUND OF THE INVENTION [0001] 1. Field of the Invention [0002] The present invention relates to a pet exercise and amusement device, and particularly to a device for improving a ball and chain pet toy. The device includes a chain link having a clamping means on each side, which is threaded through a cylindrical bore within a pet ball or attached to an attachment loop on a solid pet ball. This invention will be appreciated by those who wish to handle and transport their pet toys in a quick and clean manner, while being able to adjust the device for different sized dogs. The invention is also useful for comforting pets with physical or psychological problems. [0003] It is very important for pets, especially dogs, to receive constant exercise in order for them to maintain their health. It is also important for pets suffering from physical problems (e.g. arthritis) or psychological problems (e.g. separation anxiety) to have a toy that helps and does not hinder their well-being. Unfortunately, many pet owners do not have the time or the proper equipment to meet the daily needs of their pets. [0004] Ball toys are usually a dog&#39;s favorite play toy, both as a chew toy and for retrieving during owner interaction. These items quickly become dirty and saliva-soaked with use. As a result, pet owners require ball toys with convenient structures like straps or handles to allow them to be transported or tossed without having to handle a sordid and saliva-soaked ball. However, some dogs like to play with standalone balls with no attached structures as they can become tangled around their legs and ultimately, frustrating to play with. [0005] A solution to these problems is to provide a ball and chain device that can be used as a pet toy with a means to transport their pet toys in a quick and clean manner, adjust the device for different sized dogs, and comfort their dogs with physical or psychological problems. Specifically, the present invention comprises a ball that is adapted to receive or otherwise attach to a length of chain link. One side of the chain link includes a removable clamp that is used to attach to a dogs collar. The other end of the chain link has a ball retention element utilized to retain the ball during play or when attached to the pet&#39;s collar. Different ball retention elements are contemplated for different applications, including a chewable knot, a removable clamp, or another form of retention member that can support the ball when disposed at the end of the chain link assembly. [0006] 2. Description of the Prior Art [0007] Devices have been disclosed in the prior art that relate to pet exercise and amusement devices. These include devices that have been patented and published in patent application publications. These devices generally relate to ball toys with rope handles or straps connected within or around the balls. The following is a list of prior art deemed most relevant to the present disclosure that are described for the purposes of highlighting and differentiating the unique aspects of the present invention and further highlighting the drawbacks existing in the prior art. [0008] In the pet ball and chain devices of the prior art, none are provided that attach to the dog&#39;s collar, adjust for different sized dogs, or detach from the ball retention element such that the dog may play with a standalone ball. [0009] One such device in the prior art is U.S. Pat. No. 7,543,550 to Simpson, which describes a pet toy and exercise device that allows the pet to exercise without the aid of the pet owner. The device has three sets of cords and a ball that can be hung from a support structure such as a ceiling or a tree limb. One elastic cord is connected to the support structure on one side and a non-elastic cord on the other. The non-elastic cord is then connected to the ball, while a second, shorter non-elastic cord is connected to the other side of the ball and is used for chewing or a grasping aid. While the device provides a useful unassisted exercise device for pets, it is not readily adjustable and pet owners would have to purchase specific cord lengths based on their pet&#39;s size. [0010] Another such device is U.S. Pat. No. 5,961,406 to Hass, which describes a pet toy device with a ball having a looped handle. The ball has a hollow cavity with two openings where two ends of the handle are inserted into the openings and joined. The device improves the durability of pet ball toys by having the joining means of the handle inside the hollow cavity to prevent premature wear and breakage of the ball-handle mating areas. The device provides a ball and handle pet toy that can be transported by the pet owner without having to handle the used ball, however, the device cannot be connected to the dog&#39;s collar and the handle cannot be readily removed to enable the pet to play with a handle-less ball. [0011] U.S. Pat. No. 4,321,888 to Topliffe describes a tethered ball device to be used as a toy for small dogs. The ball has two halves that feature multiple cylindrical passageways modeled on each side. When the two halves are adhered together they form a watertight seal and the cylindrical passageways form channels to receive cotton cable cord tethers. The tethered ball can then be used as a lightweight, graspable and pullable toy for one or more small dogs. While providing a useful amusement toy for small dogs, the device cannot be adjusted for different sized dogs and cannot be transported without the pet owner handling a filthy and saliva covered pet toy. [0012] Finally, U.S. Patent Application Publication 2007/0062461 to Lubeck describes a device with a rope attached to a bounceable biting object in multiple configurations to be used as a dog toy. The biting object is a ball with equivalent material and performance characteristics as a tennis ball and has a hollow interior cavity with an opening on one side of the ball. A rope is attached to the ball by a method of creating a double knot within the hollow cavity. This device suffers from similar aforementioned adjustability and transportability problems. [0013] None of the prior art provide the benefits inherent described by the present invention, nor do they suggest like or similar elements that would achieve the same goals. The prior art consists of overly complex, difficult to manufacture, and expensive designs with specialized components. Therefore, there is a need for a novel and useful pet toy device that is adaptable from a ball and chain toy to a standalone ball, attachable to a dog collar and adjustable for different sized dogs. In this regard, the instant invention substantially fulfills these needs. [0014] The present invention is contemplated as an ideal tool for redirecting a pet&#39;s attention while suffering from physical and mental distress, including physical injuries and mental health issues such as found in elderly pets, those with obsessive compulsive disorders, and the like. It is submitted that the present invention is substantially divergent in design elements from the prior art, and consequently it is clear that there is a need in the art for an improvement to existing pet ball and chain toy devices. In this regard the instant invention substantially fulfills these needs. SUMMARY OF THE INVENTION [0015] In view of the foregoing disadvantages inherent in the known types of pet amusement devices now present in the prior art, the present invention provides a new ball and chain link pet toy device that can be utilized to connect a pet ball toy to a pet&#39;s collar and adjust for different sized dogs, providing enhanced well-being and convenience for the pet and pet owner. [0016] It is therefore an object of the present invention to provide a new and improved pet amusement device that has all of the advantages of the prior art and none of the disadvantages. [0017] It is another object of the present invention to provide a ball and chain link device that is readily attachable to a typical dog collar. [0018] Another object of the present invention is to provide a hollow ball toy with a through hole for a chain link to be threaded through. [0019] Another object of the present invention is to provide a solid ball toy with having an attachment loop adapted to secure to the chain link, which can then be attached to a pet&#39;s collar. [0020] Yet another object of the present invention is to provide a pet amusement device that attaches to a ball toy with a ball retention element therealong for securing to the chain link, which can then be attached to a pet&#39;s collar. [0021] A final object of the present invention is to provide a pet toy that is adjustable for different sized pets and can be utilized for amusement and comforting purposes. [0022] Other objects, features and advantages of the present invention will become apparent from the following detailed description taken in conjunction with the accompanying drawings. BRIEF DESCRIPTIONS OF THE DRAWINGS [0023] Although the characteristic features of this invention will be particularly pointed out in the claims, the invention itself and manner in which it may be made and used may be better understood after a review of the following description, taken in connection with the accompanying drawings wherein like numeral annotations are provided throughout. [0024] FIG. 1 shows a perspective view of the preferred embodiment of the present invention in an assembled state such that the pet owner can initiate play with their pet or actuate the clamp and attach the chain link to a pet collar. [0025] FIG. 2 shows a view of an alternate embodiment of the present invention, attached to a pet&#39;s collar in an adjusted state. [0026] FIG. 3 shows a perspective view of an alternate embodiment of the present invention, wherein an attachment loop is shown extending therefrom and attaching to a chain link. [0027] FIG. 4 shows a perspective view of the present invention, in a disassembled state with the standalone ball toy. [0028] FIG. 5 shows a view of another embodiment of the ball retention element, where a ball end stop is provided. DETAILED DESCRIPTION OF THE INVENTION [0029] Reference is made herein to the attached drawings. Like reference numerals are used throughout the drawings to depict like or similar elements of the dumbbell attachment device. For the purposes of presenting a brief and clear description of the present invention, the preferred embodiment will be discussed as provided for amusing and soothing a pet using a ball and chain device. The figures are intended for representative purposes only and should not be considered to be limiting in any respect. [0030] Referring now to FIG. 1, there is shown a view of an embodiment of the ball and chain device 11 of the present invention in an assembled state. The device comprises a hollow ball 12 that is secured by a chain link assembly 20 fed therethrough. The hollow ball 12 comprises a through hole 16 that is located through the ball&#39;s central axis in order to receive the chain link assembly 20. The ball 12 is preferably made of a durable rubber material that is typically used on dog toys. The chain link assembly 20 has a plurality of chain links 13 that are attached to a removable clamp 14 on one end and a ball retention element at the opposite end. In one embodiment, the ball retention element is a rope knot 17 that can be chewed on by the dog or used in tug of war play exercises. [0031] The removable clamp 14 and the ball retention element are used to retain the hollow ball 12 between both ends of the chain link assembly 20. The removable clamp 14 is preferably a spring-loaded latching mechanism 15 that enables the pet owner to use the device in several ways. In the assembled state, the pet owner can actuate the clamp&#39;s latching mechanism 15 and attach the device to a pet&#39;s collar, or begin playing fetch or tug-of-war with the dog, or remove the clamp 14 and withdraw the chain link from the ball 12. By removing the clamp 14, the pet owner and dog can use the hollow ball 12 by itself as the primary play toy. [0032] The removable clamp 14 is preferably a typical carabineer with a metal loop and a spring-loaded gate. It should be appreciated that many types of materials and clamping means can be utilized to provide the ability to quickly and easily clamp the device to a dogs collar and be readily removable to disassemble the device. [0033] The chain links 13 are torus-shaped to provide flexibility and adjustability of the device. The open interior portion of the torus-shaped links allows the clamp 14 to be positioned at multiple points in the chain link 13 to adjust the device to different lengths based on pet owner preferences or different sized dogs. The chain links 13 are made out of a metallic material, hard plastic, or some other durable but lightweight composite to provide strength while being lightweight enough to not injure or overburden the dog with additional weight around their neck. Alternatives to the chain material include rubber, plastic, or composite material for reduced weight. [0034] The rope knot 17 embodiment of the ball retention element is used for chewing or gripping by the dog. The knot 17 is made of durable nylon rope and is permanently adhered to the chain link 13 by tying the knot around the end of the chain link 13 and applying non-toxic adhesive to the knot 17 and chain link 13. It should be appreciated that the nylon rope can be any durable material that prevents premature wear caused by the teeth of a pet and everyday use. Another alternative for a ball retention element may include an oversized link attached at the end of the chain, the link being composed of the same chain link material and of such a size that it does not fit or pass through the smaller diameter of the hole passage in the ball itself. [0035] Referring now to FIG. 2, there is shown a view of the ball and chain device 11 according to a second embodiment. Similar to the embodiment illustrated in FIG. 1, this embodiment includes a hollow ball 12 and removable clamp 14, but instead of a non-removable knot 17 as the ball retention element, this embodiment contemplates a removable clamp 19 attached to the end of the chain link assembly and below the ball 12. The addition of another removable clamp 19 allows for further adjustability of the device and rapid removal of the hollow ball 12 while the device is attached to the dog&#39;s collar. [0036] Furthermore, FIG. 2 shows the device in an adjusted state and attached to the dog&#39;s collar 24. In order to adjust the device the pet owner removes the clamp 14 from the end of the chain link 13 and attaches it to the appropriate link at the desired length and then attaches the clamp 14 to the O-ring 22 on the dog&#39;s collar 24. When properly attached to the dog&#39;s collar 24, the dog can play with the device without the support of the pet owner. This is particularly useful for pets that require constant stimulation, have trouble locating their toys, or have other physical, mental, or physiological issues. In addition, when in the attached state the likelihood of the pet owner or pet misplacing the ball will be eliminated. It should be appreciated that the embodiment of FIG. 1 can be utilized in similar fashion as described here. [0037] Referring now to FIG. 3, there is shown a perspective view of the ball and chain device according to yet another embodiment 31. In this embodiment 31, there is a solid ball 25 with a U-shaped attachment loop 18 protruding therefrom. The clamp 14 can be attached to the attachment loop 18 and used as described in the above embodiments. Alternatively, a solid chain link can be received by the attachment loop 18 for a permanent connection therebetween, whereby the final chain link of the chain link assembly is secured by the attachment loop. The solid ball 25 and attachment loop 18 embodiment provides a configuration that may be preferred over the hollow ball based on pet owner and pet desires. This embodiment 31 also provides a more suitable standalone ball toy as the pet owner will have a handle to pick up and launch the ball during play and transportation, while also reducing or eliminating the pet owner from handling a saliva-ridden and dirty pet toy. [0038] Referring now to FIG. 4, there is shown a perspective view of the ball and chain device in a disassembled state. In this state, the pet owner and pet have multiple options of play. The pet can play with or chew the chain link assembly 20 or with the hollow ball 12. Further shown in FIG. 4 is the addition of a standard squeaker 23 mechanism, which can be inserted into the hollow ball 12 or flush mounted on the ball&#39;s surface. The squeaker creates a sound when the pet compresses the ball, as is well understood in the art of pet and dog toys. [0039] Referring finally to FIG. 5, there is shown yet another embodiment of the ball retention element of the present invention. In this embodiment, the final chain link within the hollow ball 12 is attached to a ball-stop element 41 that includes a raised ridge 43 that is of greater diameter than the through hole in the hollow ball 12. An upstanding portion 43 of the ball-stop element is inserted into the through hole while the ridge 43 prevents the ball from sliding off of the end of the chain. A hole 42 in the upstanding portion 43 accepts a link in the chain to secure the two elements together while in use. This embodiment retains the ball 12 at the end of the chain, wherefrom the ball 12 can be removed by detaching the upper clamp from the opposite end of the chain link assembly. [0040] Overall, the present invention provides a unique configuration for the ball and chain pet toy, which allows the pet owner and pet to be extremely flexible and adaptable while playing, while also providing an affordable and safe toy. The toy is adapted to entertain a pet and provide comfort thereto. The device is attachable to a pet collar and can be readily detached and used in different ways. The several embodiments provide for alternatives for the pet owner, wherein a chain link assembly attachable to a pet collar and supporting a pet chew toy is desired. [0041] It is therefore submitted that the instant invention has been shown and described in what is considered to be the most practical and preferred embodiments. It is recognized, however, that departures may be made within the scope of the invention and that obvious modifications will occur to a person skilled in the art. With respect to the above description then, it is to be realized that the optimum dimensional relationships for the parts of the invention, to include variations in size, materials, shape, form, function and manner of operation, assembly and use, are deemed readily apparent and obvious to one skilled in the art, and all equivalent relationships to those illustrated in the drawings and described in the specification are intended to be encompassed by the present invention. [0042] Therefore, the foregoing is considered as illustrative only of the principles of the invention. Further, since numerous modifications and changes will readily occur to those skilled in the art, it is not desired to limit the invention to the exact construction and operation shown and described, and accordingly, all suitable modifications and equivalents may be resorted to, falling within the scope of the invention.

Summary: A pet exercise and amusement device is provided that attaches a pet toy to a pet collar. The device includes a chain link assembly, a ball, and a clamping means for attaching the chain link assembly and ball to a pet collar. In a preferred embodiment, a hollow ball with a through hole is provided that accepts the chain link assembly therethrough. The chain link assembly includes a plurality of links with a clamp on one end and a ball retention element along the opposing end. Another contemplated embodiment includes a solid ball and an attachment loop adapted to provide connection to the chain link assembly. The device attaches to a pet collar for continuous exercise or amusement, and for preventing the pet from losing the toy while engaged therewith. The device can also be rapidly configured into different toys based on pet owner or pet needs.

big_patent

en

Summarize: Not far from this time Nat Turner's insurrection broke out; and the news threw our town into great commotion. Strange that they should be alarmed, when their slaves were so "contented and happy"! But so it was. It was always the custom to have a muster every year. On that occasion every white man shouldered his musket. The citizens and the so-called country gentlemen wore military uniforms. The poor whites took their places in the ranks in every-day dress, some without shoes, some without hats. This grand occasion had already passed; and when the slaves were told there was to be another muster, they were surprised and rejoiced. Poor creatures! They thought it was going to be a holiday. I was informed of the true state of affairs, and imparted it to the few I could trust. Most gladly would I have proclaimed it to every slave; but I dared not. All could not be relied on. Mighty is the power of the torturing lash. By sunrise, people were pouring in from every quarter within twenty miles of the town. I knew the houses were to be searched; and I expected it would be done by country bullies and the poor whites. I knew nothing annoyed them so much as to see colored people living in comfort and respectability; so I made arrangements for them with especial care. I arranged every thing in my grandmother's house as neatly as possible. I put white quilts on the beds, and decorated some of the rooms with flowers. When all was arranged, I sat down at the window to watch. Far as my eye could reach, it rested on a motley crowd of soldiers. Drums and fifes were discoursing martial music. The men were divided into companies of sixteen, each headed by a captain. Orders were given, and the wild scouts rushed in every direction, wherever a colored face was to be found. It was a grand opportunity for the low whites, who had no negroes of their own to scourge. They exulted in such a chance to exercise a little brief authority, and show their subserviency to the slaveholders; not reflecting that the power which trampled on the colored people also kept themselves in poverty, ignorance, and moral degradation. Those who never witnessed such scenes can hardly believe what I know was inflicted at this time on innocent men, women, and children, against whom there was not the slightest ground for suspicion. Colored people and slaves who lived in remote parts of the town suffered in an especial manner. In some cases the searchers scattered powder and shot among their clothes, and then sent other parties to find them, and bring them forward as proof that they were plotting insurrection. Every where men, women, and children were whipped till the blood stood in puddles at their feet. Some received five hundred lashes; others were tied hands and feet, and tortured with a bucking paddle, which blisters the skin terribly. The dwellings of the colored people, unless they happened to be protected by some influential white person, who was nigh at hand, were robbed of clothing and every thing else the marauders thought worth carrying away. All day long these unfeeling wretches went round, like a troop of demons, terrifying and tormenting the helpless. At night, they formed themselves into patrol bands, and went wherever they chose among the colored people, acting out their brutal will. Many women hid themselves in woods and swamps, to keep out of their way. If any of the husbands or fathers told of these outrages, they were tied up to the public whipping post, and cruelly scourged for telling lies about white men. The consternation was universal. No two people that had the slightest tinge of color in their faces dared to be seen talking together. I entertained no positive fears about our household, because we were in the midst of white families who would protect us. We were ready to receive the soldiers whenever they came. It was not long before we heard the tramp of feet and the sound of voices. The door was rudely pushed open; and in they tumbled, like a pack of hungry wolves. They snatched at every thing within their reach. Every box, trunk, closet, and corner underwent a thorough examination. A box in one of the drawers containing some silver change was eagerly pounced upon. When I stepped forward to take it from them, one of the soldiers turned and said angrily, "What d'ye foller us fur? D'ye s'pose white folks is come to steal?" I replied, "You have come to search; but you have searched that box, and I will take it, if you please." At that moment I saw a white gentleman who was friendly to us; and I called to him, and asked him to have the goodness to come in and stay till the search was over. He readily complied. His entrance into the house brought in the captain of the company, whose business it was to guard the outside of the house, and see that none of the inmates left it. This officer was Mr. Litch, the wealthy slaveholder whom I mentioned, in the account of neighboring planters, as being notorious for his cruelty. He felt above soiling his hands with the search. He merely gave orders; and, if a bit of writing was discovered, it was carried to him by his ignorant followers, who were unable to read. My grandmother had a large trunk of bedding and table cloths. When that was opened, there was a great shout of surprise; and one exclaimed, "Where'd the damned niggers git all dis sheet an' table clarf?" My grandmother, emboldened by the presence of our white protector said, "You may be sure we didn't pilfer 'em from _your_ houses." "Look here, mammy," said a grim-looking fellow without any coat, "you seem to feel mighty gran' 'cause you got all them 'ere fixens. White folks oughter have 'em all." His remarks were interrupted by a chorus of voices shouting, "We's got 'em! We's got 'em! Dis 'ere yaller gal's got letters!" There was a general rush for the supposed letter, which, upon examination, proved to be some verses written to me by a friend. In packing away my things, I had overlooked them. When their captain informed them of their contents, they seemed much disappointed. He inquired of me who wrote them. I told him it was one of my friends. "Can you read them?" he asked. When I told him I could, he swore, and raved, and tore the paper into bits. "Bring me all your letters!" said he, in commanding tone. I told him I had none. "Don't be afraid," he continued, in an insinuating way. "Bring them all to me. Nobody shall do you any harm." Seeing I did not move to obey him, his pleasant tone changed to oaths and threats. "Who writes to you? half free niggers?" inquired he. I replied, "O, no; most of my letters are from white people. Some request me to burn them after they are read, and some I destroy without reading." An exclamation of surprise from some of the company put a stop to our conversation. Some silver spoons which ornamented an old-fashioned buffet had just been discovered. My grandmother was in the habit of preserving fruit for many ladies in the town, and of preparing suppers for parties; consequently she had many jars of preserves. The closet that contained these was next invaded, and the contents tasted. One of them, who was helping himself freely, tapped his neighbor on the shoulder, and said, "Wal done! Don't wonder de niggers want to kill all de white folks, when dey live on'sarves" [meaning preserves]. I stretched out my hand to take the jar, saying, "You were not sent here to search for sweetmeats." "And what _were_ we sent for?" said the captain, bristling up to me. I evaded the question. The search of the house was completed, and nothing found to condemn us. They next proceeded to the garden, and knocked about every bush and vine, with no better success. The captain called his men together, and, after a short consultation, the order to march was given. As they passed out of the gate, the captain turned back, and pronounced a malediction on the house. He said it ought to be burned to the ground, and each of its inmates receive thirty-nine lashes. We came out of this affair very fortunately; not losing any thing except some wearing apparel. Towards evening the turbulence increased. The soldiers, stimulated by drink, committed still greater cruelties. Shrieks and shouts continually rent the air. Not daring to go to the door, I peeped under the window curtain. I saw a mob dragging along a number of colored people, each white man, with his musket upraised, threatening instant death if they did not stop their shrieks. Among the prisoners was a respectable old colored minister. They had found a few parcels of shot in his house, which his wife had for years used to balance her scales. For this they were going to shoot him on Court House Green. What a spectacle was that for a civilized country! A rabble, staggering under intoxication, assuming to be the administrators of justice! The better class of the community exerted their influence to save the innocent, persecuted people; and in several instances they succeeded, by keeping them shut up in jail till the excitement abated. At last the white citizens found that their own property was not safe from the lawless rabble they had summoned to protect them. They rallied the drunken swarm, drove them back into the country, and set a guard over the town. The next day, the town patrols were commissioned to search colored people that lived out of the city; and the most shocking outrages were committed with perfect impunity. Every day for a fortnight, if I looked out, I saw horsemen with some poor panting negro tied to their saddles, and compelled by the lash to keep up with their speed, till they arrived at the jail yard. Those who had been whipped too unmercifully to walk were washed with brine, tossed into a cart, and carried to jail. One black man, who had not fortitude to endure scourging, promised to give information about the conspiracy. But it turned out that he knew nothing at all. He had not even heard the name of Nat Turner. The poor fellow had, however, made up a story, which augmented his own sufferings and those of the colored people. The day patrol continued for some weeks, and at sundown a night guard was substituted. Nothing at all was proved against the colored people, bond or free. The wrath of the slaveholders was somewhat appeased by the capture of Nat Turner. The imprisoned were released. The slaves were sent to their masters, and the free were permitted to return to their ravaged homes. Visiting was strictly forbidden on the plantations. The slaves begged the privilege of again meeting at their little church in the woods, with their burying ground around it. It was built by the colored people, and they had no higher happiness than to meet there and sing hymns together, and pour out their hearts in spontaneous prayer. Their request was denied, and the church was demolished. They were permitted to attend the white churches, a certain portion of the galleries being appropriated to their use. There, when every body else had partaken of the communion, and the benediction had been pronounced, the minister said, "Come down, now, my colored friends." They obeyed the summons, and partook of the bread and wine, in commemoration of the meek and lowly Jesus, who said, "God is your Father, and all ye are brethren."

Summary: Fear Of Insurrection Harriet details how Nat Turner's rebellion filled the white population in the south with fear and paranoia. One day the whites called together a muster, which the slaves thought would be another holiday. Everyone gathered out of doors and soldiers marched about while martial music played. Suddenly, orders were given and the soldiers and "low whites", who relished their slim allowance of power, rushed about. Slaves were beaten and robbed, houses were searched and possessions were stolen. Harriet felt that her grandmother's house would be safe since they were in the high esteem of many white families. The house was searched by insolent soldiers who rifled through their belongings, but they finally left. The captain cursed the house as they departed. That evening greater cruelties raged in the town. Harriet marveled at this "spectacle for a civilized country. A rabble, staggering under intoxication, assuming to be the administrators of justice. Patrols continued for weeks. Slaves were beaten and jailed to try and get information from them. Finally the slaveholders were appeased by the capture of Nat Turner. Following this, the slaves' church was demolished and they were forced to attend with the whites.

booksum

en

Write a title and summarize: Chromatin insulators are eukaryotic genome elements that upon binding of specific proteins display barrier and/or enhancer-blocking activity. Although several insulators have been described throughout various metazoans, much less is known about proteins that mediate their functions. This article deals with the identification and functional characterization in Paracentrotus lividus of COMPASS-like (CMPl), a novel echinoderm insulator binding protein. Phylogenetic analysis shows that the CMPl factor, encoded by the alternative spliced Cmp/Cmpl transcript, is the founder of a novel ambulacrarian-specific family of Homeodomain proteins containing the Compass domain. Specific association of CMPl with the boxB cis-element of the sns5 chromatin insulator is demonstrated by using a yeast one-hybrid system, and further corroborated by ChIP-qPCR and trans-activation assays in developing sea urchin embryos. The sns5 insulator lies within the early histone gene cluster, basically between the H2A enhancer and H1 promoter. To assess the functional role of CMPl within this locus, we challenged the activity of CMPl by two distinct experimental strategies. First we expressed in the developing embryo a chimeric protein, containing the DNA-binding domain of CMPl, which efficiently compete with the endogenous CMPl for the binding to the boxB sequence. Second, to titrate the embryonic CMPl protein, we microinjected an affinity-purified CMPl antibody. In both the experimental assays we congruently observed the loss of the enhancer-blocking function of sns5, as indicated by the specific increase of the H1 expression level. Furthermore, microinjection of the CMPl antiserum in combination with a synthetic mRNA encoding a forced repressor of the H2A enhancer-bound MBF1 factor restores the normal H1 mRNA abundance. Altogether, these results strongly support the conclusion that the recruitment of CMPl on sns5 is required for buffering the H1 promoter from the H2A enhancer activity, and this, in turn, accounts for the different level of accumulation of early linker and nucleosomal transcripts. Chromatin insulators are specialized DNA elements that upon binding of specific proteins display barrier and/or directional enhancer-blocking activity. The analysis of the genome-wide localization of insulator binding proteins (IBPs) in vertebrates and Drosophila suggests that insulators partition the eukaryotic genome in autonomous functional domains by promoting the formation of physical loop structures and/or mediate tethering of the chromatin fiber to structural elements within the nucleus [1], [2]. In vertebrates, CCCTC-binding factor (CTCF) is the only IBP that has been well characterized. Mechanistically, CTCF and its associated co-factors, most notably cohesin, are important in establishing long range chromatin interaction [3], [4]. This is illustrated by the CTCF-dependent intra- and inter-chromosomal interaction necessary for allele specific transcription within the mouse β-globin locus and at the imprinting control region in the H19/Igf2 locus [5]–[7]. Similarly, upon binding near the ins and syt8 promoters, located more that 300 kb away, CTCF stabilizes their interaction and affects gene expression at the human insulin locus [8]. Distinct families of insulators, defined by the IBPs necessary for their activity, have been described in drosophila. The best characterized IBPs are Zeste-white5 (Zw5) and Boundary Element Associated Factor 32 (BEAF-32), that bind to the first identified enhancer-blocking insulators scs and scs′ [9], [10], Suppressor of Hair-wing [Su (Hw) ] of the gypsy retrotransposon [11], and dCTCF [12]. The functions of all Drosophila insulators converge as chromatin organizer into that of CTCF in vertebrates. Zw5 and BEAF-32 interact with each other to generate a chromosomal loop that include the 87A7 hsp70 locus [13]. Su (Hw) and dCTCF colocalize at several insulator bodies of diploid nuclei, but not in polytene chromosomes, with the Centrosomal Protein 190 (CP190) which is necessary for both insulator body formation and enhancer-blocking activity [14], [15]. BEAF-32 has also been shown to recruit CP190 to specific DNA sites [16], suggesting that loop formation mediated by CP190 might be a common mechanism for insulator function in drosophila. A DNA element displaying features common to other chromatin insulators has been found at the 3′ end of the sea urchin P. lividus H2A gene, within the tandem repeat of the early histone unit. As reported, the 462 bp sns5 fragment is required for regulation of histone gene expression in the early embryo as well as for H2A silencing at gastrula stage [17], [18]. A physically separable sns fragment of 265 bp, displaying directional enhancer-blocking function in both sea urchin and mammalian cells [19]–[21], was previously identified in sns5. Most importantly, sns5, but not the enhancer-blocker sns, placed in flanking location of a γ-retrovirus vector prevents position effect variegation, improves transgene expression at randomly integration sites in erythroid cells, and by binding erythroid and ubiquitous transcription factors modifies nucleosomal histones to maintain a euchromatic state at the provirus locus [22]. Four protein binding sites have been identified by DNaseI footprinting in the sns5 element, namely -A, -B, -CT, and -D box, all required for the enhancer-blocking and silencing functions, and none of them resemble the CTCF binding-site consensus sequence [23]. Also the ArsI element, the only other insulator so far characterized in sea urchins, does not belong to the CTCF type [24]. It follows that the identification of sea urchin IBPs is of some importance to unravel the mechanism of action of insulators in chromosome organization and gene expression in this species. There is at least an additional reason to identify sns5 IBPs, that is, the mechanism of function of sns5 can be studied within the natural histone gene context. We have in fact presented compelling evidence that its role is to attenuate the H2A enhancer in the interaction with the downstream H1 promoter in order to assure the different level of accumulation of nucleosomal and linker transcripts during sea urchin embryogenesis [25]. In this paper, we describe the identification and functional characterization of a novel homeodomain-containing IBP encoded by the Compass/Compass-like locus that is exclusive to the ambulacrarians. To identify the trans-acting factors that interact with the sns5 insulator in P. lividus, we used a yeast one-hybrid genetic assay [26]. Briefly, a cDNA library of N-terminal fusions to the GAL4 activation domain was screened using as bait a yeast strain bearing a stably integrated pentamer of the boxB cis-element upstream of both the HIS3 and lacZ reporter genes. From this screening we isolated a ∼2. 2 kb cDNA clone encoding a predicted protein of 396 amino acids, which contains a Compass domain followed by an atypical Homeodomain at the C-terminus (Figure 1A). The former domain is shared exclusively among members of the SATB and COMPASS (CMP) protein families [27], [28]. SATB proteins possess an atypical Homeodomain with phenylalanine, instead of tryptophan, at the 48th residue and a single glycine insertion between the first and second helices, whereas CMP proteins contain two atypical Homeodomains with a ten amino-acid insertion between the second and third helices (Figure 1B) [28]. Differently from the above described proteins, the sea urchin predicted protein exhibits a unique atypical Homeodomain bearing an eleven amino acid long insertion between helices II and III (Figure 1B). For these reasons, we have named this newly identified factor COMPASS-like (CMPl). By blasting the public databases with the sequence coding for the Homeodomain of the P. lividus CMPl protein, we show that the above mentioned differences are completely conserved in orthologs of various sea urchin species and in the hemichordate Saccoglossus kowalevskii (Figure 1B). Such a high degree of conservation suggests that these proteins play important role (s) in echinoderms and hemichordates, altogether forming the Ambulacraria group of deuterostome metazoans [29]. To clarify the phylogenetic relationship between SATB, CMP and CMPl, we built a neighbor-joining tree using set of Homeodomain sequences from various metazoans. As expected, in this analysis orthologs of the SATB family, which have only been identified in vertebrates [30], [31], comprised a monophyletic clade (Figure 1C). Orthologs of the CMP family, which instead have been described only in invertebrates [31], also formed a clade. Importantly, the ambulacrarian CMPl sequences formed a distinct clade supported by a high bootstrap value, suggesting that they constitute a novel family of proteins. In spite of extensive searches in the currently available databases of several metazoans, additional CMPl orthologs were not identified, indicating that the CMPl family probably exists only in ambulacrarians. In order to obtain the nucleotide sequence of the Cmpl gene, we BLAST-searched the P. lividus genome database (whole genome shotgun assembly v1. 0, http: //octopus. obs-vlfr. fr/blast/oursin/blast_oursin. php) using the Cmpl full cDNA sequence as a query. Several overlapping scaffolds and contigs were isolated (Supplementary Table S1), from which the overall sequence was derived. The gene structure was inferred by aligning the genome sequence with that of the Cmpl cDNA and by the use of the Genscan software. We further coupled this analysis to the screening of the available P. lividus EST resources. By this approach we retrieved several hits of different size (Supplementary Figure S1). Collectively, these cDNAs harbor a nearly identical 5′-UTR and utilize the same translation initiation sequence, but only one of them almost entirely matched to Cmpl. Intriguingly, four of the remaining cDNAs appeared instead larger and highly divergent at the 3′-side compared to the query sequence (Supplementary Figure S1). We noticed that this fragment actually maps within the Cmpl gene, being partitioned in a couple of additional exons, namely e5 and e6, which are spliced out in the Cmpl mRNA being mutually exclusive with respect to e7–9 (Figure 2A and B). To assess the conservation of the Cmpl locus across ambulacrarians, we extended the BLAST searches to the public genomic databases of the Strongylocentrotus purpuratus and Lytechinus variegatus sea urchins, and to that of S. kowalevskii. From each of the mentioned database, a single genomic scaffold was retrieved (Figure 2A and Supplementary Table S1). Of importance, by phylogenetic footprinting performed by comparison of nucleotide sequences with the VISTA software, we established that the genomic organization of the P. lividus Cmpl locus is fully conserved in the two evolutionarily distant sea urchins, as well as in the hemichordate (Figure 2A). Furthermore, the retrieving of a single Cmpl hit from the fully completed genome sequence of S. purpuratus leads us to presume that Cmpl is most probably a single copy gene in sea urchins. Sequence analysis revealed that, as expected, the protein encoded by the largest splice variant was identical to CMPl for 233 amino acids at the N-terminal side, including the Compass domain, but strongly diverged in the C-terminal region. Most notable is the presence of two atypical Homeodomains, with an insertion of ten amino acids between helices II and III (Figure 2C and Figure 1B). On the bases of these findings, coupled to the phylogenetic analysis based on Homeodomain sequences (Figure 1B and C), we designated this protein as the sea urchin CMP ortholog. Therefore, and unexpectedly, the genetic information for CMPl and CMP proteins partially overlaps in representative genomes of both the ambulacrarian taxa. We then looked by qPCR at the time-course of accumulation of the two splice forms, utilizing primers that distinguish them. As shown in Figure 2D, both transcripts are maternally stored in the unfertilized egg and present at all stages of development. However, Cmpl mRNA is accumulated in the embryo at about a three- to ten-fold lower level than is the Cmp mRNA. After fertilization, Cmpl transcript abundance declines throughout the very early cleavage (up to morula stage), followed by a slight and steady increase until the prism stage. At this time, a later sharp burst in the message prevalence is detected through the pluteus larva. The Cmp transcript is the most abundant and it is accumulated in the embryo following three main phases of expression. Just after fertilization, the mRNA level rapidly raises to peak at the 16-cell stage. A second increase in transcript level occurs approximately from the morula stage, to peak as the pre-hatching blastula is approached. The terminal phase of mRNA accumulation begins at the prism stage, by which time a dramatic climb in the transcript abundance is observed. Thus, these results clearly established distinct temporal expression patterns for the alternative splice products of the Cmp/Cmpl locus. Altogether, our findings indicate that the genomic organization of the Cmp/Cmpl locus is evolutionary conserved across ambulacrarians, and that the mRNAs generated by the alternative spliced Cmp/Cmpl transcript exhibit distinct temporal expression profile in the sea urchin embryo. To ascertain the binding activity of CMPl to the sns5 chromatin in sea urchin embryos, we performed quantitative ChIP assays. To this end, we expressed different portions of the CMPl protein in E. coli. As the fragment corresponding to the N-terminal 98–270 amino acid residues gave the maximum yield of the protein in a soluble form, we have generated a polyclonal antibody against this peptide. Being the first 134 residues of this peptide shared by CMPl and CMP, we predicted that the anti-CMPl antibody should rather be able to react with both proteins. Indeed, in western blot assay, the antibody recognized two distinct protein bands at roughly 40 and 90 kDa in sea urchin nuclear extracts at morula and gastrula stages (Figure 3A). These molecular weights were congruent with those predicted for CMPl and CMP proteins, respectively, whereas no reaction occurred with the pre-immune serum (Figure 3A). Chromatin containing the sns5 region was consistently precipitated by the affinity-purified anti-CMPl antibody, in samples obtained from cultures of embryos at morula and gastrula stages (Figure 3B; see Materials and Methods). As a negative control, we selected two additional genes, hbox12 [32] and otp [33], [34], that do not share significant sequence similarity with sns5 in their promoters. As expected, both genes were clearly negative to CMPl occupancy from the same ChIP preparations (Figure 3B). Furthermore, only negligible amounts of sns5 sequences were precipitated from chromatin of both developmental stages by the unrelated antiserum from the same host species against the Otx regulator [32], used as control. Overall, these results point out the specific and constitutive association of CMPl to sns5 sequence in the native chromatin. However, as the antibody effectively recognizes epitopes common to both CMPl and CMP, these experiments may represent the full impact of both proteins on the sns5 chromatin. We addressed this question by performing a in vivo trans-activation assay. To this purpose, pentamer of the boxB cis-element was introduced, in both orientations, upstream of the H3 minimal promoter in the pH3-GFP vector, to obtain the 5×boxB-pH3-GFP reporter constructs (Figure 3C). As effectors we used synthetic mRNAs encoding for a forced transcription activator, in which the activation domain of the viral VP16 protein was joined to the DNA binding domain of either CMPl or CMP. Each transgene, alone or in combination with a chimeric effector mRNA, was then microinjected into sea urchin zygotes, embryos were allowed to develop and scored for GFP expression. As shown in Figure 3D, the control pH3-GFP vector and the 5×boxB-pH3-GFP constructs were not expressed in the absence of effectors in all of the injected embryos (n>300). As expected, and in agreement with the one-hybrid and ChIP results, a significant fraction of embryos (52%, n>300) injected with the reporter construct along with VP16-CMPl mRNA exhibited patches of clonal GFP-expression, irrespectively of the orientation of the cis-acting element on the transgene. By contrast, expression of the reporter was barely detectable in a minor fraction of embryos (5%, n>300) co-injected with equal amounts of the VP16-CMP mRNA (Figure 3D). qPCR measurements further confirmed that GFP expression was weakly evoked in these specimen, with respect to the VP16-CMPl co-injected embryos (Figure 3E). Altogether, these results support the contention that most, if not all, of the boxB binding sequences specifically recruits CMPl in vivo. Further insights were obtained by examining the specificity of binding of CMPl versus CMP to the boxB element in the natural chromatin context of sns5, within the histone gene cluster. The DNA replication-dependent sea urchin early histone genes are organized in a single large cluster made up of almost 2000 tandem repeats of the 5′-H2B-H3-H2A-H1-H4-3′ unit [35]. Coordinate transcription of these genes is limited to the cleavage and reaches its maximum at the morula stage. The M30 cis-regulatory sequence, upstream the H2A promoter, upon binding of the MBF1 activator displays a bidirectional enhancer activity [25], [36]. Remarkably, as we previously shown [25], the H1 promoter is shielded by the M30 enhancer activity by the sns5 insulator, which is located at the 3′end of the H2A transcription unit (Figure 4A). Sea urchin zygotes were microinjected with either the VP16-CMPl or the control VP16-CMP synthetic transcripts. Then, the expression of the H3, H2A and H1 genes was analyzed by qPCR at the morula stage. As expected, the injection of the VP16-CMP transcript had no detectable effect on histone genes expression (Figure 4B). Likewise, the mRNA levels of H3 and H2A did not show relevant change following the injection of the VP16-CMPl transcript. By contrast, the number of molecules of H1 mRNA was more than double in embryos expressing VP16-CMPl (Figure 4B). The most obvious explanation for the enhancement of H1 expression is that VP16-CMPl acted as a transcriptional activator on the H1 promoter. Alternatively, VP16-CMPl, by competing with the binding of the endogenous CMPl protein, impaired the enhancer-blocking activity of the sns5 element, thus allowing the H2A enhancer to act on the H1 promoter. This hypothesis is in line with our previous in vivo competition assays showing that inhibition of the sns5 led to up-regulation of only the H1 gene [25]. In conclusion, whatever is the mechanism, these experiments, as well as ChIP and trans-activation assays, strongly suggest that CMPl, but not CMP, associates to the boxB site in vivo. The finding that CMPl occupies the sns5 chromatin provided an opportunity to examine the function of an IBP in its natural gene context. To challenge CMPl activity, increasing amounts of the affinity-purified anti-CMPl antibodies, or control antibodies against the H2A enhancer binding factor MBF1, were injected into the sea urchin zygotes and histone gene expression analyzed by qPCR at the morula stage. In these experiments, injection of anti-MBF1 provoked a dose-dependent negative effect on the expression of the nucleosomal H2A and H3, but not the linker H1, genes (Figure 4C), excluding a unspecific effect of the injection. Also, it should be noted that H2A was more strongly affected compared to H3. These results are in agreement with those previously obtained by the in vivo inhibition of the H2A enhancer [25]. In strict accordance with previous findings [25 and this paper], both H2A and H3 mRNAs did not vary their abundance upon injection of different doses of anti-CMPl (Figure 4D), while the number of H1 mRNA molecules increased proportionally with the augmentation of the CMPl antiserum (Figure 4D). Taken together, these findings strongly point a role of the CMPl factor in mediating the sns5 insulator function by binding to the boxB cis-element. Furthermore, we predicted that the block of the H2A enhancer function might counteract the rise of H1 expression due to inhibition of CMPl binding to sns5. Indeed, the results showed in Figure 4E fulfilled this assumption, as co-injection of dnMBF1 mRNA, the dominant-negative version of MBF1 [25], along with saturating amounts of anti-CMPl caused a significant drop in the prevalence of H1 transcripts. Remarkably, in these embryos the number of mRNA molecules for the linker histone was comparable to that of the control uninjected embryos, confirming the independence of H1 transcription from the MBF1/enhancer positive input. Once again, the mRNA abundance of H2A and H3 (although to a lesser extent than H2A) decreased with the microinjection of dnMBF1, irrespectively of the anti-CMPl presence (Figure 4E). On the basis of these results, we conclude that recruiting of the CMPl factor to the boxB cis-element is critical for the enhancer-blocking activity of the sns5 insulator during the early embryogenesis of the sea urchin. Previous studies in the sea urchin model led to the identification of several candidate proteins (such as ISWI, Sin3A, PARP1, and more) that are recruited on the ArsI insulator [40]. Although all these factors are probably part of protein complexes required for enhancer-blocking activity of ArsI, none of them directly binds the insulator DNA sequence and therefore should not be considered a sensu stricto IBP. Here we have described the identification and functional characterization of CMPl which, to our knowledge, represents the first IBP of a non-model organism. Our molecular analyses indicate that although Cmpl is a single copy gene in the sea urchins, at least two distinct transcripts exist, due to alternative RNA splicing. They encode the CMPl and CMP proteins that are identical in their N-terminal sequences, where the Compass domain is located. Such a domain is followed by one or two atypical Homeodomains, respectively in CMPl and CMP. The sea urchin CMP and CMPl proteins belong to distinct families. Indeed, the former, and likely the most abundant, protein displays features of the COMPASS family, containing two 48W-type Homeodomains, each embedding a decapeptide insertion between helices II and III. Although displaying a 48W signature, the single Homeodomain of CMPl exhibits instead an unusual K/R-rich insertion of eleven residues which is not found in any other known Homeodomain protein but is conserved in sea urchins and S. kowalevskii. As for most of the Drosophila IBPs, apparently, there are no sequence homologs of CMPl in vertebrates. Thus CMPls constitute an additional, previously not described, ambulacrarian-specific family of proteins within those containing both the Compass- and Homeo-domain. Although the CMP protein is rather conserved among invertebrates, our phylogenetic analysis strongly suggests that hemichordates and echinoderms share a unique genomic organization at the Cmp/Cmpl locus. Consequently, the CMPl protein is found neither in chordates nor in protostomes. The monophyly of Ambulacraria is supported by three morphological characters: a trimeric arrangement of the adult coeloms, an axial complex with hydropore, and a dipleurula larva with neotroch [41]. At the molecular level, monophyly is also supported by 18S rDNA gene analyses [41]–[44], a unique mitochondrial gene code [45]–[46], the presence of three distinct posterior Hox genes [47], and now the possession of the Cmp/Cmpl locus. The functional significance of the emergence and loss of CMPl, respectively in ambulacrarians and chordates, is not clear at the moment. On the other hand, the Cmp gene is thought to have a highly flexible behavior during evolution. According to a current model, Cmp genes had emerged from a common ancestor with the POU class homeobox genes, acquiring the insertions in the COMPASS- and Homeo-domain [31]. In the lineage to vertebrates, SATB genes emerged and the genomic structure changed after the divergence of the amphioxus and vertebrate ancestors. SATB gene may have arisen from the Cmp gene by domain shuffling between Cmp and Onecut genes and eventually the Cmp gene was lost from the ancestral vertebrate [31]. In light of this scenario, the genomic configuration of the ambulacrarian Cmp/Cmpl locus could be emerged by similar mechanisms. Last, but not least, many insulator proteins are known to have multiple functions, and a wider functional analysis of the possible CMPl functional contribution to the sea urchin embryogenesis, outside the sns5 region, should help in the elucidation of the matter. In any case, this study provides an additional step towards an understanding of the evolution of Cmp, Cmpl and SATB genes in lower deuterostomes. The specific binding of CMPl to the boxB cis-element of the sns5 chromatin insulator is substantiated by several lines of evidence. First, a cDNA encoding the CMPl protein was recovered following a yeast one-hybrid assay, using the boxB sequence as bait. Second, constitutive occupancy of the sns5 chromatin by the CMPl protein was demonstrated by ChIP assay, using a CMPl antiserum. Third, specific interaction between the CMPl Homeodomain and the boxB element was further verified by a trans-activation assay in which boxB was placed upstream of the GFP reporter and the resulting transgene injected together with an mRNA encoding the CMPl Homeodomain fused to VP16. Fourth and most important, the expression of the VP16-CMPl chimeric protein, by competing with the endogenous CMPl, acts as either a trans-activator of the H1 promoter or as inhibitor of the enhancer-blocking activity of sns5, or both. Whatever is the mechanism, such a result definitively proved the specific association of the CMPl Homeodomain with the sns5 native chromatin. Intriguingly, this result clearly indicates that the Homeodomain alone is sufficient for CMPl effective DNA binding, in apparent contrast to the Compass domain-mediated oligomerization required for SATB1 to bind specific DNA sequences [48]. Although the Compass domain has been initially assimilated to a PDZ-like domain, a recent structural study indicated that it rather resembles a classic ubiquitin domain, even in the absence of sequence homology [49]. According to this study, the Compass domain mediates homo-tetramerization of SATB1 in solution. In particular, two dimers are joined together through multiple hydrogen bonds and hydrophobic interactions within their interfaces. Among these reciprocal interactions, the 97E98F162H residues are necessary for the formation of a hemi-dimer, and the 136K137W138N triad is important for the formation of the other dimer. A sequence alignment of Compass domain across species shows that these residues are all highly conserved among SATB proteins (Supplementary Figure S2), indicating that the Compass domain may have similar biological functions in vertebrates. By contrast, residues at positions 97,98, and 162 are divergent in ambulacrarian sequences, and the 136K137W138N tripeptide exhibits an inverted orientation in the primary sequence (Supplementary Figure S2). The observed changes in key residues of the Compass domain could explain the different behaviour in DNA binding activity between CMPl and SATB1. Expression of a CMP Homoeodomain-VP16 chimera in the developing embryo only modestly affected GFP expression in the trans-activation assay, and failed to prejudice sns5 enhancer-blocking function. Altogether, these findings lead us to conclude that no, or maybe very weak, interaction occurs between CMP and the boxB cis-element. It is known that the transcription factor LFB1/HNF1 contains a twenty-one amino-acids insertion between helices II and III which forms a large extra-loop that does not affect the overall structure of the Homeodomain [50]. On this basis, we speculate that the different-size insertions in CMPl and CMP Homeodomains do not participate in DNA interactions. Rather, we reckon that substitution of specific amino acids in Homeodomain sequences may account for differences in DNA binding affinity. Indeed, the Homeodomain of CMPl has a certain sequence similarity with those of CMP (58% and 66%, respectively; Figure 1B) but, notably, significant differences are detectable even in the helix III, which is known to be responsible for the discrimination of binding sequences [51]–[52]. The identification of CMPl in the sea urchin is of some importance to unravel the mechanism of action of insulators in chromosome organization and gene expression in this species. A principal criticism on studying insulators is that, often, the assays are performed by using artificial constructs in a chromosome context different than that of theirs, and it is known that the enhancer/promoter combination influences the activity [53]. In sharp contrast, our experiments provide a clear demonstration of the CMPl-dependent anti-enhancer function of the sns5 insulator in its natural chromatin context. Indeed, we have shown that the inhibition of the CMPl/boxB interaction, either by expressing the VP16-CMPl chimera or by titrating the CMPl factor through injection of specific antibodies, allowed an up-regulation of only the endogenous H1 gene. Most importantly, impairment of the H2A enhancer activity by expressing the forced repressor dnMBF1 restores the normal level of H1 transcripts in embryos in which CMPl is titrated by saturating amounts of the specific antiserum. Altogether, the results presented in this article strongly suggest that the recruitment of the CMPl protein on the sns5 insulator is absolutely required for buffering the H1 promoter from the H2A enhancer activity, and this, in turn, accounts for the different level of accumulation of early nucleosomal and linker transcripts. We have previously published several manuscripts analyzing the properties of the sns5 insulator in mammalian cells [20]–[22]. The finding that CMPl is an ambulacrarian-specific factor raises the paradoxical question of how sns5 works as an insulator in cells in which CMPl is absent. For completeness, it should be also remarked that neither the sns5 sequence does exist in the normal vertebrate genome but, if introduced by means of specific vectors, it is bound by several nuclear factors that are normally not recruited in sea urchin cells [21], [22]. In particular, through EMSA and ChIP assays we have demonstrated the occupancy of the boxB element by the Oct1 Homeodomain-containing regulator [21], [22]. In light of this evidence, an explanation to the above mentioned paradox could be that the unconventional recruitment of Oct1 on sns5 in mammalian cells somehow compensates for the lack of CMPl. A pertinent study in transgenic plants documents the enhancer-blocking activity of BEAD-1, a CTCF-dependent human-derived insulator [54], [55]. As reported above, no functional equivalents of CTCF factor and correspondent binding sites have been identified in plants. However, a large number of zinc-finger factors exhibit at least some degree of similarity at the amino acid level with the zinc-fingers of the vertebrate CTCF proteins [56] and may provide a similar function. In any case, the fact that insulators retain their activity in a unnatural host organism implies that at least a proportion of the insulator machinery in eukaryotes may be evolutionarily conserved. poly (A) + RNA was extracted from total RNA of P. lividus embryos at the gastrula stage and cDNA library was made by using the Matchmaker One-Hybrid System kit (Clontech). Briefly, poly (A) + RNA was reverse transcribed and the cDNA products were inserted into a shuttle vector, pGAD10, containing the GAL4 activation domain. Transformation of E. coli DH5α cells yielded >6×105 independent colonies. Pentamer of the 38 bp boxB sequence was used as the bait to select DNA-binding domains encoded in the library. The bait was inserted into pHISi-1 and pLacZi reporter vectors, and the recombinant plasmids were introduced sequentially into the genome of the yeast strain YM4271. Transformants were tested for growth on medium lacking histidine (SD/−His) in the presence of increasing concentrations of 3-aminotriazol (3-AT). Cells whose growth was inhibited by 5 mM 3-AT were selected as the host for the library screen. Transformation with the library was carried out by using LiCl-PEG, and transformants grown on SD/−His and SD/−Leu selective medium were tested for β-galactosidase activity. Plasmids from positive yeast clones were isolated by homogenization with glass beads and then individually transferred into DH5α cells for amplification. To eliminate false positives, these plasmids were separately introduced into yeast cells containing either the boxB bait or the p53 binding site, and transformants were tested for β-galactosidase activity. In this assay, a single plasmid conferred expression only in the boxB host. Sequence analysis revealed that such a plasmid harbored a ∼2. 2 kb cDNA insert encoding for CMPl (Genbank accession number: KF421245). BLASTP, BLASTX, and TBLASTN searches in public sequence databases (http: //blast. hgsc. bcm. tmc. edu/blast. hgsc; http: //www. molgen. mpg. de/~ag_seaurchin) with P. lividus CMPl and CMP as queries were performed and yielded candidates for many phyla. In some cases, a CMP coding region was deduced by Genscan analysis of genomic contigs. Protein domain architecture was defined via use of the Pfam (http: //pfam. sanger. ac. uk) and SMART (http: //smart. embl-heidelberg. de) databases. Multiple sequence alignments were generated using ClustalW, the output file was formatted using BioEdit, and neighbor-joining tree was constructed using the MEGA software package (http: //www. megasoftware. net). The reliability of branching points was inferred by bootstrapping using 1000 replicates. Genomic sequence comparisons for phylogenetic footprinting were performed with the VISTA platform (http: //genome. lbl. gov/vista/index. shtml), using window size varied between 50 and 100 bp, with 70% and 50% conservation respectively for sea urchins and S. kowalevskii. A DNA fragment corresponding to amino acids 98–270 of CMPl was subcloned into the pGEX-4T-1 expression vector to create a glutathione-S-transferase (GST) fusion protein. This protein was affinity purified from bacterial extracts and then used to generate a rabbit polyclonal antibody (Eurogentec, BE). After serum preincubation with a sepharose-4B column bound to the GST protein, the anti-CMPl antibody was purified by sepharose-4B affinity columns bound to the GST-CMPl protein. The specificity of the antibody was assayed by western blot detection against GST-CMPl and Thioredoxin-CMPl proteins. ChIP experiments were performed essentially as described in [32], with minor modifications. Briefly, formaldehyde cross-linked sea urchin embryos at morula and gastrula stages were incubated in cell lysis buffer (10 mM HEPES pH 8. 0 and 85 mM KCl, containing the following protease inhibitors: 0. 5% NP40,1 µg/ml leupeptin, 1 µg/ml aprotinin, 1 mM PMSF), for 10 min on ice. Nuclei were then resuspended in nuclear lysis buffer (50 mM Tris-HCl pH 8. 1,10 mM EDTA and 1% SDS, containing the same protease inhibitors as in cell lysis buffer) and incubated on ice for 10 min. Chromatin was sonicated using a Bandelin Sonopuls ultrasonic homogenizer to an average fragment size of 150 to 500 bp, as determined by agarose gel electrophoresis. To reduce non-specific background, the samples were diluted into five volumes of ChIP dilution buffer (16. 7 mM Tris-HCl pH 8. 1,167 mM NaCl, 0. 01% SDS, 1. 1% Triton X-100,1. 2 mM EDTA, plus proteinase inhibitors) and incubated with 100 µl of a salmon sperm DNA/protein A-sepharose slurry for 1 h at 4°C, with mixing. Ten percent of chromatin was withdrawn (Input) and processed as the immunoprecipitated chromatin. Aliquots of chromatin containing 25 µg of DNA were incubated in the absence of antibodies (as a negative control) or either with the anti-CMPl or the anti-Otx serum overnight at 4°C. The immune complexes were adsorbed to protein A-sepharose beads, which were sequentially washed with a low salt buffer (0. 1% SDS, 1% Triton X-100,2 mM EDTA, 20 mM Tris-HCl pH 8. 1,150 mM NaCl), a high salt buffer (0. 1% SDS, 1% Triton X-100,2 mM EDTA, 20 mM Tris-HCl pH 8. 1,500 mM NaCl), a LiCl buffer (0. 25 M LiCl, 1% NP40,1% deoxycholate, 1 mM EDTA, 10 mM Tris-HCl pH 8. 0) and twice in 1×TE buffer (10 mM Tris-HCl, 0. 1 mM EDTA pH 8. 0). The immune complexes were eluted with the elution buffer (1% SDS, 0. 1 M NaHCO3), digested with RNase at 37°C and treated with proteinase K in 0. 3 M NaCl at 65°C for 4 h to reverse the cross-links. DNA from chromatin samples was extracted with phenol/chloroform, precipitated with ethanol and dissolved in 50 µl of water. DNA samples were then quantified by readings in a Qubit Fluorometer (Invitrogen) using the Quant-iT dsDNA HS assay kit (Invitrogen). The enrichment of histone regulatory sequences in 100 pg aliquots of genomic DNA purified from the precipitated chromatin fractions was examined by qPCR as described previously [25], [32]. qPCR experiments were performed from two different batches and all reactions were run in triplicate on the 7300 Real-Time PCR system (Applied Biosystems) using SYBR Green detection chemistry. ROX was used as a measure of background fluorescence and, at the end of the amplification reactions, a ‘melting-curve analysis’ was run to confirm the homogeneity of all amplicons. Calculations from qPCR raw data were performed by the RQ Study software version 1. 2. 3 (Applied Biosystems), using the comparative Ct method. Primer efficiencies (i. e., the amplification factors for each cycle) were found to exceed 1. 9. In every experiment, a no-template control was included for each primers set. Primers used in this study are listed in Supplementary Table S2. The amounts of Cmp/Cmpl and histone gene transcription in control and injected embryos were evaluated as follows. Total RNA from batches of 150 embryos at the desired stage was extracted by using the Power SYBR Green Cells-to-CT kit (Ambion) and reverse transcribed following the manufacturer' s recommendations. The resulting cDNA sample was further diluted and the equivalent amount corresponding to one embryo was used as template for qPCR analysis, using the primers indicated in Supplementary Table S2. A cytochrome oxidase or the mbf1 mRNA, which are known to be expressed at a constant level during development [25], [32], were used to normalize all data, in order to account for fluctuations among different preparations. The pH3-GFP DNA plasmid was constructed as follows. A PCR fragment harboring the H3 minimal promoter (spanning from −62 to +60 with respect to the transcription start site) was inserted in the plasmid polylinker of a pGL3 vector containing the GFP coding sequence. The 5×boxB-pH3-GFP reporter constructs were obtained by shotgun cloning of ligated double-stranded oligonucleotides, bearing the boxB cis-regulatory sequence, upstream of the H3 promoter of the pH3-GFP plasmid. The VP16-CMPl and VP16-CMP effector constructs were obtained by fusing the DNA-binding domain coding sequences of either CMPl or CMP to those of the VP16 activation domain cloned in the CS2+nls expression vector. All DNA clones were checked by sequencing. Capped mRNAs were synthesized from the linearized pCS2-constructs using the mMessage-mMachine kit (Ambion). Purified RNAs were resuspended at 0. 5 mg/ml and 2 pl were then microinjected either alone or in combination with the linearized pH3-GFP and 5×boxB-pH3-GFP constructs. Microinjection was conducted as previously described [57]–[58]. In the trans-activation assay, more than 100 injected embryos per experiment were scored for GFP expression at the mesenchyme blastula stage and each experiment was repeated three times with different batches of eggs. As a control of the expression of the injected transgenes, we used an actively transcribed GFP construct driven by the full promoter of the hbox12 gene [32]. Images were captured with a Leica DC300F digital camera. As for in vivo titration assays with antibodies, affinity purified rabbit polyclonal IgG reacting with either CMPl or MBF1 were diluted to a final concentration of 12. 5–100 ng/pl in ultrapure water containing 30% glycerol, and eventually injected into sea urchin zygotes.

Title: The Compass-like Locus, Exclusive to the Ambulacrarians, Encodes a Chromatin Insulator Binding Protein in the Sea Urchin Embryo Summary: Mounting evidence in several model organisms collectively demonstrates a role for the DNA-protein complexes known as chromatin insulators in orchestrating the functional domain organization of the eukaryotic genome. Several DNA elements displaying features of insulators, viz barrier and/or directional enhancer-blocking activity, have been identified in yeast, Drosophila, sea urchin, vertebrates and plants; however, proteins that bind these DNA sequences eliciting insulator activities are far less known. Here we identify a novel protein, COMPASS-like (CMPl), which is expressed exclusively by the ambulacrarian group of metazoans and interacts directly with the sea urchin sns5 insulator. Sns5 lies within the early histone gene cluster, basically between the H2A enhancer and H1 promoter, where it acts buffering the H1 promoter from the H2A enhancer influence. Intriguingly, we find that CMPl role is absolutely required for the sns5 activity, therefore imposing the different level of accumulation of the linker and nucleosomal transcripts. Overall, our findings add an interesting and novel facet to the chromatin insulator field, highlighting the surprisingly low evolutionary conservation of trans-acting factors binding to chromatin insulators. This opens the possibility that multiple lineage-specific factors modulate chromatin organization in different metazoans.

lay_plos

en

Summarize: SUMMARY OF THE INVENTION This invention relates to implements for distributing liquids containing undissolved solids, such as organic manure slurry and other organic manure mixtures, into and/or onto the soil, such implements being of the kind comprising a container for the liquid and means for distributing it under pressure. According to one aspect of the invention, there is provided an implement of the kind set forth, wherein a cutting mechanism for treating the solid constituents of a liquid to be distributed by the implement is provided, the mechanism being at least partially enclosed by a casing and comprising a cutter arranged to cooperate movably with an apertured counter blade, and wherein the movable cutter extends from a fastening region thereof to a location close to the inner surface of said casing and co-operates throughout at least a greater part of its length between said fastening region and said location with the holes in the counter blade, the means for distributing the liquid under pressure being constructed and arranged to force the liquid through the cutting mechanism by producing a pressure difference between inlet and outlet sides of that mechanism when the implement is in operation. For a better understanding of the invention, and to show how the same may be carried into effect, reference will now be made, by way of example, to the accompanying drawings, in which: BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a side elevation of a self-propelled implement in accordance with the invention constructed and arranged for use in supplying organic manure mixtures into and/or onto the soil, FIG. 2 is a vertical section, to an enlarged scale, of a cutting mechanism of the implement, said mechanism being located at the right-hand side of FIG. 1, FIG. 3 is a section taken on the line III-III in FIG. 2, FIG. 4 is a side elevation of an implement that is constructed and arranged for the same purpose as the implement of FIGS. 1 to 3 but which is a towed, rather than self-propelled, implement, FIG. 5 is a vertical section, to an enlarged scale, of a cutting mechanism of the implement of FIG. 4 that is to be seen towards the left-hand side of FIG. 4, FIG. 6 is a elevation, to the same scale as FIG. 5, but illustrates an alternative construction and arrangement for the cutting mechanism of the implement, FIG. 7 is a section taken on the line VII-VII in FIG. 6, and FIG. 8 is a broken sectional view, to an enlarged scale, illustrating an alternative construction and arrangement for some parts of the cutting mechanism of FIGS. 2 and 3. DESCRIPTION OF THE PREFERRED EMBODIMENTS Referring to FIGS. 1 to 3 of the drawings, the self-propelled implement that is illustrated therein comprises a container in the form of a cylindrical tank 1, the tank 1 being mounted on the bed of a truck 2 immediately to the rear of a driving cab of that truck. Truck 2 has four ground wheels 3 the front two of which are steerable and its intended direction of straight forward travel is indicated in FIG. 1 by an arrow A. It will be appreciated that the precise form of the truck 2 is of no great significance and that it could be varied in many respects as compared with the appearance that is illustrated somewhat diagrammatically in FIG. 1. Purely as an example, truck 2 could have a greater number of the ground wheels 3. An air pump 5 is mounted on a bracket 4 carried by the front bumper or fender of truck 2, the pump 5 being arranged to be driven in any convenient manner (that is not illustrated in the drawings) from the adjacent propelling engine of the truck. As an alternative, the air pump 5 may be powered from a small independent motor that, in such a case, would also be mounted on the bracket 4. A pipe opens into the domed top of the tank 1 and said pipe is connected by a duct 6 and a moisture collector 7 to the pump 5. The connection is made by way of a three-way valve 8 which is so arranged that said duct 6 can be placed in communication with either the suction/inlet side of the pump 5 or the compression/outlet side thereof, the third connection of the valve 8 placing that side of the pump 5 which is not coupled to the duct 6 in either case in direct communication with the ambient atmosphere. The tank 1 is provided with a flexible suction hose 9 that is arranged for the supply of liquid organic manure mixtures containing undissolved solids to the interior of the tank 1, said hose 9 advantageously having a diameter of substantially 6 inches (151/4 cms). The rear of truck 2 with respect to the direction A is provided with a three-point lifting device or hitch 10 to which is connected a rearwardly extending frame 11. The frame 11 carries a cutting mechanism 13 that is shown in detail in FIGS. 2 and 3 of the drawings, the cutting mechanism 13 being connected by a hose 12 to the bottom of the tank 1 and to at least two manure injectors 15 by corresponding tubular outlets 25 and flexible hoses 14, said outlets 25 opening into the bottom of the mechanism 13 at locations remote from an upper tubular inlet 24 of said mechanism which is connected to the hose 12. It is noted that, although the described and illustrated embodiment has two manure injectors 15, it is within the scope of the invention to provide only one manure injector 15 or more than two thereof. The manure injectors 15 are fastened to the rear, with respect to the direction A, of injection tines or blades 16 that extend downwardly from the frame 11 into the soil, during operation of the implement, and which are somewhat similar to rigid and fixed tines of a cultivator. As can be seen in FIG. 1 of the drawings, each injection tine or blade 16 is upwardly and downwardly adjustable in position relative to its mounting on the frame 11 at its upper end, its lower end, that will penetrate more or less deeply into the soil during operation, being inclined forwardly with respect to the direction A from top to bottom by a few degrees. The lowermost extremity of each injection tine or blade 16 carries a goose foot-shaped blade 17 having a general plane which is inclined to the horizontal by a few degrees in such a way that the leading edge of the blade with respect to the direction A is at a slightly lower horizontal level than is the rearmost edge thereof. Each manure injector 15 is secured to the rear of the corresponding tine of blade 16 with respect to the direction A and is in the form of a tube which conveniently has a diameter of between substantially 4 and subtantially 5 cms. Depending upon the nature and condition of the soil to which slurry or other organic manure mixture is to be distributed, each injection tine or blade 16 penetrates downwardly beneath the soil surface by a distance of substantially 15 cms. This distance can be set and maintained by upward or downward adjustment of the tines or blades 16 relative to the frame 11, by upward or downward movement of the three-point lifting device or hitch 10 relative to the body of truck 2 and/or by the provision of at least one depth-control ground wheel (not illustrated). The cutting mechanism 13 that is shown in detail in FIGS. 2 and 3 of the drawings is driven from the propelling engine of truck 2 by way of a telescopic transmission shaft 18 having universal joints at its opposite ends, the rearmost universal joint of said shaft 18 being coupled to the forwardly projecting end of a substantially horizontally disposed driving shaft 19 of the mechanism 13. The mechanism 13 has a casing 20 that is preferably of substantially cylindrical configuration in which case, as illustrated, the driving shaft 19 substantially coincides in position with the longitudinal axis of the casing. The rearmost end of the casing 20 comprises a substantially vertically disposed wall at the center of which is arranged a fluid-sealed rotary bearing 21 for the rearmost end of the shaft 19. A front wall or cover 22 of the mechanism 13 is secured to a flange of the cylindrically curved wall of the casing by eight bolts and is provided, at its center, with a further fluid-sealed rotary bearing 23for a leading region of the driving shaft 19, said rotary bearing 23 being in substantially horizontal alignment with the rear rotary bearing 21. The aforementioned upper tubular inlet 24 that communicates with the hose 12 opens into the cylindrical wall of the mechanism 13 quite close to its front wall or cover 22 and, to match the diameter of the hose 12, advantageously has a diameter of substantially 6 inches (151/4cms.). The two tubular outlets 25 open into the rear substantially vertical wall of the casing 20 at locations that are substantially diametrically opposite to the inlet 24 with respect to the geometric center of the housing 20, each tubular outlet 25 advantageously having a diameter of substantially 4 inches (10 cms.). When the implement is in use, the slurry or other organic manure mixture flows into the casing 20 of the mechanism 13 through the tubular inlet 24 in the direction of an arrow B that is shown in FIG. 2 of the drawings and leaves said casing for distribution to the ground through the outlets 25 and the hoses 14 in the direction that is indicated by an arrow C in the same Figure. Approximately midway along the axial length of the housing 20 of the mechanism 13, the driving shaft 19 of that mechanism carries a cutter blade 26. The cutter blade 26 is releasably fastened to a hub 27 by machine screws and the hub 27 is, in turn, secured against axial and rotational displacement relative to the driving shaft 19 by a releasable set bolt 28. The shape of the cutter blade 26 can be seen best in FIG. 3 of the drawings from which it will be evident that said blade is of smoothly curved elliptic shape although its outer edge does not define a true ellipse. The shaft 19 passes through the geometric center of the blade 26, the maximum length of that blade between the extremities thereof that are farthest from said shaft 19, and thus quite close to the internal surface of the cylindrically curved portion of the casing 20, having a value of between substantially 35 cms. and substantially 45 cms., a magnitude of substantially 40 cms. being advantageous. The minimum width of the blade 26 (measured horizontally in the plane of FIG. 3) has a value of between substantially 15 cms. and substantially 25 cms., a magnitude of substantially 20 cms. being advantageous and being preferred. The two ends of the cutter blade 26 that are farthest apart from one another coincide with a straight line that is contained in a longitudinal plane of symmetry of the blade that intersects the axis of the shaft 19. The blade 26 that is movable during operation of the implement co-operates with a fixed or counter blade 29 that is in the form of a circular disc having its outer edge region secured to a ring 30 that is fastened to the inner surface of the cylindrically curved portion of the casing 20 in perpendicular relationship with the longitudinal axis of that casing and the substantially coincident longitudinal axis of the driving shaft 19. Those portions of the cutter blade 26 which are farthest from the shaft 19 are enclosed between an annular locking element 30A and an outer region of the circular fixed or counter blade 29. The element 30A is fastened to the ring 30 with the fixed or counter blade 29 by a plurality, such as four, of small bolts whose positions can be seen in FIG. 3 of the drawings. The mounting arrangements that have been described enable the cutter blade and/or the fixed or counter blade 29 to be readily replaced should this become necessary. It will be evident that access can be obtained to the interior of the casing 20 for replacement purposes merely by temporarily removing the eight bolts which secure the front wall or cover 22 of said casing to the flange of the cylindrical wall thereof. The fixed or counter blade 29 is formed with a plurality, such as eighteen, of circular holes 31 having positions which can be seen in FIG. 3 of the drawings, but it is emphasized that a greater or lesser number of the holes 31 may be provided, that their sizes and/or positions may be changed and/or that their shapes may be other than circular. For example, each hole 31 may be of regular polygonal shape and the plurality of those holes that is provided may be regularly arranged within at least one circumscribing circle. It can be seen in FIG. 2 of the drawings that, with respect to the directions B and C, each hole 31 is frusto-conically divergent through the thickness of the fixed or counter blade 29 from the surface thereof which faces the movable cutter blade 26 to the surface thereof which faces the ring 30. An intimate contact is obtained between the cutter blade 26 and the fixed or counter blade 29 and the result is that the cutter blade 26 is self-sharpening. It is preferred that each hole 31 should have a diameter of substantially 4 cms. and that diameter should not be greater than substantially 6 cms. In the particular example that is being described, there is an outer circular row of twelve regularly spaced apart holes 31 and an inner circular row of six regularly spaced apart holes 31, the center of the two circular rows being coincident with one another and with the longitudinal axis of the shaft 19. With this arrangement, the holes 31 of the inner and outer rows are radially offset from one another in the surface of the fixed or counter blade 29. It has been found that, in order to ensure that the slurry or other organic manure mixture will flow entirely satisfactorily through the cutting mechanism 13, the total open area of the holes 31 should be substantially 30% greater than the open area of the upper tubular inlet 24. A second blade or pre-cutter 32 is disposed before the cutter blade 26 along the driving shaft 19 with respect to the directions B and C. The second blade or pre-cutter 32 is located in that chamber of the casing 20 of the mechanism 13 into which slurry or other organic manure mixture is delivered from the tubular inlet 24 in the direction B. It is preferred that, as illustrated, the second blade or pre-cutter 32 should be identical to the cutter blade 26. With this preferred arrangement, the blade or pre-cutter 32 is secured by countersunk machine screws (not visible) to a sleeve-like hub 33, that hub being secured against axial and angular displacement relative to the shaft 19 by a set bolt 34, the tip of which co-operates with an axially extending groove formed in the surface of the shaft 19. It will be evident that the parts 32 and 33 can be retained in different axial positions along the shaft 19 by tightening the set bolt 34 in different settings lengthwise of the groove in the shaft 19. In fact, the two set bolts 28 and 34 are arranged to co-operate with the shaft 19 in such a way that the cutter blade 26 and second blade or pre-cutter 32 can be spaced apart from one another at different distances and can occupy more or less registering angular settings about the axis of the shaft 19. It is preferred that, as illustrated, the second blade or pre-cutter 32 should be 90° out of register with the cutter blade 26 about the axis of the shaft 19. In other words, as seen in FIG. 3 of the drawings, a line joining the farthest apart extremities of the blade or pre-cutter 32 should be inclined at 90° to a line joining the farthest apart extremities of the cutter blade 26. It is preferred that, as illustrated, the cylindrically curved wall of the casing 20 should merge into the substantially vertically disposed rear wall thereof by way of rounded corners to ensure a satisfactory flow of the material around those corners and little or no lodgement of solid portions of the material therein. The cylindrical casing 20 has a diameter of between substantially 35 cms. and substantially 45 cms., a diameter of substantially 40 cms. being preferred and it will, of course, be realized that this diameter matches the maximum diameter of the cutter blade 26 and the second blade or pre-cutter 32 so that the outer ends of those parts 26 and 32 which are farthest from the shaft 19 closely approach the inner surface of the cylindrically curved wall of the casing 20. The fixed or counter blade 29 effectively divides the interior of the casing 20 into a pre-treatment or material-receiving chamber and a post-treatment or delivery chamber. It is important that these two chambers should have definite predetermined volumes and, in the example that is being described, the pre-treatment or material-receiving chamber that is in direct communication with the upper tubular inlet 24 has an axial length of between substantially 15 cms. and substantially 30 cms. FIGS. 4 and 5 of the drawings illustrate an alternative form of implement in accordance with the invention which implement is constructed and arranged to be towed by an agricultural tractor 39 or other operating vehicle. To this end, a chassis 36 of the implement has a triangular towing member 38 at its leading end, with respect to the direction A, said member 38 being adapted to have its apex connected to a tow bar, hitch pin or the like of the tractor 39 or other vehicle. The chassis 36 is provided with two pairs of large ground wheels 37 and supports a container in the form of a cylindrical tank 35, the longitudinal axis of which is substantially horizontally disposed. An air pump 40 is mounted on the chassis 36 immediately to the rear of the towing member 38 and is arranged to be driven from the power take-off shaft of the agricultural tractor 39 or other operating vehicle by way of an intermediate telescopic transmission shaft 41 that is of a construction which is known per se having universal joints at its opposite ends. However, as in the preceding embodiment, the air pump 40 may, if preferred, be driven by a small independent motor which would be mounted at the front of the chassis 36. A turret at the top and front of the tank 35 with respect to the direction A is connected by a duct 42 to the air pump 40. As in the case of the first embodiment, a valve is provided by which said duct 42 can be coupled to either the suction or inlet side of the pump 40 or to the compression or outlet side thereof, that side of the pump which is not coupled to the duct 42 in either case being opened by said valve to the ambient atmosphere. An outlet 43 is provided at the rearmost end of the tank 35 and is furnished with a regulating valve 44. With this arrangement it is, in fact, desirable that the longitudinal axis of the tank 35 should be gently inclined to the horizontal in such a way that the center of the front of the tank is at a slightly higher horizontal level than is the center of the rear thereof. The operating member of the regulating valve 44 is connected by a lever, rod and pivot system 45 to a handle which projects forwardly at the front of the implement to a location from which it will be accessible to a driver of the tractor 39 or other operating vehicle when the implement is in use. This enables the driver to operate the valve 44 without having to leave his driving seat. A substantially horizontally disposed frame 46 extends rearwardly behind the chassis 36 to which chassis said frame 46 is connected by a horizontally disposed pivotal shaft 47 that extends perpendicular to the direction A. A double-acting hydraulic piston and cylinder assembly 48 pivotally interconnects a bracket mounted on top of the frame 46 and a lug carried by the tank 35 and is powered from the hydraulic system of the tractor 39 or other vehicle under the control of an operating member that is accessible to the driver of that tractor or other vehicle. The hydraulic ducts that are necessary for this purpose are not illustrated in the drawings. Thus, the frame 46 and the parts which it carries can be turned upwardly and downwardly relative to the chassis 36 about the axis of the pivotal shaft 47. In the example that is being described, the hydraulic piston and cylinder assembly 48 has a stroke length of substantially 80 cms. The frame 46 is provided, towards its rear with respect to the direction A, with at least one injection tine or blade 49 that is similar in construction and arrangement to the previously described injection tines or blades 16, each tine or blade 49 having a goose foot-shaped blade 49A at its lowermost end. The rear of each injection tine or blade 49 with respect to the direction A has a tubular manure injector 51 secured to it, the upper end thereof being in communication, by way of at least one tube and at least one flexible hose 50, with the delivery side of the regulating valve 44 that is carried by the outlet 43 of the tank 35. The flexibility of each hose 50 enables the frame 46 to be turned upwardly or downwardly about the pivotal shaft 47 without interfering with the delivery of slurry or other manure mixture to the or each manure injector 51. The outlet 43 of the tank 35 opens from a lower region of a domed manhole or handhole cover 52 that is normally retained in its effective closing position by two clamps 53. The cover 52 is of circular shape as viewed in the direction A and, when clamped in its normal closing position, bears surroundingly against a short tubular extension 54 of the tank 35 through the intermediary of a large resilient sealing ring 55 of circular cross-section. The short tubular extension 54 of the tank 35 is of circular cross-section and is welded to the rearmost end of said tank very close to the bottom thereof. The tubular extension 54 has a diameter of between substantially 40 cms. and substantially 50 cms., a magnitude of substantially 45 cms. being preferred. A cutting mechanism 56 is accommodated inside the tubular extension 54 of the tank 35, the rearmost end of a cylindrical casing 57 of said mechanism 56 being welded or otherwise rigidly secured to the inner concave surface of the domed manhole or handhole cover 52. The mechanism 56 is, in many respects, similar to the mechanism 13 that has already been described and parts that are substantially identical to parts which have already been discussed in connection with FIGS. 1 to 3 of the drawings are indicated in FIG. 5 of the drawings by the same reference numerals as are employed in FIGS. 2 and 3 of the drawings. The cutting mechanism 56 has an axially extending driving shaft 58 which is thus substantially horizontally disposed, the rearmost end of said shaft 58 being rotatably supported by a fluid-sealed bearing 59 at the center of the cover 52 and a leading region thereof being rotatably supported by a further fluid-sealed bearing 60 which is fastenend to two parallel strips 61 of L-shaped cross-section having upper and lower ends which are releasably bolted to inwardly directed upper and lower lugs at the leading edge of the casing 57. The shaft 58 passes between the two parallel strips 61 immediately in front of the leading rotary bearing 60. In this embodiment, the cutter blade 26 is releasably secured by countersunk machine screws (not visible) to a sleeve or ring 62 which surrounds the driving shaft 58 in a manner which enables it to be axially displaceable along that shaft while at the same time it is not significantly angularly displaceable relative thereto. Co-operating splines (not visible) are provided for this purpose. The second blade or pre-cutter 32 is also releasably secured by countersunk machine screws (not visible) to a sleeve or ring 63 that is, however, welded or otherwise rigidly secured to the shaft 58. A helical compression spring 64 is wound around the shaft 58 so as to bear between the second blade or pre-cutter 32 and the axially displaceable sleeve or ring 62 to which the cutter blade 26 is fastened. Thus, the spring 64 constantly urges the sleeve or ring 62 and the cutter blade 26 to the left as seen in FIG. 5 of the drawings and thus into intimate self-sharpening engagement with the fixed or counter blade 29. That end of the cutting mechanism 56 that faces forwardly with respect to the direction A into the interior of the tank 35 is wholly open around the bearing 60 apart from the provision of the two parallel strips 61 by which that bearing 60 is carried. Once again, as in the preceding embodiment, the fixed or counter blade 29 effectively divides the interior of the housing 57 of the mechanism 56 into two separate chambers. The outlet 43 of the tank 35 is in direct communication with the post-treatment or delivery chamber of the mechanism 56 that is to the left of the fixed or counter blade 29 as viewed in FIG. 5 of the drawings. A rotary shaft 65 that is substantially horizontally disposed extends lengthwise through the tank 35 near the bottom thereof from which it is rotatably supported by at least one sleeve bearing 66. The shaft 65 is provided, inside the tank 35, with a plurality of agitator/cutter blades 65A. The rearmost end of the shaft 65 is drivingly connected to the leading end of the shaft 58, inside the tank 35, by a fork coupling 67. The construction and arrangement of the fork coupling 67 are such that the shaft 58 can be axially disconnected from the shaft 65 without any difficulty when removal of the cutting mechanism 56 from the remainder of the implement is required. Conversely, when the cover 52 is closed and the mechanism 56 is in its operative position, the co-operating parts of the fork coupling 67 drivingly engage one another in an automatic manner that does not require the use of any bolts or other fastenings. The leading end of the shaft 65 with respect to the direction A is passed through a liquid-sealed bearing in the front wall of the tank 35 and is there provided with a pulley 68 that is driven from an underlying smaller pulley 69 by way of a V-belt 70 or the like. The pulley 69 is mounted on a rotary output shaft of the air pump 40 and will thus be driven, during operation, from the power take-off shaft of the tractor 39 or other vehicle through the intermediary of the telescopic transmission shaft 41 or from the alternative independent motor that may be provided to drive the air pump 40. The driving shaft of the air pump 40 should rotate at a speed of substantially 1500 revolutions per minute and the transmission ratio between the pulleys 69 and 68 is such as to produce a speed of rotation of the shaft 65 of substantially 540 revolutions per minute. However, if desired, the transmission ratio may be changed so that the shaft 65 can be rotated at a speed of up to substantially 1100 revolutions per minute. It is desirable, but not absolutely essential, to provide the tank 35 with a separate suction opening which can be employed when said tank is to be filled. An inlet opening 72 (FIG. 4) is provided for this purpose near the bottom of the tank 35 and near to the front thereof with respect to the direction A, said inlet opening 72 being provided with a manually operable shut-off valve 71 with an actuating lever which projects forwardly to a location where it will be accessible to the driver of the tractor 39 or other operating vehicle without that driver having to leave his seat on the vehicle. Although positioning of the inlet opening 72 at this point is convenient, it is by no means essential and it may, if preferred, be furnished at some other location on the tank 35. FIGS. 6 and 7 of the drawings illustrate an alternative to the construction and arrangement that is illustrated in FIGS. 4 and 5 in which a cutting mechanism 73 is partly countersunk into the cylindrically curved side wall of the tank 35 instead of being mounted at the rearmost end thereof as is the mechanism 56. However, the mechanism 73 comprises parts that are identical or substantially identical to parts that have already been described and such parts will not be described in detail again and are indicated in FIGS. 6 and 7 by the same reference numerals as are employed in the preceding Figures. The mechanism 73 has a cylindrical casing 74 having a longitudinal axis which is parallel or substantially parallel to that of the cylindrical tank 35, said casing 74 being arranged in the cylindrically curved wall of the tank 35 in such a way that substantially one third of its volume is countersunk into the tank 35 (see FIG. 7). Thus, with this arrangement, an axially disposed driving shaft 75 of the mechanism 73 is located outwardly just beyond said curved wall of the tank 35. Angle brackets 76 welded to the external surface of the casing 74 co-operate with the wall of the tank 35 by way of intervening sealing strips, the liquid-sealed co-operation being maintained by a plurality of bolts 77. In the embodiment of FIGS. 6 and 7 of the drawings, two of the holes 31 in the fixed or counter blade 29 are covered by a sharpening stone 78 releasably mounted on counterblade 29 formed, for example, from silicon carbide. The sharpening stone 78 is received in one hole 31 in the outer circular row of those holes and one hole 31 in the inner circular row thereof and ensures that the automatic self-sharpening of the cutter blade 26 by its continuous spring-loaded contact with the fixed or counter blade 29 is continuously and effectively maintained. The sharpening stone 78 may, of course, also be provided in the embodiment that is illustrated in FIGS. 2 and 3 of the drawings and in the embodiment that is illustrated in FIG. 5 thereof even though, in the first case, there is no resilient loading of the cutter blade 26 against the fixed or counter blade 29. As in the preceding embodiments, the fixed or counter blade 29 effectively divides the interior of the casing 73 into two chambers, the inlet opening 72 being in direct communication with the pre-treatment or material-receiving chamber while the post-treatment or delivery chamber is located rearwardly of the fixed or counter blade 29 with respect to the direction D (FIG. 7) in which slurry or other organic manure mixture moves through the cutting mechanism 73 during the use of the implement. The driving shaft 75 of the mechanism 73 is rotatably journalled at opposite ends of the cylindrical housing 74 in fluid-, or at least liquid-, sealed bearings 80 and 81, the end of said shaft 75 that is closest to the bearing 81 being provided with a pulley 82 to which rotary power is transmitted from a further pulley (not shown) by a V-belt 83. The wall of the casing 74 is, of course, formed in the region thereof that is located internally of the tank 35 with a hole 79 of large diameter through which the slurry or other organic manure mixture that has been chopped by the blades of the mechanism 73 passes in the direction D into the tank 35. The cutting mechanism 73 that is located at the inlet of the tank 35 could, of course, equally well be provided in the embodiment of FIGS. 1 to 3 of the drawings in which case it would communicate directly with an inlet opening 84 (FIG. 1) of the tank 1. The flexible suction hose 9 is, of course, usually connected to the inlet opening 84 when the tank 1 is to be filled. Moreover, if desired, in both of the basic embodiments that have been described, a cutting mechanism may be provided in association with both the inlet and the outlet of the tank 1 or 35. FIG. 8 of the drawings illustrates, to an enlarged scale, an alternative embodiment of an annular locking member for the rotary cutter blade 26. Said annular locking member is in the form of a bent-over portion 20A of the casing 20 and has the shape of a flange which registers with a perpendicularly bent-over flange 20B of a separate, in this embodiment, part of the casing 20. An outer edge region of the circular fixed or counter blade 29 is clamped between the bent-over portion 20A and the flange 20B by a plurality of bolts together with an intervening shim plate 20C. Shim plates 20C of different thicknesses can be substituted for the illustrated plate 20C or an appropriate number of similar but very thin shim plates can be employed so that the distance between the portion 20A and the flange 20B can be adjusted to compensate for inevitable wear of the rotary cutter blade 26. In the use of the implement that has been described with reference to FIGS. 1 to 3 of the drawings with or without the modification of FIG. 8, the tank 1 is first filled from a pit or other bulk supply of slurry or other liquid organic manure mixture containing undissolved solids, filling being effected by coupling the hose 9 to the inlet 84 and operating the air pump 5 with the valve 8 in a position in which the duct 6 is coupled to the suction or inlet side of the pump. The tank 1 has a moderate capacity of, for example, substantially 2000 liters and the implement of which it forms a part is particularly suitable for use in applying organic manure mixture into and/or onto soil in which plants are growing, or are to be grown, by row culture. Examples of such plants are maize, beans, potatoes and so on. With the aforementioned moderate capacity of the tank 1, the tires of the ground wheels 3 may be relatively narrow in an axial direction without their pressure against the ground surface becoming unacceptably great. When the implement is to be used on land which is not already growing a crop or for the fertilization of rows of crops that are not unduly retarded in growth by the passage of ground wheels exerting a high pressure, a tank 1 of greater volumetric capacity than that mentioned above can be used. Although the implement can, of course, be adjusted to distribute the slurry or other organic manure mixture directly onto the ground surface, it is generally preferable to use it in the manner illustrated in the drawings in which all, or most, of the manure is forced into the soil beneath ground level by the air under pressure that is provided from the air pump 5. This way of operating the implement minimizes wastage of the manure and greatly reduces the unpleasant and lingering odor that is produced by direct distribution onto the ground surface. The frame 11 that is connected to the three-point lifting device or hitch 10 to the rear of the tank 1 preferably comprises two or more of the injection tines or blades 16 each of which is furnished with a corresponding one of the manure injectors 15. The frame 11 to which the injection tines or blades 16 are connected is preferably pivotally mounted with the aid of ball bearings so that the tines or blades 16 and the manure injectors 15 which they carry will be movable not only upwards and downwards to enable the required operating depth to be set but also laterally to some extent. Lateral swingability can be advantageous because the slurry or other manure mixture is then distributed into the soil along more or less zig-zag lines. The implement that has been described with reference to FIGS. 1 to 3 of the drawings may comprise four of the injection tines or blades 16 and corresponding manure injectors 15 spaced apart from one another in a direction perpendicular to the direction A but, of course, the number of these assemblies and their relative spacing will depend upon the working width of the implement, the spacing between any rows of plants in the land that is to be fertilized and the volume of manure per unit area of land that is to be delivered. Under some working conditions, particularly when the manure injectors 15 are operating at a shallow depth, the use of substantially horizontally disposed covering discs immediately above ground level may be advantageous. Depending upon the nature and condition of the soil that is to be fertilized, the tines or blades 16 may be set to penetrate into the soil to a depth of between substantially 10 and substantially 15 cms. It will be evident that, when more than two of the manure injectors 15 are provided, some branching of the tubular outlets 25 or of the hoses 14 will be necessary but this is not shown in the drawings. Once the tank 1 has been filled from a bulk supply of slurry or other liquid organic manure mixture containing undissolved solids by way of the inlet opening 84, the three-way valve 8 is moved from the position in which it applies suction to the interior of the tank 1 to the position in which it connects the interior of said tank to the compression/outlet side of the pump 5. The inlet opening 84 is, of course, provided with a shut-off valve (not shown) by which it is kept closed when it is not in use. As soon as the pressure in the tank 1 is greater than the ambient air pressure by a value of substantially 1 atmosphere, a valve 85 (FIG. 1) is opened and the slurry or other manure mixture within the tank 1 is indirectly forced by the pump 5 out of said tank through a pipe opening into the bottom thereof and into the hose 12 and thence through the tubular inlet 24 into the pre-treatment or material-receiving chamber of the cutting mechanism 13. The second blade or pre-cutter 32 rotates in the chamber that has just been mentioned without co-operating with any counterblade or the like but will, of course, cut any large and/or coarse solid constituents of the slurry or other manure mixture into smaller pieces. The second blade or pre-cutter 32 is, like the cutter blade 26, of generally elliptical shape and comprises two opposed and arcuately curved convex cutting edges. This shape is important and has the practical result that, during operation, large and/or coarse solid lumps of the manure are sliced rather than being chopped. Quite small lumps of the manure are thus produced without damage to the second blade or pre-cutter 32. It will be noted that the second blade or pre-cutter 32 is so positioned relative to the tubular inlet 24 that, when the shaft 19 is rotating, lumps of manure entering the mechanism 13 in the direction B meet the cutting edge of the blade 32 that is moving towards them in a substantially opposite direction. The collision speed between the blade 32 and the lumps of manure entering in the direction B is thus quite high and this is conductive to rapid and effective slicing of the manure lumps. The arrangement of the second blade or pre-cutter 32 in advance of the cutter blade 26 and its co-operating fixed or counter blade 29 with respect to the directions B and C has the advantage that the blade 32 will thoroughly slice up any unusually large and/or coarse lumps of manure before they reach the co-operating parts 26 and 29, thus ensuring that the latter parts will not be subjected to damagingly high loads and that the risk of the mechanism 13 becoming clogged is brought to a very low level. Moreover, the provision of the second blade or pre-cutter 32 increases the volume of slurry or other manure mixture per unit time that can be dealt with effectively by the mechanism 13. The pressure of substantially 1 atmosphere above the pressure of the ambient atmosphere under which the slurry or other organic manure mixture is forced into the mechanism 13 through its inlet 24 causes that mixture to move towards the rotary cutter blade 26 and its co-operating fixed or counter blade 29. These blades still further reduce the size of the lumps of solid material in the mixture until the sliced up lumps are small enough to pass through the holes 31 in the fixed or counter blade 29 and thus into the post-treatment or delivery chamber of the mechanism 13. The sizes of the holes 31 are, of course, important and it has been found that, as previously mentioned, each hole should have a diameter which does not exceed between 4 and 6 cms. If a larger diameter were to be used, or if a manure injection operation were to be effected without employing the cutting mechanism, the danger of blockage of the manure injectors 15 and the tubular members (14, 25) through which those injectors 15 are fed would be very greatly increased with the likelihood of frequent and tiresome blockages occurring during any manure distributing operation. The preceding paragraph discusses the danger of clogging or blockage and the manner in which that danger is eliminated, or very greatly reduced, in accordance with the present invention but it will be appreciated that clogging and blockage could be eliminated, or be very greatly reduced, by operating at a much higher pressure than substantially 1 atmosphere. However, this answer to the problem has the grave disadvantage that the tank 1 and the various ducts would have to be constructed so as to be capable of withstanding such greatly increased pressure. Particularly in the case of the tank 1, it would need to be made in a similar way to a high pressure steam boiler which would very significantly increase its cost and make it necessary that it should comply with the various safety regulations that apply to such equipment. Moreover, with such an arrangement, the manure would inevitably be injected into the soil at high pressure and this produces a considerably less satisfactory result because the injected manure tends to escape upwardly in a manner wherein the degree of vigour is proportional to the injection pressure concerned. Although the results might be acceptable on very heavy land, they would be quite unsatisfactory on light and/or porous and/or cracked soil. The injection of the manure at a relatively low pressure is clearly desirable but involves the problem of clogging and blockage. This problem is solved, or very greatly reduced, in implements in accordance with the invention by the provision of the various cutting mechanisms 13, 56 and 73. Lumps of manure that are sliced up by the second blade or pre-cutter 32 and by the rotary cutter blade 26 and its co-operating fixed or counter blade 29 are forced at relatively low pressure through the small diameter holes 31 into the post-treatment or delivery chamber of the mechanism concerned from which the mixture passes in the direction C or D to the injectors 15 or 51, clogging or blockage being a very rare event because of the small size of the lumps of solid material in the manure mixture once that mixture leaves the cutting mechanism. It is not absolutely exxential that the second blade or pre-cutter 32 should be provided in all cases but, under most conditions, the irregular and coarse consistency of the solid constituents of manure mixtures makes its provision most desirable. By virtue of the provision of the cutting mechanism 13, 56 or 73 an implement in accordance with the invention can inject into the soil mixed manures, that are primarily organic in nature, of almost any composition. For example, mixtures containing coarse poultry manure and feathers, waste fodder, heaped manure with straw, soil and so on can all be dealt with satisfactorily provided only that there is a sufficient liquid content to bring the mixture to an at least semi-liquid condition. Obviously, in accordance with known practice, water can be added to produce the necessary consistency of the mixture when so required. A significant advantage of the cutting mechanism 13 is that its tubular outlets 25 may have a small diameter of, conveniently, substantially 4 inches (10 cms.). The hoses 14 may thus also be of a matching diameter which is considerably smaller than that of the hoses that are conventionally employed in manure injection work with prior art implements. The small diameter has the advantage that the outlets and hoses are less expensive to produce and that the joints between them are light in weight and can be readily manipulated without great effort. The cutting mechanism that has been described may advantageously be employed in a spreading implement that has a broad working width and that functions by using a known spreading plate (as described in United Kingdom Pat. No. 813512). Not only are the advantages of the smaller diameter lightweight pipes and hoses and their interconnecting joints obtained but also the advantage that the manure mixture is fed to the soil in a uniformly homogeneous condition so that its beneficial effect upon the soil is improved. In fact, the cutting mechanism 13 may be employed in a number of implements for distributing manure to the soil which implements also perform other simultaneous operations such as, for example, harrowing, seed sowing, planting and so on. The cutting mechanism 13 can be employed in a so-called central conduit system for feeding manure to the soil, the use of the mechanism 13 being particularly advantageous because such systems include very long ducts that are otherwise frequently subject to clogging and blockage. In such cases, the holes 31 may have somewhat larger diameters than are desirable in the case of the implements that have been described but, nevertheless, the holes 31 should not have diameters that are greater than substantially 6 cms. The lifetime of each replaceable rotary cutter blade 26 can be effectively doubled if the direction of rotation of the driving shaft 19, 58 or 75 can be reversed since, upon such reversal, the leading and trailing positions of the cutting edges of each cutter blade 26 are interchanged. If desired, the driving shaft 19 may be provided with a plurality of knives at intervals along its length so that said knives will assist in reducing the size of the lumps or other solid constituents of the manure mixture. As previously mentioned, the speed of rotation of the shaft 19 will normally be of the order of substantially 540 revolutions per minute but, particularly when the shaft 19 is provided with a plurality of knives, the speed of rotation of the shaft may advantageously be raised to substantially 1100 revolutions per minute. When a predetermined volume of manure mixture is to be delivered from the implement per unit time the speed of rotation of the shaft 19 will be subject to a maximum value whose magnitude will depend upon a number of variable factors. An alternative fixed or counter blade 29 may then be provided which has a larger number of holes 31 that are of smaller diameter but, generally speaking, a somewhat increased operating pressure is required under these circumstances. It is noted again that the holes 31 need not be of circular shape. Holes of regular polygonal shape and even holes of irregular shapes arranged inside at least one circumscribing circle will, in most cases, give satisfactory results. The cutting edge of the blade 26 advantageously and preferably has a length which is not less than twice the diameter or greatest width of each hole 31 to ensure an optimum cutting action. Whatever the shape of each hole 31, it is greatly preferred that it should be of divergent formation through the thickness of the fixed or counter blade 29 considered in the directions of flow B and C. Feathers and other components of some manure mixtures tend to become lodged between the rotary cutter blade 26 and the co-operating fixed or counter blade 29. However, continuing operation is usually effective in breaking up and removing such items. The bent-over portion 20A (FIG. 8) of the casing 20 or the annular locking element 30A ensures, throughout the useful lifetime of each cutter blade 26, a satisfactory degree of engagement between that blade and the co-operating fixed or counter blade 29. It is noted that the bent-over portion 20A or the annular locking element 30A can be employed in the cutting mechanism 56 of FIG. 5 or in the cutting mechanism 73 of FIGS. 6 and 7 in either of which cases the compression spring 64 may be omitted and said blade 26 be fixedly, rather than axially slideably, secured to the driving shaft 58 or 75. The division of the casing 20 into two parts that are bolted together at the bent-over portion 20A and the flange 20B in the embodiment of FIG. 8 of the drawings is advantageous in affording ready access to the cutter blade 26 and the fixed or counter blade 29 for replacement or adjustment purposes when required. The cutting mechanism 13 will only operate in a consistently satisfactory manner if there is an adequate pressure difference between its inlet opening 24 and its tubular outlets 25. It has been found that, if good operating results are to be maintained, this pressure difference should not be less than substantially half an atmosphere and it is noted that, with the described operating pressure of substantially 1 atmosphere and a pressure not much in excess of the ambient atmospheric pressure at the output end of the or each manure injector 15, the required pressure difference of not less than half an atmosphere between the inlet and outlet ends of the cutting mechanism 13 is readily achieved. If, as is often the case, a plurality of manure injectors 15 are employed, it can be useful to form the casing 20 of the mechanism 13 with a corresponding plurality of tubular outlets 25 thus making complicated and expensive branched outlet manifolds unnecessary. Conversely, a plurality of tubular outlets 25 is by no means essential since a relatively simple branched outlet manifold to a plurality of the manure injectors 15 will often suffice because the danger of clogging or blockage downstream of the mechanism 13 is very greatly reduced. If either of the blades 26 or 32 should be damaged or if adjustment of the mechanism 13 is necessary to match changed operating conditions, access to the parts needing replacement or adjustment is readily obtainable merely by removing the bolts which hold the front wall or cover 22 in place relative to the remainder of the casing 20. The spacing between the blades 26 and 32 and the angular difference between them about the axis of the shaft 19 is readily adjusted after loosening the set bolts 28 and 34. In the case of the towed implement of FIGS. 4 and 5 of the drawings, its cutting mechanism 56 is arranged at the rear of the substantially horizontally disposed cylindrical tank 35. The arrangement of the mechanism 56 underneath the manhole or handhole cover 52 is advantageous because it avoids the provision of any significant number of projecting parts and, during operation, ensures a regular supply of the manure mixture from the tank 35 with its solid constituents well comminuted. The connection between the rotary shaft 65 and the driving shaft 58 of the mechanism 56 by way of the fork coupling 67 is very convenient since it allows the cover 52 and the mechanism 56 that is secured thereto to be released without difficulty and to be reinstalled in such a way that the drive between the two shafts 65 and 58 is substantially automatically reengaged. The simple and compact mounting and drive of the rotary shaft 65 that have been described and that are illustrated in FIG. 4, in particular, of the drawings are convenient because the agitator/cutter blades 65A which are carried by said shaft inside the tank 35 tend to maintain the slurry or other manure mixture in a more or less homogeneous condition within the tank and to break up any initially very large solid constituents thereof. The stirring effect that is produced by the blades 65A tends to ensure that solid constituents of the manure mixture do not settle to the bottom of the tank and will thus flow towards the cutting mechanism 56 with the rest of the mixture when a manure distribution operation is in progress. The leading end of the casing 57 is substantially completely open except for the bearing 60 and the strips 61 by which it is supported and, therefore, the raised pressure which is produced in the tank 35 by the pump 40 (preferably substantially 1 atmosphere) causes the mixture to flow towards the outlet 43 as soon as the valve 44 is opened. The solid constituents of the manure mixture are first sliced into smaller pieces by the second blade or pre-cutter 32 during after which the mixture moves towards the rotating cutter blade 26 and the co-operating fixed or counter blade 29, those parts reducing the solid constituents of the mixture to a size that will pass through the holes 31 in the fixed or counter blade 29 under the action of the pressure difference between the inlet and outlet sides of the mechanism 56. The treated mixture, containing substantially only small solid pieces, passes from the post-treatment or delivery chamber of the casing 57 through the outlet 43 in the direction C towards the open valve 44 and the or each manure injector 51. Once again, as in the case of the embodiment of FIGS. 1 to 3 of the drawings, consistently satisfactory operation of the cutting mechanism 56 is dependent upon the maintenance of an adequate pressure difference between its inlet and outlet sides. The compression spring 64 automatically maintains the rotary blade 26 in correct contacting engagement with the fixed or counter blade 29 and said spring 64 may be so arranged that, in the event of an unusual accumulation of solid material causing overload, it will be further compressed and will prevent, or greatly reduce, damage to the blades 26 and 29 from this cause. As in the preceding embodiment, the valve 44, each hose 50 and each manure injector 51 may have significantly smaller diameters than are conventional in manure spreading and/or injecting implements that do not comprise a cutting mechanism. The previously mentioned advantages of lightness in weight, reduction in expense and easy handling are thus again obtained. As in the case of the cutting mechanism 13, the cutting mechanism 56 may be employed in other manure mixing and distributing implements to produce manure mixtures wherein the solid constituents do not exceed an advantageously small size, said constituents being distributed substantially homogeneously throughout the mixture. In the embodiment of FIGS. 4 and 5 of the drawings, each injection tine or blade 49 can be moved upwardly or downwardly, as may be required, by turning the frame 46 upwardly or downwardly relative to the chassis 36 about the pivotal shaft 47 using the double-acting piston and cylinder assembly 48 that is controlled from the driving seat of the agricultural tractor or other vehicle that operates the implement. The precise number of injection tines or blades 49 that are provided, and the number of associated manure injectors 51, is chosen in accordance with the width of the strip of land that is to be treated, the spacing between a plurality of assemblies 49, 49A and 51 being dictated by the spacing between any rows of plants that are growing, or that are to be grown, upon the land being treated. Once again, the depth at which the injection of manure takes place should be between substantially 10 cms. and substantially 15 cms. beneath the ground surface depending upon the nature of the soil being treated and its condition at the time of treatment. It will be appreciated that a change in working depth is readily brought about by increasing or decreasing the effective length of the hydraulic piston and cylinder assembly 48 and that, when the implement is to be transported from one place to another without performing any manure injecting operation, the piston rod of the assembly 48 can be fully retracted to turn the frame 46 upwardly as far as possible about the pivotal shaft 47 and thus raise the parts 49, 49A and 51 to a level above that of the ground surface. When the cutting mechanism 73 of FIGS. 6 and 7 of the drawings is employed in association with the inlet opening 72 of the tank 35, said mechanism performs its function during filling of the tank and the initially untreated manure mixture is caused to flow in the direction B and subsequently, after treatment, in the direction D by the difference between the prevailing atmospheric pressure and the sub-atmospheric pressure that is produced in the tank 35 by the action of the pump 40. If desired, a cutting mechanism corresponding to the mechanism 73 may be provided in connection with the inlet opening 84 of the embodiment of FIGS. 1 to 3 of the drawings partially inside the tank 1 in which case the valve 85 may, like the other valves that are disposed downstream of at least one of the cutting mechanisms, be of lighter construction and smaller effective diameter than is conventional in ducting for solid-containing organic slurry and other manure mixtures. In the arrangement that has been described with reference to FIGS. 6 and 7 of the drawings, the casing 74 of the mechanism 73 is partly recessed, in a simple manner, into the cylindrically curved wall of the tank 35 very near to the front of that tank with respect to the direction A, said casing 74 being in direct communication with the shut-off valve 71 and its inlet opening 72. The mechanism 73 operates in a manner which is very similar to that of the mechanisms 13 and 56. The driving shaft 75 of the mechanism 73 is located externally of the tank 35 and is conveniently powered from the pulley 69, or from an adjoining pulley, on the shaft that operates the air pump 40, the drive being transmitted from the pulley 69 or its immediate neighbor to the pulley 82 at the leading end of the shaft 75 by the V-belt 83. The speed of operative rotation of the driving shaft 85 is advantageously of the order of 540 revolutions per minute. The provision of the sharpening stone 78, including portions extending through adjacent holes 31, in this embodiment ensures that at least the leading cutting edges of the blade 26 are maintained continuously in an optimumly sharp condition during the operation of the implement. The spring 64 that is preferably employed in the embodiment of FIGS. 6 and 7 of the drawings urges the rotary blade 26 resiliently against the fixed or counter blade 29 and thus against the sharpening stone 78. The arrangement of the cutting mechanism 73 at the inlet, rather than at the outlet, of the tank 35 can be advantageous since it is then not so necessary that said tank should have agitating members such as the blades 65A that have been mentioned and that are illustrated in FIG. 4 of the drawings. Moreover, relatively long flexible hoses and rigid tubes/pipes can be used in association with the tank 35 with a very greatly reduced danger of clogging and blockage. As has been previously mentioned, the associated valves may also be of smaller diameter and lighter construction than is conventional for dealing with solid-containing manure mixtures. After initially untreated slurry or other manure mixture has passed through the mechanism 73 under the action of the pressure difference between the atmosphere and the sub-atmospheric pressure pertaining in the tank 35 and has entered that tank through the hole 79 in the direction D, it is ready for use without further treatment and can, as soon as is required, be pumped to the or each injector 51 merely by closing the valve 71, opening the valve 44 and placing the valve associated with the pump 40 in the position in which the duct 42 is connected to the compression/outlet side of that pump. It will be noted that both the cutting mechanism 56 of FIG. 5 and the cutting mechanism 73 of FIGS. 6 and 7 are installed in a simple manner in the tank 35 in such a way as to allow their installation in already existing tanks so that an existing manure distributing implement can be modified to give it the greatly improved performance that is possible in accordance with the invention at considerably less expense than would be involved in purchasing a complete new implement in accordance with the invention. It is noted that, in any of the embodiments that have been described, should clogging or blockage exceptionally occur in one of the mechanisms 13, 56 or 73, it can almost always be cleared in a simple manner, without any dismantling, merely by temporarily interchanging the duct/pipe connections to the pump 5 or 40 thus temporarily reversing the direction of flow through the affected mechanism. Although certain features of the implements that have been described and that are set forth in the accompanying drawings will be set forth in the following claims as inventive features, it is emphasized that the invention is not necessarily limited to those features and that it includes within its scope each of the parts of each embodiment that has been described or illustrated in the accompanying drawings or both, individually and in various combinations.

Summary: A homogenizing mechanism for a manure slurry in combination with a supply container and blades adapted to penetrate about fifteen centimeters under the soil surface for injecting manure into the soil by an injection pipe carried by the blade. The mechanism is disposed between container and the injection outlet so that the injected slurry must pass therethrough. An air displacement pump selectively places the container under pressure (up to about one atmosphere) or vacuum for moving the slurry out of or into the container, respectively. The homogenizing mechanism has a substantially cylindrical casing with an inlet from the container on one end and an outlet leading to the injector at the other end. The inlet may be a conduit or an open end of a casing mounted in part within the container. A disc-shaped counterblade with openings is secured within the casing between the inlet and outlet and an oval blade is rotated against the counterblade in a self-sharpening action cutting lumps and solids within the slurry as drawn through the openings in the counterblade. A precutter similar to the oval blade may be placed on the same shaft which is selectively or resiliently positioned to act on slurry as it enters the casing. A shaft rotating the oval blade or blades may also extend through the container for agitating the slurry therein. The container may be on a vehicle or towed trailer with the injection blades adapted to be pivoted to a position under the soil for operation and above the ground for transport. The homogenizing mechanism may also be positioned to treat slurry drawn into the container.

big_patent

en

Summarize: A 22-year-old waitress whose legs were severed by a train as she walked home after work was conscious during the ordeal and had to wait three hours in the freezing cold before she was taken to hospital. Sarah Stott was walking across a set of tracks as she made her way home in Verdun near Montreal when the train struck her in December. She lost her entire right leg, her left leg was severed below the knee and she also risks losing her fingertips after suffering hypothermia as she lay helpless in the plummeting temperatures. Severe: Sarah Stott, 22, was making her way across a set of tracks on her way to her home in Verdun near Montreal when a train struck her in December. Debiltating: She lost her entire right leg, her left leg was severed below the knee and she also risks losing her fingertips after suffering hypothermia as she lay helpless in the plummeting temperatures. Despite the double amputation, her friends and family say she is in good spirits and a crowd-funding campaign has so far raised more than $30,000 towards her medical bills. Miss Stott had planned to visit a friend following her shift at the Irish Embassy Pub and Grill in downtown Montreal on Monday December 8. She got a taxi to her house but when she realized no one was at home, she left on foot and headed home. As a short cut, she made her way over the CN Rail Tracks near Victoria Bridge, an area which has become popular with people crossing despite being unauthorized. Miss Stott noticed there was a stopped train on one side of the tracks, however she did not spot the second coming the other way. It's not known how fast the train was travelling at the time. Her mother told CBC that Miss Stott could see her severed legs beside her on the tracks, so tried to crawl towards them. She then lay on the ground in the cold for three hours before she saw another train approaching, waved it down and got them to help. Miss Stott was then admitted to Montreal hospital trauma unit and has undergone 15 surgeries since her arrival. Her mother Shelley said: 'It’s a miracle that she’s alive. Every day with her is an absolute blessing. She has an extremely strong spirit and will to live. She was left there for three, four hours with her legs severed, in the cold. She was still conscious. She was hypothermic.' Her mother said Miss Stott saw her severed legs laying on the tracks next to her so she tried to crawl towards them. She lay in the freezing cold for three hours before she was taken to hospital. Positive: Despite the double amputation, her friends and family however say she is in good spirits and a crowd-funding campaign has so far raised more than $30,000 towards her medical bills. Despite the severity of her injuries her mother added that she still had a sense of humor. Mrs Stott added: 'I walked into the room one day and she was awake, and she lifted her leg and said, "Look Mom, I have no legs!" And I said, "Yes sweetheart, you’re going to get a brand new one.'" 'She said, 'Yes I am! It’ll be firm forever — and I want it tanned,'" Her mother now plans to take her back to the family home in Ottawa so she can care for her. With a long road ahead of her, a GoFundMe page has been set up and has already attracted hundreds of anonymous bids. 'It’s very overwhelming,' Mrs Stott added. 'I always believed people have a good heart, but for the amount that was raised in such little time. 'I’m speechless. I’m overwhelmed. I’m full of gratitude.' Spirit: Her family say she has maintained her sense of humor while laying in her hospital bed. As her mother walked into the room one day she said: 'Look Mom, I have no legs!'

Summary: Sarah Stott was crossing a train yard near Montreal in December. Had taken a taxi to a friend's but left on foot because no one was there. She saw a stopped train on the rails, but she did not spot the second. Thinking she could make it across, she started running, but was hit. Seeing her severed legs on the track beside her she tried to crawl to them. Three hours later she sat up and waved down an approaching train. Miss Stott was admitted to a trauma unit and has undergone 15 surgeries. She may still lose her fingertips after suffering hypothermia.

cnn_dailymail

en

Summarize: Aaron and Dana, microphones in hand, visit Myers at a sanitarium but fail to provoke an obvious response from him. Their mention of Laurie does spark some kind of awakening, though, because soon enough Myers has escaped and is on the warpath, out for revenge. His main target? Laurie, who has moved to a fortified home out in the woods, and is played with edgy brilliance by Curtis, sporting a wild mane of gray hair. Having never quite gotten over 1978, Laurie has become somewhat of a crazed hermit, waiting with shotgun in hand for the day her old nemesis comes home. That reversal should be the key to Green’s pitch. The old dynamic of Carpenter’s film is being flipped, in a way: Now Myers is the prey, and Laurie the hunter. But that’s not really how the story progresses—instead, as Myers rampages toward town, the action shifts to Laurie’s estranged daughter, Karen (Judy Greer), who has rejected her mother’s apocalyptic outlook, and Laurie’s granddaughter, Allyson (Andi Matichak), who very much resembles 1978 Laurie. Allyson is out on the town with her friends, one of whom has a babysitting gig; to her, Laurie is just a kooky grandma, and Michael Myers no more than a creepy bedtime story. As Myers reaches Haddonfield, Allyson and her pals are placed squarely in his sights, and Halloween becomes just another slasher film, though Green assembles some expertly tense sequences. This is a project that’s been attempted before: In 1998, there was Steve Miner’s Halloween H20, also starring Curtis, set 20 years after the original and similarly focused on an ultimate showdown between Myers and Laurie. That was even more horror-by-numbers; Green’s film has a little more artistry to it. But still, all his best tricks are borrowed from Carpenter, right down to the chilling, minimalistic score (composed by Carpenter himself, along with Cody Carpenter and Daniel Davies). The reason the first Halloween felt so bold was its simplicity—imagine making a horror movie about a stranger murdering a bunch of other strangers and just titling it after the scariest holiday! Green’s Halloween, like many other imitators, can wring plenty of stress from a scene of a babysitter checking behind the closet door for a boogeyman. In its portrayal of Laurie, the film has the potential to dig beyond homage, but she’s largely sidelined from the action until the denouement. Other new twists on the old tale, like a loopy psychiatrist played by Haluk Bilginer to replace the departed Dr. Loomis (Donald Pleasence) of the original, are gratingly self-referential. In its last 30 minutes, Halloween finally stops playing the hits and tries something really different. I won’t spoil beyond that, but it works. Curtis’s performance is genuinely poignant and restrained, mostly avoiding the twitchy clichés that Laurie’s post-traumatic stress might encourage. Dumping the hacky sequel concept that Laurie’s related to Myers makes her motivation simpler and crueler; this is a revenge tale for each character, and once Green starts telling it from both sides, the film sings with purpose. Halloween takes its time warming up, but when Curtis grabs the reins, it does more than enough to justify its curious existence. We want to hear what you think about this article. Submit a letter to the editor or write to letters@theatlantic.com. Horror movie fans are a special audience sub-genre. They’ll travel to drive-ins in the middle of the Mojave for a good thrill. They are especially loyal to the Halloween franchise that has been creating goosebumps, heart palpitations and heebie-jeebies for 40 years. They don’t care if the latest hike around the jack-o’-lantern is not as good as the original John Carpenter screamfest or even any kind of acceptable re-boot of that 1978 classic at all. Nor do they care if, after all these years, Jamie Lee Curtis is too long in the tooth to keep screaming her head off every time Michael Myers shows up with a brand new hatchet. He’s been burned, stabbed, shot, drowned and beheaded before, and nothing has kept him down yet. No, Halloween addicts just want more—and so do I. Unfortunately, this one doesn’t deliver the goods with any new ideas or fresh suspense. It just lays there, like leftover pumpkin. Subscribe to Observer’s Entertainment Newsletter Endangered turkeys, rabbits and Santa Claus have never done for Thanksgiving, Easter and Christmas what Jamie Lee Curtis has done for Halloween! Now, 40 years to the Halloween night the first movie took place, she returns to the blood-stained lawns of Haddonfield, Illinois where, as Laurie Strode, she was the only babysitter in town who escaped a massacre by the insane serial killer in a fright mask that started it all. HALLOWEEN ★★ (2/4 stars) Directed by: David Gordon Green Written by: David Gordon Green Starring: Jamie Lee Curtis, Judy Greer, Andi Matichak Running time: 109 mins. Four decades have left her almost as demented as her tormenter, and she has spent the years cautiously—becoming a crazy town eccentric estranged from her mother Karen (Judy Greer) and her granddaughter Allyson (Andi Matichak). Never mind. She’s been out of her mind with terror, permanently unhinged by paranoia and dread while preparing her house for the inevitable return of Michael Myers. A master of self-defense, she has a hiding place under her floor like a bomb shelter and an arsenal of automatic weapons that outnumber the Republicans in the U.S. Congress. Smart girl, because, predictably, he escapes again from a fool-proof insane asylum and heads for Haddonfield faster than you can say “Bates Motel.” David Gordon Green, who made such past horrors as Pineapple Express and Our Brand Is Crisis, is not an imaginative director, so the result is a disappointing collection of the usual familiar cliches, including kids too stoned or drunk to use common sense when the floor creaks in an empty house, victims who lose their cell phones before danger strikes, and an assortment of dumb cops and naive psychiatrists who say things about the monster like “Remember, he’s the property of the state—he mustn’t be harmed!” Michael no longer creeps around in the bushes waiting to pounce. On the safest night of the year, when everyone thinks he’s only another Trick-or-Treater wearing a Michael Myers costume, he just walks right into people’s houses, slashes their throats, and stomps their heads in without interference. There are a few gory scares here and there, but the thrills are uneven and the setups all have a tired feeling of déjà vu. Sadly, Michael Simmonds’ camerawork for Halloween circa 2018 also lacks the clarity and beauty of the original cinematography that made the 1978 Halloween one of the best-photographed horror flicks of all time. That the contrived script leads up to a final showdown between the indefatigable girl and the indestructible ghoul comes as no surprise. But in 40 years, what once seemed creepy now just seems campy. I’m sorry to report that in the 2018 Halloween, the howls sound more like giggles than screams. 'Halloween': This Time, Laurie Strode Is Locked And Loaded Enlarge this image toggle caption Ryan Green/Universal Pictures Ryan Green/Universal Pictures Trauma is not neat and pretty to deal with; it is not easily diagnosed, it does not vanish on its own, and its lingering effects can touch those around us. In the latest sequel to the long and winding Halloween series, trauma plays an important role in the narrative arc of famed final girl Laurie Strode (Jamie Lee Curtis). You might remember her from the original 1978 John Carpenter film, which saw her screaming, running, discovering her friends brutally murdered, then fending off a serial killer to protect the kids she was babysitting. The 2018 sequel picks up several decades later, and while it largely conforms to the retro thrills of the "serial killer on the loose" subgenre, it makes something interesting out of Laurie's earlier experience. In this film, trauma and survivor's guilt are not swept under the rug, as often happens in sequels. Instead, Laurie's experience shapes her behavior and her relationship with both her loved ones and the wider world. Horror movies have lightly toyed with a character's trauma for dramatic effect before. In Neil Marshall's The Descent, Sarah (Shauna Macdonald) tries to cope with the loss of her family in an accident by reuniting with friends and taking a girl's trip. Things go terribly wrong on the group's cave-diving adventure, and the memory of her daughter as well as her survivor's guilt haunt her as she fights off cannibalistic monsters. Wes Craven's Scream features Sidney Prescott (Neve Campbell) struggling to cope with her mother's murder. When a similar killer starts attacking her classmates, it brings her worst fears back to her doorstep. But in this present-day Halloween, directed by David Gordon Green, trauma is no mere plot device; it's the film's explicit subject. Laurie has become a virtual hermit, closing herself off from a world that saw her more like a freak show than a survivor. She's quick to shut out journalists looking to make a sensational story out of her experience. In this timeline, which skips all of the other sequels, Laurie arms herself in case serial killer Michael Myers returns. She teaches her daughter how to survive, how to shoot, and when to seek shelter in the family panic room. She's trying to inoculate her daughter from fully inheriting her trauma, as when young women are taught to walk to their cars with their keys between their fingers. This Halloween sets out to explore the emotional cost of seeing a monster in every shadow. Laurie's insistence that her daughter Karen (Judy Greer) learn to protect herself and check around every corner causes a rift in their relationship: Karen resents her mother for the survivalist training and for exposing her to secondhand paranoia. She settles for a passive husband and refuses to train her own daughter Allyson (Andi Matichak) the way her mother raised her. She naively considers her mother's trauma to be hers alone and actively tries to separate Laurie from spending time with her granddaughter. In the movie, trying to break the cycle of fear leaves them vulnerable to the man who caused the fear in the first place. We see why Karen has so forcefully pushed Laurie out in one especially tense dinner scene: A visibly shaken Laurie shows up late to meet the family at a restaurant, upsetting the shallow pleasantries. Granddaughter Allyson tries to calm her, while daughter Karen becomes confrontational, angry that her mother has shown up at all. Curtis' performance here is moving — she's clearly uncomfortable within seconds of sitting down at the table. She keeps looking past the others nervously, while Karen's body language telegraphs her frustration at the challenges of caring for someone struggling with mental health issues. Trauma manifests in ways we can't control, often at times when it isn't appropriate to cry or scream. Laurie's instability in these moments is palpable, and helps explain why she took such drastic measures against a (likely supernaturally driven) killer. Laurie's story could have gone any number of ways. She could have buried her trauma, reliving it only in nightmares. She could have moved to another part of the world. If it's disappointing to see Laurie Strode turned, here, into a gun-toting survivalist in a standard revenge plot, the actress' own words may shed some light on that decision. At Austin's Fantastic Fest screening last month, Curtis told the crowd, "Laurie Strode went back to school on November 1st with a bandage on her arm. She left school on the 31st, this dreaming, intellectual, going-off-to-college girl. And she came back on the first of November a freak, where everybody talked about her. Nobody helped her. And that's what I think was the reasoning behind going back to the original trauma. And I'm really glad they did." It would have been nice if more women could have had some say in the narrative trajectory Laurie has taken, instead of film's all-male screenwriting trio of Green, Danny McBride and John Fradley. However, this Halloween highlights a question that horror films so often ignore: How does a genre that unleashes so much violence on its characters grapple with post-traumatic stress disorder, trauma and grief? Horror filmmakers will always terrorize their characters in the moment, of course — but here's hoping we'll start to see more films willing to explore the lingering costs of living with fear every day. While this latest Halloween may not accomplish everything it sets out to do, it amply demonstrates how difficult it can be to move on from the ghosts of traumas past. New ‘Halloween’ stays true to splatter movie traditions Even before Michael Myers starts with the stabbing and the bashing and the strangling and the hammering and the stomping, “Halloween” is one ruthlessly efficient killer of a movie — and I’m grateful for that. Director and co-writer David Gordon Green’s bloody good splatter film is a direct sequel to John Carpenter’s 1978 horror classic, picking up the story some 40 years after the events of that film. That means they’ve killed off “Halloween II” and “Halloween III: Season of the Witch” and “Halloween H20” et al., pretty much wiping the slate clean, so here’s all you really need to know: Four decades after the masked boogeyman Michael Myers killed three people in the town of Haddonfield, Illinois, on the night of Oct. 31, survivor Laurie Strode (Jamie Lee Curtis, yes!) is now a tightly wound, wild-eyed grandma, obsessed with the imprisoned Myers and convinced he will one day escape and track her down and try to finish the job. Come on, Laurie, give it up. You’re talking crazy. It’s not like the sixtysomething Michael Myers is really going to break out and somehow track her down in the dead of night — or is he? Laurie lives in a remote house deep in the woods — a house equipped with multiple security cameras, floodlights, a panic room hidden beneath the kitchen and a number of booby traps. She also has enough firepower to arm a small militia. If and when Michael comes for her, she’ll be ready! Her fixation on Myers led to the breakup of two marriages, and also caused Laurie to lose custody of her daughter Karen (played by Judy Greer as a grown-up) when Karen was just 12. These days, Karen spends very little time with her increasingly paranoid and delusional mother, but Laurie remains close with Karen’s teenage daughter, the plucky Allyson (Andi Matichak). MORE FROM RICHARD ROEPER Urgent but emotional, ‘The Hate U Give’ reflects the realities of right now ‘First Man’ brilliantly depicts rise of Neil Armstrong, step by giant step In a particularly ill-conceived — some might even say idiotic — plan, authorities decide it’s a good idea to take Michael out of the facility that has kept him in check for 40 years and put him on a bus with a bunch of other mentally ill prisoners on Halloween night. And just like that, Michael Myers is once again on the loose in Haddonfield, methodically killing random strangers in a number of creatively gory ways. (First, of course, he has to retrieve his mask, which just happens to be — well, I won’t give it away other than to tip my cap to the screenwriters for the clever set-up.) Haluk Bilginer is the creepy Dr. Sartain, who is in charge of Michael’s care and is fascinated by (and maybe even overly fond of) his subject. (When Laurie meets Dr. Sartain, she says, “So you’re the new Loomis,” referencing the late great Donald Pleasance’s character from the original.) Like most of the cops and many of the civilians — from a couple of earnest podcasters to, yes, a babysitter, to a number of Haddonfield locals — Dr. Sartain makes some really bad and dumb choices, but that’s what we expect of supporting players in a slasher movie, right? We’re supposed to be calling them out for opening a closet door or leaning too close to a seemingly dead adversary or calling out “Who’s there?” while walking toward the danger instead of running away like a cartoon character. The ubiquitous Judy Greer is strong as Laurie’s daughter. Veteran character actor Will Patton is a welcome presence as the only Haddonfield cop who remembers the Babysitter Murders. Nick Castle (the original Michael Myers) delivers chills as the masked killing machine, even though we never see his face. And Jamie Lee Curtis is badass terrific as Laurie, who lived through those horrific events all those years ago but was robbed of having a real life. We also get some choice callbacks to the original film, including one sequence so obvious (and yet so fantastically satisfying) we’d be surprised if they hadn’t figured out a way to make it happen. Director Green isn’t trying to reinvent the squeal. “Halloween,” the 2018 version, is the B-movie sequel “Halloween,” the 1978 version, has always deserved. ‘Halloween’ ★★★ Universal Pictures presents a film directed by David Gordon Green and written by Jeff Fradley, Danny McBride and David Gordon Green. Rated R (for horror violence and bloody images, language, brief drug use and nudity). Running time: 106 minutes. Opens Friday at local theaters.

Summary: Four decades after she first encountered Michael Myers, Laurie Strode (Jamie Lee Curtis) meets the killer for what is said to be the final time in David Gordon Green's Halloween, a follow-up to John Carpenter's 1978 horror classic that overrides all the other sequels that have come before. According to critics, it's worth the fright. "Halloween, the 2018 version, is the B-movie sequel Halloween, the 1978 version, has always deserved," writes Richard Roeper at the Chicago Sun-Times. "It's one ruthlessly efficient killer of a movie." Actors Nick Castle, Judy Greer, and Will Patton earn his praise, while Curtis is "badass terrific," to boot, he writes. Though the film "may not accomplish everything it sets out to do," Monica Castillo appreciated that it embraced trauma and survivor's guilt as an "explicit subject" as opposed to ignoring such real-life struggles. Aiding this story line, Curtis delivers a "moving" performance, her character's instability "palpable," Castillo writes at NPR. Rex Reed was not impressed. Green "is not an imaginative director, so the result is a disappointing collection of the usual familiar cliches," he writes at the Observer. "There are a few gory scares" but the film is missing "any new ideas or fresh suspense," he adds. "It just lays there, like leftover pumpkin." Green's "best tricks are borrowed from Carpenter," but the director jets out on his own for an "excellent final act," in David Sims' view at the Atlantic. "This is a revenge tale for each character, and once Green starts telling it from both sides, the film sings with purpose," he writes, also applauding "fantastic work" from Curtis. Prefer movies that are scary bad? Browse this list.

multi_news

en

Summarize: PRIORITY [0001] This non-provisional application claims priority of Provisional Application No. 61/558,259, filed on Nov. 10, 2011. The entirety of Application No. 61/558,259 is incorporated herein by reference. FIELD OF THE INVENTION [0002] The present invention relates to fastening systems for absorbent personal care articles. More particularly, it relates to absorbent personal care articles having foldable wings or flaps that can be employed to properly position and attach the absorbent articles to undergarments or other articles of clothing. BACKGROUND [0003] Absorbent personal care articles such as sanitary napkins, panty liners and incontinence pads commonly utilize a pair of wings or flaps which are used to help secure the article in place to the wearer&#39;s undergarments. Generally, the wings are folded around the outside of the wearer&#39;s undergarment and attach to the outside of the undergarment via adhesive or other fastening means. Once secured to the undergarment the wings help reduce the likelihood that the article will become dislodged and move out of position. Examples of such foldable wing fasteners are shown and described in U.S. Pat. No. 4,589,876 Van Tilberg; EP051190B1 Pigneul; U.S. Pat. No. 5,401,268 Rodier; and EP1208823A1 Hohmann. [0004] However, while wings of various size and shape have previously been used, there remain a number of drawbacks to these designs. First, many wings do not adequately prevent the article from bunching or twisting due to the stresses imparted on the article as the wearer moves. Second, misapplication of the article to the undergarment can also greatly increase the risk of leakage. In this regard, it can be difficult for wearers to place conventional wings properly onto their undergarment and when the wings are improperly fastened the absorbent article can be bunched or partially twisted as donned or more easily become twisted or bunched with the wearer&#39;s movement. Twisting of the article and/or the deformation of the article when worn can result in the article being at an angle relative to the wearer as opposed to being perpendicular to or flat against the wearer. When the article is sidewardly angled to the wearer the ability of the article to take in and absorb fluids can be reduced to an extent such that the article functions significantly less effectively than desired. Further, bunching of the article results in the article covering considerably less area under the vaginal region than desired. Thus, such unwanted twisting and bunching of the article can result in increased frequency of leakage and staining of the wearer&#39;s garments. [0005] Thus, there exists a continued need for an absorbent personal care article having foldable wings that assist the wearer with proper placement and donning of the article. [0006] There further exists a need for such an article wherein the foldable wings also help maintain the article in an uncontorted and/or generally flap shape in order to minimize the incidence of leakage. SUMMARY OF THE INVENTION [0007] The present invention addresses problems experienced with the flap designs of the prior art by providing an absorbent personal care article including (i) a left flap having first and second peaks and a furrow positioned there between, and (ii) a right flap having a first peak. The left and right flaps are positioned on opposed longitudinal sides of the article and sized such that, when the flaps are folded under the article and extended so that they lay flat against the liquid impermeable backsheet, the right flap peak extends across the longitudinal centerline of the article and into the left flap furrow. [0008] In a further aspect of the invention, the left and right flaps can be integrally shaped and sized such that the wings substantially inter-mesh with or conform to one another when folded under and around the article. In still a further embodiment, the left and right flaps may define a space or gap between them along the substantial length of the flaps when the flaps are folded under the article lying flat adjacent the liquid impermeable backsheet. In an alternate embodiment, the left and right flaps can be sized and shaped so as to form one or more discrete areas of overlap when the flaps are folded under and around the article and lay flat against the liquid impermeable backsheet. [0009] In a further aspect of the invention, the left and right flaps may include fasteners located on the garment facing side of the flap peaks such that the fastener extends across the longitudinal centerline of the article and either into the furrow of the opposed flap or over the opposed flap. This may be achieved, in one embodiment, by placing the fastener proximate the outer edges of the flap peaks. BRIEF DESCRIPTION OF THE DRAWINGS [0010] FIG. 1 is a representative partially cut away plan view of one embodiment of a sanitary napkin of the present invention in a flat and unfolded state. [0011] FIG. 2 is a representative plan view of a sanitary napkin of an alternate embodiment of the present invention suitable for use with both traditional and tanga style underwear. [0012] FIGS. 3-6 are enlarged views of individual embodiments of wings of the present invention shown in an inter-meshing relationship as folded directly under the personal care article lying flat against the backsheet. DESCRIPTION OF THE INVENTION [0013] In reference to FIGS. 1 and 2, the drawings show absorbent personal care articles in a flat and unfolded state. Except as otherwise noted, discussion of dimensions of the article and/or the positions of individual components thereof are in reference to the article being in a flat and unfolded state and further, in the event elasticated components are utilized, dimensions are in reference to the article being in an uncontracted state. Further, as used herein, the terms “comprising” or “including” are inclusive or open-ended and do not exclude additional unrecited elements, compositional components, or method steps. Accordingly, the terms “comprising” or “including” encompass the more restrictive terms “consisting essentially of” and “consisting of.” [0014] In reference to FIG. 1, an absorbent personal care article 10 is provided comprising a liquid permeable topsheet 12, a liquid impermeable backsheet 14 and an absorbent core 16. The absorbent article 10 has a lengthwise or longitudinal direction and a widthwise or transverse direction. The longitudinal centerline of the article 10 is shown as line “L” and the transverse centerline of the article 10 is shown as line “T”. The absorbent article 10 can comprise any one of numerous elongate shapes including, but not limited to, triangular, rectangular, dog-bone and elliptical. In addition, it will often times be desirable for the article to have rounded corners and/or generally convex ends. [0015] The absorbent article desirably has a length between about 80 mm and about 450 mm, and still more desirably a length between about 150 mm to about 250 mm. The absorbent article 10 desirably has a maximum width (excluding the wings) between about 40 and about 160 mm, and still more desirably a maximum width between about 65 mm and about 95 mm. [0016] The absorbent article 10 further includes a first wing 20 and second wing 30 extending from opposite longitudinal sides of the article 10. The first and second wings 20, 30 desirably extend from about 20% to about 75% of the length of the article 10. In a further aspect, the wings desirably have a length, in the longitudinal direction L, of from about 40 mm to about 160 mm, and still more desirably a length from about 95 mm to about 145 mm. The wings can be positioned about the transverse centerline or may be positioned either some distance forward or rear of the transverse centerline as may be desired to better accommodate the particular shape of the article and/or use on a particular style of garment. In addition, while not shown, it is noted that absorbent articles can, if desired, contain more than one set of opposed wings of the present invention. [0017] A portion of the outside surface of the wings 20, 30 include one or more fasteners 26, 36. The fastener will be selected to releasably engage either a garment or an overlapping portion of an opposed wing. Numerous adhesives and mechanical hook-type fasteners that releasably attach to itself or a user&#39;s garments are well known in the art and are suitable for use in connection with the present invention. Pressure sensitive adhesives are particularly well suited for use with the present invention. However, in order to protect the adhesive from contamination or drying prior to use, the adhesive is commonly protected by one or more releasable peel strips as is known in the art. A suitable releasable peel strip is a white Kraft paper having a silicone coating on one side so that it can be easily released from the adhesive. In addition, with respect to wing-to-wing attachment, examples of specific mechanical hook, adhesive and other fastening systems include but are not limited to those described in WO03/015682 to Hammonds et al.; WO03/015684 to Hammonds et al. and US2004013317 to Steger et al. [0018] The first wing 20 includes at least a first peak 21 and a second peak 22 and a furrow base 24 spanning the peaks; the inner edges of the first and second peaks 21, 22 and the furrow base 24 define a groove or furrow 24 A in the first wing 20. The shapes of the peaks and furrow(s) can vary as desired including both rectilinear and curvilinear configurations. The wing 20 and components thereof are sized such that, when the wing 20 is folded around the underside of the article and the wing 21 lays flat against the backsheet 14, portions of the first and second peaks 21, 22 extend across the longitudinal centerline L whereas the furrow base 24 does not extend across or even to the longitudinal centerline. Thus, the specific dimensions for the wings will be selected in relation to the corresponding width of the absorbent article. In one aspect, the dimension of the peak in the transverse direction may be at least 50% of the width of the adjacent section of the absorbent core. In a further aspect, the distance from the middle of the first peak to the middle of the furrow base 24 is desirably at least about 20 mm and still more desirably between about 20 mm and about 60 mm. [0019] The second wing 30 includes at least a first peak 31 and first and second shoulders 38, 39 positioned on opposite sides of the first peak 31 of the second wing 30. Individual elements of the second wing 30 can have dimensions the same as or similar to those of the first wing 20. However, as discussed in more detail below, desirably the peaks, furrows, and/or shoulders of the first and second wings are shaped so to coincide with one another. The second wing 30 and components thereof are sized such that, when second wing 30 is folded around the underside of the article and lays flat against the backsheet 14, portions of the first peak 31 extend across the longitudinal centerline L whereas the shoulders 38, 39 do not extend across or even to the longitudinal centerline L. The shapes of the peak(s), furrow(s) and/or shoulders can vary as desired including both rectilinear and curvilinear configurations. [0020] The first and second wings 20, 30 are positioned along the longitudinal sides of the article 10 wherein the furrow base 24 of the first wing 20 lies in the same plane as the first peak 31 of the second wing. Stated differently, the first and second wings 20, 30 are positioned along opposed longitudinal sides of the article 10 such that, when the first and second wings 20, 30 are folded around the underside of the article 10 and extended to lay flat against the backsheet 14, the first peak 31 of the second wing 30 extends into the furrow 24 A of the first wing 20 (the furrow 24 A of the first wing 20 being defined by the peaks 21, 22 and furrow base 24 ). [0021] In one embodiment and in reference to FIG. 3, the first and second wings 20, 30 can be sized and shaped so that, when folded around the underside of the article 10 and extended to lay flat against the backsheet 14, the wings 20, 30 do not overlap thereby leaving a space or gap “G” between them. In the embodiment shown, the wings 20, 30 are sized and shaped so that they substantially intermesh but leave a substantially uniform gap “G” between them when folded around the underside of the article so as to lay flat against the backsheet 14. Desirably in such embodiments the wings leave a gap “G” of less than about 20 mm and still more desirably less than about 15 mm. Thus, in use, the first wing 20 and second wing 30 extend around the crotch portion of the garment, and the first peak 31 of the second wing 30 extends into the furrow 24 A of the first wing 20 in a mating relationship. In a further aspect, the first and second peaks 21, 22 of the first wing 20 and the shoulders 38, 39 of the second wing 30 similarly lie in a corresponding relationship having a similar gap between the respective edges. Primary fasteners 26, 36, such as pressure sensitive adhesive, can be positioned adjacent the outer edges of the peaks such that, when the wings 20, 30 are folded under the article so that the wings 20, 30 lie flat against the backsheet 14, the fasteners 26, 36 lie on the opposite side of the longitudinal center line relative to which the wing is attached. The wings may also optionally include secondary fasteners 27, 37 located proximate to outer edges of the furrow base 24, shoulders 38, 39 or base of the peaks 21, 22, 31. The primary fasteners 26, 36 may lie entirely or partially beyond the longitudinal center line when the wings 20, 30 are folded around the underside of the article 10 and lay flat against the backsheet 14. As shown in FIG. 3, when the wings 20, 30 are folded around the underside of the article 10 and lay flat against the backsheet 14, the primary fasteners 26, 36 are positioned entirely on the opposite side of the longitudinal center line “L” relative to the side that the wing extends from. [0022] In a further embodiment, and in reference to FIGS. 4 and 5, the first and second wings 20, 30 are sized and shaped so that the wings form overlap regions 50 when folded around the underside of the article 10 and extended to lay flat against the backsheet 14. Thus, in use, the first wing 20 and second wing 30 can extend around the crotch portion of the garment and the first peak 31 of the second wing 30 extends over the furrow base 24 of the first wing 20 in an overlapping relationship. In this embodiment the wings are sized and shaped so as to inter-mesh in a manner such that the wings superpose one another. When the wings 20, 30 are folded around the underside of the article 10 so as to lay flat against the backsheet 14, individual overlap regions 50 formed by the superposed portions of the first wing 20 and second wing 30 desirably each comprise an area of at least about 50 mm 2, more desirably between about 50-600 mm 2 and still more desirably between about 100-250 mm 2. In a particular embodiment and in reference to FIG. 4, the dimension of the wings relative to the width of the article 10 (exclusive of the wings) is such that the first and second wings 20, 30 form overlap regions 50 adjacent the outer edges of the peaks 21, 22 and 31 extending generally in the longitudinal direction. In a further particular embodiment and in reference to FIG. 5, the shape and dimension of the wings 20, 30 relative to the width of the article 10 (exclusive of the wings) is such that the first and second wings 20, 30 form overlap regions 50 adjacent the side edges of the peaks 21, 22 and 31 extending generally in the transverse direction T. The wings 20, 30 can include fasteners (not shown) positioned on one or both areas of the wings intended to overlap and directly engage one another. Desirably the fasteners are positioned adjacent the edges of the peaks 21, 22, 31. The wings may optionally include secondary fasteners such as pressure sensitive adhesive located in one or more areas of the wings 20, 30 intended to overly the garment when worn. [0023] In still a further embodiment and in reference to FIG. 6, the second wing 30 can have a shape the same as or substantially similar to that of the first wing 20. Thus, in this embodiment, the first wing 20 and second wing 30 each have first peaks 21, 31, second peaks 22, 32 and furrow bases 24, 34 respectively. The first peaks 21, 31 and second peaks 22, 32 are sized so as to extend beyond the longitudinal centerline “L” when the wings 20, 30 are folded under the backside of the article and extended so as to lay flat against the backsheet 14. In addition, the wings 20, 30 are off-set from one another such that, when the wings are folded around the underside of the article and extended so that the wings 20, 30 lay flat against the backsheet 14, the first peak 31 of the second flap 30 extends into the furrow of the first wing 20 and the first peak 21 of the first wing 20 extends into the furrow of the second wing 30. As will be readily understood by one skilled in the art, the multiple peaks of the wings can be configured to have non-overlapping relationships, overlapping relationships or both an overlapping and non-overlapping relationship. Accordingly, the wings will contain a plurality of fasteners in accord with the selected overlap scheme and fastening mechanism. In reference to FIG. 6, the primary fasteners 26, 36 traverse the longitudinal centerline “L.” [0024] The front and rear halves of each wing can be symmetrical or asymmetrical as desired. For example, in one embodiment and in reference to FIG. 1, the front and rear halves of the wings, i.e. the halves above and below the transverse centerline in the longitudinal direction, are symmetrical. The absorbent core in the embodiment of FIG. 1 is also symmetrical and commonly it will be desirable for the wings to be symmetrical when the absorbent core is symmetrical. In an alternate embodiment, and in reference to FIG. 2, the absorbent core 16 is shaped having wider front (F) and narrower rear (R) sections in order to better conform to a tanga or thong type undergarments as well as for use in connection with certain overnight pads. The wings are therefore configured to correspond with the difference in the width of the article 10. More specifically, the first peak 21 of first wing 20, which is positioned adjacent a wider section of the absorbent core 16, has a greater dimension in the transverse direction than the rearward second peak 22 of the first wing 20. In the embodiment shown in FIG. 2 the wings 20, 30 are centered about the transverse centerline “T” of the article however, as noted previously, the wings 20, 30 can be positioned either forwardly or rearwardly relative to the transverse centerline as desired. [0025] With respect to the general function and composition of the article 10, the backsheet or outer cover 12 functions to isolate absorbed fluids from the wearer&#39;s garments and therefore comprises a liquid-impervious material. In one aspect the outer cover may optionally comprise a material that prevents the passage of liquids but allows air and water-vapor to pass there through. The outer cover can comprise a single layer or multiple layers and these one or more layers can themselves comprise similar or different materials. Suitable backsheet materials include, but are not limited to, polyolefin films, nonwovens and film/nonwoven laminates. The particular structure and composition of the outer cover may be selected from various known films and/or fabrics with the particular material being selected as appropriate to provide the desired level of liquid barrier, strength, abrasion resistance, tactile properties, aesthetics and so forth. Suitable outer covers include, but are not limited to, those described in U.S. Pat. No. 4,578,069 to Whitehead et al.; U.S. Pat. No. 4,376,799 to Tusim et al.; U.S. Pat. No. 5,695,849 to Shawver et al; U.S. Pat. No. 6,075,179 et al. to McCormack et al. and U.S. Pat. No. 6,376,095 to Cheung et al. [0026] The topsheet 14 functions to receive and take in fluids, such as urine or menses, and therefore comprises a liquid permeable material. Additionally, topsheets can further function to help isolate the wearer&#39;s skin from fluids held in the absorbent core 16. Topsheets can comprise a single layer or multiple layers and these one or more layers can themselves comprise similar or different materials. Topsheets are well known in the art and may be manufactured from a wide variety of materials such as, for example, porous foams, reticulated foams, apertured plastic films, woven materials, nonwoven webs, aperture nonwoven webs and laminates thereof. It is also well known that one or more chemical treatments can be applied to the topsheet materials in order to improve movement of the fluid through the topsheet and into the article. Suitable topsheets include, but not limited to, those described in U.S. Pat. No. 4,397,644 to Matthews et al.; U.S. Pat. No. 4,629,643 to Curro et al.; U.S. Pat. No. 5,188,625 Van Iten et al.; U.S. Pat. No. 5,382,400 to Pike et al.; U.S. Pat. No. 5,533,991 to Kirby et al.; and U.S. Pat. No. 6,410,823 to Daley et al. Between the liquid pervious topsheet 12 and liquid impervious backsheet 14 is positioned an absorbent core 16. The absorbent core 16 functions to absorb and preferably “lock-up” the bodily fluids that pass into the absorbent article 10 through the topsheet 12. The absorbent core can comprise a single layer or multiple layers and these one or more layers can themselves comprise similar or different materials. In order to efficiently and effectively utilize the absorbent capacity of the article, it is common for the absorbent core to include one or more liquid distribution layers or wicking layers in combination with a highly absorbent layer that preferentially absorbs and retains the liquids. Suitable wicking layers include, but are not limited to, bonded-carded webs, hydroentangled nonwoven webs, or spunbond webs containing fibers treated with or containing one or more topical agents that improve the contact angle with the bodily fluid and/or modify the flow properties of the bodily fluid. Highly absorbent layers often include, but not limited to, batts or webs containing wood pulp fibers, superabsorbent particles, synthetic wood pulp fibers, synthetic fibers and combinations thereof. The absorbent core may comprise any one of a number of materials and structures, the particular selection of which will vary with the desired loading capacity, flexibility, body fluid to be absorbed and other factors known to those skilled in the art. By way of example, suitable materials and/or structures for the absorbent core include, but are not limited to, those described in U.S. Pat. No. 4,610,678 to Weisman et al.; U.S. Pat. No. 6,060,636 to Yahiaoui et al.; U.S. Pat. No. 6,610,903 to Latimer et al.; US20100174260 to Di Luccio et al.; and U.S. Pat. No. 7,358,282 to Krueger t al. [0027] The shape of the absorbent core can vary as desired and can comprise any one of various shapes including, but not limited to, generally triangular, rectangular, dog-bone and elliptical shapes. In one embodiment, the absorbent core 16 has a shape that generally corresponds with the overall shape of the article 10 such that the absorbent core terminates proximate the edge seal 18 and wings 20, 30. The dimensions of the absorbent core can be substantially similar to those referenced above with respect to the absorbent article 10 ; however it will be appreciated that the dimensions of the absorbent core 16 while similar will often be slightly less than those of the overall absorbent article 10 in order to be contained therein. [0028] As previously indicated, the absorbent core 16 is positioned between the topsheet 12 and backsheet 14. The individual layers comprising the article can be attached to one another using means known in the art such as adhesive, heat/pressure bonding, ultrasonic bonding and other suitable mechanical attachments. Commercially available construction adhesives usable in the present invention include, for example Rextac adhesives available from Huntsman Polymers of Houston, Tex., as well as adhesives available from Bostik Findley, Inc., of Wauwatosa, Wis. In one embodiment, and in reference to FIG. 1, the absorbent core can be sealed between the topsheet 12 and backsheet 14 along the perimeter of the absorbent core 16 along edge seal 18 formed by the application of heat and pressure to melt thermoplastic polymers located in the topsheet 12 and/or backsheet 14. [0029] The wings can be constructed from materials described above with respect to the topsheet and backsheet. In one embodiment, the wings can comprise an extension of a layer of material within the topsheet and/or backsheet. By way of example and in reference to FIG. 1, the wings 20, 30 can be formed by an extension of the topsheet 12 and backsheet 14 that are welded together along edge seal 18. Such wings can be integrally formed with the main portion of the absorbent article. Alternatively, the wings can be formed independently and separately attached to an intermediate section of the article. Wings that are made independent of the other components of the absorbent article can be welded onto or adhesively joined to a portion of the topsheet and/or backsheet. In addition, as is known in the art, when cutting materials to the desired shape it is preferable to arrange the components so as to minimize waste. Examples of processes for manufacturing absorbent articles and wings include, but are not limited to those described in U.S. Pat. No. 4,059,114 to Richards; U.S. Pat. No. 4,862,574 to Hassim et al. WO1997040804 to Emenaker et al.; U.S. Pat. No. 5,342,647 to Heindel et al.; US20040040650 to Venturino et al.; and U.S. Pat. No. 7,070,672 to Alcantara et al. [0030] In order to further assist with the maintenance of the article 10 in the desired location on the undergarment, garment adhesive (not shown) may be applied to the garment facing side of the backsheet 14. The use of garment adhesive on the backsheet to help secure placement of an absorbent article on the garment is well known in the art and there are numerous adhesive patterns and releasable peel strips suitable for use with the present invention. Examples of suitable garment adhesives, patterns and release sheets include, but are not limited to, those described in DE700225U1; U.S. Pat. No. 3,881,490 to Whitehead et al.; U.S. Pat. No. 3,913,580 Ginocchio; U.S. Pat. No. 4,337,772 to Roeder et al.; GB1349962 Roeder; U.S. Pat. No. 4,556,146 to Swanson et al.; and US20070073255A1 to Thomas et al. [0031] The absorbent articles of the present invention may further include one or more components or elements as may be desired. By way of example, the absorbent article may optionally include slits, voids or embossing on the topsheet and/or absorbent core in order to improve fluid intake, fluid distribution, stiffness (bending resistance) and/or aesthetic appeal. As a specific example and in reference to FIGS. 1 and 6, embossing 17 can extend into both the topsheet 12 and absorbent core 16. Examples of additional suitable embossing patterns and methods include, but are not limited to, those are described in U.S. Pat. No. 4,781,710 Megison et al.; EP769284A1 to Mizutani et al.; US20050182374 to Zander et al.; and U.S. Pat. No. 7,686,790 to Rasmussen et al. [0032] The personal care articles can, optionally, contain one or more additional elements or components as are known and used in the art including, but not limited to, the use of fold lines, individual wrappers, elasticated flaps that extend above the plain of the topsheet in use, additional independent wings such as about the ends, odor control agents, perfumes, and the use of ink printing on one or more surfaces of the topsheet, backsheet, wings or absorbent core. Still further additional features and various constructions are known in the art. Thus, while the invention has been described in detail with respect to specific embodiments and/or examples thereof, it will be apparent to those skilled in the art that various alterations, modifications and other changes may be made to the invention without departing from the spirit and scope of the same. It is therefore intended that the claims cover or encompass all such modifications, alterations and/or changes.

Summary: An absorbent personal care article, such as a sanitary napkin or incontinence pad, having a longitudinal centerline and a transverse centerline and including a pair of opposed first and second wings extending along the longitudinal sides of the article. The first wing includes two or more peaks with furrows there between and the second wing includes one or more peaks. The peaks of the first and second wings are sized and positioned on the article such that when folded under the article and around the wearer&#39;s undergarments, the peak of the second wing extends across the longitudinal centerline of the article and into the furrow of the first wing. The inter-meshing wings help wearer&#39;s properly don the articles, improve the attachment of the article to the wearer&#39;s garment and/or reduce unwanted twisting or bunching of the article during use.

big_patent

en

Summarize: David Strettle reminded England coach Stuart Lancaster of his predatory credentials with a match-winning hat-trick that helped erase the painful memories of Saracens last Twickenham visit. The former England international, who finished last season as the Aviva Premiership’s leading English-qualified try-scorer with 11 touchdowns, was back in business again on Saturday as Mark McCall’s men made hard work of putting Dai Young’s resurgent Wasps away. His last-minute try - awarded by Television Match Official David Sainsbury but contested by Young and his Wasps charges - stole what would have been a famous victory from Wasps; who also failed to win on the opening day of last season by the narrowest of margins. Match winner: A straining David Strettle crosses for the winning try. Elusive: Christian Wade crosses for his second try. Back in it: Nathan Hughes touches down to begin Wasps' comeback. Concentration: Wasps' Joe Simpson passes the ball off the back of a scrum. Saracens have spent the summer employing a variety of methods to help support their players, including one similar to that used to treat service veterans suffering Post Traumatic Stress Disorder, following the agony of losing in both European and domestic finals. But there’s nothing like getting back on the bike. On Saturday they had Strettle to thank following a below-par performance that saw them take a 21-6 first-half lead before allowing another winger with England credentials, Christian Wade, to put Wasps within sight of victory before Strettle pounced. ‘We had drama here at the end of last season and we had drama here again today,’ said Strettle. ‘The intensity wasn’t there all the time but we got there in the end.’ The 31-year-old Strettle made the last of his 14 England appearances on tour in Argentina 15 months ago and has been overtaken in the pecking order by the likes of Marland Yarde, Jack Nowell, Jonny May, Chris Ashton and his opposite man in this game, Wade. Opener: Strettle dives over for his and Saracens' first try. Dive for the line: Chris Ashton stretches to score a try. Delighted: Strettle celebrates his opening score with Billy Vunipola and Ashton. Committed: It was a tense encounter at Twickenham between London rivals Wasps and Saracens. ‘I still have England ambitions but you should be asking Stuart Lancaster,’ Strettle added. ‘I want to be involved in the World Cup. I think I played well enough last season to be in the squad but nobody has told me what I need to do to get there.’ Wade will consider himself unlucky to have been on the losing side after producing an enormously encouraging display on his first game back since suffering a serious foot injury at the tail end of last season which cost him his place on England’s tour to New Zealand. In truth, the whole Wasps team will be kicking themselves after battling their way back from an awful first-half display to find themselves 28-20 in front when Wade touched down for his second try after 60 minutes. They only had themselves to blame in front of 66,164 at Twickenham. First, Strettle latched on to replacement Owen Farrell’s clever pass to cross in the left-hand corner. The fly-half converted to make the score 28-27. Doubling up: Strettle claims his second try during the thrilling victory over Wasps. Nice job: Andy Goode congratulates Wade on his second try. Animated: Saracens celebrate Ashton's first half score. As Wasps sensed a repeat of last season’s defeat to Harlequins on day one of the season, Young’s men seemed to suffer a case of the collective collywobbles. Flanker Ashley Johnson — outstanding up until that point — stood still before hitting a ruck close to Saracens’ line before being penalised by referee Andrew Small and allowing Saracens to clear their lines and breathe again. Centre Duncan Taylor burst through the Wasps midfield and Farrell was again on hand to feed Strettle to bounce over in the corner with Elliot Daly in close attendance. Referee Small referred the decision to the TMO and, just like last season’s final on the same ground, the decision went in the attacking team’s favour. This time, unlike their last-gasp defeat to Northampton in May, Saracens were the beneficiaries. ‘It’s important we recognised there was some hurt from last season,’ McCall said. ‘We’ve talked about the response we’ve wanted to have to the way last season ended. There’s certainly been no self-pity at our club. We’ve moved on.’ Divine intervention: Hughes points to the sky after scoring. Close call: Wade just about touches down in the corner under the eagle eyes of the line judge. Ruck: Saracens and Wasps players battle for the ball at Twickenham. Sin bin: Saracens' Kelly Brown is shown the yellow card. Young, sat disbelieving as his side blew their second London double header in succession, was left fuming at the decision to award Strettle’s third try after he’d opened his account with another contentious first-half effort which saw him make the slightest of contacts with Wasps full back Rob Miller before touching down. ‘Our first 40 minutes weren’t good enough,’ said Young. ‘We were much better in the second half but ended up committing suicide. There were two decisions which didn’t go our way. But the reason Sarries are a champion team is because they take every single opportunity they get.’ Wasps replacement prop Phil Swainston will be assessed this week after passing the newly updated 10-minute Head Injury Assessment only to suffer another head knock when he returned

Summary: Strettle crossed in the last minute after Wasps' brilliant comeback looked to have won the season opener. Chris Ashton and Strettle ran in first half tries for Saracens to give them 20-9 half-time lead. Nathan Hughes replied early in the second period for Wasps. Christian Wade's sublime double turned the match around before Strettle scored his second try to cut the lead to a single point. The England winger then came up trumps in a grandstand finish.

cnn_dailymail

en

Summarize: A fierce supermarket price war has made it possible to put a Christmas turkey with all the trimmings on the table this year for just £2.66 per person. Shopping around for the best deals among the ten biggest chains could deliver a meal that costs £21.31 for a family of eight – 53p less than last year. If you opt to go to only one outlet, then Iceland wins on cost. Their basket came in at £27.83 with Lidl second at £28.13, Morrisons third at £29.12 and Aldi costing £32.06. Scroll down for video. Christmas dinner with all the trimmings could cost as little as £2.66 a person after a fierce supermarket price war. The rise of the discount chains has dragged mainstream stores into a price war that has delivered real savings on everyday essentials, such as milk, bread and eggs. However, the battle has now been spread to the most important meal of the year and includes fresh vegetables, Christmas pudding and brandy butter. The price comparison was made by the Good Housekeeping Institute which has been monitoring prices since 2009 when the cheapest selection of ingredients came in at £3 per head, or £24. Consumer director at Good Housekeeping, Caroline Bloor, said: ‘It’s a constant struggle for many to keep family food bills under control, but the current battle between the traditional supermarkets and the discounters is pulling prices down for everyone – and will continue to do so. ‘Even at the most expensive supermarkets there are still bargains to be found, for example Waitrose’s Christmas cake is 49p cheaper than Aldi’s and the cost of potatoes and carrots is broadly the same across all retailers. ‘It’s a real time of change, and we’ll be monitoring it closely to see who’s really focused on the customer.’ This year's cheapest turkey which is big enough to feed eight can be bought at Lidl for £9.99 (picture from Lidl Christmas advert) It said the cheapest turkey that is big enough to feed eight was the frozen Braemoor self-basting bird from Lidl, which was £9.99 at the time the survey was done. The firm’s website now offers a small frozen Braemoor turkey at £8.99, which is up to 4kg, while a medium bird of up to 5.4kg is £10.99. The next biggest expense was a family size Christmas cake which came in at £3 from Iceland for a large iced fruit bar of 800g. While Iceland is known predominantly for its frozen food, it also sells the normal range of fresh produce and Christmas products. The chain is making a determined attempt to attract more middle Britain shoppers with some more upmarket special deals, such as a whole cooked lobster for just £5. The company’s Deluxe Mince Pies at £1.50 for a pack were recently named the best on the high street, even beating products costing more than eight times as much from Fortnum & Mason and Harrods. The pies were praised for being ‘generously filled with sweet, fruity mincemeat’, while the pastry was described as buttery and crumbly. Iceland's mince pies, which beat Harrods and Fortnum & Mason's efforts in a taste test, cost just £1.50. Aldi supplied the cheapest sprouts at 49p for 750g, while its carrots were best value at 49p for 1.2kg. Lidl and Aldi had the cheapest Brandy butter at £1.49 for 200g. Tesco was best for parsnips at 90p for 750g and its Everyday Value cranberry sauce was just 50p for 185g. The Co-op was best for potatoes at £1.50 for a 1.5kg bag of Maris Piper. The Sainsbury’s Basics range provided two 454g Christmas puddings for £2 and eight puff pastry mince pies at 65p for a pack of eight. The price battle for customers has also delivered savings at the quality end of the Christmas food table. The figure for Marks & Spencer is down from £51.29 to £47.04, while Waitrose is down from £53.15 to £41.05. Given the cut-throat nature of the battle for festive food sales, there is every chance that prices will change – and fall further – through special promotions in the coming weeks

Summary: Christmas dinner with all the trimmings can be bought for just £2.66 each. Shopping for the best deals could feed a family of eight for £21.31. A price war sparked by discount chains has cut total cost by 53p in a year. Iceland sell the cheapest Christmas lunch, with M&S the most expensive. Lidl's turkey is the best value for money, costing less than a tenner.

cnn_dailymail

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Alaska Native Veterans Land Allotment Equity Act''. SEC. 2. AMENDMENT TO ALLOW CERTAIN ALASKA NATIVE VETERAN LAND ALLOTMENTS. Section 41 of the Alaska Native Claims Settlement Act (43 U.S.C. 1629g) is amended as follows: (1) Paragraphs (1) and (2) of subsection (a) are amended to read as follows: ``(1) The period for filing allotments under this Act shall end 3 years after the Secretary issues final regulations under section 3 of the Alaska Native Veterans Land Allotment Equity Act. A person described in paragraph (1) or (2) of subsection (b) shall be eligible for an allotment of not more than two parcels of Federal land totaling 160 acres or less. ``(2)(A) Allotments may be selected from the following: ``(i) Vacant lands that are owned by the United States. ``(ii) Lands that have been selected or conveyed to the State of Alaska if the State voluntarily relinquishes or conveys to the United States the land for the allotment. ``(iii) Lands that have been selected or conveyed to a Native Corporation if the Native Corporation voluntarily relinquishes or conveys to the United States the land for the allotment. ``(B) A Native Corporation may select an equal amount of acres of appropriate Federal land within the State of Alaska to replace lands voluntarily relinquished or conveyed by that Native Corporation under subparagraph (A)(iii). ``(C) For security reasons, allotments may not be selected from-- ``(i) lands within the right-of-way granted for the TransAlaska Pipeline; or ``(ii) the inner or outer corridor of that right-of-way withdrawal.''. (2) Subsection (a)(3) is repealed. (3) In subsection (b)(1), strike ``A person'' and insert ``Except as provided in paragraph (3), a person''. (4) Subsection (b)(1)(B) is amended to read as follows: ``(B) is a veteran who served during the period between August 5, 1964, and May 7, 1975, including such dates.''. (5) Subsection (b)(2) is amended to read as follows: ``(2) If an individual who would otherwise have been eligible for an allotment dies before applying for the allotment, an heir on behalf of the estate of the deceased veteran may apply for and receive the allotment.''. (6) In subsection (b)(3), insert before the period the following: ``, except for an heir who applies and receives an allotment on behalf of the estate of a deceased veteran pursuant to paragraph (2)''. (7) Subsection (e) is amended to read as follows: ``(e) Regulations.--All regulations in effect immediately before the enactment of subsection (f) that were promulgated under the authority of this section shall be repealed in accordance with section 552(a)(1)(E) of the Administrative Procedure Act (5 U.S.C. 552(a)(1)(E))''. (8) Add at the end the following new subsections: ``(f) Approval of Allotments.--(1) Subject to valid existing rights, and except as otherwise provided in this subsection, not later than 2 years after the date of the enactment of the Alaska Native Veterans Land Allotment Equity Act, the Secretary shall approve an application for allotments filed in accordance with subsection (a) and issue a certificate of allotment which shall be subject to the same terms, conditions, restrictions, and protections provided for such allotments. ``(2) Upon receipt of an allotment application, but in any event not later than 6 months after receiving such application, the Secretary shall notify any person or entity having an interest in land potentially adverse to the applicant of their right to initiate a private contest or file a protest under existing Federal regulations. ``(3) Not later than 2 years after the date of the enactment of the Alaska Native Veterans Land Allotment Equity Act, the Secretary shall-- ``(A) if no contest or protest is timely filed, approve the application pursuant to paragraph (1); or ``(B) if a contest or protest is timely filed, stay the issuance of the certificate of allotment until the contest or protest has been decided. ``(g) Reselection.--A person who made an allotment selection under this section before the date of the enactment of Alaska Native Veterans Land Allotment Equity Act may withdraw that selection and reselect lands under this section if the lands originally selected were not conveyed to that person before the date of the enactment of Alaska Native Veterans Land Allotment Equity Act.''. SEC. 3. REGULATIONS. Not later than 1 year after the date of the enactment of this Act, the Secretary of the Interior shall issue final regulations to implement the amendments made by this Act.

Title: To amend the Alaska Native Claims Settlement Act to provide for equitable allotment of lands to Alaska Native veterans Summary: Alaska Native Veterans Land Allotment Equity Act - Amends provisions of the Alaska Native Claims Settlement Act (ANCSA) that allow certain Alaska Native Vietnam veterans to file for allotments of up to two parcels of federal land totaling up to 160 acres. Eliminates the requirement that limits the allotments to lands that were vacant, unappropriated, and unreserved on the date when the person eligible for the allotment first used and occupied them. Allows allotments to be selected from vacant federal lands or lands that have been selected or conveyed to the state of Alaska or a Native Corporation, if the state or Corporation voluntarily relinquishes or conveys the land to the United States for allotment. Limits the prohibition against conveying allotments to: (1) lands in the right-of-way granted for the TransAlaska Pipeline, or (2) the inner or outer corridor of that right-of-way withdrawal. Limits the eligibility for allotments to veterans who served between August 5, 1964, and May 7, 1975. Allows an heir to apply for and receive the allotment. Allows a Native Corporation to select an equal amount of acres of appropriate federal land in Alaska to replace lands voluntarily relinquished or conveyed to the United States for allotment. Permits any person who made an allotment selection under ANCSA before this Act's enactment to withdraw it and reselect lands if those originally selected were not conveyed to that person before this Act's enactment.

billsum

en

Summarize: By. Daily Mail Reporter. PUBLISHED:. 15:59 EST, 10 May 2013. |. UPDATED:. 16:08 EST, 10 May 2013. Investigators have gathered'mounting evidence' that suggest the Boston bomber brothers could have been involved in a grisly unsolved triple murder in 2011, it has emerged. Officials told ABC News that forensic evidence could tie Tamerlan and Dzhokhar Tsarnaev to the killings of Brendan Mess, Raphael Teken and Erik Weissman, who were found with their throats slit and marijuana dumped over their dead bodies in a Waltham, Massachusetts house. The Tsarnaevs knew the men as Tamerlan trained in boxing and martial arts with Brendan Mass. However, officials said more DNA testing is required before bringing an indictment against the surviving brother, Dzhokhar, who is recovering from a self-inflicted gun wound in a prison infirmary. Involved? Tamerland, left, and Dzhokhar Tsarnaev, right, could have been involved in a 2011 triple murder, investigators have said. Forensic evidence and cell phone records reportedly tie them to the scene. Following the April 15 bombings and the suspected involvement of the Tsarnaev brothers, investigators began to look into the link between Tamerlan and Mess. Authorities have now told ABC that forensic evidence from the crime scene in 2011 matches the Tsarnaev brothers. Their cell phones were also in the area at the time of the killings, records show. Victim: Tamerlan's best friend, Brendan Mess, had his throat slit in an attack in September 2011. The three men had ordered food from an Italian restaurant on the September 11, 2011, but when a delivery woman came to leave the food, no one answered the door. The next morning, one of the victim's girlfriends found their bodies. Their throats had been slit, they have been covered with marijuana and there was also $5,000 cash in the home. Initially. police said two other people had been there on the day and they were. looking to question them, although no one has ever been charged. Ray said there had been no forced entry, so police believe the killer was known the victim and was let into the apartment. Investigators at the time said the murders were 'targeted and not a random act of violence.' Middlesex District Attorney Gerard Leone issued a statement soon after the murders saying, 'based on the present state of the investigation, it is believed that the victims knew the assailant or assailants, and the attacks were not random.' Neighbors described Mess and his two roommates as quiet, nice people who were a welcome change of pace from previous residents who often had loud parties late into the evening. Murdered: Raphael Teken (left with a friend) and Erik Weissman (right) were also killed in the home. Scene: Investigators said there was no sign of forced entry so it is likely the men knew their murderers. After the deaths, friends said that. Tamerlan acted oddly - failing to attend his close friend's funeral and. dropping out of the martial arts school where they had both trained. One man who knew Tamerlan through the. gym where they trained said some of their social circle 'without even. speaking about it beforehand have all been thinking' he could be. involved. The friend, who gave his name only as Ray, told BuzzFeed Politics:. 'At the time, none of us would have thought it was Tam. It was just so. emotional and we thought we had someone else who had done it.' But since Tamerlan was identified as. the suspect in the Boston Marathon bombings that killed three and. injured 180, Ray believes his sudden disappearance after Mess's death. may be a clue. Band of brothers: Tamerlan Tsarnaev, fifth from. left, top row, poses with his team at 2010 New England Golden Gloves. Championship in Lowell, Mass. He boxed with Mess before the murders. Quiet guy: Tamerlan's (left) former coach described him as a subdued, nice young man who kept to himself. 'Tam wasn't there at the memorial. service, he wasn't at the funeral, he wasn't around at all,' Ray said. 'And he was really close with Brendan. That's why it's so weird.' Tamerlan. was killed following a gunbattle with police, a day after the FBI. released images of him and his younger brother at the Boston marathon. They. allegedly dumped two pressure cooker bombs crammed with shrapnel and. detonated them near the finish line, killing three people, including an. eight-year-old boy, and injuring 180 more. His brother, 19-year-old Dzhokhar,. was found hiding in a boat parked in a suburban yard and suffered a. self-inflicted gunshot wound to the neck. He is now recovering and has. been charged with using a weapon of mass destruction. Horror: The Tsarnaevs were allegedly behind the Boston bombings on April 15, which left three dead

Summary: Tamerlan Tsarnaev's friend Brendan Mess and two other men were found killed in September 2011 but their murderers have not been found. Now investigators said forensic evidence connects the Tsarnaev brothers to the scene and cell phone records show they were in the area. After Mess's death, Tamerlan did not go to his funeral and stopped attending the boxing and martial arts club they had attended together.

cnn_dailymail

en

Summarize: Come di consueto, una delle ricorrenze annuali della Mostra del Cinema di Venezia è l'assegnazione del Premio Bianchi, un riconoscimento indetto dal Sindacato Nazionale Giornalisti Cinematografici Italiani (Sngci), con il quale si intendono premiare i rappresentanti più significativi del cinema nostrano. Quest'anno, l'ambito premio è stato assegnato allo storico giornalista del Tg1, Vincenzo Mollica. Quando si parla di cronache di spettacolo, tra i nomi che balzano subito alla mente non può non esserci quello di Vincenzo Mollica, uno dei volti iconici del Tg1, che nella sua lunga carriera ha avuto modo di conoscere ed intervistare i più grandi interpreti della musica, del cinema e della televisione internazionale. La presidente del Sngci, Laura Delli Colli ha consegnato il premio al cronista stamane, 3 settembre 2019, dinanzi alla folla urlante dell'Hotel Excelsior, al Lido di Venezia. Una cerimonia toccante, dove il noto giornalista non si è risparmiato nel ringraziare coloro che ha sentito vicini in questo suo lungo percorso: Una dedica per Andrea Camilleri, che mi ha insegnato molto dell'arte di non vedere, i film si vedono ma si possono anche sentire. L'ultima volta ci siamo dati un abbraccio che non dimenticherò mai, ma voglio dedicarlo anche a Federico Fellini che mi ha regalato pensieri preziosi come: " l'unico vero realista è il visionario" o "non sbagliare mai i tempi di un addio o un vaff… se sbagli anche di un secondo ti si può ritorcere contro". Solo alcuni stralci di un ringraziamento lungo e sentito, di un'icona del giornalismo italiano, che nonostante le sue problematiche di salute non ha mai smesso di mostrarsi entusiasta, portavoce di un modo di fare informazione mai eccessivo, sempre pacato, ilare e fin troppo benevolo. Per indicarne questi atteggiamenti fu il critico televisivo Aldo Grasso a creare un neologismo, ovvero"mollichismo". In una recente intervista al Corriere della Sera, Vincenzo Mollica ha parlato di sé, del suo lavoro, della sua famiglia. Si è soffermato a raccontare del Morbo di Parkinson di cui è affetto, del diabete che lo accompagna da anni, ma soprattutto della sua quasi completa cecità. Un'oscurità solo fisica che, se già aveva dimezzato la sua visione del mondo sin da ragazzino, con il passare degli anni ha raggiunto la totalità del suo sguardo. Eppure, questo non gli ha impedito di continuare a parlare di spettacolo, non gli impedito di essere uno dei giornalisti più amati della Tv, uno dei più longevi in fatto di permanenza sul piccolo schermo, che ha parlato di arte e spettacolo ad intere generazioni, con il suo modo e la sua voce inconfondibili. Un amatore delle arti sceniche tanto da decantare le lodi di questo o quell'altro artista, esaltandone ogni qualità, ed è lui stesso ad apostrofarsi sulle pagine del noto quotidiano: "Omerico non fui per poesia ma per mancanza di diottria", e non si può che concordare con questa altisonante affermazione.

Summary: Ogni anno durante la Mostra Internazionale d'arte cinematografica al Lido di Venezia, viene consegnato uno dei premi più significativi indetto dal Sindacato dei giornalisti cinematografici, ovvero il Premio Bianchi. Ad incrementare la folta lista di nomi illustri che lo hanno ricevuto, si aggiunge il noto cronista del Tg1, Vincenzo Mollica. Il giornalista ha ringraziato la folla esultante e ha dedicato il riconoscimento ad Andrea Camilleri e Federico Fellini.

fanpage

it

Summarize: An angelic new picture has been released of Nehemiah Griego, the 15-year-old pastor's son who allegedly gunned down his parents and three younger siblings in Albuquerque, New Mexico on Saturday. Wearing a smart suit and pulling a slight smile for the camera, the undated photograph has been released amid claims Griego was a military obsessed loner who enjoyed playing violent video games like Modern Warfare and Grand Theft Auto. 'The suspect was involved heavily in games, violent games- and was quite excited as he got the opportunity to discuss them with our investigators,' sheriff Dan Houston said at a Tuesday press conference about the shooting. Scroll down for video. This undated photo provided by shows Nehemiah Griego who is charged with killing five family members, including his father, mother, and three youngest siblings in Albuquerque, New Mexico on Saturday. Local residents of the teenager described a lonesome boy who was always wearing camouflage fatigues and admited to police he had been plagued by suicidal and homicidal thoughts. Neighbours said they would often see Griego by himself and he appears on an online dating site called, www.meetone.com wearing military garb. His profile states, 'I'm a fun-loving guy who likes to make peope happy; I might be shy but I'll open up once you get to know me.' Investigators revealed that 15-year-old Nehemiah Griego said that he killed his relatives because 'he was frustrated with his mother.' The boy told police that he was feeling homicidal and suicidal at the time of the early morning attack on Saturday and he initially planned to drive to a local Walmart and kill more people. He also reportedly considered killing the parents of his 12-year-old girlfriend, though no further details about the confession, and they are continuing to piece together the timeline of events. Sheriff's department spokesman Aaron Williamson told MailOnline that they are still unsure of what the boy was doing between the hours of 5am- when he reportedly killed his father- to 8pm on Saturday when he drove to their local Calvary Church and told one of the churchgoers. That person then called the police. Mr Williamson said that the investigation is still ongoing but there are no active searches for any other suspects. Filling in the gaps: Sheriff Dan Houston (right) and Lt. Sid Covington (left) said that the teen has been'very unemotional' throughout his questioning and is currently being held in the local juvenile detention center. He confirmed that all of the weapons- both the.22-calibre rifle and AR-15 military assault rifle that were used to kill the relatives, and the two additional shotguns that Nehemiah had on him when he drove to the church- were all legally owned by his father, former pastor Gregory Griegos. Once taken into custody sometime after 9.15pm on Saturday, Nehemiah told police the gruesome story of how he killed his mother with a.22-caliber rifle because he was 'annoyed with' his mother, and then went on to shoot dead his three younger siblings before taking an AR-15 assault rifle and waiting for hours until his father arrived home so that he could kill him too. Nehemiah Griego is in police custody and the formal statement of probable cause tells how, after reciting several false versions of events, he eventually admitted to killing five of his family members. Lieutenant Sid Covington described Nehemiah as having a'very stern demeanor, very unemotional' throughout the interrogation. Religious: The boy's father, a former pastor, was thought to be working at a local mission at the time that his wife and three children were killed, and only returned home at around 5am when his son then allegedly shot him. The 15-year-old said that at just after midnight on Saturday he walked into his parent's bedroom where his mother and younger brother were sleeping and took the rifle from his parent's closet. He then shot his mother Sara in the head, and when his 9-year-old brother Zephania awoke and said that he did not believe that she was dead, the police report states that Nehemiah 'picked up his mother's head to show his brother her bloody face.' When Zephania began to cry, Nehemiah shot him dead too before proceeding into the room where his 5-year-old sister Jael and 2-year-old sister Angelina were sleeping. 'Nehemiah stated he lost his sense of. conscience and went to the bedroom his two younger sisters share. Nehemiah stated when he entered he noticed that his sisters were crying. and he shot both of them in the head,' the police report says. Suspected shooter: Nehemiah Griego, 15, was said to regularly wear military camouflage gear around the neighborhood. 'Quiet': Nehemiah was not registered with the school district so he was thought to be home schooled. Mr Williamson said that the working theory is that Mr Griego, 51, worked at one of the local missions, which potentially explains why he was not at home when his son allegedly started firing at around midnight. After allegedly killing his siblings and his mother, he then went back to his parent's closet and grabbed the AR-15 military-style assault rifle that they kept there and then went to wait fro his dad in the downstairs bathroom. When his father arrived at around 5am on Saturday, he waited until his dad had walked past the bathroom so that he was able to shoot him multiple times with the assault rifle. Nehemiah admitted to police that at the time of the shooting he was having homicidal and suicidal thoughts. In a chilling note, he added that there would have been more deaths, telling police that 'after killing five of his family members he reloaded the weapons so that he could drive to a populated area to murder more people.' He said that he expected that he would be killed in a firefight that would likely ensue when he tried to kill others. The timeline of events from that point on appears a little less defined as he admitted to texting a picture of his dead mother to his girlfriend. Tragedy: One of the victims of the shooting was identified as Gregory Griego, pictured center, a former pastor at the Calvary Albuquerque church. Killing: Five people were shot to death at the home in Albuquerque, New Mexico, in the Saturday night shooting. In an earlier story, he told police that he had come home to find his family had been killed, and that he drove to the church with rifles in the trunk of the van in order to protect himself from the potential attacker. In that story, he told his girlfriend about the deaths, and then her grandmother then reported it to the authorities. Nehemiah was arrested after the shooting at his family's Albuquerque home where police found the bodies and they have charged him with two counts of murder, and three counts of child abuse. resulting in death, according to the station. Each of the victims were shot multiple. times, and police found a number of weapons in the house. Nehemiah is believed to be the seventh of Pastor Griego's ten children and because he has no existing records with the county school board, they believe he was home schooled. A neighbor told local news station KRQE that Nehemiah quiet but courteous. Location: The bodies were found at a home on Long Lane Southwest in South Valley, New Mexico. 'He seemed to be a normal kid just walking up and down the road,' said neighbor Jerry Crites. 'He seemed to be a very good kid, he was fairly quiet not real rowdy that we could tell.' One of the only places that Nehemiah. left a trail is online where he lied about his age to make a dating. profile on a site called MeetOne. 'Well I'm a fun loving guy who like. [sic] to make people happy I might be shy but I'll open up once you get. to know me,' he wrote on the site. He wrote that he was 18-years-old, most likely to comply with the site's terms and conditions, and posted a photo of himself in his favorite camouflage fatigues. Family murder: The shooting took place inside the Griego home, and Nehemiah waited there for hours after killing his mother and siblings until his father arrived home from work. House of guns: The boy allegedly used his father's.22 rifle and an AR-15 semiautomatic rifle to shoot his family. Crime scene: Authorities investigate the death of Pastor Gregory Griego and family members at his home on Sunday morning. 'There's no other way to say it, except. that we have a horrific crime scene down there that we are working on,' Sheriff Dan Houston said on Sunday. 'Right. now we're to the meticulous points of processing the scene and. collecting physical evidence, and this is a vast scene with a lot of. physical evidence,' sheriff's department spokesman Sid Covington said. Though little is known about Nehemiah, his father was a recognizable figure in the community and previously served as the pastor at Calvary Albuquerque Church. After spending six years working at the Calvary Chapel in Montebllo, California, Mr Griego moved to New Mexico. Since moving to Albuquerque, he has worked in a number of different outreach capacities for the Christian church, including leading the prison outreach program and leading the group Veterans for Christ. WATCH THE VIDEOS HERE. Visit NBCNews.com for breaking news, world news, and news about the economy

Summary: Nehemiah Griego, 15, arrested and charged with shooting his relatives. Said after killing his parents and three younger siblings he'reloaded the weapons and then planned to drive to a busy place and kill more people' Planned on going to local Walmart to carry out shooting spree. Unclear if he did actually go to the store or what stopped him. Sheriff's office identifies victims as former pastor Gregory Griego, 51, his wife Sara, 40, and their three youngest children Zephania, 9, Jael, 5, and Angelina, 2. Each victim was shot multiple times and police found multiple weapons at the Albuquerque scene including a military-style assault weapon.

cnn_dailymail

en

Summarize: A little rain fell, but it hardly mattered. Queen Elizabeth II was there, after co-starring with a tuxedoed Daniel Craig, also known as James Bond, in a witty video in which she appears to parachute from a helicopter (in fact, she entered the park the usual way). Looking mystified at times — the ceremony was pitched to a generation different from hers — she presided over a bevy of lesser royals and Prime Minister David Cameron. The first lady, Michelle Obama, was in the audience to cheer on the United States athletes, who, it must be said, did a lot of cheering for themselves anyway during the athletes’ procession. And Mitt Romney, the presumptive Republican presidential nominee, was there, too, although he was practically Public Enemy No. 1 around here after he appeared to question the British capacity for enthusiasm, something only Britons are allowed to do. One of the biggest secrets of the night — who would light the Olympic caldron — was revealed at the end of the 3-hour-45-minute show, when seven teenage athletes took over from the British rower Steve Redgrave, who carried the torch into the stadium. The ceremony, conceived and directed by the filmmaker Danny Boyle, was two years in the making. As is the case almost every Olympics, much of the speculation around it centered on how Britain could possibly surpass the previous summer host, China. In 2008, Beijing used its awe-inspiring opening extravaganza to proclaim in no uncertain terms that it was here, it was rich, and the world better get used to it. But outdoing anyone else, particularly the new superpower China, was not the point for a country that can never hope to re-create the glory days of its empire. Mr. Cameron, the prime minister, said this week that London’s are “not a state-run Games — it is a people-run Games,” and Boris Johnson, the London mayor, noted sharply that Britain was not planning to “spend our defense budget” on “pyrotechnics” but would take pride in being “understated but confident.” That the Olympics come at a time of deep economic malaise, with Britain teetering on the edge of a double-dip recession, the government cutting billions of dollars from public spending, and Europe lurching from crisis to crisis, made the scene a bit surreal, even defiant in the face of so much adversity. Photo The crowd in the stadium sat in a bubble of excitement. In the wider park, volunteers have been behaving with an enthusiasm that seems bewilderingly un-British. But out in the rest of the country, critics have been questioning the expense, the ubiquitously heavy-handed security apparatus, and the rampant commercialism of the Games. In The Guardian, the columnist Marina Hyde said government officials appeared to be rashly depending on the Olympics, which cost an estimated £9.3 billion (or $14.6 billion), to save the country’s struggling economy virtually single-handedly. Advertisement Continue reading the main story Referring to a British track-and-field star, Ms. Hyde wrote that according to the government’s thinking, “Jessica Ennis winning gold is no longer merely a sporting aspiration but something that would cause a massive and immediate recalibration of the balance of payments.” Newsletter Sign Up Continue reading the main story Please verify you're not a robot by clicking the box. Invalid email address. Please re-enter. You must select a newsletter to subscribe to. Sign Up You will receive emails containing news content, updates and promotions from The New York Times. You may opt-out at any time. You agree to receive occasional updates and special offers for The New York Times's products and services. Thank you for subscribing. An error has occurred. Please try again later. View all New York Times newsletters. The final cost, or benefit, of the Games will never really be known. But for now, the fact that things went smoothly on Friday was in itself a minor cause for celebration. Mr. Boyle said he did not want to seem extravagant, particularly in a time of economic trouble, as he was given the daunting task of trying to find a way for Britain to account for itself in this difficult moment in its long history. The country has always eagerly celebrated its past: its military victories, its kings and queens, its glorious cultural and intellectual achievements. But it has a harder time celebrating its present. A quixotic exercise in self-branding, during which the then-Labour government thought to unite the country by coming up with what it called a British “statement of values,” devolved into near-farce a few years ago when the public greeted it with ridicule rather than enthusiasm. The Times of London mischievously sponsored a motto-writing contest; the winner was “No Motto Please, We’re British.” The ceremony seemed to reflect that view, too, suggesting that the thing that is most British about the British is their anarchic spirit and their ability to laugh at themselves. It is hard to imagine, for instance, the Chinese including, as the British did, a clip of the comic actor Rowan Atkinson inserted into the opening scene from “Chariots of Fire,” shoving the other runners out of the way (and ending with a rude noise paying tribute to British lavatorial humor). The ceremony, too, reflected the deeply left-leaning sensibilities of Mr. Boyle. It pointedly included trade union members among a parade of people celebrating political agitators from the past, a parade that also included suffragists, Afro-Caribbean immigrants who fought for minority rights, and the Jarrow hunger marchers, who protested against unemployment in 1936. It would not be lost on Mr. Boyle that unions have suffered in Britain in recent years, particularly at the hands of the Conservative Party, led by Mr. Cameron. But he devised the ceremony, he said, with no political interference. That proved highly irritating to at least one politician, Aiden Burley, a Conservative member of Parliament, who denounced on Twitter what he referred to as the ceremony’s “leftie multicultural” content. “The most leftie opening ceremony I have ever seen — more than Beijing, the capital of a communist state!” he posted grumpily. Who knows how the country will feel when the Olympics are over? But when the British athletes entered the stadium at the end of the procession of countries, they did so to a recording of David Bowie, a quintessential British oddity and supreme self-reinventor. “We can be heroes,” the song goes, “just for one day.” The ballsy choice of Danny Boyle to oversee the 2012 Summer Olympics opening ceremony yielded a unique take on large-canvas nation-themed spectacle that is likely to go down as one of the more eccentric and memorable kickoffs in the Games' history. TWITTER Kenneth Branagh, J.K. Rowling, Rowan Atkinson as Mr. Bean, David Beckham, Paul McCartney, Daniel Craig and Queen Elizabeth II were among the eclectic featured cast of director Danny Boyle's wild and whimsical Olympics opener. Details of the $42 million opening ceremony of the 30th Summer Olympics have been cloaked in secrecy. But it was a no-brainer that Danny Boyle – the genre-hopping director who was a key figure in the Cool Britannia wave of 1990s cultural reinvigoration with his first films Shallow Grave and Trainspotting – was never going to settle for standard-issue pomp and pageantry. If Zhang Yimou’s dazzling Beijing opening in 2008 was about automaton-like synchronicity and majestic spectacle, Boyle’s epic opera of social and cultural history was a vibrant work of unfettered imagination that celebrated a nation, but even more so, its people. PHOTOS: London 2012: Inside the Olympics Opening Ceremonies The three-hour ceremony was the brainchild of Boyle, with the creative consultancy of Stephen Daldry, two Brit directors who have successfully straddled film and theater. And that twin embrace of fluid cinematic visuals with magical stagecraft was evident above all in the sensational first hour. If the meaning behind some of the imagery was occasionally baffling and the focal points too numerous to absorb in a single television sitting, the overall impact was that of a mesmerizing ADHD banquet. The key note of any Olympics opener is a celebratory one, but Boyle injected playful irreverence, unexpected humor and even darkness. From the puffy fake clouds suspended over the arena, acknowledging the U.K.’s infamy as lousy-weather capital of the planet, to the mischievous inclusion of the Sex Pistols’ doing “God Save the Queen” in the filmed intro, whimsy played more of a part in the proceedings than solemn sense of occasion. STORY: London 2012: Star-Studded Danny Boyle Opening Ceremony Kicks Off Olympics The biggest surprise was an actual acting cameo from Queen Elizabeth II herself. A real sport, she greeted a tuxedo-clad Daniel Craig as he marched up the corridors of Buckingham Palace trailed by the monarch’s pet corgis: “Good evening, Mr. Bond.” A sly switch with a body double followed as they boarded a chopper, with “H.M.” dropped into the Stadium on a Union Jack parachute to the 007 theme music. Genius. But by far the most striking work was the brilliantly conceptualized live opening, broken into three parts labeled The Green and Pleasant Land, Pandemonium and Frankie and June Say Thanks to Tim. The three parts were cast with a multiethnic crowd heavier on Joe Public volunteers than rigorously drilled professional performers. Before the kickoff, farm animals milled in pens on the grassy fields of a village green, as agricultural workers tended their veggie patches, a waterwheel slowly turned, maypole dancers twirled and cricketers in period uniforms played a gentlemanly match. Dominating the visual field was a replica of Glastonbury Hill. Its grassy slopes – dotted with dandelions and daisies – evoked the British pastoral tradition with a simplicity that grew even more beautiful as the show progressed and the hill became home to the flags of the 204 participating countries. While different songs represented the various regions in this segment, a lone boy soprano singing William Blake’s verses to “Jerusalem” set the serene tone. Boyle then turned somber with the arrival of the Industrial Revolution, heralded by Kenneth Branagh in top coat and tall hat, playing pioneering British civil and mechanical engineer Isambard Kingdom Brunel. Accompanied by dozens of drummers, Branagh read the “Be not afeard; the isle is full of noises” speech from Shakespeare’s The Tempest, which was the inspiration for Boyle’s Isles of Wonder title and the show’s incorporation of dreams as a central element. STORY: London 2012: Organizers Hope to Sell $1.55 Billion in Olympics Merchandise As the farmers and villagers rolled up the turf, the scene made way for towering smokestacks that sprouted from the ground as the arena filled with factory workers, suffragettes, war veterans and – incongruously – a troop of Sgt. Pepper figures in brightly colored satin military jackets. Thematic cohesion wasn’t always a strong point but with so much to amuse the eye, who’s complaining? Blacksmiths toiled away at their furnaces to forge the Olympic rings, which were then hoisted above the stadium, raining down a shower of sparks in one of the show’s more awe-inspiring moments. This nod to paradise lost was one of Boyle’s boldest strokes, illustrating that Brit patriotism has an infinitely greater variety of shadings than the rah-rah American equivalent. An extended tribute followed to – wait for it – the U.K.’s National Health Service. Mike Oldfield played “Tubular Bells,” while what looked like hundreds of volunteer nurses and medical professionals took on dance duty. The segment effectively tapped into Britain’s rich tradition of children’s literature via a celebration of Great Ormond Street Hospital, which was largely financed by royalties from J.M. Barrie’s Peter Pan (an excerpt from which was read by J.K. Rowling). The naysayers in the divisive U.S. debate over universal healthcare might want to spend a moment contemplating the heartfelt pride that obviously went into this segment. PHOTOS: Olympic Gods and Goddesses: Behind the Scenes With 4 Former Olympians As kids were tucked up under illuminated duvets, their bedtime reading conjured villains from Cruella de Vil to Captain Hook to the Queen of Hearts to Voldemort, all of them eventually banished by a flock of Mary Poppinses swooping in under flying umbrellas. In amongst all this was a nod to the British film industry and its depiction of sports. The iconic Vangelis theme from Chariots of Fire was led by Rowan Atkinson in Mr. Bean guise, hammering away at a single synthesizer note while dreaming of his own athletic glory. This managed simultaneously to provide a daffy centerpiece while acknowledging the vital role of British humor in the popular culture – fart joke included. The final part of this opening trilogy will no doubt be the most discussed, and while enjoyably messy, it was perhaps the least suited to stadium/television presentation. Basically a story of an average family in an average house, it evolved into a romance between two teens out on a Saturday night, Frankie and June. Their blossoming love served to illustrate the growing impact of social media in a bow to British web inventor Tim Berners-Lee. Projections on the house were a wonderful sampling of TV through the decades. PHOTOS: Going for Gold: 10 Medal-Worthy Olympics Movies While the storytelling wasn’t as lucid here as elsewhere, the music was a blast. Music supervisors for the event were Karl Hyde and Rick Smith of electronica outfit Underworld, who have had a long association with Boyle spanning from Trainspotting through his acclaimed National Theatre reimagining of Frankenstein last year. Among the pearls of the evening, galvanizing use was made of The Clash’s “London Calling” and The Jam’s “Going Underground.” But the Frankie and June chapter also served as a decade-by-decade salute to the British music industry that will no doubt cause a stampede on iTunes. From The Who and The Rolling Stones through The Kinks and The Beatles and then on into the glam-rock years with Mud, David Bowie and Queen, the choices were terrific. The Specials popped up, as did more Pistols as we moved into the punk era (what other country in the world would have the self-irony to include “Pretty Vacant” on its Olympics soundtrack?). Then came New Order, Frankie Goes to Hollywood, Soul To Soul, The Eurythmics, The Prodigy and Amy Winehouse. Bliss. There were plenty of glaring omissions of course: No Tears for Fears or Duran Duran from the ‘80s? No Blur or Oasis in the ‘90s bracket? No George Michael or Elton John or Kate Bush? And no Dusty Springfield??!! Are you kidding me? But personal gripes aside, the musical accompaniment that threaded the invention of the steam engine through to the arrival of the World Wide Web was tremendous. The more pedestrian elements included a tribute to the fallen, with a somewhat stale modern-dance routine to “Abide With Me.” And the Parade of Nations is a format too set-in-stone to play with, though there was some fun to be had with the bizarrely random juxtaposition of national teams with odd musical choices – China with the Pet Shop Boys? Poland with Fleetwood Mac? Fiji with The Bee Gees might have been someone’s attempt at a haiku. On a side note: What’s with those tacky gold-trimmed white tracksuits on the Brit team? And watching athletes endlessly texting, tweeting and taking photographs on their smart phones did make me wonder if they weren't somehow separating themselves from the actual experience of being there. The lighting of the torch was preceded by an appearance from The Arctic Monkeys, one of the better live musical elements, doing “I Bet You Look Good on the Dancefloor” (why not?) and a cover of “Come Together.” This served as backup to the stunning image of a squad of cyclists wearing illuminated wings to represent the doves at the early Olympics in Ancient Greece. The much ballyhooed Paul McCartney closing slot was a rousing singalong to “Hey Jude,” which added some sentimental value but was otherwise fairly standard Superbowl halftime stuff. PHOTOS: Going for Gold: Portraits of Famous Former Olympians The concluding fireworks (backed by Pink Floyd’s “Eclipse”) were, for once, truly spectacular, making the Macy’s July 4th show look like a bunch of kids with sparklers. One of the big secrets of the event was who would light the torch, which traveled its climactic leg up the Thames on a speedboat piloted by David Beckham. (Only the addition of a pouting Victoria could have made this more sublime.) Don’t read on if you haven’t yet watched the U.S. broadcast. But in a moving choice, rather than a single figure to light the torch, a group of young athletes in line for the next Olympics was chosen, pushing the “Inspire a Generation” theme. Each nation’s copper petal was lit before they came together to form a gorgeous fire flower on elevated stems. There’s been much talk about the collective gloom in Britain over the past year, with the economy in the toilet, crippling austerity measures being imposed, a hacking scandal exposing deep-rooted media corruption and a crisis of political faith. It was no doubt a well-considered choice to cut Britain’s captains of government out of the picture, with the exception of a cheesy CGI-animated Winston Churchill statue in the opening film. In an interview during planning, Boyle had said, “This is for everyone,” and in that sense, the show will likely be received at home as a welcome tonic. In his wild, wacky and often hilarious Games kickoff, Boyle kept his promise, delivering something unique that acknowledged the nation’s people and its innovative creative spirit more than its leaders or its past as a grand empire. The director’s stock got a major boost when he won an Oscar for Slumdog Millionaire, but this audacious show should bump it even higher. Danny Boyle has just made the biggest, maddest, weirdest, most heartfelt and lovable dream sequence in British cinema history. Heaven knows, hopes were not high after our sheepish "handover" performance in Beijing in 2008; we thought we would never match the Chinese and many of us were getting ready to excuse the anticipated cockups and catastrophes as proof of our supposedly superior democratic tolerance. But Boyle's opening ceremony was the equal of Beijing and more. He had the spectacle – chiefly, an inspired vision of the five Olympic rings being forged by the workers of the industrial revolution. But he also had jokes and laughs; he had narrative, of a cheerfully loopy kind, with some anarchic fun, and cheeky comic turns from Daniel Craig, Rowan Atkinson and the Queen. Sometimes it looked like a 21st-century version of an Elizabethan pageant. Sometimes it looked like a seaside summer special on amyl nitrate. But it always looked great. The Olympic opening ceremony is a very cinematic tradition. As a genre, it was pretty much invented by Leni Riefenstahl for the 1936 Berlin Games, and then given a dose of Hollywood razzmatazz for LA in 1984, with choreography inspired by the song 'n' dance routines that kick off the Academy Award ceremony. Both these influences are very serious. Boyle corrected this, and gave the ceremony two things I never believed could co-exist in a sports arena: a sense of humour and a sense of wonder. To begin with, his guiding force seemed to be Terry Gilliam, or maybe Peter Jackson. A surreal vision of bucolic Britain unfolded in a Teletubby-shire. Then Sir Kenneth Branagh came on as a glamorous Isambard Kingdom Brunel, declaimed Caliban's "isle is full of noises" speech from The Tempest with a positive spin on the word "dream". And the industrial revolution swept everything away. The hyperreal greensward vanished, as if by magic, and the 19th century arrived, giving way bizarrely but entertainingly to Sgt Pepper's Lonely Hearts Club band. There was a glorious tribute to the NHS, whose care and attention to child patients was elided sentimentally but persuasively with the glories of great children's literature and its scary villains. JK Rowling made a stylish appearance. But the evening took off like a rocket with a romantic fantasia, riffing on the eternal Saturday night, social media, boy meets girl. The director shyly gave us an allusion to his own film Trainspotting, along with flashes of Bill Forsyth's Gregory's Girl and Ken Loach's Kes – and many more. It didn't make a bit of sense, but what a thrilling spectacle and what fun. This could be Danny Boyle's 3D multimedia masterpiece.

Summary: After Zhang Yimou's spectacular cast of thousands opened the 2008 Beijing Olympics, the pressure was on London to have an opening ceremony at least as memorable. And after seeing Oscar-winning Danny Boyle's $42 million spectacle, the verdict is... well, weird. But entertaining: The Hollywood Reporter calls Boyle a "ballsy" choice, saying his opening was "a unique take on large-canvas nation-themed spectacle that is likely to go down as one of the more eccentric and memorable kickoffs in the Games' history." The New York Times said the opening was "a wild jumble of the celebratory and the fanciful" that presented Britain as "a nation secure in its own post-empire identity, whatever that actually is." Five stars from the Guardian. "It didn't make a bit of sense, but what a thrilling spectacle and what fun." At least one Brit wasn't impressed, though. Conservative MP Aidan Burley tweeted the show was "leftie multi-cultural crap." He quickly apologized, saying he had been "misunderstood," writes Sky News.

multi_news

en

Write a title and summarize: Aging is a multifactorial process that includes the lifelong accumulation of molecular damage, leading to age-related frailty, disability and disease, and eventually death. In this study, we report evidence of a significant correlation between the number of genes encoding the immunomodulatory CD33-related sialic acid-binding immunoglobulin-like receptors (CD33rSiglecs) and maximum lifespan in mammals. In keeping with this, we show that mice lacking Siglec-E, the main member of the CD33rSiglec family, exhibit reduced survival. Removal of Siglec-E causes the development of exaggerated signs of aging at the molecular, structural, and cognitive level. We found that accelerated aging was related both to an unbalanced ROS metabolism, and to a secondary impairment in detoxification of reactive molecules, ultimately leading to increased damage to cellular DNA, proteins, and lipids. Taken together, our data suggest that CD33rSiglecs co-evolved in mammals to achieve a better management of oxidative stress during inflammation, which in turn reduces molecular damage and extends lifespan. Aging is controlled partly by genetic factors, such as insulin/IGF-1, mTOR, AMPK, and Sirtuin signaling pathways (Lopez-Otin et al., 2013). Another important element affecting aging is thought to be cumulative damage to macromolecules by reactive oxygen and nitrogen species (ROS/RNS) induced by unbalanced cellular inflammatory responses, or generated via mitochondrial dysfunction (Berlett and Stadtman, 1997; Dizdaroglu et al., 2002). A large proportion of reactive oxygen species (ROS) formed in vivo is derived from the electron transport chain in mitochondria during cellular respiration. Additionally, ROS are generated in blood and tissue phagocytes upon release of superoxide radicals by NADPH oxidase in response to pathogens (Finkel and Holbrook, 2000). ROS can also be rapidly induced from resident local cells and recruited leukocytes upon tissue injury. Evolution towards an optimal trade-off between protective and damaging ROS levels in organisms includes the introduction of a number of enzymatic and non-enzymatic anti-oxidant mechanisms to maintain homeostasis and mitigate damage. Accordingly, comparative studies have shown association between the longevity of a species and the capacity of cells in its individuals to resist oxidative stress (Kapahi et al., 1999; Andziak et al., 2006; Brown and Stuart, 2007). Understanding the finer details of this regulatory process might also provide access to measures for alleviating and controlling conditions associated with aging, a pressing medical challenge in a society with increasing lifespan. In this study, we sought to determine whether the CD33rSiglecs impact aging and influence lifespan in mammals. Siglecs are mainly expressed by cells of the immune system and bind broadly to sialylated structures of the same cell or of neighboring cells through their extracellular domain (Crocker et al., 2007). Two classes of Siglecs are defined based on sequence homology and conservation. The first group (Sialoadhesin/Siglec-1, CD22/Siglec-2, MAG/Siglec-4 and Siglec-15) share low sequence identity but are conserved across mammals. In contrast, the genes encoding CD33rSiglecs underwent extensive rearrangements, including duplication, conversion, and pseudogenization, and therefore vary in number and in sequence between different mammal species (Cao and Crocker, 2011; Padler-Karavani et al., 2014; Schwarz et al., 2015). For instance, mice and humans (the two best studied organisms in this respect) express five and ten functional CD33rSiglecs, respectively (Angata et al., 2004). CD33rSiglecs in humans are numbered (e. g., Siglecs-3, -5, -6, -7, -8, -9, -10, -11, -XII, -14 and -16), while murine CD33rSiglecs (other than Siglec-3) are identified by a distinct alphabetical nomenclature (Crocker et al., 2007; Macauley et al., 2014). Although information regarding Siglec expression patterns is not comprehensive, it is known that many members are expressed in a cell type-specific manner. For instance, among the murine CD33rSiglecs, CD33 is expressed mainly in granulocytes, Siglec-E is expressed primarily in neutrophils, monocytes, microglia, and dendritic cells, Siglec-F is mainly found in eosinophils and mast cells, Siglec-G is predominantly expressed in B cells and some dendritic cells, and Siglec-H is primarily expressed in plasmacytoid dendritic cells (Pillai et al., 2012). Although it is not possible to identify clear CD33rSiglec orthologs between human and murine Siglecs, due to rapid Siglec evolution and deep divergence time between mice and humans, some Siglec receptors (for instance, Siglec-E and Siglec-9) are considered to be functional homologs (Läubli et al., 2014). Notably, there is no evidence so far for a significant degree of functional redundancy among Siglecs. Despite the general low affinity of Siglecs towards the sialylated structures, it appears that each Siglec has unique sialoglycan specificity profile with regard to the type of sialic acid, its linkage and the composition of underlying glycan structure. Interestingly, CD33rSiglecs can transmit inhibitory signals into immune cells by phosphorylation of intracellular ITIM or ITIM-like domains, thus quenching pro-inflammatory cascades (Crocker et al., 2007). Recently, it has been shown that Siglecs can directly control Toll-like receptor (TLR) signaling by sustaining sialic acid-dependent interactions with TLRs and CD14 (Chen et al., 2014; Ishida et al., 2014). As the development of chronic inflammation is one of the hallmarks of aging (Franceschi et al., 2005), we investigated whether the number of CD33rSiglecs has co-evolved to modulate the aging process. We asked if the number of CD33rSIGLEC genes correlates with the maximum lifespan in mammalian species and found there was indeed a strong link, which was maintained after correction for phylogenetic or body mass constraints. We then tested if deletion of Siglec-E impacts longevity in mice. Indeed, Siglec-E-deficient mice exhibited accelerated signs of aging compared to littermate controls. We detected an increased rate of oxidative damage to cellular macromolecules at the systemic level, which we found to be related to a disrupted ROS homeostasis and early signs of aging. Finally, we tested the absence of Siglec-E in survival studies and found that these mice had significantly reduced longevity. Our combined data indicate that CD33rSiglecs regulate inflammatory damage and that the expansion of their number in the genome has coevolved with the extension of lifespan in mammals. The evolutionary theory of germ line and disposable soma predicts that long-lived species assure their longevity through investments in more resilient somatic tissues (Moore et al., 1991; Kirkwood, 1992). It follows then that genes involved in management of cellular stress and repair of damage contribute to lifespan. Indeed, it has been experimentally shown that lifespan of eight mammalian species correlates to the ability of their primary fibroblasts to cope with stress (Kapahi et al., 1999). As Siglecs are capable of modulating cellular inflammatory responses and the number of genes encoding CD33rSiglecs varies widely between species (Angata et al., 2004), we asked if CD33rSIGLEC gene number correlates with maximum lifespan in mammals. A positive correlation was observed between these two parameters in the 14 mammalian species tested (R2 = 0. 7630) (Figure 1A, Figure 1—figure supplements 1,2). As the genes encoding CD33rSiglecs are mainly found in a single syntenic cluster in each species, we considered the possibility that the observed correlation could be due to factors associated with the chromosomal environment surrounding these genes or due to hitchhiking effects with adjacent genes. We therefore examined the Kallikrein-related peptidase (KLK) gene cluster, which is located in the chromosomal region immediately adjacent to CD33rSIGLECs in most of the 14 species. Strikingly, the number of KLK genes showed a poor correlation with mammalian lifespan (R2 = 0. 1825) (Figure 1B). Next, we tested if the observed correlation of CD33rSIGLEC/maximum lifespan was due to a general expansion of genes encoding for cell surface receptors that interact with pathogens to initiate immune responses. Therefore, we examined Toll-like receptor (TLR) genes, which play important roles in innate recognition of PAMPs and DAMPs (Janeway and Medzhitov, 2002; Beutler, 2009), and genes for IgG Fc gamma receptors, which bind the Fc region of IgG to regulate immune responses (Nimmerjahn and Ravetch, 2008). Predicted gene numbers for both families showed only marginal association with maximum lifespan (Figure 1C, D). 10. 7554/eLife. 06184. 003Figure 1. Correlation between gene numbers in gene families and maximum lifespan in mammals. Numbers of CD33rSiglecs (A), KLK (B), IgG Fc receptors (C), and TLRs genes (D) and maximum lifespan in 14 mammalian species listed in Figure 1—figure supplement 1. (E and F) Correlation of CD33rSIGLECs and maximum lifespan after correction for average adult body weight and phylogeny. PGLS: λ = 1, phylogenetic tree I (E) or tree II (F) were used. The Pearson' s correlation coefficient (R2) for each plot is indicated. DOI: http: //dx. doi. org/10. 7554/eLife. 06184. 00310. 7554/eLife. 06184. 004Figure 1—figure supplement 1. Data of 14 mammalian species used for analysis of correlation. Maximum lifespan and average adult body weight were retrieved from the AnAge database. The number of genes of each family was either found in the literature or searched following the methodology described in the ‘Materials and methods’. DOI: http: //dx. doi. org/10. 7554/eLife. 06184. 00410. 7554/eLife. 06184. 005Figure 1—figure supplement 2. Correlation between number of genes of each family and maximum lifespan. Data are shown in a linear scale, whereas are presented in a logarithmic scale in Figure 1 for statistical reasons. The correlation coefficient (R2) is indicated for each plot. DOI: http: //dx. doi. org/10. 7554/eLife. 06184. 00510. 7554/eLife. 06184. 006Figure 1—figure supplement 3. Phylogeny and tree branch information. Phylogeny and tree branch information used in this study were obtained from Prasad et al. (2008) and trimmed by Archaeopteryx 0. 957 (Zmasek and Eddy, 2001; Han and Zmasek, 2009) down to the same 14 species. The topology is also indicated in the Newick tree format. DOI: http: //dx. doi. org/10. 7554/eLife. 06184. 006 Since closely related species may also share similar traits simply due to their common ancestry, data from different species may not be statistically independent. To control for such effects, we used phylogenetic comparative analysis using Phylogeny Generalized Least-Squares (PGLS) or Felsenstein' s Independent Contrast (FIC) approaches. The correlation between CD33rSiglecs and longevity remained very strong after such phylogenetic correction (Table 1 and Figure 1—figure supplement 3). Moreover, the correlation was maintained after mathematical correction for body mass represented by average adult body weight (Table 2), another factor known to correlate with metabolic rate and lifespan (Manini, 2010). Overall, a positive correlation was shown between the residual maximum lifespan and residual CD33rSIGLEC gene numbers (controlling for both body mass and phylogeny) (Figure 1E, F). Since the time that these data were originally collected and evaluated, additional genome sequences have become available. Therefore, in order to further test the strength of the correlation, we included the data from three short-lived primate genomes (Saimiri boliviensis, Tarsius syrichta, and Otolemur garnettii). Interestingly, these genomes were found to have fewer CD33rSIGLEC genes (5,5, and 4 genes, respectively). Addition of these data to the primary correlation did not change the statistical significance of the association between number of CD33rSIGLEC genes and maximum longevity (R2 = 0. 661 in logarithmic scale, R2 = 0. 752 in linear scale). Furthermore, based on the different sample size of different species tested, an adjusted value of maximum longevity of 90 years for humans was considered, in line with previous studies (Lorenzini et al., 2005). Notably, the overall correlation between number of CD33rSIGLEC genes and maximum longevity remained strong (R2 = 0. 649 in the logarithmic scale, R2 = 0. 843 in the linear scale). 10. 7554/eLife. 06184. 007Table 1. Statistical analysis of the correlation between number of genes and maximum lifespan, corrected for phylogenyDOI: http: //dx. doi. org/10. 7554/eLife. 06184. 007Gene familyPGLSFICTree I CD33rSIGLECs0. 000160. 00012 KLKs0. 490. 17 TLRs0. 380. 10 IgG Fc receptors0. 350. 0016Tree II CD33rSIGLECs0. 000170. 00011 KLKs0. 650. 23 TLRs0. 320. 14 IgG Fc receptors0. 390. 0019Phylogenetic comparative analysis was conducted in COMPARE 4. 6b using Phylogeny Generalized Least-Squares (PGLS) or Felsenstein' s Independent Contrast (FIC) approaches. Student' s t-values were computed based on the regression slopes and the standard errors. Two-tailed probability (p) value of a Student' s t-test was estimated using a degree of freedom of 11. The phylogenetic relationship of 14 mammalian species represented by Tree I and Tree II are indicated in Figure 1—figure supplement 3. Note that although FIC analysis obtained a significant p value for IgG Fc receptor gene family, the p value increased to 0. 56 when human data was excluded. Thus, this correlation is driven by one outlier data point. 10. 7554/eLife. 06184. 008Table 2. Statistical analysis of the correlation between number of genes and maximum lifespan, corrected for body weightDOI: http: //dx. doi. org/10. 7554/eLife. 06184. 008Gene familyt valuep valueTree I CD33rSIGLECs3. 5214350. 004786 KLKs0. 3606010. 725226 TLRs−0. 7018220. 497370 IgG Fc receptors1. 6565190. 125834Tree II CD33rSIGLECs3. 6609170. 003748 KLKs0. 1802270. 860251 TLRs−0. 7264650. 482726 IgG Fc receptors1. 5895860. 140235Phylogenetic comparative analysis conducted in CAIC package. Average adult body weight and maximum lifespan of 14 mammalian species were log-transformed and phylogenetic regressions were run using pglmEstLambda in the CAIC package in R. This function uses the PGLS method and estimates λ with the average adult body weight controlled for. Student' s t-values and two-tailed probability (p) values are shown. The phylogenetic relationship of 14 mammalian species represented by Tree I and Tree II are indicated in Figure 1—figure supplement 3. Taken together, these data indicate that the number of CD33rSIGLEC genes correlates to lifespan in mammals. This correlation appears to be independent from phylogenetic constraints, from effects of genomic location, from a generally observed rapid evolution of receptors involved in immune responses and from body mass. We decided to use a mouse model to seek experimental evidence for the observed correlation, as mice have a simplified CD33rSiglec profile compared to other mammalian model systems, in terms of number of genes and expression patterns. In fact, mice possess five CD33rSiglecs (namely, CD33, Siglec-E, -F, -G, -H). Among these, Siglec-E is the dominant receptor and it is strongly expressed on neutrophils, tissue macrophages (Figure 2—figure supplement 1), and microglia (Zhang et al., 2004; Claude et al., 2013). We monitored the survival of mice lacking Siglec-E (Siglec-E−/−) over the course of 100 weeks in comparison to their control wild type littermates (WT) (Figure 2A). The survival study was carried out in two sequential cohorts totaling 117 WT and 120 Siglec-E−/− mice. Overall survival of the Siglec-E−/− males was markedly reduced compared to WT (48% and 70% remaining, respectively, when the experiment was terminated). Similarly, relative to the WT, the median survival of Siglec-E−/− females decreased by 17%. In an attempt to mimic natural conditions of early exposure to inflammatory insults, we exposed all groups of mice to a non-specific antigenic challenge early in life (heterologous cell membranes mixed with Freund' s adjuvant). This treatment did not affect the viability of Siglec-E−/− mice over 100 weeks (Figure 2—figure supplement 2). No differences in general appearance or body weight were noted and no signs of specific pathologies were observed during the study (Figure 2—figure supplement 3). Hematological and biochemical analysis of blood samples at periodic intervals and at termination of the study did not reveal significant differences between the two groups (Figure 2—figure supplement 4). Additionally, there was no evidence indicative of systemic chronic disease, such as increased leukocyte counts, microcytic anemia, or hypoalbuminemia. Serum creatinine levels did not suggest diminished renal function. Higher values of alanine aminotransferase were noted for Siglec-E−/− animals but were not statistically different from the controls. Similarly, systematic histological analysis of multiple organs showed no evidence of pathological abnormalities, though we observed sporadic instances of periportal liver inflammation, and a slight increase in lung inflammation compared to control mice (Figure 2—figure supplement 5). Examination of kidneys showed that more of the Siglec-E−/− mice exhibited minor age-related glomerular changes, with thickening of glomerular tufts, visible on Periodic-Acid Schiff stains. These data were in line with previous work on the same mice at a younger age (McMillan et al., 2013). 10. 7554/eLife. 06184. 009Figure 2. Absence of immunomodulatory Siglec-E aggravates aging phenotypes and reduces lifespan in mice. (A) Survival curves of WT and Siglec-E−/− male (n = 59–62) and female (n = 58–59) littermates. Data are from two independent cohorts (cohort 1 included 31 WT and 38 Siglec-E−/− males, 31 WT and 33 Siglec-E−/− females. Cohort 2 included 28 WT and 23 Siglec-E−/− males, 27 WT and 26 Siglec-E−/− females). Log-rank test analysis showed significant differences in the survival curves both in males and females (males: χ2 = 5. 833, d. f. = 1 and p = 0. 0157; females: χ2 = 8. 821, d. f. = 1 and p = 0. 0030). (B and C) Mice at 80 weeks were assessed for spatial learning and memory via Barnes maze. Latency to escape (B) and number of errors before finding the escape box (C) are indicated in 3-day interval. Error bars reflect mean ± s. e. m. (n = 11). p was calculated with a Student' s t test. (D) Hair graying of males was evaluated by three independent observers in a blind test. Average rank scores for each mouse are indicated. Error bars reflect mean ± s. e. m. (n = 9–11). p was calculated with a Student' s t test. (E) Surviving mice were sacrificed at 100 weeks of age. Representative field of β-galactosidase staining of liver. Arrows indicate cells with increased localized staining. Scale bar is 100 μm. (F) Skin epidermal thickness was measured for WT and Siglec-E−/−. Mean and s. e. m. are indicated, n = 12, p was calculated with a Student' s t test. DOI: http: //dx. doi. org/10. 7554/eLife. 06184. 00910. 7554/eLife. 06184. 010Figure 2—figure supplement 1. Expression of Siglec-E in mouse tissues. Sections of frozen organs from WT and Siglec-E−/− animals were stained with anti-Siglec-E antibodies. Siglec-E is expressed in splenocytes and in tissue macrophages in liver, heart, and kidney. DOI: http: //dx. doi. org/10. 7554/eLife. 06184. 01010. 7554/eLife. 06184. 011Figure 2—figure supplement 2. Exposure to human red blood cell membranes does not impact survival of Siglec-E−/− mice. Survival curves of mice intraperitoneally (IP) injected with human red blood cell membranes and Freund' s adjuvant (ADJ + HRBC). Controls mice were injected with adjuvant and PBS (ADJ + PBS) or PBS only. There are no significant differences between groups. Log-rank (Mantel–Cox) test: Chi square = 1. 310, df = 3, p = 0. 7268. Gehan-Breslow-Wilcoxon test: Chi square = 0. 6019, df = 3, p = 0. 8960. DOI: http: //dx. doi. org/10. 7554/eLife. 06184. 01110. 7554/eLife. 06184. 012Figure 2—figure supplement 3. Deletion of Siglec-E does not alter body weight increase. Weights of mice were recorded for mice from the two cohorts characterized in this study. Indicated are mean ± sem, * indicates p < 0. 05. DOI: http: //dx. doi. org/10. 7554/eLife. 06184. 01210. 7554/eLife. 06184. 013Figure 2—figure supplement 4. Hematology and serum chemistry values of male mice at the termination of the study. DOI: http: //dx. doi. org/10. 7554/eLife. 06184. 01310. 7554/eLife. 06184. 014Figure 2—figure supplement 5. Absence of Siglec-E is associated with overall increased inflammation in liver and lung. Paraffin sections of liver or lungs from WT and Siglec-E−/− animals were analyzed for inflammation using anti-CD45 immunohistochemistry and demonstrate many more areas with accumulation of inflammatory cells in Siglec-E−/− age mice. DOI: http: //dx. doi. org/10. 7554/eLife. 06184. 01410. 7554/eLife. 06184. 015Figure 2—figure supplement 6. Deletion of Siglec-E does not affect locomotor activity. WT and Siglec-E−/− mice show habituation of activity (a significant decrease) across the 2 hr test in the activity chamber. There are no differences between the groups. Indicated are mean ± sem, * indicates p < 0. 05, n = 7–11. DOI: http: //dx. doi. org/10. 7554/eLife. 06184. 015 We submitted the mice to a series of analyses to test if Siglec-E−/− animals exhibited exacerbated age-related defects. First, 80-week-old Siglec-E−/− mice showed a threefold increase in error rate in the Barnes maze test compared to controls (Figure 2B, C). These results are consistent with previous reports of impairments in learning and in spatial memory in aged mice (Kennard and Woodruff-Pak, 2011). Deficits in the Barnes maze were not due to alterations in locomotor activity (Figure 2—figure supplement 6). Secondly, a blind test involving three independent observers noted increased hair graying in Siglec-E−/− males compared to WT (Figure 2D). Hair graying is related to incomplete maintenance of melanocyte stem cells through loss of the differentiated progeny that occurs physiologically during aging (Nishimura et al., 2005). After termination of the survival study, immunohistochemistry of liver tissues revealed an increased frequency of focal expression of beta-galactosidase, a marker of senescent cells (Figure 2E). Moreover, examination of the epidermis revealed a 50% reduction in thickness in animals lacking Siglec-E (Figure 2F). Epidermis tends to thin with increasing age through mechanisms that possibly involve senescent cells (Lopez-Otin et al., 2013). Collectively, these data indicate that deletion of Siglec-E results in a faster progression of aging and, consequently, to increased frailty leading to an earlier death. Siglec-E regulates inflammatory states upon acute stress (McMillan et al., 2013; Chang et al., 2014). We speculated that aging might act as a chronic stimulus and investigated whether Siglec-E−/− mice exhibited low-grade signs of inflammation. As noted above, some organs showed accumulation of inflammatory cells (Figure 2—figure supplement 5). Inflammation was not due to anti-nuclear antibodies, which are typical of some autoimmune diseases but were undetectable in the sera of Siglec-E−/− and WT mice. To gain mechanistic insights, we analyzed the role of Siglec-E on the management of oxidative stress in innate immune cells. Primary bone marrow neutrophils from Siglec-E−/− mice were more prone to produce oxidative burst upon stimulation, compared to controls (Figure 3A and Figure 3—figure supplement 1). Additionally, neutrophils lacking Siglec-E secreted higher ROS per cell (Figure 3B). Similarly, thioglycollate-recruited peritoneal neutrophils showed a 10% increase in ROS (Figure 3—figure supplement 2), corroborating the notion that Siglec-E controls oxidative stress and that the elimination of CD33rSiglec receptors leads to disordered ROS. These observations were also in line with what was shown with a microglial cell line (Claude et al., 2013). 10. 7554/eLife. 06184. 016Figure 3. Altered ROS homeostasis in mice lacking Siglec-E. (A) Neutrophils purified from bone marrow were incubated with immunocomplexes. Cells producing vacuolar ROS were measured by flow cytometry after 60 min. Representative of three experiments, for each n = 3. (B) Neutrophils secrete ROS upon stimulation with PMA for 60 min. Extracellular ROS were detected with a probe that does not cross the plasma membrane (n = 11–12). (C) Representative Gstp1 immunohistochemistry in liver from WT or Siglec-E−/− male mice at 100 weeks. Expression pattern is altered in the knockout mice. (D) Immunoblot analysis and quantification of Gstp1 expression in liver of 100-week-old mice. The level of Gstp1 protein is reduced of about 40%. p was calculated with a Student' s t test, n = 4. DOI: http: //dx. doi. org/10. 7554/eLife. 06184. 01610. 7554/eLife. 06184. 017Figure 3—figure supplement 1. Neutrophils lacking Siglec-E are more prone to oxidative burst. Neutrophils isolated from bone marrow were incubated with immunocomplexes conjugated with a probe sensitive to ROS. Flow cytometry profiles at 60 min indicate that cells lacking Siglec-E are more prone to produce ROS, whereas the levels of ROS are comparably low before stimulation. Gates indicate cells producing ROS. DOI: http: //dx. doi. org/10. 7554/eLife. 06184. 01710. 7554/eLife. 06184. 018Figure 3—figure supplement 2. Thioglycollate-elicited neutrophils from Siglec-E−/− produce higher ROS than WT controls. Neutrophils isolated from peritoneum were incubated with immunocomplexes conjugated with a probe sensitive to ROS. The percentage of cells producing ROS after 60 min of incubation is higher when Siglec-E is absent, n = 3. DOI: http: //dx. doi. org/10. 7554/eLife. 06184. 01810. 7554/eLife. 06184. 019Figure 3—figure supplement 3. Gstp1 is found in lower levels in the liver of Siglec-E−/− mice. (A) Representative images generated during analysis of Gstp1 staining of liver tissues. Original images (left) were converted to grayscale to discard color information and only indicate brightness. Normalized images are shown in the second column (with jet color map). Images with pixel labels are in the third column (red: bright pixels, blue: dark pixels, green: discarded from analysis). In the last column, the labeled images are overlayed on the original image to compare pixel labels to the original (30% transparency). Three images per liver sample were acquired and processed in this way. (B) Quantification of the Gstp1 staining, as measured by the proportion of dark/bright areas. Mean ± sem, n = 8. DOI: http: //dx. doi. org/10. 7554/eLife. 06184. 019 Since we found evidence of inflammation in the liver, we used a microarray to examine differential gene expression in this organ in aged Siglec-E−/− animals. The liver is a central organ for the regulation of glucose homeostasis, xenobiotic metabolism and detoxification, and steroid hormone biosynthesis and degradation. Gene expression analysis in aged C57BL/6 mice has indicated that 40% of the genes with changes in expression during aging are associated with inflammation (Lee et al., 1999; Cao et al., 2001). Another set of genes undergoing changes is related to stress response and chaperones, followed by genes involved in xenobiotic metabolism. Principal component analysis uncovered a subset of genes whose expression differed significantly between genotypes. Pathway analysis of differentially regulated genes suggested changes in leukocyte-mediated inflammation, including increased activation of leukocytes and granulocyte movement, as well as an increase in ROS metabolism in the Siglec-E−/− mice (Supplementary file 1). Interestingly, the glutathione S-transferase protein 1 (gstp1) gene was found to be down-regulated. Gstp1 catalyzes nucleophilic attack by reduced glutathione on a variety of electrophilic compounds (Hayes et al., 2005). The resulting complexes are usually less toxic and are eventually metabolized and exported via a glutathione-dependent transport system. In humans, early loss of Gstp1 expression due to promoter hypermethylation results in increased cancer susceptibility (Lin et al., 2001). In male mice, Gstp1 is quantitatively the principal glutathione transferase in the liver and is found at lower levels in other organs (Knight et al., 2007). In liver from WT male mice, anti-Gstp1 antibodies stained hepatocytes of the zone 1 (Figure 3C). A less defined pattern was observed in liver sections of Siglec-E−/− mice. Overall, we observed a substantial difference in staining (Figure 3—figure supplement 3). Immunoblot analysis confirmed a 40% reduction in Gstp1 expression (Figure 3D). It is interesting to note that Gsto1 gene, encoding for another glutathione S-transferase, was found to be negatively regulated by age in a previous study (Cao et al., 2001). Thus, changes in the xenobiotic-metabolizing capacity of the liver appear to be intimately connected to the aging process. Taken together, these data indicate that absence of Siglec-E leads to a dysregulation of ROS metabolism, resulting in increased levels of reactive species. This phenomenon is due to both an increased production of vacuolar ROS and a deficiency of removal of ROS. Many types of ROS that are formed to serve a signaling or protective function can also cause damage spontaneously to lipids, nucleic acids, and proteins. Polyunsaturated fatty acids are a sensitive oxidation targets for ROS because of a damaging chain reaction that takes place once lipid peroxidation is initiated (Niki, 2009). DNA bases are also very susceptible to ROS attack, and oxidation of DNA is believed to cause mutations and deletions (Fraga et al., 1990). Most amino acids in a protein can be oxidized by ROS, with these modifications leading to a loss of function (Brennan and Hazen, 2003). Such damage occurs constantly, and cells must repair it or replace the impaired molecules. Defects that allow oxidative damage to accumulate can contribute to the origin and progression of cancers and neurodegenerative diseases, and in general contribute to the symptoms of aging (Berlett and Stadtman, 1997; Halliwell, 2013). Similarly, impairment of the processes that control ROS levels can lead to molecular damage. We looked for signs of molecular damage in the organs of the Siglec-E−/− mice, and found a 1. 4-fold increase of DNA damage in liver compared to WT (Figure 4A). This was in line with the evidence that glutathione S-transferases protect cells against as much as 90% of the damage induced by electrophiles and other free radicals (Vasieva, 2011). Brain, spleen, and heart tissues also showed a slight trend towards increase in DNA damage (Figure 4—figure supplement 1). Notably, these differences were not detected in the organs of 10-week-old mice (Figure 4—figure supplement 2). We then searched for oxidative adducts in proteins elsewhere in the body and found elevated plasma protein-bound 3-nitrotyrosine levels, a marker of protein modification by nitric oxide (NO) -derived oxidants (Figure 4B). Similarly, liver of Siglec-E−/− mice showed a trend towards accumulation of oxidized amino acids in proteins compared to WT (Figure 4—figure supplement 3). Furthermore, we detected a twofold increase of F2-isoprostanes levels, including 8-iso Prostaglandin F2α and its metabolite 2,3-dinor-8-iso PGF2α in the urine (Figure 4C, D). F2-isoprostanes are generated by non-enzymatic peroxidation of arachidonic acid due to free radical species (Montuschi et al., 2004). Taken together, these data indicate that elimination of Siglec-E leads to accelerated oxidative modification of DNA, proteins and lipids at the systemic level, via elevated ROS and reactive nitrogen species (RNS) production. 10. 7554/eLife. 06184. 020Figure 4. Increased oxidative damage in mice lacking Siglec-E. (A) Oxidative damage of DNA (AP sites, apurinic/apyrimidinic sites) was measured in the liver from WT and Siglec-E−/− mice at 100 weeks, n = 10. (B) Nitrotyrosine (NO2Tyr) accumulation in plasma proteins of Siglec-E−/− mice, n = 8. (C and D) Concentrations of F2-isoprostanes in urine derived from free radical-induced oxidation of arachidonic acid. Values were normalized by creatinine levels to account for dilution in urine. F2-Isoprostane levels are significantly higher in Siglec-E−/− mice. Data are mean ± s. e. m., Student' s t test. DOI: http: //dx. doi. org/10. 7554/eLife. 06184. 02010. 7554/eLife. 06184. 021Figure 4—figure supplement 1. Spleen and brain of aged WT and mutant mice have equivalent levels of DNA damage. Quantification of apurinic/apyrimidinic (AP) sites in DNA from spleen or brain. Mean ± sem is indicated. DOI: http: //dx. doi. org/10. 7554/eLife. 06184. 02110. 7554/eLife. 06184. 022Figure 4—figure supplement 2. Young Siglec-E−/− mice exhibit levels of DNA damage comparable to WT. Quantification of AP sites in DNA from liver, heart, or spleen of 10-week-old mice. DNA damage is expressed as ratio between DNA damage in Siglec-E−/− and WT animals, n = 3. DOI: http: //dx. doi. org/10. 7554/eLife. 06184. 02210. 7554/eLife. 06184. 023Figure 4—figure supplement 3. Oxidation of hepatic proteins. Protein-bound oxidized amino acid content (normalized to the precursor amino acid) in proteins from liver homogenates was determined by stable isotope dilution LC/MS/MS analysis. Methyl-tyrosine (m-Tyr) is a stable adduct of phenylalanine (Phe). Brominated tyrosine (BrTyr) is formed by brominating oxidants. Di-tyrosine (Tyr) is an oxidative crosslink. Indicated is mean ± sem, n = 8. DOI: http: //dx. doi. org/10. 7554/eLife. 06184. 023 CD33rSiglecs differ by a great degree in number, sequence and expression pattern among mammalian species. Together with the evidence that many genes involved in the biosynthesis of sialylated glycoconjugates are rapidly evolving and that some bacterial pathogens can also produce sialylated structures, this led to the hypothesis that CD33rSiglecs function to recognize self in the form of the host sialic acids (‘self-sialome’), thereby dampening unwanted responses in the steady state by immune cells, wherein CD33rSiglecs are prominently expressed (Crocker and Varki, 2001). Indeed, it has been shown for several CD33rSiglecs that ligation of sialic acid results in the phosphorylation of tyrosine residues of the intracellular immunoreceptor tyrosine-based inhibitory motifs (ITIMs), followed by the recruitment of phosphatases SHP-1 and SHP-2 that turn off the pro-inflammatory cascade (Angata et al., 2002; Ikehara et al., 2004). Therefore, CD33rSiglecs engage in a dense network of sialic acid-dependent interactions in cis on the cell membrane to provide homeostasis. However, higher affinity ligands on other cells can displace cis interactions to take advantage of the inhibitory properties of CD33rSiglecs in these host cells. For instance, many cancer cells produce a heavily sialylated cell surfaces to contact Siglecs of natural killer cells and neutrophils, allowing successful escape from immune recognition (Hudak et al., 2014; Jandus et al., 2014; Läubli et al., 2014). Similarly, bacterial pathogens expressing sialic acids can engage CD33rSiglecs (Carlin et al., 2009; Chang et al., 2014) and might therefore represent strong driving forces for evolution of this class of receptors (Varki, 2011). Of course, other yet unexplored functions of Siglecs might also be associated to their variation in number. In this study, we analyzed the expansion of CD33rSIGLEC genes in the context of evolution of aging. To test our hypothesis that inhibitory CD33rSiglecs might affect aging by regulating ROS homeostasis, we used mice as a simplified model system as deletion of Siglec-E results essentially in the removal of most of the CD33rSiglec receptors from macrophages and neutrophils, which are the main producers of ROS upon inflammatory stimuli. Mice lacking Siglec-E are viable, exhibit no apparent developmental defect and reproduce normally (McMillan et al., 2013). Upon acute challenge by lipopolysaccharide-induced airway inflammation or by intravenous administration of bacteria, Siglec-E deficient mice develop exaggerated neutrophil recruitment to the lung and produce higher levels of pro-inflammatory cytokines (McMillan et al., 2013; Chang et al., 2014). However, as for other Siglec-deficient mice such as CD33 or Siglec-F null animals, no clear phenotype was reported in absence of acute challenge (Brinkman-Van der Linden et al., 2003; Zhang et al., 2007). Here, we showed that Siglec-E affects ROS homeostasis, and deletion of Siglec-E results in overproduction of ROS. This, together with a secondary impairment in the radical-scavenging enzyme Gstp1 expression leads to higher levels of oxidative adducts of proteins, lipids and DNA, which may lead to acceleration of aging. We thus concluded that Siglec-E impacts aging in mice through regulation of ROS homeostasis. Formally, we cannot state that the upregulation of ROS due to the absence of Siglec-E is the direct cause of the observed molecular damage. In fact, the observed levels of oxidation may be primarily due to the impairment of the detoxification system, which might be controlled upstream by Siglec-E through ROS signaling. Interestingly, the latter hypothesis is in line with a recent revision of the Harman' s free radical theory of aging that proposes that ROS generation represents a stress signal to age-dependent damage, rather then being the primary cause of it (Harman, 1956; Hekimi et al., 2011). However, our findings do support the concept that alteration of the ROS homeostasis accelerates aging. It is also interesting to note that both genetic and pharmacological intervention to reduce ROS levels has produced contrasting results in reverting aging phenotypes, suggesting that too low or too high ROS levels can be equally deleterious. In light of this, it is likely that overexpression of Siglec-E in mice might not result in lifespan expansion. Additionally, this work complements a recent report showing Siglec-E in ROS management in the fibrinogen/β2-integrin signaling pathway (McMillan et al., 2014). However, in our assays, bone marrow and peritoneal neutrophils from Siglec-E−/− mice consistently showed a higher ROS production. Lastly, whilst we suggest here that Siglec-E impacts inflammaging by a ROS-mediated mechanism, Siglec-E might also modulate the ability to recognize and remove senescent cells in aging (van Deursen, 2014). Even if the correlation between number of CD33rSiglec family members and lifespan is particularly strong, a higher number of SIGLEC genes may not directly translate in a comparable increase of CD33rSiglec pathway activity. Instead, it is quite possible that the observed gene expansion relates to expression patterns in specific cell types that might ultimately influence cellular CD33rSiglec repertoires. We suggest that specific CD33rSiglec members contribute to the regulation of inflammation by interaction through distinct sialylated structures in vivo, leading to improved regulation of inflammatory responses. Our finding that long-living mammals tend to have more CD33rSIGLEC genes is in line with the ‘inflammaging’ theory (Franceschi et al., 2000). Inflammaging postulates that lifetime exposure to antigenic load caused by both clinical and subclinical infections, as well as exposure to noninfective agents, generates low-grade inflammation. This yields additional cytokines and results in a vicious cycle that drives immune system remodeling to a chronic proinflammatory state, ultimately leading to aging and common age-related disorders (Finch and Crimmins, 2004; Finch et al., 2010). Therefore, age-related diseases may represent the cost of an efficient defense against pathogens conferred by strong inflammation in early life. It also derives that elements that protect against inflammatory damage or mediate repair may have an impact on aging, and that species differences in those elements may translate in distinct patterns of age-dependent disease. The evidence presented in this work is consistent with a role of CD33rSiglecs in modulating aging derived from chronic inflammation. In fact, CD33rSiglecs are receptors of innate immune cells. Their primary function is to recognize self-associated molecular patterns and modulate host immune responses by regulating cellular reactions, survival, and production of cytokine mediators (Crocker et al., 2007; Chen et al., 2009; Cao and Crocker, 2011; Varki, 2011). CD33rSiglecs counteract random molecular damage, which is the main driver of aging. Lastly, CD33rSIGLEC gene number correlates with longevity. In summary, our data provide molecular mechanisms underlying the CD33rSiglec-dependent control of oxidative stress and identify this gene family as modulators of aging pattern and lifespan in mammals. Siglec-E−/− mice were described in McMillan et al. (2013) and backcrossed with C57BL/6 animals. Heterozygous mice were used to produce WT and Siglec-E−/− littermates control. Mice were housed in cages of groups of 3–5 that did not change from weaning, at 20 ± 2°C under a 12 hr light/12 hr dark photoperiod. Mice were provided with unlimited access to water and to a soy-based chow (Dyets, Inc., AIN-93M, Bethlehem, PA) supplemented with either 0. 25 mg/g chow Neu5Gc (by adding purified porcine submaxillary mucin) or 0. 25 mg/g chow Neu5Ac (by adding edible bird' s nest, Golden Nest Inc., Arcadia, CA). Addition of Neu5Gc or Neu5Ac did not significantly increase the caloric content of the chow. Sterile inflammation was induced via intra-peritoneal injection with 200 μg of human erythrocyte membrane ghosts in 200 μl PBS, along with Freund' s complete adjuvant, at an age of 10 weeks. Human erythrocyte membrane ghosts were prepared as described previously (Hedlund et al., 2008). A booster injection using Freund' s incomplete adjuvant with the same amount of immunogen was given 2 and 4 weeks later. Mice were accessed periodically for evaluation of health status, body weight, and blood tests. Deaths were recorded by animal technicians throughout the study. Decisions for euthanasia of aged mice with severely compromised health were taken by animal technicians, following the guidelines of Institutional Animal Care and Use Committee of the University of California, San Diego, and without involving the scientists. At approximately 75 weeks of age WT or Siglec-E−/− male mice were ranked blind in order of visible graying to coat fur. In total 26 mice were ranked, including 6 female mice (3 Siglec-E−/− and 3 WT) which had no obvious graying in the coat and therefore acted as a negative baseline. The highest graying was scored 25, and the lowest was scored = 0. The option was available to say that there was no difference between some or all mice, in which case they would be given the same score, but this option was not used by any of the analysts. Organs were extracted from euthanized animals and either fixed in 4% paraformaldehyde (skin, liver, lung, brain) or snap-frozen in OCT and stored at −80°C. Fixed tissues were processed and embedded in paraffin. Paraffin sections were de-paraffinized, blocked, and stained with antibodies following protocols of the UC San Diego Mouse Phenotypic Core http: //mousepheno. ucsd. edu/. Antibodies were as following: goat anti-Siglec-E (R&D Systems, Minneapolis, MN), rabbit anti-Gstp1 (Sigma–Aldrich, St. Louis, MO), mouse anti-β-actin (Sigma–Aldrich), rabbit anti-β-actin (Cell Signaling, Danvers, MA), anti-CD45 (BD Pharmingen, San Jose, CA), rat anti-Ly6G (clone 1A8, BD Pharmingen), mouse anti-Gstp1 (BD Pharmingen), and rabbit anti-β-galactosidase (Bioss Antibodies, Woburn, MA). Secondary antibodies were from LI-COR (Lincoln, NE) or Jackson ImmunoResearch Laboratories (West Grove, PA). Dorsal skin was dissected from mice, fixed in 10% paraformaldehyde, and embedded in paraffin. Paraffin sections were prepared at 5-μm thickness and stained with hematoxylin and eosin. Digital photomicrography using the Keyence B6000 (Keyence, Itasca, IL) was performed to collect 400× images, and the epidermal thickness was measured with Keyence BZII Analyzer. Bone marrow neutrophils were flushed from femur and tibia and purified by Percoll gradient. Peritoneal neutrophils were obtained from peritoneal exudate 16 hr after intraperitoneal injection of 3% thioglycollate. Purity was evaluated by flow cytometry with an anti-Ly6G antibody. For phagosomal ROS, 1 million neutrophils were incubated for 60 min in 700 μl PBS containing 0. 5% (wt/vol) glucose and 140 μg/ml Fc OxyBURST (Life Technologies, Grand Island, NY). ROS production was measured with a BD FACScalibur (BD Biosciences). For extracellular ROS, half a million neutrophils were incubated with 10 μg/ml OxyBURST Green H2HFF BSA (Life Technologies) and phorbol myristate acetate (PMA). ROS production was monitored with a SpectraMax M3 (Molecular Devices, Sunnyvale, CA). Resected liver samples were placed immediately into RNALater (Qiagen, Valencia, CA) on ice. Tissues were homogenized using a Kinematica homogenizer. RNA was isolated from tissues using RNeasy kit (Qiagen). Concentration and quality of RNA were measured by a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies) and by a 2100 Bioanalyzer (Agilent). Gene microarray analysis was run by the UC San Diego Biomedical Genomics Microarray Core Facility using a MouseRef-8 v2 Expression BeadChip (Illumina, San Diego, CA). A principal component analysis (PCA) was conducted on the signals obtained from the data matrix (25,697 probes × 6 samples) with Matlab (Mathworks, Inc., Torrance, CA). Data generated from gene array were analyzed for differential geneexpression. Genes were considered differentially expressed with a p value <0. 05 (Mann–Whitney U test), and a Log2 fold change of >1 or < −1. The generated list was analyzed using Ingenuity Pathway Analysis. For immunoblot analysis, liver tissues were washed with PBS and homogenized in RIPA buffer. Cell lysates were spun at 10,000×g. Protein concentration of the supernatant was measured with a BCA kit (Pierce, Rockford, lL). Proteins were run in a SDS-PAGE and transferred to a nitrocellulose membrane. Membranes were incubated with antibodies. Signals were acquired with an Odyssey instrument (LI-COR) and analyzed by Image Studio software (LI-COR). For immunohistochemistry analysis, liver were fixed in 10% paraformaldehyde and embedded in paraffin. Paraffin sections were prepared at 5-μm thickness and incubated with antibodies. Images were collected using a B6000 microscope (Keyence). Simple image analysis on the brightness (grayscale value of the image) was conducted with the Image Processing Toolbox of Matlab (Mathworks, Inc.). Images were loaded into Matlab, normalized via z score, and then pixel value histograms were inspected. Images were manually inspected for artifact and those pixels were discarded from the analysis (as shown on the images as white lines on far right inset and marked as green in the image to the left). Histograms often showed a bimodal distribution of pixel values indicating a clear demarcation of positive staining. The middle value between this bimodal distribution was used as a criterion to classify between negative and positive staining. Then, the pixels were marked either as bright (red) or dark (blue) and counted. Visual inspection of the classified image was compared to the original image, and if pixels were misclassified, the midpoint was manually changed until the resulting image most clearly separated the tissue differences. DNA was extracted from tissues with a DNeasy Blood & Tissue Kit (Qiagen). DNA concentrations of each sample were adjusted to 0. 1 μg/ml. The number of apurinic/apyrimidinic (AP) sites was determined using the DNA damage Quantification Kit (Dojindo, Rockville, MD), following the manufacturer' s instructions. At the time of harvest, all tissues were immediately rinsed in ice-cold PBS and frozen at −80°C in PBS containing 100 μM diethylenetriamine pentaacetic acid (DTPA) and 100 μM butylated hydroxytoluene (BHT) in gas-tight containers overlaid with nitrogen. Analysis of oxidative modification of amino acids was done by stable isotope dilution liquid chromatography with on-line tandem mass spectrometry (LC/MS/MS) using a HPLC interfaced to an AB SCIEX 5000 triple quadrupole mass spectrometer, as described in Zheng et al. (2004). Urine samples were spun to remove potential cellular debris and then frozen at −80°C until the time of analysis. Urinary creatinine (Cr) levels were quantified on an Abbott Architect machine (Abbott Diagnostics, Abbott Park, IL), according to the manufacturer' s instructions. Immediately after thawing, an internal standard (9α, 11α, 15S-trihydroxy-5Z, 13E-dien-1-oic-3,3, 4,4-d4 acid; PGF2α-d4; Cayman Chemical Company) was added to the sample. Urinary levels of F2-IsoProstanes (PGF2α and 2,3-dinor-PGF2α) were analyzed by stable isotope dilution LC/MS/MS using a HPLC interfaced to an AB SCIEX 5000 triple quadrupole mass spectrometer. To adjust for variations in urinary dilution, the results of F2-IsoProstanes are reported as ratios with urine Cr concentrations. The Barnes maze test is a spatial learning and memory test originally developed in rats (Barnes, 1979), but also adapted for mice (Bach et al., 1995). The Barnes maze task has the benefit of minimizing pain and distress to the animal. The Barnes maze apparatus consists of an opaque Plexiglas platform 75 cm in diameter elevated 58 cm above the floor. 20 holes, 5 cm in diameter, are located 5 cm from the perimeter, and a black Plexiglas escape box (19 × 8 × 7 cm) is placed under one of the holes. Distinct spatial cues are located all around the maze and are kept constant throughout the study. On the first day of testing, a training session was performed, which consists of placing the mouse in the escape box and leaving it there for 5 min. 1 min later, the first trial was started. At the beginning of each trial, the mouse was placed in the middle of the maze in a 10-cm high cylindrical black start chamber. After 10 s the start chamber is removed a bright light is turned on, and the mouse is allowed to explore the maze. The trial ended when the mouse entered the escape tunnel or after 3 min elapsed. When the mouse entered the escape tunnel, it remained there for one minute. When the mouse did not enter the tunnel, it is gently placed in the escape box for one minute. The tunnel was always located underneath the same hole (stable within the spatial environment), which is randomly determined for each mouse. Mice were tested once a day for 9 days. On day 10, a probe test was conducted during which time the escape tunnel was removed and the mouse allowed to freely explore the maze for 3 min. The time spent in each quadrant was determined and the percent time spent in the target quadrant (the one originally containing the escape box) was compared with the average percent time in the other three quadrants. Each session was videotaped and scored by an experimenter blind to the genotype of the mouse. Measures recorded include the number of errors made per session and the strategy employed by the mouse to locate the escape tunnel. Errors were defined as nose pokes and head deflections over any hole that did not have the tunnel beneath it. Search strategies were determined by examining each mouse' s daily session and classifying it into one of three operationally defined categories: (1) Random search strategy—localized hole searches separated by crossings through the center of the maze, (2) Serial search strategy—systematic hole searches (every hole or every other hole) in a clockwise or counterclockwise direction, or (3) Spatial search strategy—reaching the escape tunnel with both error and distance (number of holes between the first hole visited and the escape tunnel) scores of less than or equal to 3. Locomotor activity was measured using an automated monitoring system (Kinder Associates, San Diego, CA). Polycarbonate cage (42 × 22 × 20 cm) containing a thin layer of bedding material was placed into frames (25. 5 × 47 cm) mounted with photocell beams. Each mouse was tested for 120 min. Sequences of previously reported human and mouse CD33rSiglecs were retrieved from HGNC (http: //www. genenames. org/) and MGI (http: //www. informatics. jax. org/), respectively. NCBI annotated CD33rSIGLEC genes from additional mammalian species were used as references for orthologous gene searching. Additional putative CD33rSIGLEC genes were obtained by searching available mammalian genome sequences at UCSC Genome Bioinformatics (http: //genome. ucsc. edu/), Ensembl (http: //www. ensembl. org/index. html), and NCBI (http: //www. ncbi. nlm. nih. gov/gene). As SIGLEC genes contain introns, we adopted and modified a previously established search strategy (Shi and Zhang, 2006). First, we used BLAT/TBlastN to identify the genomic location of a putative CD33rSiglec gene in a genome with a previously reported CD33rSiglec as a query. Secondly, Genscan was used to predict the gene structure found in this genome location. Simultaneously, the genomic DNA sequences of the putative CD33rSIGLEC gene and the known CD33rSiglec protein sequence were used to conduct a protein-to-genomic sequence alignment by Wise2. Furthermore, to ensure the accurate prediction of a CD33rSIGLEC, the obtained putative protein sequence was examined by TMHMM V. 2. 0 or SPLIT 4. 0 SERVER for the presence of a transmembrane domain and examined by SignalP 3. 0 Server for the presence of a signal peptide. Additional domain evaluation was also conducted in Pfam 25. 0 (http: //pfam. sanger. ac. uk/) to find the existence of V-set and C2-set domains in the putative CD33rSiglec-encoding gene. All candidates then underwent BLAST analysis against the entire GenBank to ensure that their best hits are annotated as CD33rSiglecs. This step is important because CD33rSIGLECs are known to be related to other SIGLEC genes (e. g., CD22, MAG, and SIGLEC15), as well as other cell surface Ig-like receptors. The above gene search strategy was also applied for predicting all of the KLKs, TLRs, and IgG Fc receptors in mammals under consideration, though the criteria used in gene structure evaluation were gene family dependent. Based on previous studies on CD33rSiglecs some particular characteristics are considered in order to define a gene as encoding a functional Siglec (Crocker et al., 1998). One criterion is that a Siglec protein is capable of binding sialylated glycans. This binding activity requires a conserved arginine residue in the Ig-like V-set domain. The other criterion is that a functional Siglec protein should contain either a cytosolic tail with at least one ITIM motif or a transmembrane domain carrying a positively charged amino acid. The eventually acquired candidate CD33rSiglecs in each species were considered as true orthologs and used in our correlation analysis. Defining a functional gene using our gene prediction approach is not black and white, due to the nature of incomplete genome sequences or genome sequencing errors. Thus, a few rules were considered during our prediction process. First, when entire exons of a gene (usually one or two) are missing due to a gap in the genome but ORFs remain undisrupted in the available sequences, we treat the case as a functional gene. Second, different species have variable quality of genome coverage. For example, human and mouse genomes have the highest coverage (>12×) out of all mammals, whereas cat and pig genomes have the lowest ones (<5×). Notably, we did not see a trend of higher genome coverage leading to more CD33rSiglec-encoding genes. Moreover, even when we focused only on the species with comparable genome coverage (opossum, dog, marmoset, cow, rhesus macaque, orangutan, chimpanzee, elephant, horse, and rat), the correlation of the number of CD33rSiglecs and maximum life span was still maintained. Therefore, the quality of genome sequencing in mammalian species likely had no impact on our overall findings and conclusion. Finally, we also observed genome sequencing errors in the form of 1 bp mutations or indels in two KLK genes, one IgG Fc receptor gene, and five TLR genes. In this study, such sequences were also considered as functional genes in all species. Notably, the number of TLR genes predicted in several mammalian species using our approach is equal to those reported earlier (Leulier and Lemaitre, 2008). Data regarding maximum lifespan and average adult body weight for mammalian species are from AnAge: the animal aging and longevity (http: //genomics. senescence. info/species/) (de Magalhães and Costa, 2009). Unpaired Student' s t-test was used for comparisons involving two groups. Lifespan analysis was performed using log-rank (Mantel–Cox) test. Median survival refers the time at which half the subjects have died. The Pearson' s coefficient was used to calculate correlation. All variables except the gene number counts were log-transformed for statistical analyses. Prism 6 Program (GraphPad, La Jolla, CA) was used for most of the statistical analyses. PGLS and FIC analysis were conducted in COMPARE 4. 6b (http: //www. indiana. edu/∼martinsl/compare/) using a degree of freedom of 11, with three (one for calculating contrast and two for estimating the slope and the intercept) subtracted from 14 (the total number of taxa). Phylogenetic regressions controlled for the body mass were run using pglmEstLambda in the CAIC package (Comparative Analysis of Independent Contrasts) in R. The function of pglmEstLambda uses the PGLS method, estimating λ as an index of the strength of the phylogenetic pattern in the data. The model included CD33rSiglec gene numbers as response, maximum lifespan and body mass as covariates. For λ values, we followed the rationale described in Navarrete et al. (2011). All animal studies were approved by the IACUC of the University of California San Diego. Gene expression data are available at the GEO Archive (GSE64760).

Title: Siglec receptors impact mammalian lifespan by modulating oxidative stress Summary: As we get older, we are more likely to become frail, be less mobile and develop heart disease, diabetes, and other age-related diseases. This is partly due to damage to tissues and organs that accumulates over the course of our lifetime. How quickly we age is controlled both by our genetics and by the environment we live in. It is thought that damage to DNA, proteins, and other molecules in the body caused by chemically active molecules called reactive oxygen species (ROS) can influence aging. ROS are produced during respiration, immune responses, and other important processes in cells, but in excessive amounts they can be extremely harmful. To avoid damage to DNA and other important molecules, cells have several ways to control the levels of ROS. One of the other hallmarks of aging is the development of chronic inflammation in tissues around the body, which is partly triggered by the immune system in response to cell damage. A group of genes called the CD33rSIGLEC genes are involved in controlling inflammation. The genomes of different mammal species carry different numbers of these genes, but it is not clear whether this alters the aging process in these animals. In this study, Schwarz et al. investigated whether the CD33rSIGLEC genes influence the lifespans of mammals. Species with a higher number of CD33rSIGLEC genes generally have a longer lifespan than those with fewer of these genes. Mice that were missing one of these genes and were subjected to inflammation early in life showed signs of accelerated aging and had shortened lifespans compared with normal mice. As predicted, these mice also had higher levels of ROS, which led to a greater amount of damage to the DNA and other molecules in their bodies. Schwarz et al.' s findings suggest that the CD33rSIGLECs co-evolved in mammals to help control the levels of ROS during inflammation, thereby reducing the damage to cells and extending the lifespan of the animals. Given that individual humans have different numbers of working CD33rSIGLEC genes, it would be interesting to see if this influences human lifespan.

lay_elife

en

Summarize: Diva has arrived! Pregnant Beyonce gets the VIP treatment as she's escorted out of chauffeur driven car by TWO helpers Beyonce certainly received the VIP treatment as she rolled up for a meeting in New York today. The 30-year-old singer was escorted out of her chauffeur driven car by two helpers. The Love on Top - and her burgeoning baby bump - were also protected from the elements by her bodyguard's large umbrella. Rainy day blues: Beyonce's bodyguard protects her from the rain today in NYC Dark duds hide everything: She may be nearly six months pregnant, but it's impossible to tell! Clad in an all-black ensemble of a flattering black top and trousers, it was impossible to tell that the mother-to-be is almost six months pregnant with her first child. Of course, all eyes were on her bright blue accessories of heels and a handbag, so her stomach was not the focus. One might also wonder why the songbird was wearing sunglasses in the pouring rain as she stepped out of her car and into a New York City office building. The typically private star is expecting her first child with husband Jay-Z, and according to US Weekly, the two already know the baby's sex. Given their hush-hush nature, though, they're not telling. Beyonce's mother, 57-year-old Tina Knowles, coyly let that piece of information slip at Monday's Angel Ball in New York. She also said that she's certain her eldest daughter and House of Dereon designing partner is going to be a brilliant mother. 'She's going to be an awesome mum,' Tina gushed. As for how the pregnancy itself is going, Tina revealed: 'She had morning sickness, but she's over it and she's doing really good...she's very busy.' The singer herself will attest to how well she's doing. 'It's going really well, thank you,' she told Britain's new! magazine. 'I am so happy with everything right now.' She added: 'I feel like we didn't rush anything, and now we are being blessed with everything naturally.' Pregnancy protection: A black-clad Beyonce covers her bump That's swell! Beyonce and Jay Z to build mammoth nursery for their baby at New York pad By Sophie Forbes As the U.S.'s highest earning celebrity couple you would expect Beyonce and Jay Z to drop a few dollars on their unborn baby. But the power couple are reportedly going all out when it comes to preparations for the birth, by building a huge nursery at their TriBeCa apartment. Prepping for baby: Beyonce is reportedly building a 2,200 square foot nursery for her unborn child According to Us Weekly, the doting parents to be 'will have a nursery that is 2,200 square feet.' But despite the extravagant plans several people close to the couple are not too enthusiastic about the giant baby facilities. 'Some people are like, 'Won't you be scared to leave your baby in that huge room?,' an insider told the magazine. Bump chic: The singer, seen today in New York, looked casual in a sweater and dark jeans Despite the skepticism from her friends, the Destiny's Child star is excited for the next phase in her life and is enjoying her pregnancy. 'It's going really well, I am so happy with everything right now,' the 30-year-old said recently. 'I am not nervous because I know it's happening at the right time. I felt I got married at the right time for me, and now we are having the baby at the right time. I feel like we didn't rush anything, and now we are being blessed with everything naturally.' Bootylicious: Beyonce is in great shape and has been keeping well throughout the pregnancy Beyonce and Jay Z already know the sex of the child but in true Hollywood fashion, they are keeping the information to themselves. Beyonce's mother, 57-year-old Tina Knowles, coyly let that piece of information slip at Monday's Angel Ball in New York. She also said that she's certain her eldest daughter and House of Dereon designing partner is going to be a brilliant mother. 'She's going to be an awesome mum,' Tina gushed. Home sweet home: Beyonce and Jay Z own a large portion of this Tribeca apartment building which is where they got married in 2008 Keeping mum: Beyonce and Jay Z already know the sex of the child but in true Hollywood fashion, they are keeping the information to themselves

Summary: Beyonce and Jay-Z are sparing no expense when it comes to their baby: The couple is planning a 2,200-square-foot nursery inside their TriBeCa apartment, the Daily Mail reports, citing Us. One amusing quote from an insider: "Some people are like, 'Won't you be scared to leave your baby in that huge room?'" Plus, MediaTakeOut reports that she traded her Maybach for a mom van... if by mom van, you mean a $1 million customized Mercedes van that includes, among other necessities, a $150,000 audio system, a full bathroom complete with a shower, and wiring for DirecTV and wi-fi. In another one of the many signs that Beyonce's pregnancy is nothing like yours, the Mail also notes that Bey was assisted out of said mom van by not one, but two helpers as she arrived at a meeting in New York yesterday.

multi_news

en

Write a title and summarize: Der Golem ist ab dem frühen Mittelalter in Mitteleuropa die Bezeichnung für eine Figur der jüdischen Literatur und Mystik. Dabei handelt es sich um ein von Weisen mittels Buchstabenmystik aus Lehm gebildetes, stummes, menschenähnliches Wesen, das oft gewaltige Größe und Kraft besitzt und Aufträge ausführen kann. == Etymologie Golem (hebr. golem) ist das hebräische Wort für "formlose Masse; ungeschlachter Mensch", aber auch für "Embryo" (s. Psalm 139,16 EU). Im modernen Iwrit bedeutet das Wort golem "dumm" oder "hilflos". Die rabbinische Tradition bezeichnet alles Unfertige als Golem. Auch eine Frau, die noch kein Kind empfangen hat, wird als Golem bezeichnet (z. B. im Babylonischen Talmud, Traktat Sanhedrin 22b). In den Sprüchen der Väter ist "Golem" die Bezeichnung für eine ungebildete Person ("An sieben Dingen erkennt man den Ungebildeten, und an sieben Dingen den Weisen"; 5,9). == Ursprünge der Legende Von der Golem-Legende sind verschiedene Varianten bekannt. Ihr Ursprung liegt jedoch im Dunkeln. Die erste schriftliche Erwähnung datiert auf das 12. Jahrhundert. Damals wurde in Worms ein Kommentar zum Buch der Schöpfung (Sefer Jetzira), einem Text der Kabbala, verfasst, in dem Zahlenmystik um die zehn Urziffern, die Sephiroth, und die 22 Buchstaben des hebräischen Alphabets eine Rolle spielen. In diesem nur fragmentarisch erhaltenen Text wird ein Ritual erwähnt, das durch bestimmte Kombinationen dieser Buchstaben und Zahlen unbelebte Materie zum Leben erwecken sollte. Im Talmud (Traktat Sanhedrin 38b) wird die Erschaffung Adams in der Weise beschrieben, dass er wie ein Golem aus einem formlosen Brocken gestaltet worden sei. Wie er werden alle Golems als aus Lehm geformt beschrieben, und zwar als Schöpfung derer, die als besonders heilig gelten, da ihnen in ihrer Nähe zu Gott seine Weisheit und Kräfte mitgeteilt worden seien. Freilich reichte auch die Erschaffung eines Golems nicht an die Schöpfung heran: Golems werden in der Regel als zum Sprechen unfähig beschrieben. In der Folge wurde die Sage durch weitere derartige Charakteristika angereichert, so etwa derjenigen, dass erst ein Zettel oder Plättchen unter der Zunge den Golem zum Leben erwecke. Da die Erschaffung eines Golems folglich als Merkmal großer Gelehrtheit und Weisheit galt, wurden im Mittelalter verschiedenen jüdischen Gelehrten und Rabbinern Golems zugeschrieben. Dass zunehmend Prag als Schauplatz der Golemgeschichte angesehen wurde, hat offenbar mehrere Gründe: Dort befand sich im Spätmittelalter die größte und zahlreiche Gelehrte zu ihren Mitgliedern zählende jüdische Gemeinde Europas. Außerdem förderte Kaiser Rudolf II. von seinem Sitz in der Prager Burg aus sowohl die Wissenschaften als auch okkulte Künste und Alchemie. Darüber hinaus sind Beratungen zwischen Rabbi Judah Löw und dem Kaiser überliefert. Zu einer Mythologisierung der historischen Gestalt des Rabbi Löw kam es aber erst um 1725, als der Grabstein Löws restauriert wurde und Prag das Zentrum einer erneuten Beschäftigung mit der Kabbalah war. == Die Legende vom Prager Golem Unter anderem wird dem Rabbi Baal Schem Tov und dem Rabbi Davidl Jaffe die Erschaffung des Golems zugeschrieben. Rabbi Jaffe soll den Golem allerdings im Wesentlichen als Ersatz für einen "Schabbesgoi" verwendet haben, also für einen Nicht-Juden, der die nötige Arbeit für Juden am Sabbat verrichtet. Die bei weitem bekannteste Version der Golem-Legende ist jedoch diejenige um den aus Worms stammenden Prager Rabbiner Judah Löw (1525-1609), der sich auch als Philosoph, Talmudist und Kabbalist hervortat. Diese Version der Geschichte erschien, soweit bekannt ist, 1836 zum ersten Mal im Druck (in der Oesterreichischen Zeitschrift für Geschichts- und Staatskunde). Kurz darauf gab der Schriftsteller Berthold Auerbach sie in seinem Roman Spinoza (1837) wieder. 1847 war die Legende Teil einer Sammlung jüdischer Märchen namens Galerie der Sippurim von Wolf Pascheles aus Prag. Sechzig Jahre später wurde das Thema von Judl Rosenberg im Jahr 1909 literarisch aufgegriffen. Nachfolgend ist die Legende auszugsweise wiedergegeben. === Die Erschaffung des Prager Golems Die Tätigkeit des Rabbi Löw war der Legende zufolge darauf gerichtet, dem bedrängten Volk der Juden von Prag zu helfen und es von den immer wieder vorgebrachten Anwürfen zu befreien, es bediene sich zu rituellen Zwecken des Bluts kleiner Kinder, an denen es angeblich Ritualmorde verübte. Im Jahr 1580 soll ein Geistlicher mit dem Namen Thaddäus sich erneut gegen die Juden gewandt und gegen die Prager Judengemeinde Ritualmordbeschuldigungen gerichtet haben. Der Himmel gab dem Rabbi im Traume den Gedanken ein, aus Ton das Bild eines Menschen zu formen, um so die gegen die Prager Juden gerichteten Pläne zu vereiteln (ata bra Golem devuk hakhomer v'tigtzar tzedim khevel torfe yisrael - "schaffe du aus Lehm einen Golem und überwinde das feindselige Pack, welches den Juden Übles will"). Hierauf rief Rabbi Löw seinen Schwiegersohn sowie einen Schüler zu sich und erzählte ihnen von seiner Vision. Zur Erschaffung des Golems waren die vier Elemente Erde, Wasser, Feuer und Luft vonnöten. Rabbi Löw maß sich selbst die Eigenschaften des Windes bei, der Schwiegersohn verkörperte das Feuer, während dem Schüler die Eigenschaften des Wassers zugeteilt wurden. Den beiden wurde der Eid abgenommen, von dem Vorhaben nichts verlauten zu lassen, und der Rabbi ordnete an, dass sie sich sieben Tage lang gewissenhaft im Gebet auf das Werk vorbereiten sollten. Um vier Uhr morgens (es soll sich um den 20. Adar 5340 gehandelt haben, was dem 17. März 1580 entspräche) begaben sich die drei Männer zu einer Lehmgrube an der Moldau außerhalb der Stadt. Aus feuchtem Lehm fertigten sie eine drei Ellen hohe Figur an, der sie menschliche Züge verliehen. Als dies geschehen war, befahl Rabbi Löw seinem Schwiegersohn, siebenmal um den Golem herumzugehen und hierbei eine Formel (tzirufim) aufzusagen, die der Rabbi ihm vorgab. Hierauf begann die Tonfigur zu glühen, als sei sie dem Feuer ausgesetzt. Danach umschritt der Schüler den Golem siebenmal: Der Körper wurde feucht und strömte Dämpfe aus, und dem Golem entsprossen Haare und Fingernägel. Als letzter schritt der Rabbi siebenmal um den Golem herum, und schließlich stellten sich die drei Beteiligten zu Füßen des Golems auf und sprachen gemeinsam den Satz aus der Schöpfungsgeschichte: "Und Gott blies ihm den lebendigen Atem in die Nase, und der Mensch erwachte zum Leben." Da öffneten sich die Augen des Golems. Als Rabbi Löw ihn sich aufrichten hieß, erhob sich der Golem und stand nackt vor den drei Männern. Da kleideten sie den Golem in das mitgeführte Gewand eines Synagogendieners und Rabbi Löw gab ihm den Namen Joseph nach dem talmudischen Joseph Scheda, der halb Mensch gewesen sei und den Schriftgelehrten in vielen Bedrängnissen beigestanden haben soll. In der Stube des Rabbi pflegte der Golem in einer Ecke zu sitzen, und kein Leben war an ihm zu erkennen. Zum Leben erweckt wurde der Golem erst durch kabbalistische Rituale mit Hilfe des Sefer Jezirah. Hierzu musste ihm ein Zettel mit dem Schem, dem Namen Gottes, unter die Zunge gelegt werden. Dieser Zettel verlieh ihm Leben; sollte der Golem auf seinen Missionen aber nicht gesehen werden, so legte ihm der Rabbi zusätzlich ein Amulett aus Hirschhaut um. Die Aufgabe des Golems war es, in der Zeit vor dem Pessachfest allnächtlich durch die Stadt zu streifen und jeden aufzuhalten, der eine Last mit sich trug, um zu kontrollieren, ob er ein totes Kind mit sich führe, um es zum Verderben der Prager Judenschaft in die Judengasse zu werfen. Zusätzlich machte sich der Golem als Schammes nützlich, indem er die Synagoge ausfegte. Der Zettel unter der Zunge musste an jedem Sabbat (der Tag, an dem nach jüdischem Glauben nicht gearbeitet werden darf) entfernt werden. In Abwandlung des Motivs eines Zettels mit dem Schem wird auch von einem "Siegel der Wahrheit" berichtet, das der Golem auf der Stirn getragen habe. Dieses Siegel habe das hebräische Wort für "Wahrheit" (d. i. AMT (transkribiert: EMETh)) dargestellt. Entfernt man den ersten der drei Buchstaben dieses Wortes, bleibt das hebräische Wort für "Tod" übrig (d. i. MT (transkribiert: METh)). Die Entfernung des Buchstabens stellte demnach eine Möglichkeit zur Deaktivierung des Golems dar. === Weitere Sagen aus dem Legendenkreis des Prager Golems Als der Rabbi Löw einmal vergessen hatte, ihm den Zettel aus dem Mund zu nehmen, begann der Golem durch die Straßen des Prager Ghettos zu rasen und alles zu zerschlagen, was sich ihm in den Weg stellte. Da warf sich der Rabbi vor ihn, entfernte den Zettel und vernichtete diesen, woraufhin der Golem in Stücke zerfiel. Nach einer anderen Fassung der Sage allerdings soll Rabbi Löw den Gottesdienst in der Altneu-Synagoge auf die Kunde hin, der Golem sei außer Rand und Band, unterbrochen haben. Löw soll auf die Straße gegangen sein und laut ausgerufen haben: "Joseph, bleib stehen!" Hierauf sei der Golem stehen geblieben, und der Rabbi habe ihn geheißen, zu Bett zu gehen. Rabbi Löw, in die Altneusynagoge zurückgekehrt, ordnete an, das Sabbatlied nochmals zu singen, weshalb es angeblich seitdem in Prag - und nur dort - im Rahmen des jüdischen Gottesdienstes stets zweimal gesungen wird. Eine andere Version beschreibt, wie die Frau des Rabbi Löw - entgegen dem ausdrücklichen Geheiß des Rabbis, dass der Golem für derartige Arbeiten nicht heranzuziehen sei - dem Golem befahl, Wasser ins Haus zu bringen. Dann ging sie auf den Markt, und der Golem trug weiter mehr und mehr Wasser ins Haus, weil ihm nicht befohlen war, damit aufzuhören. Diese Legende könnte möglicherweise als Vorlage für Goethes Ballade vom Zauberlehrling gedient haben. Ferner soll zu Jom Kippur des Jahres 1587 ein Gemeindevorsteher die Thorarolle fallen gelassen haben, was als böses Vorzeichen galt. Im Traum fragte Rabbi Löw, auf welche Sünde dieses böse Vorzeichen zurückzuführen sei. Die Antwort war eine Buchstabenfolge, die er sich nicht zu erklären wusste. Daher beauftragte er den Golem, eine Antwort darauf zu finden, was diese Buchstaben wohl besagten. In der Thora fand der Golem im Dekalog einen Vers, dessen Worte mit den besagten Buchstaben begannen: "Du sollst nicht begehren deines Nächsten Weib." Mit diesem Vers konfrontierte der Rabbi den Gemeindevorsteher, der weinend seine Sünde gestand. === Die Vernichtung des Prager Golems Nachdem viel Zeit verstrichen war und gegen die Gemeinde keine verleumderischen Anwürfe mehr gerichtet wurden, beschloss der Rabbi im Jahr 1593, dass es des Golems nicht mehr bedürfe. Nach Angaben von Isaak Kohen, dem Schwiegersohn des Rabbis, soll das erfolgt sein, nachdem im Zuge einer von ihm auf den 23. Februar 1592 datierten Audienz Rabbi Löw von Kaiser Rudolf II. das Versprechen erwirkt habe, dass gegen Ritualmordbeschuldigungen gegen die Juden in Zukunft unnachsichtig vorgegangen werde. Rabbi Löw hieß deshalb Joseph, den Golem, nicht wie üblich in der Wohnung des Rabbi zu schlafen, sondern sein Bett auf den Dachboden der Altneusynagoge zu stellen. Wieder versammelte er seinen Schwiegersohn und den Schüler um sich, die schon bei der Erschaffung des Golems mitgewirkt hatten. Er richtete an sie die Frage, ob der in Lehm zurückverwandelte Golem wie ein gewöhnlicher Toter eine Verunreinigung bewirke, was aber beide nach reiflicher Überlegung verneinten. So versammelten sich die Drei wie bei der Erschaffung des Golems an seinem Bett auf dem Dachboden der Altneusynagoge, wo der Golem schlief, gingen aber genau in entgegengesetzter Reihenfolge vor, als sie es bei der Erschaffung getan hatten. Statt zu seinen Füßen standen sie zu seinem Haupt, und die Tzirufim sagten sie rückwärts auf. Hierauf zerfiel der Golem wiederum zu einem Haufen Lehm, wie er es vor seiner Erschaffung gewesen war. Rabbi Löw deckte ihn mit den alten Gebetsmänteln und mit Schriftrollen zu, die auf dem Dachboden der Altneusynagoge reichlich umherlagen: Anderntags ließ Rabbi Löw verbreiten, der Golem sei mit unbekanntem Ziel entwichen, und er verbot allen, jemals den Dachboden der Altneusynagoge zu betreten. Gemäß der Legende wird darum ein Lehmhaufen auf dem Dachboden der Prager Altneu-Synagoge, die während des Zweiten Weltkrieges nicht zerstört wurde, als sein Überrest angesehen. Eine andere Version vom Ende des Golems, die der oben wiedergegebenen Version vom Ende des amoklaufenden Golem ähnlicher ist, berichtet davon, dass Rabbi Löw dem Golem befohlen habe, ihm die Schuhe auszuziehen. In diesem Moment habe der Rabbi dem Geschöpf das "Siegel der Wahrheit" (emeth) vom Kopf gerissen und es so getötet. Allerdings wurde nach dieser Erzählung der Rabbi von dem umfallenden Golem erschlagen. == Der Golem der deutschen Romantik Eine Notiz Jacob Grimms in der Zeitung für Einsiedler (1808) machte den Golem unter den deutschen Romantikern bekannt. Grimm stützte sich auf eine Darstellung von Johann Jacob Schudt, der die literarische Kontroverse über ein angeblich durch jüdische Zauberei zum Gehen gebrachtes "Bild von Laymen (Lehm) einem Menschen gleich" referierte, die 1614/15 zwischen Samuel Friedrich Brenz und Salomo Salman Zevi Hirsch geführt worden war. Aufgrund des herrschenden Antisemitismus wurde dem Golem eine vorwiegend negative Rolle zugeteilt (Achim von Arnim: Isabella von Ägypten) oder als Synonym für Stupidität wie in den Gedichten von Theodor Storm (Der Staatskalender) oder Annette von Droste-Hülshoff (Die Golems) (1844) verwendet. E.T.A. Hoffmann verwendet das Golem-Motiv stark verfremdet in seiner Erzählung Der Sandmann, in Die Geheimnisse (1822), Meister Floh und Der Elementargeist schikaniert der Golem als eine Art Unperson und seelenloser Snob die Welt. == Rezeptionsgeschichte Das Golem-Thema wurde in Literatur, Film, Rundfunk und in Computerspielen verschiedentlich aufgegriffen. === Belletristik und Theater Gustav Meyrink veröffentlichte 1915 seinen Roman Der Golem, von dem zunächst 100.000 Exemplare in einer billigen Feldausgabe unter Soldaten verbreitet wurden, wodurch Meyrink erst allgemeine Bekanntheit erlangte. Der Roman gilt als Klassiker der phantastischen Literatur. Meyrinks Golem ist eine Art Gespenst, das alle 33 Jahre im Prager Ghetto auftaucht, um Angst und Schrecken zu verbreiten und wird als bleicher, mongolischer Typ beschrieben mit gebeugtem schleichendem Gang und mittelalterlicher Kleidung: Meyrinks Golem ist weit von der jüdischen Idee des Golems entfernt, er ist eine ahasverische Erscheinung, er verkörpert das Ghetto. 2014 erarbeitete die Regisseurin und Dramaturgin Suzanne Andrade bei den Salzburger Festspielen eine szenische Version von Gustav Meyrinks Roman, die Publikum und Presse "bezauberte" und schließlich auf Europa-Tournee ging. Die "Roboter" in Karel Capeks Drama R.U.R. (1920) sind deutlich vom Golem-Mythos beeinflusst. Das Wort "Roboter" (von tschechisch robot) wurde aus diesem Stück in zahlreiche Sprachen übernommen. Eugen d'Alberts 1926 uraufgeführte Oper Der Golem befasst sich mit dem Stoff; ebenso wie Gedichte Jorge Luis Borges' (El Golem, 1958) und John Hollanders (A propos of the Golem, 1969). Friedrich Torberg transferiert den Golem in seiner 1968 erschienenen Erzählung Golems Wiederkehr in die Zeit des Zweiten Weltkriegs in Prag. Dabei handelt es sich um Ereignisse, welche die Errichtung des Jüdischen Museums durch die SS begleiten. Auch die Science-Fiction-Literatur griff den Mythos vielfach auf, etwa Stanislaw Lems Golem XIV (1981). Marge Piercy benutzt die Legende in ihrem Roman Er, Sie und Es (1991) als Hintergrund für die Erschaffung eines Cyborgs. Golems bevölkern die "Scheibenwelt" des Fantasy-Autors Terry Pratchetts. Sie spielen vor allem in Hohle Köpfe (1996) und Ab die Post (2004) eine zentrale Rolle. Mirjam Presslers Jugendroman Golem stiller Bruder von 2007 spielt zwar im Umfeld des Rabbi Löw in Prag um 1600, ist aber nach Aussagen der Autorin auch vor dem Hintergrund moderner Erscheinungen wie der künstlichen Intelligenz und des Klonens zu verstehen. === Sachliteratur Arnold Zweig verfasste 1915 eine Rezension, die sich auf den ersten Golem-Film Wegeners, Meyrinks Roman und das Theaterstück Der Golem von Arthur Holitscher von 1908 bezieht. In der Philosophie Ludwig Klages' (Vom Kosmogonischen Eros, 1922) bezeichnet Golem den Triumph der "Larve", des "letzten Menschen", den vom "Geist als Widersacher des Lebens" beherrschten "nachgeschichtlichen" Menschen im Moment seines Unterganges. Egon Erwin Kisch veröffentlichte 1925 eine Reportage Dem Golem auf der Spur, in welcher er der Sage nachgeht. Hans Ludwig Held schrieb 1927 Das Gespenst des Golem. Eine Studie aus der hebräischen Mystik, mit einem Exkurs über Das Wesen des Doppelgängers. === Film und Fernsehen Unter der Regie von Paul Wegener entstanden drei Stummfilme, die sich mit dem Golem befassen: Der Golem (1915), Der Golem und die Tänzerin (1917) und Der Golem, wie er in die Welt kam (1920), besonders letzterer gilt als Höhepunkt des expressionistischen Films und trug dazu bei, die Golem-Sage weithin bekannt zu machen. In der Zeichentrickserie "Gargoyles" wird dem Prager Golem in der 2. Staffel, Episode 27: "Der Golem" (1995) eine ganze Folge gewidmet. In der Serie "Akte X - Die unheimlichen Fälle des FBI" wird der Golem in der 4. Staffel, Folge 15, Der Golem (im Original: Kaddish, 1997) behandelt. Auch die Macher der Zeichentrickserie "Die Simpsons" greifen die Figur des Golems in der Episode Treehouse of Horror XVII (2006) auf. In der Serie Grimm wird der Golem in der 4. Staffel, Folge 4, Der Golem (im Original: "Dyin' on a Prayer", 2015) behandelt. 2018 produzierten die israelischen Regisseure Doron Paz und Yoav Paz den Horrorfilm Golem - Wiedergeburt, der im Litauen des 17. Jahrhunderts spielt. === Wissenschaft und Technik Norbert Wiener interpretierte den Golem in God & Golem, Inc. (1964) als Vorläufer kybernetischer Maschinen. Als der Kabbala-Forscher Gershom Scholem hörte, dass 1965 im Weizmann-Institut in Rechovot (Israel) ein neuer Großrechner in Betrieb genommen werden sollte, schlug er dem Konstrukteur des Rechners, Chaim L. Pekeris, vor, diesen "Golem I" zu nennen. Pekeris stimmte unter der Bedingung zu, dass Scholem die Einweihungsrede halte. === Spiele Verschiedene Zweige der Fantasy, insbesondere Rollenspiele, beschreiben Golems als menschenähnliche, magisch erschaffene Kreaturen, die aus verschiedenen Materialien bestehen und dazu passende Eigenschaften aufweisen. === Folklore Der Golem ist heute Teil der Prager Folklore, und touristische Golem-Souvenirs werden allenthalben angeboten. == Literatur

Title: Golem Summary: Der Golem ist eine Figur aus der Welt der jüdischen Sagen. Er hat die Form eines Menschen und besteht aus Lehm. Durch einen Zauberspruch wurde er lebendig. Der Golem soll die Juden beschützen. Die bekannteste Geschichte über den Golem ist die mit Rabbi Löw. Ein Rabbi ist ein Lehrer oder Prediger im Judentum. Judah Löw hat wirklich gelebt, und zwar in Prag vor etwa fünfhundert Jahren. Über ihn wird erzählt, er habe den Golem erfunden. Allerdings gibt es noch ältere Sagen, in denen ein Golem vorkommt. In der Geschichte mit Rabbi Löw sieht der Rabbi, wie die Juden verfolgt werden. Darum baut er aus Lehm eine Menschenfigur. Er schreibt einen Zauberspruch auf Papier und schiebt es dem Golem in den Mund. Der Golem ist sehr stark und kann allerlei Aufgaben vollbringen. Er ist aber stumm, das unterscheidet ihn vom Menschen. Der Golem wurde durch Romane und andere Bücher bekannt. Unter anderem hat Jacob Grimm über ihn geschrieben, in der Zeit der Romantik. Im Jahr 1920 erschien ein berühmter Film: "Der Golem, wie er in die Welt kam". Viele Zeichner von Comics haben den Golem in ihre Erzählungen aufgenommen. Der Golem erscheint als unheimlich und macht viel kaputt, darum ist er meist eine Horror-Figur. Dabei war er an sich nicht böse. Er erinnert an das Monster von Frankenstein. Rabbi Löw macht sein Wesen aber nicht durch Wissenschaft lebendig, sondern durch Zauberei. Darum gehört der Golem zur Fantasy, nicht zur Science-Fiction.

klexikon_de

de

Summarize: Boston UFC Fighters Decry Assault Charges Facing Conor McGregorConor McGregor is facing assault and other charges after a backstage melee he sparked at a UFC event in New York City. Brockton Firefighter Matt Parziale Misses Cut At The MastersMatt Parziale, a Brockton firefighter and amateur golfer, missed the cut at The Masters Friday after carding a second round score of 79. Northeastern Hockey Player Wins Hobey Baker AwardAdam Gaudette, a junior hockey player at Northeastern University, is the first player in the school's history to win the Hobey Baker Award. Here's What Needs To Happen For Bruins To Get No. 1 Seed In Eastern ConferenceThe NHL's playoff picture can get complex. Here's an effort at laying out what can happen for the Bruins to earn the No. 1 seed. Red Sox Boasting Baseball's Best Pitching Staff Through Season's First WeekDespite an offense that has yet to fully click, the Boston Red Sox are currently the owners of a 6-1 record, tying them for the best such mark in the majors. Only the defending champion Houston Astros have matched that performance thus far. The East Bridgewater Vikings were relentless from start to finish in their Div. 3 South Sectional opener against Madison Park, pressing, shooting and sprinting their way to a lopsided 93-7 victory Wednesday night. EAST BRIDGEWATER — With 10 seconds left in the third quarter, the East Bridgewater girls basketball team raced down the court with the ball. The clock ticked down. Nine...eight... seven. One of the Viking players drove to the hoop, then kicked to a teammate outside the 3-point line. Four... three... two. The Viking shot went up from beyond the arc, then swished through the net as the buzzer sounded. The crowd cheered heartily, but the three points weren’t for the lead. The score wasn’t close at all. After three quarters, East Bridgewater led 70-4. The Vikings were relentless from start to finish in their Division 3 South Sectional opener against Madison Park -- pressing, shooting and sprinting their way to a lopsided 93-7 victory Wednesday at East Bridgewater High School. The score left some in the stands shaking their heads, particularly as the Vikings continued their full-court press into the third quarter, then kept several starters on the court in the final few minutes. “Madison Park is waving the white flag,” declared the play-by-play announcer on East Bridgewater Community Access Media. Following the game, an East Bridgewater school official asked for the score not to be reported in an Enterprise media source. East Bridgewater Superintendent Elizabeth Legault called the game “an unfortunate situation.” “This is not a reflection of our student body or our athletic program,” she said Thursday. Legault said athletic director Patrick Leonard did speak with coach Andrew MacDonald, as well as the athletic director at Madison Park and the MIAA, but did not share further details. Leonard did not respond to The Enterprise Wednesday. The Enterprise attempted to enter the varsity basketball practice, to interview MacDonald, but were not allowed in. In addition, The Enterprise emailed MacDonald, but they have not heard back as of this time. The East Bridgewater girls, seeded fifth in the Division 3 South Sectional tournament, will play Friday at fourth-seeded Archbishop Williams at 6:30 p.m. Madison Park, which had a 10-10 record in the regular season, was seeded 12th. Officials at the Roxbury vocational high school gave no comment to The Enterprise about the game. “It was an unfortunate situation,” Legault said. “The two teams were ready and excited for playoffs, and the two schools were not matched up as well as they should be it seemed.” East Bridgewater opened up a 24-0 lead after one quarter and led 48-4 at halftime. “This can be over and done by just the first quarter,” one of the announcers for East Bridgewater Community Access Media said. He was right. The team left the starters on the court, continued to shoot and steal until the final buzzer as the Lady Cardinals became noticeably disheartened and frustrated as the game continued. “The defense is just vicious,” the announcer said as the team had more than 25 steals in the first half. “This is a tough game. Team Rowdy (East Bridgewater’s fan base) is even over there feeling sympathetic.” Within the next week, the game will be shown on East Bridgewater Community Access Media’s website www.eb-cam.org “I’m happy we’re in the tournament,” Legault said. “But of course no one likes that type of score. I’m hoping this game will bring a thoughtful reflection from our program leaders.”

Summary: It doesn't feel good to lose in the first round of the playoffs. It probably feels even worse to lose by 86 points. And it certainly feels even worse than that when the superintendent of the opposing school later apologizes for how bad you lost. But CBS Boston reports that's exactly what happened to the girls basketball team from Madison Park High School in Massachusetts this week. Madison Park was down 48-4 at halftime, but its opponent, East Bridgewater High School, continued its full-court press on defense into the third quarter and still had starters in the game with just minutes remaining in Madison Park's eventual 93-7 defeat, according to the Enterprise. Afterward East Bridgewater superintendent Elizabeth Legault apologized for the victory, calling it "an unfortunate situation" that "is not a reflection of our student body or our athletic program." Ouch.

multi_news

en

Summarize: TOKYO -- Suppliers of LCD panels for Apple's new iPhone will ramp up production soon, in line with a timetable for a worldwide launch as early as September. The new phone, expected to be called the iPhone 6, will likely be offered in 4.7- and 5.5-inch versions, both of which are larger than the current generation's 4-inch screen. Manufacturers have apparently begun making such components as fingerprint sensors and chips for liquid-crystal drivers. Mass production of liquid crystal display panels will start as early as the April-June quarter at Sharp's Kameyama factory, Japan Display's Mobara plant, and elsewhere, according to sources. LG Electronics will supply panels as well. The new handset's display resolution is expected to be significantly higher than that of current models. Apple put the iPhone 5 on the market in September 2012, selling 5 million units within the first three days. But shipments have since been lackluster. Last year, it introduced models in the same series with different price points for the first time with the 5S and 5C. (Nikkei) Screenshot Apple will release the iPhone 6 in September, according to a report in the Nikkei Asian Review. It said suppliers of the iPhone's screens are set to ramp up production to hit the September release. Nikkei said the iPhone would come in two screen sizes, 4.7-inch and 5.5-inch. Right now, Apple's iPhone 5 and iPhone 5S have four-inch screens. Apple is the only major phone manufacturer with a screen that small. The latest flagship Android phones from Samsung and HTC have five-inch screens. As a result, the iPhone's screen feels small and cramped relative to its Android competition. In addition to enlarging the screen, Apple will make the resolution of the new iPhones significantly higher, said Nikkei. For Apple, this has the potential to be massive. Brian Marshall at ISI said this would be the "mother lode" of upgrade cycles for Apple. The new iPhones, with their larger screens, will be significantly different from older models, and as a result Marshall expects big sales to existing customers. NOW WATCH: 13 Simple Mac Shortcuts To Make You More Productive Please enable Javascript to watch this video // OO.ready(function() { OO.Player.create('ooyalaplayer', 'NpaHcwajpL5n7xscXeo7Ln9gJ3Q4ECLP'); }); //

Summary: The iPhone 6 is coming in September, and it'll be available in two screen sizes-both bigger than the current four inches. At least, that's what a report from Nikkei Asian Review is suggesting, via Business Insider. The story is based on insider accounts regarding the production of LCD panels, which could reportedly begin as soon as April at a number of factories. Current iPhones have 4-inch screens; the iPhone 6 appears poised to come in 4.7-inch and 5.5-inch varieties. That seems to align with earlier word that Apple was considering a larger screen amid a growing market for "phablets," or phone-tablet hybrids. For comparison, flagship phones from Samsung and HTC have five-inch screens, Business Insider notes. The new iPhones' displays will also likely have a much higher resolution, Nikkei reports.

multi_news

en

Write a title and summarize: Intergroup conflict contributes to human discrimination and violence, but persists because individuals make costly contributions to their group’s fighting capacity. Yet how group members effectively coordinate their contributions during intergroup conflict remains poorly understood. Here we examine the role of oxytocin for (the coordination of) contributions to group attack or defense in a multi-round, real-time feedback economic contest. In a double-blind placebo-controlled study with N=480 males in an Intergroup Attacker-Defender contest game, we found that oxytocin reduced contributions to attack and over time increased attacker’s within-group coordination of contributions. However, rather than becoming peaceful, attackers given oxytocin better tracked their rival’s historical defense and coordinated their contributions into well-timed and hence more profitable attacks. Our results reveal coordination of contributions as a critical component of successful attacks and subscribe to the possibility that oxytocin enables individuals to contribute to in-group efficiency and prosperity even when doing so implies outsiders are excluded or harmed. Editorial note: This article has been through an editorial process in which the authors decide how to respond to the issues raised during peer review. The Reviewing Editor' s assessment is that all the issues have been addressed (see decision letter). Conflict between groups of people can profoundly change their demographic, economic and cultural outlook. Across human history, intergroup conflict functioned as a critical change agent and selection pressure that may have shaped the biological preparedness for in-group oriented cooperation and self-sacrifice on the one hand, and out-group hostility and aggression on the other hand (Bar-Tal et al., 2007; Boyd and Richerson, 1982; Choi and Bowles, 2007; De Dreu et al., 2010; Macfarlan et al., 2014). Out-group hostility and aggression serves to subordinate and exploit rivaling out-groups (henceforth out-group attack), and/or to defend the in-group against such hostility from neighboring groups (henceforth in-group defense) (De Dreu et al., 2016a; Halevy et al., 2008; Rusch, 2014a; Rusch, 2014b; Lopez, 2017; Wrangham, 2018). Recent work has showed that individuals are more strongly motivated to contribute to defend one’s own group than to attack out-groups and, importantly, that out-group attacks frequently fail because individual contributions to out-group attacks are poorly coordinated (De Dreu et al., 2016a). Indeed, attacking rivals who are expected to have strong defenses more likely results in failure and waste, than attacking groups expected to be weak and defenseless (De Dreu et al., 2016b; Grossman and Kim, 2002; Goeree et al., 2003). Thus, to succeed in intergroup competition and conflict, group members not only need to contribute to their group’s competitive strength, but they also need to coordinate within their group the intensity and timing of attacks. How group members coordinate behavior into effective joint actions during intergroup competition and conflict remains poorly understood (De Dreu et al., 2016a) and we lack insight into the underlying neurobiological mechanism. Here, we target the neuro-hormone oxytocin as a neurobiological mechanism underlying within-group coordination of out-group attack in dynamic intergroup contests. Studies in ethnography and anthropology have shown that small groups preparing for intergroup conflict build cohesion and commitment through social bonding routines and rituals. Groups selectively invite friends to join a raid (Glowacki et al., 2016), bond like family (Macfarlan et al., 2014), and engage in cultural rituals that simulate self-sacrifice, cooperation and coordination (Xygalatas et al., 2013). Neuroendocrine studies (Burkett et al., 2016; Carter, 2014; Ma et al., 2016b; Samuni et al., 2017) have linked these and related practices to the release of oxytocin, a nine-amino acid neuropeptide. In turn, intranasal administration of oxytocin has been shown to modulate neural responses in brain regions involved in threat detection and reward processing (Ma et al., 2016b; Paloyelis et al., 2016; Wang et al., 2017; Liu et al., 2019). Moreover, in both non-human and human primates, elevated levels of oxytocin via intranasal administration have been linked to a range of cognitive and behavioral effects including within-group conformity, trust, affiliation, and cooperation (Arueti et al., 2013; Aydogan et al., 2017; De Dreu et al., 2010; Madden and Clutton-Brock, 2011; Rilling et al., 2012; Samuni et al., 2017; Stallen et al., 2012; Yan et al., 2018). Whereas these work together point to oxytocin as a possible neurobiological mechanism underlying group coordination, three issues remain unclear. First, we lack empirical evidence for the possibility that oxytocin promotes group-level coordination of collective action in general, and during intergroup competition and conflict in particular. Second, we poorly understand how group members coordinate collective action during intergroup competition and conflict, and whether oxytocin can directly influence coordination and/or the strategy group members use to coordinate. Third, we do not know whether oxytocin differentially modulates tacit coordination within groups when collective contributions are focused on attacking one’s rival, versus defending the in-group against possible attacks by one’s rival. To address these issues, we examined the role of oxytocin in 80 interactive, multi-round contests between three-person attacker and three-person defender groups. Group members on each side made individual contributions to their group pool (aimed at attacking the other side, or at defending against such possible attacks). We provided individuals with real-time feedback on group investments and success after each contest round, which allowed group members to learn and adapt to their rival’s past investments, and use the history of play as a focal point to coordinate their future attacks and defenses. Indeed, when lacking explicit coordination mechanisms such as a leader or decision-making protocols (De Dreu et al., 2016a; Gavrilets and Fortunato, 2014; Hermalin, 1998), groups use social norms and focal points to tacitly coordinate collective action (Halevy and Chou, 2014; Schelling, 1960). In multi-round intergroup contests, the rival’s history of play can serve as a focal point for groups to coordinate their contributions to attack and/or defend (De Dreu et al., 2016b). Thus, when attacking out-groups, group members may coordinate their contributions on their rival’s historical level of defense, and attack when historical defense is low and the target appears vulnerable; and not attack when historical defense is high and the target appears strong and difficult to beat. We expected effects of oxytocin to be stronger during out-group attack than during in-group defense. In-group defense is first and foremost an adaptation to the attackers’ (past) aggression and is typically well-coordinated—individuals fight towards the same goal of self-preservation and group survival. Although there is some evidence that oxytocin may increase protective aggression (for a review see De Dreu and Kret, 2016), administering oxytocin may contribute little to the relatively high baseline levels of contribution and coordination during in-group defense. In contrast, out-group attacks are typically less strong, more variable, and less well-coordinated (De Dreu et al., 2016a), leaving more room for oxytocin administration to influence behavior. We anticipated two possibilities for the effect of oxytocin. On the one hand, oxytocin has been linked to prosociality (Madden and Clutton-Brock, 2011; Rilling et al., 2012; Liu et al., 2019), empathy (Hurlemann et al., 2010; Bartz et al., 2010) and consolation (Burkett et al., 2016). This line of research would lead us to anticipate that oxytocin may enable individuals in attacker groups to coordinate on a peaceful no-attack strategy that is independent of the rivals’ history of defense. On the other hand, oxytocin has been shown to enhance in-group conformity (Aydogan et al., 2017; Stallen et al., 2012; De Dreu and Kret, 2016), increase behavioral coordination and neural synchronization within pairs of individuals performing a joint task (Arueti et al., 2013; Mu et al., 2016), enhance facial mimicry, motor imitation, and neural responses linked to action-intention mirroring (Korb et al., 2016; De Coster et al., 2014; Kret and De Dreu, 2017; Levy et al., 2016), and improve memory and learning from feedback (Striepens et al., 2012; Guastella et al., 2008; Ma et al., 2016a). These functionalities alone and in combination may facilitate coordination on social norms and shared focal points that emerge during group interaction, suggesting that oxytocin may facilitate the use of rival’s history, enable individuals in attacker groups to coordinate better on the level and timing of their attacks, and to efficiently appropriate resources from their out-group. Evidence for this possibility would be consistent with earlier findings that oxytocin shifts the focus from self-interest to in-group interests (De Dreu and Kret, 2016), limits trust and cooperation to in-group members (De Dreu et al., 2010; Ma et al., 2015; Ten Velden et al., 2017), and promotes aggression toward threatening rivals (Madden and Clutton-Brock, 2011; Samuni et al., 2017; Striepens et al., 2012; Ne' eman et al., 2016). We examined these possibilities using a dynamic, fully incentivized Intergroup Attacker-Defender Contest game (De Dreu et al., 2016a). The IADC is an all-pay contest (Abbink et al., 2010; Dechenaux et al., 2015) involving six individuals randomly assigned to a three-person attacker and a three-person defender group. In the IADC game, 3 attackers made individual contributions to the group pool to subordinate the other group and increase gains through victory (but always keep the remaining resources), and 3 defenders contributed to their group pool to defend rival’s attack and protect against loss and defeat (defenders ‘survive’ from left with 0 only if defense succeeds). We created 80 IADC sessions (with N = 480 healthy males); in 40 (40) sessions, participants received intranasal oxytocin (matching placebo) (Figure 1). Each IADC session involved two blocks of 15 investment rounds with real-time feedback in between rounds. For each investment round (Table 1), each individual received an initial endowment of 20 MUs (Monetary Units). Each individual decided the amount (Ii, 0 ≤ Ii ≤ 20) to the group’s pool G (0 ≤ G ≤ 60, GAttacker = IAttacker-1 + IAttacker-2 + IAttacker-3, GDefender = IDefender-1 + IDefender-2 + IDefender-3). Contributions were wasted, but when GAttacker ≤ GDefender, attackers failed and defenders survived and all six individuals kept their remaining endowment (leftovers, 20 – Ii). However, when GAttacker > GDefender, defenders failed and left with 0. The attacker group won and took away defender group’s remaining MU (spoils from winning, 60 – GDefender), which were divided equally among three attacker group members (each attacker member received: (60 – GDefender) /3) and added to their remaining endowments (20 – IAttacker-i). Thus, contributions in the attacker group (GAttacker) and in the defender group (GDefender) reflect the contribution level to out-group attack and to in-group defense, respectively. In one 15-round block, individuals made their decisions individually and simultaneously without communication (i. e. Simultaneous decision-making block). In the other 15-round block (order counterbalanced), individuals within groups made their decisions in sequence: one randomly drawn member made his decision first, followed by the second randomly selected member who was informed about the first member’s contribution, and then the third and final member made his decision (i. e. Sequential decision-making block, De Dreu et al., 2016a; Gavrilets and Fortunato, 2014; Figure 2). The sequential decision-making protocol acts as a ‘coordination device’ that facilitates behavioral coordination within groups (De Dreu et al., 2016a; Gavrilets and Fortunato, 2014; Hermalin, 1998). This treatment thus provides a benchmark to compare groups in the simultaneous decision-protocol who lack an explicit coordination mechanism and have to find other means—such as a shared social norm or the rival’s past defense — to coordinate individual contributions into effective joint action (De Dreu et al., 2016a). We operationalized within-group coordination as behavioral alignment of contribution to the group, indicated by the variance in contributions to group fighting, with lower group-level variance reflecting better coordination. We expected that effects of oxytocin on group coordination would emerge especially under simultaneous rather than sequential decision-making. Before examining within-group coordination, we examined treatment effects on contributions to group pool. Individual contributions were averaged across the three members within each three-person group, and submitted to a 2 (Treatment: Oxytocin vs. Placebo) × 2 (Role: Attack vs. Defense) × 2 (Procedure: Simultaneous vs. Sequential) × 15 (Rounds) mixed-model Analysis of Variance (ANOVA) with Treatment between-sessions. Individuals contributed more under sequential than simultaneous decision-making (M ± SE = 6. 89 ± 0. 20 vs. 6. 47 ± 0. 24; F (1,78) = 5. 109, p = 0. 027, η2 = 0. 061), and somewhat less when given oxytocin rather than placebo (M ± SE = 6. 28 ± 0. 27 vs. 7. 08 ± 0. 30; F (1,78) = 3. 719, p = 0. 057, η2 = 0. 046; marginal significance). Figure 3A showed higher contributions to in-group defense than to out-group attack, especially in earlier rounds (Role, F (1,78) = 287. 903, p < 0. 001; η2 = 0. 787; Role × Round, F (14,65) = 4. 529, p < 0. 001, η2 = 0. 494). Treatment effects also emerged when we examined the number of non-contributors. There were more non-contributors in attacker compared to defender groups (M ± SE = 20. 23 ± 0. 90 vs. 4. 25 ± 0. 44; F (1,78) = 408. 489, p < 0. 001; η2 = 0. 840), and more non-contributors in groups given oxytocin than placebo (M ± SE = 13. 46 ± 0. 90 vs. 11. 01 ± 0. 75; F (1,78) = 4. 345, p = 0. 040; η2 = 0. 053). Crucially, oxytocin increased the number of non-contributors in attacker groups but not in defender groups (Role × Treatment, F (1,78) = 5. 043, p = 0. 028, η2 = 0. 061, Figure 3B). This Role × Treatment effect is especially true when decisions were made simultaneously (F (1,78) = 5. 712, p = 0. 019, η2 = 0. 068) but less so when decisions were made sequentially (F (1,78) = 2. 143, p = 0. 147; η2 = 0. 027). We then examined participants’ decision time when deciding to (not) contribute, we showed that individuals in attacker groups made their decisions to not contribute faster than to contribute (F (1,78) =137. 679, p < 0. 001, η2 = 0. 641). Oxytocin increased the speed with which individuals in attacker groups decided to not contribute (Treatment × Contribute: F (1,77) = 4. 857, p = 0. 031; η2 = 0. 059, Figure 4). Next, we analyzed group-level coordination operationalized as the within-group variance in contributions, with lower variance indicating stronger coordination (De Dreu et al., 2016a). First, there was a Procedure × Role interaction (F (1,78) = 101. 978, p < 0. 001, η2 = 0. 567) showing that sequential decision-protocol facilitated coordination for attack (F (1,78) = 77. 852, p < 0. 001, η2 = 0. 500) and, unexpectedly, reduced coordination for defense (F (1,78) = 39. 268, p < 0. 001, η2 = 0. 335). Importantly, as predicted, oxytocin facilitated group-level coordination (i. e. reduced within-group variance in contributions) of out-group attack but not of in-group defense, especially in earlier rounds (Role × Treatment × Round, F (14,1092) = 1. 753, p = 0. 041, η2 = 0. 022; Figure 5A; Figure 5—figure supplement 1 for similar results of another index of coordination). To examine what strategy attackers given oxytocin coordinated on, we first examined the contest outcomes. As noted, oxytocin may enable groups to coordinate on a peaceful ‘no-attack strategy’, in which case we should find (1) lower victories in attacker groups given oxytocin rather than placebo, (2) the oxytocin effect on the number of non-contributing attackers should not differ when attacks succeed or fail, and (3) no effect of oxytocin on tracking the rival’s defense history. This was not the case. First, the number of victories was similar in attacker groups given oxytocin (M ± SE: 24. 8 ± 1. 8%) and placebo (M ± SE: 26. 6 ± 1. 6%), (F (1,78) =0. 572, p=0. 452; η2 = 0. 007). Thus, rather than making groups coordinate on a peaceful no-attack strategy, oxytocin may enable groups to coordinate on attacking at the right moment with the right force. Indeed, analyses of the spoils and leftovers showed that groups given oxytocin rather than placebo had higher leftovers when attacks failed (t (78) = 2. 609, p=0. 011, Cohen’s d = 0. 581,95% Confidence Interval (CI), 0. 232 to 1. 76, Figure 5B) and somewhat higher spoils when attacks were successful (t (74) = 1. 819, p=0. 073, Cohen’s d = 0. 419,95% CI, −0. 086 to 1. 888, marginal significance, Figure 5C). To illustrate the increased efficiency of attack under oxytocin, attackers’ contribution and payment under the four conditions (i. e. Simultaneous/Sequential x Oxytocin/Placebo) were plotted in Figure 5D using a bootstrapping technique (Davison and Hinkley, 1977). Specifically, a bootstrapped dataset with sample size N = 40 was resampled with replacement separately for each of the four conditions. The mean contribution and payment of the bootstrapped sample was then calculated and saved as a new data point. For each condition, this procedure was repeated for 1000 times to represent the population information. As illustrated in Figure 5D, oxytocin decreased contributions to attack (a shift toward less contribution) but increased payment (a shift toward more payment). The distribution of attacker groups under oxytocin and placebo in a space defined by the two vectors (contribution and payment) indicates a clear separation of oxytocin and placebo treatments (especially when decisions were made simultaneously, that is black dots vs. grey dots). Second, we conducted an ANOVA on the average number of non-contributing attackers, with Treatment (Oxytocin vs. Placebo) as a between-subjects factor, Procedure (Simultaneous vs. Sequential) and Success (Success vs. Failure) as within-subjects factors. There were more non-contributing attackers when attack failed than succeeded (Failure vs. Success: M ± SE = 1. 68 ± 0. 60 vs. 0. 37 ± 0. 05, F (1,74) = 636. 941, p < 0. 001; η2 = 0. 891). Interestingly, we found a significant Treatment × Success interaction on the number of non-contributing attackers (F (1,74) = 6. 345, p = 0. 014; η2 = 0. 075, Figure 5E): Oxytocin increased the number of non-contributing attackers only in failed rounds (Oxytocin vs. Placebo: M ± SE = 1. 84 ± 0. 09 vs. 1. 52 ± 0. 09; F (1,74) = 7. 036; p = 0. 010; η2 = 0. 083) but not in successful attacks (Oxytocin vs. Placebo: M ± SE = 0. 34 ± 0. 06 vs. 0. 40 ± 0. 06; F (1,74) = 0. 448; p = 0. 505; η2 = 0. 006). Third, we examined how attacker groups collectively identified when to attack by creating a past defense parameter α (average defender group’s investment in the last two rounds, that is (Dj-1+Dj-2) /2 on round j) and regressed attacker group’s investments onto α (attack increased when defender groups were vulnerable rather than strong, as indicated by α approaching -1). It showed that attacker groups given oxytocin tracked their rival’s past defense and attacked especially when defenders appeared more rather than less vulnerable (i. e. attack regressed negatively on rival’s historical defense). Specifically, when decisions were made simultaneously, attack regressed more strongly on α when groups received oxytocin (M ± SE: -0. 30 ± 0. 05) rather than placebo (M ± SE: -0. 042 ± 0. 098; t (78) = -2. 334; p = 0. 022, Cohen’s d = -0. 522,95% CI, -0. 482 to -0. 038), and under oxytocin but not placebo, the regression on α was also stronger in simultaneous rather than sequential decision-making (Treatment × Procedure interaction, F (1,78) = 8. 312, p = 0. 005, η2 = 0. 097, Figure 6A). Combined, results suggest that groups given oxytocin created more spoils from winning and had higher leftovers when attacks failed because they better coordinated attack at the right time and with the proper force. Indeed, when decisions were made simultaneously, the more strongly attacker groups relied on tracking parameter α, the lower their within-group variance when contributing (r = 0. 281, p=0. 012, Figure 6B), and the lower within-group variance when contributing, the higher the attacker’s spoils when winning the conflict (r = −0. 328, p=0. 004, Figure 6C). Indirect mediation analyses confirmed that the attacker’s higher spoils under oxytocin was mediated by (i) increased tracking of defender group’s past investments and (ii) concomitant increased within-group coordination (indirect effect = 0. 147, SE = 0. 103; 95% CI, 0. 019 to 0. 511, Figure 6D). To be victorious in intergroup conflict, group members not only need to contribute to their group’s fighting capacity. They also need to coordinate collective action so that they attack when their rival is expected to be weak, and avoid wasting resources on attacking tough defenders. Here we found, using a dynamic intergroup contest between attackers and defenders, that those groups who tracked their defender’s history of play and coordinated their attacks of weak rather than strong defenders wasted less resources on failed attacks and enjoyed greater spoils when winning. In addition, we uncovered that oxytocin serves as a neurobiological mechanism underlying such well-timed and coordinated attacks. Specifically, we found that oxytocin enabled individuals within attacker groups to converge their individual contributions on each other more, to collectively refrain from attacking apparently strong defenders, and effectively attacking weak defenders. These findings emerged when groups lack an explicit coordination device; providing attacker groups with a sequential decision-making protocol as an explicit coordination device substituted oxytocin-induced tacit coordination. Our finding that oxytocin enables within-group coordination of contributions to out-group attacks resonates with two heretofore disconnected sets of findings—that small groups of warriors engage in social bonding and cultural rites (Glowacki et al., 2016; Macfarlan et al., 2014; Schelling, 1960; Wilson and Wilson, 2007; Xygalatas et al., 2013), and that social bonding and synchronized action can trigger the release of oxytocin (Burkett et al., 2016; Carter, 2014; Samuni et al., 2017). Combined with the current results, it suggests that oxytocin might be a potential neurobiological mechanism through which social bonding and performing coordinated rituals can help groups to better coordinate their attacks. Our findings furthermore suggest that such oxytocin-mediated within-group coordination can be substituted by institutional arrangements, such as a sequential decision-making protocol. We speculate that related institutional arrangements, like appointing a leader or having open communication channels can similarly obviate the need for bonding rituals and/or oxytocin to make out-group attack well-coordinated and successful. Neither oxytocin nor the sequential decision-protocol contributed to within-group coordination in defender groups. One possibility is that in-group defense is tacitly well-coordinated because of the stronger alignment of individual interests within defender groups. After all, when defender groups survive an enemy attack, those who did not contribute to in-group defense come out relatively wealthy. But when in-group defense fails, all group members lose regardless of whether they contributed or not. As a result of this stronger common fate in defender groups, individuals contribute spontaneously and tacitly coordinate well on avoiding collective defeat. Exogenous enhancers, whether at the neurobiological or institutional level, appear not necessary. Previous studies provided evidence for the role of oxytocin in intergroup interaction: It can increase the positive view and benign approach of the in-group and has been linked to subtle forms of intergroup discrimination (De Dreu et al., 2010; De Dreu and Kret, 2016; Ma et al., 2015; Stallen et al., 2012; Ten Velden et al., 2017). Without exception, this early evidence was limited to individual-level decision-making, and did not clearly distinguish the distinct motives for contributing to in-group efficiency and out-group hostility. It remained unknown whether and how oxytocin differentially affects attack and defense behavior during intergroup conflict. Using a dynamic attack-defense contest we revealed selective effects of oxytocin on group attacking. As such, the present study provides a new perspective on oxytocin in intergroup conflict by highlighting its functionality for strategic attack (rather than defense). In doing so, we also obtained first-time evidence that in-group coordination for collective action can be tracked to evolutionary preserved neurobiological factors. Our study has two potential limitations. First, it involved only Chinese males as study participants. Whereas we cannot exclude specific cultural effects, findings for the comparison between out-group attack and in-group defense and between sequential and simultaneous decision-making protocols resonate with findings obtained in Western culture, with both male and female participants (De Dreu et al., 2016a). This generates confidence in the generality of the behavioral effects for attack/defense and decision protocols. Furthermore, recent work on the role of oxytocin in in-group cooperation suggests similar effects for both male and female participants (Ten Velden et al., 2017). Thus, and given the absence of strong counter-evidence, we cautiously conclude that current findings may generalize across cultural contexts and apply to male as well as female participants. Second, it is unclear how exogenous administration of oxytocin operates at the neurophysiological level. Whereas some have questioned whether intranasal administration of oxytocin can have a direct impact on brain and behavior (Leng and Ludwig, 2016), recent studies in rodents (Neumann et al., 2013; Tanaka et al., 2018), rhesus macaques (Lee et al., 2018; Modi et al., 2014) and in humans (Paloyelis et al., 2016) collectively suggest that intranasal oxytocin elevates brain-level presence of oxytocin, and impacts behavioral decisions through neural networks involved in threat detection and reward processing (Carter, 2014; Hurlemann et al., 2010; Ma et al., 2016b; Rilling et al., 2012; Stallen et al., 2012; Wang et al., 2017; Liu et al., 2019). In addition, there is some evidence that higher levels of oxytocin in saliva, blood, or urine relate to in-group affiliation and cooperation (Madden and Clutton-Brock, 2011; Samuni et al., 2017) and intergroup discrimination (Levy et al., 2016). Nevertheless, new research is needed to uncover the neurophysiological pathways through which intranasal oxytocin impact human cognition and behavior, and how findings on intranasal oxytocin relate to endogenous oxytocin measured from saliva, urine, or blood samples. Intergroup competition and conflict shape the economic and cultural outlook of groups and societies, and interferes with individual life-trajectories. Success and survival in times of intergroup competition and conflict depend on the extent to which individuals make personally costly contributions and, as shown here, on their ability to coordinate their contributions when attacking out-groups, or defending against threatening out-groups. Both institutional arrangements, such as leading-by-example, and neurobiological mechanisms, such as oxytocin, facilitate behavioral coordination and the effective exploitation of out-group rivals. Indeed, as shown here, providing group members with oxytocin or an explicit coordination device enables them to waste less on failed attacks, and to earn more from their victories. We recruited 486 healthy males, mostly science and engineering students, as paid volunteers. One IADC session (N = 6) was dropped from data analysis because of technical failure. Data from 480 participants (80 IADC sessions, age 18–29 years; M ± SE = 20. 28±0. 09 years) were included in the final data analysis. The data analysis on the current study was conducted on a 6-person-group level, thus we conducted sample size estimation by G*Power to determine the number of groups sufficient to detect a reliable effect. Based on an estimated average small-to-medium effect size of oxytocin effect on social behaviors (d = 0. 28, Walum et al., 2016), 80 6-person groups were needed to detect a significant effect (α = 0. 05, β = 0. 85, ANOVA: repeated measures, within-between interaction, G-Power, Faul et al., 2009). All participants were healthy and had normal or corrected-to-normal vision and no history of neurological or psychiatric disorders. Those who majored in psychology or economics or participated in any other drug study in recent weeks were excluded from participation. Participants were instructed to refrain from smoking or drinking (except water) for 2 hr before the experiment. The experiment involved no deception, and participants were paid for their presence for the experiment (i. e. $10 show-up fee) plus their average earnings in two randomly selected IADC rounds. All participants provided written informed consent to participate after the experimental procedures had been fully explained, and were acknowledged their right to withdraw at any time during the study. All experimental procedures adhered to the standards set by the Declaration of Helsinki and were approved by the Institutional Review Board at the State Key Laboratory of Cognitive Neuroscience and Learning, Beijing Normal University, Beijing, China (protocol number: ICBIR_A_0107_001). Participants were randomly assigned to the intranasal administration of oxytocin or placebo in a double-blind placebo-controlled between-subjects design (Figure 1). For each IADC session, six strangers were invited to the lab at the same time and randomly assigned to six individual cubicles within the same room. Upon arrival, participants first completed questionnaires that measured current mood, empathic capacity, prosocial personality, impulsiveness, subjective socio-economic status, and cooperative personality. Participants then self-administered oxytocin or placebo. After 35 min, participants were given instructions for the IADC game and completed two practice rounds. When they also passed a comprehension check, they played 15 simultaneous rounds and 15 sequential rounds of IADC investments (order of simultaneous and sequential blocks was counterbalanced across sessions, Figure 2). All the experimental instructions used neutral language (e. g. contribution was labeled investment; defense and attack were avoided, and groups were labeled as group A or B). Finally, participants filled out a post-survey for mood measurement and manipulation check. The attacker and defender groups under oxytocin or placebo did not differ in demographic information, mood change, and prosocial-related traits (Supplementary file 1, Table 1A and B). The procedure of oxytocin and placebo administration was similar to previous work that showed oxytocin effects on decision-making behaviors or in-group favoritism (De Dreu et al., 2010; Ma et al., 2015; Rilling et al., 2012; Yan et al., 2018). A single intranasal dose of 24 IU oxytocin or placebo (containing the active ingredients except for the neuropeptide) was self-administered by nasal spray about 35 min before the experimental task under experimenter supervision. A 24 IU dosage is the most commonly used dosage in oxytocin literature (Wang et al., 2017) and recently shown as having more pronounced effects (compared with 12 or 48 IU dose of oxytocin) on behavioral and neural responses (Spengler et al., 2017). The spray was administered to participants three times, and each administration consisted of one inhalation of 4 IU into each nostril. Six participants in the same IADC session were assigned to the same treatment (oxytocin or placebo), so as to avoid potential influence of oxytocin to placebo between individuals. Data were aggregated to the group level, with Role (Attacker vs. Defender), Procedure (Simultaneous vs. Sequential) and Round as within-group variables, and Treatment (Oxytocin vs. Placebo) as a between-group factor. Analyses were performed on (i) contribution (the averaged investment of each round, range: 0–20), (ii) the number of non-contributors (the number of group members making a 0 contribution across a 15-round block, range: 0–45), (iii) variance (within-group variance of each round), (iv) success rate for attack (range 0–100%), (v) the attackers’ leftovers when losing a conflict, (vi) the attackers’ spoils when winning a contest and, finally, (vii) inter-group tracking. The within-group variance is calculated for each decision round, thus reveals the group coordination of contribution at each round, with lower variance indicating stronger coordination. In addition, to complement and validate these analyses, we analyzed (viii) decision time for investment decisions (log 10-transformed decision time), and (ix) within-group coordination as reflected in the Intra-class correlation coefficient. The IADC is an all-pay contest with a single mixed-strategy Nash equilibrium (Abbink et al., 2010; Dechenaux et al., 2015). With two three-person groups, each member assumed to have risk-neutral preferences and having a discretionary resource of e = 20 MU to invest from, the IADC game has unique mixed-strategy Nash equilibrium with out-group attack (in-group defense) expected to average 10. 15 (9. 77) across rounds, and attackers (defenders) should win (survive) 32. 45% (67. 55%) of the contest rounds (De Dreu et al., 2016a). Across the 15 rounds of simultaneous decision-making under placebo, both out-group attack and in-group defense fell below the Nash-equilibrium (t (39) = −11. 30, p < 0. 001 and t (39) = −4. 18, p < 0. 001). Attackers defeated defenders in 22. 08% (SE = 2. 2%) of their attacks, which is below the Nash success-rate (t (39) = −4. 734, p < 0. 001). Oxytocin did not influence deviations from rationality (attack: t (39) = −15. 78, p<0. 001; defense: t (39) = −6. 022, p<0. 001; success-rate: t (39) = −6. 615, p < 0. 001). We showed that oxytocin increases the number of non-contributors in attacker groups. To further reveal how oxytocin influenced the non-contributing decisions, we examined participants’ decision time by calculating the response time separately for the round that participants decided to or not to contribute. This analysis was conducted only on the attacker group because (1) there were very few rounds (9%) in which defenders decided not to contribute; (2) oxytocin selectively influenced the number of non-contributors in attacker groups. Since the distribution of decision times is heavily right skewed, linear regression is not appropriate. Similar to our previous study (Ma et al., 2015), we first log 10-transformed decision times in all the analyses that involved decision times. The log 10-transformed decision time was submitted into a 2 (Contribute: Yes vs. No) × 2 (Treatment: Oxytocin vs. Placebo) ANOVA for the attacker group. The decisions of which the response time exceeded 180 seconds were excluded in final data analysis (0. 51% of the decisions, due to network problem during the experiment). To complement and cross-validate the results for within-group variance as an indicator of within-group coordination, we computed another related index — the intra-class correlation. The intraclass correlation (ICC, De Dreu et al., 2016a; LeBreton and Senter, 2008) operates on a data structured as groups, rather than data structured as paired observations. ICC describes the amount of statistical interdependence within a group (group cohesion), reflects how strongly individuals’ contributions in all rounds in the same group resemble each other, that is how similar group members are in their contributions to the group pool across rounds. Higher ICC values in essence mean group members are more similar to each other in the contributions made to their group pool. A Treatment × Role × Procedure ANOVA showed effects for Role (F (1,78) = 43. 090, p < 0. 001, η2= 0. 356), Procedure (F (1,78) = 166. 199, p < 0. 001, η2 = 0. 681) and for the Role x Procedure interaction (F (1,78) = 147. 586, p < 0. 001, η2 = 0. 654). Fitting the results for within-group variance reported in the Main Text (Figure 5A), results further showed that oxytocin increased attacker groups’ ICC under simultaneous decision-making (t (78) = 2. 057, p = 0. 043, Cohen’s d = 0. 460, Figure 5—figure supplement 1; not under sequential block: t (78) = -0. 179, p = 0. 859, Cohen’s d = 0. 040), but did not influence defender groups’ ICC (simultaneous: t (78) = 0. 485, p = 0. 629, Cohen’s d = 0. 108; sequential: t (78) = 0. 389, p = 0. 698, Cohen’s d = 0. 087). To test whether attacker groups made their contributions based on tracking of their rival’s historical level of defense, we built a multiple linear regression of attacker groups’ average contribution on round j (referred as Aj, with j range from 3 to 15) as a function of average level of defense of last rounds (calculated as (Dj-1 +Djj-2) /2, regression weight referred as α). The regression weight α was Fisher’s z transformed for statistical analysis. Similar to a previous study (De Dreu et al., 2016b), we also included another parameter: defense change of the last and before-last rounds, calculated as (Dj-1 - Dj-2), regression weight referred as β. However, the analysis on β failed to show significant main effects of Treatment/Procedure or their interaction (ps >0. 1). To complement the analysis of attacker groups, we also examined whether and how defender groups tracked the historical level of attack in their rivals. This showed that defender groups relied more on α to track attacker groups under simultaneous (relative to sequential) decision-making. The main effect of Treatment and its interaction with Procedure were not significant (ps >0. 05). Mediation analysis. We performed formal mediation analyses to examine through which route oxytocin increased attacker group’s spoils from winning a conflict. Two potential mediators were included in the mediation model: one is tracking coefficient (α) the other is within-group variance. Four different regression models were constructed, as shown below: (1) Y=β11X+β10 (2) M1−β21X+β20 (3) M1=β31X+β32MI+B30 (4) Y=β41X+β42MI+B43M2+B40 In these models, X is the independent variable (Treatment, dummy-coded, 0 for placebo and one for oxytocin), M1 is the first mediator (the weight for attacker group’s tracking of the historical defense, the tracking coefficient, α), M2 is a second mediator (attacker group’s within-group variance), and Y is the dependent variable (attacker groups’ spoils from winning a conflict, reported in the Main Text, and DV with the sum of attacker groups’ spoils from winning a conflict and leftovers from losing a conflict reported in the SI). A resampling method known as bootstrapping was used to test the direct and indirect path. Bootstrapping is a nonparametric approach to effect-size estimation and hypothesis testing that is increasingly recommended for many types of analyses, including mediation (Mackinnon et al., 2004; Shrout and Bolger, 2002). Rather than imposing questionable distributional assumptions, bootstrapping generates an empirical approximation of the sampling distribution of a statistic by repeated random resampling from the available data, and uses this distribution to calculate p-values and construct confidence intervals (5000 resamples were taken for these analyses). Moreover, this procedure supplies superior CIs that are bias-corrected and accelerated (Preacher et al., 2007). Results are summarized in Figure 6D, Figure 6—figure supplement 1, Supplementary file 1, Table 1C and D. As can be seen, multistep mediational analysis showed that the oxytocin effect on increasing attacker group’s spoils from winning the conflict plus leftovers from losing the conflict was mediated by its effect on increasing tracking of defenders’ history so as to increase within-group coordination.

Title: Oxytocin promotes coordinated out-group attack during intergroup conflict in humans Summary: Conflict between groups is a recurring theme in human history. We tend to form social bonds with others who share the same characteristics as ourselves, whether that is nationality, ethnicity, or supporting the same football team. Individuals that belong to the same group as us comprise our 'in-group'. All other individuals make up our 'out-groups'. Competition and conflict with out-groups - from benign sporting rivalry to warfare - has a key role in shaping human cultures and societies. Such conflict often requires individuals to act in ways that harm their own self-interests. It also requires them to coordinate their actions with other members of their in-group. How does our biology drive this behavior? When small groups prepare for conflict with other groups, they often perform social bonding routines and rituals. These trigger the brain to release a hormone called oxytocin into the bloodstream. Known as the 'love hormone', oxytocin helps promote pair bonding as well as social bonding with in-group members. Studies in both humans and monkeys show that boosting oxytocin levels artificially via a nasal spray makes individuals more trusting and cooperative. But Zhang et al. now show that the 'love hormone' also helps individuals launch more coordinated 'attacks' on out-groups. In a study involving a multi-round economic contest game between groups of 'attackers' and 'defenders', oxytocin did not make attackers less aggressive. Instead it enabled them to better coordinate their attacks. Each contest game involved three attackers individually contributing money to a group pool to outbid the other group and win more money, and three defenders making similar contributions to their own group pool to defend it against the rivals' attacks and protect themselves from losing all their money. Attackers who used an oxytocin nasal spray were better at tracking their rivals' defensive strategies than attackers whose nasal spray contained a placebo. Under the influence of oxytocin, the attackers timed their strikes to occur when their rivals were vulnerable. Over time, the oxytocin users became better at coordinating their behavior with other members of their in-group. This resulted in more earnings. Success - and even survival - in intergroup conflicts depends on how willing individuals are to make contributions that incur a personal cost. They also depend on how well individuals coordinate their contributions. Social strategies, such as leading by example, and neurobiological mechanisms such as oxytocin can both help achieve the coordination needed to exploit out-group rivals.

lay_elife

en

Summarize: This application claims benefit of provisional application Ser. No. 60/043,089 filed Apr. 15, 1997. FIELD OF THE INVENTION The present invention relates generally to sleeves, jackets, covers, tubes, pipes, hoses, wraps, tapes, wire looms and conduits for use with cords, cables or wires. The present invention relates more particularly to sleeves or jackets, which provide protection to, and increase manageability of, cords, cables or wires, especially power cords for portable electrical tools or appliances that typically require relatively long cords in actual use. SUMMARY OF THE INVENTION It is a primary object of the present invention to provide a lightweight low-cost sleeve that can protect devices such as power cords, cables or wires, such as the relatively long power cord typically used with electric hedge trimmers. Another related object is to provide such an improved sleeve that is capable of enhancing the manageability of devices such as power cords or wires. An additional object is to provide such an improved sleeve that is capable of increasing the user&#39;s awareness regarding the presence of devices such as power cords, cables or wires. A further object is to provide such a device that protects against general wear and tear on relatively long power cords used with certain electrical tools or appliances such as hedge trimmers, edging trimmers, floor buffers and vacuum cleaners. Other objects and advantages of the invention will be apparent from the following detailed description and the accompanying drawings. In accordance with the present invention, the foregoing objectives are realized by providing a sleeve to surround, or to incorporate with, in whole or in part, the device to be affected. The sleeve is typically used with a portable electric tool having a driven element and an electrical power cord for connecting the tool to an electrical power source. The sleeve is adapted to fit onto at least a portion of the power cord and has a size, shape and material that protects the cord from damage in the event of accidental contact with the driven element. The protective sleeve has a relatively large cross-section compared to the cross-section of the power cord or other element being protected. The invention reduces the likelihood of the power cord or other element being introduced into tools or appliances having moving or reciprocating parts, to prevent damage to both the cord or other protected element and/or the apparatus having the moving parts. This in turn thus prevents electrical hazards as well as maintaining the operability of the apparatus with the moving parts. Furthermore, the sleeve provides rigidity to the cord or other protected element to aid in the manageability of both the cord and the powered device. The invention also allows for preventing the entanglement of the device with its corresponding apparatus as described above. In addition, the invention&#39;s rigid exterior prevents abrasion of the device surrounded by the invention. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a drawing of a hedge trimmer and power cord that could be used with a sleeve embodiment of the present invention. FIG. 2 is an enlarged cross-section of the sleeve and power cord taken generally along line 2--2 in FIG. 1 but includes an enlarged fragmentary side elevation view of a portion of the hedge trimmer blades shown in FIG. 1. FIG. 3 is a drawing, similar to FIG. 1, of a hedge trimmer and a power cord that could be used with an expanded cylindrical sleeve embodiment of the present invention. FIG. 4 is a drawing, similar to FIG. 2, with a cross-section taken generally along line 4--4 in FIG. 3. FIG. 5 is a drawing, similar to FIG. 1 and FIG. 3, of an alternative embodiment of the present invention wherein the device is partially disposed outside of one of the cylindrical sleeves of the present invention. FIG. 6 is a drawing, similar to FIG. 2 and FIG. 4, with a cross-section taken generally along line 6--6 in FIG. 5. FIG. 7 is a drawing, similar to FIG. 1, FIG. 3 and FIG. 5 of an alternative embodiment of the present invention wherein the device is separated into multiple strands, each strand being enclosed in, or adjacent to, one of the cylindrical sleeves of the present invention such that the sleeve protects the strands from damage from the corresponding apparatus. FIG. 8 is a drawing, similar to FIG. 2, FIG. 4 and FIG. 6, with a cross-section taken generally along line 8--8 in FIG. 7. FIG. 9 is a drawing of another embodiment of the present invention, similar to FIG. 1, FIG. 3, FIG. 5 AND FIG. 7, of a corrugated sleeve surrounding an expanded polymeric material. FIG. 9a is an enlarged section taken along line 9a--9a in FIG. 9. FIG. 10 is a drawing, similar to FIG. 2, FIG. 4, FIG. 6 AND FIG. 8, with a cross-section taken generally along line 10--10 in FIG. 9. FIG. 11 is a drawing of yet another embodiment of the present invention, similar to FIG. 1, FIG. 3, FIG. 5, FIG. 7 and FIG. 9, of a pliable jacket surrounding an expanded polymeric material. FIG. 12 is a drawing, similar to FIG. 2, FIG. 4, FIG. 6, FIG. 8 and FIG. 10, with a cross-section taken generally along line 12--12 in FIG. 11. DESCRIPTION OF THE PREFERRED EMBODIMENT While the invention is susceptible to various modifications and alternate forms, specific embodiments thereof have been shown by way of examples in the drawings and will be described in detail. It should be understood, however, that they are not intended to limit the invention to the particular forms described, but on the contrary, the intention is to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the invention. Turning now to the drawings, FIG. 1 is a drawing of a wire loom or corrugated hose, shown as sleeve 101, preferably resilient, semi-rigid, lightweight, and made from a polymeric material with fire retardent properties. Sleeve 101 partially surrounds an electric power cord 103 that corresponds to a typical electrically powered hedge trimmer 104. In a preferred embodiment, sleeve 101 has a slit extending longitudinally along sleeve 101. The slit allows for easily placing sleeve 101 over power cord 103 by pulling away sleeve 101 at the slit and inserting power cord 103 into the hollow region within sleeve 101. In an alternative embodiment, sleeve 101 has a diameter sufficiently large enough to allow sleeve 101 to slide over the plug or receptacle of power cord 103. In this embodiment, the user or manufacturer would simply slide sleeve 101 over the plug or receptacle and feed power cord 103 through the hollow region within sleeve 101. Alternatively, the plug or receptacle could be installed on power cord 103 after sleeve 101 has been installed over power cord 103. The invention also contemplates any other method of placing sleeve 101 over power cord 103. Sleeve 101 is attached to power cord 103 at region 101a so as to fix the relative longitudinal positions of sleeve 101 and power cord 103. Sleeve 101 is preferably attached to power cord 103 by a ratcheting pull-tie, cable tie or clamp that surrounds sleeve 101 or passes through holes in sleeve 101 and clinches sleeve 101 to power cord 103 thereby preventing longitudinal movement of sleeve 101 relative to power cord 103. The tie or clamp may be loosened to allow the sleeve to be adjusted, or moved longitudinally on the cord, and then retightened, in order to configure it for use with different apparatuses. In an alternative embodiment, sleeve 101 is attached to power cord 103 by a grommet disposed in sleeve 101, around the enclosed power cord 103, such that sleeve 101 can be clinched around the grommet and thereby prevent longitudinal movement of sleeve 101 relative to power cord 103. Alternatively, the grommet may be replaced with a bushing, reducer or adapter. In another alternative embodiment, sleeve 101 is attached to power cord 103 by adhesive disposed between a portion of sleeve 101 and power cord 103, thereby preventing longitudinal movement of sleeve 101 relative to power cord 103. The invention also contemplates any other method of securing sleeve 101 to power cord 103 that prevents longitudinal movement of sleeve 101 relative to power cord 103. As can be seen most clearly in FIG. 2, the outside diameter of sleeve 101 is larger than the distance across the void in blade 106 measured between the surfaces 106a and 106b. Therefore, as sleeve 101 is introduced into this void, the semi-rigid properties of sleeve 101 prevent blade 106 from penetrating sleeve 101, thereby protecting power cord 103. Moreover, as sleeve 101 proceeds into the void, sleeve 101 is stopped, because of its diameter, after traveling only a short distance. Thus, sleeve 101 is prevented from contacting blade 107, thereby reducing the likelihood of damage to sleeve 101, power cord 103 and hedge trimmer blades 106 and 107. Referring again to FIG. 1, segment 103a of power cord 103 need not be enclosed by sleeve 101 because the length of segment 103a is such that it cannot extend from cord attachment region 104a to blades 106 and 107 of hedge trimmer 104. The segment 103b of power cord 103 is not enclosed by sleeve 101 because sleeve 101 need not extend along the entire length of power cord 103, to its end 105, in order to significantly reduce the likelihood of segment 103b contacting the blades 106 and 107 while the hedge trimmer 104 is in typical use. In typical use, segment 103b of power cord 103 is disposed on the ground, while only the segment of power cord 103 enclosed by sleeve 101 is suspended above the ground and potentially in proximity to hedge trimmer 104 and blades 106 and 107. FIG. 3 and FIG. 4 show an alternative embodiment of the present invention wherein a cylinder composed of an expanded polymeric material, shown as sleeve 201, partially surrounds power cord 203. Therefore, referring to FIG. 4, as sleeve 201 is introduced into the void between blade surfaces 206a and 206b, the sleeve 201 is stopped, because of its diameter, after traveling only a short distance. Thus, sleeve 201 is prevented from contacting blade 207, thereby reducing the likelihood of damage to sleeve 201, power cord 203 and hedge trimmer blades 206 and 207. In a preferred embodiment, sleeve 201 has a slit extending longitudinally along sleeve 201. The slit allows for easily placing sleeve 201 over power cord 203 by pulling away sleeve 201 at the slit and inserting power cord 203 into the slit. In an alternative embodiment, sleeve 201 has a hollow center with an inner diameter sufficiently large enough to allow sleeve 201 to slide over the plug or receptacle of power cord 203. In this embodiment, the user or manufacturer would simply slide sleeve 201 over the plug or receptacle and feed the cord through the hollow center within sleeve 201. Alternatively, the plug or receptacle could be installed on power cord 203 after sleeve 201 has been installed over power cord 203. The invention also contemplates any other method of placing sleeve 201 over power cord 203. Sleeve 201 is attached to power cord 203 so as to fix the relative positions of sleeve 201 and power cord 203. Sleeve 201 is preferably attached to power cord 203 by at least one ratcheting pull-tie, cable tie, band, or clamp that surrounds a portion of sleeve 201, as depicted at region 201a of sleeve 201 in FIG. 3, and clinches sleeve 201 to power cord 203, thereby attaching and preventing movement of sleeve 201 relative to power cord 203. The tie, band or clamp may be loosened to allow the sleeve to be adjusted, or moved longitudinally on the cord, and then retightened, in order to configure it for use with different apparatuses. In an alternative embodiment, sleeve 201 is attached to power cord 203 by at least one grommet disposed in sleeve 201, around the enclosed power cord 203, such that sleeve 201 can be clinched around the grommet and thereby prevent movement of sleeve 201 relative to power cord 203. Alternatively, the grommet may be replaced with a bushing, reducer or adapter. In another alternative embodiment, sleeve 201 is attached to power cord 203 by adhesive disposed between a portion of sleeve 201 and power cord 203 thereby preventing movement of sleeve 201 relative to power cord 203. The invention also contemplates any other method of securing sleeve 201 to power cord 203 that prevents movement of sleeve 201 relative to power cord 203. Referring again to FIG. 3, segment 203a of power cord 203 need not be enclosed by sleeve 201 for the reasons stated above; namely, because the length of segment 203a is such that it cannot extend from cord attachment region 204a to blades 206 and 207 of hedge trimmer 204. The segment 203b of power cord 203 is not enclosed by sleeve 201 because, as stated above, sleeve 201 need not extend along the entire length of power cord 203, to its end 205, in order to significantly reduce the likelihood of segment 203b contacting the blades 206 and 207 while the hedge trimer 204 is in typical use. In typical use, segment 203b of power cord 203 is disposed on the ground, while only the segment of power cord 203 enclosed by sleeve 201 is suspended above the ground and potentially in proximity to hedge trimmer 204 and blades 206 and 207. FIG. 5 and FIG. 6 show an alternative embodiment of the present invention wherein power cord 303 is partially disposed outside of a protective flexible cylinder 301. Power cord 303 is protected from damage from blade 307 due to the diameter of the cylinder 301. Referring to FIG. 6, the diameter of cylinder 301 is such that the cylinder 301 is stopped after entering the void between blade surfaces 306a and 306b and before power cord 303 reaches blade 307. Thus, power cord 303 is protected from damage from blade 307 despite being partially disposed outside of the cylinder 301. FIG. 7 and FIG. 8 show an alternative embodiment of the present invention wherein power cord 403 is separated into multiple strands 403c, 403d and 403e, each strand being enclosed in, or adjacent to, a protective flexible cylinder 401 such that the cylinder protects the strands from damage from blades 406 and 407 of hedge trimmer 404. The strands of power cord 403 are protected from damage from blade 407 because the diameter of the cylinder 401 is such that the cylinder is stopped after entering the void between blade surfaces 406a and 406b and before any strand of power cord 403 reaches blade 407. Thus, the strands of power cord 403 are protected from damage from blade 407 despite some of the strands being partially disposed outside of the cylinder 401. FIG. 9 and FIG. 10 show an alternative embodiment of the present invention wherein power cord 503 disposed within expanded polymer 508 and expanded polymer 508 is surrounded by a wire loom or corrugated hose shown as sleeve 501. Expanded polymer 508 will increase the crush resistance of the present invention. Sleeve 501 will increase the surface strength and abrasion resistance of the present invention. In a preferred embodiment, expanded polymer 508 has a slit extending longitudinally along expanded polymer 508. The slit allows for easily placing expanded polymer 508 over power cord 503 by pulling away expanded polymer 508 at the slit and inserting power cord 503 into the slit. A slit also extends longitudinally along sleeve 501. This slit allows for easily placing sleeve 501 over expanded polymer 508 by pulling away sleeve 501 at the slit and inserting expanded polymer 508 into the hollow region within sleeve 501. The slit of sleeve 501 would then be turned 180 degrees in relation to the slit of expanded polymer 508 so that the slits are no longer aligned thereby preventing power cord 503 from escaping from expanded polymer 508 or sleeve 501. At least one ratcheting pull-tie, band, clamp or cable tie 501a would then be installed over sleeve 501 to hold the invention in place over power cord 503. As shown in the sectional view in FIG. 9a, the cable tie 501a compresses the expanded polymers tightly against the power cord 503 to hold the sleeve 501 in place. In an alternative embodiment, the expanded polymer would be extruded around power cord 503 and then sleeve 501 would be slid over, and attached by adhesive to, expanded polymer 508. In another alternative embodiment, power cord 503 would be inserted in sleeve 501 and then sleeve 501 would be filled with expanded polymer 508. Alternatively, power cord 503 could be inserted into a slit in expanded polymer 508 and then sleeve 501 could be slid over expanded polymer 508 and power cord 503. Adhesive, cable ties, or pull-ties, as described previously, are then installed. The invention also contemplates any other method of placing expanded polymer 508 and sleeve 501 over power cord 503. FIG. 11 and FIG. 12 show another alternative embodiment of the present invention wherein power cord 603 is disposed within expanded polymer 608 and expanded polymer 608 is surrounded by a pliable jacket shown as jacket 601. The power cord 603 is placed, into the expanded polymer 608 by any of the previously described methods. The pliable jacket 601, composed of a heat shrinkable material, is then easily placed over the expanded polymer 608, along with the power cord 603. Heat is then applied to jacket 601 to shrink jacket 601 onto expanded polymer 608, thereby preventing relative movement between power cord 603, expanded polymer 608 and jacket 601. In an alternative embodiment, the jacket 601, could be composed of an extrudable polymer and be extruded directly around the expanded polymer 608 after the power cord 603 had been disposed into the expanded polymer 608 by one of the previously described methods. Alternatively, the jacket 601 could be applied by wrapping it around expanded polymer 608, either in a circular or spiral fashion, and being affixed by an adhesive or a fusion process or by one of the tie methods described previously. The above references to power cord 103, 203, 303, 403, 503, and 603 are meant to encompass both extension-type cords and power cords manufacturers include with, or as a part of, their apparatuses, or sell separately. In addition, the sleeves of the present invention can be used with cords for apparatuses such as floor sanders, buffers, and vacuum cleaners with rotating brushes; hand-held saws, drills, nailers, sanders, and buffers; and mowers, trimmers, and edgers. The sleeves of the present invention may also have other cross-sectional shapes such as square, rectangular, semicircular or half-elliptical. The color of the sleeves of the present invention may also be varied to contrast with the background associated with the particular apparatus, e.g., the green bushes associated with hedgers or the white walls associated with drills. Furthermore, the sleeves of the present invention are of various lengths to facilitate particular applications, e.g., indoor and outdoor applications. Additional benefits achieved by the present invention include, but are not limited to, the following. The larger diameter of the sleeve of the present invention compared with a power cord will cause an apparatus to push a power cord using the present invention out of the way rather than entangling the cord, cutting the cord, etc. The larger size of the sleeve compared with a power cord and the contrasting color of the sleeve compared with the cord and the background associated with the apparatus will increase the user&#39;s awareness of the sleeve and cord, thereby reducing the likelihood of damage to the sleeve or cord. Moreover, the increased rigidity of the sleeve compared with a power cord will increase the manageability of a power cord using the present invention. The increased rigidity and size of the protected cord assists in managing the cord to keep it out of the way without becoming entangled with itself or other objects. Also, the protected cord tends to ride on the top of grass or bushes rather than falling down into the grass or bushes. The fact that the protective sleeve can be moved relative to the cord allows the cord to be easily inspected for wear or damage along its length. Finally, the protective sleeve reduces general wear and tear on the power cord.

Summary: A sleeve for surrounding a power cord, in whole or in part, for apparatuses such as hedge trimmers. The sleeve, preferably composed of a lightweight polymeric material in expanded, corrugated or similar form, has relatively large radial dimensions compared to the cord and therefore resists the insertion of the sleeve and the cord into apparatuses (such as a hedge trimmer&#39;s cutting blades) thereby preventing damage to the sleeve and the cord and preventing other undesired results. In addition, the relatively large size of the sleeve tends to increase the user&#39;s awareness of the sleeve and cord. Also the sleeve&#39;s increased rigidity compared to the cord aids in preventing the cord from being entangled in the apparatus and assists in managing and manipulating the cord. The sleeve is also lightweight and flexible enough so as not to constrain the intended function of the cord.

big_patent

en

Summarize: INFphoto.com Everybody's talking about Shiloh Jolie-Pitt's boyish haircut and clothes, saying they're bad for a little girl. Are the critics right? —Mayyis, via the Answer B!tch inbox The world is freaking out, completely freaking out, that Brangelina's 3-year-old girl has a "boyish" haircut and clothes reportedly picked out from the boy's sections of department stores. Brad Pitt also has said Shiloh prefers to answer to boy's names, like John, causing groups like the conservative Focus on the Family to condemn, condemn, condemn. But is this the gender apocalypse we're supposed to believe? Well......of course not. I'm not one to defend celebrities overmuch—they and their puppy-crushing publicity minions have never impressed me, thanks—and Brangelina aren't necessarily the perfect parents, dragging the kids across the planet like they do. But in this case, the public needs to, as one child development expert so neatly put it, "get a life." Yes, Shiloh has a relatively new, short cut—oddly similar to the style currently sported by Vanity Fair Hollywood issue cover girls Mia Wasikowska and Carey Mulligan. Could it be that Shiloh wants to be Carey Mulligan? Or maybe Mia wants to be a boy named John. That, apparently, is what passes for logic in the tabloids these days. For the record, child development experts say Shiloh's boy togs fall well within the realm of healthy and normal. "As a culture, we need to have explanations to everything and get frightened when things just are as they are," child psychologist Jennifer Hartstein tells me. "Shiloh has two older brothers and could very well be emulating them. It's great that her parents are willing to let her explore all aspects of herself and encourage her to express herself as she chooses." Shiloh could also simply identify more with Pitt than Jolie at this stage of her young life, or maybe she just likes boy clothes right now. As child development specialist and ParentsAsk.com contributor Betsy Brown Braun noted to me, boy toddlers often express an interest in girly things at that age as well, asking to wear Mommy's nail polish or a sister's barrettes. "Children experiment with all kinds of clothing and behavior as they figure out who they are and who they want to be," she tells me. "It has nothing to do with sexuality; it has everything to do with relationships and the people with whom the child is identifying." Can we criticize something else now? _________ And on the other hand, Suri Cruise wears high heels. Life & Style Weekly Have you heard about the terrible things Angelina Jolie and Brad Pitt have been doing to their daughter Shiloh? The horrifying odyssey began this winter, when paparazzi snapped photos of the preschooler in Paris sporting jeans, a pullover, and -- zut alors! -- a short, breezy haircut. Ever since, the tabloids have been stewing with concern for the child, reaching a pitch yesterday when Life & Style published a cover story that agonized, "Why is Angelina turning Shiloh into a BOY? Is it harming the 3-year-old?" The story goes on to quote such authorities as a stylist for VH1 who decrees that "Shiloh is pushing the boundaries of a tomboy look and crossing over to cross-dresser territory," and a representative from Focus on the Family who says, "Little girls have never been women before. They need help; they need guidance of what that looks like. It's important to teach our children that gender distinction is very healthy." Getting fashion advice from Focus on the Family: About as wise as getting marital advice from Alec Baldwin. On the Hollywood Life blog, meanwhile, the ever-hyperventilating tabloid guru Bonnie Fuller asked recently, "So Brad and so Angelina -- what’s up with the cross-gender dressing for Shiloh? Did YOU both want another boy, not a girl? Maddox and Pax weren’t enough? Aren’t you worried that you’re going to confuse little Shiloh? Give her gender identity issues? Isn’t it hard enough to grow up without your parents dressing you like the opposite sex?" Yes, Shiloh, your parents are MONSTERS. The New York Daily News took a somewhat more restrained view of the issue, noting yesterday that Shiloh's "ultra-boyish attire" is only a problem if, according to psychologist Lisa Rene Reynolds, "they are trying to bend gender roles in order to be politically correct," since "that could lead to self-esteem issues and role and gender confusion later on." It's easy to laugh at all the furor over one little girl's hair -- and believe me, I do, heartily -- but the hand-wringing over Shiloh says a hell of a lot about how eager we are to narrowly define sex roles, and how easy it is to incite outrage when we transgress in the slightest. Shiloh, that poor girl, may not be the über fashionista that Suri Cruise is, but guess what? Go to a playground sometime, and see how well you fare identifying the gender of any little kid who isn't in a fairy costume or a football jersey. Oh, to have a dollar for every parent who's put a foot in the mouth over some cherub in a snowsuit. Which leads to the question -- who, by the way, decided that short hair and pants were the exclusive domain of boys? Keira Knightley, Natalie Portman, Halle Berry, Victoria Beckman and, uh, every other woman who's ever cut her hair are going to be pissed when they hear about this. Likewise, say what you will about parents who force a gender-neutral identity on their kids, but it's pretty ridiculous to go straight to j'accuse! town every time a tyke isn't all decked out in extreme parodies of femininity -- or, for that matter, masculinity. You think all the ink given to Shiloh is crazy? Ever seen what happens when a boy dares to flout convention and wear long hair? The outrage! Mostly, though, I have to wonder if any of the critics of Shiloh's casual look have any firsthand experience with the daily nightmare that is little girl hair. The tears! The snarls! The DRAMA. If I had as many kids as Angelina Jolie does, they'd be getting military-grade buzz cuts every week. Short hair isn't always a way of subverting the patriarchy; it isn't even just a cute fashion statement. When you've got children, it's practical as hell. Less hair equals less places for gum to get stuck. I have two daughters myself, both of whom I kept in pixie-ish styles for as long as they would stand it. The elder is now a superfemme who wears tutus to school; the younger has a strictly self-imposed uniform of tight ponytails and jeans. Because, duh, they may be girls, but they're also individuals. And though we parents -- whether we're tabloid superstars or regular slobs -- are buying our children's outfits and helping them button their sweaters, our kids are the ones who need the freedom to figure out who they are. Identity is a lot more complicated than hair length or wardrobe color. You can't be comfortable in your own skin if you're not comfortable in your own clothes. Shiloh may not yet be be able to tie her shoes, but from the looks of things, she's already figured that much out. Which puts her light years ahead of a whole lot of her critics. Brangelina—what are you doing to poor Shiloh Jolie-Pitt? Your 3 1/2-year-old daughter is getting dressed in boys clothes so often by you that the New York Post even described her today as your “son.” And no wonder. She was photographed in daddy Brad Pitt‘s arms, heading in to the Broadway show, Mary Poppins, on Jan. 3, wearing a boy’s (literally) Burton ski cap and black puffy jacket. In recent photos she’s been decked out in a fedora, tie, camouflage pants, boy vest, pirate sword, navy knit skull and crossbones hat, black jeans, gray jackets, black and white skull socks and sneakers. Even the stuffed animal she carries is blue. Never ever is Shiloh dolled up in anything remotely girlish. Her blond hair is hidden under hats or left unbrushed and pushed to the side of her face. Her sister Zahara Jolie-Pitt, however, is allowed to have her girly touches. HER Mary Poppins hair was pulled into a purple barrette and a pretty bracelets escaped from under the arm of her coat. And you’re not dressing your little boys like girls! So Brad and so Angelina—what’s up with the cross-gender dressing for Shiloh? Did YOU both want another boy, not a girl? Maddox and Pax weren’t enough? Aren’t you worried that you’re going to confuse little Shiloh? Give her gender identity issues? Isn’t it hard enough to grow up without your parents dressing you like the opposite sex? A shrink says yes. “Angelina has said she was bisexual in public—this is her bisexuality coming through. She’s saying “I’m not going to teach my daughter gender—let her pick, believes psychologist, Dr. David Eigen. But will it confuse her? “Yes,” says Dr. Eigen. “She is being guided into a bisexual role. Her mother is projecting this onto this particular child—she has chosen her as her favorite. I think this is an issue.” Such an issue that Shiloh is already insisting she be called by a boy’s name, “John.” Brad apparently told Oprah that Shiloh insists on being called “John, I’m John,” he explained, “It’s a Peter Pan thing.” Peter Pan Thing, my ahem! Brad, does Shiloh even know what the color pink is? Has she even seen it? Why do you let little Shiloh be dressed this way? “All I can say is that Brad must be whipped if he allows this,” believes Dr. Eigen. Wow! Brad you’re whipped! Now, come on—time to get up your gumption for the sake of your daughter and let her be a girl, if she wants to be. –Bonnie Fuller

Summary: Can the media get off Shiloh Jolie-Pitt's case and let the kid be a tomboy in peace? That's what Gawker wants to know now that several publications and blogs have skewered the toddler for her lack-of-frilly attire. "What's up with the cross-gender dressing?" sniffed hysterical tab queen Bonnie Fuller, who seems to have started it all in her Hollywood Life blog. Early Show co-anchor Maggie Rodriguez fretted that Shiloh's preference for boyish clothes might "confuse a child about her gender identity." In fact, Shiloh's attire is no odder than 3-year-old Suri Cruise already donning high heels, point out child psychologists. "Children experiment with all kinds of clothing and behavior as they figure out who they are," an expert tells E! Online. While it might be tempting to guffaw at the idea of Shiloh as a "preschool gender warrrior," it's nevertheless a painful reminder of how rabidly our culture judges individuals on gender expectations, notes Salon.

multi_news

en

Summarize: Cult rapper Riff Raff, known for his bizarre tattoos, corn rows, and fang-like set of bedazzled teeth, will terrorize some unfortunate American dad this spring when he takes a teen to prom. That is, if anyone coughs up $28,000 for the privilege. The rapper's rental fee includes a night in a penthouse hotel suite, a ride in a Lamborghini and, in Riff Raff's words, the knowledge 'U are a legend at your school.' Scroll down for video. Could this be you? Cult rapper Riff Raff famously took Katy Perry to the 2014 Video Music Awards and now he's offered to take a rich and over-18 high schooler to prom this spring for the low, low price of $28,000. Riff Raff, 32, who was born Horst Simco in Copperfield, Texas, posted his offer and all its myriad perks on Instagram over the weekend for all his 900,000 followers to see. Those perks include a full week of promotion of the event on Twitter and Instagram'saying who you are and that he is taking you to prom.' The lucky, and well-heeled, young Riff Raff fan will also receive, 'freestyle videos and iconic prom pictures all night,' Riff Raff writes. Aside from his $28,000 fee, Riff Raff requires only that his date be 18-years-old or over. Riff Raff's lucky date can also revel in knowing that she will be on the arm of the same man who took Katy Perry to the 2014 MTV Video Music Awards. He's also the man who inspired James Franco's Alien character from 'Spring Breakers.' Riff Raff first gained notoriety after appearing on MTV's From G's to Gents. He's now a beloved hip hop personality, albeit not for his musical talents. What a steal: Riff Raff posted his scintillating offer on Instagram over the weekend. Expensive car fan? Riff Raff will pick up his prom date in a Lamborghini. He's seen here on a video shoot with a BMW. That's right! Riff Raff has accompanied a pop princess on the red carpet--where they sported matching mock-ups of the denim cowboy ensembles worn by Britney Spears and Justin Timberlake to the 2001 VMAs. The Dolce & Gabbana singer decked himself out in chain necklaces, a metallic top and a belt that matched Katy's. He opted out of wearing a denim hat like JT did back in the day in order to show off his colorful braided hair, though he did arrive on the red carpet carrying one in his hand. Riff Raff is known more for his off-the-wall style than his musical talents, but that doesn't keep fans from lining up to see him perform songs from his album Neon Icon live. He first gained notoriety on the MTV show From G's to Gents before breaking out to collaborate with such hip hop notables Lil B, Lil Debbie and Soulja Boy. Inspirational: Riff Raff is often cited as the inspiration of James Franco's Alien character in 2012's Spring Breakers

Summary: The flamboyant 32-year-old, originally born Horst Simco outside Houston, just requires applicants be a high schooler over 18-years-old. Riff Raff's out-there 90s-inspired style was the basis for James Franco's Alien character in Spring Breakers. In addition to the exotic car ride and hotel, Riff Raff promises to make sure all his dates' classmates know 'U are now a legend at your school' He famously escorted Katy Perry to the VMAs wearing outfits inspired by Justin Timberlake and Britney Spears circa 2001.

cnn_dailymail

en

Summarize: TECHNICAL FIELD The present invention relates to an in-vitro method and an apparatus for evaluating the activity of any substance as a mosquito repellent. The method is particularly useful for screening a large amount of compounds in a short time and thus, is particularly suited for the development of new repellents through programmed studies of structure-activity models. The method does not have the limitations of the in-vivo method such as the level of hunger of the mosquitoes or the type of human or animal subject performing the test. Furthermore, the present invention provides a model apparatus in which the in-vitro tests can be performed and the requirements for such testing apparatus to work efficiently. Because the amounts of the testing materials are set in relation to a standard, the values of repellency are repetitive, eliminating discrepancies in different tests. BACKGROUND Despite the prevalence of mosquito-transmitted diseases such as malaria and dengue, little progress has been made in the development of a safe mosquito repellent. In the middle of last century a large number of compounds were evaluated in-vivo for repellency against Aedes aegypti (the yellow fever mosquito) and other species of blood-sucking mosquitoes. The study was a large random search through a variety of chemical structures, most of them organic, which provided several potential compounds for development. From these studies, the most popular mosquito repellent today, N,N-diethyl-m-toluamide (DEET, or m-DEET), emerged first for the use of the US Army and later for use of the general public. A few animal studies on DEET have shown a range of toxic effects ranging from skin irritation to adverse neurological effects. Other compounds, natural and synthetic, have been used but due to their range of action and level of safety have had little success compared to DEET. The development of safe repellents has been hampered by the poor knowledge of the mosquito&#39;s receptors and the difficulties involved in the testing of new substances. In addition to the lack of molecular targets (receptors) for rational design, the testing of new chemicals as potential repellents using humans is variable and intrinsically dangerous, since the toxicology of the new substance is usually not known. The in-vivo test in practice today dates back to 1919 and uses the forearm or the hand of human subjects exposed at short time intervals to hungry mosquitoes. Other methods have been tried in order to overcome the shortcomings of the human test but none have prevailed due to the fact that most of them rely on the attractants of an animal subject and the need of a hungry female mosquito. Reliability of the human test is questionable. Early verification of the activity of DEET, for instance, gave zero activity in the first test using the arm, lasted 2 h in a Russian measurement using the forearm, and 5 h using a hand test. Number and degree of hunger of the mosquitoes, concentration of the repellent, and differences in the type of attractants released by the human subjects can account for the discrepancies. Furthermore, because the method is based on the attractants released on the skin, the human test cannot distinguish between substances that actually affect the sensory system of the insect (true repellents) and those that block the release of those attractants from the skin (attractant blockers). There is therefore a need to develop a better testing method for the evaluation of mosquito repellents such as the one described here. This new approach overcomes the limitations of the human method by not relying on the attractants present in the human skin or on the need of the female mosquito of a blood meal. Thus, this method differentiates between true repellents and attractant blockers. This method is based on the disturbance created by the repellent of the natural tendency of the mosquito to rest in certain rough surfaces above ground. SUMMARY The present invention recognizes the need to rapidly and reliably evaluate potential mosquito repellents of unknown nature, man-made or nature-derived. It also recognizes that an effective testing method should take into account the potential human toxicity of the unknown materials tested. Thus, the present invention recognizes that no humans or animals should be involved as subjects in the testing to eliminate the potential toxicity of the unknown materials tested on them. The present invention also recognizes that such method should be reliable and repetitive under a set of standard conditions given and not be dependent on mosquito attractants or on the need of the mosquitoes for a blood meal. The present invention permits the identification of unknown materials useful as mosquito repellents, does not require attractants from humans or blood-hungry mosquitoes, and it permits the evaluation of a large number of compounds in few hours. The present invention thus provides unique advantages over the most commonly used human forearm method. It is fast, safe, simple and reliable and provides a foundation of standards that anybody can duplicate and evaluate. BRIEF DESCRIPTION OF THE FIGURES FIG. 1. Drawing of the box or chamber used for the in-vitro testing of mosquito repellents. The drawing shown displays 8 corks atop a transparent smooth box where the repellent substances are impregnated. The box also has two access openings on the front which under working conditions are covered with a fabric sleeve. These access openings are used to introduce water and food for the mosquitoes as well as for performing cleaning of the box. Also shown is an access opening at the bottom with a door for the introduction of mosquitoes grown in a separate cage, and aeration holes on the side panels. FIG. 2. Drawing of a transparent chamber used for the in-vitro testing of mosquito repellents atop a mosquito growing chamber. The repellent testing chamber on top displays 8 corks where the repellent substances are impregnated. The mosquito growing chamber displays a mosquito growing pool at the bottom where mosquito eggs are developed into adult mosquitoes. Both chambers display access openings used for the introduction of water and food as well as for performing cleaning of the boxes. The bottom of the repellent testing chamber displays an access opening with a door for the introduction of the mosquitoes grown in the bottom chamber DETAILED DESCRIPTION OF THE INVENTION The natural tendency of the most routine testing mosquito model, Aedes aegypti, is to rest on the walls and ceiling of the common laboratory wire mesh cage rather than to stand on the bottom. This tendency is observed in many mosquito species. When the surfaces of walls and ceiling of the cage are changed to smooth and polished—such as acrylic plastic or glass—, the insects are forced to rest on the bottom. If a rough surface is provided on the ceiling of that smooth box, that rough surface becomes the preferred resting place for the mosquitoes. It is on the above observations that the present method is based. The following description of the bioassay uses definite dimensions and materials for the corked-box; however, other dimensions and materials can be used according to the needs. To perform the bioassay, a 2 ft×1 ft×1 ft box, such as the one depicted in FIG. 1, is built of plexiglass with minute aeration holes on the side panels, 8 holes (1.5 inches diameter each, 6 inches apart from each other) on the top to accommodate as many #21 cork stoppers. Two larger holes (4 inches diameter) on the front panel fitted with a cotton sleeve for easy hand access, and a 4 inch square mosquito access opening with door at the bottom completes the box design. Food (10% sucrose) and water are provided inside the box in two small Erlenmeyer flasks with cotton wicks. Under normal conditions, when the box is filled through the mosquito access opening, with about 400 mixed-sex mosquitoes, 20 to 40 will rest on each cork. Thus, the size of the corks and the number of mosquitoes per cubic feet are important for the test to be statistically significant. The cork material is not an attractant; a cork sitting at the bottom of the cage does not attract mosquitoes. The design of this box and testing conditions permits the evaluation of 8 substances at the same time with no crossover effect from one cork to its neighbors. When a cork impregnated with a repellent is replaced with a new cork, mosquito landing on the new cork is immediate. Thus, testing can be performed continuously on different compounds. Repellent testing is performed with mosquitoes 3 days to 3 weeks old that are maintained at 70–80% humidity and a temperature of 27–29° C. with an artificial 16—8 day-night cycle. On average 200–300 mosquitoes per cubic foot provide optimum results. Substances to be tested are prepared at a concentration 0.015 M in ethanol. This concentration is important because 1) the activity of repellents is directly proportional to concentration and 2) for relative comparison to the standard DEET. A cork impregnated with a solution of DEET at that concentration (0.015 M) produces a Repellence Time (RpT) of about 4 h. Repellency Time (RpT) is defined as the time between the introduction of an impregnated cork into the testing chamber and the time one mosquito lands and remains on that cork for 1 minute. In a typical experiment, a cork is immersed for 30 seconds in an ethanol solution of the compound under study at a concentration of 0.015 M. The alcohol is allowed to evaporate (about 10 min.) and the cork is inserted into one of the top holes of the testing chamber that contains between 200 and 300 mosquitoes per cubic foot. The time is recorded and the cork is observed directly by a technician or monitored by a video camera connected to recorder for later evaluation. The presence of one mosquito on the cork for 1 minute determines the end of the test, and the repellency time (RpT) is then noted. The area of substance coverage on the cork is about 30 cm 2, and the amount of substance on the cork after evaporation of the alcohol is about 7.7×10−4 mmol/cm 2. Blank corks are immersed in pure ethanol for the same amount of exposure and evaporation times. However, blank corks are not required except to verify that the alcohol does not contain repellent substances as contaminants. The following comparison of repellencies was made between reported in-vivo values from different sources and those obtained using the in-vitro method presented here. The list shows that a correlation exists between the two methods and that the in-vitro method can be used to predict the repellency time of a given repellent in humans. Compounds o-DEET, m-DEET, and p-DEET correspond to the three isomers of the same material; the m-DEET is the most active and it is the one used as the standard. RpT (min) RpT (min) Compound in-vivo in-vitro o-DEET 90 20 ± 5 m-DEET 300 240 ± 20 p-DEET 240 210 ± 20 Camphor 0–60 15 ± 2 Geraniol 120–180 315 ± 20 Nerolidol 120–180 300 ± 25 Citronellal 0–60 0 ± 5 2-Tridecanone 0–60 20 ± 5 Amyl alcohol 0–60 5 ± 1 Cyclohexanol 0–60 10 ± 1 Cyclohexanone 0–60 0 Oleic acid 0–60 0 REFERENCES Abdel-Rahman, A., Shetty, A. K., Abou-Donnia, M. B. (2001) Sub-chronic dermal application of N,N-diethyl m-toluamide (DEET) and permethrin to adult rats, alone or in combination, causes diffuse neuronal cell death and cytoskeletal abnormalities in the cerebral cortex and the hippocampus, and Purkinje neuron loss in the cerebelum. Experimental Neurology. 172: 153–171. Fradin, M. S., Day, J. F. (2002) Comparative efficacy of insect repellents against mosquito bites. New Eng. J. Med. 347: 13–18. King, W. V. (1954) Chemicals evaluated as insecticides and repellents at Orlando, Fla. USDA Agriculture handbook No 69. Knippling, E. F., Mcalister, L. C., Jones, H. A. (1947) Results of screening tests with materials evaluated as insecticides, miticides, and repellents at the Orlando, Fla., laboratory. April 1942 to April 1947. USDA Publication E-733. Ma, D. A., Apurba, K., Bhattachariee, R., Gupta, K., Karle, M. J. (1999) Predicting mosquito repellent potency of N,N-dietyl-m-toluamide (DEET) analogues from molecular electronic properties. Am. J. Trop. Med. Hyg. 1–6. Schreck, C. E. (1977) Techniques for the evaluation of insect repellents: a critical review. Ann. Rev. Entom. 22: 101–119. Suryanarayana, J. V. S., Pandey, K, S., Prakash, S., Raghuveeran, C. D., Dangi, R. S., Rao, K. M. (1991) Structure-activity relationship studies with mosquito repellent amides. J. Pharm. Sc. 80: 1055–1057. Vogt, R. G. (2003) Biochemical diversity of odor detection: OBPs, ODEs and SNMPs. p. 391, in G. J. Blomquist and R. G. Vogt (eds.). Insect pheromone biochemistry and molecular biology: the biosynthesis and detection of pheromones and plant volatiles. Elsevier Academic, London. Zolotarev, E. K., Kalakustkaya, T. V. (1962) Repellent study IX. Diethyltoluamides. Comparative evaluation of ortho-, meta- and para-isomer repellency against ticks and mosquitoes. Vestn. Mosk. Univ. 3: 18–21

Summary: This invention provides an apparatus and a method for testing insect repellents that is derived from the behavior of mosquitoes in nature. The method is based on the displacement of mosquitoes from a place (cork) on a created habitat (corked-box) using a repellent substance. It does not require attractants, or blood-hungry mosquitoes, and it is appropriate for high throughput testing of different materials at the same time and in few hours.

big_patent

en

Summarize: IRS’s Budget Request Continues to Shift Priority from Taxpayer Service to Enforcement, but the Short- and Long-term Impacts on Taxpayers Are Unclear IRS’s fiscal year 2006 budget request reflects a continuing shift in priorities by proposing reductions in taxpayer service and increases in enforcement activities. The request does not provide details about how the reductions will impact taxpayers in the short-term. Nor does IRS have long-term goals; thus the contribution of the fiscal year 2006 budget request to achieving IRS’s mission in the long-term is unclear. Because of budget constraints and the progress IRS has made improving the quality of taxpayer services, this is an opportune time to reconsider the menu of services IRS offers. IRS Is Proposing Reductions in Taxpayer Service and BSM and Increases in Enforcement IRS is requesting $10.9 billion, which includes just over a 1 percent decrease for taxpayer service, a 2 percent decrease for BSM, and nearly an 8 percent increase for enforcement, as shown in table 1. As table 1 further shows, the changes proposed in the 2006 budget request continue a trend from 2004. In comparison to the fiscal year 2004 enacted budget, the 2006 budget request proposes almost 4 percent less for service, almost 49 percent less for BSM, and nearly 14 percent more for enforcement. As table 1 also shows, taxpayer service sustained a reduction of $104 million or 2.8 percent between fiscal years 2004 and 2005. According to IRS officials, the majority of this reduction was the result of consolidating paper-processing operations, shifting resources from service to enforcement, and reducing some services. IRS officials said that this reduction is not expected to adversely impact the services they provide to taxpayers but added that the agency cannot continue to absorb reductions in taxpayer service without beginning to compromise some services. For fiscal years 2005 and 2006, table 2 shows some details of changes in both dollars and full-time equivalents (FTE). Both are shown because funding changes do not translate into proportional changes in FTEs due to cost increases for salaries, rent, and other items. For example, the $39 million or 1.1 percent reduction in taxpayer service translates into a reduction of 1,385 FTEs or 3.6 percent. Similarly, the over $500 million or 7.8 percent increase in enforcement spending translates into an increase of 1,961 FTEs or 3.4 percent. The difference between changes in dollars and FTEs could be even larger because of unbudgeted expenses. Unbudgeted expenses have consumed some of IRS’s budget increases and internal savings increases over the last few years. Unbudgeted expenses include unfunded portions of annual salary increases, which can be substantial given IRS’s large workforce, and other costs such as higher-than-budgeted rent increases. According to IRS officials, these unbudgeted expenses accounted for over $150 million in each of the last 4 years. An IRS official also told us they anticipate having to cover unbudgeted expenses in 2006. As of March 2005, IRS officials were projecting unbudgeted salary increases of at least $40 million. This projection could change since potential federal salary increases for 2006 have not been determined. IRS Is Proposing $39 Million Less for Taxpayer Service, but the Impact on Taxpayers Is Unclear The budget request provides some detail on how IRS plans to absorb cost increases in the taxpayer service budget. IRS is proposing a gross reduction of over $134 million in taxpayer service from reexamining the budget’s base and plans to use more than $95 million of it to cover annual increases such as salaries. This leaves a net reduction of nearly $39 million or 1.1 percent in the taxpayer service budget. The extent to which IRS is able to achieve the gross reductions will impact its ability to use the funds as anticipated. Decisions on how the $134 million gross reduction would be absorbed were not finalized prior to releasing the budget. According to IRS officials, some of the reductions would result from efficiency gains such as reducing printing and postage costs; however, others would result from reductions in the services provided to taxpayers such as shortening the hours of toll- free telephone service operations. The officials also said most decisions have now been made about general areas for reduction and most changes will not be readily apparent to taxpayers. Although IRS has made general decisions about the reductions, many of the details have yet to be determined. Therefore, the extent of the impact on taxpayers in the short term is unclear. For example, IRS plans to reduce dependence on field assistance, including walk-in sites, but has not reached a final decision on how to reduce services. Table 3 provides further detail on how IRS is proposing to reduce funding and resources for taxpayer service. IRS’s fiscal year 2006 budget request is the sixth consecutive year the agency has requested additional staffing for enforcement. However, up until last year, IRS was unable to increase enforcement staffing; unbudgeted costs and other priorities consumed the budget increase. IRS’s proposal for fiscal year 2006, if implemented as planned, would return enforcement staffing in these occupations to their highest levels since 1999. Of the more than $500 million increase requested for 2006, about $265 million would fund enforcement initiatives, over $182 million would be used in part for salary increases, and over $55 million is a proposal to transfer funding authority from the Department of Justice’s Interagency Crime and Drug Enforcement. The $500 million increase would be supplemented by internal enforcement savings of $88 million. As is the case with taxpayer service savings, the extent to which IRS achieves enforcement savings will affect its ability to fund the new enforcement initiatives. The $265 million for new enforcement initiatives consist of: $149.7 million and 920 FTEs to attack corrosive non-compliance activity driving the tax gap such as abusive trusts and shelters, including offshore credit cards and organized tax resistance; $51.8 million and 236 FTEs to detect and deter corrosive corporate non- compliance to attack complex abusive tax avoidance transactions on a global basis and challenge those who promote their use; $37.9 million and 417 FTEs to increase individual taxpayer compliance by identifying and implementing actions to address non-compliance with filing requirements; increasing Automated Underreporter resources to address the reporting compliance tax gap; increasing audit coverage; and expanding collection work in walk-in sites; $14.5 million and 77 FTEs to combat abusive transactions by entities with special tax status by initiating examinations more promptly, safeguarding compliant customers from unscrupulous promoters, and increasing vigilance to ensure that the assets of tax-exempt organizations are put to their intended tax-preferred purpose and not misdirected to fund terrorism or for private gain; and $10.8 million and 22 FTEs to curtail fraudulent refund crimes. The $88 million in internal savings would be reinvested to perform the following activities: $66.7 million and 585 FTEs to devote resources to front-line $14.9 million and 156 FTEs to, in part, address bankruptcy-related $6.7 million and 52 FTEs to address complex, high-risk issues such as compliance among tax professionals. In the past, IRS has had trouble achieving enforcement staffing increases because other priorities, including unbudgeted expenses, have absorbed additional funds. IRS achieved some gains in 2004 and expects modest gains in 2005. Figure 1 shows that the number of revenue agents (those who audit complex returns), revenue officers (those who do field collection work), and special agents (those who perform criminal investigations) decreased over 21 percent between 1998 and 2003, but increased almost 6 percent from 2003 to 2004. IRS’s recent gains in enforcement staffing are encouraging, as tax law enforcement continues to remain an area of high risk for the federal government because the resources IRS has dedicated to enforcing the tax laws have declined, while IRS’s enforcement workload—measured by the number of taxpayer returns filed—has continually increased. Figure 2 shows the trend in field, correspondence, and total audit rates since 1995. Field audits involve face-to-face audits and correspondence audits are typically less complex involving communication through notices. IRS experienced steep declines in audit rates from 1995 to 1999, but the audit rate—the proportion of tax returns that IRS audits each year—has slowly increased since 2000. The figure shows that the increase in total audit rates of individual filers has been driven mostly by correspondence audits, while more complex field audits, continue to decline. The link between the decline in enforcement staff and the decline in enforcement actions, such as audits, is complicated, and the real impact on taxpayers’ rate of voluntary compliance is not known. This leaves open the question of whether the declines in IRS’s enforcement programs are eroding taxpayers’ incentives to voluntarily comply. IRS’s National Research Program (NRP) recently completed a study on compliance by individual tax filers based on tax data provided on 2001 tax returns. The study estimated that the tax gap—the difference between what taxpayers owe and what they pay—is at least $312 billion per year as of 2001 and could be as large as $353 billion. This study is important for several reasons beyond measuring compliance. It is intended to help IRS better target its enforcement actions, such as audits, on non-compliant taxpayers, and minimize audits of compliant taxpayers. It should also help IRS better understand the impact of taxpayer service on compliance. IRS Is Developing Long- term Goals That Can Be Used to Assess Performance and Make Budget Decisions IRS is developing but currently lacks long-term goals that can be used to assess performance and make budget decisions. Long-term goals and results measurement are a component of the statutory strategic planning and management framework that the Congress adopted in the Government Performance and Results Act of 1993. As a part of this comprehensive framework, long-term goals that are linked to annual performance measures can help guide agencies when considering organizational changes and making resource decisions. A recent Program Assessment Rating Tool (PART) review conducted by OMB reported that IRS lacks long-term goals. As a result, IRS has been working to identify and establish long-term goals for all aspects of its operations for over a year. IRS officials said these goals will be finalized and provided publicly as an update to the agency’s strategic plan before May 2005. For IRS and its stakeholders, such as the Congress, long-term goals can be used to assess performance and progress towards these goals, and determine whether budget decisions contribute to achieving those goals. Without long-term goals, the Congress and other stakeholders are hampered in evaluating whether IRS is making satisfactory long-term progress. Further, without such goals, the extent to which IRS’s 2006 budget request would help IRS achieve its mission over the long-term is unclear. This Is an Opportune Time to Review IRS’s Menu of Taxpayer Services For at least two reasons, this is an opportune time to review the menu of taxpayer services that IRS provides. First, IRS’s budget for taxpayer services was reduced in 2005 and an additional reduction is proposed for 2006. As already discussed, these reductions have forced IRS to propose scaling back some services. Second, as we have reported, IRS has made significant progress in improving the quality of its taxpayer services. For example, IRS now provides many Internet services that did not exist a few years ago and has noticeably improved the quality of telephone services. This opens up the possibility of maintaining the overall level of taxpayer service but with a different menu of service choices. Cuts in selected services could be offset by the new and improved services. Generally, as indicated in the budget, the menu of taxpayer services that IRS provides covers assistance, outreach, and processing. Assistance includes answering taxpayer questions via telephone, correspondence, and face-to-face at its walk-in sites. Outreach includes educational programs and the development of partnerships. Processing includes issuing millions of tax refunds. When considering program reductions, we support a targeted approach rather than across-the-board cuts. A targeted approach helps reduce the risk that effective programs are reduced or eliminated while ineffective or lower priority programs are maintained. With the above reasons in mind for reconsidering IRS’s menu of services, we have compiled a list of options for targeted reductions in taxpayer service. The options on this list are not recommendations but are intended to contribute to a dialogue about the tradeoffs faced when setting IRS’s budget. The options presented meet at least one of the following criteria that we generally use to evaluate programs or budget requests. These criteria include that the activity duplicates other efforts that may be more effective and/or efficient; historically does not meet performance goals or provide intended results as reported by GAO, TIGTA, IRS, or others; experiences a continued decrease in demand; lacks adequate oversight, implementation and management plans, or structures and systems to be implemented effectively; has been the subject of actual or requested funding increases that cannot be adequately justified; or has the potential to make an agency more self-sustaining by charging user fees for services provided. We recognize that the options listed below involve tradeoffs. In each case, some taxpayers would lose a service they use. However, the savings could be used to help maintain the quality of other services. We also want to give IRS credit for identifying savings, including some on this list. The options include closing walk-in sites. As the filing season section of this testimony discusses, taxpayer demand for walk-in services has continued to decrease and staff answer a more limited number of tax law questions in person than staff answer via telephone. limiting the type of telephone questions answered by IRS assistors. IRS assistors still answer some refund status questions even though IRS provides automated answers via telephone and its Web site. mandating electronic filing for some filers such as paid preparers or businesses. As noted, efficiency gains from electronic filing have enabled IRS to consolidate paper processing operations. charging for services. For example, IRS provides paid preparers with information on federal debts owed by taxpayers seeking refund anticipation loans. Progress in BSM Implementation, but the Program Remains High Risk and Budget Reductions Have Resulted in Significant Adjustments Although IRS has implemented important elements of the BSM program, much work remains. In particular, the BSM program remains at high risk and has a long history of significant cost overruns and schedule delays. Furthermore, budget reductions have resulted in significant adjustments to the BSM program, although it is too early to determine their ultimate effect. IRS Has Made Progress in Implementing BSM, but Much Work Remains IRS has long relied on obsolete automated systems for key operational and financial management functions, and its attempts to modernize these aging computer systems span several decades. IRS’s current modernization program, BSM, is a highly complex, multibillion-dollar program that is the agency’s latest attempt to modernize its systems. BSM is critical to supporting IRS’s taxpayer service and enforcement goals. For example, BSM includes projects to allow taxpayers to file and retrieve information electronically and to provide technology solutions to help reduce the backlog of collections cases. BSM is important for another reason. It allows IRS to provide the reliable and timely financial management information needed to account for the nation’s largest revenue stream and better enable the agency to justify its resource allocation decisions and congressional budgetary requests. Since our testimony before this subcommittee on last year’s budget request, IRS has deployed initial phases of several modernized systems under its BSM program. The following provides examples of the systems and functionality that IRS implemented in 2004 and the beginning of 2005. Modernized e-File (MeF). This project is intended to provide electronic filing for large corporations, small businesses, and tax-exempt organizations. The initial releases of this project were implemented in June and December 2004, and allowed for the electronic filing of forms and schedules for the form 1120 (corporate tax return) and form 990 (tax-exempt organizations’ tax return). IRS reported that, during the 2004 filing season, it accepted over 53,000 of these forms and schedules using MeF. e-Services. This project created a Web portal and provided other electronic services to promote the goal of conducting most IRS transactions with taxpayers and tax practitioners electronically. IRS implemented e-Services in May 2004. According to IRS, as of late March 2005, over 84,000 users have registered with this Web portal. Customer Account Data Engine (CADE). CADE is intended to replace IRS’s antiquated system that contains the agency’s repository of taxpayer information and, therefore, is the BSM program’s linchpin and highest priority project. In July 2004 and January 2005, IRS implemented the initial releases of CADE, which have been used to process filing year 2004 and 2005 1040EZ returns, respectively, for single taxpayers with refund or even-balance returns. According to IRS, as of March 16, 2005, CADE had processed over 842,000 tax returns so far this filing season. Integrated Financial System (IFS). This system replaces aspects of IRS’s core financial systems and is ultimately intended to operate as its new accounting system of record. The first release of this system became fully operational in January 2005. Although IRS is to be applauded for delivering such important functionality, the BSM program is far from complete. Future deliveries of additional functionality of deployed systems and the implementation of other BSM projects are expected to have a significant impact on IRS’s taxpayer services and enforcement capability. For example, IRS has projected that CADE will process about 2 million returns in the 2005 filing season. However, the returns being processed in CADE are the most basic and constitute less than 1 percent of the total tax returns expected to be processed during the current filing season. IRS expects the full implementation of CADE to take several more years. Another BSM project—the Filing and Payment Compliance (F&PC) project—is expected to increase (1) IRS’s capacity to treat and resolve the backlog of delinquent taxpayer cases, (2) the closure of collection cases by 10 million annually by 2014, and (3) voluntary taxpayer compliance. As part of this project, IRS plans to implement an initial limited private debt collection capability in January 2006, with full implementation of this aspect of the F&PC project to be delivered by January 2008 and additional functionality to follow in later years. BSM Program Has History of Cost Increases and Schedule Delays and Is High Risk The BSM program has a long history of significant cost increases and schedule delays, which, in part, has led us to report this program as high- risk since 1995. Appendix II provides the history of the BSM life-cycle cost and schedule variances. In January 2005 letters to congressional appropriation committees, IRS stated that it had showed a marked improvement in significantly reducing its cost variances. In particular, IRS claimed that it reduced the variance between estimated and actual costs from 33 percent in fiscal year 2002 to 4 percent in fiscal year 2004. However, we do not agree with the methodology used in the analysis supporting this claim. Specifically, (1) the analysis did not reflect actual costs, instead it reflected changes in cost estimates (i.e., budget allocations) for various BSM projects; (2) IRS aggregated all of the changes in the estimates associated with the major activities for some projects, such as CADE, which masked that monies were shifted from future activities to cover increased costs of current activities; and (3) the calculations were based on a percentage of specific fiscal year appropriations, which does not reflect that these are multiyear projects. In February 2002 we expressed concern over IRS’s cost and schedule estimating and made a recommendation for improvement. IRS and its prime systems integration support (PRIME) contractor have taken action to improve their estimating practices, such as developing a cost and schedule estimation guidebook and developing a risk-adjustment model to include an analysis of uncertainty. These actions may ultimately result in more realistic cost and schedule estimates, but our analysis of IRS’s expenditure plans over the last few years shows continued increases in estimated project life-cycle costs (see fig. 3). The Associate CIO for BSM stated that he believes that IRS’s cost and schedule estimating has improved in the past year. In particular, he pointed out that IRS met its cost and schedule goals for the implementation of the latest release of CADE, which allowed the agency to use this system to process certain 1040EZ forms in the 2005 filing season. It is too early to tell whether this signals a fundamental improvement in IRS’s ability to accurately forecast project costs and schedules. The reasons for IRS’s cost increases and schedule delays vary. However, we have previously reported that they are due, in part, to weaknesses in management controls and capabilities. We have previously made recommendations to improve BSM management controls, and IRS has implemented or begun to implement these recommendations. For example, in February 2002, we reported that IRS had not yet defined or implemented an IT human capital strategy, and recommended that IRS develop plans for obtaining, developing, and retaining requisite human capital resources. In September 2003, TIGTA reported that IRS had made significant progress in developing a human capital strategy but that it needed further development. In August 2004, the current Associate CIO for BSM identified the completion of a human capital strategy as a high priority. Among the activities that IRS is implementing are prioritizing its BSM staffing needs and developing a recruiting plan. IRS has also identified, and is addressing, other major management challenges in areas such as requirements, contract, and program management. For example, poorly defined requirements have been among the significant weaknesses that have been identified as contributing to project cost overruns and schedule delays. As part of addressing this problem, in March 2005, the IRS BSM office established a requirements management office, although a leader has not yet been hired. IRS Is Adjusting the BSM Program in Response to Budget Reductions The BSM program is undergoing significant changes as it adjusts to reductions in its budget. Figure 4 illustrates the BSM program’s requested and enacted budgets for fiscal years 2004 through 2006. For fiscal year 2005, IRS received about 29 percent less funding than it requested (from $285 million to $203.4 million). According to the Senate report for the fiscal year 2005 Transportation, Treasury, and General Government appropriations bill, in making its recommendation to reduce BSM funding, the Senate Appropriations Committee was concerned about the program’s cost overruns and schedule delays. In addition, the committee emphasized that in providing fewer funds, it wanted IRS to focus on its highest priority projects, particularly CADE. In addition, IRS’s fiscal year 2006 budget request reflects an additional reduction of about 2 percent, or about $4.4 million, from the fiscal year 2005 appropriation. It is too early to tell what effect the budget reductions will ultimately have on the BSM program. However, the significant adjustments that IRS is making to the program to address these reductions are not without risk, could potentially impact future budget requests, and will delay the implementation of certain functionality that was intended to provide benefit to IRS operations and the taxpayer. For example: Reductions in Management reserve/project risk adjustments. In response to the fiscal year 2005 budget reduction, IRS reduced the amount that it had allotted to program management reserve and project risk adjustments by about 62 percent (from about $49.1 million to about $18.6 million). If BSM projects have future cost overruns that cannot be covered by the depleted reserve, this reduction could result in (1) increased budget requests in future years or (2) delays in planned future activities (e.g., delays in delivering promised functionality) to use those allocated funds to cover the overruns. Shifts of BSM management responsibility from the PRIME contractor to IRS. Due to budget reductions and IRS’s assessment of the PRIME contractor’s performance, IRS decided to shift significant BSM responsibilities for program management, systems engineering, and business integration from the PRIME contractor to IRS staff. For example, IRS staff are assuming responsibility for cost and schedule estimation and measurement, risk management, integration test and deployment, and transition management. There are risks associated with this decision. To successfully accomplish this transfer, IRS must have the management capability to perform this role. Although the BSM program office has been attempting to improve this capability through, for example, implementation of a new governance structure and hiring staff with specific technical and management expertise, IRS has had significant problems in the past managing this and other large development projects, and acknowledges that it has major challenges to overcome in this area. Suspension of the Custodial Accounting Project (CAP). Although the initial release of CAP went into production in September 2004, IRS has decided not to use this system and to stop work on planned improvements due to budget constraints. According to IRS, it made this decision after it evaluated the business benefits and costs to develop and maintain CAP versus the benefits expected to be provided by other projects, such as CADE. Among the functionality that the initial releases of CAP were expected to provide were (1) critical control and reporting capabilities mandated by federal financial management laws; (2) a traceable audit trail to support financial reporting; and (3) a subsidiary ledger to accurately and promptly identify, classify, track, and report custodial revenue transactions and unpaid assessments. With the suspension of CAP, it is now unclear how IRS plans to replace the functionality this system was expected to provide, which was intended to allow the agency to make meaningful progress toward addressing long-standing financial management weaknesses. IRS is currently evaluating alternative approaches to addressing these weaknesses. Reductions in planned functionality. According to IRS, the fiscal year 2006 funding reduction will result in delays in planned functionality for some of its BSM projects. For example, IRS no longer plans to include Form 1041 (the income tax return for estates and trusts) in the fourth release of Modernized e-File, which is expected to be implemented in fiscal year 2007. The BSM program is based on visions and strategies developed in 2000 and 2001. The age of these plans, in conjunction with the significant delays already experienced by the program and the substantive changes brought on by budget reductions, indicate that it is time for IRS to revisit its long- term goals, strategy, and plans for BSM. Such an assessment would include an evaluation of when significant future BSM functionality would be delivered. IRS’s Associate CIO for BSM has recognized that it is time to recast the agency’s BSM strategy because of changes that have occurred subsequent to the development of the program’s initial plans. According to this official, IRS is redefining and refocusing the BSM program, and he expects this effort to be completed by the end of this fiscal year. Additional Actions Needed to Improve Budgeting for IT Operations and Maintenance IRS has requested about $1.62 billion for IT operations and maintenance in fiscal year 2006, within its proposed new Tax Administration and Operations account. Under the prior years’ budget structure, these funds were included in a separate account, for which IRS received an appropriation of about $1.59 billion in fiscal year 2005. The $1.62 billion requested in fiscal year 2006 is intended to fund the personnel costs for IT staff (including staff supporting the BSM program) and activities such as IT security, enterprise networks, and the operations and maintenance costs of its current systems. We have previously expressed concern that IRS does not employ best practices in the development of its IT operations and maintenance budget request. Although IRS has made progress in addressing our concern, more work remains. The Paperwork Reduction Act (PRA) requires federal agencies to be accountable for their IT investments and responsible for maximizing the value and managing the risks of their major information systems initiatives. The Clinger-Cohen Act of 1996 establishes a more definitive framework for implementing the PRA’s requirements for IT investment management. It requires federal agencies to focus more on the results they have achieved and introduces more rigor and structure into how agencies are to select and manage IT projects. In addition, leading private- and public-sector organizations have taken a project- or system-centric approach to managing not only new investments but also operations and maintenance of existing systems. As such, these organizations identify operations and maintenance projects and systems for inclusion assess these projects or systems on the basis of expected costs, benefits, and risks to the organization; analyze these projects as a portfolio of competing funding options; and use this information to develop and support budget requests. This focus on projects, their outcomes, and risks as the basic elements of analysis and decision making is incorporated in the IT investment management approach that is recommended by OMB and GAO. By using these proven investment management approaches for budget formulation, agencies have a systematic method, on the basis of risk and return on investment, to justify what are typically substantial information systems operations and maintenance budget requests. In our assessment of IRS’s fiscal year 2003 budget request, we reported that the agency did not develop its information systems operations and maintenance request in accordance with the investment management approach used by leading organizations. We recommended that IRS prepare its future budget requests in accordance with these best practices. To address our recommendation, IRS agreed to take a variety of actions, which it has made progress in implementing. For example, IRS stated that it planned to develop an activity-based cost model to plan, project, and report costs for business tasks/activities funded by the information systems budget. The recent release of IFS included an activity- based cost module, but IRS does not currently have historical cost data to populate this module. According to officials in the Office of the Chief Financial Officer, IRS is in the process of accumulating these data. These officials stated that IRS needs 3 years of actual costs to have the historical data that would provide a basis for future budget estimates. Accordingly, these officials expected that IRS would begin using the IFS activity-based cost module in formulating the fiscal year 2008 budget request and would have the requisite 3 years’ of historical data in time to develop the fiscal year 2010 budget request. In addition, IRS planned to develop a capital planning guide to implement processes for capital planning and investment control, budget formulation and execution, business case development, and project prioritization. IRS has developed a draft guide, which is currently under review by IRS executives, and IRS expects it to become policy on October 1, 2005. Although progress has been made in implementing best practices in the development of the IT operations and maintenance budget, until these actions are completely implemented IRS will not be able to ensure that its request is adequately supported. So Far This Filing Season IRS Has Generally Maintained or Improved Performance, Including Telephone Accuracy, with Less Funding Results to date show IRS has generally maintained or improved its 2005 filing season performance in key areas compared to last year despite a decrease in the 2005 budget for taxpayer service. These key areas are paper and electronic processing, telephone assistance, IRS’s Web site, and walk- in assistance. Table 4 shows performance to date in these four areas. Overall IRS’s filing season performance to date is good news because, as table 1 shows (page 6), IRS’s budget for taxpayer service is $104 million less than the year before. According to IRS officials, it absorb this reduction by generating additional internal savings and program reductions. However, because the filing season is not over, the extent to which IRS will achieve efficiency gains and the full impact of reductions on taxpayers in this or future filing seasons is not yet known. Processing Has Been Smooth, Staff Continues to Decline, and Electronic Filing Continues to Grow but not at a Rate to Meet Long-term Goal As of March 18, IRS processed about 63 million individual income tax returns and 57 million refunds. According to IRS data and information from external stakeholders such as paid practitioners, processing has been uneventful and without significant disruptions. IRS officials attribute this year’s smooth processing to adequate planning and few tax law changes. This year’s processing activities are important, in part, because for the first time during the filing season, IRS is using CADE to process the simplest taxpayer accounts (1040EZ without problems or balance due). As we note in the BSM section, CADE is the foundation of IRS’s modernization effort and will ultimately replace the Individual Master File that currently houses taxpayer data for individual filers. As of March 16, 2005, CADE has processed over 842,000 tax returns without significant problems. Growth in electronic filing (e-filing) helps fund IRS’s modernization. Electronic filing allows IRS to control costs by reducing labor-intensive processing of paper tax returns. E-filing also improves taxpayer service by eliminating transcription errors associated with processing paper returns. E-filing also has benefits for taxpayers, primarily by allowing them to get their refunds in half the time of paper filers. As shown in figure 5, the number of e-filed returns has increased since 1999 and the number of paper returns has decreased. The figure also shows that these changes have allowed IRS to reduce the staff devoted to processing paper returns between 1999 and 2004 by just over 1,100 staff years. As the number of e-filed returns has increased, the number of staff years used to process those returns has not. The decline in paper processing staff allowed IRS to close its Brookhaven processing center in 2003. In addition, IRS is in the process of closing its paper processing operation in Memphis. Although the growth in e-filing is about 6.7 percent over the same period last year, it is growing at a slower rate than previous years. Based on the current trend and the fact that the percentage of returns e-filed traditionally declines as April 15 approaches, it appears that IRS will not achieve its goal of having 68.2 million individual tax returns e-filed this year (an 11 percent increase over last year). Over recent years, IRS has undertaken numerous initiatives to increase e-filing. However, neither this year’s current growth rate nor the projected annual growth rate will enable IRS to achieve its goal of 80 percent of all individual tax returns being e-filed in 2007. This goal has focused attention on increasing e-filing. As we reported last year, IRS officials believe that achieving the goal would require additional measures to convert the tens of millions of taxpayers and tax practitioners who prepare individual income tax returns on a computer, but filed on paper to e-filing. IRS officials also stated that the additional measures might need to include legislation that mandates e-filing for certain classes of returns, such as those prepared by practitioners. Last year we reported five states, including California, that mandated the e-filing of state tax returns, also showed increases in the e- filing of federal returns. This year, three additional states have introduced mandatory e-filing of state returns by tax practitioners. Telephone Access Has Remained Relatively Stable and Accuracy Has Improved Between January 1 and March 12, IRS received approximately 23 million calls. As shown in table 4, IRS’s automated service handled nearly 14 million calls and customer service representatives (CSRs) handled just over 9 million. The percentage of taxpayers who attempted to reach CSRs and actually got through and received service—referred to as the CSR level of service—remained relatively stable at 83 percent compared to 84 percent at the same time last year. IRS reduced its 2005 goal for CSR level of service from 85 percent in 2004 to 82 percent because of the budget reduction for taxpayer service. However, IRS has been able to achieve a relatively stable CSR level of service of 83 percent since last year. According to IRS officials, this level of performance is due to staff plans being made before the level of service goal was reduced; the agency receiving fewer calls due to fewer tax law changes than in the agency improving methods for handling calls; and an increased use of IRS’s Web site. Although CSR level of service is about the same as last year, down one percentage point, there are other indications of slippage in telephone access. Specifically, taxpayers are waiting longer to speak to a CSR. Wait times have increased by about 35 seconds or 15 percent compared to the same period last year. Additionally, the rate at which taxpayers abandon their calls to IRS increased from 10 percent to 11.5 percent, which translates into about 99,000 calls. The responsible IRS official considers the increase in wait time and increase in abandon rate to be acceptable, in part because IRS data are showing that the agency is using 9 percent fewer FTEs than last year and answering 195 more calls per FTE. IRS officials said they lowered the CSR level of service goal in response to the reduction in the taxpayer service budget, and will adjust staffing plans after the filing season to address the taxpayer service budget reduction. IRS officials believe the adjustments will likely result in a lower level of service than is currently being achieved. IRS estimates that the accuracy of CSRs’ answers to taxpayers’ tax law questions improved compared to last year. Specifically, tax law accuracy increased to an estimated 87 percent as compared to 76 percent at the same time last year. This represents a significant change from last year, when we drew attention to the declining tax law accuracy rate. According to IRS officials and staff, the improvement is primarily due to formatting changes made in 2004 to the guide that CSRs use to help them answer taxpayers’ tax law questions that have enhanced the usability of the guide. IRS officials stated that the revised guide is better and more user-friendly, partly because many of the suggested improvements were from CSRs who use the guide daily. In addition, IRS officials stated that the improved tax law accuracy rate reveals that the previous version of the guide was indeed the reason for last year’s decline in tax law accuracy, and attributed fluctuations in the tax law accuracy rate to changes in the guide in past years. IRS estimates that accounts accuracy (the accuracy of answers to questions from taxpayers about the status of their accounts) has improved compared to last year and since 2002. Taxpayers who called about their accounts received correct information an estimated 92 percent of the time, which is an improvement compared to last year’s 89 percent rate and the 88 percent rate seen in 2002 and 2003. The responsible IRS official told us that accounts accuracy rates have improved because IRS has improved its ability to monitor and manage staff, expanded training, and improved its ability to search for account information. Web Site Performing Well and Used Extensively Various data indicate that IRS’s Web site is performing well. We found it to be user-friendly because it was readily accessible and easy to navigate. Problem areas that we reported in the past, such as the search function, were much improved this filing season, thus eliminating our previous concerns about the search function. Furthermore, an independent weekly study done during the filing season has reported that IRS’s Web site has ranked in the top 4 out of 40 government Web sites and that users were able to access the IRS Web site in.65 seconds or less. The same independent weekly assessment reported that IRS ranked first or second in response time of downloading data. Finally, the electronic tax law assistance program on IRS’s Web site has shown marked improvement this year over last. For example, the average response time is down from 3.8 days to 1.6 days and the accuracy rate has improved from 56.9 percent to 87.5 percent. According to IRS officials, this significant improvement is due to a decrease in the number of tax law questions being submitted—down from about 56,000 to 8,700 for the same time period. IRS’s Web site is experiencing extensive usage this filing season based on the number of visits, pages viewed, and forms and publications downloaded. As of February 28, 2005, the Web site was visited about 83 million times by users who viewed about 628 million pages. This is the first time that IRS has publicly reported the number of visits to and number of pages viewed on its Web site. Further, about 70.3 million forms and publications had been downloaded this fiscal year through February, with about 45 million of those downloads occurring in January and February. IRS’s Web site continues to provide two very important tax service features: (1) “Where’s My Refund,” which enables taxpayers to check on the status of their refund and (2) Free File, which provides taxpayers the ability to file their tax return electronically for free via IRS’s Web site. As of March 20, 2005, about 16 million taxpayers accessed the “Where’s My Refund” feature to check the status of their tax refund—about a 15 percent increase over the same time period last year. Also, IRS provided new functionality for “Where’s My Refund” whereby a taxpayer whose refund could not be delivered by the Postal Service (i.e., returned as undeliverable mail), can change their address on the Web site. In addition, as of March 16, 2005, 3.6 million tax returns had been filed via Free File, which represents a 44 percent increase over the same time period last year. In the 2005 filing season, all individual taxpayers are eligible to file free via IRS’s Web site. Use of IRS’s Walk-in Assistance Continues to Decline, While Use of Volunteer Assistance Increases As of March 12, assistance provided at IRS’s approximately 400 walk-in sites declined by 11 percent compared to the same time last year, with the number receiving tax preparation assistance declining by about 22 percent. Staff at those sites provides taxpayers with information about their tax accounts and answer a limited scope of tax law questions. If staff cannot answer taxpayers’ questions, they are required to refer taxpayers to IRS’s telephone operations or have taxpayers correspond via IRS’s Web site. In combination with decreased demand, IRS reduced the staff used at walk-in sites for return preparation assistance and continues to encourage taxpayers to use volunteer sites for return preparation. These declines are consistent with IRS’s goal to further limit return preparation and tax law assistance at walk-in sites by 2007 and with its 2006 budget request. As reflected in table 4 and figure 6, in contrast to IRS walk-in sites, the number of taxpayers seeking return preparation assistance at volunteer sites has increased this year and every year since 2001. These sites, staffed by volunteers certified by IRS, do not offer the range of services IRS provides, but instead focus on preparing tax returns primarily for low- income and elderly taxpayers and operate chiefly during the filing season. IRS officials estimated that the number of taxpayers receiving assistance at approximately 14,000 volunteer sites has increased over 23 percent compared to the same time last year. The shift of taxpayers from walk-in to volunteer sites is important, because it has transferred time-consuming services, particularly return preparation, from IRS to volunteer sites and allowed IRS to concentrate on services that only it can provide such as account assistance or compliance work. As a result, IRS has devoted fewer resources to return preparation. While this shift is important to IRS, others have been more cautious. For example, in her January 2005 report, the Taxpayer Advocate has expressed concern about the reduction of face-to-face services, such as those offered at walk- in sites. She stated that IRS’s plan does not adequately provide for the segment of the population that continues to rely on the interaction provided by walk-in sites. At the same time, last year, we and TIGTA called attention to issues related to the quality of service at both IRS walk- in and volunteer sites. IRS has separate quality initiatives under way at both IRS walk-in sites and volunteer sites, although data remain limited and cannot be compared to prior years. Conclusions As IRS shifts its priorities to enforcement and faces tight budgets for service, the agency will be challenged to maintain the gains it has made in taxpayer service. In order to avoid a “swinging pendulum,” where enforcement gains are achieved at the cost of taxpayer service and vice versa, IRS and the Congress would benefit from a set of agreed-upon long- term goals. Long-term goals would provide a framework for assessing budgetary tradeoffs between taxpayer service and enforcement and whether IRS is making satisfactory progress towards achieving those goals. Similarly, long-term goals could help identify priorities within the taxpayer service and enforcement functions. For example, if the budget for taxpayer service were to be cut and efficiency gains did not offset the cut, long-term goals could help guide decisions about whether to make service cuts across the board or target selected services. To its credit, IRS has been developing a set of long-term goals, so we are not making a recommendation on goals. However, we want to underscore the importance of making the goals public in a timely fashion, as IRS has planned. The Congress would then have an opportunity to review the goals and start using them as a tool for holding IRS accountable for performance. In addition, the Congress would benefit from more information about the short-term impacts of the 2006 budget request on taxpayers. The 2006 budget request cites a need for reducing the hours of telephone service and scaling back walk-in assistance but provides little additional detail. Without more detail about how taxpayers will be affected, it is difficult to assess whether the 2006 proposed budget would allow IRS to achieve its stated intent of both maintaining a high level of taxpayer service and increasing enforcement. BSM and related initiatives such as electronic filing hold the promise of delivering further efficiency gains that could offset the need for larger budget increases to fund taxpayer service and enforcement. Today, taxpayers have seen payoffs from BSM; however, the program is still high risk and budget reductions have caused substantive program changes. IRS has recognized it is time to revisit its long-term BSM strategy and is currently refocusing the program. As we did with long-term goals above, we want to underscore the importance of timely completion of the revision of the BSM strategy. Recommendation We recommend that the Commissioner of Internal Revenue supplement the 2006 budget request with more detailed information on how proposed service reductions would impact taxpayers. Description of IRS’s Proposed Budget Structure IRS's proposed new budget structure as depicted in figure 7 combines the three major appropriations that the agency has had in the past— Processing, Assistance, and Management; Tax Law Enforcement; and Information Systems into one appropriation called Tax Administration and Operations. The Business Systems Modernization and Health Insurance Tax Credit Administration appropriations accounts remain unchanged. The Tax Administration and Operations appropriation is divided among eight critical program areas. These budget activities focus on Assistance, Outreach, Processing, Examination, Collection, Investigations, Regulatory Compliance, and Research. According to IRS, as it continues to move forward with developing and implementing this new structure, these program areas and the associated resource distributions will be refined to provide more accurate costing. IRS reported that the new budget structure has a more direct relationship to its major program areas and strategic plan. We did not evaluate IRS's proposed budget structure as part of this engagement because it was not within the scope of our review. However, we have recently completed a study on the administration's broader budget restructuring effort. In that study we say that, going forward, infusing a performance perspective into budget decisions may only be achieved when the underlying information becomes more credible and used by all major decision makers. Thus, the Congress must be considered a partner. In due course, once the goals and underlying data become more compelling and used by the Congress, budget restructuring may become a better tool to advance budget and performance integration. BSM Project Life Cycle Cost/Schedule Variance and Benefits Summary The table below shows the life-cycle variance in cost and schedule estimates for completed and ongoing Business Systems Modernization (BSM) projects, based on data contained in IRS's expenditure plans. These variances are based on a comparison of IRS's initial and revised (as of July 2004) cost and schedule estimates to complete initial operation or full deployment of the projects. How IRS Allocated Expenditures and Full- Time Equivalents in Fiscal Year 2004 Figures 8 and 9 illustrate how the Internal Revenue Service (IRS) allocated expenditures and full-time equivalents (FTE) in fiscal year 2004. Figure 8 shows total expenditures. The percentage of expenditures devoted to contracts decreased from 9 percent in 2002 to 5 percent in 2004, because of fewer private contracts. The percentage of expenditures devoted to other nonlabor costs increased from 8 percent in 2002 to 12 percent in 2004, due to increases in miscellaneous costs. Figure 9 shows IRS’s total FTEs. FTEs have decreased slightly from 99,180 in 2002 to 99,055 in 2004. We previously reported that processing FTEs declined 1 percentage point between 2002 and 2003. Between 2003 and 2004, IRS’s allocation of FTEs remained similar with a 1 percentage point increase in conducting examinations, and in management and other services.

Summary: The Internal Revenue Service (IRS) has been shifting its priorities from taxpayer service to enforcement and its management of Business Systems Modernization (BSM) from contractors to IRS staff. Although there are sound reasons for these adjustments, they also involve risks. With respect to the fiscal year 2006 budget request, GAO assessed (1) how IRS proposes to balance its resources between taxpayer service and enforcement programs and the potential impact on taxpayers, (2) the status of IRS's efforts to develop and implement the BSM program, and (3) the progress IRS has made in implementing best practices in developing its Information Technology (IT) operations and maintenance budget. For the 2005 filing season, GAO assessed IRS's performance in processing returns and providing taxpayer service. IRS's fiscal year 2006 budget request of $10.9 billion proposes increased funding for enforcement, but reduced funding for taxpayer service and BSM. However, the potential impact of these changes on taxpayers in either the short- or long-term is unclear, because IRS has not provided details of proposed taxpayer service reductions, and although it is developing longterm goals, they are not yet finalized. Because of the proposed reductions and new and improved taxpayer services in recent years, this is an opportune time to examine the menu of services IRS provides. It may be possible to maintain the overall level of service to taxpayers by offsetting reductions in some areas with new and improved service in other areas. Taxpayers and IRS are seeing some payoff from the BSM program, with the deployment of initial phases of several modernized systems in 2004. Nevertheless, the BSM program continues to be high-risk, in part, because projects have incurred significant cost increases and schedule delays and the program faces major challenges in areas such as human capital and requirements management. As a result of budget reductions and other factors, IRS has made major adjustments. It is too early to tell what effect these adjustments will have on the program, but they are not without risk and could potentially impact future budgets. Further, the BSM program is based on strategies developed years ago, which, coupled with the delays and changes brought on by budget reductions, indicates that it is time for IRS to revisit its long-term goals, strategy, and plans for BSM. Because of these challenges, IRS is redefining and refocusing the BSM program. IRS has generally maintained or improved its filing season performance in 2005. Processing is more efficient, the accuracy of answers provided by telephone assistors is improved, and telephone access is relatively comparable to last year. This is particularly noteworthy, because IRS received less funding for taxpayer service in 2005 than it spent in 2004. Because the filing season is not over, the full impact on taxpayers and IRS operations is not yet known. However, there are indications of slippage in telephone access such as more abandoned calls and longer wait times.

gov_report

en

Summarize: Image caption Sgt Emile Cilliers denies attempting to murder Victoria Cilliers An Army sergeant tried to kill his wife by removing parts of her parachute, causing her to spin thousands of feet to the ground, a court has heard. Emile Cilliers, 37, is accused of two counts of attempted murder of Victoria Cilliers who survived the jump on 5 April 2015. Winchester Crown Court heard Ms Cilliers suffered multiple injuries. Mr Cilliers, who denies all charges, wanted to leave his wife for a lover he had met on Tinder, prosecutors said. It is also claimed that just days before the jump, on 29 March 2015, the defendant tried to kill Ms Cilliers, 40, by deliberately causing a gas leak in the family home while he stayed away. Image copyright Wiltshire Police Image caption Police evidence showed the kitchen cupboard where the gas leak occurred (large arrow) Prosecutor Michael Bowes QC said that on the night of the gas leak Mr Cilliers had left his wife at their home in Amesbury, Wiltshire, to stay at his Army barracks in Aldershot, Hampshire. He said the following morning Ms Cilliers contacted her husband complaining of a gas smell coming from a kitchen cupboard next to the oven. She noticed dried blood on the fitting which was later found to be a full DNA match to her husband, the court was told. The jury was told the Royal Army Physical Training Corps sergeant lied to his lover, Stefanie Glover, that he was leaving his wife because she was having an affair and he was not the father of one of their children. Mr Bowes QC said Mr Cilliers was also having an affair with his ex-wife Carly Cilliers. He told the court the defendant had debts of £22,000 and believed he would receive a £120,000 life insurance payout on his wife's death. Image copyright PA Image caption Emile Cilliers made up lies about his wife having an affair, the court heard Mr Bowes QC said Ms Cilliers was a highly experienced parachutist and instructor but when she jumped out of the plane 4,000ft (1,200m) above Netheravon Airfield in Wiltshire "both her main parachute and her reserve parachute failed". "Those attending at the scene expected to find her dead, although she was badly injured, almost miraculously she survived the fall. "Those at the scene immediately realised that something was seriously wrong with her reserve parachute, two vital pieces of equipment which fasten the parachute harness were missing," he said. Image copyright PA Image caption Police picture of the gas pipe which Sgt Cilliers allegedly tampered with The day before the failed jump the couple had visited Netheravon together, the court heard. While there Mr Cilliers collected a hire parachute for his wife and took it into the men's toilets at the base, where he is alleged to have tampered with it. Mr Bowes QC said: "It's heavy, it's bulky, there is absolutely no reason to take it in there at all. "The weather was so poor that afternoon that Victoria couldn't jump, the cloud base was too low." The court heard that Mr Cilliers then arranged to keep the equipment overnight in his wife's locker, a move that was against normal procedure. He added that at the time of the murder attempts, Mr Cilliers was leaving his wife and treated her with "callousness and contempt". The third allegation, which Mr Cilliers also denies, is damaging a gas fitting, reckless to endangerment of life. The trial continues. The PT based in Aldershot, Hampshire has pleaded not guilty to three charges in relation to his wife Victoria Cilliers Click to share on WhatsApp (Opens in new window) Click to share on Facebook (Opens in new window) Click to share on Twitter (Opens in new window) WINCHESTER Crown Court heard the extreme lengths an army sergeant allegedly went through to be with his Tinder lover. Emile Cilliers has been accused of attempted murder on two counts, but who is the army sergeant and what is his background? Simon Jones - The Sun Emile Cilliers arrives at Winchester Crown Court for the start of his trial Who is Emile Cilliers? South-African born Cilliers is a 37-year-old PT instructor. Based in Aldershot, Hampshire, he works with the Royal Army Physical Training Corps - attached to the Royal Engineers. According to reports, he had a string of affairs during his marriage to wife Victoria Cilliers. He was also said to be £22,000 in debt around the time he tried to kill Ms Cilliers. Pixel 8000 Emile with the ex-wife he allegedly tried to kill, Victoria Cilliers, 40 Why has he been accused of attempted murder? On April 5 2015, Easter Sunday, Victoria Cilliers suffered multiple serious injuries after a botched parachute jump. Emile allegedly removed parts of her parachutes which were deemed important for a safe jump, causing her to spring out of control on Salisbury Plain. Victoria, an Army physiotherapist and "highly experienced parachute instructor" broke her leg, collarbone and ribs when the main parachute and reserve chute failed. Emile has also been accused of damaging a gas valve at their home, days before he severed her parachute, in a bid to kill her. Not known, clear with picture desk Emile Cilliers and his wife Victoria pose for a photograph before he allegedly tried to kill her When his wife Victoria noticed the damaged valve, she jokingly texted him, "Are you trying to kill me". Emile was trying to kill Victoria after he lied to his Tinder love Stefanie Goller, that Victoria had cheated on him, and he was not the father of one of their kids, the QC said Prosecuter Michael Bowes QC told the court Emile was treating his wife with "callousness and contempt" around the time of the botched murder attempts. What did Emile Cilliers plea in court? Cilliers pleaded not guilty to three charges in relation to his wife. The trial continues at Winchester crown court.

Summary: On a cloudy day in 2015, British army sergeant Emile Cilliers offered to take his wife skydiving as a treat. It turned out to be anything but. Victoria Cilliers, who'd previously taken part in 2,600 skydives, was helpless when both her main and reserve parachutes failed, sending her plummeting 4,000 feet to the ground. Never before in the UK had there been a double parachute failure and those who first reached her expected to find the army physiotherapist dead, report the BBC and Guardian. So, too, did her husband, according to prosecutors, but she survived. Speaking at Cilliers' attempted murder trial this week, prosecutors described how Cilliers allegedly removed half of the clips connecting his wife's harness to the parachutes in an effort to rid her from his life. Having promised to start a new life with a woman he'd met on Tinder, Cilliers didn't initially plan for the botched skydive, which Victoria survived with a broken pelvis, ribs, and vertebrae, prosecutors say. They argue Cilliers-who was nearly $30,000 in debt and allegedly believed he would've received a life insurance payout of almost $160,000 after his wife's death-tampered with a gas pipe in the couple's kitchen a week before the skydive in the hope that it would cause an explosion. "Are you trying to kill me?" his wife reportedly asked Cilliers in jest upon discovering the leak. Cilliers later texted her, "You want to go jump this weekend?" per the Sun. He has pleaded not guilty to two counts of attempted murder.

multi_news

en

Summarize: Background For each of their aircraft, the Air Force lead commands set training requirements that aircrews must complete on an annual basis in order to maintain combat mission readiness. These training requirements include basic tasks such as take-offs and landings and also more-advanced tasks, such as air-to-air combat and ground-attack missions. To help meet these requirements, the Air Force has developed an approach to training that it terms distributed mission operations. This approach is intended to train units as they expect to fight, maintain readiness, and conduct mission rehearsals in a realistic environment. Distributed mission operations utilizes the integration of virtual (e.g., a person training in a simulator) and constructive (e.g., computer generated) elements to train personnel at geographically separated sites by means of a network. For the purposes of this report, we refer to training that includes a simulator as virtual training. The Air Force has four primary centers that facilitate distributed mission operations by connecting units and simulators from geographically dispersed areas: Distributed Mission Operations Center in Albuquerque, New Mexico, managed by Air Combat Command; Distributed Training Operations Center in Des Moines, Iowa, managed by the Air National Guard; Warrior Preparation Center in Einsiedlerhof, Germany, managed by U.S. Air Forces Europe; and Korean Air Simulation Center in Osan, Republic of Korea, managed by Pacific Air Forces. The Distributed Mission Operations Center functions as the lead integrator of virtual systems to conduct theater-level exercises and events that include air, land, space, cyber, and maritime virtual assets for Air Force, joint, and coalition partners. These large-scale events, known as virtual flags, are conducted quarterly and last about 2 weeks. In 2011, the Distributed Mission Operations Center trained over 1,400 personnel from the Air Force, Army, Navy, Marines, and coalition forces through this virtual exercise as well as other, small-scale, events. The Distributed Training Operations Center plans, builds, and manages small-scale events to meet the learning objectives of its customers, mainly Air Combat Command, Air National Guard, and Air Force Reserve Command. These events are short-term, typically lasting 90 minutes. During 2011, the Distributed Training Operations Center conducted over 4,000 events that trained more than 9,500 personnel, of which at least 60 percent were active-duty personnel. The two overseas virtual training centers provide different capabilities for the commands they support. The Warrior Preparation Center supports training for joint, coalition, and partner-nation forces in the European and African theaters. In addition, the Warrior Preparation Center supports an Air-to-Ground Operations School and three detachments that provide multinational training opportunities. The Korean Air Simulation Center operates constructive simulations that support the air operations in Korea during U.S. Forces Korea operational-level exercises and supports selected exercises for U.S. Forces Japan. To train its units and personnel, the Air Force conducts distributed mission operations using several different internal Air Force and Department of Defense (DOD) information networks. Some of these key networks, along with their managing organizations, are shown in table 1. These networks differ according to such factors as security restrictions, bandwidth capacity, data protocols, and support services. In May 2010, the Secretary of Defense directed DOD to undertake a department-wide efficiency initiative to reduce excess overhead costs and to reinvest the resulting savings in sustaining force structure and modernization. The Air Force identified a number of areas to improve its efficiency, including an initiative, beginning in fiscal year 2012, to decrease training costs by reducing its live flying hour program for its legacy fighter and bomber aircraft by 5 percent and its Air Force Reserve Command F-16 flying hour program by 10 percent.initiative, the Air Force expects to save a total of $1.7 billion from fiscal years 2012 to 2016. The Air Force estimated savings of about $268 million for fiscal year 2012. In discussing the initiative, the Air Force stated that it expected to offset any effect on readiness caused by a reduction in live flying hours by increasing its use of simulators. Air Force Major Commands Determine Their Mix of Live and Virtual Training Based on Various Factors Currently, the three lead Air Force major commands—Air Mobility Command, Air Force Special Operations Command, and Air Combat Command—have similar processes to determine the mix of live and virtual training, but the mix of training differs across the major commands, and among aircraft within the commands. Air Combat Command is responsible for fighters, bombers, and attack aircraft; Air Mobility Command is responsible for transport and tanker aircraft; and Air Force Special Operations Command is responsible for special-operations aircraft. At each command, training-requirement review boards composed of subject-matter experts meet to consider broad sets of training issues and evaluate training requirements for specific aircraft. The boards consider factors such as specific combatant command mission requirements and the capabilities of simulators and networks that have already been fielded, and determine which training requirements can be completed in a virtual environment and which need to be completed in a live environment. The results of their reviews are reflected in updated training guidance for each type of aircraft. In addition, each of the commands also establishes requirements to improve, acquire, or upgrade training devices to meet mission tasks. While all three lead major commands rely on both live and virtual training to meet aircrews’ training requirements, the mix is different for each major command, as discussed below. Air Mobility Command For each aircraft type, Air Mobility Command issues a requirement document that specifies the number of times each task or “event” must be completed for a pilot or aircrew to be certified as mission ready. The document also specifies the percentage of events that can be completed in a simulator. For example, the C-130 requirement document specifies that 50 percent of assault landings may be completed in a simulator and 100 percent of instrument approaches in a simulator. Although live and virtual training requirements vary by aircraft, according to Air Mobility Command officials, approximately 50 percent of aircrew training is conducted in simulators, including all training related to takeoffs, landings, and instrument approaches.however, training for some special qualifications such as aerial refueling, formation flying, airdrops, and assault landings must periodically be conducted live in the actual aircraft. For example, for aerial refueling, currently, there are differences between what the fighter pilots see in their simulators and what air refueling crews see in their simulators. Because the simulators are currently not able to accurately replicate the aerial refueling environment, simulated training cannot yet replace live training. In developing its virtual training program, Air Mobility Command worked with the Federal Aviation Administration to leverage civilian standards, which require simulators to respond like the actual aircraft in order to be certified for training. Air Mobility Command is currently developing a networked distributed training center that would enable more virtual training with combat air forces and coalition partners. Air Force Special Operations Command As Air Mobility Command does, for each aircraft type Air Force Special Operations Command issues a requirement document that specifies the number of times each task or “event” must be completed for a pilot or aircrew to be certified as mission ready and the percentage of events that can be completed in a simulator. Air Force Special Operations Command officials stated that the command’s goal is to accomplish up to 50 percent of its aircrew training in simulators depending upon the aircraft. For example, aircrew training requirements for the AC-130U, a close air support aircraft, allows aircrew to accomplish 50 percent of their mission tasks in a simulator. Air Force Special Operations Command based its simulator certification program on the standards and metrics used by the Federal Aviation Administration and Air Mobility Command. Air Force Special Operations Command officials stated that simulators provide training that might not be available in the live environment, such as training for specific locations or adverse weather conditions. Air Force Special Operations Command has a stated goal to perform all qualification and continuation training events in the simulator, while increasing both live and simulator mission rehearsal training. Air Combat Command Air Combat Command also issues a requirement document for each type of aircraft on an annual basis. Virtual training requirements vary by aircraft, with large aircraft such as bombers generally able to satisfy more of their training requirements in simulators than fighters. Beginning in fiscal year 2012, Air Combat Command’s training-requirement review board revised each aircraft’s training requirements and specified that approximately 25 percent of training requirements were to be met using virtual training, while the rest of the requirements were to be met using live training. Prior to this, Air Combat Command training guidance specified that virtual training was to be used as a supplement to live training, but it did not set a goal or specific percentage requirement for virtual training. The virtual training that had been done in those years included emergency procedures, instrumentation training, and tactical training rather than mission training. With the availability of more- advanced full mission-training simulators, aircrews are now able to train beyond these basic tasks to more-advanced air-to-air and air-to-ground combat missions, like suppression of enemy air defenses. According to Air Combat Command officials, the combat air forces face certain challenges that prevent them from conducting the same level of virtual training as forces from the other major commands. Some challenges arise due to differences between unit and simulator locations, difficulties coordinating distributed training events, and a lack of simulator fidelity. For example, officials stated that there are very few simulators collocated with Reserve component units, which means valuable reserve component training time can be lost travelling to and from the simulators. Officials also noted that the software for some aircraft simulators is two or three versions behind the software in the actual aircraft, which could in some cases, affect the performance of aircrews in the actual aircraft. In addition, fighter simulators cannot replicate the extreme physical effects of air combat maneuvers that fighter pilots experience in the actual aircraft. Fighter pilots we interviewed stated that unlike flying other aircraft such as bombers and transports, fighter pilots must effectively make decisions while conducting their missions in a hostile environment and maneuvering the aircraft through high-speed and high-gravity maneuvers that put stress on the human body. We note that the Navy faces similar challenges in conducting virtual training for its fighter aircrews. For example, the crews of the Navy’s F/A-18E/F currently conduct 18 percent of their training through virtual training and plan to increase this to 32 percent by 2020. The Air Force Has Not Established an Overarching Organizational Framework to Guide, Oversee, and Integrate Virtual Training Efforts The Air Force has recently taken steps to increase management attention over its virtual training efforts, but its approach to virtual training currently lacks (1) a designated organization with accountability and authority for achieving results and (2) an overarching strategy—key elements of an organizational framework that we have found to be critical for successful transformations in both public and private organizations. In the absence of a framework to structure and guide its virtual training efforts, the Air Force will continue to face challenges in integrating its virtual capabilities and cannot be certain that its efforts align with strategic goals or know whether critical gaps or duplication of efforts exist. The Air Force Has Increased Management Focus on Virtual Training Efforts, but Oversight Remains Fragmented According to Air Force leadership, distributed mission operations are the cornerstone of the Air Force training transformation. Additionally, in the Strategic Plan for the Next Generation of Training, DOD has emphasized comprehensive training that integrates service and joint capabilities. The Air Force has increased management attention on virtual training efforts by reorganizing and creating new headquarters offices and establishing working groups, but oversight remains fragmented. For instance, in February 2011, the Air Force Agency for Modeling and Simulation was realigned under Headquarters Air Force Director of Operations (A3O) to serve as the execution arm for integrating and implementing virtual capabilities, resources, and policy. Also, in August 2011, the Air Force established the Headquarters Air Force Director of Operations– Operational Training (A3O-CL) office to provide leadership and support to distributed mission operations users across the Air Force. Additionally, in February 2012, Headquarters Air Force established a working group, composed of subject-matter experts from the Distributed Training Centers and the major commands, to address operational challenges within the virtual training programs. Issues unable to be resolved in this forum are elevated to higher-level working groups including the Headquarters Operations Conference, the Modeling and Simulation Steering Committee, and finally the Air Force Modeling and Simulation General Officer’s Steering Group. These organizations and working groups have increased management focus on virtual training efforts, but the Air Force has not designated an organization with accountability and oversight authority necessary to integrate all its virtual training efforts, including developing and acquiring interoperable virtual training systems and establishing and enforcing authoritative standards for simulators, constructive elements, and databases. Rather, oversight of standards development, acquisition, sustainment, and integration of training systems is fragmented among various Air Force organizations, as shown in table 2. In the absence of an organization to guide virtual training efforts, the lead major commands have developed their own standards and acquired and fielded systems that are not interoperable and often require costly, time- consuming work-arounds to be able to train together in large, complex virtual training exercises. For example, in conducting its quarterly virtual flag exercises, the Distributed Mission Operations Center must integrate simulators and networks that have been developed to different standards. To integrate all the participants into the exercises, the center must implement “gateways” that allow dissimilar simulators to translate data; develop databases to provide a common constructive environment; and link numerous Air Force and DOD networks that have different security restrictions, bandwidth limitations, and data transfer protocols. According to officials, developing and implementing these types of solutions takes up to 9 months, and involves significant reliance on contractor personnel. The network configuration must be certified for each virtual flag event and then it must be disassembled, reconfigured, and recertified for subsequent training events. While the Air Force has been developing these work-around solutions to allow interoperability among its older aircraft simulators, similar solutions will be also be needed for Joint Strike Fighter simulators as they are fielded and integrated into distributed mission operations. According to Joint Strike Fighter program office officials, the programs’ operational requirement document specifies that the aircraft and simulators must be interoperable with other aircraft and networks, but interoperability is not scheduled to be achieved until later blocks in the program’s development. The Air Force’s current Joint Strike Fighter simulators are stand-alone and not integrated into distributed mission operations. Like other aircraft simulators, the Joint Strike Fighter simulators will require complex multilevel security guards and gateways to allow them to operate with other aircraft simulators in a distributed mission environment. Joint Strike Fighter program officials stated that since the types of interoperability challenges that they face are not unique but are similar to those of other programs there should not be any unique technical barriers that would prevent solutions to these challenges. Air Combat Command is also currently assessing the technologies needed to integrate live and virtual training for the Joint Strike Fighter. Our prior work has found that designating an integration team, vested with the necessary authority and resources, is a critical element of managing the transformation of an organization. We note that the Army and the Navy have each designated an organization with centralized oversight over standards development, acquisition, sustainment, and integration of virtual training systems. Further, the Navy has established guiding principles and investment priorities to assist decision makers in selecting the proper simulator solution for specific training requirements and gaps, and to help avoid interoperability issues. One of the principles states that simulators intended to interface with other simulators must be compatible with the Navy Continuous Training Environment network. A Navy training instruction elaborates on this guiding principle by further stating, “Interoperability is a key objective for Fleet simulators. Translator development is expensive and time consuming, translation slows things down (introduces latency), and translation is never perfect. To reduce the need for translators to overcome interoperability challenges, Navy Continuous Training Environment network technical standards have been adopted Fleet-wide and are mandatory for new simulators that will integrate into Fleet synthetic training.” Office of the Under Secretary of Defense, Strategic Plan for the Next Generation of Training for Department of Defense (Sept. 23, 2010). training environment. However, the Air Force has not yet identified an organization to perform this oversight. Without a dedicated organization with responsibility and accountability to integrate virtual training efforts, the Air Force may continue to face challenges in managing and integrating its virtual training efforts, including interoperability issues that lead to diminished training quality, fewer training opportunities due to lengthy preparation times, and increased costs. Individual Air Force Initiatives to Enhance Virtual Training Capabilities Are Not Yet Guided by an Overarching Strategy The Air Force is currently pursuing a number of individual initiatives to enhance its virtual training capabilities. Among these initiatives are the following: Air Mobility Command is planning to create and staff a Distributed Training Center at Scott Air Force Base in December 2012. The training center is initially planned to provide the integration capability needed for transport aircraft simulators to conduct distributed mission operations on a daily, consistent basis and will also provide the ability for these simulators to participate in Distributed Mission Operations Center events. Air Mobility Command also has plans to expand the center’s capability to include integration of tanker simulators to train air refueling virtually. The Distributed Training Operations Center has increased its capabilities in response to increased user requirements and mission requests by adding personnel and expanding event availability. Additionally, the Distributed Training Operations Center plans to work with the major commands to establish remote capability sites that would be networked to the center to increase distributed mission operations availability across the Air Force. According to Distributed Training Operations Center officials, remote-capability sites have already been established for the Air National Guard in South Dakota and Pacific Air Forces in Alaska. Air Combat Command is in the process of establishing a Distributed Training Center at Langley Air Force Base. The training center is intended to provide a focal point for scheduling of combat air forces events not involving the Distributed Training Operations Center or Distributed Mission Operations Center. It is also intended to provide scenario development, focused on training gaps, desired unit missions, operational plan missions, and other tactics, techniques, and procedures. The training center is expected to be fully operational in September 2012. Air Force Special Operations Command is in the process of establishing a Distributed Training Center at Cannon Air Force Base that will focus on virtual training activities for initial and mission qualification training and unit-level mission essential tasks. Our prior work has found that strategic planning is a key element of an overarching organizational framework. For example, a leading practice derived from principles established under the Government Performance and Results Act of 1993 is to improve the management of federal agencies by developing comprehensive strategies to address management challenges that threaten their ability to meet long-term goals. We have previously reported that these types of strategies should contain results-oriented goals, performance measures, and expectations with clear linkages to organizational, unit, and individual performance goals to promote accountability and should also be clearly linked to key resource decisions. While the Air Force currently has numerous individual initiatives underway to enhance its virtual training capabilities and is planning to make additional investments, it has not yet developed an overall strategy to guide and integrate these efforts. For example, the Air Force has not outlined overall goals for its virtual training efforts, resource needs, and investment priorities. In the absence of a strategy, the Air Force cannot be certain that its individual initiatives are synchronized and will address its highest priority needs. Air Force officials stated that they are currently developing a Live, Virtual, Constructive Flight Plan to serve as their strategy for virtual training. They told us the Flight Plan will provide direction to the major commands on the handling of operational issues and will establish an internal structure for how issues are to be raised and resolved. Officials expect that the Flight Plan will be completed by July 2012. Officials stated that a separate effort will be undertaken to develop an acquisition strategy for virtual training systems. At this point, it is unclear the extent to which these plans will contain the necessary elements of an overall strategy that the Air Force can use to manage and integrate its planning and acquisition efforts. Air Force Lacks Cost Data for Virtual Training and Did Not Account for Virtual Training Costs When Determining Savings from Its Flying-Hour Efficiency Initiative In outlining its efficiency initiative related to training, the Air Force estimated potential cost savings of $268 million for fiscal year 2012, and a total of $1.7 billion for fiscal years 2012 to 2016 by among other things, reducing legacy combat Air Force flying hours across the board by 5 percent. The flying-hour efficiency initiative also called for a concurrent increase in the use of high-fidelity simulators and virtual training to avoid any effect on aircrews’ mission readiness from the reduction in live flying. However, in estimating costs, the Air Force included the savings associated with reductions in live training but not the potential costs associated with increases in virtual training that were called for to offset the reduction in live training. On the basis of our prior work, cost savings estimates should include all significant costs in order to have a reasonable basis. Additionally, federal internal control standards state that decision makers need visibility over a program’s financial data to determine whether the program is meeting the agencies’ goals and effectively using resources. Air Force officials told us that the cost savings associated with the flying- hour efficiency initiative were estimated by multiplying the reductions in live training flying hours for each aircraft by the cost per flying hour for that aircraft, and then adding the resultant figures for all the aircraft to determine total savings. For example, according to numbers provided by the Air Force, the live training cost of 1 F-15E flight hour is approximately $17,449 and F-15E flying hours were reduced by 1,782 hours. These amounts were multiplied together to arrive at the Air Force’s projected total savings of approximately $31,094,000 for reductions in F-15E flight hours. Similar calculations were made for each of the other aircraft that had their flight hours reduced and the savings for all the aircraft were summed. The Air Force did not consider any potential costs associated with the increase in virtual training in its estimate of cost savings because it has not developed a methodology to collect and track information on the cost of its virtual training program. According to Air Force officials, some training costs could increase as a result of increases in virtual training. These costs could include expenses for aircrew to travel to simulator locations, additional contractor personnel to schedule and operate simulators, and the purchase of additional simulators to meet increased demand. Furthermore, according to Air Force officials, identifying virtual training costs is challenging because funds to support virtual training and distributed mission operations are currently dispersed across multiple program elements. For example, our analysis identified a portion of virtual training funding, specifically distributed mission operations funding, in a program element titled “Human Effectiveness Applied Research.” In another case, distributed mission operations funding was part of a program element titled “International Activities,” under an “Armaments Cooperation” subcategory that also included funding for alternative energy among other things. In 2011, the Air Force conducted a onetime study in an attempt to identify the full cost of its virtual efforts. It found that the total investment in virtual capabilities for fiscal year 2012 was at least $1.9 billion. Of that, operational training support accounted for approximately 50 percent of the annual investment, including the largest identified expenditure of $182.3 million for combat air forces distributed mission operations. However, the study noted that its efforts may not have identified all program elements associated with virtual training and therefore further steps would be needed to capture the full value of the Air Force’s virtual training investment. As of May 2012, the Air Force had not taken any additional steps to develop a methodology for identifying virtual training costs. Without a means to collect or calculate its virtual training costs, the Air Force lacks the information it needs to make informed investment decisions in the future regarding the mix of live and virtual training. Furthermore, the Air Force will be unable to determine the potential costs associated with its flying-hour efficiency initiative. Conclusions In an effort to achieve greater efficiencies in its training program while maintaining mission readiness, the Air Force has taken various steps to emphasize and increase the use of virtual training. Among other things, the Air Force has implemented various initiatives and established organizations intended to enhance its virtual training capabilities. However, none of these organizations have the authority necessary to ensure the integration of the Air Force’s virtual training efforts, and oversight remains fragmented. Further, the Air Force lacks an overarching organizational framework to guide its current virtual training efforts and the additional investments it plans to make. In the absence of such a framework, the Air Force faces challenges in managing its current inventory of virtual training systems and has experienced delays and costs that stem from the lack of interoperability among its simulators and networks, resulting in workarounds that are required to compensate for these limitations. An overarching management approach, including a single entity responsible for coordinating and integrating all virtual training efforts, as well as a comprehensive strategy that aligns individual efforts with goals and investment priorities, will not be enough if decision makers lack visibility over the potential costs of virtual training—especially as they consider future changes to the mix of live and virtual training. Until the Air Force has a methodology to consistently collect and track its virtual training costs and a management framework to coordinate its efforts, it will continue to face challenges to planning and conducting its virtual training and informing its future investment decisions. Recommendations for Executive Action To develop a fully integrated management approach to guide virtual training efforts and investments, we recommend the Secretary of Defense direct the Secretary of the Air Force to designate an entity that is responsible and accountable for integrating all of the Air Force’s virtual training efforts, including the development and enforcement of interoperability standards across virtual training systems, and investment planning; and develop an overarching strategy to align goals and funding for virtual training efforts across all Air Force major commands. This strategy should at a minimum contain elements such as results-oriented goals, performance measures, and a determination of resources needed to achieve stated goals. In addition, this strategy should show clear linkages between existing and planned initiatives and goals. To improve decision makers’ visibility over the costs related to virtual training, we recommend that the Secretary of Defense direct the Secretary of the Air Force to develop a methodology for collecting and tracking cost data for virtual training and use this cost data to help inform future decisions regarding the mix of live and virtual training. Agency Comments and Our Evaluation In written comments on a draft of this report, DOD stated that it concurred with all of our recommendations. In response to our recommendation to designate an entity that is responsible and accountable for integrating all of the Air Force’s virtual training efforts, including the development and enforcement of interoperability standards across virtual training systems, and investment planning, DOD stated that the Air Force has taken initial steps to designate its Headquarters, Air Force office, AF/A3/5 (Operations, Plans, and Requirements) as the single entity responsible for integrating the Air Force’s virtual training efforts. In response to our recommendation to develop an overarching strategy to align goals and funding for virtual training efforts across all Air Force major commands, DOD stated that the Air Force is developing an overarching strategy and policy to provide a fully integrated management approach to guide its Live Virtual Constructive-Operational Training efforts and investments. It further stated that operational level guidance will be provided in Air Force Instruction 36-2251, Management of Air Force Training Systems and that investment guidance to link virtual training to “Readiness” was provided in the Air Force’s Fiscal Year 2014 Annual Planning and Programming Guidance and Program Objective Memoranda Preparation Instructions. In response to our recommendation to develop a methodology for collecting and tracking cost data for virtual training and use this cost data to help inform future decisions regarding the mix of live and virtual training, DOD stated that the Air Force is taking actions to improve visibility related to virtual training to inform decisions regarding the mix of live and virtual training. It also stated that the Air Force Instruction regarding Management of Air Force Training Systems will provide major commands with clear guidance to employ consistent methods to collect and measure virtual training systems data. DOD said the Aviation Resource Management System will be enhanced to provide the capability to capture projected and executed aircraft virtual training and cost data to provide better oversight and management of virtual training funding. Finally, DOD stated that the Air Force is developing a standard methodology of accounting and tracking the programming and execution of program funds through improved visibility into cost categories associated with Live Virtual Constructive-Operational Training. DOD’s comments are included in their entirety in appendix II. DOD also provided a number of technical and clarifying comments, which we have incorporated where appropriate. We are sending copies of this report to appropriate congressional committees, the Secretary of Defense, the Secretary of the Air Force, and the Under Secretary of Defense for Personnel and Readiness. In addition, this report will be available at no charge on our website at http://www.gao.gov. If you or your staff have any questions about this report, please contact me at (202) 512-9619 or pickups@gao.gov. Contact points for our Offices of Congressional Relations and Public Affairs may be found on the last page of this report. GAO staff who made major contributions to this report are listed in appendix III. Appendix I: Scope and Methodology To address our objectives, we met with officials from the Office of the Secretary of Defense, Joint Staff, Office of the Secretary of the Air Force, Headquarters Air Force, and several Air Force major commands. Our review focused primarily on virtual training systems for manned aircraft from combat air forces, mobility air forces, and special operations forces. Excluded from this review were virtual training programs for unmanned aircraft, space, combat support, and combat service support systems. To determine how the Air Force determines the mix of live and virtual training, we obtained and analyzed training requirement instructions for combat, mobility, and special operations aircraft from each of the three lead major commands—Air Mobility Command, Air Combat Command, and Air Force Special Operations Command. We provided a questionnaire and received written responses from the major commands on the mix of live and virtual training and the benefits, limitations, and challenges of virtual training. We interviewed officials from Air Combat Command, Air Mobility Command, Air Force Special Operations Command, Air National Guard, Air Force Reserve Command, U.S. Air Forces Europe, and Pacific Air Forces. To determine the extent to which the Air Force has developed an overarching framework to guide, oversee, and integrate its virtual training efforts, we analyzed Air Force studies on virtual training technologies and capabilities. We reviewed relevant Department of Defense (DOD) and Navy training guidance. We also reviewed our ongoing work related to Navy virtual training. We interviewed officials from the Office of the Secretary of the Air Force, Headquarters Air Force, the Joint Staff, the Department of the Navy, Air Force Major Commands, the four primary centers that facilitate distributed mission operations, and joint training officials. We visited Langley Air Force Base, Virginia, to observe F-15 and F-22 simulator operations at the Mission Training Center. We also visited the Distributed Mission Operations Center at Kirtland Air Force Base, New Mexico, to observe a distributed training event and the center’s capabilities. To determine the extent to which the Air Force considered costs related to virtual training in estimating potential savings from its training efficiency initiative, we obtained and analyzed the Air Force efficiency calculation and compared it with cost saving estimating best practices. We analyzed Air Force budget program elements related to virtual training and distributed mission operations. We also analyzed an Air Force study on the cost associated with Air Force modeling and simulation efforts. We interviewed officials from the Air Force Defense Contracting Management Organization and Headquarters Air Force budget operations office, as well as officials from the major commands listed above. We conducted this performance audit from August 2011 to July 2012 in accordance with generally accepted government auditing standards. Those standards require that we plan and perform the audit to obtain sufficient, appropriate evidence to provide a reasonable basis for our findings and conclusions based on our audit objectives. We believe that the evidence obtained provides a reasonable basis for our findings and conclusions based on our audit objectives. Appendix II: Comments from the Department of Defense Appendix III: GAO Contact and Staff Acknowledgments GAO Contact Staff Acknowledgments In addition to the contact named above, Michael J. Ferren, Assistant Director; Russell M. Bryan; Paige A. Muegenburg; Mathew Sakrekoff; and Erik S. Wilkins-McKee made key contributions to this report.

Summary: Over the last 20 years, the Air Force has sought ways to expand its approaches to meeting aircrew training requirements, including the increased use of virtual training. In 2012, the Air Force reduced live flying hours, which it estimates will save $1.7 billion in fiscal years 2012 through 2016, as part of its response to the Secretary of Defense’s efficiency initiatives. GAO conducted this study in response to House Report 112-78, accompanying a bill for the Fiscal Year 2012 National Defense Authorization Act, which directed GAO to review the status of the military services’ virtual training programs. Specifically, GAO assessed (1) how the Air Force determines the mix of live and virtual training to meet training requirements; (2) the extent to which the Air Force has an overarching organizational framework to guide, oversee, and integrate its virtual training efforts; and (3) the extent to which the Air Force considered costs related to virtual training in estimating potential savings from its training efficiency initiative. To do so, GAO analyzed guidance and other documents, visited virtual training facilities, and interviewed officials from the Office of the Secretary of Defense, the Joint Staff, and the Air Force. The three lead Air Force major commands—Air Mobility Command, Air Force Special Operations Command, and Air Combat Command—all utilize training requirements review boards composed of subject-matter experts to determine training requirements for specific aircraft. These boards determine which training requirements can be completed in live or virtual environments based upon factors such as specific combatant command mission requirements and the capabilities of fielded simulators and networks. All three commands use a combination of live and virtual approaches, but the mix varies by aircraft. For example, Air Combat Command specifies that approximately 25 percent of its training requirements could be met virtually. The other two commands conduct approximately 50 percent of their training virtually. The Air Force has taken steps to manage its virtual training efforts, but its approach lacks some key elements of an overarching organizational framework needed to fully integrate efforts and address challenges. It has reorganized offices and undertaken various initiatives intended to enhance existing virtual training capabilities, but has not designated an entity to integrate these efforts or developed an overarching strategy to define goals, align efforts, and establish investment priorities. As a result, major commands have developed their own investment plans and standards for acquiring and fielding virtual training systems, which are often not interoperable and require costly, time-consuming work-arounds to allow personnel to train together and with joint and coalition partners. GAO’s prior work has found that a designated entity with the necessary authority and resources and an overarching strategy are critical elements of managing organizational transformations and meeting long-term goals and agency missions. In the absence of an approach that establishes clear accountability and a strategy to guide its planning and investment decisions, the Air Force will continue to be challenged to guide the efforts of its commands in planning for and investing in virtual training, ensure these efforts meet the highest priority needs and are synchronized to avoid gaps or future interoperability issues, and maximize available resources. The Air Force estimated it could save about $1.7 billion in its training program by reducing live flying hours and taking other steps, such as increasing the use of virtual training, but it lacks a methodology for determining the costs of virtual training and therefore did not consider these costs in its estimate. The Air Force estimated savings based solely on reductions in live flying hours without considering expenses such as those incurred for aircrew to travel to simulators, contractor personnel to schedule and operate simulators, and purchase of additional simulators. GAO has found that decision makers need visibility over financial data to meet agency goals and effectively use resources. Identifying virtual training costs is challenging because data is spread across multiple program elements in the Air Force’s accounting structure. The Air Force completed an initial study in September 2011 that identified some costs related to virtual training, but it concluded these data might not be complete. In the absence of taking further steps to determine the universe of costs and a means to collect and track data, the Air Force will be limited in its ability to make fully informed investment decisions about the mix of live and virtual training in the future.

gov_report

en

Summarize: BACKGROUND OF THE INVENTION [0001] 1. Field of the Invention [0002] The present invention relates to devices utilized to control the spread of ectoparasite-borne diseases and, more particularly, to an improved apparatus for feeding and applying pesticides onto animals, particularly wildlife such as deer. [0003] 2. Description of the Background [0004] A variety of diseases are transmitted to humans and animals by ectoparasites such as ticks. Certain species of wildlife, such as white-tailed deer, propagate and harbor large populations of ectoparasites in direct proximity to areas populated by humans and their domesticated pets. An effective strategy for the prevention of disease transmission through the control of ectoparasites includes the pesticidal treatment of such wildlife found in and around human-populated areas. Unfortunately, direct treatment can be challenging, especially with species that are not easily captured, restrained or otherwise handled directly. Thus, access to wildlife in order to control ectoparasites remains a challenging problem, [0005] There have been prior efforts to develop devices that passively (and surreptitiously) apply pesticides to wildlife. One noteworthy example by a subset of the present inventors is described in U.S. Pat. No. 5,367,983 to Pound et al. As shown in FIG. 1, the Pound et al. &#39;983 patent discloses an apparatus for feeding and applying pesticides onto animals, particularly wildlife such as deer. This device includes a feed supply bin 20 that spills feed into either side of an open-topped receptacle 10. A pair of spaced apart vertical support members 30 carry pesticide applicators 31 positioned near the sides of the receptacle 10. Pesticide applicators 31 are positioned on each of the support members 30, and are adapted to apply pesticide onto an animal upon contact therewith. Pesticide is automatically supplied, for example, from pesticide reservoirs 50 at the lower end of each applicator 31 that wick pesticide into the absorbent material of the applicator. While the concept of the Pound et al. &#39;983 device is excellent, the structural features leave room for improvement both functionally and to achieve manufacturing economy. For example, the vertical support members 30 in the aforementioned apparatus are rigid and may obstruct (or certainly do not adapt to) wildlife as they crane their heads and/or necks to feed and, therefore, may not apply adequate pesticide. Moreover, the design suggested by Pound et al. &#39;983 was intended for sheet metal construction, thereby resulting in sharp edges that might cut the animals and susceptibility to oxidation. In addition, the entire product had to be fully assembled at the factory and shipped as a unit. This was very heavy and expensive. It has been found that a more economical modular design more suited for molded construction allows ready solutions to the foregoing problems (the Pound &#39;983 design is not well-suited for molding). A modular molded product is comparatively lightweight, and the components can be shipped for user-assembly, thereby saving significant shipping and manufacturing costs. Therefore, there remains a need for a like device possessing an improved means for accommodating wildlife of all sizes (inclusive of all species of deer, cattle, antelope, elk, etc.), and which is formed by a simple, scalable, durable and economically mass-producible design which can be manufactured wholly or partly by molding in order to provide for more widespread use. SUMMARY OF THE INVENTION [0006] It is an object of the invention to provide an improved means for applying pesticides to wildlife that employs simple, durable modular componentry that is economical to manufacture, lightweight for economical shipping (the prior metal version was heavy and expensive to assemble), easy to assemble for user assemblage, and more rugged and durable in the field. [0007] It is another object to provide a plastic-molded means for applying pesticides to wildlife as described above that avoids sharp and rusty edges to maintain the safety of the animals and operators. [0008] It is still another object to provide an improved means for maximizing the per capita application of pesticide to deer, utilizing flexible applicators that adapt to and can accommodate animals that vary greatly in physical size, without obstructing them. [0009] In accordance with the above objects, the present invention is designed for the application of pesticides to animals as they feed. In use, the apparatus of this invention is positioned in the locus or vicinity of the animals to be treated with feed loaded in the feed bin. Animals attracted to the apparatus to feed will be subjected to the application of a pesticide upon their head, neck, ears, and/or, where applicable, antlers or horns upon contact with one or more of a plurality of applicators. [0010] Without being limited thereto, corn and other non-absorbent pelletized feeds are preferred. Attractions such as apple aromas may also be added to the feed as are conventional in the art. [0011] While the apparatus may be used for applying pesticides to a wide variety of animals, including domesticated species, it is particularly valuable for the treatment of wild or captive animals, in particular those species that have antlers or horns (e.g. deer, antelope, elk, goats, cattle), as well as those that do not (swine, sheep, etc.). The preferred embodiment of the present invention is an economically-designed apparatus fabricated of a variety of lightweight, rigid materials (e.g. molded plastics) to provide the durability required by the nature of its usage. The main sub-assemblies of the present invention are well-adapted for molded fabrication and include a dual-compartment feed trough/receptacle, a feed bin, a plurality of pesticide applicators, and an optional pesticide reservoir/feed system. [0012] Animal feed placed in the feed bin is dispensed into the trough/receptacle through an opening at the bottom of the bin. For the application of a pesticide to a feeding animal, a plurality of pesticide applicators are positioned proximate the two compartments of the trough/receptacle. The applicators are positioned such that as an animal feeds, some part of its head, neck and/or ears will contact one or more of the applicators. The applicators may be dosed with pesticide simply by wetting on a periodic basis (weekly), or automatically by an internal reservoir/feed system. To ensure contact between the animal and at least one applicator, the applicators are positioned relatively close together near the trough/receptacle feeding compartments. This creates limited side-long access through which the animal must crane their necks to reach the feeding compartment. The applicators are mounted on flexible masts that adapt to and can accommodate animals that may vary greatly in physical size, without obstructing them, thereby ensuring a full application of pesticide without exerting undue force on the applicators or the trough/receptacle. [0013] The modular molded product employs a simple, durable, economically mass-producible design with lightweight components that can be shipped for user-assembly, thereby reducing shipping and manufacturing costs. In the field the device has greater utility because it accommodates wildlife of a variety of sizes, poses no threat of harm to the animals, and maximizes the per capita application of pesticide. BRIEF DESCRIPTION OF THE DRAWINGS [0014] Other objects, features, and advantages of the present invention will become more apparent from the following detailed description of the preferred embodiments and certain modifications thereof when taken together with the accompanying drawings in which: [0015] FIG. 1 is a front view of a prior art apparatus for feeding and applying pesticides onto animals from U.S. Pat. No. 5,367,983 to the inventors herein. [0016] FIG. 2 is a perspective fully-assembled view of an apparatus 15 for applying pesticides to wildlife according to a first embodiment of the present invention. [0017] FIG. 3 is a perspective partial-assembly exploded view of the apparatus 15 of FIG. 2. [0018] FIG. 4 is a perspective partial-assembly exploded view of the apparatus 15 of FIG. 2. [0019] FIG. 5 is a top perspective view of the apparatus 15 of FIGS. 2-4. [0020] FIG. 6 is a cross-sectional view of a flexible applicator 40 including support member 44 and applicator sleeve 41 according to a first embodiment of the present invention. [0021] FIG. 7 is a cross-sectional view of the flexible applicator 40 flexible applicator 40 support members 44 flexible applicator 400 f FIG. 6 shown in a deflected condition due to the introduction of a side load or force. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS [0022] FIGS. 2-5 are, respectively, a perspective fully-assembled view, two perspective partial-assembly exploded views ( FIGS. 3-4 ), and a top view ( FIG. 5 ) of the apparatus 15 for applying pesticides to wildlife according to a first embodiment of the present invention. [0023] The major structural components of the apparatus 15 have been simplified to five modular snap-fit plastic (e.g., polyethylene) component parts, including a lid 34, feed bin 30, feed trough/receptacle assembly 20, a plurality of flexible applicators 40 anchored in the feed trough/receptacle assembly 20, and two adjustable gate assemblies 53 for limiting access to the feed trough/receptacle assembly 20. This modular embodiment facilitates packaging of the unassembled components and shipping in two compact boxes, rather than a fully assembled product. The simple snap-fit design allows the end-user to complete the assembly. Shipping costs are drastically reduced because non-freight carriers may be used. Assembly costs are reduced, and the replacement cost of expendable parts is reduced. The modular components are described in more detail below. [0024] As best seen in FIG. 3, the molded plastic feed trough/receptacle assembly 20 is formed with side walls 21, a bottom 22, and two feeding compartments 24. Presently, the feed trough/receptacle assembly 20 is rotationally molded, albeit blow- or injection-molding may also be suitable. The depth of each feeding compartment 24 is preferably sufficiently shallow to allow the animal to see over the top edge of the side walls 21 while feeding. Support legs and/or a base stabilizer (not shown in the Figures) may be used to prevent the tipping over of the apparatus 15 and to allow the trough/receptacle 20 to be positioned at some distance above the ground for ease of access by the appropriate animals, and notches 25 or sleeves may be molded into the trough/receptacle 20 as shown to seat the support legs. [0025] In accordance with the present invention, the trough/receptacle 20 is fabricated of one piece molded in high density cross-linked polyethylene or high density polyethylene plastic with integral side walls 21, bottom 22, and recessed feeding compartments 24, and molded sleeves 25 for press-fit insertion of support legs. [0026] The feed bin 30 is open-topped and open-bottom, and the trough/receptacle 20 is formed with a central plateau that segregates the feeding compartments 24 and partially blocks the open-bottom of the feed bin 30 such that when the feed bin 30 is seated on the trough/receptacle 20 there are two opposing apertures left open at the bottom of the feed bin 30 from which feed drains evenly into the feeding compartments 24. The recessed feeding compartments 24 are formed with an outwardly-angled surface for directing the feed downwardly and sideways away from the feed bin 30 toward the sides. The low-friction polyethylene of the feeding compartments 24 coupled with downward sloping surfaces has significantly less friction than galvanized metal surfaces, thus improving the flow of corn down the slopes. [0027] The supply of animal feed for the apparatus 15 comes from the molded plastic feed bin 30 that is positioned above the trough/receptacle 20 and is dispensed from the bin 30 into the feeding compartments 24 where it may be accessed by animals, through the opposing apertures or openings at the lower end of the bin 30. Preferably, a pair of guillotine divider gates 23 are inserted into corresponding notches formed in the sides of the trough/receptacle 20 to partially block access to the bin 30. These gates 23 may be adjustable up/down to vary the size of the opening, or may be fixed and interchangeable (with varying apertures) in order to regulate the flow of the feed from the bin 30. This helps to prevent large amounts of feed from being dispensed into the feeding compartment 24 at one time. Limiting the size of the openings to control the amount of feed dispensed into the feeding compartments 24 prevents the animal from rapidly consuming large amounts of feed and thus aids in keeping the animal at the apparatus 15 for a longer period of time. The use of adjustable gates 23 is preferred when it is envisioned that different feeds may be employed. It is also noteworthy that the floors 22 of the feeding compartments 24 are recessed below the feed slopes leading from the feed bin into feeding compartments 24. This in combination with the gates 23 aid in preventing water and moisture from creeping back into the feed bin 30, or from falling into the feeding compartments 24, thereby soaking the corn. [0028] Protection of the feed in the feed bin 30 is afforded by a plastic cover or lid 34 that may be friction fit, or pivotally attached to the bin 30, and secured in place via two latching brackets 35. The position of the bin 30 relative to the trough/receptacle 20 is not critical; it may be positioned approximately centrally or adjacent an end of the trough/receptacle 20. [0029] In accordance with the present invention, the feed bin 30 is fabricated of lightweight, rigid molded plastic (preferably also high density cross-linked polyethylene or high density polyethylene plastic) with annular reinforcing ribs 29. The feed bin 30 is preferably anchored to the receptacle 20 by a friction-fit shroud 33 that fits over the sidewalls of the receptacle 20. As best seen in FIG. 3, the outwardly extending shroud 33 is integral to the base of the feed bin 30 and is formed as a substantially horizontal plate with angled edges conforming to the sides of receptacle 20 to anchor it onto the receptacle 20. The shroud 33 extends partially over the bin opening. [0030] Both the feed bin 30 and trough/receptacle 20 are fully recyclable, may be made in any color, and include non-removable and non-fading EPA pesticide warning labels integrally formed into the plastic. The shape of the trough/receptacle 20 and the number of feeding compartments 24 may be varied, and other shapes (e.g. circular, oval, square) having more or fewer feeding areas may be utilized. [0031] As seen in FIGS. 2 and 4, adjustable gate assemblies 53 are provided over top the feeding compartments 24 to limit access thereto. Each gate assembly 53 comprises a secondary cover 54 fixedly attached to the feed bin shroud 33, and covering a bottom adjustable plate 55. Adjustable plate 55 is attached to mounting holes in the feed trough/receptacle 20, and adjustable plate 55 is provided with a corresponding series of adjustment holes for screw-attachment. By sliding the plate 55 forward or backward feed access can be restricted in discrete increments (for example, 0″, ½″, 1″, and 1½″). The secondary cover 54 is then secured in place (via set screws or the like) to cover the slide plate 55, and in this manner the adjustable gate assemblies 53 as a whole vary the feeding animals access to the feeding compartments 24. The intent here is to limit access as much as possible so that the feeding animal needs to tilt their head to dig under the gate assembly 53 in order to reach the feed in feeding compartments 24. This ensures that the animal makes full contact with flexible applicators 40 (to be described) all of which carry pesticide. [0032] Each flexible applicator 40 (four are shown) comprises a support member 44 equipped with an absorbent applicator sleeve 41. The support members 44 are positioned adjacent the outlying corners of each feeding compartment 24, opposite the feed bin opening, and each is slidably inserted into a conforming sleeve formed in trough/receptacle 20. Preferably, the base of each support member 44 is equipped with a detent pin for positive locking-engagement with the sleeves of trough/receptacle 20. In the illustrated embodiment, four pesticide applicator sleeves 41 are slidably inserted, one on each support member 44, likewise positioned at the corners of feed bin 30. One skilled in the art will understand that the number of support members 44 and applicator sleeves 41 can be varied in accordance with the number of feeding compartments 24. Pesticide applicator sleeves 41 extend upwardly above the upper edge of the trough assemblies&#39; side walls 21. Pesticide applicator sleeves 41 are similar to paint rollers, and each is slidably inserted onto a corresponding support member 44, which in turn is installed into a corresponding molded sleeve in trough/receptacle 20. The pesticide applicator sleeves 41 may be secured in place on support members 44 by detent caps 42. Pesticide applicator sleeves 41 are adapted to apply pesticide onto an animal upon contact. [0033] Both the feed bin 30 and trough/receptacle 20 are preferably configured to be shipped separately and economically (for example, multiple feed bins 30 may be stacked), but otherwise the size/shape may be varied to meet a wide variety of application-specific parameters. Thus, the device may be shipped partially assembled for complete assembly by the user. Final assembly proceeds as follows: [0034] 1. Secure feed bin 30 to the trough/receptacle 20 with four (2 each side) screws and four flat washers as shown (for example, ¼×20×1″ screws). Install legs (not shown) in sleeves 25 in the trough/receptacle 20. [0035] 2. Slide each divider gate 23 into the slot at each end of the trough/receptacle 20. Assure that the divider gates 23 are fully seated. [0036] 3. Place adjustable plate 55 over mounting holes in the trough/receptacle 20. In the illustrated embodiment adjustable plate 55 has four sets of adjustment holes. By sliding the plate 55 forward or backward feed access can be restricted by 0″, ½″, 1″, and 1½″. [0037] 4. Place secondary cover 54 over the adjustable plate 55 with mounting holes aligned to the adjustable plate 55 and the trough/receptacle 20. Assemble as shown in FIG. 4, and install nine ¼″×20×1″ screws, and an equal number of flat washers. Repeat this procedure at both ends to install both secondary covers 54. [0038] 5. Install four support members 44 into sleeves in the trough/receptacle 20. The detent pins should snap into corresponding lock holes in the sleeves to hold the support members 44 in place. [0039] 6. Slide pesticide applicator sleeves 41 over each of the four support members 44 and install detent caps 42 overtop. Again, the detent pin of support members 44 should snap into lock holes in the caps 42 to hold the caps 42 in place. [0040] 7. Place container lid 34 onto feed bin 30 and secure the lid 34 to feed bin 30 with the latches 35. [0041] 8. Fill the feed bin 30 and wet the pesticide applicator sleeves 41 with liquid pesticide. [0042] Given the foregoing assembly, when attempting to feed, animals access the feeding compartments 24 from either side of the apparatus by inserting their heads between a support member 44 and the feed bin 30. The animals are effectively forced by gate assemblies 53 to turn their head sideways, thereby ensuring better contact with an applicator sleeve 41. The back of the head, the neck, and/or the ears of the animal will contact one of the applicator sleeves 41 during the feeding process, resulting in the application of the pesticide. Further enhancement of the pesticide application process occurs if the animal chooses to deliberately and/or vigorously rub against the applicators 41 while feeding. The application of the pesticide to the aforementioned areas of the animal provides significant ectoparasite control because they are the locations that usually harbor the greatest number of ticks. [0043] FIGS. 6 and 7 are cross-sectional views of an exemplary flexible applicator 40 including support member 44 and applicator sleeve 41 according to the preferred embodiment of the present invention. FIG. 6 shows support member 44 and applicator sleeve 41 in an unloaded condition (i.e. not subject to a side load or force), while FIG. 7 shows them in a deflected condition due to the introduction of a side load or force (i.e. caused by a feeding animal). [0044] As can be seen in both FIG. 6 and FIG. 7, the support members 44 are adapted to flex slightly such that they accommodate the head, neck, or ears of a feeding animal. In accordance with the illustrated embodiment of the support member 44, this is accomplished by forming the support member with a spring-loaded rocker-base to allow a limited degree of rocking, with a tendency to right itself to an erect position when not biased. To this end each support member 44 further comprises an assembly of conventional PVC tubing components including a section of pipe 143 with a removable upper detent cap 42. The cap 42 is held in place by a conventional thumb-detent pin 142 inserted into the pipe section 143 and protruding out through aligned holes in both the pipe section 143 and cap 141. Thus, by depressing the detent pin 142 the cap may be easily removed to insert or replace the applicator 41 when necessary (by slidable insertion onto pipe section 143 ). The pipe section 143 extends downward to a rocker base 146 which may be a conventional threaded PVC pipe coupling. The pipe section 143 is seated loosely in the rocker base 146 and is not affixed, and so remains free to pivot therein by approximately +/−20 degrees in any direction. The pipe section 143 is biased into the rocker base 146 by an extension spring 145 that is extended between two pins 144 A &amp; 144 B. The first pin 144 A is inserted through the pipe section 143 midway along its length, while the second pin 144 B is inserted with a 90 degree offset through the rocker base 146 beneath the pipe section 143. Thus, spring 145 compresses the pipe section 143 into the rocker base 146 and maintains it in an erect orientation when not influenced by outside pressure. The threaded rocker base 146 may be inserted directly into the sleeves in the trough/receptacle 20 (see FIG. 4 ). The spacing and height of the support members 44, as well as the diameter of the applicators 41, can vary and may be readily determined by one skilled in the use of the apparatus 15. The spacing of the support members 44 /applicators 41 and the feed bin 30 is sufficient to entice an animal to pass its head through an opening in order to access a feeding compartment 24, but the recessed feed tray forces the animal to crane its neck such that the neck, ears, and/or back of the head of the animal will contact one or more of the applicators 41 during the feeding process. The height of the support members 44 /applicators 41 should be great enough to extend above the animal&#39;s head when feeding. The flexibility of the support members 44 /applicators 41 allows an animal possessing antlers, horns, etc. to feed just as easily as one that does not have them. [0045] FIG. 6 shows support member 44 and applicator sleeve 41 in an unloaded condition (i.e. not subject to a side load or force), while FIG. 7 shows them in a deflected condition due to the introduction of a side load or force (i.e. caused by a feeding animal). [0046] One skilled in the art will understand that alternate support members 44 and applicators 41 are possible without departing from the scope and spirit of the present invention. For example, rather than a rocker base 46 the pipe section 143 may be rigidly mounted but formed of flexible material to allow bending, such as a solid rubber cylinder, a hollow rubber tube section, or a cylindrical spring fabricated of rust-resistant metal or plastic. [0047] The applicators 41 may be constructed to deliver liquid (wet), solid or particulate (dry powder) pesticides. Virtually any pesticide may be applied including insecticides, specifically acaricides. However, only EPA approved/allowed pesticides may legally be used, and those that are specifically listed below are EPA approved. In the illustrated embodiment, the applicator sleeve 41 is an absorbent material that is periodically saturated (e.g. when the feed storage bin 30 is refilled) with pesticide. An absorbent material such as Draylon™ fabric wrapped about a tubular plastic or cardboard core is suitable for this purpose. A ½″-¾″ nap fabric works well (and retains the tickicide for a full week), and a bonded plastic core lasts longer than cardboard cores. The applicators 41 are periodically dosed with pesticide simply by wetting with tickicide on a weekly basis. The preferred tickicide is EPA approved 4 Poster (tm) liquid tickicide which is 10% permethrin-based. Alternatively, rather than periodic wetting, an optional on-demand automatic feed/delivery system may be used as described below. [0048] The optional pesticide feed/delivery system is more suitable in remote locations where weekly maintenance is undesirable. In accordance an embodiment incorporating a gravity-fed delivery system, the supply of pesticide to the applicators may occur through a pesticide reservoir connected with the top of each applicator sleeve 41 through a conduit. To prevent dripping and/or excess accumulation of pesticide on the applicators 41, pressure activated flow control valves may be provided to open and allow the flow of pesticide onto the applicators 41 when pressure, or a side load/force, is applied upon the applicator sleeve 41 by the feeding animal. Preferred valves include, but are not limited to, conventional spring-loaded pinch valves. In addition, a shut-off valve may also be provided to disrupt flow completely. One skilled in the art will understand that a variety of other liquid-based delivery systems may be utilized. For example, a pesticide reservoir may be located within the molded body of the trough/receptacle 20 below the lower end of each applicator sleeve 41 (or each pair of applicators), with pesticide being wicked into the absorbent material of the applicator sleeve 41. In yet another alternative embodiment, a pressure activated pump or a pressurized container may be utilized to transfer pesticide from a reservoir to the applicators 41. These variations are considered to be within the scope and spirit of the present invention. [0049] Furthermore, solid pesticides may also be used. In this case, the applicators 41 may be plastic strips impregnated with dry pesticide, the strips being wrapped or wound around each support member 44. Pesticide-laden materials/strips suitable for use in this embodiment include, but are not limited to, Taktic strips impregnated with amitraz and commercially available from Hoechst Roussel Agri-Vet Company of Sommerville, N.J. [0050] In all such cases the apparatus 15 may be used for the control of a variety of animal/wildlife-borne ectoparasites including, but not limited to, ticks (e.g. deer ticks, cattle fever ticks, ear ticks), mites (e.g. ear mites), lice, fleas, and flies (e.g. horn flies, stable flies). [0051] Having now fully set forth the preferred embodiment and certain modifications of the concept underlying the present invention, various other embodiments as well as certain variations and modifications of the embodiments herein shown and described will obviously occur to those skilled in the art upon becoming familiar with said underlying concept. It is to be understood, therefore, that the invention may be practiced otherwise than as specifically set forth herein. INDUSTRIAL APPLICABILITY [0052] There is a significant commercial demand for an improved feeder device that concurrently applies pesticides to wildlife to control the spread of ecto-parasite-borne diseases and, more specifically, a feeder/applicator that accomplishes these goals by a simple, durable molded design that can be economically manufactured and mass-produced to provide for more widespread use. The present invention fulfills this demand with a multi-part molded design that combines a refillable feeding bin with flexible pesticide applicators for the application of pesticides to animals as they feed from the bin, the applicators accommodating animals that vary greatly in physical size. The feeder/applicator of this invention is positioned in the locus or vicinity of the animals to be treated. Animals attracted to the apparatus to feed will be subjected to the application of a pesticide upon their head, neck, ears, and/or, where applicable, antlers or horns upon contact with one or more of the applicators.

Summary: A device ( 15 ) for the application of pesticides to animals as they feed and that accommodates wildlife of all sizes, poses no threat of harm to the animals, and maximizes the per capita application of pesticide. Whole kernel corn (or other feed) placed in a feed bin ( 30 ) is dispensed into a trough/receptacle ( 20 ) through an opening at the bottom of the bin. The trough/receptacle ( 20 ) is surrounded by pesticide applicators ( 40 ) such that as an animal feeds, some part of its head, neck and/or ears will contact one or more of the applicators. The applicators ( 40 ) are flexible and rotatable, so that animals attracted to the apparatus to feed are subjected to the application of a pesticide upon their head, neck, ears, and/or, where applicable, antlers or horns, the flexible and rotatable applicators ( 40 ) maximizing pesticide application with minimal stress to both the animal and device. The device employs a modular molded polyethylene design that is durable, economical, mass-producible, lightweight, and can be shipped for user-assembly, thereby reducing shipping and manufacturing costs.

big_patent

en

Write a title and summarize: Ein Frisbee, auch Flugscheibe, Segelscheibe oder wie in der DDR Wurfscheibe oder Schwebedeckel genannt, ist ein meist aus Kunststoff gefertigtes, scheibenförmiges Sport- und Freizeitgerät. Es wird durch aerodynamischen Auftrieb und Kreiselbewegung in der Luft gehalten. Neben der bekannten Verwendung als Rasen- oder Strandspielzeug werden mit diesem Sportgerät auch zahlreiche Einzel- und Mannschaftssportarten gespielt. Ursprünglich aus den USA stammend, haben sich vor allem die Frisbee-Sportarten Ultimate und Discgolf mittlerweile rund um den Erdball verbreitet. Der Begriff Frisbee ist, obwohl er zumeist als Gattungsname verwendet wird, eine eingetragene Marke des Spielzeugherstellers Wham-O. Den Rekord für den weitesten Frisbeewurf hält David Wiggins, Jr. aus den USA mit 338,00 m. == Geschichte Die heutige Bezeichnung "Frisbee" lässt sich historisch auf eine Übertragung des Firmennamens "Frisbie Pie Company" zurückführen. Dieses Familienunternehmen wurde 1871 von dem Bäcker William Russel Frisbie in Bridgeport (Connecticut) an der amerikanischen Ostküste gegründet. Diese Bäckerei verkaufte unter anderem Torten in runden Kuchenformen (Pie-Tins). In den 1940er Jahren begannen Kinder mit den weggeworfenen Formen zu spielen, die aber nur über sehr kurze Distanzen flugfähig waren. Dies beobachtete Walter Frederick Morrison, der in seiner Kindheit selbst die Kuchen der "Frisbie Pie Company" gekauft hatte, und machte sich daran, die Flugeigenschaften zu verbessern. Er begann damit, die Formen mit Metallringen zu stabilisieren, aber das brachte nicht den erwünschten Erfolg. Nach weiterem Tüfteln hielt er 1948 die erste aus Kunststoff selbstgefertigte Scheibe in den Händen. 1951 schuf Morrison seine zweite Scheibe, die "Pluto-Platte", die ab dem 13. Januar 1957 kommerziell von Wham-O hergestellt und vertrieben wurde. Dieses Modell besaß schon einige wichtige Merkmale, die auch die heutigen Scheiben noch aufweisen, zum Beispiel die Riefen im äußeren Drittel auf der Oberseite der Scheibe, die die Flugbahn stabilisieren. 1959 hörte Rich Knerr, einer der Inhaber von Wham-O, zum ersten Mal den Ausdruck "Frisbie/Frisbee". Er wusste nichts über die Herkunft des Namens, ließ aber die fliegenden Scheiben unter dem Handelsnamen "Frisbee" eintragen. 1980 stellte Rainer Pawelke innerhalb eines pädagogischen Sporttheaterprojektes das Frisbee-Spiel an der Universität Regensburg vor, an der er als Dozent in der Sportlehrerausbildung tätig war. In einem 1986 vom deutschen Bundeswissenschaftsministerium in Auftrag gegebenen Forschungsprojekt wurden unter seiner Leitung neue Bewegungsspiele mit der Frisbeescheibe entwickelt, u. a. Frisbee-Baseball. == Sportarten Der Welt-Frisbeesport-Verband (World Flying Disc Federation, WFDF) hat die folgenden Frisbee-Sportarten anerkannt: Weitere Sportarten sind:

Title: Frisbee Summary: Ein Frisbee, sprich: Friss-Bi, ist ein Scheibe aus Plastik zum Werfen. Man nennt sie auch Wurfscheibe oder Flugscheibe. Den Namen Frisbee hat eine bestimmte Firma sich als Markennamen gesichert. Genau genommen darf nur sie ihre Flugscheiben so nennen. Schon in den Jahren um 1940 haben Menschen Scheiben aus Spass geworfen, wie sonst einen Ball. Dazu gehörte auch jemand, der mit Kuchenscheiben eines Kuchenladens warf. Der Laden hiess "Frisbie Pie". Jemand anderes hat im Jahr 1959 den anders geschrieben Namen "Frisbee" für so ein Fluggerät genommen. Die kreisrunden Scheiben sind etwa 20 bis 30 Zentimeter breit, also noch etwas grösser als die Hand eines Erwachsenen. Vor allem seit den Jahren nach 1980 ist das Werfen von Frisbee-Scheiben ein beliebtes Spiel und für manche sogar ein Sport. Es gibt gleich mehrere Sportarten, bei denen die Wurfscheiben eingesetzt werden können. Bei einer davon geht es darum, dass ein Hund den Frisbee möglichst trickreich in der Luft fängt und so Punkte sammelt.

klexikon_de

de

Summarize: Background DON is a major component of Department of Defense (Defense), and consists of USN and Marine Corps service components. It is a large and complex organization, whose primary mission is to organize, train, maintain, and equip combat-ready naval forces capable of winning wars, deterring aggression from foes, preserving freedom of the seas, and promoting peace and security for the nation. To support this mission, DON performs a variety of interrelated and interdependent IT-dependent functions. In fiscal year 2012, DON’s IT budget was approximately $7.8 billion for 841 investments. NGEN, with a budget of $1.7 billion in fiscal year 2012, is one such system investment. Overview of NGEN NGEN is to replace and improve the enterprise network and services provided by NMCI, which were delivered through a DON-wide network services contract with a single service provider (Hewlett Packard Enterprise Services) that ended in September 2010. To bridge the time between the end of the NMCI contract and the full transition to the first increment of NGEN, DON awarded a $3.4 billion continuity of services contract to Hewlett Packard Enterprise Services, which is scheduled to run from October 2010 through April 2014. In addition to providing continuity of network services, the contract includes transition services and the transfer of NMCI infrastructure and intellectual property to DON. When implemented, NGEN is to provide secure data and IT services, such as data storage, e-mail, and video teleconferencing to USN and the Marine Corps. It is also intended to provide the foundation for DON’s future Naval Networking Environment. The network is to be developed incrementally, with the first increment expected to inherit the same architecture and design, and provide the same capabilities and services as does NMCI. In addition, NGEN is to provide increased DON control over network operations and additional mandatory information assurance capabilities to meet new Defense security requirements and the implementation of an independent security validation function. Future increments of the network have yet to be defined. While NGEN’s first increment capabilities are not expected to differ from those of NMCI, the operational environment for the network is expected to change—from the contractor-owned and contractor-operated model previously used by both services to a government-owned and contractor- operated model for USN and to a government-owned and government- operated model for the Marine Corps. In particular, USN plans to have ownership and oversight of network operations while it relies on contractors to execute and provide NGEN services. The Marine Corps also plans to have ownership and oversight of network operations, but will serve as its own service provider and obtain supplemental contractor support as needed. The different operational models are intended to allow USN and Marine Corps to operate their respective domains in the manner best suited to support their different mission needs. Oversight and Acquisition Processes for NGEN To manage the acquisition and deployment of NGEN, DON established a program management office within the Program Executive Office for Enterprise Information Systems. In February 2011, DON merged the NGEN program management office with the NMCI program management office to form the Naval Enterprise Networks program management office. This office manages the program’s cost, schedule, and performance and is responsible for ensuring that the program meets its objectives. In addition, various Defense and DON organizations share program oversight and review responsibilities. These key entities include the Under Secretary of Defense for Acquisition, Technology, and Logistics. Serves as the Milestone Decision Authority, which is the individual designated with overall responsibility for the program, to include approving the program to proceed through its acquisition cycle on the basis of, for example, the acquisition strategy, an independently evaluated economic analysis, and the acquisition program baseline. The Milestone Decision Authority is accountable for cost, schedule, and performance reporting, including reporting to Congress. Assistant Secretary of the Navy, Research, Development, and Acquisition. Serves as DON’s acquisition oversight organization for the program, to include implementation of Under Secretary of Defense for Acquisition, Technology, and Logistics policies and procedures. Determines when all key milestones are ready to be submitted to the Milestone Decision Authority. Department of the Navy, Program Executive Office for Enterprise Information Systems. Oversees a portfolio of large-scale projects and programs designed to enable common business processes and provide standard capabilities. Reviews the acquisition strategy, economic analysis, and the acquisition program baseline prior to approval by the Milestone Decision Authority. Department of the Navy Chief Information Officer. Supports DON’s planning, programming, budgeting, and execution processes by ensuring that the program has achievable and executable goals and conforms to financial management regulations and to DON, Defense, and federal IT policies in several areas (e.g., security, architecture, and investment management). Works closely with the program office during milestone review assessments. NGEN is designated as a Major Automated Information System (MAIS) and is subject to both the Office of the Secretary of Defense’s and DON’s MAIS acquisition policy and guidance, which require the program to comply with defense acquisition system requirements. The defense acquisition system consists of five key program life-cycle phases and three related milestone decision points: (1) materiel solution analysis, (2) technology development (milestone A held prior to entering this phase), (3) engineering and manufacturing development (milestone B held prior to entering this phase), (4) production and deployment (milestone C held prior to entering this phase), and (5) operations and support. The Milestone Decision Authority is to review the initial capabilities document, which defines operational goals and needed capabilities, and authorize the phase in which a MAIS program is to enter the defense acquisition system. In May 2010, the Under Secretary of Defense for Acquisition, Technology, and Logistics authorized the NGEN program to enter the defense acquisition system at production and deployment. NGEN was approved to enter at this later phase because the technology was considered mature and already operational under NMCI. Prior to entering the production and deployment phase, a milestone C review must be held to review the capability production document and the test and evaluation master plan, among other things, and to authorize limited deployment to support operational testing. The purpose of the phase is to achieve an operational capability that satisfies the mission needs and is verified through independent operational test and evaluation, and to implement the system at all applicable locations. At milestone C, the NGEN program is planned to be initiated and the acquisition program baseline to be approved, establishing the cost, schedule, and performance thresholds and objectives for the program. On approval of milestone C, DON will proceed with award of the NGEN contracts for the transport and enterprise services segments. In addition to the defense acquisition system requirements, DON guidance and policy require all MAIS programs to go through a “two- pass/six-gate” acquisition review process. The first pass, which consists of gates 1 through 3, is focused on requirements development and validation and is led by the Chief of Naval Operations or the Commandant of the Marine Corps. The second pass, which consists of gates 4 through 6, is focused on developing and delivering a solution via systems engineering and acquisition and is led by the Assistant Secretary of the Navy (Research, Development and Acquisition). In addition to meeting specific criteria for passing a given gate and proceeding to the next gate, all gate reviews are to consider program health (i.e., satisfactory cost and schedule performance, known risks, and budget adequacy) in deciding whether to proceed. Table 1 lists the key purpose of each gate review. In March 2011, we evaluated DON’s AOA for NGEN, which had examined four acquisition alternatives. All of the alternatives were assumed to deliver the same NMCI capabilities and the technology considered for each alternative was assumed to be substantially the same. As a result, DON officials stated that the AOA was not intended to be a traditional analysis to determine a system solution, but rather was an analysis of alternative acquisition approaches. The primary differences among the alternatives related to how NGEN was to be acquired, managed, and operated. Specifically, the alternatives varied in terms of the number of contracts to be awarded and in the scope of government versus contractor responsibilities. Table 2 provides a description and comparison of each alternative that was examined in the AOA. However, we reported that the approach pursued by DON did not match any of the alternatives assessed in the AOA, and it was riskier and potentially costlier than the alternatives assessed because it included a higher number of contractual relationships. In particular, the chosen approach was one that included more contracts, a different segmentation scheme, and a different transition timeline than any of the alternatives that had been assessed. We also reported that DON’s November 2009 risk-adjusted preliminary program life-cycle cost estimate for the approach for fiscal years 2011 through 2015 showed that this approach would cost at least an estimated $4.7 billion more than the alternatives assessed in the AOA. Moreover, DON had not analyzed the impact of these differences in terms of how they compared to the original alternatives. Further, we identified key weaknesses in the cost estimates and operational effectiveness analysis included in the NGEN AOA. Specifically, we reported that, while the AOA cost estimates were substantially well documented, they were not substantially accurate, and they were neither comprehensive nor credible. Additionally, we reported that, while the AOA identified program capabilities and goals, it did not sufficiently assess the alternatives’ ability to satisfy the capabilities and goals. Given our findings, we recommended that Defense reconsider the acquisition approach based on a meaningful analysis of all viable alternative acquisition approaches. The department did not fully concur with our recommendation and stated that it had concluded that DON’s AOA was sufficient and that the analysis had been approved by the Office of the Secretary of Defense, Cost Assessment and Program Evaluation. The department added that it would complete an economic analysis for milestone C, which would include a follow-on independent cost estimate and an updated determination of the most cost-effective solution. However, in response, we pointed out that DON planned to assess only the status quo and the current approach in the economic analysis, not other alternatives such as those that had been included in the AOA, and we maintained that without a meaningful analysis of alternatives, the department would be unable to determine the most cost-effective solution. We also reported that DON’s schedule for NGEN did not adequately satisfy key schedule estimating best practices by, for example, establishing the critical path (the sequence of activities that, if delayed, impacts the planned completion date of the project) and assigning resources to all work activities. Because it did not satisfy these practices, the schedule did not provide a reliable basis for program execution. According to program officials, schedule estimating had been constrained by staffing limitations. However, these weaknesses contributed to delays in the completion of NGEN events and milestones, including multiple major acquisition reviews and program plans. Accordingly, we recommended that Defense ensure that the NGEN schedule substantially reflect key schedule estimating practices. The department partially agreed with our recommendation. Additionally, we reported that NGEN acquisition decisions were not always performance- and risk-based. In particular, senior executives had approved the program’s continuing progress in the face of known performance shortfalls and risks. For example, in November 2009, the program was approved at a key acquisition review despite the lack of defined requirements, which officials recognized as a risk that would impact the completion of other key documents, such as the test plan. According to DON officials, the decision to proceed was based on their view that they had sufficiently mitigated known risks and issues. We recommended that the department ensure future NGEN acquisition reviews and decisions fully reflect the state of the program’s performance and its exposure to risks. The department agreed with our recommendation. DON Revised the NGEN Acquisition Approach Subsequent to the issuance of our March 2011 report,reconsidered and made certain changes to the NGEN acquisition approach. Specifically, in April 2012, the Office of the Secretary of Defense approved NGEN acquisition approach changes that were intended to support program executability and reduce program risk for USN. Like the original approach, the revised approach emphasized segmentation of the network, with the same five segments that had been defined in the previous acquisition approach: the two primary segments are enterprise services and transport services and the remaining three segments are end user hardware; enterprise software licenses; and verification, validation, and reporting (see table 3 for details on these segments). Further, each segment is expected to be delivered by either a contractor or government provider, with multiple competitive awards. However, DON made changes to how certain NGEN segments are to be acquired and transitioned. For example, it plans to solicit transport and enterprise services using a single request for proposals and has said it may award a combined contract for both segments; in addition, it plans to transition both segments to the new provider(s) simultaneously instead of staggering their implementation. According to DON officials, these changes were made primarily because the transport and enterprise services segments were integrally related under NMCI, so acquiring them simultaneously would potentially reduce labor costs and administrative burden, and reduce risk. Another change is that USN is expected to acquire end user hardware as a service from the enterprise services contractor rather than purchase the equipment and provide it as government-furnished property to the contractor. According to program officials, this change was made to mitigate a critical NGEN risk that the program may not be fully funded if end user hardware must be purchased in fiscal year 2014 and, in the long term, procuring the end user hardware as a service is not more expensive than government-purchased equipment. As an additional change to the acquisition approach, USN is no longer expected to award a contract for the verification, validation, and reporting segment because it now has an internal entity—the Tenth Fleet Cyber Command—that is to perform this function. Table 3 summarizes the previous and current plans for acquiring NGEN. DON Has Not Reevaluated Alternatives to Ensure It Is Pursuing the Most Cost-Effective NGEN Acquisition Approach According to cost estimating and acquisition guidance, cost effectiveness is shown by a comparative analysis of all life-cycle costs and quantifiable and nonquantifiable benefits among the competing alternatives. Such an analysis should be used to examine viable alternatives to inform acquisition decision making on the most promising solution, without assuming a specific means of achieving the desired result. For example, an AOA is initiated to examine potential solutions with the goal of identifying the most promising option and can subsequently be updated, as needed, to refine the proposed solution and reaffirm the rationale in terms of cost effectiveness.economic analysis assesses net costs and benefits of the proposed solution relative to the status quo and can identify and examine additional alternatives that are considered feasible methods of satisfying the objective. Even after having revised its acquisition approach, DON has not yet shown that it is pursuing the most cost-effective approach for acquiring NGEN capabilities because it did not revisit the AOA to address the nor did it conduct any other weaknesses we previously identified, analysis that would show that the current approach is the most cost effective. Officials told us they believe the approach they are now pursuing remains consistent with the AOA we previously assessed. However, the revised approach DON is now pursuing was not one of the alternatives assessed because it differs from the AOA alternatives in terms of transition timeline, segmentation scheme, and potentially the number of contracts and the AOA still contains the issues we identified in our previous report. GAO-11-150. approach is the most cost-effective solution. Further, according to program officials, the draft economic analysis is to be refined and updated based on a revised service cost position, and is not expected to be final until the acquisition program baseline is to be approved and about 3 months before the planned time frame for awarding the primary NGEN contracts for transport and enterprise services, and thus, would be limited in its ability to inform decision makers on the best NGEN approach to pursue. Program officials agreed that the final economic analysis would not be able to show the most cost-effective solution; they stated that the economic analysis is being prepared because it is a required document for program initiation (milestone C review). DON also developed analyses to support changes to its acquisition approach by examining whether a specific change to a particular segment would be more cost effective. For example, DON examined whether it should release one request for proposals instead of two for the transport and enterprise services segments. Additionally, USN examined whether it should acquire existing end user hardware owned by the incumbent and provide it to the enterprise services contractor as government-furnished property or acquire the end user hardware from the enterprise services contractor as a service. However, because these analyses focus on specific changes, they do not provide an understanding of whether DON’s overall acquisition approach is the most cost effective. Without a meaningful analysis of acquisition alternatives, DON does not know whether its approach for acquiring NGEN capabilities and meeting NGEN goals is the most cost effective among other viable alternatives. DON Is Proceeding with the NGEN Acquisition, but Is Experiencing Schedule Delays and Not Adequately Mitigating Risks Notwithstanding the lack of assurance that it is pursuing the most cost- effective acquisition, DON nonetheless has moved forward with its revised approach for acquiring NGEN. In this regard, the department has undertaken activities to support its acquisition and transition to NGEN, prepared plans and analyses required for program initiation at milestone C, and conducted oversight reviews to support the release of the request for proposals for transport and enterprise services. However, the program’s schedule for acquiring NGEN capabilities has been delayed, resulting in a compressed timeline for transitioning to the new network and increased risks associated with transitioning to the new network before the end of the continuity of services contract. Compounding this situation is the fact that identified risks that can further impact schedule delays are not being adequately mitigated. Execution of the NGEN Program Is Proceeding, but Major Milestones Have Slipped DON has undertaken activities to support its acquisition and transition to NGEN, prepared plans and analyses required for program initiation at milestone C, and conducted oversight reviews to support the release of the request for proposals for transport and enterprise services. Specifically, As of December 2011, DON had completed early transition activities, such as developing IT service management strategies, processes, procedures, and tools to serve as the overarching governance framework for delivering NGEN capabilities; analyzing and validating the current NMCI infrastructure inventory; and conducting job task analyses and assessing learning tools for contractor technical representatives. Additionally, the Marine Corps assumed control of the NMCI infrastructure currently supporting its operations and awarded the Marine Corps Common Hardware Suite contract to procure NGEN end user hardware in May 2012. Also in May 2012, DON reached agreement on the first of 12 planned enterprise software license agreements. Further, the department released NGEN documents and technical data to industry to ensure all competitors have full access to NMCI technical data and to reduce the potential for a protest. DON also released multiple requests for information and solicited input from industry on a draft request for proposals in order to better understand the capabilities of the current IT marketplace with respect to NGEN requirements. Finally, DON released the request for proposals for transport and enterprise services in May 2012. DON has also prepared several plans and analyses required for program initiation at milestone C, when the acquisition program baseline is to be approved. In particular, in October 2011, DON approved the cost analysis requirements description, which defines the programmatic and technical features of NGEN increment 1 and serves as the basis for estimating program costs. Additionally, the Naval Center for Cost Analysis developed the service cost position, which was based on the reconciliation of a completed program life- cycle cost estimate and an independent cost estimate. DON also approved the systems engineering plan and the test and evaluation master plan, which describes the overall test and evaluation strategy for how the network’s capabilities will be assessed. Subsequently, in November 2011, the program office developed the capability production document, which clarified and solidified the capabilities for NGEN increment 1 and became the primary source requirements document for the program. Finally, the revised acquisition strategy, which was required prior to release of the transport and enterprise services request for proposals, was approved in April 2012. According to Defense and DON policy, acquisition programs must proceed through a series of gate and milestone reviews (as described earlier in this report in table 1). Since our prior report, DON has conducted two gate reviews and an Office of the Secretary of Defense-level decision review to support the release of the request for proposals for transport and enterprise services. In particular, in October 2011, it completed an acquisition gate review to endorse the NGEN increment 1 capability production document. Subsequently, DON conducted a second NGEN acquisition gate review in January 2012 to approve the transport and enterprise services request for proposals, during which it reviewed the current status and health of the program including the key activities remaining to release the request for proposals. Subsequently, in April 2012, the Office of the Secretary of Defense, Milestone Decision Authority, reviewed the NGEN program to approve the updated acquisition strategy and authorize the release of the transport and enterprise services request for proposals. While DON has made progress on these efforts to acquire and transition to NGEN, key program activities remain to be completed. For example, DON will need to demonstrate that it is prepared to execute control and governance of the network through four government readiness reviews; baseline the program by establishing cost, schedule, and performance thresholds and objectives; award the primary NGEN contract(s); and transition to the new NGEN provider(s). Table 4 lists planned completion dates for these remaining key activities. However, a number of acquisition activities are facing schedule delays, even though the incumbent is scheduled to end service delivery in April 2014. Specifically, while the request for proposals for transport and enterprise services was issued, as we previously stated, it was delayed by 17 months and 9 months, respectively, resulting in current delays in NGEN program milestones, including the dates for conducting the milestone C review and awarding the contract(s) for transport and enterprise services. Additionally, the schedule for assessing USN’s readiness to transition (i.e., government readiness reviews) is tied to milestone C review and contract award, meaning that they are expected to occur a certain number of days before or after their associated event; thus, the government readiness reviews would also be impacted by delays in milestone C and contract award. Moreover, these delays have compressed the timeline for and increased the risks associated with transitioning to the new network before the end of the continuity of services contract. For example, the date for USN’s initial transition from the current service provider to the new service provider(s) has slipped by 5 months and final transition is scheduled for March 2014, thus compressing the period for shutting down network services with the incumbent and transitioning them to the new NGEN contractor(s) by about 5 months. Further, USN has identified a number of factors that could impact transition and increase the risk that NGEN may not be completed on time and may experience cost overruns, such as proposals not meeting NGEN requirements and lack of coordination among contractors and the government in operating the network. Program officials attributed these schedule delays to the department’s need to conduct more detailed planning before issuing the transport and enterprise services request for proposals and for addressing industry comments on the draft request for proposals to reduce the potential of a bid protest. Figure 1 illustrates the delays in major NGEN milestones. Our prior report highlighted the significance of DON not having a reliable schedule for executing NGEN and its contribution to delays in key program milestones. The lack of a reliable schedule, as we previously noted, and the continuing delays in DON’s efforts to complete the network transition as planned, raise concerns that it will be unable to complete the transition within the time frames of the current continuity of services contract. As a result, ensuring that the NGEN schedule substantially reflects the key estimating practices, as we discussed and recommended in our previous report, continues to be a vital step for DON to take. Program Risk Mitigation Plans Have Not Been Fully Defined According to industry best practices,process identifies potential problems before they occur, so that risk- handling activities may be planned and invoked, as needed, across the life of the product and project in order to mitigate adverse impacts on achieving objectives. Key activities of a comprehensive risk management process include (1) identifying and analyzing risks, (2) escalating key risks to the attention of senior management, and (3) developing risk mitigation plans and milestones for key mitigation deliverables. In particular, effective plans for risk mitigation should be developed for the most important risks to the project, which includes a period of performance, identification of resources needed, and responsible parties. In addition, the status of each risk should be monitored periodically to determine whether established thresholds have been exceeded and risk mitigation plans should be implemented as appropriate to ensure that systems will operate as intended. NGEN program-wide and project-specific risks are managed by different offices, with the program office identifying and tracking program-wide risks—those that affect the overall NGEN program. In accordance with best practices, the NGEN program identifies and analyzes program-wide risks, by assigning a severity rating to risks, tracking these risks in a database, and planning response strategies for each risk in the database. In addition, NGEN program officials escalate these risks by reviewing and evaluating these risks during monthly program risk management board meetings. As of July 2012, the program office had identified eight program risks that it considered critical (moderate- or high-level risks) and that could result in schedule delays and cost increases. These risks included potential delays in transition from the incumbent to the new service provider(s) and in contract award for the transport and enterprise services, as well as the potential lack of coordination among contractors and the government in operating the network. Table 5 describes the program-identified critical risks for NGEN as of July 2012. While DON is working to mitigate seven of the eight program risks, its mitigation plans did not always include all the elements of an effective plan (e.g., identification of resources needed, responsible parties, and period of performance). Specifically, the reported mitigation strategies did not fully identify the resources needed, such as the staff and funds, nor fully identify organizations that are responsible and accountable for accomplishing risk mitigation activities. Additionally, while five of the seven mitigation plans had activities with planned completion dates, most did not include an estimated start date; thus, the plans did not fully define the period of performance to ensure that the mitigation activities are being implemented appropriately. Moreover, three of the seven plans did not identify the status of activities for which completion dates had already occurred. In particular, to mitigate the risk of potential lack of coordination among contractors and the government in operating the network, DON was to develop, implement, and automate key processes by February 15, 2012. However, the plan does not reflect whether this activity has been completed or, otherwise discuss its status. Additionally, two of the seven plans did not fully reflect the current status of the program. For example, to mitigate transition risks, DON officials identified that the enterprise and transport services contract(s) must be awarded no later than December 2012 in order to ensure continuous network availability during the transition from the continuity of services contract to the NGEN contract(s). However, the current mitigation plan does not document this milestone or reflect the current status of the program, which now plans to award the contract(s) in February 2013. Further, according to program documentation, a mitigation plan was required and was being updated for the service offering descriptions risk; however, according to other program documentation, the plan to mitigate service offering descriptions is still under development, even though it has been identified as a program risk since August 2011. According to program officials, weaknesses in these mitigation plans were due, in part, to the lack of a priority in establishing and maintaining comprehensive and current plans. Several of the risks identified are significant to ensure that NGEN transition occurs as planned and within the estimated costs. Therefore it is essential to ensure that for a given risk, techniques and methods will be invoked to avoid, reduce, and control the probability of occurrence. Conclusions Even though DON does not know whether it is pursuing the most cost- effective approach to acquiring NGEN capabilities, it has proceeded to implement its revised acquisition approach, completed various plans and analyses including the first official program life-cycle cost estimate, and held oversight reviews to support the issuance of the request for proposals for the two primary NGEN segments. While these steps have been taken, DON faces delays in upcoming milestones, which have resulted in a compressed transition timeline and increased risks associated with transitioning to the new network before the end of the continuity of services contract. Compounding this are weaknesses in DON’s risk mitigation efforts that could further impact schedule delays and result in cost increases. Without a well-defined schedule, as we previously reported, and adequate risk mitigation, DON cannot ensure that needed NGEN capabilities will be in place in time to ensure that services will continue to operate when the incumbent is scheduled to shut down its services. Recommendation for Executive Action To strengthen risk mitigation activities for the NGEN program, we recommend that the Secretary of Defense direct the Secretary of the Navy to develop comprehensive mitigation plans and strategies for program-wide critical risks that identify the mitigation period of performance, resources needed, and responsible parties, and that fully reflect the current status of the program. Agency Comments The Department of Defense provided written comments on a draft of this report, signed by the Deputy Assistant Secretary of Defense (C3 and Cyber), and reprinted in appendix II. In its comments, the department agreed with our recommendation and noted that the program office will continue to build on efforts to improve NGEN’s risk management and mitigation process. For example, the department stated that it plans to increase the speed at which NGEN risk management board action items are closed. We are sending copies of this report to the appropriate congressional committees; the Director, Office of Management and Budget; the Congressional Budget Office; the Secretary of Defense; and the Secretary of the Navy. In addition, the report is available at no charge on the GAO website at http://www.gao.gov. If you or your staff have any questions about this report, please contact me at (202) 512-6304 or melvinv@gao.gov. Contact points for our Offices of Congressional Relations and Public Affairs may be found on the last page of this report. GAO staff who made major contributions to this report are listed in appendix III. Appendix I: Objectives, Scope, and Methodology Our objectives were to determine (1) the extent to which the Department of the Navy’s (DON) selected approach to acquiring the Next Generation Enterprise Network (NGEN) is the most cost effective and (2) the current status of and plans for acquiring NGEN. To determine the extent to which DON’s approach to acquiring NGEN is the most cost effective, we reviewed our prior work evaluating the NGEN analysis of alternatives and analyzed current documentation that DON had completed to describe and justify the cost effectiveness of its acquisition approach. These included the draft economic analysis and analyses to support specific acquisition approach changes. We assessed DON’s supporting analyses against relevant Department of Defense guidance and our Cost Estimating and Assessment Guide. In this regard, we evaluated the purpose and use of these analyses in examining viable alternatives to inform acquisition decision making on the most cost- effective solution. We also interviewed cognizant DON program officials and Office of the Secretary of Defense Cost Assessment and Program Evaluation officials about the use of these analyses in acquisition decision making. To determine the current status of and plans for acquiring NGEN, we analyzed the revised NGEN acquisition strategy, integrated master schedule, program performance assessments, risk reports, transport and enterprise services request for proposals, planned system requirements, cost estimates, draft operational readiness plan, and executive acquisition decision briefings and meeting minutes, among other things. We also reviewed these documents to determine how the program had changed since our prior review of NGEN. To assess the status of risk management for the NGEN program initiative, we compared the risk management plans and supporting documentation against leading practices, such as Carnegie Mellon Software Engineering Institute’s Capability Maturity Model® Integration for Services,whether such practices had been specified in the plans. Further, we interviewed relevant DON program officials and Office of the Secretary of Defense Cost Assessment and Program Evaluation officials to clarify information in documents we reviewed and to more fully understand the program’s progress to acquire NGEN. To assess the reliability of the data that we used to support the findings in this report, we reviewed relevant program documentation to substantiate evidence obtained through interviews with agency officials. We determined that the data used in this report are sufficiently reliable. We have also made appropriate attribution indicating the sources of the data used. We conducted this performance audit from November 2011 to September 2012 in accordance with generally accepted government auditing standards. Those standards require that we plan and perform the audit to obtain sufficient, appropriate evidence to provide a reasonable basis for our findings and conclusions based on our audit objectives. We believe that the evidence obtained provides a reasonable basis for our findings and conclusions based on our audit objectives. Appendix II: Comments from the Department of Defense Appendix III: GAO Contact and Staff Acknowledgments GAO Contact Staff Acknowledgments In addition to the individual named above, key contributors to this report were Eric Winter (assistant director), Nabajyoti Barkakati, Harold Brumm, Neil Doherty, Nancy Glover, Madhav Panwar, Jeanne Sung, and Niti Tandon.

Summary: DON, a component of the Department of Defense (Defense), is replacing its existing network system with NGEN. Capabilities for the new system include secure transport of voice and data, data storage, and e-mail, at a cost of about $38 billion through fiscal year 2024. In March 2011, GAO reported that the approach for acquiring NGEN was not grounded in a reliable analysis of alternatives, the execution of NGEN was not based on a reliable schedule, and acquisition decisions were not always performance- and risk-based. GAO recommended that Defense, among other things, reconsider its approach. The department has not yet fully implemented GAO’s recommendations but revised its approach to include acquiring certain NGEN services simultaneously instead of staggering their implementation. GAO was asked to review the revised approach to determine (1) the extent to which DON’s selected approach to acquire NGEN is the most cost effective and (2) the current status of and plans for acquiring NGEN. To do this, GAO reviewed analyses supporting the cost effectiveness of the acquisition approach, the program’s revised acquisition strategy, integrated master schedule, key milestone decisions, and other relevant documents. While the Department of the Navy (DON) has revised its acquisition approach for its new network system, the Next Generation Enterprise Network (NGEN), it still has not shown that it has selected the most cost-effective approach for acquiring NGEN capabilities. Cost effectiveness is shown by comparing life-cycle costs and quantifiable and nonquantifiable benefits among alternatives, which can be accomplished by conducting a thorough analysis of alternatives. GAO previously identified weaknesses with the NGEN analysis of alternatives related to cost estimates and analysis of operational effectiveness and made associated recommendations. However, DON did not revisit the analysis of alternatives to address the weaknesses previously identified, nor did it conduct any other analysis that would show whether its revised approach is the most cost effective. For example, while DON developed a draft economic analysis in February 2012, the analysis assessed only the status quo and revised approach, and not other alternatives. As a result, GAO remains concerned with the analysis measuring NGEN cost effectiveness and DON does not know whether its revised approach for acquiring NGEN is the most cost effective. Even though DON lacks assurance that it is pursuing the most cost-effective approach to acquiring NGEN capabilities, it has moved forward with implementing its revised approach. For example, the agency has completed activities to support the acquisition and transition to NGEN, prepared plans and analyses required for program initiation, and conducted oversight reviews to support the release of the request for proposals for transport and enterprise services (secure data and e-mail services, among other things). However, the program’s schedule for acquiring NGEN capabilities has been delayed, thus making it more likely that DON will not be able to fully transition by the end of the continuity of services contract in April 2014. For example, the release of the request for proposals was delayed, and upcoming milestones, such as contract award and program initiation, have slipped (see table for major delays). Program officials attributed the delays to the need for additional planning and to revisions to the request for proposals. Compounding this situation is that identified risks are not being adequately mitigated. For example, not all mitigation plans are comprehensive because they do not always include all the elements of an effective plan (e.g., identification of resources needed) nor do they always contain the current status of the mitigation actions. According to program officials, weaknesses in these mitigation plans were due, in part, to the lack of a priority in establishing and maintaining comprehensive and current mitigation plans. As a result, the program faces an increased probability that transition from its existing system to NGEN will face further delays and cost overruns.

gov_report

en

Summarize: Farmers and homeowners across country are spraying herbicides on milkweed plants - and in doing so, they're causing a massacre of the monarch butterfly. When spraying the plant, they're destroying the iconic orange-and-black butterflies' nursery, food source and habitat, leaving millions homeless. Since 1990, about 970million of the colorful creature have vanished - a 90 per cent decline in the species. And in an attempt to counter years of destruction, the Fish and Wildlife Service, the National Wildlife Federation and the National Fish and Wildlife Foundation have launched a partnership in hopes of growing milkweed and saving the monarchs. Scroll down for video. Since 1990, about 970million monarch butterflies have vanished - a 90 per cent decline in the species. Species are dying out as their habitats are ruined by herbicides and climate change. In an attempt to counter years of destruction, the Fish and Wildlife Service, the National Wildlife Federation and the National Fish and Wildlife Foundation have launched a partnership in hopes of growing milkweed. About $2million of the $3.2million project will be used to restore more than 200,000 acres of milkweed (pictured) habitat from California to the Corn Belt. About $2million of the $3.2million project will be used to restore more than 200,000 acres of habitat from California to the Corn Belt. The restoration includes more than 750 schoolyard habitats and pollinator gardens, which could increase, or at least keep stagnant, the number of monarchs in the United States. Each winter, monarch butterflies travel thousands of miles from the United States and Canada to central Mexican forests. And in the spring, the insect makes the trek back. Because butterflies only live for four to five weeks, the trip requires six generations to complete. Their food supply of milkweed - which is also their home across the United States - is decreasing. Farmers and homeowners are spraying herbicides, or weed killers, reducing the availability of the plant. The monarchs spend their winters in Mexican mountain forests where climate is less extreme and they have a better chance of survival. But nearby human communities rely on the same forests for agriculture and tourist activities. Climate change disrupts the butterfly's annual migration pattern by affecting conditions in both winter grounds and summer breading grounds. While colder and wetter winters could be lethal to the insects, hotter and drier summers could shift habitats more north. Source: World Wildlife Fund. There are about 30million monarch butterflies remaining in the United States, according to the Washington Post. Remaining money will be used to start a conservation fund that will provide grants to farmers and other landowners to conserve habitat. The move by the Fish and Wildlife Service comes as it considers whether to classify the monarch butterfly as a threatened species under the Endangered Species Act, which would give the butterfly more protection. 'We can save the monarch butterfly in North America but only if we act quickly and together,' said Service Director Dan Ashe. Monarch butterflies travel thousands of miles to Canada from Mexico each spring on a journey that requires six generations of the insect to complete. On the journey, the insect - which only lives for four to five weeks - lays its eggs exclusively on the milkweed plant. Conversion of prairies into cropland and the increasing use of pesticide-resistant crops have greatly reduced milkweed, which is also an important food source, particularly in the heartland, according to a petition filed last August by environmental groups. The conservation projects will be focused on the Interstate 35 corridor from Texas to Minnesota, in areas that provide important spring and summer habitats along the path for about 50 per cent of the migrating monarchs. Fish and Wildlife Service is encouraging other federal and state agencies to join in on the project and preserve public land as well. The move by the Fish and Wildlife Service comes as it considers whether to classify the monarch butterfly as a threatened species under the Endangered Species Act, which would give the butterfly more protection. Monarch butterflies (pictured here as a caterpillar) travel thousands of miles to Canada from Mexico each spring on a journey that requires six generations of the insect to complete. The group is working with governments in Canada and Mexico to help the iconic butterfly. Yosemite National Park, too, offers protection for the milkweed plant. Cities across the United States have declared themselves sanctuaries for monarchs. The groups heading the preservation project said the new announcement was a positive step, but the species needs legal protection. Monarchs are pollinators and indicators of broader environmental problems. 'The specter of listing will spur a lot of conservation for the monarch,' said Tierra Curry, a senior scientist with the Center for Biological Diversity, one of the groups that asked the Fish and Wildlife Service last August to protect the monarch butterfly and set aside critical habitat. But Curry said the butterfly needed to be listed for it to recover. Other species of butterflies have faced extinction in the past, according to Fish and Wildlife Service. The Xerces blue vanished from San Francisco sometime in the mid-1900s, and two subspecies - the rockland grass skipper and Zestos in Florida - haven't been seen since 2004. The conservation projects will be focused on the Interstate 35 corridor from Texas to Minnesota, in areas that provide important spring and summer habitats along the path for about 50 per cent of the migrating monarchs. The groups heading the preservation project said the new announcement was a positive step, but the species needs legal protection. Monarchs are pollinators and indicators of broader environmental problems

Summary: Since 1990 about 970million monarch butterflies have vanished. Only about 30million of the iconic orange-and-black insect remain. Reduction of milkweed and use of herbicides are ruining the insect's habitat. A $3.2million government project will help restore milkweed plant across U.S. Plant serves as the butterflies' home and primary source of food. Comes as Fish and Wildlife Service considers classifying the monarch butterfly as a threatened species under the Endangered Species Act.

cnn_dailymail

en

Summarize: The family of Jean Charles de Menezes have called for an investigation after the Wikipedia page on his death was updated with inaccurate information by a government computer. The family of Jean Charles de Menezes have called for an investigation after the Wikipedia page on the shooting victim's death was updated with inaccurate information by a government computer. Edits were made to the page covering the death of Mr de Menezes, who was shot dead by a Metropolitan police officer at Stockwell tube station in 2005, an investigation has found. According to a Channel 4 News investigation, users of government computers added inaccurate suggestions that the 27-year-old may have been on drugs, deleted information about his immigration status, and removed a section on his death from a page about the Independent Police Complaints Commission. Changes were also made to pages on the deaths of Lee Rigby and schoolboy Damilola Taylor from government computers which downplayed their deaths, the investigation found. The updates were made from computers using the government's secure intranet service, which is used by the civil service and police officers. The uncovering of the edits comes just weeks after a civil servant was sacked for posting offensive Wikipedia comments on the Hillsborough disaster from government computers. Today Mr de Menezes's family said there must be an investigation into who made the edits, and action taken. 'We have someone sitting in a government office spending time to undermine and smear an innocent man's memory,' family spokesman Asad Rehman told Channel 4 News. 'It's low and it's callous and we have to find out did this person act on orders, and if so whose orders?' The investigation found that in 2006 government computers were used to add suspicions that Mr de Menezes had a 'high level' of Class A drugs in his blood at the time of his death. There was also an attempted request that Wikipedia editors change the reason for the police decision to shoot-to-kill. On the second day of the 2008 inquest into the Brazilian electrician's death, information about Mr de Menezes's immigration status was deleted - making the page wrongly infer he might have been an illegal immigrant. Changes were also made to pages on the deaths of schoolboy Damilola Taylor and soldier Lee Rigby and which downplayed their deaths. A page on the IPCC also had a section in which the watchdog's handling of Mr de Menezes's death was removed, including a statement that the IPCC had 'got it wrong' over leaks. A quote saying the Metropolitan Police. Federation had accused the IPCC of 'perverse action' in relation to the case was also deleted. Mr de Menezes was shot seven times in the head by officers. who mistakenly thought he was a terrorist in the wake of the 7/7 London bombings. An inquest jury later found. the Met guilty of health and safety failings over its bungled operation. but no officer faced criminal charges. Last month Mr de Menezes's parents (l-r) Matuzinhos da Silva and Maria Otone de Menezes learned the family had been spied on by the Met police. Mr de Menezes was shot seven times in the head by officers who mistakenly thought he was a terrorist. Just last month it was revealed in a damning report on the on. the activities of a now disbanded Metropolitan Police undercover unit,. the Special Demonstration Squad (SDS) that the Met had spied on the de. Menezes family. Officers. from the SDS collected information on 18 justice campaigns – including. those concerning Mr de Menezes and the Stephen Lawrence case – which. resulted in ‘collateral intrusion’ on family members. The. Channel 4 probe also found that anonymous edits were made to the pages. of schoolboy Damilola Taylor, saying the 10-year-old, killed in November. 2000 had 'died', rather than 'was murdered'. And the death of Fusilier Lee Rigby - who was killed by Michael Adebolajo and Michael Adebowale near the Royal Artillery Barracks, Woolwich, in May last year - was deemed to be 'not notable enough' for. an article on terrorism, so the entire section on his death was deleted. A Cabinet Office spokesman told MailOnline that the government had only recently been informed of the issue, and was looking into how to deal with the matters raised. 'Government takes these matters very seriously,' the Cabinet Office statement said. 'We have recently reminded civil servants of their responsibilities under the Civil Service Code and any breaches of the Code will be dealt with. We will shortly be issuing fuller guidance on using the internet and social media to all departments.' In June it was revealed that a civil servant who made offensive alterations to Wikipedia pages on the Hillsborough disaster using Government computers was sacked. The 24-year-old used the secure intranet to change the phrase 'You'll never walk alone' - the anthem of Liverpool FC - to 'You'll never walk again'. It was one of a slew of tweaks that began to emerge on the 20th anniversary of the April 1989 tragedy which saw 96 fans crushed. In June it was revealed that a civil servant who made offensive alterations to Wikipedia pages on the Hillsborough disaster using Government computers was sacked. The 24-year-old used the secure intranet to change the phrase 'You'll never walk alone' - the anthem of Liverpool FC - to 'You'll never walk again' Announcing the sacking to MPs, Cabinet Office minister Francis Maude wrote: 'The Government has treated this matter with the utmost seriousness. 'Our position from the very start has been that the amendments made to Wikipedia are sickening. 'The behaviour is in complete contravention of the Civil Service Code, and every canon of civilised conduct. It is entirely unacceptable.' Jimmy Wales, co-founder of Wikipedia, told Channel 4 that in many cases offensive edits made to Wikipedia pages were made by people 'goofing off on their lunch break'. 'We condemn it without any question but I do not think it's some official disinformation campaign,' he said. 'I think it's someone who has gone a bit rogue, updating something they shouldn't.'

Summary: Electrician was shot dead by police officer at Stockwell tube station in 2005. Investigation finds Wikipedia page on death edited by government computer. Suggestion he was on drugs added, and immigration information removed. Pages on Lee Rigby and Damilola Taylor also altered to downplay deaths. De Menezes family spokesman calls page edits 'low and callous' Cabinet Office says any breaches of civil service code 'will be dealt with' In June a civil servant was sacked for posting offensive comments about Hillsborough disaster on Wikipedia.

cnn_dailymail

en

Summarize: The Indian Health Service (IHS), an agency within the Department of Health and Human Services, is responsible for providing federal health services to American Indians and Alaska Natives. The dog was found here in a desert area just beyond the Kino Sports Complex. (Source: Tucson News Now) Pima Animal Care Center is treating a dog that was found hanging from a rope at Kino Stadium. Grounds workers said someone who works in the area found the dog on Tuesday. Workers at PACC are calling her Sunny. According to Chief of Operations for PACC, Kristen Barney, Sunny is a mixed-breed about two years old. She is suffering swelling in the head and neck area. Although she is stable, it could take weeks for her to be 100 percent. She was found bound by yellow rope around her torso, legs, and neck - hanging from a low-lying tree. PACC officer Chris Meek showed up to help when Tucson police called. "When I first got down into the wash and went to go pick her up, she tried, that's the heartbreaking thing, she tried to lift her head up a little bit to say hello," Meek said. "But she just wasn't strong enough to." Tucson Police are handling the criminal investigation. Anyone with information is urged to contact police on the non-emergency number at (520) 791-4444 or 88-CRIME if you wish to remain anonymous. Meanwhile, if you want to help PACC treat Sunny and other injured or abused animals, they are always looking for donations for their medical fund. Donations can be submitted to the shelter located at 4000 N. Silverbell. PACC says a donor has stepped up to match donations up to $5,000. Copyright 2015 Tucson News Now. All rights reserved.

Summary: A brutal story is moving toward a happy ending. A shelter in Arizona has received more than $20,000 in donations after it began caring for a young dog left hanging from a tree, reports AP. Sunny, a 2-year-old mix, is now recuperating in foster care. "She's getting her spirit back," says the director of the Pima Animal Care Center. "Even the look in the eye looks more trusting and hopeful, which is a testament to how resilient animals are." The dog was found earlier this month bound by yellow rope and hanging from a tree in Tucson, and police are treating it as a criminal investigation. At the time, Tucson News Now quoted the shelter employee who rescued her: "When I first got down into the wash and went to go pick her up, she tried, that's the heartbreaking thing, she tried to lift her head up a little bit to say hello," he says. "But she just wasn't strong enough to." Sunny's medical bills are about $2,500, and the shelter will put the excess money toward care for the other animals there. See updates at the shelter's Facebook page.

multi_news

en

Summarize: As a model, Clare-Alana Ford has to hold hard, angular poses for long periods. But she can go weak and floppy at any moment due to a rare muscle condition – just like a real-life rag doll. Ms Ford, 22, from Hayling Island, Hampshire, suffers from a bizarre condition that makes her body go limp and weak without warning. The incurable condition, often nicknamed the rag doll disease, can cause Ms Ford to lose all control of her voluntary muscles, such as those in her legs and arms. Scroll down for video. Clare-Alana Ford, 22 has forged a successful career as a model (left), despite suffering from a rare muscle condition which makes her go weak and floppy at any moment. She had surgery to remove her thymus gland in 2013 (pictured right) and is waiting to see if it has been successful. Ms Ford says sometimes she will attempt to do her hair and make up, but her arms will go limp and floppy. Despite her 'rag doll' condition - known as myasthenia gravis – she has worked hard to forge a successful modelling career. But despite her rag doll condition - known as myasthenia gravis – Ms Ford has managed to forge a successful modelling career. Clare-Alana said: 'Sometimes I will go to put my hair up and suddenly my arms will just go limp and flop down to my side. 'I've been walking along the road before and my legs will just give way, and there's nothing I can do. 'It's a condition that improves with rest so I have to talk breaks when I'm doing activity. 'It sounds strange but it's just like a rag doll. 'It can be difficult as I get very tired, but I refuse to be a slave to my condition. 'I love modelling and I've been able to be successful despite my health issues. 'I'll always do my best and I'll never let it affect how well I do on a shoot. 'I won't let my condition define me.' Ms Ford began to model at the age of 17 - just as she began to experience her unusual symptoms. She said: 'A friend of mine was looking for people to model some dresses for a show during London Fashion Week. 'I thought it sounded like fun, so I told her I'd do it. Myasthenia gravis is a rare long-term condition that causes certain muscles to become weak. It mainly affects muscles that are controlled voluntarily –often those controlling eye and eyelid movement, facial expression, chewing, swallowing and talking. Sometimes, the muscles that control breathing, neck and limb movements are also affected. The muscle weakness associated with myasthenia gravis is usually worse during physical activity and improves with rest. It is an autoimmune condition that affects the nerves and muscles. Autoimmune conditions are caused by the body's immune system mistakenly attacking healthy tissue. In myasthenia gravis, the immune system produces antibodies (proteins) that block or damage muscle receptor cells. This prevents messages being passed from the nerve endings to the muscles, which results in the muscles not contracting (tightening) and becoming weak. It is not fully understood why some people's immune systems produce antibodies that attack the muscle receptor cells. Source: NHS Choices. 'But at around the same time I started to get very tired easily and weak for no reason at all - I was terrified I'd fall over on the runaway in front of everyone. 'I was very active and I did ballet, so I thought I was just doing too much. 'I was nervous but I loved the experience of modelling, and I decided to embark on it professionally. 'Then I remember once my legs just totally gave way and I felt like a weight was pushing down on me and I couldn't get up.' At first the doctor told her she was suffering from growing pains, but she pushed for further tests. Eventually she was diagnosed with myasthenia gravis, an uncommon condition which affects about 15 in every 100,000 people s in the UK. Ms Ford said: 'At first the doctor told me it was growing pains, but I knew it was something more so I pushed for further tests. 'Eventually I was diagnosed with myasthenia gravis - I'd never even heard of it before. 'It was very scary and such a shock to be diagnosed with something so foreign to myself, and something that even medical professionals knew little about, but I was determined to carry on with my life as normal.' Ms Ford has continued to model, and even had surgery last year in the hope of treating her condition. She said: 'I had surgery in July 2013 to remove my thymus gland, as there is some evidence that this can help kick start the condition into remission and aid symptoms. 'It can take up to three years to see improvement so I have a little while yet. 'For now I'm taking medication and I'm trying not to let it affect me too much. 'It can be hard as the condition is invisible, so often people don't realise if I'm having a particularly bad with it. 'People can be quite insensitive at times because of their ignorance about the condition and I'm often mistaken for being lazy which is very upsetting. 'Stress can play a big factor in worsening the symptoms so I try to stay cool and not let things affect me too much. Ms Ford is able to model but has to take breaks, as her condition improves with rest. Now she has become a successful model, Ms Ford won't let anything hold her back. As her agency is based in London, she says travelling back and forth on the tube can be 'daunting' with all the stairs and crowds. 'Sometimes I've had to pass up jobs as I've been ill - I had the opportunity to model for Harrods but I was too unwell to accept it, and I turned down the chance to model in Thailand as I was having surgery. 'My agency is based in London so traveling back and forth can sometimes be daunting and scary - the idea of facing the tube on a casting day is mortifying for me with all the stairs and the crowds. 'It's hard sometimes to miss out on things, but it just makes me more determined to get better. I won't let anything hold me back.' Ruth Ingledew, CEO of Myasthenia charity, Myaware, said: 'Myasthenia Gravis is a neuromuscular condition which affects the transmission of messages from nerves to muscles. 'The brain can tell a muscle that it wants to, for example, lift up an arm, but the more the message tries to get through, the message gets weaker and weaker, until eventually the arm can't lift up anymore. 'Initially it can affect the facial muscles so often people are misdiagnosed with a stroke. 'We don't know what triggers myasthenia gravis, but women tend to be diagnosed in their 20s and 30s, whilst men are diagnosed in their 40s and 50s - our figures suggest that there around 10 to 12,000 people with the condition in the UK. 'In the past, myasthenia gravis could be fatal, but these days there are medications that work very well, and people can go on to lead happy, normal lives. 'If people want any support or information about the condition, we have a great website and a Facebook page that sufferers of all ages will find useful.' For more information visit www.myaware.org

Summary: Clare-Alana Ford can go limp at any moment due to rare muscle condition. Despite her illness, she has forged a successful career as a model. At 17 doctors thought she had growing pains as her legs kept giving way. She diagnosed with the incurable myasthenia gravis and given medication. Had surgery in July 2013 to remove her thymus gland, which can help. Now has to wait three years to see if surgery has had any effect. Illness is uncommon, affecting about 15 in every 100,000 people s in the UK.

cnn_dailymail

en

Summarize: FIELD OF THE INVENTION The present invention relates to a lifting and transporting device. More specifically, the present invention relates to a device for lifting and transporting invalids or bedridden patients, preferably with a minimum of assistance. BACKGROUND OF THE INVENTION There are numerous mobile patient lift devices disclosed in the prior art which are used to move or transport invalids, bedridden-patients, or wheelchair confined patients from one area of a hospital or home to another area. Often the patients must be deposited on a table for physical therapy or into a tub for water therapy treatment or bathing. One problem encountered with conventional patient lift devices is that a patient cannot be deposited beyond the area defined by the base of the device. Although depositing a patient on a table or a chair which can be positioned within the frame of the device creates no problem, the conventional patient lift devices cannot be used for depositing a patient into a bathtub or onto a similar object such as a table that has a vertical wall extending upwardly from the floor so as to prevent positioning that object within the area defined by the base of the lift. With these previous mobile lifters, it was necessary, when lifting a patient onto or into such an object, to use, in combination with the mobile lifters other devices such as T-shaped frames or the like permanently, pivotally mounted near the base of the object such as the bathtub. Another problem associated with known conventional patient lift devices is that the devices are difficult for one person to operate, or are relatively fragile and, because of their narrow bases, are subject to instability. Still further prior art lift devices suffer from the disadvantage of having excessive gadgetry and complex pivoting and moving mechanisms, and these devices are either very expensive, or are subject to frequent breakdowns. Typical prior lift devices having the above noted structures, with the attendant disadvantages, are shown and described in the following U.S. Patents: Averill, No. 3,711,877; James, No. 3,829,916; Brown, No. 3,877,421; Bunker, No. 1,971,294; Kral, No. 3,123,244; Allen, No. 1,061,715; and Higgins, No. 787,760. Hence, there exists a need for providing a new and improved patient lift structure which will overcome the problems which have existed heretofore. SUMMARY OF THE INVENTION The present invention overcomes these and other disadvantages of the prior art by providing a patient lift device that can safely transport a patient beyond the frame support area a sufficient distance so as to enable a patient to be lowered onto or into an object located outside the area defined by the supporting base of the lift device. Moreover, the present invention accomplishes the foregoing without the need for transferring the patient between the mobile lift device and other devices and without any attachments or external equipment. With the present invention, a patient can be simply and efficiently lifted from one location, moved directly to another location and deposited gently and smoothly onto or into an object at a second location. The controls of the present invention are comprised of simple mechanical elements that are compact, inexpensive, simple in design to prevent breakdown, rugged to prevent breakage, and easily operated by a single operator. In one embodiment of the invention there is provided a movable patient lift device comprising a support assembly, an elongate substantially horizontal boom assembly supported by the support assembly and extending in a first longitudinal direction beyond a support area defined by the support assembly. A movable suspension means for suspending a means for carrying a patient is carried by the boom assembly. The suspension means includes a vertical adjustment for vertically moving the patient carrying means. A horizontal adjustment means mounted to the boom assembly horizontally transports the suspension means along the boom assembly and outside the area defined by the support base. Attached to the support assembly and extending beyond the support area, preferably in the other longitudinal direction, is a stabilizing means for counterbalancing the weight of the patient when the suspension means is moved beyond the support area. It is an object of this invention to provide a new and improved patient lift device. It is a further object of this invention to provide a new and improved patient lift device capable of transporting a patient, without the need for additional equipment, onto or into an object located beyond the area defined by the base of the lift device. It is still another object of this invention to provide a new and improved patient lift device having a boom from which the patient holding seat is hung, which extends beyond the area defined by the base, in combination for counterbalancing excessive weights located beyond said area. It is still another object of this invention to provide a rugged and simplified patient lift device adapted to be easily operated by a single operator. Other features and advantages of the present invention will be discussed in or apparent from the description of the preferred embodiment of the invention found hereinbelow. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a perspective view of a lift device according to the present invention; FIG. 2 is a side elevation of the lift device shown in FIG. 1 with certain parts cut away and other elements shown in phantom and further shows a sling for holding a patient; FIG. 3 is an enlarged drawing of a portion of FIG. 2 with parts removed showing the details of a suspension means for suspending a patient according to the present invention. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT With reference to the figures in which like elements are represented by the same number, a patient lift device 10 according to the present invention is depicted. Lift device 10 generally comprises a support assembly 12 that has attached thereto a pair of front castors or wheels 14 and a pair of rear castors or wheels 16 thereby permitting movement of lift device 10 along a supporting surface. As shown in dashed lines in FIG. 1, front and rear wheels 14 and 16 outline the periphery or outer perimeter of a support area 17. In accordance with well known physical laws of mechanics, so long as the combined center of gravity of lift device 10 plus a patient being carried thereby remains within support area 17, lift device 10 will remain stable and not tip over. Lift device 10 further comprises an elongate, substantially horizontal boom assembly 18 supported by support assembly 12 at its rear end and extending beyond support area 17 at its forward end. A movable patient support or suspension assembly 20 is carried by boom assembly 18 and comprises a vertical adjustment assembly 22 for vertically moving a patient being carried by lift device 10. Suspension assembly 20 and hence a patient suspended therefrom is horizontally transported along boom assembly 18 both within and beyond support area 17 by a horizontal adjustment assembly 24. Attached to support assembly 12 and extending beyond support area 17 in the rearward direction is a cantilever platform 26 for stabilizing lift device 10 and counterbalancing the weight of a patient when suspension assembly 20 is moved along boom assembly 18 beyond and outside of support area 17. Support assembly 12 comprises a lower base assembly 30 and an upstanding post assembly 32 mounted at one end thereof to base assembly 30. Base assembly 30 comprises a substantially horizontal U-shaped frame 34 that is comprised of a rearward transverse beam 38 and a mid-transverse beam 40 and two longitudinally extending, substantially parallel arms 41. Post assembly 32 is rigidly mounted at approximately the transverse center of base 36 and can be permanently attached thereto by, for example, welding or can be removably attached thereto with bolts and angle members (not shown). Post assembly 32 comprises a front post 42, a rear post 43 and a horizontal brace 44. Removably and rigidly mounted at the top of posts 42 and 43 with screws 45 and angle braces 46 is boom assembly 18. Thus, in one embodiment of the invention, lift device 10 can be substantially disassembled for storage or transportation. Alternately, post assembly 32 can be comprised of a single vertical post which can be removably mounted into and rigidly attached to a short tube that in turn is welded or otherwise permanently attached to base 34. Support assembly 12 can also include a storage shelf 48, shown in FIG. 2 above and extending transversely between arms 41 of frame 34. Alternately, platform 48 could be mounted above or adjacent to horizontal brace 44. Boom assembly 18 comprises a substantially horizontal cantilever boom 50 rigidly mounted at the rearward end to the post assembly with angle braces 46 and screws 45 as described above. An end plate 52 is attached to the forward end of boom 50 and extends therebelow. In the presently disclosed embodiment of the invention, boom 50 is an inverted T-bar track 54 that consists of a central vertical portion 56 and a lower horizontal portion 58. Alternately, track 54 could be rigidly attached to boom 50. As shown in FIG. 1, a dashed line 60 drawn vertically downward from the rearward face of end plate 52 terminates on the ground at a point well outside support area 17. Rigidly mounted onto the rearward face of end plate 52 is an upper bearing block 62 and a lower bearing block 64, the purposes for which will be described hereinbelow. Movable patient suspension assembly 20 comprises a travelling trolley assembly 66 mounted on and movable over track 54. With reference in particular to FIG. 3, trolley assembly 66 comprises two spaced apart side plates 68 and two spaced apart end plates, a forward end plate 70 and a rearward end plate 72. Each end plate has an orifice 74 at the lower end thereof, said orifices being colinearly aligned with each other. Mounted on rearward end plate 72 is a threaded Whitworth nut 76, the threaded orifice of which is colinearly aligned with said orifices 74. Rotatably mounted at the upper ends on the inside of each side plate 68 is a forward roller or wheel 78 and a rear roller or wheel 80 in rolling engagement with the upper side of horizontal portion 58 of track 54. Wheels 78 and 80 of each side plate 68 are on the corresponding side of vertical portion 56 of track 54. As shown in both FIGS. 2 and 3, vertical adjustment assembly 22 comprises a drum 82 having a square central bore completely therethrough and round ends with reduced diameters journalled in bearing blocks 86 mounted on respective end plates 70 and 72. Drum 82 has external deep threads 88 for guiding and retaining a flexible cable 90, one end of which is secured to drum 82 with a lock plate 92 mounted with screws to one end of drum 82. The other end of flexible cable 90 terminates in a ring 94 to which can be attached, as shown in FIG. 2, a sling 96 for holding a patient. Sling 96 is not a part of the present invention and any supporting device for comfortably, yet securely, holding a patient such as a chair can be substituted therefor. Vertical adjustment assembly 22 also comprises a drum rotating means comprised of an elongate member or square shaft 98 having rounded end portions 99. The forward end portion 99 of square shaft 98 is journalled in upper bearing 62 and the other end passes through the upward portions of post members 42 and 43 and is journalled thereat in bearings 100. Rigidly mounted on the rearward end of square shaft 98 is a gear 102. A vertical shaft 104 having a worm gear 106 in geared relationship with gear 102 at one of its ends and a miter or bevelled gear 108 on its other end transfers the rotation from an outer, large hand wheel 112 to square shaft 98. Support braces 110 are rigidly attached to the rearward side of post member 43 and rotatably mount vertical shaft 104 thereto. Large hand wheel 112 is comprised of a hub 114 with bevel gear 116 rigidly mounted at the forward end thereof and it has a bore completely therethrough. A bearing 118 is mounted inside the bore of hub 114 so that outer hand wheel 112 can be rotatably mounted on a smaller, inner hand wheel 120 as described hereinbelow. Horizontal adjusting assembly 22 comprises a Whitworth threaded shaft 124 that is journalled at the forward end thereof in lower bearing block 64 with the rearward end rigidly coupled to a round unthreaded extension shaft 125. Extension shaft 125 extends through an orifice in post member 42 and is rotatably supported by a bearing 126 mounted on post member 42. The rearward end of extension shaft 125 terminates in a sprocket 128. A shaft rotation means for shaft 124 comprises smaller hand wheel 120, and a horizontally extending shaft 130 rigidly mounted at one end thereof to smaller hand wheel 120 and supported in a bearing 132 located in an orifice in rear post member 44. The forward end of shaft 130 terminates in a sprocket 134 which is rotatably connected to and drives sprocket 128 attached to extension shaft 125 by means of an endless chain 136. Larger hand wheel 112 is concentrically, rotatably mounted on shaft 130 at a point just forward of smaller hand wheel 120. The rotation of large hand wheel 112 is transferred to square shaft 98 through vertical shaft 104 and the associated gearing and to drum 82 as a result of the mating engagement between square shaft 98 and the square central bore 84 of drum 82. Drum 82 also can be keyed to a rotating shaft and still be left free to move axially along the shaft with other obvious mechanisms. For example, shaft 98 can be round and have a straight keyway running axially along the shaft, and a key rigidly mounted in the bore of drum 82 can slidably engage the keyway. An obvious modification that is still within the present invention is to employ a channel type track with wheels 78 and 80 of trolley assembly 20 mounted on the outer surfaces of side plates 68. Threaded shaft 124 would then be located above square shaft 98 inside the channel of the channel track and nut 76 would extend between side plate 68 and in threaded engagement with threaded screw 124. Other modifications of a channel-type track are disclosed in the aforementioned Kral patent. The gearing mentioned above which transfers the rotation from hand wheels 112 and 120 to square shaft 98 and threaded shaft 124 respectively are sized so as to provide a mechanical advantage thereby requiring less effort by the operator when turning the respective hand wheel. Similarly, the use of threaded screw 124 provides a further mechanical advantage and results in a very easily operated lift device. Alternatively, reversible electric motors can be mounted between post members 42 and 43 and geared to operate threaded shaft 124 and square shaft 98. The motors could be powered from a battery located on storage shelf 48 and operational switches can be mounted on the rearward side of post member 43 where hand wheels 112 and 120 are now depicted. With reference to FIG. 1 and particularly to FIG. 2, platform 26 is rotatably mounted with hinges 140 to the rearward end of base assembly 30 of support assembly 12. Platform 26 is supported in a substantially horizontal, lowered operational position by support rods 142 which slidably extend through a common swiveling pin 144 that is rotatably mounted on rear post member 43 with a bracket 146. Support rods 142 are retained in swiveling pin 144 by nuts 147 mounted on the corresponding forward ends of support rods 142. The other end of each support rod 142 extends through a slot 160 in platform 26 and is rotatably attached to a bracket 148 securely mounted on the bottom of platform 26. When not in use, as shown in phantom lines in FIG. 2, platform 26 can be raised to a vertical, stowed position and retained there with a latch 150. In operation, the present invention provides a lift device that can transport a patient safely beyond the support area 17. An operator would push lift device 10 to the place where the patient is first located and would operate smaller hand wheel 120 to position trolley assembly 20 to a position abutting end plate 52 on boom assembly 18, a location that is outside support area 17. The operator would then lower platform 26 and stand on the platform while operating larger hand wheel 112 so as to lower sling 96 to enable a patient to get into the sling. The rotational moment of an operator mounted on platform 26 acts through a distance from the operator&#39;s position on platform 26 to the pivot point or fulcrum which is located at front wheels 14. The counterrotational moment exerted by a patient that is positioned in sling 96 acts through the much shorter distance from the end of boom assembly 18 to the same front wheels 14. Thus, a 70 pound operator can safely counter the weight of a 250 pound patient. As a result of the aforedescribed mechanical advantages and the rotational linkage between hand wheels 112 and 120 and threaded shaft 124 and square shaft 98, as little as a 21/2 pound effort is required to lift a 250 pound patient and to move the patient to a location inside of support area 17. Once a patient has been moved within the support area 17, the operator can descend from platform 26 and stow platform 26 in its upright position. The patient can then be easily transported to another area such as to a bathroom. The front of lower base assembly 30 can be placed in contact with the vertical wall of a bathtub and the patient can be easily and safely lowered into the bathtub by reversing the aforedescribed procedure. All the operator has to do is to lower and mount platform 26 and then operator hand wheels 120 and 112 to position the patient over the bathtub and lower the patient down into the bathtub. In a preferred embodiment of the present invention, the height of boom assembly 18 and the width of base assembly 30 are selected so that lift device 10 can be easily transported through standard sized door openings. The length of track 54 is preferably selected such that a 15 inch length extends beyond front wheels 14. Thus, the present invention provides a sturdy, relatively inexpensive and mechanically simple patient lift device that is easily operated and can be used to position a patient into or onto an object that is located in front of the base assembly of the lift device. Although a manually operated lift device was thoroughly described above, an electrically operated lift device is still within the scope of the present invention. Although the invention has been described in detail with respect to an exemplary embodiment thereof, it will be understood by those of ordinary skill in the art that variations and modifications may be effected within the scope and spirit of the invention.

Summary: A movable patient lift device that comprises a lower base assembly, an upstanding post assembly mounted on one end of the base assembly, a cantilever boom assembly, which includes a track, mounted on the upper end of the post assembly and extending longitudinally at the distal end beyond the base assembly, and a movable trolley assembly in movable engagement with and supported by the track. The trolley assembly contains a rotatable drum onto which a flexible cable is wound. A patient chair or sling is attached to the other end of the cable and linkage and gearing is provided to enable an operator to rotate the drum thereby raising or lowering the patient, and to longitudinally position the trolley assembly and hence the patient along the track. A cantilever platform is pivotally mounted to the base assembly and extends outwardly therefrom, preferably in the direction opposite that of the boom assembly. When an operator mounts the platform, the operator counterbalances the moment exerted by a patient who is suspended beyond the base assembly.

big_patent

en

Write a title and summarize: Here we report on the identification and functional characterization of the ADAMTS-like homolog lonely heart (loh) in Drosophila melanogaster. Loh displays all hallmarks of ADAMTSL proteins including several thrombospondin type 1 repeats (TSR1), and acts in concert with the collagen Pericardin (Prc). Loss of either loh or prc causes progressive cardiac damage peaking in the abolishment of heart function. We show that both proteins are integral components of the cardiac ECM mediating cellular adhesion between the cardiac tube and the pericardial cells. Loss of ECM integrity leads to an altered myo-fibrillar organization in cardiac cells massively influencing heart beat pattern. We show evidence that Loh acts as a secreted receptor for Prc and works as a crucial determinant to allow the formation of a cell and tissue specific ECM, while it does not influence the accumulation of other matrix proteins like Nidogen or Perlecan. Our findings demonstrate that the function of ADAMTS-like proteins is conserved throughout evolution and reveal a previously unknown interaction of these proteins with collagens. The establishment and maintenance of extracellular matrices (ECM) are important tasks to allow proper organ function in metazoans. Among other factors, changes in ECM composition, turnover and homeostasis are crucial mediators of human cardiovascular disease leading to life threatening conditions and premature death. The ECM allows cells to resist mechanical forces, protects complex tissues from being damaged and promotes specific physical properties like elasticity or stiffness in order to maintain organ functionality. While the composition of the ECM is very complex and extremely variable the basic structural constituents can be grouped as collagens, glycoproteins and proteoglycans, which are highly conserved throughout metazoan species [1]. Consequently, defects in ECM proteins or matrix composition cause major developmental defects and strongly contribute to prevalent human disease like fibroses or cancer [2]. During the last years fibrotic disease and mutations in various ECM proteins were correlated to cardiovascular disease. For example mutations in human Col4a1 cause the weakening of the major vasculature leading to life threatening aneurysms or stroke [3] while mutations in murine Col4a1 and Col4a2 induce vascular defects causing internal bleedings and prenatal lethality [4]. Even more recently ADAMTS-like (ADAMTSL, A Disintegrin and Metalloprotease with Thrombospondin repeats) proteins have gained significant importance in the understanding of certain types of fibrillinopathies [5], [6]. Mutations in human ADAMTSL4 were identified in patients suffering from isolated ectopia lentis (EL), a recessive disorder of the occular lense [7], [8] and, more severely, aberrations in ADAMTSL2 cause geleophysic dysplasia a syndrome which, amongst others, manifests in the thickening of the vascular valves and progressive cardiac failure causing premature death [9]. Unfortunately, despite the pathological mutations no ADAMTSL alleles in genetically treatable model systems were described so far. In the present study we use Drosophila melanogaster as a model of ECM function in the cardiac system. In Drosophila the maintenance of cardiac integrity is of great importance, since no mechanisms of cardiac cell replacement or tissue repair exist. A variety of mutations in ECM genes have been analyzed with respect to their function in different tissues and processes like neurogenesis, muscle attachment, wing development and others [10]–[12]. Cardiogenesis in the fly embryo depends on several ECM components including the evolutionarily conserved toolkit of proteins forming the basement membrane. The basement membrane constitutes a specialized type of ECM consisting of Laminins, Collagen IV, Perlecan and Nidogen found at the basal side of epithelial cells [13]. The interaction of laminins with cellular receptors like integrins or dystroglycan and its self-assembly into a higher meshwork forms the initial step of basement membrane formation in animals [14], [15]. Consequently, mutations in any of the four laminin encoding genes in Drosophila lead to severe embryonic cardiac defects. For example loss of lanB1, encoding the only β-subunit of the laminin trimer, prevents the accumulation of collagen IV and perlecan towards cardiac cells, while mutations in lanA and lanB2 (encoding the α3,5-subunit and the γ-subunit, respectively) cause the detachment of pericardial cells, a specific type of nephrocytes in arthropods, from the heart tube [14], [16]–[18]. The highly abundant proteins forming the basement membrane have in common that they are distributed ubiquitously and cover all internal organs of the fly [14], [19]. Compared to that the cardiac ECM is unique, since it contains the collagen Pericardin (Prc), which is rather specifically decorating the heart tube [20], [21]. Prc displays certain homologies to mammalian collagen IV and was shown to be crucial for heart morphogenesis and cardiac cell to pericardial cell adhesion [20], [22]. However, the question of how Prc accumulates in a cell specific manner in the fly embryo or how specific matrices are specified in the rather open body cavity of insects in general was not addressed in detail so far. Here we introduce the gene lonely heart (loh), which is crucial to maintain cardiac integrity during postembryonic developmental stages. We show that Loh is a member of the ADAMTSL protein family and constitutes the essential mediator of Prc accumulation and matrix formation already in embryonic cardiac tissue. ADAMTSL proteins belong to the evolutionary conserved family of ADAM proteases with the exception that these proteins lack a proteolytically active domain in their primary sequence and therefore its function is unclear [5], [6]. We found evidence that Loh is sufficient to specifically recruit Prc to the ECM of different tissues indicating that Loh regulates the assembly of tissue and organ specific matrices. This is of great interest since the composition of the ECM determines its mechanical properties crucial for correct organ function and cellular behavior [23]. We also address the physiological relevance of cardiac integrity and show that lack of either loh or prc prevents proper blood circulation in the animals and cause a reduction of the fly' s life span. The findings presented in here demonstrate that mutations in ADAMTSL proteins lead, like in human disease, to progressive heart failure and premature death in flies, strongly arguing for an evolutionary conserved function. In order to identify novel mediators of cardiac function we screened a set of pupal lethal EMS induced mutants, known as the Zuker collection, for the presence of postembryonic cardiac malformations [24]. To mark all cells contributing to the mature heart we introduced the previously described handC-GFP reporter into each individual mutant strain [25]. We identified a single allele, lonely heart (loh1), showing a strong detachment of pericardial cells from the heart tube during larval stages (Figure 1 and Figure S1A, B). To map the mutation to the genome we introduced the loh1 allele to a collection of genomic deficiencies and assayed the progeny for the presence of the pericardial cell detachment phenotype. The allele failed to complement the deficiencies Df (2L) Exel7048, Df (2L) BSC453 and Df (2L) BSC144 but complements Df (2L) BSC209 (Figure S1C–F). This allowed us to narrow down the location of the mutation to a 14 kb genomic region at band 31E3-4 containing three open reading frames (Figure S1I). Since EMS is known to promote secondary hits on the same chromosome we decided to assay existing alleles of these three genes for the presence of the pericardial cell detachment phenotype. We were able to identify two alleles, MB05750 and MI02765, that are allelic to loh1 and Df (2L) Exel7048 and produce the heart phenotype in transheterozygous condition (Figure 1A–D and Figure S1G, H). Both mutations were induced by the insertion of minos elements within the locus of the previously uncharacterized gene CG6232 [26], [27]. Based on sequence predictions CG6232 encodes an ADAMTS-like (A Disintegrin and Metalloproteinase with Thrombospondin repeats) protein, containing several Thrombospondin type 1 repeats, a central ADAM-spacer domain and a C-terminal Protease and Lacunin (PLAC) domain (Figure S1J). The primary sequence of Loh/CG6232 shows high homologies to mammalian ADAMTSL6, known to promote the formation of fibrillar matrices in mice [28]. During a parallel reverse genetic approach we also tested transposon induced alleles affecting known ECM genes for the appearance of late cardiac defects. We identified the allele MB03017 carrying a minos element in the pericardin (prc) locus. Homozygous prcMB03017 and transheterozygous prcMB03017/Df (3L) vin6 animals display a strong pericardial cell detachment phenotype similar the loh phenotype (Figure 1E, F and Figure 2E). The Prc protein constitutes a rather heart specific collagen, which shows homologies to vertebrate collagen IV [22]. Previous studies implicated Prc to be involved in dorsal closure as well as cardiogenesis [20]. However, no gene specific mutant was available so far. To investigate the adhesion defects arising in both loh and prc mutants in more detail we analyzed the morphology of the heart at different developmental stages. During embryogenesis the heart tube arises from two bilateral primordia and forms a simple tube at the dorsal midline. Determination and migration of heart precursor cells is not affected in either lohMB05750/Df (2L) Exel7048 or prcMB03017/prcMB03017 mutant animals (Figure 2A, D and G). During larval development the pericardial cells irreversibly detach from the heart tube with the phenotype becoming fully visible in third instar larvae (Figure 2B, E and H). The loss of cardiac integrity in both mutants does not constrain the development into adult animals and we could detect the pericardial cell detachment phenotype in pharate adult animals, which further develop into viable and fertile flies (Figure 2C, F and I). These findings show that the phenotype arises progressively during development and indicate that proper heart function is not essential for development into the imago. Of note the alleles loh1 and lohMI02765 cause larval lethality in homozygous condition, while the alleles are viable in transheterozygous combination indicating second site mutations or yet unknown dominant effects of the mutated proteins. Since lohMB05750 and prcMB03017 animals are homozygous viable and show the pericardial cell detachment phenotype all experiments predominantly focus on these two alleles. Postembryonic pericardial cells are enclosed by a dense network of Prc fibers and connected to the alary muscles (Figure 2J–K). Since the heart tube and the alary muscles are not connected via direct cell-to-cell contacts this Prc network is likely to be a fundamental structural component to suspend the heart to the body cavity [29]. To evaluate the adhesion of the heart tube to the alary muscles in more detail we stained transheterozygous lohMB05750/Df (2L) Exel7048 and prcMB03017/Df (3L) vin6 larvae for F-actin and βPS integrin (Figure 2L–N). The detachment of pericardial cells also ruptures the connection between the alary muscles and cardiomyocytes demonstrating that the lack of pericardial cell adhesion consequently lead to a breakdown of the heart' s suspension towards the epidermis. Furthermore, the morphology of the cardiomyocytes itself is dramatically altered in lohMB05750/Df (2L) Exel7048 and prcMB03017/Df (3L) vin6 mutants (Figure 2O–Q). While in the wild type cardiomyocytes show a defined arrangement of F-actin fibers in a circular fashion mutant cells exhibit an uncoordinated distribution of actin fibers and an altered cell shape. Since the arrangement of actin fibers might be a secondary effect of a changed cardiac cell polarity we stained mutant embryos for the polarity markers FasIII and αSpectrin (Figure S2A–L). Neither loh nor prc mutant hearts displayed changes in cell polarity proving that the changed actin arrangement is an effect of the defective cellular adhesion. We next elucidated how heart beat is influenced in the mutants. For this purpose the beating pattern of the heart was recorded in semi-dissected third instar larvae (Movies S1, S2, S3) [30]. Wild type heart beat follows a very regular pattern and the heart walls display systolic and diastolic movements (Movie S1). Compared to that the beating pattern in lohMB05750/Df (2L) Exel7048 and prcMB03017/Df (3L) vin6 mutant larvae is dramatically altered. The disorganized actin fibers cause a changed contraction movement of the whole organ along the posterior-anterior axis (Movie S2 and Movie S3). In addition no systole and diastole are detectable already indicating that the pumping performance of the organ is altered. To evaluate whether the disruption of heart architecture and the changed beating pattern impairs heart functionality we analyzed the capability of mutant hearts to provide circulatory activity. To visualize the hemolymph flow by dye angiography we injected a fluorescent tracer into the abdomen of adult animals shortly before eclosion (pharate adults) and semi-quantified the pumping capacity of the dorsal vessel by measuring the tracer accumulation within the head (Figure 3A–C) [31]. To verify the reliability of the technique a control strain that does not display any cardiac defects was tested and showed a strong accumulation of the tracer in the head (Figure 3B–C and Movie S4). In contrast homozygous prcMB03017 and lohMB05750 mutant animals displayed a dramatic reduction or total absence of dye accumulation within the examination time, which proves that the observed disruption of heart integrity directly influences the ability to promote circulatory activity (Figure 3C). Since it is known that heart failure can cause a significant reduction of Drosophila' s life span [32], [33] we tested whether the isolated alleles show a direct effect on adult survival. As a wild type control we used the white1118 strain, because this genotype resembles the genetic background of both minos insertion strains. Wild type flies (white1118) revealed an average life time of 46 days, while the mean life span of homozygous lohMB05750 and prcMB03017 animals was decreased by 26% (34 days) or 46% (25 days), respectively (Figure S3). This strongly argues that impaired cardiac function in the mutants reduces the survival of the animals. We investigated the temporal expression pattern of loh and prc by developmental Northern blots. The loh locus encodes two transcripts - a longer isoform A (3081 bp predicted) and a shorter isoform C (2131 bp predicted) (Figure 4A). While isoform A constitutes the major transcript during embryogenesis, isoform C becomes additionally expressed during the first and second larval stage (L1 and L2). Later on expression declines and becomes weakly re-activated during pupal and adult stages. Compared to loh the temporal expression profile of prc was found to be remarkably similar (Figure 4A). A single transcript (5535 bp predicted) becomes expressed from the embryo to L2 and declines in L3. During metamorphosis expression re-initiates and lasts until adulthood. In order to reveal if both loh isoforms are essentially needed to ensure proper heart integrity we expressed two independent gene specific hairpins either effecting only isoform A (loh-IRNIG6232-2) or both isoforms (loh-IRVDRC31020) under the control of handC-Gal4 to knock down the gene' s expression (Figure 4B). Expression of both hairpins causes a pericardial cell detachment phenotype. However, since expression of the loh-IRNIG6232-2 hairpin, which only targets isoform A, resulted in a detachment phenotype (Figure S4) we concluded that isoform A constitutes the relevant one for the observed adhesion defect. To investigate the effect of the isolated mutations on the expression level we analyzed the total protein amounts by immunoblotting (Figure 4D, E). Therefore we raised a specific peptide antibody recognizing both Loh isoforms. In embryonic extracts the antibody detects a single protein band corresponding to isoform A. The band runs slightly higher compared to the predicted molecular mass of 100 kDa, most likely due to posttranslational modifications (Figure 4D). The protein is absent from extracts of homozygous Df (2L) Exel7048 embryos proving the specificity of the antibody. Significantly, the protein is also undetectable in extracts of homozygous lohMB05750 embryos. RT-PCR analysis proved that lohA transcripts are severely reduced but not absent in these animals (Figure S4A), obviously leading to massively decreased protein levels. Similarly, Prc protein could be detected in extracts of different developmental stages in the control, but is absent from homozygous mutants (Figure 4E). Given the similar phenotypes of the mutants we sought to analyze the spatial expression pattern of both genes. Transcripts of loh and prc can be detected from embryonic stage 13 onwards until the end of embryogenesis in cardioblast and pericardial cell precursors (Figure 5A–F), where loh seems to be more prominently expressed in the ventricle of late stage embryos (Figure 5C). Additionally, loh transcripts were detected in the chordotonal organs, while prc is expressed by the oenocytes. Since it is known that prc is only expressed by a subset of cardiac cells we analyzed the expression of loh mRNA in combination with the cardiac cell markers Tinman and odd skipped-lacZ [20], [34], [35]. loh transcripts are expressed by both cell types demonstrating that most cardioblasts and pericardial cells contribute to the gene' s expression (Figure 5G, H). As previously reported, Prc protein distributes predominantly along the basal side of the cardiomyocytes where it co-localizes with the collagen IV fusion protein Vkg: : GFP (Figure 5I) [20], [36]. Strikingly, Loh co-localizes with Vkg: : GFP as well as Prc, demonstrating that it constitutes an integral part of the basal cardiac ECM (Figure 5J–K). The detected signal was considered to be specific since it follows the observed mRNA pattern and is undetectable in homozygous Df (2L) Exel7048 embryos (Figure S5A–C). The expression of Loh and Prc supports a function in mediating the adhesion between pericardial cells and cardiomyocytes in the mature heart, while the observed co-localization throughout the whole embryo indicates a cooperative function (Figure 5L). The data presented so far pointed us to the question if Loh and Prc act cooperatively in the cardiac ECM. To test if the proteins affect each other we analyzed the localization of Prc in loh mutant background and vice versa (Figure 6A–O). In homozygous lohMB05750, lohMI02765 and loh1 embryos Prc becomes normally secreted but strikingly fails to assemble properly in between the pericardial cells and the heart (Figure 6A–F and Figure S6A, B). While in the wild type Prc organizes into a proteogenic sheet at the basal side of the cardiomyocytes this regular distribution is completely disrupted in loh mutant embryos (Figure 6A–F). We also tested whether impaired loh expression affects other ECM proteins like Laminin, Nidogen or Perlecan (Figure 6B, E and Figure S6F, G and I, J). The expression and distribution of all tested proteins was unchanged in loh mutant animals indicating that Loh specifically regulates the correct accumulation of Prc but is not needed for ECM formation in general. The other way around the lack of Prc in homozygous prcMB03017 embryos does not affect the localization of Loh (Figure 6J–O) or any other tested ECM protein demonstrating that the function of both proteins is not mutual (Figure 6G–N and Figure S6H, K). To prove that the phenotypes in lohMB05750 and prcMB03017 definitely arise from the inserted transposons we generated revertants by precise excision of the minos elements [26], which was verified by PCR and subsequent sequencing (Figure S6C–E). The precise remobilization of both transposons lead to a restored Prc expression and distribution in both revertants demonstrating that the mutations are gene specific. To study the effect of loh and prc mutants on heart cell morphology in more detail we investigated TEM cross sections of wild type and homozygous lohMB05750 and prcMB03017 embryos (Figure 6P–V and Figure S6L–N). Like in wild type the cardiomyocytes are localized along the dorsal midline at the end of embryogenesis in both mutants showing that dorsal closure is not affected (Figure S6L–N). However, frequently the cardiomyocytes in homozygous prcMB03017 mutants fail to seal the lumen properly at the ventral side of the heart tube (Figure S6N). Staining against the ligand Slit, which is involved in heart lumen formation did not reveal any changes in its distribution indicating that the Slit/Robo signaling cascade is not affected (Figure S6O–Q) [37]. Most importantly, the luminal and basal membranes of the cardiomyocytes are covered by a distinct basement membrane in both homozygous mutants supporting the immunocytochemical data (Figure 6P–R). Measuring its thickness does not reveal any significant changes (Figure 6S). However, even if the pericardial cells are not fully detached from the embryonic heart, small gaps between the cells and rupture of the connecting ECM are detectable (Figure 6T–V). Taken together these data demonstrate that Prc and Loh are essential to maintain pericardial cell to cardiomyocyte adhesion and heart integrity but are not involved in ECM formation in general. Hypothetically the open circulatory system of insects would allow ECM proteins to be expressed by a certain cell type, then be distributed over the blood flow and finally become recruited by specific receptors expressed on the target cells. The embryonic expression pattern of loh and prc argue that both proteins are primarily produced locally by heart cells and become secreted into the cardiac ECM. To analyze the expression of prc during later stages we used the previously described prc-Gal4 driver to express GFP and found that it exactly mimics the expression pattern of prc in the embryo (Figure 7A) [20]. Upon larval hatching the driver becomes strongly activated in the fat body (Figure 7B) raising the question, whether the reporter mimics the endogenous prc expression. To test if Prc becomes produced by adipocytes we trapped the protein by inhibiting the protein secretion machinery of the cell by knocking down the expression of the small GTPase Sar1, which is essential for the establishment of COPII coated vesicles and protein secretion (Figure 7C, D) [38]. Compared to wild type, adipocytes of prc>sar1-IR first instar larvae displayed a strong accumulation of intracellular Prc protein unambiguously demonstrating that it becomes expressed by the larval fat body. To estimate the contribution of fat body derived Prc to the total amount of the protein made, we knocked down prc expression either in heart cells alone (handC-Gal4) or in both heart and fat body (prc-Gal4) and detected the protein by immunoblotting (Figure 7E). The specificity of the knock down was ensured by the use of two independent hairpins (Figure 3C). Prc levels are not markedly changed in handC>prc-IR third instar larvae, while the protein is nearly undetectable in extracts of prc>prc-IR animals illustrating that most of the larval Prc protein becomes secreted by adipocytes. Finally, the pericardial cell detachment phenotype could be induced by knocking down prc expression using both drivers (Figure S7). However, the penetrance of the induced pericardial cell detachment phenotype is strikingly higher if the knock down was mediated via prc-Gal4 (Figure 7F), showing that the protein secreted from adipocytes indeed contributes to pericardial cell adhesion. From these experiments we conclude that the major source of Prc in larvae is non-cardiac tissue. Nevertheless, locally produced Prc contributes to proper heart integrity, since heart specific knock down of Prc expression does induce the detachment phenotype as well. Taken together these experiments prove a developmental switch in Prc expression with embryonic Prc being locally produced by cardiac cells and during later stages becoming mainly secreted by the fat body (Figure 7G). Furthermore, the integration of fat body derived Prc into the cardiac ECM is essential to promote organ integrity. Although Prc is produced by adipocytes, the protein is not incorporated into the ECM of the fat body indicating that these cells lack specific adhesion properties for Prc (Figure 8A). We found that in third instar larvae the protein almost exclusively accumulates around tissues that initially expressed loh during embryogenesis, but is nearly absent from other mesodermal tissues. From these observations we concluded that Loh might act as a mediator or receptor of Prc matrix formation in Drosophila. To test if Loh is indeed sufficient to induce the formation of Prc matrices we expressed the protein ectopically either in adipocytes or myocytes by using prc-Gal4 or mef2-Gal4, respectively. Even if some sole Prc fibers can be found along both cell types these organs are not naturally covered by a Prc matrix (Figure 8A). Ectopically expressed LohA protein becomes secreted from both cell types and localizes around the cells (Figure 8C). The protein is retained at the cell surface of adipocytes or myocytes indicating proper localization in the ECM. Upon expression in the fat body, LohA distributes along the whole organ showing a higher accumulation at cellular contacts. Similarly, LohA ectopically expressed by myocytes distributes along the whole myotube with higher accumulation at the muscle tendons (Figure 8C, inset). Most importantly, we found that LohA expression strongly induces the formation of an ectopic proteogenic Prc network around both cell types (Figure 8C). Adipocytes and myocytes ectopically expressing LohA are tightly covered by Prc fibers, which are interconnected to each other and form a dense meshwork. Immunoblot analysis on whole extracts revealed that the overall amount of Prc was not changed in these animals (Figure S8A), demonstrating that ectopic LohA expression leads to a re-direction of Prc protein. To evaluate if Loh acts within the ECM we ectopically expressed a secretion defective version of the protein (Figure 8B), lacking the N-terminal signal peptide. The mutated protein localizes to the nuclei of the cells and fails to recruit Prc to the target matrix demonstrating that LohA has to be secreted in order to act as an initiating factor of Prc matrix formation. To evaluate if both proteins co-localize in such artificial matrices we counterstained dissected prc>LohA third instar larvae for Loh and Prc (Figure 8D, E). High resolution images of dissected fat bodies showed that ectopic LohA distributes as a very faint network at the surface of adipocytes and clusters in a pointy fashion along the cell contacts (Figure 8D) but does not completely co-localize with the recruited Prc fibers. Single slices and optical cross sections further demonstrate that Loh co-localizes with Prc at the anchoring points of the Prc network (Figure 8E), indicating that Loh might connect the root of each Prc fiber to the cell surface. Eventually, co-immunoprecipitation experiments using protein extracts isolated from prc>LohA adults proved a either direct or indirect biochemical interaction of both proteins (Figure 8F). In the respective experiments Prc co-precipitated if Loh was pulled down and vice versa. Based on these findings we hypothesize that Loh acts as a linker protein allowing Prc to interact with the cell surface, and wondered if Loh co-localizes with specific cell surface receptors. We found that LohA co-localizes to βPS integrin in adipocytes of prc>LohA third instar larvae (Figure S8B) tending us to speculate that LohA binds to integrin receptors, which has to be proven by further experiments. In summary we found that LohA is a crucial and sufficient mediator of Prc matrix formation, very likely acting by interconnecting Prc with the cell' s ECM. In this study we demonstrate that the Drosophila ADAMTSL protein Loh constitutes an unique protein of the cardiac ECM, essentially mediating cell adhesion and matrix formation. Loh is the first protein of its family identified and characterized in depth in flies. We isolated three independent alleles of the gene, all displaying the very same phenotype - the detachment of pericardial cells from the contracting heart tube during larval stages. Thus, the gene loh constitutes a novel and essential mediator of heart cell adhesion and cardiac function. Surprisingly, impaired heart function does not hamper proper development into adult animals but significantly reduces life span. This might be explained by the fact that oxygen transport and blood flow is uncoupled in insects and therefore a reduced hemolymph circulation might not immediately result in cytotoxicity. Furthermore, the open body cavity of the larvae might also allow a distribution of hemolymph independently of a pumping organ supporting the finding that larvae seem not to achieve any drawbacks by the loss of heart function. Based on the primary sequence the domain architecture of Loh is extremely similar to that of vertebrate ADAMTSL6 and is likely to be its ortholog. Furthermore, ADAMTSL6 is the only protein of this family known to produce two transcriptional isoforms from one gene locus. In contrast to Loh the shorter ADAMTSL6 isoform was found to be functional in organizing the ECM in mice [28]. Our data demonstrate that LohA, the larger protein, is functional and sufficient to mediate matrix formation in Drosophila while the role of the shorter isoform C remains elusive by now. However, since the lohC transcript is not expressed during embryogenesis, the critical time window of loh function, we exclude any role of LohC in mediating cardiac ECM formation. By testing different ECM proteins we demonstrated that Prc, a collagen with a very restricted distribution in the animal, is particularly affected in all isolated loh mutant alleles, emphasizing the specific function of Loh to promote Prc matrix formation. Consequently, we isolated the first prc mutant allele, which phenocopies the cardiac defects found in loh mutant strains. In loh mutant animals Prc mislocalizes along the heart already during embryogenesis, leading to a progressive loss of tissue integrity, which eventually causes the observed collapse of the heart tube and an abolishment of cardiac activity. The main function of both proteins is therefore the mediation of cellular adhesion between the heart, the pericardial cells and the alary muscles which further connect the whole organ system to the body cavity. In addition to the cell adhesion defects we also found that the process of heart lumen formation was impaired in prc but not loh mutants. Since we have not followed up the details of this phenotype the role of Prc in lumen formation remains elusive for now. However, the data implicates that the presence of Prc is critical to allow cardioblasts to seal the lumen correctly, while the correct localization of Prc into the matrix seems not to be essential for this process. Analyzing the embryonic and larval expression patterns of loh and prc revealed that both genes are predominantly active during the growing stages of the animal and become deactivated after the heart has grown to its final size. In the embryo, both genes are transcribed in either the same or very proximate cells indicating that the proteins are not distributed over longer distances once they are secreted. Importantly, the final localization of Prc therefore mainly follows the expression of loh. This can be seen best in the oenocytes of the embryo, where Prc becomes secreted but later on mainly localizes to the overlying chordotonal organs that in turn express loh. Thus, loh expression is a prerequisite for the successful establishment of a Prc matrix. This local protein distribution changes during larval stages. As demonstrated by an inhibited secretion in adipocytes of prc>sar1-IR animals, Prc becomes strongly expressed by the fat body during early larval stages. Hence, the protein becomes distributed over longer distances in the larva but still decorates organs and tissues that initially expressed loh. Based on these data, we provide a conceptual model (Figure 7G) in which Loh predetermines the ECM to allow Prc to become coupled to the cell surface and to be organized into a reticular matrix. Previously it was shown that Collagen IV, the major collagen in the basement membrane, becomes also secreted by adipocytes and distributes through the hemolymph [39]. We can now prove that Prc as a second collagen is also synthesized by the larval fat body, which enhances the importance of this organ for ECM biogenesis. The developmental change in prc expression might therefore be explained by the ongoing differentiation of pericardial cells into mature nephrocytes during larval stages. While embryonic pericardial cells are able to secrete large amounts of protein into the extracellular space, the major function of pericardial nephrocytes is endocytosis [40], thus requiring adipocytes to take over Prc production. Finally our results show that the cardiac matrix is maintained during larval growing phases presumably by the consecutive incorporation of fat body derived Prc. The ectopic expression of Loh showed that the secreted protein is readily incorporated into different matrices raising the question how Loh itself interacts with the ECM in general. At the moment it is not fully understood if ADAMTSL proteins interact with miscellaneous ECM components or require specific cell surface receptors. Based on the spatial proximity of Loh to βPS integrin we speculate that Loh may interact with integrin receptors and link these to Prc bundles, thereby promoting the connection of the Prc network to the cell surface. This idea is supported by the observed changes in fiber orientation of mutant cardiomyocytes. Since it is known that integrins are connected to the underlying Z-disks of muscle cells by a structure called the costamere [41] we propose that lack of integrin-ECM binding induces the redistribution of myofibrils. However, there is no evidence of an interaction between ADAMTSL proteins and integrins or any other cellular receptor so far. Nevertheless, in such a model Loh would allow the specific binding of specialized ECM molecules to only some unique matrices. Since Drosophila possesses only two β integrin subunits the number of α/β-dimers is limited and the use of Loh as an adapter molecule increases the diversity of matrix composition and opens up the possibility to create sub-functional matrices. Furthermore, integrin mediated binding seems to influence the correct assembly of Prc since previous findings already showed that lack of αPS3- or βPS integrin can interfere with the distribution of Prc and induce pericardial cell detachment phenotypes [42]. In addition to a receptor mediated ECM incorporation of Loh, binding might also be achieved by some or all of the five TSR1 domains found in the primary sequence of the protein. Previously it was demonstrated that ADAMTS (L) proteins can bind to the ECM via the various TSR1 motifs that interact with glycosaminoglycans [43]. This would not need special receptors and allow Loh to incorporate into any matrix. The cell specific expression of loh would then mainly decide which matrix will incorporate Prc and this would in turn strongly depend on the cis-regulation of the gene' s expression. On the molecular level we propose that Loh basically acts as a linker protein. Based on the ectopic expression of Loh and the co-immunoprecipitation experiments we can demonstrate that Loh and Prc interact in vivo. In our hands Loh behaves like a secreted receptor molecule that specifically recruits Prc to the cell surface. Our findings indicate that the main molecular function might therefore be binding, but does not exclude additional functions of the protein. It was suggested previously that ADAMTSL proteins act as regulators of extracellular proteases and thereby regulate ECM content and composition [6]. For example it was demonstrated that Drosophila Papilin, another member of ADAMTSL related proteins, is sufficient to inhibit a vertebrate procollagen proteinase in vitro [44]. Thus, it is possible that also Loh regulates a so far unknown proteinase that renders the matrix unsuitable for the accumulation of Prc in some way. In such a model the activity of Loh would then influence the pre-existing microenvironment around a cell to allow Prc to assemble into a network. However, there is no evidence for such a function or the involvement of proteinases so far. The observed roles of Loh in Drosophila partially reflect the function of ADAMTSL proteins in vertebrates, which were shown to organize Fibrillin-1 (FBN1) microfibrils in specialized matrices. Genetic and biochemical analyses showed that ADAMTSL4 and ADAMSTL6 are sufficient to mediate the formation of FBN1 fibrils in cultured fibroblasts as well as in vivo [28], [45]. ADAMTSL4 acts as a FBN1 binding protein that mediates microfibril assembly in the zonule fibers of the human eye leading to isolated ectopia lentis (IEL) if mutated. Thus, IEL is caused predominantly by altered mechanical properties of the zonular fibers leading to a progressive dislocation of the lens [45]. In Drosophila, where no FBN1 homolog exists, Loh interacts with Prc and mediates its distribution within the ECM in a very similar manner. Therefore, the correct assembly of Prc between the pericardial cells and the heart tube could promote the mechanical properties needed to sustain the permanent mechanical forces during heartbeat. The clinical phenotypes of geleophysic dysplasia (GD) observed in ADAMTSL2 mutant patients exceed a function of simply promoting mechanical stability of the ECM. It was shown that ADAMTSL2 binds to FBN1 but also interacts with LTBP1, a regulator of TGFβ signaling, and therefore the phenotypes of GD also include growing defects, muscular hypertrophy and thickening of the skin [9]. None of these additional phenotypes were observed in Drosophila loh mutants. Therefore, it is obvious that ADAMTSL proteins developed novel functions during evolution making them essential mediators of ECM development and homeostasis. So far there are no reports of interactions between any ADAMTSL proteins with collagens but the obviously similar functions in flies and vertebrates strongly argue for a conserved function in organizing fibrillar matrix proteins. Flies were kept under standard conditions at 25°C on cornmeal agar. The following fly stocks were obtained from the Bloomington stock center: w1118; Mi (ET1) prcMB03017/TM6c, Sb1, w1118; Mi (ET1) lohMB05750, y1, w1118; Mi (MIC) lohMI02765/SM6a, Df (2L) Exel7048/CyO, Df (3L) vin6/TM3, Sb1, Ser1, w1118; Sco/SM6a, P{hsILMiT}2. 4, w1118; UAS-eGFP and balancer stocks KrIf-1/CyO, Kr>GFP and Dr1/TM3, Kr>GFP. Further fly stocks used are: handC-GFP and handC-Gal4 [25], oddrk111 (odd-lacZ) (C. Rauskolb), vkg: : GFP-454 [36], UAS prc-IR41320, UAS prc-IR100357, UAS loh-IR31020 and UAS Sar1-IR34191 [46], UAS loh-IR6232-2 (Drosophila Genetic Resource Center, Kyoto), mef2-Gal4 (H. Nguyen) and prc-Gal4 [20]. Precise excision of minos elements was carried out essentially as described before [26]. Briefly, homozygous w1118; Mi (ET1) lohMB05750 or w1118; Mi (ET1) prcMB03017 males were mated to w1118; Sco/SM6a, P{hsILMiT}2. 4 “jump starter” females. After two days adults were removed and the F1 progeny was heat shocked each day at 37°C for 1 h until hatching. F1 males, carrying the minos element (expressing GFP) and the transposase source (recognized by the SM6a balancer) were mated to adequate balancer stocks. In the F2 generation revertant chromosomes were identified by the absence of GFP expression and isolated via backcrossing to the F1 balancer stocks. Revertant lines were established and removal of the minos elements was evaluated by amplifying closely flanking sequences of the transposon by PCR and sequencing. Oligonucleotides (minos-flank) used for PCR and sequencing are: loh-fwd GCGGTCAGCTAAATAGCATC, loh-rev GAATTGGTTTGTCCCACAACG, prc-fwd CACACAGTGGAGCGAGATCC and prc-rev CCTTTCGAAGTGTAAAGTGC. Embryos were prepared for staining by chemical or heat fixation as described previously [47], [48]. Staining of larvae was done on dissected tissue samples, fixed 1 h in 3. 7% formaldehyde in 1× PBS. Primary antibodies used are: guinea pig anti-Loh (1∶500, heat fixation, this study), mouse anti-Prc/EC11 (1∶5, Developmental Studies Hybridoma Bank, DSHB), mouse anti-βPS integrin/CF. 6G11 (1∶3, DSHB), mouse anti-FasIII/7G10 (1∶3, DSHB), mouse anti-αSpectrin/3A9 (1∶3, DSHB), mouse anti-Slit/C555. 6D (1∶3, heat fixation, DSHB), rabbit anti-Perlecan/Trol (1∶1. 000) [49], rabbit anti-Nidogen/Entactin (1∶1. 000, a gift from S. Baumgartner), rabbit anti-Laminin (detects only secreted Laminin trimers; a gift from J. Fessler), rabbit anit-Tinman (1∶800) [34] and rabbit anti-GFP (1∶1. 000, Abcam). Secondary antibodies used are anti-mouse-Cy2/Cy3 (1∶100/1∶200, Dianova), anti-rabbit-Cy2/Cy3 (1∶100/1∶200, Dianova) and anti-guinea pig-Cy2/Cy3/Alexa633 (1∶100/1∶200/1∶200, Dianova and Abcam). F-Actin was visualized by staining fixed tissues using TRITC coupled phalloidin (Sigma), at a concentration of 0. 4 µg/ml in 1× PBS, for 1 h at room temperature. All images were acquired using a Zeiss LSM 5 PASCAL confocal microscope and standard objectives. The ability of insect nephrocytes to sequester colloids from solutions can be used to specifically label living cells. Therefore colloidal toluidine blue was used as vital stain. Third instar larvae were dissected in 1× PBS and incubated in 0,1 mg/ml colloidal toluidine blue solution for 1 min. Living nephrocytes specifically take up the dye resulting in a deep blue staining. Unspecific signals were removed by three consecutive washes in 1× PBS and animals were photographed immediately. Embryonic protein extracts were isolated from 20 selected embryos, which were homogenized in 25 µl ECM extraction buffer (1 mM EDTA, 1,5% Triton-X 100 and 2 M urea). Samples were supplemented with 25 µl 2× SDS sample buffer, cooked at 99°C for 2 min and 20 µl were used for SDS-PAGE. Larval and adult extracts were obtained from 10 whole animals homogenized in extraction buffer. Primary antibodies were diluted in 10% dry milk powder (w/v) in TBS-T and incubated overnight at 4°C. Antibodies used were guinea pig anti-Loh (1∶5. 000, this study), mouse anti-Prc/EC11 (1∶200, DSHB) and mouse anti-βTub/E7 (1∶5. 000, DSHB). Alkaline phosphatase coupled secondary antibodies (Dianova, Germany) were diluted 1∶10. 000 and phosphatase activity was visualized by colorimetric NBT/BCIP reaction. Total protein was stained using 0. 1 µg/ml amido black 10B (Sigma) in 7% acetic acid. Animals were equilibrated for 20 min and heart beat was recorded on a Zeiss Axioplan upright microscope equipped with a 10× air objective (n. a. = 0. 30). Single pictures were recorded at 80 frames per second (fps) using a Hamamatsu EM-CCD C9100 camera. Images were processed using Fiji and transformed into movie files. For dye injections staged pharate adults (<90 h APF) were glued on a glass object slide using double sided scotch tape. After 10 min the operculum was removed with fine forceps to allow imaging of dye accumulation. One single injection per animal was carried out, using a glass capillary applied to a micro manipulator and an Eppendorf FemtoJet microinjector. The capillary was filled with 10 µl uranin solution (1 µg/µl in PBS) that was injected laterally into the abdomen of the animal. Dye accumulation was recorded over three minutes using a stereo microscope equipped with an UV lamp, a corresponding filter set and a consumer digital camera (Canon PowerShot A650 IS). Pixel intensities were measured using the “Plot Z-axis profile” tool of Fiji within a region of interest (R. O. I) of the head (excluding the eyes due to different pigmentation). Freshly hatched animals were collected and separated according their sex and genotype. The flies were kept in plastic vials filled with standard cornmeal agar in groups of less than 20 animals at 22°C. The number of living animals was evaluated every three to five days and the flies were transferred onto new vials. Late stage embryos were selected according their genotype, judged by balancer expression. Fixation of embryos, sectioning and image acquisition was described previously [47]. The thickness of the basement membrane (BM) was investigated in sections of three independent animals (two sections per animal) of each genotype using Fiji. Therefore, BM thickness was measured at ten randomly picked positions in each image leading to a total number of 60 values per genotype. Northern blot was done as described previously with 15 µg total RNA loaded per lane [50]. Hybridization was carried out at 66°C for 24 h. The cDNA of lohA was amplified from cDNA clone GM15606 (BDGP). Oligonucleotides used were lohA-EcoRI-F TACTCAGAATTCATGGCGAAGCTGTTGTTAATATTCAG and lohA-KpnI-R TACTCAGGTACCTTAAATGCCACCCGTGCAGGAAAAAC. The lohAΔSP coding DNA was amplified using the modified oligonucleotide lohAΔSP-EcoRI-F TACTCAGAATTCATG GATTTAACAACTAAAGAGCG. The resulting DNA fragments were cloned into the pUAST vector and transgenic flies were established after standard protocols (TheBestGene Inc., USA). An antiserum against Loh was generated by injecting two guinea pigs with the sequence specific peptide VFDYHRIDGAEDSNGVTEW-C bound to KLH. Harvested antiserum was affinity purified against the peptide. Peptide synthesis, serum production and affinity purification were carried out by a commercial service (Pineda Antikörperservice, Berlin). All steps were carried out at 4°C or on ice. Total protein from 100 mg adult prc-Gal4/+; UAS-LohA/+ flies (∼100 flies) was extracted in 500 µl ECM extraction buffer (1 mM EDTA, 1,5% Triton-X 100 and 2 M urea). Flies were homogenized, pulled 6-times through a syringe (Ø = 0,8 mm) and debris was spun down at 8. 000 g for 30 min. The supernatant was centrifuged again at 13. 100 g for 30 min. The soluble protein fraction was split into four 100 µl aliquots. One aliquot served as input. The other aliquots were supplemented with 10 µl Protein A-Sepahrose 4B (Sigma), 0,1% BSA and either 10 µl PBS (negative control), 10 µl anti-Loh or 67 µl anti-Prc antibody and incubated under constant shaking overnight. Protein A slurry was spun down at 13. 100 g for 10 min and the pellet was washed in 500 µl ice cold 1M NaCl. The washing step was repeated three times, afterwards the pellets were resolved in 60 µl 2× SDS sample buffer and used for Western blotting

Title: The Conserved ADAMTS-like Protein Lonely heart Mediates Matrix Formation and Cardiac Tissue Integrity Summary: Cellular adhesion and tissue integrity in multicellular organisms strongly depend on the molecular network of the extracellular matrix (ECM). The number, topology and function of ECM molecules are highly diverse in different species, or even in single matrices in one organism. In our study we focus on the protein class of ADAMTS-like proteins. We identified Lonely heart (Loh) a member of this protein family and describe its function using the cardiac system of Drosophila melanogaster as model. Loh constitutes a secreted protein that resides in the ECM of heart cells and mediates the adhesion between different cell types - the pericadial cells and the cardiomyocytes. Lack of Loh function induces the dissociation of these cells and consequently leads to a breakdown of heart function. We found evidence that the major function of Loh is to recruit the collagen Pericardin (Prc) to the ECM of the cells and allow the proper organization of Prc into a reticular matrix. Since the function of Loh homologous proteins in other systems is rather elusive, this work provides new important insights into the biology of cell adhesion, matrix formation and indicates that ADAMTS-like proteins might facilitate an evolutionary conserved function.

lay_plos

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``EPA Regulatory Relief Act of 2011''. SEC. 2. LEGISLATIVE STAY. (a) Establishment of Standards.--In place of the rules specified in subsection (b), and notwithstanding the date by which such rules would otherwise be required to be promulgated, the Administrator of the Environmental Protection Agency (in this Act referred to as the ``Administrator'') shall-- (1) propose regulations for industrial, commercial, and institutional boilers and process heaters, and commercial and industrial solid waste incinerator units, subject to any of the rules specified in subsection (b)-- (A) establishing maximum achievable control technology standards, performance standards, and other requirements under sections 112 and 129, as applicable, of the Clean Air Act (42 U.S.C. 7412, 7429); and (B) identifying non-hazardous secondary materials that, when used as fuels or ingredients in combustion units of such boilers, process heaters, or incinerator units are solid waste under the Solid Waste Disposal Act (42 U.S.C. 6901 et seq.; commonly referred to as the ``Resource Conservation and Recovery Act'') for purposes of determining the extent to which such combustion units are required to meet the emissions standards under section 112 of the Clean Air Act (42 U.S.C. 7412) or the emission standards under section 129 of such Act (42 U.S.C. 7429); and (2) finalize the regulations on the date that is 15 months after the date of the enactment of this Act. (b) Stay of Earlier Rules.--The following rules are of no force or effect, shall be treated as though such rules had never taken effect, and shall be replaced as described in subsection (a): (1) ``National Emission Standards for Hazardous Air Pollutants for Major Sources: Industrial, Commercial, and Institutional Boilers and Process Heaters'', published at 76 Fed. Reg. 15608 (March 21, 2011). (2) ``National Emission Standards for Hazardous Air Pollutants for Area Sources: Industrial, Commercial, and Institutional Boilers'', published at 76 Fed. Reg. 15554 (March 21, 2011). (3) ``Standards of Performance for New Stationary Sources and Emission Guidelines for Existing Sources: Commercial and Industrial Solid Waste Incineration Units'', published at 76 Fed. Reg. 15704 (March 21, 2011). (4) ``Identification of Non-Hazardous Secondary Materials That Are Solid Waste'', published at 76 Fed. Reg. 15456 (March 21, 2011). (c) Inapplicability of Certain Provisions.--With respect to any standard required by subsection (a) to be promulgated in regulations under section 112 of the Clean Air Act (42 U.S.C. 7412), the provisions of subsections (g)(2) and (j) of such section 112 shall not apply prior to the effective date of the standard specified in such regulations. SEC. 3. COMPLIANCE DATES. (a) Establishment of Compliance Dates.--For each regulation promulgated pursuant to section 2, the Administrator-- (1) shall establish a date for compliance with standards and requirements under such regulation that is, notwithstanding any other provision of law, not earlier than 5 years after the effective date of the regulation; and (2) in proposing a date for such compliance, shall take into consideration-- (A) the costs of achieving emissions reductions; (B) any non-air quality health and environmental impact and energy requirements of the standards and requirements; (C) the feasibility of implementing the standards and requirements, including the time needed to-- (i) obtain necessary permit approvals; and (ii) procure, install, and test control equipment; (D) the availability of equipment, suppliers, and labor, given the requirements of the regulation and other proposed or finalized regulations of the Environmental Protection Agency; and (E) potential net employment impacts. (b) New Sources.--The date on which the Administrator proposes a regulation pursuant to section 2(a)(1) establishing an emission standard under section 112 or 129 of the Clean Air Act (42 U.S.C. 7412, 7429) shall be treated as the date on which the Administrator first proposes such a regulation for purposes of applying the definition of a new source under section 112(a)(4) of such Act (42 U.S.C. 7412(a)(4)) or the definition of a new solid waste incineration unit under section 129(g)(2) of such Act (42 U.S.C. 7429(g)(2)). (c) Rule of Construction.--Nothing in this Act shall be construed to restrict or otherwise affect the provisions of paragraphs (3)(B) and (4) of section 112(i) of the Clean Air Act (42 U.S.C. 7412(i)). SEC. 4. ENERGY RECOVERY AND CONSERVATION. Notwithstanding any other provision of law, and to ensure the recovery and conservation of energy consistent with the Solid Waste Disposal Act (42 U.S.C. 6901 et seq.; commonly referred to as the ``Resource Conservation and Recovery Act''), in promulgating rules under section 2(a) addressing the subject matter of the rules specified in paragraphs (3) and (4) of section 2(b), the Administrator-- (1) shall adopt the definitions of the terms ``commercial and industrial solid waste incineration unit'', ``commercial and industrial waste'', and ``contained gaseous material'' in the rule entitled ``Standards of Performance for New Stationary Sources and Emission Guidelines for Existing Sources: Commercial and Industrial Solid Waste Incineration Units'', published at 65 Fed. Reg. 75338 (December 1, 2000); and (2) shall identify non-hazardous secondary material to be solid waste only if-- (A) the material meets such definition of commercial and industrial waste; or (B) if the material is a gas, it meets such definition of contained gaseous material. SEC. 5. OTHER PROVISIONS. (a) Establishment of Standards Achievable in Practice.--In promulgating rules under section 2(a), the Administrator shall ensure that emissions standards for existing and new sources established under section 112 or 129 of the Clean Air Act (42 U.S.C. 7412, 7429), as applicable, can be met under actual operating conditions consistently and concurrently with emission standards for all other air pollutants regulated by the rule for the source category, taking into account variability in actual source performance, source design, fuels, inputs, controls, ability to measure the pollutant emissions, and operating conditions. (b) Regulatory Alternatives.--For each regulation promulgated pursuant to section 2(a), from among the range of regulatory alternatives authorized under the Clean Air Act (42 U.S.C. 7401 et seq.) including work practice standards under section 112(h) of such Act (42 U.S.C. 7412(h)), the Administrator shall impose the least burdensome, consistent with the purposes of such Act and Executive Order No. 13563 published at 76 Fed. Reg. 3821 (January 21, 2011). Passed the House of Representatives October 13, 2011. Attest: KAREN L. HAAS, Clerk.

Title: To provide additional time for the Administrator of the Environmental Protection Agency to issue achievable standards for industrial, commercial, and institutional boilers, process heaters, and incinerators, and for other purposes Summary: EPA Regulatory Relief Act of 2011 - Provides that the following rules shall have no force or effect and shall be treated as though they had never taken effect: (1) the National Emission Standards for Hazardous Air Pollutants for Major Sources: Industrial, Commercial, and Institutional Boilers and Process Heaters; (2) the National Emission Standards for Hazardous Air Pollutants for Area Sources: Industrial, Commercial, and Institutional Boilers; (3) the Standards of Performance for New Stationary Sources and Emission Guidelines for Existing Sources: Commercial and Industrial Solid Waste Incineration Units; and (4) Identification of Non-Hazardous Secondary Materials That are Solid Waste. Requires the Administrator of the Environmental Protection Agency (EPA), in place of such rules, to promulgate and finalize on the date that is 15 months after the date of the enactment of this Act regulations for industrial, commercial, and institutional boilers and process heaters and commercial and industrial solid waste incinerator units subject to such rules, that: (1) establish maximum achievable control technology standards, performance standards, and other requirements for hazardous air pollutants or solid waste combustion under the Clean Air Act; and (2) identify non-hazardous secondary materials that, when used as fuels or ingredients in combustion units of such boilers, heaters, or incinerator units, are solid waste under the Solid Waste Disposal Act for purposes of determining the extent to which such combustion units are required to meet emission standards for such pollutants under such Act. Requires the Administrator to establish a date for compliance with standards and requirements under such regulations, which shall be no earlier than five years after such a regulation's effective date, after considering compliance costs, non-air quality health and environmental impacts and energy requirements, the feasibility of implementation, the availability of equipment, suppliers, and labor, and potential net employment impacts. Treats the date on which the Administrator proposes such a regulation establishing an emission standard as the proposal date for purposes of applying the definition of a "new source" to hazardous air pollutants requirements or of a "new solid waste incineration unit" to solid waste combustion requirements under the Clean Air Act. Requires the Administrator, in promulgating such regulations, to: (1) adopt the definitions of "commercial and industrial solid waste incineration unit," "commercial and industrial waste," and "contained gaseous material" in the rule entitled Standards for Performance of New Stationary Sources and Emission Guidelines for Existing Sources: Commercial and Industrial Solid Waste Incineration Units; (2) identify non-hazardous secondary material to be solid waste only if the material meets such definitions; (3) ensure that emissions standards for existing and new sources can be met under actual operating conditions consistently and concurrently with emission standards for all other air pollutants regulated by the rule for the source category, taking into account variability in actual source performance, source design, fuels, inputs, controls, ability to measure the pollutant emissions, and operating conditions; and (4) impose the least burdensome regulatory alternative.

billsum

en

Summarize: Hollywood star George Clooney said fellow celebrities and industry figures did not want to sign a petition supporting 'The Interview' film featuring the assassination of Kim Jong-un as they were afraid of the consequences. Clooney said he wanted to see the film released online to undermine the threats of the hacking gang, who are believed to be supported by North Korean agents. And separately Sean Penn said he wanted the United Nations Security Council to take action, and warned that ISIS would be next to try to censor freedom of expression. Sony's computer systems were breached following a major hacking attack last month, which saw highly confidential material released as well as a string of embarrassing emails. Scroll down for video. George Clooney, pictured, said the hackers were clever by releasing embarrassing emails between senior Sony executives because this sent a chill throughout the rest of the industry who are afraid of being attacked. Clooney said he did not wish to be told what he could not watch by Kim Jong-un, pictured. Speaking to Hollywood showbiz magazine Deadline, Clooney said the hackers had released the embarrassing emails to undermine any possible support for Sony through the rest of the industry. The 53-year-old described the tactic as 'brilliant', because the hackers humiliated Sony, which subsequently prevented anyone from standing up to defend them. He said: 'After the Obama joke, no one was going to get on the side of Amy, [Amy Pascal, Sony Pictures co-chair] and so suddenly, everyone ran for the hills. Look, I can't make an excuse for that joke, it is what it is, a terrible mistake. Having said that, it was used as a weapon of fear, not only for everyone to disassociate themselves from Amy but also to feel the fear themselves. They know what they themselves have written in their emails, and they're afraid.' Clooney said he approached a large number of important people to sign his petition but kept getting rebuffed. He said that people are afraid of potential retribution. 'This is just where we are right now, how scared this industry has been made,' he told the magazine. 'Quite honestly, this would happen in any industry. I don't know what the answer is, but what happened here is part of a much larger deal. A huge deal. 'And people are still talking about dumb emails. Understand what is going on right now, because the world just changed on your watch, and you weren't even paying attention.' Crucially, Clooney said that, although North Korea is being held up as the reason for the movie being pulled, the reality is different. 'Sony didn't pull the movie because they were scared; they pulled the movie because all the theaters said they were not going to run it,' he told Deadline. 'And they said they were not going to run it because they talked to their lawyers and those lawyers said if somebody dies in one of these, then you're going to be responsible.' '[The Interview] is a silly comedy, but the truth is, what it now says about us is a whole lot. 'We have a responsibility to stand up against this.' Canned: Sony decided not to release The Interview - in which an ailing talk show host (Franco) and his producer (Rogen) land an interview with Kim Jon-un - after all major theaters decided they wouldn't play it. The theaters were reportedly under pressure from malls who feared they would be terror targets. Clooney said that Sony should release the movie online to prove a point to North Korea and anyone else who wishes to threaten free speech. 'I just talked to Amy (Pascal, Sony Pictures co-chair) an hour ago. She wants to put that movie out. What do I do? My partner Grant Heslov and I had the conversation with her this morning.... Stick it online,' he said. 'Do whatever you can to get this movie out. Not because everybody has to see the movie, but because I'm not going to be told we can't see the movie. That's the most important part. 'We cannot be told we can't see something by Kim Jong-un, of all f****** people.' As for his motivation in standing up against the cyberhack and its aftershock, Clooney said he is trying to protect his own artistic freedoms, as well as those of his peers. 'Frankly, I'm at an age where I'm not doing action films or romantic comedies,' he told Deadline. 'The movies we make are the ones with challenging content, and I don't want to see it all just be superhero movies. 'Nothing wrong with them, but it's nice for people to have other films out there.' Workers removed a massive poster publicising The Interview in Hollywood after its release was cancelled. Fox has already pulled out of an unnamed thriller set in North Korea - that was to star Steve Carrell - as a result of the current hacking scandal. A number of cinemas that planned to show a controversial 2004 movie, Team America: World Police, instead of The Interview have now been forced to cancel the screenings. Team America, from South Park creators Trey Parker and Matt Stone, features Kim Jong Un's father, Kim Jong Il, as a singing marionette. At the end of the film, the leader's head explodes. Cleveland's Capitol Theatre said its long-planned Team America screening was canceled Thursday by Paramount Pictures, the studio that released the film. Paramount have declined to comment. Controversial: A handful of theaters across the U.S. have cancelled screenings of Team America - the 2004 puppet comedy that parodies former North Korea leader Kim Jong Il - they planned to run in place of The Interview. The actor emailed Mother Jones and said:. 'This week, the distributors who wouldn't show The Interview and Sony have sent ISIS a commanding invitation. I believe ISIS will accept the invitation. Pandora's box is officially open. The damage we do to ourselves typically outweighs the harm caused by outside threats or actions. Then by caving to the outside threat, we make our nightmares real. The decision to pull The Interview is historic. It's a case of putting short term interests ahead of the long term. If we don't get the world on board to see that this is a game changer, if this hacking doesn't frighten the Chinese and the Russians, we're in for a very different world, a very different country, community, and a very different culture. I'm not sure the world has come to terms with all the implications of the hacking. I was in Liberia and Sierra Leone right at the beginning of the Ebola outbreak in April. It did seem to those of us there that the response was neither coming swiftly or with a true sense of urgency. This feels the same. This matter should be before the UN Security Council today.' Oscar-winning screenwriter Aaron Sorkin criticized the reaction to the Sony situation: 'Today the U.S. succumbed to an unprecedented attack on our most cherished, bedrock principle of free speech by a group of North Korean terrorists who threatened to kill moviegoers in order to stop the release of a movie.' The White House has described the cyber attack on Sony Pictures as a serious matter of national security. White House spokesman Josh Earnest declined to confirm reports that North Korea had attacked the movie giant, which pulled the film after hackers invoked September 11, 2001 in threatening attacks on cinemas. But, in a sign US intelligence believes the attack came from an enemy of the United States, he said: 'The president considers this to be a serious national security matter.' He continued: 'There has been destructive activity with malicious intent, and the administration believes that that activity merits an appropriate response from the United States.' Bruce Bennett, senior defence analyst with the RAND corporation believes action against the hackers is necessary. He said: 'A weak response will only embolden North Korea and lead to more serious attacks, even if it is not proven to be the culprit.' North Korea has denied involvement in the brazen November 24 cyber attack, which experts say could have been carried out by disgruntled Sony workers or by supporters of a foreign power. Former presidential nominee Senator John McCain criticised Sony for backing down, a few days after the so-called Guardians of Peace hacker group threatened cinema-goers. He said: 'By effectively yielding to aggressive acts of cyber-terrorism by North Korea, that decision sets a troubling precedent that will only empower and embolden bad actors to use cyber as an offensive weapon even more aggressively in the future.' Former House Speaker Newt Gingrich said this week's events should sound alarm bells. 'With the Sony collapse America has lost its first cyberwar. This is a very very dangerous precedent.' Criticized: Oscar-winning screenwriter Aaron Sorkin (right) attacked the threats on moviegoers. He is pictured here with embattled Sony boss Amy Pascal, one of the worst-effected from the email hacks. On November 24 of this year, Sony Pictures was notified that it was the victim of a cyber attack, the effects of which is the most chilling and devastating of any cyber attack in the history of our country. Personal information including Social Security numbers, email addresses, home addresses, phone numbers and the full texts of emails of tens of thousands of Sony employees was leaked online in an effort to scare and terrorize these workers. The hackers have made both demands and threats. They demand that Sony halt the release of its upcoming comedy The Interview, a satirical film about North Korean dictator Kim Jong Un. Their threats vary from personal—you better behave wisely—to threatening physical harm—not only you but your family is in danger. North Korea has not claimed credit for the attack but has praised the act, calling it a righteous deed and promising merciless measures if the film is released. Meanwhile the hackers insist in their statement that what they've done so far is only a small part of our further plan. This is not just an attack on Sony. It involves every studio, every network, every business and every individual in this country. That is why we fully support Sony's decision not to submit to these hackers' demands. We know that to give in to these criminals now will open the door for any group that would threaten freedom of expression, privacy and personal liberty. We hope these hackers are brought to justice but until they are, we will not stand in fear. We will stand together

Summary: George Clooney circulated a petition to support the film 'The Interview' He said Hollywood stars and studios were afraid of possible retribution. Clooney said 'we cannot be told we can't see something by Kim Jong-un' The White House described the cyber attack as a 'national security issue' Newt Gingrich admitted that 'America has lost its first cyber-war' Sean Penn says 'Pandora's Box is open' and ISIS will follow example. Penn wants the United Nations Security Council to intervene.

cnn_dailymail

en

Summarize: Bryn Parry-Jones was given a £90,000 Porsche as part of his contract with Pembrokeshire County Council. A shamed council boss at the centre of a row over misuse of public money drove a taxpayer-funded Porsche that his employers kept secret for eight months. Bryn Parry-Jones, 62, was provided with the £90,000 sports car to drive to and from work despite massive cuts to public services in his area. But the council refused to reveal the perk, despite repeated information requests by journalists, for eight months – citing ‘privacy’ reasons. Last night the former chief executive was facing a growing row over his use of public money after details of his lavish lifestyle were exposed. Mr Parry-Jones, whose £195,000-a-year salary made him the highest-earning official in Wales, has been repeatedly accused of abusing taxpayers’ money while heading cash-strapped Pembrokeshire County Council. Earlier this year he was handed a £280,000 ‘golden goodbye’ despite the fact he had been forced to quit over an unlawful payments scandal. Details of his car, a perk which cost around £900 a month to lease, only emerged this week after a long Freedom of Information battle with the council. Insiders said the extravagant expense had ‘stuck in the craw’ of cash-strapped council workers who knew about it for months. Yesterday, campaigners and politicians hit out at the ‘offensive waste of money’ at a time when the council was making cuts to local services. Earlier this year, Pembrokeshire Council revealed it would have to make savings of £20million over two years. Proposed measures include closing public toilets, charging for social services and increasing parking fees. Council tax rose by 3.4 per cent this year. Stephen Crabb, Welsh secretary and Pembrokeshire MP, said: ‘These kinds of lavish car deals for council officials, alongside salary and other perks, stick in the throats of people – especially at a time when there is huge pressure on spending.’ The average salary in the county last year was £21,587. Jonathan Isaby, of the Taxpayers’ Alliance, added: ‘At a time when the council is trying to find savings, it’s particularly galling that local residents have been taken for such an extortionate ride.’ Mr Parry-Jones, who led the council for 18 years, was given an allowance to run a company car as part of his generous remuneration package. It is understood he took out a lease on the hybrid electric Porsche Panamera in March this year. Journalists first began requesting details of the car under the Freedom of Information Act in April, but the council said it must be kept secret because it was ‘private’. The expensive sports car was part of the 62-year-old's'remuneration', according to county officials. It was leased by the council and has been returned since Mr Parry-Jones left his position earlier this year. It was only this week, after he left with his enormous pay out, that the council, run by the Independent Plus Group, revealed details. Conservative councillor David Bryan said the Porsche was known about within the council and had ‘stuck in the craw’ of council workers facing ‘drastic pay cuts’. Paul Miller, who leads the opposition Labour group on the council, added: ‘He was a dictator and it got to the point where he thought he could do whatever he wanted.’ A council spokesman said: ‘Mr Bryn Parry-Jones was entitled to a lease car as part of his remuneration package.’ Mr Parry-Jones quit his post as chief executive in October, ten months after it was revealed he received more than £45,000 in cash payments in lieu of pension contributions. The Wales Audit Office said the payments were ‘unlawful’, although a police investigation concluded that no further action should be taken. Mr Parry-Jones finally stepped down after a vote of no confidence from the council – though councillors voted through a sizeable severance package. Mr Miller applied in vain for a High Court injunction against the pay-off. The council also said it would not be trying to reclaim the £45,606 cash payment. Mr Parry-Jones, who lives in Letterston, Pembrokeshire could not be contacted for comment last night. '

Summary: Bryn Parry-Jones oversaw thousands of cuts at Pembrokeshire Council. The 62-year-old was given a £90,000 Porsche Panamera in his contract. He left the position earlier this year with a £280,000 severance package. Public petition called for his resignation over 'corruption' in council. More than 1,000 staff faced pay cuts under his leadership last year.

cnn_dailymail

en

Summarize: This application is a continuation-in-part of application Ser. No. 11/833,970 filed on Aug. 3, 2007 now abandoned, which claims priority under 35 U.S.C. §119(e) from U.S. Provisional Patent Application Ser. No. 60/835,048 filed on Aug. 3, 2006, which applications are incorporated herein by reference in their entireties. BACKGROUND OF THE INVENTION Field of the Invention The present invention relates to golf clubs. More particularly, it relates to a scalable—unconventional approach for adjusting the weight distribution within a golf club&#39;s head, particularly a driver, fairway woods, iron or putter. Background Art The USGA governing body has allowed for the adjustments of weights within a golf club&#39;s head as part of fulfilling the criteria of approved conforming golf clubs. Many manufacturers have resorted to a very basic approach to capitalize on the advantage of adjusting the center of gravity (COG) within a club&#39;s design by simply interchanging ‘nuts and bolts’ on the golf club&#39;s head or affixing weights in areas of advantage in the club head. The problem with these approaches is that each time a user desires to adjust the COG within his club&#39;s design, the player must remove weighted elements from the club to do so or select a different club, which has a different playing characteristic. The former calls for the replacement or substitution of the removed parts in order to “guesstimate” the COG. Despite best effort, the COG variations are limited in both scenarios and determined by the finite number of nuts and bolts available for a particular club or manner in which the weights can be adjusted, added or subtracted. Moreover the removal of these nuts and bolts are time consuming, require specialized tools and calls for exhausting trial and error before the desire results can be achieved. When an undesired effect is appreciated, the player must tackle the golf club numerous times by interchanging a multiplicity of ‘nuts and bolts’ as before, carefully recalling ‘what goes where’ etc. In other examples, manufacturers have created open “burrows” confined to the sole of the club head and have utilize a two dimensional (2D) approach to adjust the COG in that location only. Moreover, a single port of entry and exit to add and subtract weights to the club head can be seen in, for example, United States Patent Publication 2006/0122004 of Chen et al. Further the “burrows” are left opened to the elements thereby potentially affecting the club&#39;s functionality during play. For example, debris can become stuck in a part of the “burrow” which may affect the club&#39;s COG to some degree. These limitations mentioned here and to be mentioned later are all considered to be drawbacks for a versatile golf club, which adheres stringently to the USGA&#39;s rule. U.S. Pat. No. 6,015,354 to Ahn et al. teaches a method to change the weight of a golf club&#39;s head to affect the COG. In Ahn et al., the removal and replacements of weights are stressed in all the cases, and the weights move across a two-dimensional plain as in the prior example. In United States Patent Publication No. 2004/0242343, Chao et al. describe a method of interchanging and substituting weights within a golf club&#39;s head. The mass is generally changed when this is done. As before, the invention is limited in its design and function. Weights can only be fixed into a predetermined location and their removal is required for adjustments of the COG with the use of specialized tools. The position of the COG is severely restricted by this very basic approach. Moreover a multiplicity of weights cannot be removed or substituted at the same time. In United States Patent Publication No. 2006/0122004, Chen et al. describe a method for placing weights in a “trough” located in the “back” of a club head, having a “larger width” and “insertion hole.” This approach limits the true dynamics of achieving versatile center of gravity, aesthetics or the ability to position the club&#39;s weight in a location of appreciable benefits; such as on the complexed countoured surface of the sole (without thickening the club) or along the outer perimeter of the club&#39;s head, which when achieve greatly maximizes the club&#39;s performance and versatility. As noted before there is a Single limited access (port of entry) for weight addition and removal at any given time. Moreover the weight is confined to a two-dimensional plain; has more than two components and locks using a pressure expansion-contraction system which secure the weights into the depths of the club volume, instead of outwards, and towards the surface or perimeter. These features do not ensure reliable performance and may pose a danger or liability if broken or snapped during play. A noticeable drawback once again is that it takes a considerable amount of time to modify the COG in the likes of Chen, Ahn and Chao et al. SUMMARY OF THE INVENTION It is an object of the invention to provide a golf club with an adjustable center of gravity, moment of inertia and variable equilibrium. It is another object of the invention to permit the substitution of a given set of weights as a group instead of individually. A further objective is to have a given number of weights permanently fixed to the club&#39;s head, thereby negating the need to substitute weights, and thus maintaining a constant, fixed mass. The club&#39;s center of gravity is adjustable simply by relocating the number of given weights along a given three dimensional (3D) path/track or tracks, affecting its center of gravity and moment of inertia. Weights may be configured within a cover. Removal of one or more weights can take place simultaneously (to affect the MOI/COG) by simply removing the cover located on at least part of the surface of the golf club head, and replacing the cover with another cover with different weight placement, but optionally, with the same total weight. The present invention overcomes these inconveniences and promotes advancements by providing a way to conform to the USGA rule by making the golf club “plain in design” while honoring USGA rule #4 c by providing an option to allow the golf club&#39;s weights to be easy to adjust during training, but difficult to manipulate during regulation play; individual weight can be adjusted with the use of a coin or divot in one of several embodiments. A relatively plain cover is provided which will prevent improper movement during regulation play in one of several embodiments. Weights can be added to the golf club&#39;s head by removing the cover plate from the club&#39;s head/body, allowing easy access to the tracks to then add or subtract one or more weights simultaneously or individually. Another object and further enhancement of the invention is to provide a golf club, which is literally “plain in shape” as per USGA rules 4. In so doing, a smooth finish cover, made of opaque, translucent or transparent material, is provided to fit over the sole or perimeter in a complimentary way without adding or taking away from the club&#39;s overall shape. This cover may serve as a protection from the elements for the moveable weights and which can be securely and semi-permanently or permanently fixed to the golf club&#39;s body by a specially designed screw or lock mechanism that requires specialized tools for removal as dictated by the USGA. In other embodiment of the invention classified as drivers and woods a series of separate or interconnecting recesses may be created in the sole of the club head in a three dimensional configuration. Individual spherical weights may be placed in each of the recesses and may be secured and protected by a cover as described. The cover may have slits to allow for the spheres to be further secured thereto by a frictional means along any given point of the recess. In so doing, the weights are not secured into the recesses and restricted to finite locations as seen in Chen &amp; Chao et al.; instead they are levitated and secured onto the removable cover/sole of the club head. In additional embodiments for the driver variety of the invention, the recesses for the weights are incorporated into the sole of the removable cover, situated at least partially on the sole of the club head. As before in the second embodiment, slits are provided to allow easy access and manipulation of the underlying spherical weights to be adjusted in a three dimensional orientation, close to the surface of the club. Other clubs within the golfer&#39;s array of approved (hybrids) or non-conforming clubs may be fashioned by design to incorporate the benefits of this invention. Henceforth, a putter or an iron or fairway woods or hybrid club can be designed to have moveable weights according to the scope of this invention. Innovations specific for the so call irons and putter may have weights movable behind the club face and linked to the club handle via a cable, rod, axle or hydraulic means. By inserting a specialize key into the top of the golf club handle, the weights can be adjusted toward the heel or toe using such means coupled with a compressible and expandable spring member or members engineered to effect movement of the weight. Further, the back or the club face may have a transparent or translucent cover to reveal at least a portion of the movable weight located in the head structure. In another embodiment, the club shaft may be removed from the hosel and the movement of the weight in the club head may be accessed from within the hosel by turning the cable, rod, “worm” or using a hydraulic mechanism to move the weight towards the heel or forward to the toe of the club head. Further, the club shaft can be engineered to affect the movement of weights as described. For example the shaft can be made to turn clockwise or anticlockwise or pushed up or down to affect the movement of the weights in the club head as described. Yet still in other embodiments, the weights may be accessed from the heel or toe region of the golf club head In accordance with the invention, golf club heads are provided with a scalable systems of weights which allows for a precision and convenient adjustment of the COG without having to remove, switch or change weights from a golf club&#39;s head, or change the club&#39;s orientation to access the weights in the club head. The invention is an advanced golf club technology, which allows the movement of weights in three dimensions, that is, across a three dimensional surface, having complex slopes or curves. Moreover, the tracks or recesses, which house the movable weights, can be in a plate or cover which is detachable from the club head. The tracks can be designed to be connected to each other or separated as individual entities. The removable plate structures is preferably designed for the sole and perimeter portion of the golf club, even though it can be fabricated for the entire club surface. To traverse the complex contours of a golf club&#39;s head, the weights can have the shape of a sphere or globe, coupled with a screw member of various designs and finishes. The weight can have a biasing knob member, which limits its ability to turn left, right, up or down to approximately 90 degrees. BRIEF DESCRIPTION OF THE DRAWINGS The foregoing aspects and other features of the present invention are explained in the following description, taken in connection with the accompanying drawings, wherein: FIG. 1 is a prospective view of one embodiment of a golf club in accordance with the invention. FIG. 2 is a simplified, cross-sectional schematic view taken through the golf club of FIG. 1, showing a weight. FIG. 3 is a partially exploded view of a golf club of FIG. 1, with the cover removed. FIG. 4 is similar to FIG. 1, but illustrates a different track configuration on the perimeter and sole. FIG. 5 is an enlarged, detailed schematic cross-sectional view of a portion of the 3D weight showing surface orientation. FIG. 6 is an enlarged, perspective view of another embodiment of the invention, showing three dimensional track in the club head. FIG. 7 is an enlarged, perspective view of a cover with tracks for the embodiment of the invention of FIG. 6. FIG. 8 is an exploded view showing a cover with slit in the tracks. FIG. 9 is a plan view of the embodiment of FIG. 8, with the cover of FIG. 8 in place and with weights. FIG. 9A is a plan view similar to FIG. 9, with the cover removed and the weights in place. FIG. 9B is a perspective view of an embodiment with interconnected tracks in the cover. FIG. 10 is a partially cut away view of yet another embodiment of the invention, showing a possible track configuration in a vertical plain, in the shape of an arch, wherein a horizontal arch (not shown) is also achievable. FIG. 11 is a second schematic illustration of a mechanism for adjusting the position of weights, similar to the embodiment of FIG. 10. FIG. 12 is a cut away view of a third embodiment of a iron or putter in accordance with the invention. FIG. 13 is a cross-sectional view taken generally along line 13 - 13 of FIG. 12. FIG. 14 is a top view of the hosel illustrated in FIG. 13. FIG. 15 is a back elevational view of, the embodiment of FIG. 13, illustrating another feature (transparent window) of the invention. FIG. 16 is a schematic view of another embodiment of an iron or putter in accordance with the invention, which shows a spring actuated weight system. FIGS. 17A, 17B and 17C are views of a weight adjusting key for a screw head of a weight in accordance with the invention. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Referring to FIG. 1 there is shown a perspective view of a golf club 16 having a head 17 and a shaft 18, incorporating features of the present invention. Although the present invention will be described with reference to the embodiments shown in the drawings, it should be understood that the present invention can be embodied in many alternate forms of embodiments. In addition, any suitable size, shape or type of elements or materials could be used. The type of golf club illustrated in FIG. 1 is a generally referred to as a “wood”, and has a lower surface or sole 19. In accordance with general scheme of the invention, an interconnected series of tracks X, Y and Z define passageways for a movable series of weights each designated as 20, which may be positioned along tracks X, Y and Z. Each weight 20 may have a mass of, for example, 6 grams. The series of tracks X, Y and Z follows the contour of sole 19, and in general, defines a three-dimensional contour. Thus, not only can the weights be moved from one track to another, but they can be moved in three dimensions due to the three-dimensional nature of the tracks. While more weights may be added, it is preferable that the total mass be constant, and that the positions of the weights 20 be adjustable. Referring to FIG. 2, each of tracks X, Y and Z has associated with it a channel 21 in which a lower portion 22 of weight 20 is disposed. Portion 22 is configured with a threaded blind hole 23 for receiving a mating threaded extension portion 24 of an upper portion 25 of weight 20. Upper portion 25 may also have protruding slightly from it a generally spherical portion 26 having a slot 27 for receiving a tightening tool, such as a screwdriver (not shown), for rotating upper portion 25 with respect to lower portion 22, as represented by circle 28 to grip between them outer layer 29 of sole 19, thereby securing weight 20 against unwanted movement along a track, but permitting it to be released for placement at a different position along a track. It will be understood that the upper surface of lower portion 22 may be treated with a non-skid material, or have some covering so that when in contact with the inner surface of outer layer or wall 29 of sole 19, it is prevented from easily moving, therefore facilitating tightening by rotating spherical portion 26. Referring to FIG. 1 and FIG. 3, a cover 30 is advantageously contoured to fit over sole 19, and is secured to head 17 by a securing mechanism 31, such as a screw 32 having a head 33 designed to be turned by a specialty tool (not shown). The end of screw 32 is received in a threaded hole 33 in a recess 34. Cover 30 may be formed from a transparent engineering plastic, such as a polycarbonate, thus allowing the user of golf club 16, or any other interested individual, to observe the positions of weights 20, and to verify, if desired, that they have not moved from a previously set position. Cover 30 is placed on and removed from head 19 in the directions illustrated by arrows 37. FIG. 4 illustrates another embodiment of the invention, wherein like components have reference numerals as in FIG. 1 and FIG. 3, but with the suffix “A”. This embodiment has a series of interconnected tracks X′, Y′ and Z′, as well as an additional track Q. Track Q may extend parallel to the periphery of sole 19 A of head 17 A, in the illustrated embodiment has three eight gram weights 20 A, which may be positioned along its length. FIG. 5 illustrates another possible configuration for the weights 20 or 20 A. Like components have reference numerals as in FIG. 2, but with the suffix “A”. A screw 40 has a head 42 and a threaded portion 44 that extends into a mating threaded blind hole 46 in a spherical mass 48 (having a diameter of, for example, 1.0 cm and formed of a metal; lead, tungsten, iron or steel), which fits within a channel 21 A associated with a track such as track Q. Mass 48 is prevented from turning within channel 21 A more than a limited amount by a spherical protrusion 50 that hits the walls 52 of channel 21 A. Head 42 may be caused to rotate by a suitable tool (not shown in FIG. 5 ) causing screw 40 to move into and out of mass 48, as represented by arrows 54. The outer layer or wall 29 A of sole 19 A may have a thickness of approximately 0.4 mm. The configuration of FIG. 5 has the advantage, due to the spherical nature of mass 48, of providing sufficient clearance from the wall of a channel to allow weights 20 A to be positioned along tracks in convex or concave surfaces. Referring to FIGS. 6 and 7, another embodiment of the invention is illustrated wherein like components have reference numerals as in FIG. 1 and FIG. 3, but with the suffix “C”. Instead of receiving movable weights directly within the body of head 17, as in FIG. 1, weights 20 C are received in tracks X″, Y″ and Z″ of a cover 70 ( FIG. 7 ) for a portion of the sole 19 C of head 17 C. The outer periphery of cover 70 is received in a slight recess 60 in sole 19 C. Lower portions of weights 20 C are received in channels 21 C defined in thicker portions of cover 70 associated with tracks X″, Y″ and Z″. These thicker portions are received in channels 62, 64 and 66 in head 17 C, when cover 70 is placed on head 17 C ( FIG. 6 ). If necessary or permitted by appropriate rule, recesses 67 and 68 may be filed with an appropriate material of a density needed to provide a specific weight. Referring to FIGS. 8, 9 and 9A, wherein like components have reference numerals as in FIG. 1 and FIG. 3, but with the suffix “D”, in a preferred embodiment, weights may be configured as in FIG. 5, wherein screws have heads 42 D and a threaded portion that extends into a mating threaded blind hole in a spherical mass 48 D (having a diameter of, for example, 1.0 cm and formed of tungsten or steel), which fits within one of channels 62, 64 and 66, formed in head 17 C, when cover 70 is placed on head 17 D, as illustrated being placed, and placed thereon in FIGS. 8 and 9, respectively. Hollow recess 67 and 68 may be provided in head 17 C to provide proper weight. Again, if necessary or permitted by appropriate rule, recesses 67 and 68 may be filed with an appropriate material of a density needed to provide a specific weight. The heads 42 D of the screws for the weights may be turned by a specialty tool for purposes of loosening the screws to allow movement and tightening the screws to fix weights 20 C in place, as discussed above. A different tool or key, having three prongs at its end, as illustrated in FIGS. 17A, 17B and 17C may be used for the different heads of weights 20 D of the embodiment of FIGS. 9 and 9A. The cover 17 D may be secured to head 17 D by securing mechanisms 31 D similar to 31 of FIGS. 1 and 3, as described above. In the golf club of FIG. 9B, tracks 62, 64 and 66 in the cover are interconnected so that a weight 20 E can be moved from one track to another. The embodiments of the invention described with respect to FIG. 6 to FIG. 9 have a major advantage. A golfer may adjust the position of the weights, and then remove the cover, and replace it with another cover with the weights secured in different positions. Thus, if the golfer has several favorite configuration of weights for specific positions of the COG, of specific moments of inertia, each cover, and its associated weights can effectively “store” that information, without the golfer having to laboriously reposition the weights, which can lead to inaccuracy in positions, and the need for much trial and error, until a favorite configuration is re-established. It is even possible for a golfer using a set of clubs in accordance with the invention, that are not the golfer&#39;s own, to simply bring along a cover with weights appropriately positioned, and to install the cover prior to beginning a game or practice session. FIG. 10 illustrates a golf club 16 E generally in the form of an iron, having a head 17 E and shaft 18 E. Head 17 E has hollow portions 92, 94, 96 and 98, separated by shaped weights 90, 100 and 110. An arbitrary number of movable weights 20 E, of the type illustrated in FIG. 5 (or of a type described elsewhere herein), may be moved and then secured in position along an arcuate channel 21 E, having an associated track (not shown in FIG. 10 due to its cut away nature) at arbitrary positions along channel 21 E. In FIG. 10, there are four weights 20 E at positions corresponding to lines A, B, C and D. The arcuate nature of channel 21 E, and the fact that in most irons, the surface of head 17 E is at an acute angle with respect to the shaft 18 E, causes the weights to effectively move in a three dimensional path from the toe to the heel of the head 17 E. Advantageously, one or more weights may be positioned behind the ideal impact area or “sweet spot” of the face of the iron or putter. FIG. 11 is a schematic illustration of a mechanism for adjusting the position of weights. Golf club 16 F has head 17 F and shaft 18 F. A weight 122 in a channel 123 within head 17 F is connected to a flexible rod 124. A series of spacers 127 a, 127 b, 127 c, 127 d, 127 e and 127 f (six spacers are shown, but more may be placed along the interior length of shaft 18 F) define a passageway within shaft 18 F through which rod 124 may move. A knob 130 having a blind, threaded hole 126, accepts the threaded end 124 A 126 of rod 124. Knob 130 is fixed at the end of shaft 18 F, but may rotate with respect to shaft 18 F. A slot 128 may receive the blade of a screwdriver (not shown) to rotate knob 130. Such rotation causes the end of rod 124 to move into or out of knob 130 (depending on the direction of rotation), thus causing motion of weight 122 within channel 123 through a maximum distance: Δ F 2= F 3− F 1, where: F3 is the length of channel 123, and F1 is the length of weight 122. Channel 123 can be an arcuate channel, as in FIG. 10. Weight 122 may be an array of weights for movement along channel 123. Referring to FIG. 12 and FIG. 13, an iron or putter shown generally as 131 has a head 135 and a shaft 139. A generally cylindrical weight 136 is designed to slide along the bottom 158 of a hollow portion 150 of head 135 in the directions indicated by arrow 157. Weight 136 is configured with thread like groves 162 which engage a worn gear 156, which is driven to rotate clockwise or counter clockwise, as indicated by the arrows 160, by a conical gear 155 at the end of worm gear 156. Conical gear 155 engages a conical gear 154, which is in turn caused to rotate by a rod 141 a. Rod 141 a may extend to the gripping portion of shaft 139, and be rotated clockwise or counterclockwise, as represented by arrow 161, to thus cause weight 136 to move within hollow portion 150 of head 135, in response to rotation of a knob as described with respect to FIG. 11, or other appropriate mechanism. Referring to FIG. 13 and FIG. 14, alternatively, the shaft 139 may be removed from the hosel 165 of head 135 to expose a disk 153 mounted for rotation when a key (not shown in FIG. 13 ) is inserted into an opening 158 in disk 153, and the key is rotated, thus changing the position of weight 136 within head 135. As a further alternative, a knurled edge of disk 153 may extend from a slot in hosel 165, allowing its rotation by the action of the finger of a user, without the need to remove shaft 139. In general, it will be appreciated that the position of the weight 136 may be controlled from the shaft of the golf club, or the handle of the golf club. For example, in yet other embodiments, the shaft, or a handle portion of the shaft, may be rotated with respect to the head, in order to rotate a gear which changes the position of weight 136 within head 131. It is possible for the shaft to be configured at its bottom with teeth that engage a conical gear affixed to the worm gear, so that when a set screw is loosened, the shaft can rotate with respect to the head, and thus cause the position of the weight to change. Referring to FIG. 13 and FIG. 15, a transparent window 134 may be provided to allow observation of the position of weight 136 as it is moved within head 135 between a position of low moment of inertia “L” to a position of high moment of inertia “H”, along a scale 167 having markings 169. The window may also be translucent, as long as the position of the weight, of a suitable color, can be visualized. Alternatively, the window 134 may be opaque, if it can be removed for adjustment and inspection of the position of weight 136 within head 135. In FIG. 16, weight 136 is urged into the high moment of inertia position by a spring 172. A wire 141, that loops around a pulley wheel 171, is connected to weight 136, and can be moved to thus move weight 136 by compressing or decompressing spring 172. The end of wire 141 not connected to weight 136 is connected to a take up mechanism 173, operated by a rotating disk 174, within shaft 139. Disk 174 may be rotated when a key (not shown in FIG. 16 ) is inserted into an opening 178 in disk 174, and the key is rotated, thus changing the position of weight 136 within head 135. FIGS. 17A, 17B and 17C illustrate a key useful with the invention. The key has three portions for being received in three corresponding portions of a screw head associated with a weight for use on a golf club. The key may also be used to turn a screw or screws to remove and replace the removable cover of some of the embodiments of the invention illustrated herein. Thus, in accordance with the invention, a golfer can utilize one or more variable or similar weights to achieve a desired equilibrium, COG, or moment of inertia while maintaining a constant or scalable mass. Moreover, the weights are engineered to be secured onto the complex surface/contour of the club head, thereby permitting the movement of one or more weights in a 2D or 3D (three dimensional) configuration. The invention also features one or more detachable plates/cover, which houses the various tracks containing the weights. Generally speaking, the invention allows the COG to be directed as close as possible to the surface of the club (namely the sole [bottom] and the rear). The continuously variable positioning of weights provides a nearly infinite combination of COG/MOI configurations. By being able to position the weights close to the perimeter (surface), the COG can be located/positioned close to the bottom (sole of the club). The unique design of the weight within the removable cover, and through the cover allows for the easy manipulation/adjustment and location of the spheres/weights. In addition, in accordance with the invention, the weights are positionable to the rear of the club (which again offers some advantages of COG) flexibility. It should be understood that the foregoing description is only illustrative of the invention. Various alternatives and modifications can be devised by those skilled in the art without departing from the invention. Accordingly, the present invention is intended to embrace all such alternatives, modifications and variances that fall within the scope of the appended claims.

Summary: A golf club having a head with a series of tracks forming a three-dimensional pattern; weights for positioning along the channels; and a mechanism for securing the weights at positions along the channels so as to customize center of gravity and moment of inertia. The channels can all interconnect to allow a weight to be moved from one to another. The club can include a removable cover for at least a portion of the surface to cover the channels and the weights. The weights can comprise a spherical member disposed in a channel; a member external to a surface of the head; and a coupling between the spherical member and the external member to allow the spherical member and the external member to capture between them a wall in which a track is formed. The channels may be in the removable cover, or below the removable cover, in the head.

big_patent

en

Write a title and summarize: SECTION 1. SHORT TITLE; REFERENCE. (a) Short Title.--This Act may be cited as the ``Alaska Native Claims Technical Amendments Act of 1999''. (b) Reference.--Whenever in this Act a section or other provision is amended or repealed, such amendment or repeal shall be considered to be made to that section or other provision of the Alaska Native Claims Settlement Act (43 U.S.C. 1601, et seq.). SEC. 2. COMMON STOCK TO ADOPTED-OUT DESCENDANTS. Section 7(h)(1)(C)(iii) of the Act (43 U.S.C. 1606(h)(1)(C)(iii)) is amended by inserting before the period at the end the following: ``, notwithstanding an adoption, relinquishment, or termination of parental rights that may have altered or severed the legal relationship between the gift donor and recipient''. SEC. 3. RELATION TO CIVIL RIGHTS ACT OF 1964. Section 29(g) of the Act (43 U.S.C. 1626(g)) is amended-- (1) by inserting ``(1)'' after ``(g)''; and (2) by adding at the end the following new paragraph: ``(2) Any corporation, partnership, joint venture, sole proprietorship, trust, or affiliate with which a Native Corporation or its affiliate engages in one or more commercial transactions that exceed a total of $20,000 in a calendar year shall, when in the course and scope of such commercial transaction, be within the class of entities excluded from the definition of `employer' by section 701(b)(1) of Public Law 88-352 (78 Stat. 253).''. SEC. 4. DEFINITION OF SETTLEMENT TRUST. Section 3(t)(2) of the Act (43 U.S.C. 1602(t)(2)) is amended by striking ``sole'' and all that follows through ``Stock'' and inserting ``benefit of shareholders, Natives, and descendants of Natives,''. SEC. 5. ALASKA NATIVE VETERANS. Section 41 of the Alaska Native Claims Settlement Act (43 U.S.C. 1629g) is amended as follows: (1) In subsection (a)(1), insert ``amended'' after ``promulgation of''. (2) In subsection (a)(1), strike ``subsection (b)'' and insert ``subsection (b)(1) or (b)(2)''; (3) In subsection (a)(1), insert ``and may submit an application for an allotment to the Secretary in accordance with the provisions of this section'' after ``December 18, 1971''. (4) Strike subsection (a)(2) and insert the following: ``(2) Allotments may be selected only from-- ``(A) lands that were vacant, unappropriated, and unreserved on the date when the person eligible for the allotment first used and occupied those lands; ``(B) lands in the National Petroleum Reserve- Alaska which the person eligible for the allotment used and occupied; ``(C) lands that were not vacant, unappropriated, and unreserved on the date when the person eligible for the allotment first used and occupied those lands, but which, prior to December 18, 1971, became vacant, unappropriated, and unreserved during the time that the person eligible for the allotment used and occupied those lands; or ``(D) lands that were not vacant, unappropriated, and unreserved on the date when the person eligible for the allotment first used and occupied those lands, but which became vacant, unappropriated, and unreserved after December 18, 1971, and remain vacant, unappropriated, and unreserved.''. (5) In subsection (a)(3)(B), insert ``, and not relinquished'' after ``provision of law''. (6) In subsection (a)(3)(C), strike ``Village or Regional'' and insert ``Regional, Village, Urban, or Group''. (7) In subsection (a)(3)(C), insert ``, and not relinquished'' after ``Corporation''. (8) In subsection (a)(3)(E), insert ``Federal'' after ``acquired''. (9) In subsection (a)(3)(I), strike ``, including but not limited to the following'' and all that follows through ``Cemetery sites''. (10) In subsection (a)(4), insert ``described in subsection (b)(1) or (b)(2)'' after ``A person''. (11) In subsection (a)(4)(B), strike ``(C)'' after ``section 11(a)(1)''. (12) In subsection (a)(4)(B), strike ''Park; and'' and insert ``Park; or''. (13) In subsection (a)(4)(C), insert ``, or lands withdrawn solely under section 17(d)(1) of this Act'' after ``lands''. (14) In subsection (b)(1), strike ``A person'' and insert ``Except as provided in paragraph (3), a person''. (15) In subsection (b)(1)(B), strike ``January 1, 1969 and December 31, 1971'' and all that follows through ``December 3, 1971'', and insert ``August 5, 1964, and May 7, 1975, and served on active duty for at least 6 months''. (16) In subsection (b)(2), insert ``(as defined pursuant to State law)'' after ``personal representative''. (17) In subsection (b)(2), strike ``who was'' and insert ``which decedent would have been''. (18) In subsection (b)(2), strike ``subsection (b)(1)'' and insert ``paragraph (1),''. (19) In subsection (b)(2), strike ``if, during'' and all that follows through ``prisoner of war.'' and insert ``under this section.''. (20) In subsection (b)(3)-- (A) insert ``previously applied for the same allotment,'' after ``No person who received an allotment,''; (B) insert ``application'' after ``pending allotment''; (C) strike ``receive'' and insert ``apply for''; and (D) insert before the period ``, other than a person acting in the capacity of a personal representative of an estate selecting an allotment pursuant to paragraph (2)''. (21) In subsection (e)-- (A) strike ``of this section'' and insert ``of the Alaska Native Claims Technical Amendments Act of 1999''; (B) strike ``of the Interior'' after ``Secretary''; (C) insert ``amended'' after ``Alaska Native groups''; and (D) insert ``as amended'' after ``rules to carry out this section''. (22) Add at the end the following new subsection: ``(f) Approval of Allotments.-- ``(1) In general.--Subject to valid existing rights, and except as otherwise provided in this subsection, within 18 months after close of the application period, the Secretary shall approve said application and issue a deed in accordance with the Act of May 17, 1906, which shall be subject to the same terms, conditions, and protections provided for such deeds. ``(2) Notification.--Upon receipt of an allotment application, but in any event, not later than 90 days after the close of the application period, the Secretary shall notify the State and all interested parties of the application and the land description contained therein, and any such party shall have 12 months following the close of the application period in which to file with the Secretary a protest as provided in paragraph (3). ``(3) Effect of protest.--Paragraph (1) shall not apply and the Native allotment application shall be adjudicated pursuant to the requirements of the Act of May 17, 1906 (Chapter 2469; 34 Stat. 197), this Act, and other applicable law, if, pursuant to paragraph (2)-- ``(A) a Native Corporation files a protest with the Secretary stating that the applicant is not entitled to the land described in the allotment application, and said land is withdrawn for selection by or has been conveyed to the Native Corporation pursuant to this Act; ``(B) the State files a protest with the Secretary stating that the land described in the allotment application is necessary for access to lands owned by the United States, the State of Alaska, or a political subdivision of the State of Alaska, to resources located thereon, or to a public body of water regularly employed for transportation purposes, and the protest states with specificity the facts upon which the conclusions concerning access are based and that no reasonable alternative for access exists; ``(C) a person or entity files a protest with the Secretary stating that the applicant is not entitled to the land described in the allotment application and that said land is the situs of improvements claimed by the person or entity; or ``(D) a person who resides in the vicinity of the land described in the allotment application files a protest with the Secretary stating that the land described in the allotment application is land subject to communal use. ``(4) Approval procedure.--Upon expiration of the 18 months following the close of the application period pursuant to subsection (a)(1), the Secretary shall-- ``(A) if no protest is timely filed, approve the application pursuant to paragraph (1); or ``(B) if a protest is timely filed, adjudicate the legal sufficiency of any such protest, and-- ``(i) if the protest is legally insufficient, approve the application; or ``(ii) if the protest is valid, issue a decision that closes the application and that is final for the Secretary.''. SEC. 6. APPLICABILITY OF NATIONAL WILDLIFE REFUGE RESTRICTIONS. Section 22(g) of the Act is amended by striking ``Notwithstanding'' and all that follows through ``of such Refuge.''. SEC. 7. ELIM NATIVE CORPORATION LAND RESTORATION. The Alaska Native Claims Settlement Act (43 U.S.C. 1601 et seq.) is amended by adding at the end the following new section: ``elim native corporation land restoration ``Sec. 42. (a) Findings.--The Congress finds that-- ``(1) approximately 350,000 acres of land were withdrawn by Executive Orders in 1917 for the use of the United States Bureau of Education and of the Natives of Indigenous Alaskan race; ``(2) these lands comprised the Norton Bay Reservation (later referred to as Norton Bay Native Reserve) and were set aside for the benefit of the Native inhabitants of the Eskimo Village of Elim, Alaska; ``(3) in 1929, an Executive Order deleted 50,000 acres of land from the Norton Bay Reservation, without the informed consent of the Native residents living on the Reservation, and the people of Elim believe this deletion violated the Act of March 3, 1927 (44 Stat. 1347); ``(4) there appears to have been only minimal consultation conducted by the United States Government with the inhabitants of Elim prior to this deletion of lands; ``(5) the lands were deleted from the Reservation for the benefit of others; ``(6) the deleted lands were not offered to be restored to the original Reservation when lands comprising the Reservation were made available to the Native inhabitants of Elim under section 19(b) of this Act at the time of passage of this Act; ``(7) the failure to replace these lands has been and continues to be a source of deep concern to the indigenous people of Elim; ``(8) until this matter is dealt with equitably, it will continue to be a source of great frustration and sense of loss among the shareholders of the Elim Native Corporation and their descendants; and ``(9) in light of the above, to replace the lands deleted in 1929 from the Norton Bay Reservation, which was established for the benefit of the inhabitants of the Village of Elim, 50,000 acres of land should be conveyed to the Elim Native Corporation. ``(b) Withdrawal and Availability for Selection.--The lands described in subsection (c) are withdrawn, subject to valid existing rights, from all forms of appropriation or disposition under the public land laws, including the mining and mineral leasing laws, for a period of 2 years from the date of enactment of this section, for selection by the Elim Native Corporation. ``(c) Lands Described.--The lands described in this section are within the boundary of a parcel of land in the vicinity of Elim, Alaska, more particularly depicted and designated `Temporary Withdrawal Area' on the map dated August 1, 1999, and entitled Land Withdrawal Elim Native Corporation Land Restoration. ``(d) Authorization To Select and Receive Title to Lands; Reservation of Easement.--The Elim Native Corporation is authorized to select and receive title to 50,000 acres of lands within the boundary of the lands described in subsection (c) to replace the lands deleted from the original Norton Bay Reservation. The Secretary is authorized and directed to receive and adjudicate a selection application filed by the Elim Native Corporation, and to convey the surface and subsurface estate in the selected lands to the Elim Native Corporation subject to the following rules, conditions, and limitations: ``(1) The Elim Native Corporation shall have 2 years from the date of the enactment of the Alaska Native Claims Technical Amendments Act of 1999 in which to file its selection of no more than 60,000 acres of land from the area described in subsection (c). The selection application shall be filed with the Bureau of land Management, shall describe a single tract adjacent to U.S. Survey No. 2548, Alaska, and shall be reasonably compact, contiguous, and in whole sections except when separated by unavailable land or when the remaining entitlement is less than a whole section. The Elim Native Corporation shall prioritize its selections made pursuant to this section at the time such selections are filed, and such prioritization shall be irrevocable. Any lands selected shall remain withdrawn until conveyed or full entitlement has been achieved. ``(2) The selection filed by the Elim Native Corporation pursuant to this section shall be subject to valid existing rights and may not supersede prior selections of the State of Alaska, any Native corporation, or valid entries of any private individual unless such selection or entry is relinquished prior to any selection by the Elim Native Corporation. Any lands held within the exterior boundaries of lands conveyed to the Elim Native Corporation shall have all rights of ingress and egress to be vested in the inholder and the inholder's agents, employees, co-venturers, licensees, or subsequent grantees, and such easements shall be reserved in the conveyance to the Elim Native Corporation. ``(3) The Bureau of Land Management shall reserve easements to the United States for the benefit of the public pursuant to section 17(b) of this Act in the conveyance to the Elim Native Corporation. ``(4) The Bureau of Land Management may reserve an easement for the Iditarod National Historic Trail in the conveyance to the Elim Native Corporation. ``(e) Finality of Selections.--Selection by the Elim Native Corporation of lands under subsection (d) and final conveyance of those lands to Elim Native Corporation shall constitute full satisfaction of any claim of entitlement of the Elim Native Corporation-- ``(1) with respect to its land entitlements under section 19(b); and ``(2) with respect to the extinguishment of the Norton Bay Reservation (as withdrawn by Executive Order No. 2508, dated January 3, 1917, as amended by Executive Order No. 2525, dated February 6, 1917).''. SEC. 8. CLARIFICATION OF LIABILITY FOR CONTAMINATION. The Act is further amended by adding after the section added by section 7 of this Act, the following new section: ``clarification of liability for contamination ``Sec. 43. Notwithstanding section 107 of the Comprehensive Environmental Response, Compensation, and Liability Act of 1980, or any other provision of law, no person acquiring any interest in land under this Act shall be liable for the costs of removal or remedial action, any damages, or any third party liability arising out of or as a result of any contamination on that land at the time that such land was acquired under this Act unless such person was directly responsible for such contamination.''.

Title: Alaska Native Claims Technical Amendments Act of 1999 Summary: Alaska Native Claims Technical Amendments Act of 1999 - Amends the Alaska Native Claims Settlement Act to authorize an Alaska Native to transfer Settlement Common Stock to a descendant notwithstanding an adoption, relinquishment, or termination of parental rights that may have altered or severed the legal relationship between the donor and recipient. (Sec. 3) Includes any corporation, partnership, joint venture, sole proprietorship, trust, or affiliate with which a Native Corporation or its affiliate engages in one or more commercial transactions that exceed $20,000 in a calendar year within the entities excluded from the definition of "employer" for purposes of application of the Civil Rights Act of 1964. (Sec. 4) Includes as a Settlement Trust any trust operated for the benefit of shareholders (current law), Natives, and descendants of Natives. (Sec. 5) Includes within lands authorized to be allotted to Alaska Native veterans lands: (1) in the National Petroleum Reserve-Alaska which the eligible person used and occupied; (2) that were not vacant, unappropriated, and unreserved when the eligible person first used and occupied such land, but which prior to December 18, 1971, became vacant, unappropriated, and unreserved during the time the eligible person used and occupied the land; or (3) that were not vacant, unappropriated, and unreserved when the eligible person first used and occupied such land, but which became vacant, unappropriated, and unreserved after the above date, and remain so. Makes eligible for such allotments Alaska veterans who served during the period between August 5, 1964, and May 7, 1975 (currently, the period between January 1, 1969, and December 31, 1971) and served on active duty for at least six months. Outlines allotment approval procedures, including the right to protest a proposed allotment. (Sec. 7) Withdraws for two years from all forms of appropriation under the public land laws certain lands in the vicinity of Elim, Alaska. Authorizes the Elim Native Corporation to select and receive title to 50, 000 acres of land within the withdrawn lands to replace lands deleted from the original Norton Bay Reservation by executive order in 1929. Outlines selection procedures. States that conveyance of selected lands shall constitute full satisfaction of Corporation claims to replacement lands. (Sec. 8) States that no person acquiring a land interest under the Alaska Native Claims Settlement Act shall be liable for contamination cleanup costs at the time the land was acquired unless such person was directly responsible for such contamination.

billsum

en

Summarize: CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims the benefit of U.S. Provisional Application Serial No. 60/279,267, filed Mar. 28, 2001. BACKGROUND AND SUMMARY OF THE INVENTION [0002] This invention relates to a bifold or V-type rake for forming cut crop material into a windrow, and more particularly to an internal opening and closing system and a splitter wheel arrangement for use in a rake of this type. [0003] In accordance with one aspect of the invention, a bifold or V-type rake includes a rear wheeled trolley adapted for movement along the ground, and a drawbar that extends forwardly from the rear trolley for connection to a towing vehicle such as a tractor or the like. A pair of rake arms extend forwardly from opposite sides of the trolley, and each rake arm is pivotably interconnected with the trolley for movement between an open, operative position and a closed, inoperative position for transport or storage. Each rake arm may include one or more ground-engaging wheels for supporting the rake arm forwardly of its pivotable interconnection with the trolley. Each rake arm includes a series of rake members, which may be in the form of rotatable finger wheel rakes, each of which is movable between an inoperative, raised position and a lowered, operative position in which the rake members are in engagement with the ground. An opening and closing mechanism is interconnected between the drawbar and each rake arm, for moving the rake arms between their operative, open positions and inoperative, closed positions. [0004] The opening and closing mechanism includes a pair of rear operating arms located one on each side of the drawbar, as well as a pair of front operating arms located one on each side of the drawbar. Each rear operating arm defines an outer end that is pivotably interconnected with an outer end defined by the front operating arm located on the same side of the drawbar. An actuator arm extends outwardly from the pivotable interconnection of each set of front and rear arms, and is engaged at its outer end with the rake arm. [0005] Each of the front and rear operating arms defines an inner end, each of which is pivotably mounted to a slidably movable arrangement that is guided for movement along an axis coincident with or parallel to a longitudinal axis defined by the drawbar. In one form, one or both of the slidably movable arrangements may be in the form of a sleeve or slider member that is slidably mounted to and guided on the drawbar. In another form, one or both of the slidably movable arrangements may be in the form of a telescoping portion of the drawbar. An extendible and retractable actuator assembly is interconnected between the drawbar and one of the slidably movable arrangements, for selectively imparting axial movement to one of the slidably movable arrangements relative to the drawbar. In one form, the rear operating arms are pivotably interconnected with a rear sleeve that is axially movable on a rear portion of the drawbar in response to operation of the extendible and retractable actuator assembly. The front operating arms are pivotably interconnected with a telescoping forward section of the drawbar, which is telescopingly movable from a forward end of the portion of the drawbar to which the extendible and retractable actuator assembly is secured. In this arrangement, retraction of the actuator assembly functions to move the sleeve forwardly on the drawbar, to pivot the rear operating arms outwardly and to cause the front operating arms to be drawn outwardly and the telescoping portion of the drawbar to be moved inwardly. This outward movement of the joint between each rear operating arm and front operating arm is operable to push the rake arm outwardly through the actuator arm, to attain the open position of the rake. Likewise, extension of the actuator assembly moves the sleeve rearwardly on the drawbar, to pivot the rear operating arms inwardly and to cause the front operating arms to be drawn inwardly and the telescoping portion of the drawbar to be moved outwardly. This inward movement of the joint between each rear operating arm and front operating arm causes the actuator arm to draw the associated rake arm inwardly to attain the inoperative, closed position of the rake. [0006] In another embodiment, the telescoping construction of the drawbar is eliminated, and each set of rear and front operating arms is pivotably interconnected with a sleeve or slider member which is guided for movement along an axis coincident with or parallel to the longitudinal axis of the drawbar. This embodiment functions similarly, in that retraction of the actuator assembly moves the rear inner ends of the rear and front operating arms together by movement of the sleeves or slider members toward each other on the drawbar, to move the joints between the rear and front operating arms outwardly to open the rake arms. Conversely, extension of the actuator assembly moves the inner ends of the rear and front operating arms apart by movement of the sleeves away from each other on the drawbar, to draw the joints between the rear and front operating arms inwardly to close the rake arms. [0007] In accordance with another aspect of the invention, a splitter wheel drawbar mechanism is adapted for interconnection with a drawbar for interconnecting a bifold or V-type rake with a tow vehicle such as a tractor. The splitter wheel drawbar mechanism includes a front drawbar section adapted for releasable engagement with the tow vehicle hitch, and a rear drawbar section that extends rearwardly and is interconnected with the trolley of the rake. The splitter wheel drawbar mechanism includes a pair of splitter rake members, such as rake wheels, which are oriented at an angle to each other so as to direct crop material in opposite directions as the rake is moved on the ground. Each rake member is movable between an inoperative, raised position and an operative, lowered position. In a preferred form, the splitter wheel drawbar mechanism includes a series of angularly offset drawbar sections that are interconnected together between the front and rear sections of the splitter wheel drawbar mechanism, and each splitter rake member is supported by one of the angularly offset drawbar sections in a predetermined angular relationship therewith, such that the offset nature of the drawbar sections functions to orient the splitter rake members opposite each other. The splitter wheel drawbar assembly further includes a lifting and lower arrangement for moving the splitter rake members between their inoperative, raised position and operative, lowered position. [0008] While both aspects of the present invention can be incorporated together into a bifold or V-type rake to enhance operation, it is understood that the aspects of the invention may be utilized separately from each other or in combination with other rake features, and that each functions to enhance rake operation on its own. [0009] Various other features, objects and advantages of the invention will be made apparent from the following description taken together with the drawings. BRIEF DESCRIPTION OF THE DRAWINGS [0010] The drawings illustrate the best mode presently contemplated of carrying out the invention. [0011] In the drawings: [0012] [0012]FIG. 1 is an isometric view of a bifold or V-rake incorporating the internal opening and closing mechanism of the present invention, showing the rake arms in an operative, open position; [0013] [0013]FIG. 2 is a top plan view of the rake of FIG. 1; [0014] [0014]FIG. 3 is a section view taken along line 3 - 3 of FIG. 2; [0015] [0015]FIG. 4 is an enlarged partial plan view with reference to line 4 - 4 of FIG. 2; [0016] [0016]FIG. 5 is a view similar to FIG. 1, showing the rake arms in an inoperative, closed position for transport or storage; [0017] [0017]FIG. 6 is a top plan view similar to FIG. 2, showing the rake arms in the inoperative, closed position of FIG. 5; [0018] [0018]FIG. 7 is an isometric view similar to FIG. 1, showing an alternative embodiment of an opening and closing mechanism for a bifold or V-rake in accordance with the present invention, showing the rake arms in an operative open position; [0019] [0019]FIG. 8 is a top plan view of the rake of FIG. 7, showing the rake arms in the operative open position; [0020] [0020]FIG. 9 is a view similar to FIG. 8, showing the rake arms in an inoperative, closed position; [0021] [0021]FIG. 10 is an enlarged partial top plan view, with reference to line 10 - 10 of FIG. 6, showing the splitter wheel drawbar mechanism in accordance with the present invention incorporated into the bifold or V-rake; [0022] [0022]FIG. 11 is a partial isometric view showing the splitter wheel drawbar mechanism of FIG. 10; [0023] [0023]FIG. 12 is a side elevation view of the splitter wheel drawbar mechanism of FIGS. 10 and 11, showing the splitter rake members in an inoperative, raised position; and [0024] [0024]FIG. 13 is a view similar to FIG. 12, showing the splitter rake members in an operative, lowered position. DETAILED DESCRIPTION OF THE INVENTION [0025] Referring to FIGS. 1 and 2, a bifold or V-rake 20 includes a rear trolley or frame assembly 22 having a transverse rear frame member 24 and a pair of wheels 26 rotatably mounted to a pair of depending legs 25, each of which extends downwardly from one of the ends of frame member 24. A pair of rake arm assemblies 28 are pivotably mounted one to each leg 25 of rear frame assembly 22. Each rake arm assembly 28 includes a rake arm 30 to which a series of rake members, in the form of finger wheel rakes 32, are mounted. Finger wheel rakes 32 are mounted to each rake arm 30 via pivot arms 33 in a conventional manner. Each rake arm assembly 28 includes a conventional lifting and lowering mechanism for moving rake wheels 32 between a raised position for transport and a lowered position for engagement with the ground. Each rake arm 30 may have a front wheel 34 at its forward end, as well as an intermediate wheel 36 located approximately midway between the forward and rearward ends of rake arm 30. [0026] In a manner as is known, each rake arm 30 is pivotably mounted to one of legs 25 via a rake arm mounting bracket assembly 38, for providing pivoting movement of each rake arm 30 about a vertical pivot axis between open and closed positions. Each rake arm mounting bracket assembly 38 is mounted to one of legs 25 toward its lower end. [0027] A drawbar assembly 44 extends forwardly from rear frame assembly 22. Drawbar assembly 44 includes a fixed rear section 46 and a sliding or telescoping forward section 48. Rear drawbar section 46 is fixed at its rearward end to a drawbar mounting bracket assembly 50 mounted to rear frame member 24. Rear drawbar section 46 is preferably in the form of an elongated tubular member which may be rectangular in cross-section and which defines an internal passage, although it is understood that any other satisfactory shape or configuration may be employed. [0028] Forward drawbar section 48 is mounted for sliding movement within the internal passage of rear drawbar section 46. Forward drawbar section 48 also is preferably in the form of an elongated tubular member, having a cross-section which enables forward drawbar section 48 to fit within the internal passage of rear drawbar section 46. A series of flat nylon bearings 52 (FIG. 3) are mounted within the internal passage of rear drawbar section 46, and cooperate to slidably engage the external surfaces of forward drawbar section 48, such that forward drawbar section 48 is slidably received within the passage defined by rear drawbar section 46. In this manner, forward drawbar section 48 is slidably movable in a telescoping manner relative to rear drawbar section 46, along coincident longitudinal axes defined by rear and forward draw bar sections 46, 48, respectively. [0029] As shown in FIG. 1, the forward end of forward drawbar section 48 includes a downwardly extending angled member 56 which extends between the front of an upper portion defined by forward drawbar section 48 and the rear end of a lower mounting section 58. A ground wheel 60 is mounted to mounting section 58, for supporting the front end of drawbar assembly 44. [0030] A front splitter wheel drawbar assembly 62 is located forwardly of mounting section 58. Referring to FIGS. 2 and 10, 2plitter wheel drawbar assembly 62 includes a front section 64 having a pair of hitch engaging plates 65 at its forward end, and a rear section 66 pivotably engaged with mounting section 58 via a transverse pin 68. Rear section 66 is located between a pair of side plates 69, secured to mounting section 58 and extending forwardly therefrom, and pin 68 extends through aligned openings in side plates 69 and a transverse passage associated with rear section 66, such that pin 68 defines a transverse pivot axis between mounting section 58 and splitter wheel drawbar assembly 62. Front section 64 and rear section 66 extend along coincident longitudinal axes, which are coincident with the longitudinal axis of mounting section 58 and parallel to the longitudinal axes of rear and forward drawbar sections 46, 48, respectively. [0031] Between front section 64 and rear section 66, splitter wheel drawbar assembly 62 includes front and rear oppositely angled offset frame members 70, 72, respectively. An angled intermediate frame member 74 extends between the rear end of front offset frame member 70 and the forward end of rear offset frame member 72. Angled intermediate frame member 74 is substantially perpendicular to the longitudinal axes of front and rear offset frame members 70, 72, respectively. A series of triangular gusset plates reinforce the connections of frame members 70 - 74. With this construction, splitter wheel drawbar assembly 62 defines a “zigzag” configuration when viewed from the top, as shown in FIGS. 2 and 10. A forward splitter rake wheel 76 is mounted to intermediate frame member 74, and a rear splitter rake wheel 78 is mounted to rear offset frame member 72. With this arrangement, forward splitter rake wheel 76 and rear splitter rake wheel 78 are substantially perpendicular to each other, and are symmetrical about the longitudinal axis or centerline of rake 20. Splitter rake wheels 76, 78 clear crop material from the center of the path of rake 20, and direct the crop material in opposite directions into the path of rake members 32 when rake 20 is pulled along the ground. [0032] Splitter rake wheels 76, 78 are pivotably mounted to frame members 74, 76 for movement between raised and lowered positions in a similar manner as rake wheels 32 mounted to rake arms 30. As shown in FIGS. 11 - 13, a pair of lifting and lowering cables 80, 82 are connected at one end to respective pivotable lifting and lowering arms 84, 86, which are pivotably mounted to front and rear frame members 70, 72, respectively. Forward and rear splitter rake wheels 76, 78, respectively, are rotatably mounted to the outer ends of respective lifting and lowering arms 84, 86. At the opposite end, cables 80, 82 are connected to the extendible and retractable rod of a lifting and lowering cylinder assembly 88 carried by front section 64 of splitter wheel drawbar assembly 62. Cables 80, 82 extend through a lower set of guides 90 mounted to front offset frame member 70, and a pair of elevated guides 92 mounted at the intersection of frame members 70 and 74 via an upstanding bar 94. From the lower one of elevated guides 92, cable 80 extends downwardly for connection to arm 84, and cable 82 extends from the upper one of elevated guides 92 along angled intermediate frame member 74 and through a guide 96 mounted at the intersection of frame members 72 and 74 via an upstanding bar 98. From guide 96, cable 82 extends downwardly for connection to arm 86. [0033] With the above-described arrangement, extension of the rod of cylinder assembly 88 introduces slack into cables 80, 82 to allow splitter rake wheels 76, 78 to be lowered by gravity into an operative position in engagement with the ground, as shown in FIG. 13. Retraction of the rod of cylinder assembly 88 tensions cables 80, 82 and functions to raise splitter rake wheels 76, 78 above the ground to an inoperative transport or storage position as shown in FIG. 12. [0034] Referring to FIGS. 1 and 2, a slider member or sleeve 102 is slidably mounted to rear drawbar section 46 at the rearward end of drawbar assembly 44. Sleeve 102 defines an internal passage within which rear drawbar section 46 is received, and is slidably movable along rear drawbar section 46. A hydraulic opening and closing cylinder assembly 104 has one of its ends fixed to rear drawbar section 46 forwardly of sleeve 102, and has the other of its ends fixed to slider member 102. In this manner, sleeve 102 is movable along rear drawbar section 46 in response to extension and retraction of the rod of cylinder assembly 104. [0035] An opening and closing mechanism 105 is interposed between drawbar assembly 44 and rake arms 30 for moving rake arms 30 between open and closed positions in response to operation of cylinder assembly 104 and movement of sleeve 102. Opening and closing mechanism 105 has a symmetrical, mirror image construction, and includes a pair of rear operating arms 106, a pair of joints 108, a pair of front operating arms 110 and a pair of links or actuator arms 112. [0036] Referring to FIGS. 1, 2 and 4, each rear operating arm 106 has a bifurcated construction and is mounted at its inner, rearward end to slider member 102 for movement about a vertical pivot axis. At its opposite outer, forward end, each rear operating arm 106 is connected to a joint 108 for movement about a vertical pivot axis. Each front operating arm 110 is connected at its outer, rearward end to joint 108 for movement about a vertical pivot axis, and is connected at its inner, forward end to forward drawbar section 48 for movement about a vertical pivot axis. An outwardly extending link or actuator arm 112 extends from each joint 108 and is connected at its outer end to one of rake arms 30 for movement about a vertical pivot axis. [0037] With reference to FIG. 4, each joint 108 is connected to its associated rear arm 106 via a pivot pin 114 that defines a vertical axis pivot connection between the inner end of actuator arm 112 and the outer, forward end of rear arm 106. A pivot pin 116 is connected between the outer, rearward end of each front operating arm 110 and the inner end of its associated actuator arm 112, and defines a vertical axis pivot connection therebetween. [0038] In operation, rake arms 30 of rake 20 are moved between an open position as shown in FIGS. 1 and 2, and a closed position as shown in FIGS. 5 and 6, as follows. When rake arms 30 are closed for transport as shown in FIGS. 5 and 6, the rod of cylinder assembly 104 is fully extended such that sleeve 102 is located in its rearwardmost position on drawbar assembly 44. In this position of sleeve 102, the outer, forward ends of rear operating arms 106 are positioned inwardly to their fullest extent toward drawbar assembly 44, which likewise places the outer, rearward ends of front operating arms 110 in their inwardmost position toward drawbar assembly 44 and causes maximum outward extension of telescoping front drawbar section 48 relative to fixed rear drawbar section 46. Actuator arms 112 are located in their full inwardmost positions, such that each rake arm 30 extends in a forward-rearward direction substantially parallel to drawbar assembly 44. If desired, a pair of conventional retainer arms may be connected between drawbar assembly 44 and rake arms 30 to maintain rake arms 30 in the closed position during transport. When rake arms 30 are closed in this manner, a minimum amount of overlap, shown at L 1 (FIG. 6), is provided between the rearward portion of forward drawbar section 48 and the forward portion of rear drawbar section 46. [0039] To open rake arms 30, the rod of cylinder assembly 104 is retracted so as to draw sleeve 102 forwardly on rear drawbar section 46, which functions to move the inner, rearward end of each rear operating arm 106 forwardly. This functions to increase the angle between each rear arm 106 and drawbar assembly 44, and to move the outer, forward end of each rear operating arm 106 outwardly away from drawbar assembly 44, as shown in FIGS. 1 and 2. Due to the configuration of each joint 108 and the offset relationship between pivot connections 114 and 116, this outward movement of the outer, forward end of each rear operating arm 106 simultaneously functions to draw the outer, rearward end of each front operating arm 110 outwardly, and to exert a rearward force at the pivot connection between forward drawbar section 48 and the inner end of each front operating arm 110. This causes rearward movement of forward drawbar section 48 within rear drawbar section 46, to retract or telescope forward drawbar section 48 into the internal passage defined by rear drawbar section 46. This rearward movement of forward drawbar section 48 enables outward movement of the outer, rearward ends of front operating arms 110. In addition, the outward movement of the outer, forward end of each rear operating arm 106 causes each actuator arm 112 to pivot outwardly due to the configuration of joint 108, such that the combined movement of actuator arms 112 and rear and front operating arms 106, 110, respectively, functions to apply an outward force to each rake arm 30 through actuator arm 112 to pivot each rake arm 30 about the pivot connection of rake arm 30 to bracket assembly 38. [0040] When cylinder assembly 104 is fully retracted so as to place rake arms 30 in their open position, forward drawbar section 48 is retracted into the internal passage of rear drawbar section 46 to attain a maximum amount of overlap as shown at L 2 (FIG. 2), which reduces the overall length of drawbar assembly 44. This shortening of drawbar assembly 44 functions to make rake 20 somewhat easier to handle and maneuver when being pulled in a field behind a tractor or the like so as to rake cut crop material. [0041] In an alternative construction as shown in FIGS. 7 - 9 wherein like reference characters are used to denote like parts and primed reference characters are used to denote modified parts, rake 20 ′ includes a drawbar assembly 44 ′ including a primary fixed-length drawbar member 118, which may be in the form of a series of drawbar sections fixed together in an end-to-end relationship so as to define a fixed length. A downwardly angled member 56 extends from the front end of drawbar member 118 for connection to the hitch of the tow vehicle, which may be by means of splitter wheel rake assembly 62. Sleeve 102 is slidably mounted toward the rearward end of drawbar member 118, and rear operating arms 106 are pivotably mounted to rear sleeve 102 in the same manner as discussed previously. At its forward end, each rear operating arm 106 is connected to one of joints 108 as described above, and actuator arms 112 extend outwardly from joints 108. Each actuator arm 112 is pivotably connected at its outer end to one of rake arms 30. Front operating arms 110 extend forwardly from joints 108, and each joint 108 has the same construction as described above. At its forward end, each front operating arm 110 is pivotably connected to a front slider member or sleeve 124 which is slidable relative to drawbar member 118 in the same manner as rear sleeve 102. Actuating cylinder assembly 104 is fixed at one end to drawbar member 118, and at its opposite end is mounted to rear sleeve 102. [0042] With the alternative construction as shown and described, rake 20 ′ is moved from its closed position of FIG. 9, in which rake arms 30 extend substantially parallel to drawbar member 118, to its open position of FIGS. 7 and 8 by retracting the rod of cylinder assembly 104. Such movement of the rod of cylinder assembly 104 draws rear sleeve 102 forwardly on drawbar member 118 to move the outer ends of rear operating arms 106 outwardly and to draw the inner ends of front operating arms 110 rearwardly. In this version, such rearward movement of the inner ends of front operating arms 110 draws front sleeve 120 rearwardly on drawbar member 118. In contrast to the embodiment of FIGS. 1 - 6, the length of drawbar member 118 in the embodiment of FIGS. 7 - 9 remains constant and sleeves 102, 124 move toward and away from each other on drawbar member 118. Actuator arms 112 function in the same manner as described above to push rake arms 30 outwardly and to cause pivoting movement about bracket assemblies 38, to place rake 20 ′ in the open position of FIGS. 7 and 8. Subsequent extension of the rod of cylinder assembly 104 moves rear sleeve 102 rearwardly on drawbar member 118, to pull the outer ends of rear operating arms 106 and front operating arms 110 inwardly. This causes forward sliding movement of front sleeve 124 along drawbar member 118, and inward movement of rake arms 30 through actuator arms 112. [0043] While the invention has been shown and described with respect to certain embodiments, numerous variations are possible and are contemplated as being within the scope of the present invention. For example, and without limitation, in the telescoping drawbar version of FIGS. 1 - 6, it is contemplated that operating cylinder assembly 104 may have one of its ends mounted to the extendible and retractable drawbar section for moving it inwardly and outwardly relative to the fixed drawbar section, rather than to the sleeve or slider member as shown and described. Further, it is contemplated that the sleeve or slider member could be located at the forward end of the drawbar assembly and the telescoping drawbar construction provided at the rearward end, with the extendible rod of the actuator assembly being engaged with either the sleeve or the telescoping drawbar section. It is also possible that the sleeve or slider member could be eliminated and that a dual telescoping drawbar construction could be provided, such that an extendible and retractable drawbar section is located both at the forward end and the rearward end of the drawbar assembly. In this version, both the front and rear operating arms are pivotably mounted to one of the extendible and retractable drawbar sections. This construction provides an even shorter overall length for the drawbar assembly when the operating cylinder assembly is retracted and rake arms 30 are positioned in their operative open position. [0044] In both versions, the operating device for the opening and closing mechanism is described as hydraulic cylinder assembly 104. It should be understood that any other type of movable operating device may be employed, such as a linear actuator, a rodless cylinder assembly, a manual or motor-operated screw-type mechanism, or the like. Further, while the rakes mounted to rake arms 30 are illustrated as finger wheel rakes, it is understood that rake arms 30 may carry any other type of raking devices such as basket-style rakes, tedder-type rakes, etc. [0045] In addition, the configuration of joint 108 is representative of any number of three-way pivoting joint arrangements which could be employed in the opening and closing system of the present invention. Any other types of joint configuration could function with the present invention, so long as the joint configuration provides pivoting movement of the outer ends of rear operating arms 106 relative to front operating arms 110, as well as incorporating the capability to push rakes arms 30 outwardly in response to a decrease in the angle defined between each rear operating arm 106 and its associated front operating arm 110. [0046] It is also understood that the rake arm supporting wheels, such as 34, 36, may be eliminated in rakes having a lesser number of rake wheels in which the rake arms can be cantilevered forwardly from the rake trolley. It is also understood that other types of ground-engaging rake arm supporting arrangements may be employed in place of the ground-engaging wheels such as 34, 36. [0047] Further, while rake 20 has been illustrated as including front splitter wheel drawbar assembly 62, it is understood that rake 20 may be used without splitter wheel drawbar assembly 62 or with a differently configured splitter-type arrangement for moving crop material sideways away from the center of the rake. It is also understood that splitter wheel drawbar assembly 62 may be used in conjunction with a different type of rake than rake 20 having the illustrated details and configurations, and that splitter wheel drawbar assembly 62 may be used in combination with any type of bifold rake having a central drawbar. [0048] Various alternatives and embodiments are contemplated as being within the scope of the following claims particularly pointing out and distinctly claiming the subject matter regarded as the invention.

Summary: A bifold rake for forming a windrow of cut agricultural crop material includes a rear trolley ( 22 ) to which a pair of rake arms ( 30 ) are pivotably mounted, and a drawbar ( 44 ) extending forwardly from the rear trolley and adapted for interconnection with a two vehicle such as a tractor. Each rake arms ( 30 ) carries a series of rake members ( 32 ). An opening and closing mechanism ( 105 ) is interconnected between the drawbar and the rake arms, and includes front ( 110 ) and rear ( 106 ) operating arms located on each side of the drawbar and pivotably interconnected with each other and with one of the rake arms. The inner end of each front and rear operating arm is pivotably interconnected with a slidable arrangement associated with the drawbar. In one form, the slidable arrangement is a sleeve ( 102 ) that is slidably mounted to the drawbar for axial movement. In another form, the slidable arrangement is the form of a telescoping section of the drawbar which is capable of moving inwardly and outwardly relative to a receiver section of the drawbar. An extendible and retractable actuator assembly, such as a hydraulic cylinder assembly ( 104 ), is interconnected with the drawbar and at least one of the slidable arrangements for moving the front and rear arms together and apart so as to move the rake arms between open and closed positions. A splitter wheel rake assembly is interconnected between the drawbar and a hitch member, for directing crop material in opposite directions away from the center of the trolley to rake the crop material into a windrow. The splitter wheel rake assembly includes a frame arrangement having a pair of offset frame members, and a splitter rake member ( 78 ) mounted to each offset frame member. The splitter rake members are configured to direct the crop material in opposite directions. The splitter wheel rake assembly is selectively engageable with the drawbar.

big_patent

en

Summarize: Military researchers have put dozens of soldiers, both women and men, through a series of drills Wednesday aimed at helping the Army develop a unisex test to decide which troops are fit for combat. Fort Stewart spent weeks training volunteers in performing tasks the Army considers essential for troops on front lines- from dragging a wounded comrade to safety to loading 65 pound anti-tank missiles. Scientists from the Army's Research Institute for Environmental Medicine had volunteer soldiers don oxygen masks and heart-rate monitors to record their exertion. Scroll down for video. Changing the tests: Commanders want front line tests to more accurately mimics the most strenuous tasks that infantrymen, tank crews and other combat troops perform (soldiers in Fort Drum pictured doing a physical fitness test) Old tricks: Commanders want to break from longtime gauges of physical fitness that include push-ups, sit-ups and 2-mile runs (a soldier is pictured doing push ups while serving in Balad, Iraq) On Tuesday the troops- 89 men and 58 women- were timed as they toted heavy cans of ammunition and scrambled with rifles through an obstacle course laid out with orange cones. The Pentagon plans to start opening up combat jobs to women as early as 2016. Commanders want to break from longtime gauges of physical fitness that include push-ups, sit-ups and 2-mile runs in order to devise a test that more accurately mimics the most strenuous tasks that infantrymen, tank crews and other combat troops perform. Drills such as scaling a 6-foot wall in 70 pounds of gear and removing the heavy barrel of a 25 mm gun on an armored vehicles are nothing new for male soldiers already in combat units. That said, they're completely unfamiliar to Army women so Fort Stewart gave its soldier-volunteers a month to train. 'When we started, it was very challenging because we'd never experienced any of these tasks before,' said Captain Nartrish Lance, 40, who after 21 years in the Army is getting her first taste of what it takes to serve in a combat unit. 'But, once you get to rehearse... it becomes easy.' Co-ed: Drills such as scaling a 6-foot wall in 70 pounds of gear and removing the heavy barrel of a 25 mm gun on an armored vehicles are nothing new for male soldiers but they are new to female soldiers. On Tuesday the troops- 89 men and 58 women- were timed during the run through at Fort Stewart in Georgia. In seeking fitness standards based on real-word job requirements, the Army follows many U.S. fire departments that in recent years made entrance tests fairer to women than old standards heavy on push-ups and other upper-body exercises that favor men. Major General Mike Murray, commander of Fort Stewart's 3rd Infantry Division, said allowing women into combat units will do more than break one of the military's last gender barriers. He noted a very small Army 'population' will qualify, adding 'this overall effort is really about matching skill sets and attributes to the right job.' Whatever fitness test emerges for combat service should be a challenge for both men and women to show that standards aren't being lowered to accommodate female soldiers, said Lory Manning, a retired Navy captain who studies how military policies affect women for the Women's Research and Education Institute. 'The idea for the military isn't that any women coming through can pass their test,' Manning said. 'It's that anybody male or female who can pass the test should be able to serve in that occupation. If it's one woman out of a thousand, so be it.'

Summary: Male and female soldiers in Fort Stewart, Georgia have been tested on a new set of drills as women are considered for front-line positions. Physical fitness tests have included push ups and 2 mile runs for years but now they will include other drills that are considered more essential. Drills that test soldiers' ability to carry 65-pound anti-tank missiles and the ability to carry a wounded comrade are being added. Pentagon hopes to open combat positions to women by 2016.

cnn_dailymail

en

Summarize: Rumours about Apple’s bending iPhone 6 Plus show no signs of dying down. Now two teenagers have decided to take reports about the phone’s alleged flaw into their own hands. In a five-minute video, two 15-year-old boys step into an Apple store to try to bend a gold iPhone 6 Plus. Scroll down for video. Hands-on: In a five-minute video, two 15-year-old boys step into an Apple store to try to bend a gold iPhone 6 Plus. They use so much pressure that the screen on the phone pops out. They use so much pressure that the screen on the phone pops out, causing the teenagers to say they have to run away or ‘they would have ended up paying for it’. The boys, thought to be from Norfolk, then ask a shop worker whether or not an iPhone 6 Plus could bend. It is believed that the thinner model, as well as the use of aluminium metal in its design, causes the frame to deform. But the Apple employee denies the claims saying it’s an ‘internet rumour.’ Under pressure: It is believed that the thinner model, in addition to the use of aluminium metal in its design, causes the frame to deform. But the Apple employee denies the claims saying it’s an ‘internet rumour’ This chart reveals how much force each handset could withstand. 'Deformation' refers to the point at which the phone began to bend. 'Case separation' was the point at which the display became disconnected from the case. One of the teenagers involved in the video said: ‘The reason why we were laughing was because it was really funny. ‘We were in the Apple store bending and breaking their iPhone, which I guess is criminal damage but I don’t even care, to be honest. ‘It’s Apple’s fault – they are false advertising, saying it’s the best iPhone but clearly it’s not if it can bend in your hands or your pocket. It’s just ridiculous.’ The duo aren’t the only ones attempting to bend the iPhone 6 Plus, with reports suggesting damaged iPhone can be seen throughout Apple’s stores. Some customers have even attempted to bend the allegedly less prone iPhone 6. Apple has yet to comment on the matter. Apple has acknowledged there are issues with new iPhones bending under some circumstances, but it added that it has only received nine official complaints. Experts from Consumer Reports recently suggested some of these claims may have been exaggerated. During their own stress tests, they found the iPhone 6 Plus can withstand more force than has been previously claimed - and that it is more sturdy than the HTC One (M8) and the smaller iPhone 6. The first reports of bendy iPhones began on Wednesday last week when photos appeared online showing the top of the device bent out of shape. YouTube user Lewis Hilsenteger then posted a video showing the iPhone 6 Plus bending using just his fingers, which has already been viewed more than 45.3 million times. The controversy was dubbed 'BendGate'. It led to internet jokers posting photos, mocking the unintended new feature (pictured). A number of these images went viral on social media. The first reports of bendy iPhones began on Wednesday last week when photos appeared online showing the top of the device bent out of shape. YouTube user Lewis Hilsenteger then posted a video showing the iPhone 6 Plus bending using just his fingers, which has already been viewed more than 45.3 million times. To put these claims to the test, Consumer Reports used a so-called ‘three-point flexural test.’ This involved supporting the phone at two points on either end before applying a force on the top of the device. In addition to the iPhone 6 Plus, the researchers tested the iPhone 6, HTC One (M8), LG G3, Samsung Galaxy Note 3, and the iPhone 5. According to Consumer Reports, the HTC One (M8) (pictured) was the weakest of the handsets tested. It started to deform and bend when a total of 70lbs (31.75kg) of force was applied. This was on par with the iPhone 6. The HTC handset separated from its case when a force of 90lbs (40kg) was applied. Despite the claims, the HTC One (M8) and iPhone 6 were the weakest devices. They started to deform and bend when a total of 70lbs (31.75kg) of force was applied. The iPhone 6 Plus came third, at 90lbs (40kg), followed by the LG G3 and iPhone 5 on 130lbs (59kg), and the Samsung Galaxy Note 3 on 150lbs (68kg). The iPhone 6 Plus results show the handset can withstand 15lbs (6.8kg) more force than the initial reports suggested. Consumer Reports claimed this is more than a quarter more force than is needed to break three pencils. Apple also faced criticism and complaints last week about its iOS 8.0.1 update, after it caused problems with the new phones’ TouchID sensors and data services. The update was pulled, and the problems should now be solved by updating to iOS 8.0.2. Following the reports, and #bendgate controversy on Twitter, Apple spokeswoman Trudy Muller said: 'With normal use, a bend in iPhone is extremely rare and through our first six days of sale, a total of nine customers have contacted Apple with a bent iPhone 6 Plus,' Apple shares closed down nearly 4 per cent at $97.87 (£60.26) Thursday, wiping out nearly $23billion (£14.1billion) in market value. Further tests, by AnandTech, revealed the performance of the new phones isn’t as poor as customers have made out, either. During initial benchmark tests, the iPhone 6 was found to have the fastest web browsing and page loading times on any device, just ahead of the iPhone 6 Plus (graph pictured)

Summary: Video shows teenagers in Apple's Norwich store bending the phone. They use so much pressure that the screen on the phone pops out. The boys ask a shop worker whether an iPhone 6 Plus could bend. Apple employee denies the claim saying it is an 'internet rumour' Apple has acknowledged there are issues with new iPhones bending. Cupertino-based group says it has received nine official complaints. To test claims, Consumer Reports (CR) used 'three-point flexural test' CR discovered HTC One (M8) and iPhone 6 are the weakest phones.

cnn_dailymail

en

Write a title and summarize: SECTION 1. AUTHORITY TO GRANT STATE STATUS TO INDIAN TRIBES FOR ENFORCEMENT OF SOLID WASTE DISPOSAL ACT. (a) Definitions.--Section 1004 of the Solid Waste Disposal Act (42 U.S.C. 6903) is amended-- (1) in paragraph (13)(A), by striking ``or authorized tribal organization or Alaska Native village or organization,''; (2) in paragraph (15), by inserting after ``State,'' the following: ``Indian tribe,''; and (3) by adding at the end the following new paragraphs: ``(42) The term `Indian country' means-- ``(A) all land within the limits of any Indian reservation under the jurisdiction of the Federal Government (including any right-of-way running through the reservation), notwithstanding the issuance of any patent; ``(B) all dependent Indian communities within the borders of the United States, including dependent Indian communities-- ``(i) within the original territory or territory that is subsequently acquired; and ``(ii) within or without the limits of a State; and ``(C) all Indian allotments with respect to which the Indian titles have not been extinguished, including rights-of- way running through the allotments. ``(43) The term `Indian tribe' means any Indian tribe, band, group, or community, including any Alaska Native village, organization, or regional corporation (as defined in, or established pursuant to, the Alaska Native Claims Settlement Act (43 U.S.C. 1601 et seq.)) that-- ``(A) is recognized by the Secretary of the Interior; and ``(B) exercises governmental authority within Indian country.''. (b) Treatment of Indian Tribes as States.--Subtitle A of such Act (42 U.S.C. 6901 et seq.) is amended by adding at the end the following new section: ``SEC. 1009. INDIAN TRIBES. ``(a) In General.--Subject to subsection (b), the Administrator may-- ``(1) treat an Indian tribe as a State for the purposes of this Act; ``(2) delegate to an Indian tribe primary enforcement responsibility for programs and projects established under this Act; and ``(3) provide Indian tribes grant and contract assistance to carry out functions of a State pursuant to this Act. ``(b) Environmental Protection Agency Regulations.-- ``(1) In general.-- ``(A) Treatment.--Not later than 18 months after the date of the enactment of this section, the Administrator shall issue final regulations that specify the manner in which Indian tribes shall be treated as States for the purposes of this Act. ``(B) Authorization.--Under the regulations issued by the Administrator, the treatment of an Indian tribe as a State shall be authorized only if-- ``(i) the Indian tribe has a governing body carrying out substantial governmental duties and powers; ``(ii) the functions that the Indian tribe will exercise pertain to land and resources that are-- ``(I) held by the Indian tribe, the United States in trust for the Indian tribe, or a member of the Indian tribe (if the property interest is subject to a trust restriction on alienation); or ``(II) are otherwise within Indian country; and ``(iii) in the judgment of the Administrator, the Indian tribe is reasonably expected to be capable of carrying out the functions to be exercised in a manner consistent with the requirements of this Act (including all applicable regulations). ``(2) Exceptions.-- ``(A) In general.--If, with respect to a provision of this Act, the Administrator determines that the treatment of an Indian tribe in the same manner as a State is inappropriate, administratively infeasible, or otherwise inconsistent with the purposes of this Act, the Administrator may include in the regulations issued under this section a mechanism by which the Administrator carries out the provision in lieu of the Indian tribe in an appropriate manner. ``(B) Statutory construction.--Subject to subparagraph (C), nothing in this section is intended to permit an Indian tribe to assume or maintain primary enforcement responsibility for programs established under this Act in a manner that is less protective of human health and the environment than the manner in which a State may assume or maintain the responsibility. ``(C) Criminal enforcement.--An Indian tribe shall not be required to exercise jurisdiction over the enforcement of criminal penalties. ``(c) Cooperative Agreements.--In order to ensure the consistent implementation of the requirements of this Act, an Indian tribe and each State in which the lands of the Indian tribe are located may, subject to review and approval by the Administrator, enter into a cooperative agreement, to cooperatively plan and carry out the requirements of this Act. ``(d) Report.--Not later than 2 years after the date of enactment of this section, the Administrator, in cooperation with the Secretary of the Interior, the Director of the Indian Health Service, and Indian tribes, shall submit to Congress a report that includes-- ``(1) recommendations for addressing hazardous and solid wastes and underground storage tanks within Indian country; ``(2) methods to maximize the participation in, and administration of, programs established under this Act by Indian tribes; ``(3) an estimate of the amount of Federal assistance that will be required to carry out this section; and ``(4) a discussion of proposals by the Administrator concerning the provision of assistance to Indian tribes for the administration of programs and projects pursuant to this Act. ``(e) Tribal Hazardous Waste Site Inventory.-- ``(1) Inventory.--Not later than 2 years after the date of enactment of this section, the Administrator shall undertake a continuing program to establish an inventory of sites within Indian country at which hazardous waste has been stored or disposed of. ``(2) Contents of inventory.--The inventory shall include-- ``(A) the information required to be collected by States pursuant to section 3012; and ``(B) sites located at Federal facilities within Indian country.''. (c) Technical Amendment.--The table of contents for subtitle A of such Act (contained in section 1001 of such Act (42 U.S.C. prec. 6901)) is amended by adding at the end the following new item: ``Sec. 1009. Indian tribes.''. SEC. 2. LEAKING UNDERGROUND STORAGE TANK TRUST FUND. Section 9508(c)(1) of the Internal Revenue Code of 1986 is amended-- (1) by striking ``Except as provided'' and inserting the following: ``(A) Purposes.--Except as provided''; and (2) by adding at the end the following new subparagraph: ``(B) Set aside for indian tribes.--Notwithstanding any other provision of law, for each of fiscal years 1995 through 1999, the Secretary shall reserve an amount equal to not less than 3 percent of the amounts made available to States pursuant to subparagraph (A). Such amount shall be used only by Indian tribes (as defined in section 1004(43) of the Solid Waste Disposal Act) to carry out the purposes referred to in subparagraph (A).''.

Title: A bill to amend the Solid Waste Disposal Act to grant State status to Indian tribes for purposes of the enforcement of such Act, and for other purposes Summary: Amends the Solid Waste Disposal Act to authorize the Administrator of the Environmental Protection Agency to: (1) treat Indian tribes as States under such Act; (2) delegate primary enforcement authority for programs under such Act to Indian tribes; and (3) provide grant and contract assistance to tribes to carry out such Act. Sets forth conditions under which Indian tribes may be treated as States. Directs the Administrator to report to the Congress on: (1) recommendations for addressing hazardous and solid wastes and underground storage tanks (USTs) within Indian country; (2) methods to maximize Indian participation in, and administration of, programs under such Act; and (3) an estimate of the amount of assistance required and a discussion of proposals by the Administrator concerning the provision of assistance to Indian tribes for the administration of such programs. Requires the Administrator to establish an inventory of sites within Indian country at which hazardous waste has been stored or disposed. Amends the Internal Revenue Code to reserve at least three percent of the amounts made available to States from the Leaking Underground Storage Tank Trust Fund for Indian tribes to carry out response actions for petroleum USTs.

billsum

en

Write a title and summarize: Le "globe", projet de Jean-Christophe Fromantin (LR) pour l'Exposition universelle 2025. Un « village global » construit autour d’un « globe connecté qui accueillerait de façon équitable tous les pays », en Ile-de-France. Sensual City Studio TRIBUNE. La France a présenté au mois de novembre 2016 sa candidature à l’Exposition universelle de 2025, sur le thème de « la connaissance à partager, la planète à protéger ». L’examen attentif du projet de l’un des sites potentiels d’implantation entre lesquels la France devra trancher le 12 juillet, celui de Paris-Saclay, montre qu’il n’est pas, selon nous, à la hauteur des enjeux qu’il prétend relever. Les acteurs du « cluster » Paris-Saclay, qui se mobilisent sans compter avec les collectivités locales pour que leur territoire accueille l’Exposition universelle, sont bien mal placés pour parler de partage de la connaissance. En l’occurrence, ils n’arrivent même pas à partager une même vision de la façon de produire la connaissance. Impasses L’université Paris-Saclay, qui est, ou qui était, censée regrouper tous les partenaires scientifiques du plateau de Saclay a fait long feu. Elle est aujourd’hui réduite à la seule université Paris-Sud, les grandes écoles ayant fait faux bond. Article réservé à nos abonnés Lire aussi « L’Exposition universelle à Saclay réaffirmera notre attachement à la réussite de l’accord de Paris » Quelle leçon de partage de la connaissance la France peut-elle donner au monde alors qu’elle laisse perdurer un modèle dual de production du savoir, opposant le système des grandes écoles recroquevillé sur des privilèges justifiés par la rhétorique de l’excellence, et l’université qui se trouve cantonnée à la gestion de la masse des étudiants? Quelles synergies pourraient naître dans ces conditions entre les différents acteurs du cluster pour y faire émerger l’innovation? Les impasses que nous voyions se former il y a maintenant plus de sept ans semblent malheureusement se consolider. De petits groupes privilégiés Plus fondamentalement, le cadre général dans lequel cette université a été créée et son mode de financement ne sont pas un modèle de partage : les investissements d’avenir dont elle a bénéficié consistent à ne pas partager les moyens publics pour la production scientifique, mais au contraire à les réserver à de petits groupes privilégiés qui concentrent ainsi l’essentiel des moyens publics. Lire aussi La France candidate à l’Exposition universelle de 2025 Et pourtant, la tendance mondiale est inverse : la recherche se déconcentre au profit des grandes villes régionales et aux dépends des capitales. Ainsi, la part des dix premières villes productrices de science dans le monde est passée de 20 % en 1987 à 13 % en 2007. Tout l’inverse du cluster Paris-Saclay, qui représente aujourd’hui 13 % de la recherche française et ambitionne à terme d’en concentrer 20 %. Le contraste est fort entre « la polarisation relativement accentuée repérable pour la France et les structures plus polycentriques de l’Allemagne » (« Les villes de la science dans le monde », Denis Eckert, Michel Grossetti, Laurent Jégou, Marion Maisonobe, Mappemonde n°116, 2014). La France se propose de mettre en avant un modèle dépassé.

Title: Exposition universelle de 2025: le site de "Paris-Saclay n'est pas à la hauteur des enjeux qu'il prétend relever Summary: Thomas Lamarche, économiste, et Olivier Réchauchère, militant associatif, réfutent dans une tribune au "Monde" les arguments favorables à la candidature du plateau de Saclay à l'Exposition universelle de 2025, dont le gouvernement doit choisir le site le 12 juillet.

mlsum_fr

fr

Summarize: So Mike Tyson's tattoo artist tried to stop the worldwide distribution of "The Hangover Part II," based on the premise that the filmmakers had stolen his Maori-inspired design and stuck it on Ed Helms' face. I guess that wasn't much of a legal case, which is too bad, because as it turns out the guy was accidentally trying to perform a public service. Maybe he should have tried the argument that the movie sucks so bad that if anyone, anywhere, thinks he had anything to do with it that amounts to defamation of character. Since we're talking about meta-narratives that are way more interesting than this bad and stupid movie, I guess we were supposed to think that director Todd Phillips and stars Bradley Cooper, Zach Galifianakis and Helms were being principled, woman-friendly men by kicking Mel Gibson out of "The Hangover Part II." That's nice and all, but at least Gibson, when he's being funny, is pretty damn funny. Speaking strictly from the perspective of someone who sat on my ass through this entire terrible movie, I'd gladly trade in the whole thing for five decent minutes of Mel. Can I keep vamping for a while, and stave off the movie review? In France this would-be huge hit is known as "Very Bad Trip 2." (Those words, in English.) In Spanish-speaking countries, it's called "¿Que Paso Ayer? 2." In German, it's... oh, all right. In English, it really should be called "Sex and the City 2: This Time It's for Guys." If you seriously need any more evidence that the raunchy bromance comedy genre has become a played-out shell of its former self, huffing the fumes of last night's stale beer (mixed with other unidentifiable fluids) in a back alley at dawn, the great burst of sour flatulence that is this overcooked sequel should provide it. Even as transparent attempts to recapture the so-called magic of a big hit go, this new voyage into manufactured outrageousness is especially shameless. Phillips and his co-writers, Craig Mazin and Scot Armstrong, seem to have launched into this project with a misguided faith in their own brilliance, but nothing resembling an idea or a story. "Hangover II" simply recycles the bachelor-party-gone-awry gags from the 2009 summer hit, in a new and supposedly grittier context where the cast seems ill at ease, with much less comic effect and a lot more homophobia and xenophobia. It's a dumb, ugly and, most of all, painfully unfunny movie, which can't quite decide between competing touristic impulses: Bangkok as a pervy, nasty sex-trade destination and the mysterious East as the home of a superior, contemplative spirituality. It's like "Eat, Pray, Love," only with hot ladyboys to turn you gay and a cigarette-smoking monkey to steal your heart. Do you really want me to provide some whimsical effort at plot synopsis, when you and I could both be using these few seconds for something else: reading about a maid-molesting French socialist or mocking the idiotic behavior of 2012 Republican presidential "candidates" or staring out our office windows in a melancholy stupor? OK, fine, but I don't want any complaints about how boring it sounds. So the "wolf pack" from the first movie reconvenes at a luxury resort in Thailand, where doofus dentist Stu (Helms) is supposed to marry a hot Asian chick named Lauren (Jamie Chung) whose dad hates him. (I went south on this movie as soon I realized that Stu had ditched the charming Vegas hooker he married in "The Hangover.") Cooper plays the douchey, studly Phil, who acts like a jerk all the time, and Galifianakis of course is the socially inept, passive-aggressive Alan, invited along for unclear reasons, since nobody likes him at all. There's no big bachelor party or anything, just a late-night Budweiser around the campfire. But next thing these losers know they're waking up a day or so later in a sleazy hotel room in Bangkok, accompanied by the aforementioned chain-smoking monkey in his Rolling Stones denim vest, a severed finger that seems to belong to Lauren's med-student kid brother (Mason Lee), and the sleeping nude personage of Mr. Chow (Ken Jeong), the effeminate but kick-ass gangster from the first "Hangover." Actually, I was very, very glad to see Chow, because as much of a flaming stereotype as his character is, Jeong inhabits him with a ferocity that makes him by far the funniest and most real-seeming person in the movie. Does that sound exactly like the first "Hangover," except with the wildlife made cuter and an exotic setting that's only going to produce dumb-ass cultural clichés, and no Mike Tyson? That's all correct except that Tyson shows up at the end to perform a rap version of "One Night in Bangkok," and you'll really wish he hadn't. Once again our heroes' missing hours are not entirely explained, but this time that decision feels sloppy and slapdash in a way it didn't quite in "The Hangover." Oh, there's a drug deal gone wrong and a low-grade American mobster played by Paul Giamatti and a Buddhist monk in a wheelchair. There's a fair amount of naked male peener, and of course there's the frat-boy-centric audience's greatest fear and/or desire: anal penetration. (I've seen at least four movies in the last year that resort to this as the ultimate squirm gag: The hero might take it from behind and like it!) Now, in fairness I should add that I didn't think the first "Hangover" was all that great either, but it had several good laughs and a profane, open-hearted American cheerfulness about it that was hard to resist. "The Hangover Part II" trades that in for a B-grade thriller atmosphere that isn't quite convincing but manages to make all three of the central so-called buddies seem like creeps who don't actually like each other and can't relate to the world. Cooper and Galifianakis, in particular, are talented-ish actors who are stuck in really bad grooves and on the verge of typecasting themselves into oblivion, the former as a male-model jerkass irresistible to certain women (i.e., the shallow ones) and the latter as a pitiable misfit who's supposed to make us laugh uproariously at his Asperger-like behavioral problems and 1988 leisure-wear wardrobe. I suspect there was half an impulse here -- or 20 percent of an impulse -- to take the "Hangover" characters and put them in a genuinely dark and dangerous situation. That might or might not have been interesting; it isn't that great of an idea, frankly, but it's something. Then the commercial necessity of giving a huge international audience a C-minus imitation of what they've already seen took over, and we got this shockingly inept retread instead. With "Hangover Part II," the worldwide downturn in dude comedy hits its nadir. Time to chillax and recharge, bros; check out the success of "Bridesmaids"; let the ladies have a little oxygen. We can only hope. The Hangover Part II (2011) The funniest, most reckless moments in “The Hangover Part II,” the largely mirthless sequel to the 2009 hit “ The Hangover,” take place in the final credits, when still images flash by detailing the latest misadventures of the story’s overgrown lost boys. The outrages, most of which are once again carefully elided in the actual movie, involve a slipped knife, a tribal tattoo and Thai bar girls performing specialized party tricks. The final credits are the time when viewers meander or flee from the theater or sit in stunned or ecstatic silence or chattering communion. Here the credits just emphasize how deeply square this flick is. Like the first movie, the new one involves a groom — here, the formerly married Stu (Ed Helms) — who, on the eve of his own wedding, experiences various forbidden pleasures. In other words, he briefly escapes his mundane reality as a nice-guy dentist before settling down with a soon-to-be wife, Lauren (Jamie Chung). As before Stu’s companions are a pretty boy, Phil (Bradley Cooper), and an odd duck, Alan (Zach Galifianakis), whose straight-man-and-dummy dynamic works along the lines of an R-rated Abbott and Costello. Stu, by contrast, is the everyman who journeys into the dark night — now, the jammed streets and clubs of Bangkok — on his way to enlightenment, though more likely another sequel. The director Todd Phillips, who wrote the new “Hangover” with Craig Mazin and Scot Armstrong (the first was credited to Jon Lucas and Scott Moore), cleaves numbingly to the script of the previous movie. Stu, with Phil, Alan, another friend, Doug (Justin Bartha) and Stu’s teenage future brother-in-law, Teddy (Mason Lee), shares drinks, toasting his fast-approaching nuptials. A few edits later, and he, Phil and Alan are groggily waking up in a wrecked hotel room, as they did in the first movie, only this time there’s a capuchin monkey on board instead of a baby. Shrieks and panic ensue as the friends try to figure out what happened, where Teddy is and how a human finger ended up without its hand. If you superimposed a diagram that mapped out all the narrative beats, characters and jokes in “The Hangover Part II” over one for “The Hangover,” the two would align almost perfectly. Banking on the studio adage that there’s no success like a previous box office hit, Mr. Phillips and company dutifully recycle the first movie to increasingly diminishing ends that include the baby-now-monkey, the giggly, swishy gangster Mr. Chow (Ken Jeong) and the obligatory, obliging anti-wives (i.e., whores). Paul Giamatti shows up, as do Jeffrey Tambor, Mike Tyson, the director Nick Cassavetes and assorted extras filling in for monks, gangsters, strippers, merchants and gawkers. There’s a car chase, and at one point the monkey takes a computer-generated smoke, doubtless to take its mind off the movie. Mr. Phillips throws in one good visual joke in a flashback that reveals how Alan, an overgrown child of privilege, sees himself and his friends. Mr. Galifianakis is a naturally funny screen presence, and he gives Alan a strong current of menace, turning him into a combustible teddy bear whose naïveté ignites all the trouble and serves as its convenient excuse. A walking, toddling id, the guy can’t help it, and neither can the friends he accidentally on purpose drags into his mess. In “The Hangover” and “The Hangover Part II” grown men cast off the shackles of everyday existence, leaving behind girlfriends, wives, parents and jobs in order to play, feel, live, which is why these nominal comedies are better thought of as tragedies. “The Hangover Part II” is rated R (Under 17 not admitted without accompanying parent or adult guardian). The film features knife and car violence, vulgar and sexist language, and female and she-male club performers. The Hangover Part II Opens on Thursday nationwide. Directed by Todd Phillips; written by Craig Mazin, Scot Armstrong and Mr. Phillips, based on characters created by Jon Lucas and Scott Moore; director of photography, Lawrence Sher; edited by Debra Neil-Fisher and Mike Sale; music by Christophe Beck; production design by Bill Brzeski; costumes by Louise Min- genbach; produced by Mr. Phillips and Dan Goldberg; released by Warner Brothers Pictures. Running time: 1 hour 41 minutes. WITH: Bradley Cooper (Phil), Ed Helms (Stu), Zach Galifianakis (Alan), Justin Bartha (Doug), Ken Jeong (Mr. Chow), Paul Giamatti (Kingsley), Mike Tyson (Himself), Jeffrey Tambor (Sid Garner), Mason Lee (Teddy), Jamie Chung (Lauren), Nick Cassavetes (Tattoo Joe), Sasha Barrese (Tracy) and Gillian Vigman (Stephanie). The Hangover Part II (Warner Bros.) isn't so much a sequel to The Hangover as a slightly blurred copy. Directed, like the wildly successful first film, by Todd Phillips, it airlifts the original characters, premise, and story structure out of Vegas and plonks them down in Bangkok in near-identical form, save for a few instances of ante-upping. Several years after their Vegas bachelor party turned into a 48-hour nightmare involving drug-laced drinks, a prostitute's missing baby, and near-fatal encounters with both Mike Tyson and his pet tiger, the four friends meet again in Thailand for the wedding of Stu (Ed Helms), a seemingly straight-laced dentist, to Lauren (Jamie Chung), a nice, pretty Thai girl. (I'd provide a more precise description of Lauren, but that's all the movie gives me to work with: She's Thai, pretty, and nice, or, as one of Stu's buddies put it, "an angel with a solid rack.") Besides the bridegroom, Stu, the gang includes Phil (Bradley Cooper), a handsome family man with a taste for debauchery; Doug (Justin Bartha), a bland foil who hangs around waiting to take expository phone calls; and Alan (Zach Galifianakis), a socially underdeveloped weirdo who explains his living situation as follows: "I'm a stay-at-home son." Once again, Alan has been invited along only out of grudging politeness; the other guys are creeped out by his overeager insistence that their shared experience in Vegas has bonded them forever. Advertisement The night before the wedding, for reasons that aren't revealed until much later, an innocent round of beers around a beachside fire leads to another rabbit hole of amnesia and poor decision-making. The boys wake up the next morning in a grimy Bangkok hotel room amid various clues to the previous evening's excesses: There's a clothed monkey, a severed finger in a bowl of melted ice, and a coked-up Asian gangster (Ken Jeong) who remembers them from Vegas. Worst of all, one of their cohort—the bride's naive 17-year-old brother Teddy (Mason Lee, son of the director Ang Lee) has gone missing. The rest of the movie spirals chaotically yet formulaically into the depths of the Bangkok underworld. Tattoo parlors are visited, transsexual prostitutes consulted, Buddhist monks rescued from drunk tanks, all in the service of finding Teddy in time for the upcoming wedding. Individual lines here and there are funny (most of them Galifianakis'), and Ed Helms has perfected his outraged splutter, but this film never achieves the anarchic liftoff the first one did. I didn't love The Hangover—it fell apart a bit in the second half, and none of these performers thrills me to my bones—but even in its weaker moments, that film had more comic integrity than this blatant cash grab. The Hangover Part II's big taboo-breaking set piece (every summer comedy is required to have one now, by order of the Ministry of Tastelessness) comes when the boys meet a "ladyboy" sex worker who claims to have provided services to one of them. The degree of horror displayed by the men when s/he reveals a set of unambiguously male genitalia is more than a little off-putting. Our heroes have, at this point, faced with equanimity the prospect that a teenage boy may be hurt and irretrievably lost in the squalor of the Bangkok underworld. Is the fact that one of them may or may not have had consensual gay sex really the worst possible thing they can imagine? In case it's not obvious, the R-rated Hangover Part II is not suitable for children (a fact ignored by a couple of morally challenged parents at the promotional screening I attended.) It's raunchy, violent, offensive to every conceivable interest group, and liberally laced with profanity and male nudity. The whole point of this franchise is to make even jaded adults laugh in shock at the outrageous behavior on display. This strategy works best in the final credit sequence, which, in another shameless lift from the original, reveals in a series of rediscovered snapshots what happened on that one wild night in Bangkok. That minute and a half of still photos packs in more dense, economical laughs than all the laborious gross-outs and chase sequences that came before. Maybe The Hangover Part III should consider restricting itself to the slide-show format. Like Slate Culture on Facebook. Follow Slate on Twitter.

Summary: If the first Hangover was a wild party, the second is, well, the hangover. Critics are savaging the latest effort from Todd Phillips: Writing in Salon, Andrew O'Hehir smacks the film's "mind-boggling awfulness." It's a "clumsy, homophobic, cliché-ridden, and terminally unfunny sequel" that "takes dude comedy to its Sex and the City 2 nadir." The guy who tried (and failed) to stop the film with a lawsuit was "accidentally trying to perform a public service."

multi_news

en

Summarize: A popular personal trainer who apparently had been fired from his job earlier in the day fatally shot one of his former co-workers and critically wounded another at the Equinox fitness center in Coral Gables on Saturday afternoon before killing himself. The 12:55 p.m. shooting shut down the upscale Shops at Merrick Park mall and scattered scores of scared shoppers and Equinox members onto the surrounding streets, many of them clad in exercise clothes and holding nothing but their workout towels. Read more: Before shooting, Equinox gunman was fired ‘due to work place violence,’ police say Witnesses identified the shooter as Abeku Wilson, a 33-year-old bodybuilder who had worked at Equinox for years but, according to two employees, had been let go shortly before he returned to the gym with a handgun, took aim and opened fire. Be the first to know. No one covers what is happening in our community better than we do. And with a digital subscription, you'll never miss a local story. SIGN ME UP! “Five gunshots,” said Ovi Viera, 41, a nurse from Coconut Grove who was washing his hands in the men’s locker room when he heard the bangs. “It was too loud for it to have been a weight dropping. Within two seconds, people just started running out.” Wilson shot Janine Ackerman, 35, the gym’s general manager, and Marios Hortis, 42, a fitness manager, witnesses said. One person who declined to be identified said Ackerman had been shot in the head. Hortis was conscious and asking for help but bleeding heavily, the witness said. A rescue helicopter landed at Coral Gables Senior High School, across the street from the mall, and took the victims to Ryder Trauma Center at Jackson Memorial Hospital, where Ackerman later died, a police source told the Miami Herald. A few of her friends and family gathered at the hospital Saturday evening but declined to speak to reporters. SHARE COPY LINK One dead, two wounded after gunman opens fire at Shops at Merrick Park on Saturday, April 8, 2017. Ackerman, who was originally from New Jersey, lived in Coconut Grove, public records show. Hortis graduated from St. John’s University in Minnesota, according to his LinkedIn profile, and appeared on a Miami Beach modeling registry website as Mario Hortis. Read more: Victim of Merrick Park shooting remembered as ‘the greatest person ever’ In a news conference, police declined to identify the shooter or his victims, or to confirm if it was the shooter who had initially died. They also would not confirm Wilson’s suicide, saying only that the shooter targeted the victims over an employee-manager dispute. Police sources told the Herald that Wilson turned the gun on himself. One witness said she saw the shooter, dressed in the personal-trainer uniform of black shorts and black shirt, walk into Equinox through the main entrance holding a handgun. He assumed a shooting stance and targeted a man behind the check-in counter, the witness said. Two weeks out!!!.... Gotta give it all I got and let my hard work these last few months do the rest on stage!.. Good workout with my Brother @iamdelafuente #FinishStrong #EMMDI #Equinox #NpcNationals2016 A post shared by Abeku Wilson (@abeku21) on Nov 4, 2016 at 5:39pm PDT “He was very serious,” said the witness, Benedicte, 48, of Coral Gables, who declined to give her last name. “He was not smiling.” She mimicked him holding the gun with both hands and taking aim — “just really good position” to shoot, she said. She and her husband, Bruno, 55, heard five shots — first two, then three. Another man who was at the gym when the gunfire rang out and knew the shooter said Wilson was a “nice guy, quiet. He’s not a crazy guy. This wasn’t someone who decided to kill a bunch of people.” “There was a dance class of 40 people if he wanted to do that,” the man said, referring to a cardio dance class under way during the shooting. “This was personal.” He said the shooter appeared fine moments before it all began, “although he was agitated earlier in the day after meeting with management.” Through a corporate spokesman, Equinox declined to offer details on the incident. “We are working with all of the relevant authorities as they investigate the situation,” Chris Martinelli said in a statement. “Our thoughts and prayers are with the families impacted by this terrible tragedy. Out of respect for them and our entire Equinox family, we will refrain from commenting further until it is appropriate to do so.” A biography of Wilson posted on a modeling website said he was born in Boston and graduated from the University of Miami with a degree in business administration. He lived in Kendall, according to public records, and frequently posted photographs of his chiseled physique on Facebook and Instagram. Read more: Trainer who opened fire at Coral Gables gym was popular with clients “Abeku is God-fearing, outgoing, charismatic, versatile, ambitious, kind hearted, and has a youthful and loving sense of humor,” the biography said. “He has a positive attitude and appreciates and enjoys the simple things in life.” The bio also said Wilson had modeled in various print ads, including for Lucky Brand. Wilson was well known to Equinox regulars, including celebrities, politicians and former politicians who frequent the high-end gym. Former Miami City Commissioner Marc Sarnoff, who trained with Wilson for about two years, said he bumped into Wilson and another trainer while they were working on a machine Saturday morning. “He said: ‘Sorry. I’m just off balance this morning,’ ” Sarnoff said. “Which was strange. The way he said it, he almost slurred his words.” “He did his job very professionally,” said Freddy Balsera, the owner of a Coral Gables public-affairs firm and another Equinox regular. “He always had a clipboard, measuring the work his clients were doing.” Former state Rep. Erik Fresen, who exercises at the gym almost every morning and last saw Wilson on Wednesday, called Wilson “docile — not a meat head, even though he was a big guy.” “He was honestly one of the sweetest guys there,” said Fresen, who heard of the shooting while on vacation from fellow Equinox members. “I worked out there at least two campaign cycles. I remember he would always be like, ‘Come, look: You’re on TV!’ when my commercials would air.” Wilson’s steady stable of clients included model and TV actor Cristián de la Fuente and Univision anchor Maria Elena Salinas. The shooting forced Merrick Park stores to go on lockdown as police patrols surrounded the mall and closed adjacent streets. Over loudspeakers, a recorded alert told customers over and over again: “Emergency! Evacuate or seek shelter.” Coral Gables police said they secured the scene — that is, they were certain no mass shooter was on the loose — by 1:45 p.m. “People rushed inside here,” said Tim Hartog, general manager of the Yard House sports bar, who said about 100 people were having lunch at the restaurant’s outdoor patio when the shooting began. “People were hiding under the tables. It was just crazy.” Lauren DeCanio, a 21-year-old Florida International University student, was on her way to work at the yoga apparel store Lululemon when she noticed the commotion. “I saw men with towels around their waists,” she said. “Then a man reached out and grabbed my arm, rather forcefully, and said, ‘You can’t go there. There has been a shooting.’ ” A police officer told her and others at the mall to take shelter inside shops. She went into the Chico’s store on the second floor. “I went all the way to the back of the store and just sat there with a group of women,” DeCanio said. The mall remained closed for the rest of the day. Equinox members who had run out leaving most of their belongings inside called friends and family for rides home. CORAL GABLES, Fla. - When security at the Village of Merrick Park issued an audio alert advising "emergency, evacuate or seek shelter," shoppers and employees started running for cover. The Coral Gables Police Department surrounded the mall at 358 San Lorenzo Avenue. Witnesses at the mall's Soul Cycle reported hearing several gun shots. Two people suffered gunshot wounds about 1 p.m. inside the Equinox Fitness Club, according to the Miami-Dade Fire Rescue Department. A witness said there was panic inside the gym. Miami-Dade Police Detective Alvaro Zabaleta later reported one person died. The MDFR helicopter landed at the nearby Coral Gables Senior High School's sports field and took the two wounded to Jackson Memorial Hospital's Ryder Trauma Center. This is a developing story. Refresh this link for more information. Local 10 News' Melissa Alvarez contributed to this report. A post shared by Kimber0308 🌞🌴🌞🌴 (@kskye71) on Apr 8, 2017 at 10:17am PDT Copyright 2017 by WPLG Local10.com - All rights reserved.

Summary: Two people were wounded Saturday when a former trainer opened fire at an upscale gym outside Miami, the New York Daily News reports. The Miami Herald identifies the shooter as Abeku Wilson, a 33-year-old bodybuilding enthusiast. Wilson had apparently been let go by the Equinox fitness center in Coral Gables but showed up Saturday in his uniform. Witnesses report hearing five shots and say Wilson opened fire on a man standing behind the counter at the gym. Wilson then reportedly shot and killed himself. Two wounded victims were airlifted to a hospital, Local 10 News reports. Witnesses identified them as Equinox general manager Janine Ackerman and trainer Mario Hortis. The shooting occurred around 1pm at the Shops at Merrick Park mall. Shoppers and diners at businesses near Equinox ran for the exits, hid under tables, or ducked into restaurant kitchens. Business were locked down, and the mall was closed for hours following the shooting. A former Miami city commissioner and client of Wilson's says Wilson was the most popular trainer at the gym. Another person at the gym describes Wilson as a "nice guy, quiet."

multi_news

en

Summarize: By. Michael Zennie. PUBLISHED:. 14:16 EST, 26 December 2013. |. UPDATED:. 14:30 EST, 26 December 2013. A 17-year-old high school baseball star accused of beating his mother with a baseball bat and then hacking her to death smiled as he described is crime to police, it was revealed today. William Brandon Aydelott confessed to killing his mother Sharon Hill Aydelott, who was found in a pool of blood with a knife sticking out her eye socket at her home in Gulf Breeze, Florida on Christmas Eve. The pitcher for his local high school who was being courted by college teams 'was calm and 'appeared to be emotionless, other than giving a small smile a few times during the interview, when he confessed detectives told First Coast News. Ms Aydelott was found dead in her home after a friend stopped by to check on her, the Northwest Florida Daily News reports. Horrific: Sharon Hill Aydelott was viciously hacked to death by her son William Brandon Aydelott, 17, (left), police say.The two had been fighting since September. Ms Aydelott was found dead in a pool of blood at her home in Gulf Breeze, Florida, about 6pm on Tuesday night. Brandon. had been staying at a friend's house on-and-off since September because. of a rocky relationship between mother and son, police say. Detectives say that after the murder, he fled the home and went back to the house where he had been staying. Police tracked Brandon back to the friend's home about three hours after finding the gruesome murder scene. After police took Brandon into custody, he coldly admitted to brutally slaughtering his mother. Detectives say he even smiled slightly as he confessed to the horrific crime. Brandon Aydelott made a name for himself as a promising high school pitcher and had been scouted by universities - including possibly the University of Alabama. The 6-foot-3, 200-pound teen described in detail how he repeatedly smashed his mother with a baseball bat. He. then attacked her with a large kitchen knife, slashing her multiple. times and cutting her throat before driving the blade through her eye. Detectives say he was wearing clean clothes. The found only a small splotch of dried blood on his wrist. Brandon. Aydelott, a right-handed pitcher with a hard 80mph fastball, was being. scouted by college baseball teams - including, possibly, the University. of Alabama. 'Pitching tomorrow at bama stadium #lego,' he tweeted in June. Ms. Aydelott was a beloved science teacher at Holley-Navarre Middle School,. where she had been teaching seventh and eighth graders for the last 15. years

Summary: Sharon Aydelott was found dead in a pool of blood at her Gulf Breeze, Florida, home Tuesday night when a friend came to check on her. William Brandon Aydelott, 17, coldly confessed killing his mother. Detectives say he even smiled as he described the savage attack. Mother and son had been fighting for months and Brandon had been living with a friend. Ms Aydelott was a beloved middle school science teacher.

cnn_dailymail

en

Write a title and summarize: SECTION 1. SHORT TITLE; TABLE OF CONTENTS. (a) Short Title.--This Act may be cited as the ``Lincoln National Forest Act of 2006''. (b) Table of Contents.--The table of contents for this Act is as follows: Sec. 1. Short title; table of contents. TITLE I--LAND EXCHANGES Sec. 101. Ranchman's Camp land exchange, Lincoln National Forest, New Mexico. Sec. 102. C Bar X Ranch land exchange, Lincoln National Forest, New Mexico. Sec. 103. Provisions applicable to both land exchanges. TITLE II--BOUNDARY ADJUSTMENT Sec. 201. Proclamation boundary defined. Sec. 202. Lincoln National Forest proclamation boundary adjustment. Sec. 203. Miscellaneous provisions. TITLE I--LAND EXCHANGES SEC. 101. RANCHMAN'S CAMP LAND EXCHANGE, LINCOLN NATIONAL FOREST, NEW MEXICO. (a) Conveyance Authorized.--If the owners of Ranchman's Camp, New Mexico, offer to convey to the United States all right, title, and interest of the owners in and to the non-Federal land depicted for exchange on the map entitled ``Ranchman's Camp Land Exchange'' and dated June 3, 2006, the Secretary of Agriculture may accept title to the land on behalf of the United States and convey in exchange to the owners all right, title, and interest of the United States in and to the Federal land in the Lincoln National Forest depicted for exchange on such map. (b) Easements.--Simultaneously with the exchange of Federal land and non-Federal land under subsection (a), the Secretary and the owners of Ranchman's Camp shall exchange, at no additional consideration, nonexclusive reciprocal easements for access and utilities across, over, and through Forest Road 105, as depicted on the map referred to in such subsection. (c) Treatment of Map.--The map referred to in subsection (a) shall be available for inspection in the Office of the Chief of the Forest Service and the Office of the Supervisor of Lincoln National Forest during the period beginning on the date of the enactment of this Act until one year after completion of the land exchange authorized by such subsection. (d) Completion.--To the extent practicable, the Secretary shall complete the land exchange authorized by subsection (a) not later than 180 days after the date on which the owners of Ranchman's Camp make the offer described in such subsection, unless the Secretary and the owners agree to extend such deadline. SEC. 102. C BAR X RANCH LAND EXCHANGE, LINCOLN NATIONAL FOREST, NEW MEXICO. (a) Conveyance Authorized.--If the owners of C Bar X Ranch, New Mexico, offer to convey to the United States all right, title, and interest of the owners in and to the non-Federal land depicted for exchange on the map entitled ``C Bar X Ranch Land Exchange'' and dated June 3, 2006, the Secretary of Agriculture may accept title to the land on behalf of the United States and convey in exchange to the owners all right, title, and interest of the United States in and to the Federal land in the Lincoln National Forest depicted for exchange on such map. (b) Easements.--Simultaneously with the exchange of Federal land and non-Federal land under subsection (a), the Secretary and the owners of C Bar X Ranch shall exchange, at no additional consideration, nonexclusive reciprocal easements for access and utilities across, over, and through Forest Road 488 and Forest Road 105, as depicted on the map referred to in such subsection. (c) Treatment of Map.--The map referred to in subsection (a) shall be available for inspection in the Office of the Chief of the Forest Service and the Office of the Supervisor of Lincoln National Forest during the period beginning on the date of the enactment of this Act until one year after completion of the land exchange authorized by such subsection. (d) Completion.--To the extent practicable, the Secretary shall complete the land exchange authorized by subsection (a) not later than 180 days after the date on which the owners of C Bar X Ranch make the offer described in such subsection, unless the Secretary and the owners agree to extend such deadline. SEC. 103. PROVISIONS APPLICABLE TO BOTH LAND EXCHANGES. (a) Exchange Processing.--Numerous surveys, clearances, reviews for threatened and endangered species, and reviews of cultural and historical resources have been conducted with regard to the land authorized for exchange under this title. There is no need to conduct additional duplicate studies or surveys to complete the land exchanges. (b) Final Maps and Descriptions.--The exact acreage and legal description of the land authorized to be exchanged under this title shall be more particularly delineated and described by the Secretary of the Interior according to a final boundary map and boundary description, which shall be filed in the Office of the Chief of the Forest Service. (c) Equal Value Exchange.-- (1) Equal value exchange required.--The market value of the Federal land and non-Federal land covered by each land exchange authorized by this title shall be equal or equalized as provided by subsection (d) or by adjusting the acreage to be conveyed in the land exchange, as determined by the Secretary and agreed to by the private land owners. (2) Appraiser qualifications.--The appraisal of the land authorized to be exchanged under this title shall be conducted by an appraiser with the following minimum qualifications: (A) Licensed New Mexico real estate appraiser. (B) Certified New Mexico real estate appraiser. (C) Accredited rural appraiser. (3) Costs of appraisal; other costs.--The owners of the non-Federal land to be exchanged under this title shall cover the costs of the land appraisal. The private land owners and the Secretary shall each pay half of any additional costs. (d) Cash Equalization.-- (1) Authorized amount.--Notwithstanding section 206(b) of the Federal Land Policy and Management Act of 1976 (43 U.S.C. 1716(b)), the Secretary may accept a cash equalization payment in excess of 25 percent of the total value of the Federal land conveyed by the Secretary under section 101 or 102. (2) Deposit and use.--Any cash equalization payment received by the Secretary under this section shall be deposited into a fund established under the Act of December 4, 1967 (commonly known as the Sisk Act; 16 U.S.C. 484a). The deposited amounts shall be available to the Secretary, until expended and without further appropriation, for the acquisition of lands and interest in land in New Mexico and associated administrative costs. Such amounts shall not be subject to transfer or reprogramming for wildland fire management or any other emergency purposes. (e) Title.--Title to the non-Federal land to be acquired by the United States under this title shall be acceptable to the Secretary and in conformity with the title standards of the Attorney General. Title to the Federal land shall be conveyed under this title by patent. (f) Completion.--To the extent practicable, the Secretary shall complete the land exchange authorized by subsection (a) not later than 180 days after the date of enactment, unless the Secretary and the owners of the non-Federal lands, respectively, agree to extend such deadline. (g) Revocations and Withdrawal.-- (1) Revocation.--Any public land orders withdrawing any of the Federal land from appropriation or disposal under the public land laws are revoked to the extent necessary to permit conveyance of the Federal land under this title. (2) Withdrawal.--Subject to valid existing rights, pending the completion of the land exchanges authorized by this title, the Federal land identified for conveyance are withdrawn from all forms of location, entry, and patent under the mining and public land laws, and from disposition under the mineral leasing laws and the Geothermal Steam Act of 1970 (30 U.S.C. 1001 et seq.). (h) Valid Existing Rights.--The conveyance of any Federal land under this title shall be subject to valid existing rights, and to such terms and conditions as the Secretary considers are in the public interest and agreed to by the private land owners. (i) Administration.--The Secretary shall manage the land acquired by the United States under this title in accordance with the Act of March 1, 1911 (commonly known as the Weeks Act; 16 U.S.C. 480 et seq.), and in accordance with the other laws and regulations applicable to the National Forest System. TITLE II--BOUNDARY ADJUSTMENT SEC. 201. PROCLAMATION BOUNDARY DEFINED. In this title, the term ``Proclamation Boundary'' means the exterior limits of the Lincoln National Forest in the State of New Mexico established by Presidential Proclamation 32 (32 Stat. 2018) signed by President Theodore Roosevelt on July 26, 1902, and subsequently modified by Presidential Proclamation 1474 (40 Stat. 1832), signed by President Woodrow Wilson on August 9, 1918. SEC. 202. LINCOLN NATIONAL FOREST PROCLAMATION BOUNDARY ADJUSTMENT. (a) Modification.--The 1902 Proclamation Boundary of the Lincoln National Forest is modified in section 20, township 7 south, range 16 east, New Mexico principal meridian to include only the NE\1/4\NE\1/4\ of such section, thereby excluding all non-National Forest System lands in such section as of the date of the enactment of this Act. (b) Availability.--To reflect the boundary adjustment effected by subsection (a), a legal land description signed and approved by the Regional Forester, Albuquerque, New Mexico, shall be on file and available for public inspection in the Office of the Chief of the Forest Service and the office of the Regional Forester, Albuquerque, New Mexico. (c) Correction Authority.--The Secretary of Agriculture may make minor technical and clerical corrections to the legal description to facilitate the boundary adjustment. SEC. 203. MISCELLANEOUS PROVISIONS. (a) Administration.--Any and all land or interests in land remaining within the boundaries of the Lincoln National Forest shall be managed for National Forest System purposes in accordance with-- (1) the Act of March 1, 1911 (commonly known as the Weeks Act; 16 U.S.C. 480 et seq.); and (2) the laws and regulations applicable to the National Forest System. (b) Land and Water Conservation Fund.--For purposes of section 7 of the Land and Water Conservation Fund Act of 1965 (16 U.S.C. 460l-9), the boundaries of the Lincoln National Forest, as adjusted by this title, shall be considered to be the boundaries of the national forest as of January 1, 1965. (c) Effect.--Nothing in this Act limits the authority of the Secretary of Agriculture to adjust the boundaries of the Lincoln National Forest under section 11 of the Act of March 1, 1911 (16 U.S.C. 521).

Title: To provide for the exchange of certain land in the Lincoln National Forest, New Mexico, with the owners of Ranchman's Camp and the C Bar X Ranch, to adjust the proclamation boundary of that national forest, and for other purposes Summary: Lincoln National Forest Act of 2006 - Authorizes exchanges of non-federal land of Ranchman's Camp and the C Bar X Ranch, New Mexico, for Lincoln National Forest land. Modifies the 1902 Proclamation Boundary of the Lincoln National Forest to exclude specified non-National Forest System lands. Provides that such adjusted boundaries shall be considered to be the boundaries of such Forest as of January 1, 1965, for purposes of Land and Water Conservation Fund allocations.

billsum

en

Summarize: A continuation-in-part of the following applications: Furniture Construction, filed Jun. 30, 1992, Ser. No. 07/906,430, now abandoned; Drawers and Assembly Kits Therefor, filed May 14, 1993, Ser. No. 08/061,175, now abandoned; and Bookcases and Tables and Assembly Kits Therefor, filed May 14, 1993, Ser. No. 08/061,176. BACKGROUND OF THE INVENTION Several proposals have been made to provide furniture that is ready to be assembled by the purchaser without requiring the use of metal fasteners. Such proposals have relied on tongue and groove or interfitting open ended slots as the means of interconnecting the members required for the wanted article of furniture. While both types of connections enabled furniture to be easily assembled, either type of connection has the disadvantage that the exterior of the resulting article shows portions of the connections and reduces the aesthetic appearance. SUMMARY OF THE INVENTION In accordance with the present invention, the assembled products herein described are primarily articles of furniture consisting of a number of members joined in a predetermined order by mortises and tenons. A minimum of three members are required to form an article of furniture and each such members, the three members and each additional member needed to form other articles of furniture has a pair of opposite end margins, a pair of opposite side margins and opposite sides bordered by the end and side margins. Of these, one member, hereinafter called the first member, has a first mortise opening through one end margin and extending at least part way across that member towards the opposite end margin. The first mortise intersects a second mortise which opens through one side margin and extends beyond the first mortise towards the opposite side margin. In embodiments utilizing more than three members, there are two first members, sometimes referred to as first and fourth members, with each, the mirror image of the other. Initially, the first or first two members are connected by mortises and tenons to another or second member. Each subsequent member, when added to the partial assembly or to a subsequent partial assembly locks the previously connected members against unwanted movements. The term members, as used herein denotes wooden members or members of other materials such that each two members which are to be connected have margins of complemental sizes and shapes such as to enable them to be interconnected by mortises and tenons. It is preferred, however, that such portions be formed in flat surfaces or along straight edges thereof. The maximum advantages of the invention is attained if both surfaces are flat and, for most constructions, the members are rectangular. Other materials which may be of use are, for examples, plastic, glass and man-made materials such as laminates or particle boards. The terms mortises and tenons, as used herein, include mortises and tenons which are of cross sectional sizes and shapes requiring that members provided therewith can be joined only with one end of a tenon entered in an end of a mortise with the joint completed by relative sliding movement of the members to a wanted extent. The tenons need not be of the same length as the mortises. Such mortises and tenons are identified as self-locking mortises and tenons and, when either a mortise or a tenon is thus described, the other, without being so identified is also self-locking. The term mortises and tenons also includes those of tongue and groove types with which a joint between two members may be formed either by relative sliding movement of the members with the tenon entered in one end of the mortise or by introducing the tenon laterally into the mortise. As such joints may be separated by pulling them apart, their mortises and tenons are called non-locking mortises and tenons and when either is so described, the other is also non-locking without being so named. Non-locking mortises and tenons may also be of types in which the mortises are short grooves or slots with the tenons being shaped and dimensioned to fit such grooves or, in the case of slots, to extend therethrough. The last member incorporated in an assembly to complete the product is usually locked in place with the locking means between that member and an adjacent, previously secured member. Such locking means may, for example, be a non-locking mortise and tenon if one of the thus connected members is sufficiently flexible to enable the tenon to be entered in the mortise or the locking means may consist of a locking wedge between those members or a pin confined in vertically aligned bores therein. The principles of the invention are most readily appreciated by considering the formation of an article of furniture formed by three members of which one is a first member having both mortises of the self-locking type, a second member has a self-locking tenon extending from one end portion along one side towards but terminating short of the other end portion with the length of the tenon not in excess of the distance from the closed end of the first mortise to the intersection of the mortises so that the tenon may be inserted in the first mortise to connect the second member to the first member without blocking the second mortise in order that the self-locking tenon of a third member may be slid into the second mortise, through the intersection into a position in which it will be held when the second member is slid relative to the first member into a position in which the tenon obstructs the second mortise. When the second member is thus positioned, a projection on said one end portion thereof, which includes a portion of the tenon, extends into or through a slot in the third member which serves as a mortise interconnecting the second and third members and completing the assembly which may be a stand or table. With an additional or fourth member, which is the mirror image of the first member, and with the opposite side portion of the second member provided with a self-locking tenon, identical to the first named mortise of the second member, the second and fourth members are connected as by means such as have been described with articles of furniture assembled from such four members chairs, love seats and sofas. In accordance with the invention, other articles of furniture may be assembled by the use of additional fifth members ranging, for example, from boxes, drawers, bookcases and tables. When a box or drawer is to be made, the two members which are the sides have the first and second mortises with the first mortises being non-locking mortises extending lengthwise of the sides adjacent the bottom of the side margins. The second mortises are self-locking and are located adjacent the front margins of the sides.. Each side has a self-locking tenon adjacent its rear margin which extends from the bottom margin towards but terminates short of the upper margin. The front of the drawer has a self-locking mortise adjacent each end margin which extends from the bottom margin towards but terminates short of the upper margin, the front a transverse, non-locking mortise parallel and close to the bottom margin which opens into each self-locking mortise of the front. The member which is the back has a self-locking tenon at each end extending from the bottom margin towards but terminating short of the upper margin. The bottom of the drawer is dimensioned so that, with the front connected to the sides with the tenons of the back seated in the second mortises of the sides, the first mortises are not obstructed if the tenons of the back are seated against the closed ends of the second mortises of the sides. The sliding entry of the bottom into the first mortises of the sides is then permitted and the seating of the forward end of the bottom in the transverse mortise of the front results in the rearward end of the bottom blocking the second mortises and locking the assembly together. The first members are the drawer sides, the bottom is the second member and the back is the third member and provide the assembly functions of the three members of the previously summarized embodiment. In the manufacture of a table, bookcase or stand, each of the two sides has first and second intersecting, self-locking mortises with the second mortise extending from the upper margin downwardly towards the opposite or bottom margin but terminating short thereof. Each side also has a self-locking tenon extending from the rear margin adjacent the bottom margin which is intersected by the second mortise and terminates short of the front margin. The member which constitutes a shelf has a self-locking tenon at each side margin extending from the rear margin forwardly but terminating short of the front margin. A back has at each side margin a self-locking tenon extending from end to end thereof with the two tenons intersected by a transverse, open ended non-locking mortise adjacent the bottom margin of the back. The last member is the top which has parallel, self-locking mortises commencing at the rear margin and terminating short of the front margin with each mortise disposed to receive and slidably hold the appropriate one of the tenons of the side members. With the shelf in a forward position, the back, when its tenons have been entered in the second mortises of the side member, can be slid downwardly until seated against the bottom of the second mortises with the upper margin of the back slightly below the upper edges of the sides. The first mortises of the sides are then blocked. If the back is raised the shelf may have its tenons entered in the first mortises of the sides until a transverse mortise, opening through the side margins of the shelf underlies the back which, if now lowered, is entered by the bottom margin of the back which then serves as a tenon. The back now holds the shelf against moving and the upper edge of the back and the top are releasably locked together. The intersecting mortises of the side, the shelf and the back have, accordingly, the same assembly functions as in the other embodiments. Tables are shown in the drawings as having similar five members but with the shelf having a transverse, non-locking mortise adjacent its rear margin. The side margins of the back serve as non-locking tenons as the second mortises of the sides are non-locking. The top is similar to the top of the stand or case just summarized but has a transverse non-locking mortise which overlies the second mortises when the top has been slid forwardly as far as possible. With the back raised to permit the shelf to be slid rearwardly, the transverse tenon of the bottom margin of the back, enters the transverse mortise of the shelf with the top margin of the back serving as a tenon entering the transverse, non-locking mortise of the top. It will be appreciated that the two sides, the back and the shelf perform the essential functions of all of the previously summarized embodiments. It is usually desirable to lock completed assemblies against unintended movement of the last member to be connected which then completes the assembly. Such locking can be effected in various ways with each embodiment illustrated by the drawings showing a presently preferred way of so doing. These and other novel features and advantages will be apparent from the accompanying drawings of presently preferred embodiments, the following description thereof and the claims. BRIEF DESCRIPTION OF THE DRAWINGS The foregoing and other objects, features and advantages of the invention will be apparent from the following, more particular description of preferred embodiments of the drawings in which like but distinguished reference characters refer to the corresponding parts throughout the different views. The drawings are not necessarily to scale, emphasis instead being placed upon illustrating the principles of the invention. FIG. 1 is an exploded view of the components by which a table can be formed. FIG. 2 is a perspective view of the partly assembled table. FIG. 3 is a perspective view of the completed table. FIG. 4 is an exploded view of the components enabling a chair, love seat or sofa to be formed therefrom. FIG. 5 is a front perspective view of an assembled chair. FIG. 6 is a perspective view of the chair as seen from the rear. FIG. 7 is a perspective view of an assembled drawer. FIG. 8 is a plan view of the surface of one of the two like side walls showing assembly features. FIG. 9 is a like view of the front wall. FIG. 10 is another like view showing the assembly features of the back wall. FIG. 11 is a plan view of the drawer bottom. FIG. 12 is a fragmentary perspective view showing the completed connection between the back wall and the draw bottom. FIG. 13 is a fragmentary perspective of the back wall and the drawer bottom utilizing a separate-locking element. FIG. 14 is a fragmentary section taken vertically through the back wall and the drawer bottom showing the locking element and the bores for the element. FIG. 15 is a perspective view of a partly completed assembly illustrating yet another construction by which the drawer bottom and back wall can be connected. FIG. 16 is a perspective view of an assembled table in accordance with another embodiment of the invention. FIG. 17 is a perspective view of the two like sides and the shelf before assembly. FIG. 18 is a like view of the two sides joined by the shelf and the back next to be connected to the sides and the shelf. FIG. 19 is another like view but with the back held in place by the sides and shelf and with the top next to be connected to the sides. FIG. 20 is a perspective view of the undersurface of the table top. FIG. 21 is a fragmentary view illustrating the connecting element by which the top is connected to the back then to be held against moving. FIG. 22 is a perspective view of the sides, the shelf and the back separate from each other and showing the self-locking mortise and tenon components of another embodiment of the invention. FIG. 23 is a perspective view of another embodiment of the invention on an increase in scale to show more clearly the position of the back when holding the shelf in its first position. FIG. 24 is a similar view but with the back raised to enable the shelf to be moved into its second position. FIG. 25 is a perspective view of the under surface of the top, FIG. 26 is a perspective and partly exploded view illustrating the addition of attachments to the outer sides of the assembly; and FIG. 27 is a perspective view of the fully assembled table. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS The three ready to assemble components of a table or a stand and the formation of the table therefrom are illustrated by FIGS. 1-3. The three components are shown as flat-surfaced wooden members with one member, the first member 10, constituting the top of the table and the members 11 and 12 constituting, respectively, the second and third members and constituting supports therefor. Each of the three members has a pair of opposite end margins, a pair of opposite side margins and opposite sides bordered by the end and side margins. The table top, the first member 10, is shown as having its undersurface provided with a straight, self-locking mortise 13 which is a dove tail in cross section. The mortise 13 opens through the first end margin 10A and extends towards but terminates short of its opposite or second end margin 10B. The mortise 13 is intersected by a straight self-locking mortise 14 adjacent the end margin 10A, shown as of the same cross sectional shape, which opens through the side margin 10C of the table top 10 and extends towards but terminates short of the opposite side margin 10D. The second member 11 is the first support for the table top 10 and has a non-locking rectangular tenon 15 protruding from its first end margin 11A in a position which renders the length of the first support 11 between the end margin 11A and the opposite or second end margin 11B, when measured along the side margin 11C less than the distance from the extremity of the tenon 15 along the side margin 11D to the end margin 11B. The side margin 11D has a projecting dove tail tenon 16 dimensioned to be in a sliding fit in the self-locking mortise 13 with the tenon 16 terminating short of the second end margin 11B leaving the side margin 11D a flat end margin 17. For reasons which will presently be apparent, the length of the tenon 16 must not exceed the length of the mortise 13 between the closed end thereof and the intersecting mortise 14. The tenon 16 is preferably less than that length. The first step in the assembly of the table is to attach the second member 11 to the table top 10 as by holding the second member 11 in a position such that with the flat end portion 17 of the second member against the table top 10 and the tenon 16 aligned with the mortise 13, the tenon can be slidably entered therein. The second member 11 is then pushed towards the second end margin 10B of the table top 10 until it does not obstruct the mortise 14. That position of the second member 11 is sometimes referred to as its first operative position. The third member 12 is the second support and has a projecting dove tail tenon 18 dimensioned to be slidable in the self-locking mortise 14. The tenon 18 extends from its first end margin 12A along the side margin 12D towards but terminating short of its second end margin 12B thus leaving the side margin 12D with a flat end portion 19. The tenon 18 is intersected by a slot or moritse 20 the depth of which is equal to the width of the rectangular tenon 15 of the first support 11. The table is completed by connecting the third member 12 to the table top 10 by placing the flat end portion 19 thereof against the table top 10 in a position such that the tenon 18 may be slidably entered in the mortise 14. The third member 12 is then pushed towards the side margin 10D of the table top 10 until the tenon 18 is seated against the closed end of the mortise 14. The slot or mortise 20 is then positioned to receive the rectangular tenon 15. The second member 11 is then advanced into a second position towards the first end margin 10A of the table top 10 until the first end margin 11A butts against the third member 12 with the extremity of the tenon 15 exposed through the slot or mortise 20. The assembled table is then turned to be supported by the members 11 and 12 with the side margins 11C and 12C then coplanar. The assembled table can come apart only by returning the second member 12 to its first position. For some uses, the exposed end of the rectangular tenon 15 may be bored to provide a hole 21 which will be sufficiently exposed, when the table is assembled, see FIG. 3, to enable a wedge pin, or key 22 to be driven into it to releasably lock the three members together. In another preferred embodiment, the four ready to assemble components of a chair, love seat or sofa are shown in FIG. 4. These consist of two members 23, 24 which are to serve as the sides of a chair or the ends of a love seat or sofa with each the mirror of the other at least with respect to assembly features. Another member 25 becomes, on assembly, the bottom of such articles of furniture and the member 26 becomes the back thereof. As the only structural difference between the above types of furniture is in the width of their seats and the length of their backs, only the assembled chair of FIGS. 5 and 6 is shown. Each side 23, 24, like the table top 10, has a straight self-locking mortise 27 which extends from its first or rear margin 23A, 24A towards but terminates short of its second or front margin 23B, 24B. Each mortise 27 is intersected by a self-locking mortise 28 extending from the margin of its rear legs 23C, 24C towards but terminating short of its upper margin 23D, 24D. Each side 23, 24 also has a front leg 223C, 224C. The sides 23, 24, due to their similarity to the table top 10, the first member of the embodiment of FIGS. 1-3, are called, for convenience, the first and fourth members, respectively. The seat 25 is shown as having a central recess in its first or rear margin 25A establishing a pair of rectangular, rearwardly disposed marginal portions which also serve as tenons 29. The seat 25 is also comparable to the first table support 11 in that its tenons 30, are self-locking to be slidably confined in the mortises 27 and extend along its side margins 25C and 25D from the end 25A thereof and terminate short of the outer margin 25B and establish flat end portions 31. The length the self-locking tenons 30 is limited by the distances between the closed ends the mortises 27 and the intersecting mortises 28 and, in practice, its length is slightly less than that distance. The seat 25 is sometimes referred to as the second member. To assemble the chair, the first step is to place the flat portion 31 of one side margin 25C, 25D against the inner surface of one chair side 23, 24 with its tenon 30 positioned to be slid into the mortise 27 thereof. The seat 25 is then slid relative to the appropriate one of the chair sides until the associated tenon 30 does not block the associated mortise 28 and then establishes the first position of the seat 25. The other side 23, 24 is then connected to the seat 25 as by placing that side 23, 24 against the exposed flat end portion 31 of the exposed side of the seat with its self-locking mortise 27 held in a position to receive the available tenon 30 as the side 23, 24 being slid is slid towards the rear margin of the seat 25 until it is in a position in which the mortise 28 is not obstructed with the seat 25 then in its first position relative to both sides 23 and 24. The back or fourth member 26 has a self-locking tenon 32 extending along each side edge 26C and 26D from its bottom or first end 26A towards but terminating short of its upper or second end 26B thus establishing flat end portions 26E. Each tenon 32 is intersected by the appropriate one of the transversely aligned slots or mortises 33. Each slot or mortise 33 is dimensioned to slidably receive the appropriate one of the rectangular tenons 29 when the seat 25 is pushed rearwardly from its first operative position into its second operative position with its first end margin 25A butted against the chair back 26. The chair is thus held assembled and is supported by the front and rear legs of the sides 23, 24. Seat and back cushions 34 and 35 are then added. The back and seat may be releasably locked together in the same manner as the second and third members of the previously described embodiment. Another embodiment of the present invention illustrated in FIGS. 7-15 is a drawer or box 110 consisting of five, flat surfaced and rectangular wooden members. Two of the members are sides and as each is the mirror of the other and has the same assembly features, both side walls are generally indicated at 111 and are hereinafter sometimes called side walls or first and fourth members. The assembly features are in the surfaces of the side walls 111 which are the interior surfaces of the assembled drawer 110, see FIG. 8. Such features include a self-locking tenon 112 at the first end margin 111A of each side wall 111 which extends from the bottom margin 111D towards but terminates short of the upper margin 111C. Another assembly feature of each side wall 111 is a self-locking mortise 113 close to and parallel to the second margin 111B which extends through the bottom margin 111D upwardly towards the upper margin 111C but terminates short thereof. In addition, each of the side walls 111 has a groove or channel 114 which is a non-locking mortise, adjacent and parallel to the bottom margin 111D. Each mortise 114 opens through the end margins 111A and 111B and intersect the self-locking mortise 113. A second member, generally indicated at 115, is hereinafter called the front wall and has, see FIG. 9, parallel self-locking mortises 116, one adjacent each of the end margins 115A, 115B. Each self-locking mortise 116 extends from the bottom margin 115D towards but terminates short of the upper margin 115C. The front wall 115 also has a transverse channel or groove 117 adjacent and parallel to the bottom margin 115D and opening into the self-locking mortises 116. On assembly each self-locking mortise 116 receives the appropriate one of the self-locking tenons 112 of the first and fourth members and when these are seated against closed ends of the self-locking mortises, the channels 114 and 117 are in the same plane. As shown in FIG. 7, the front wall 115 is so dimensioned that its end margins 115A, 115B protrude slightly beyond the side walls 111 as is often required of a drawer. The self-locking mortises 116 of the front wall 115 and the self-locking mortises 113 and tenons 112 of the sides 111 are of the same length. A third member becomes the rear or back wall, generally indicated at 118, of the drawer 110 when assembled and has a self-locking tenon 119 at each end margin 119A, 119B. Each self-locking tenon 119, see FIG. 10, extends from the bottom margin 118D of the back wall 118 towards but terminates short of the upper margin 118C. The self-locking tenons 119 are of the same length as the self-locking mortises 113 of the second and fourth members. On assembly, the serf-locking tenons 119 are entered in the open ends of the self-locking mortises 113 and seated against the closed ends thereof. An additional feature of the back wall or third member 118 is that it has a tab or tenon 120 located centrally of the bottom edge 118D. The fifth member, generally indicated at 121, is the base or bottom of the drawer 110 and is of a width, length and thickness to enable its side margins 121C and 121D (see FIG. 11) to serve as tenons to be slidably entered in the non-locking mortises 114 of the sides 111 and advanced therein until the first end margin 121A is seated in the channel 117 of the front wall or second member 115 with the second end margin 121B under and supporting the back wall 118 which is the third member. It will be readily appreciated that the tab 120 of the back wall 118 blocks that path of the drawer bottom 121 when connected to the side walls 111 which are the first members. In practice, the bottom 121 is sufficiently resiliently flexible that it may be centrally depressed manually to an extent such that the drawer bottom 121, the fifth member, can be advanced under the tab 120 to complete the drawer and it will be noted that the drawer bottom 121 has a socket or mortise 122 located to receive the tab 120 once the drawer bottom 121, is in place. The length of the socket is shown as somewhat greater than that of the tab. It is preferred that the socket 122 be offset slightly rearwardly of the tab 120 and that the back wall 118, the third member, be sufficiently resiliently flexible to enable it to be so flexed manually that it snaps into the socket 122 thus exerting pressure, locking and seating the drawer bottom 121 tightly in the channel 117, and locking the assembly together, see FIG. 12. Alternatively, as illustrated by FIGS. 13 and 14, the drawer bottom 121, the fifth member, can have an upwardly opening bore 123 while the back wall 118, the third member, can have a downwardly opening bore 124 which registers with the bore 123 when the drawer bottom 121 is in its seated position. A locking element 125 is dimensioned so that, with one end seated in the bore 123, its other end enters the bore 124 locking the drawer bottom 121 against movement. The locking element 125 may initially be in either bore and is usually a length of metal rod stock so that if contained initially in the bore 124 with the assembly inverted, it will slide into the bore 124 when the assembly is returned to its position for use. For uses where the back wall 118, the third member, has a tab and the drawer bottom has a tab receiving socket and it is not desired to lock the drawer bottom against movement, the self-locking tenons 119 of the back wall 118 are sufficiently shorter than the self-locking mortises 113 of the side walls to permit the back wall 118 to be so raised as to permit the drawer bottom 121 to pass under the tab 120. In another preferred embodiment, the table illustrated by FIGS. 16-21 and generally indicated at 210 in FIG. 16 is assembled, using five flat surfaced, rectangular members provided with the features required for their assembly, in a predetermined manner, to construct tables of various sizes and also bookcases with shelves. The two sides, generally indicated at 211 and the first members, are shown as prefabrications suitable for the use as the sides of tables. As shown, the sides 211 have front and rear supports 212 interconnected by upper and lower cross pieces 213 and 214. The upper edges of the cross pieces 213 are flush with the upper ends of the supports 212 while the lower cross piece 214 of each side is spaced from the bottom ends of the supports so that the latter serve as legs. The cross pieces are interconnected by laterally spaced, vertical members 215. Referring to FIG. 17, the front supports 212 establish the first or front margins 211A of the sides 211 and the rear supports 212 establish the second or rear margins 211B thereof. The upper cross pieces 213 and the adjacent ends of the supports 212 are the first or upper margins 211C of the sides while the bottom margin 211D of each of the lower cross piece 214 defines the second or bottom margin of the sides. The assembly features of each of the sides 211 include a self-locking tenon 216, extending along each upper margin 211C from the rear thereof, and terminating short of the first or front margin 211A to provide a flat surface 217, between the front edge and the proximate end of the tenon 216. The surfaces of the sides 211 which face each other in the assembled table have vertical, self-locking mortises 218, one for each rear support 212 and extending from the upper margin thereof towards the opposite margin but terminating in a plane inclusive of the central portion of the lower cross piece 214. Each side 211 also has a transverse, self-locking mortise 219 opening through the rear margin 211B and extending lengthwise of the lower cross piece 214 and terminating short of the front margin 211A. Each mortise 219 intersects the mortise 218 near the closed end thereof. The shelf, generally indicated at 220, a third member, has self-locking tenons 221 extending from the rear edge 220B towards but terminating short of the front margin 220A. The tenons 221 are shaped and dimensioned to be slidably entered in and confined by the mortises 219 of the sides 211. With the leading edges of the tenons 221 seated against the closed ends of the mortises 219, the trailing ends of the tenons are then close to but not exposed in the mortises 218, see FIG. 18. The shelf 220 is then in a first position permitting use of the unobstructed mortise 218. The back generally indicated at 222, see FIG. 18, is shown as prefabricated and has a self-locking tenon 223 extending the full length of its sides 224 which are interconnected by upper and lower cross pieces 225 and 226. The lower cross piece 226 has a transverse groove or non-locking mortise 227 which is in a plane common to the mortises 219 when the back 222 is in its correct position. The shelf 220 is then pushed slightly rearwardly to seat its rear edge in the channel 227 then to hold the back in place, the rear edge serving as a tongue or non-locking tenon. The top, the fifth member, generally indicated at 228, has parallel self-locking mortises 229 in the upper surface thereof, see FIG. 20, extending from its second or rear margin 228B forwardly but terminating short of the front margin 228A. The mortises 229 are shaped and dimensioned to slidably receive and be held by the tenons 216 (FIG. 19) when the closed ends of the mortises 229 are seated against the ends of the tenons adjacent the first or front ends of the sides 211. It will be appreciated that, while the table 210 as thus described is a complete assembly, there is nothing other than friction to hold the top 228 against moving or being moved forwardly. For that reason, the back 222 is provided with a socket 230, see FIG. 19, so located that when the top is in the assembled position, the socket 23 1 in its under surface is in vertical alignment with the socket 230. In practice, a lock or anchor 232, see FIG. 21, is slidably fitted in the socket 231 and is of such a length that it does not protrude therefrom. By positioning the partly assembled table 210 so that the top 228 can be connected to the sides 211 without having the locking element protruding, the top is slid into place and the now fully assembled table placed upright. The locking element 232 then slides into the socket 230 which is sufficiently shallow so that an anchoring portion still remains in the socket 23 1 thus unifying the assembly. The locking member 232 is preferably a short length of metal rod stock. Should the table be too heavy to be moved conveniently between the above referred to positions, the locking element 232 may be releasably held in place, for example, by a thin metal strip which can be pulled free when the top is in position, then to free the locking element. From the foregoing, the details of construction and the manner in which such articles as bookcases and tables are assembled are readily apparent. It will be appreciated that nothing is exposed that would indicate the assembly feature except when viewed from the back where the mortises and tenons connecting the top and the shelf to the sides can be seen. While the FIGS. 16-21 illustrate a table in accordance with the invention, a similar construction establishes a case such as a bookcase. The embodiment of the invention illustrated by FIGS. 22-27 is generally similar to that of FIGS. 16-21 and also utilizes five flat surfaced members. The illustrated embodiment is a table, generally indicated at 233. Two of the members are of the same size and are the sides or first members of the table and are generally indicated at 234. Except for the legs 235 of the sides 234, all the members are shown as rectangular. The surfaces of the sides 234 which face each other when positioned for assembly are provided with identical assembly features. Two sides 234 are shown in FIG. 22 but the second side is omitted from subsequent figures in order to make clear assembly details and sequences. Among the assembly features are tenons 235. These are of the self-locking type as previously defined and these extend along the upper side margins 234C from the second or rear margins 234B towards but terminate short of the first or front margins 234A to provide a flat surface 234C adjacent the front margin 234A. Each side 234 also has a groove or non-locking mortise 236 adjacent the rear margin 234B opening through the tenon 235 and extending towards but terminating short of the second or bottom margin 234D. The sides 234 also have self-locking mortises 237 extending from the rear margins 234B, intersecting the channels 236 and terminating short of the front margins 234A. The third member is shown as a shelf, generally indicated at 238 and has a self-locking tenon 239 extending along each of its side margins towards but terminating short of the front margin 238A. The tenons 239 are shaped and dimensioned to be entered in the self-locking mortises 237 of the sides 234 to establish concealed, self-locking joints between the sides 234 and the shelf 238. The tenons 239 are of a length such that when their leading ends are seated against the closed ends of the mortises 237, the trailing or rear margin 238B of the shelf 238 is ahead of but close to the non-locking mortises 236, see FIG. 23. In addition, the shelf 238 has a transverse groove or non-locking mortise 240 parallel and close to the rear margin 238B. The fourth member is the back, is generally indicated at 241 and is shaped and dimensioned so that its side margins 241C and 241D serve as tenons to be slidably entered in the non-locking mortises 236 of the sides 234 and so that when the bottom margin 241B of the back 241 is seated against the closed ends of the channels 236, see FIG. 23, the upper or first margin 241A is below the self-locking tenons 235 of the sides 234 and its bottom or second margin blocks the mortises 237 and prevents rearward movement of the shelf 238 from its first operative position. The fifth member is the top, which does not have to be rectangular, is generally indicated at 242 and has a pair of laterally spaced, parallel self-locking mortises 243 in its undersurface, see FIG. 25, extending from the second or rear end 242B towards but terminating short of the front end 242A. The mortises 243 are shaped and dimensioned to slidably receive and retain the tenons 235 of the sides 234 to establish self-locking joints the rear ends of which are visible only when the assembly is viewed from the back of the table but do not protrude. The top 242 also has a channel or non-locking mortise 244 parallel to and close to the rear end 242B and it also opens into the mortises 243 and is dimensioned to receive the upper end 241A of the back 240 as a tongue or non-locking tenon. With the two sides 234 interconnected by the shelf 238 in its first or forward position, see FIG. 23, the back 221 then has its margins 221C and 221D entered in the upper ends of the channels 236 of the sides 234 and slid downwardly until seated in the closed ends thereof. The back 241 then blocks movement of the shelf 238 rearwardly from its first position. It will also be noted, see FIG. 23, that the upper end 241A of the back 240 is below the tenons 235 of the sides 234 permitting the mortises 243 of the top 242 to be brought into slidable engagement with the tenons 235 of the sides 234 and slid rearwardly until the closed ends of the mortises 243 seat against the forward ends of the tenons 235. When the top 242 is thus positioned, the channel 244 is open with respect to the channels 236 of the sides 235. If the back 241 is now raised until its upper end 221A is seated in the channel 244, its second or bottom end 241D is so raised that the shelf 238 can be slid rearwardly from its first position into its second position in which the bottom end 241D of the back 241 can now be seated in the channel 240 of the shelf 238 thus holding the shelf 238 against being moved and supporting the back 241. In addition, the upper or first end 241A of the back 241 is entered in the channel 244 so that the top 242 is now held against being moved so that the several components of an assembly in accordance with this embodiment of the invention are locked together. Referring to FIG. 26, the outer surfaces of the sides 234 can have upwardly opening self-locking mortises 245 extending part way towards the bottom margins for the reception of articles which are to be secured thereto with the ornaments 246 but one example thereof. Each such article has a tenon 237 for entry in the appropriate one of the mortises 245 then to establish a self-locking joint under the top 242. The embodiments of the invention illustrated by FIGS. 16-27 are tables but it will be readily appreciated that bookcases in accordance with the present invention are generally similar except that bookcases utilize a plurality of shelves. While the use of rectangular sides, backs, bottoms and shelves is preferred, such members may have other shapes provided that straight edges are provided which when butted against flat surfaces can be joined by self-locking mortise and tenon joints in some articles of furniture and, by joints of established by non-locking mortises and tenons. From the foregoing, it will be appreciated that tables, bookcases, drawers, chairs, love seats, sofas and the like in accordance with the invention may be of various shapes, materials and designs as long as there are at least three types of members one of which is slidably connected to another for movement between first and second positions, in the first of which a third type of member can be added and in the second position of which the three types become locked together.

Summary: Articles of furniture are formed employing at least three members joined together by mortises and tenons of which one is a first member, when an additional member or members are needed, one such is the mirror image of the first member. In all disclosed embodiments, each first member or members has a first mortise which extends from one end margin at least part way towards the opposite end portion and a second mortise extending from the fist side margin towards the opposite side margin, intersecting the first mortise and extending beyond it. Another member has a tenon, for each first member extending part way along each side margin and is dimensioned to enable it to be entered in a first mortise and slid in one direction towards the opposite end portion of the first member into a position in which the second mortise thereof is unblocked and in the opposite direction into a position blocking the second mortise. An additional member has a tenon for each second mortise and can be slid therein with the another member in its first position and held therein when that member is in its second position, a mortise and tenon that connects said another and additional members. At least one of the mortise and tenon connections is a self-locking connection.

big_patent

en

Summarize: Another city, another referendum for taxpayers to spend tens of millions of dollars on a football stadium -- except this one is for high schoolers. McKinney, Texas, is building a $62.8 million dollar, 12,000-seat stadium for its high school gridders to do battle in, an extravagance 63 percent of voters were apparently just fine with. The stadium would be the most expensive ever built for prep pigskin, barely edging out a $62.5 million, 12,000-seat facility under construction in Katy and a $60 million stadium that opened in Allen in 2014. “We’re visionaries,” McKinney Independent School District Superintendent Rick McDaniel told the Dallas Morning News after local voters passed a $220 million bond issue to fund the stadium and other district improvements. “And we believe we have a vision for McKinney ISD that will propel us forward for a long time.” Expand / Contract The stadium will seat 12,000, and is slated to open in 2017. (MISD) As with pro sports venues that can cost upwards of $1 billion, much of the sales pitch for the high school stadium was about its value as a catalyst for development. Local officials believe it will bring restaurants and retail shops to the town, some 37 miles north of Dallas. Not everyone was thrilled at the expenditure, with Grassroots McKinney campaigning against it. “We’re disappointed,” Mike Giles, one of the group's leaders told the newspaper. “But the people have spoken.” The stadium, which will be the home field for all three of McKinney's high schools, is slated to host its first kickoff in 2017, the same season the stadium under construction in Katy is set to open. Updated at 9:15 p.m. to reflect new results. A majority of voters favored a McKinney ISD bond proposition that includes a 12,000-seat stadium and events center poised at the city’s gateway. Voters headed to the polls Saturday to decide whether or not to support the district’s $220 million bond proposal. It includes a stadium northwest of Central Expressway and State Highway 121 — roughly four miles north of Allen ISD’s mammoth Eagle Stadium. Superintendent Rick McDaniel let out a sigh of relief as the vote “for” results rolled in. “We’re visionaries,” he said of district leaders. “And we believe we have a vision for McKinney ISD that will propel us forward for a long time.” In the last few months, the stadium has garnered significant attention and was a divisive issue among residents. It prompted the formation of two political action committees: pro-bond Vote for McKinney’s Future and anti-bond Grassroots McKinney. “We’re disappointed,” said Mike Giles, a leader of Grassroots McKinney. “But the people have spoken.” Giles said the group now will push to get new people elected to the school board and called the new stadium an “embarrassment.” Because the district has retired old debt, the bond package assumes a 4.5-cent lower tax rate, or $90 per year on a home valued at $200,000. Previously, a 2-cent decrease was estimated. The stadium and attached event center amounts to $50.3 million of the overall package. About $12.5 million left over from the 2000 bond election is planned for stadium infrastructure — roads, water, sewer and electricity. Besides the stadium and events center, nearly one-fifth of the bond included facility upgrades — heating, ventilation and air conditioning replacements; new roofs; and plumbing and electrical work. Other big projects include band hall expansions at Evans and Cockrill middle schools and McKinney Boyd High School and safety and security upgrades. There’s also a plan for the district’s oldest high school to get a new auditorium and acoustics. McKinney High School’s auditorium currently seats about 500 — about half the capacity of auditoriums at McKinney North and McKinney Boyd high schools. For the first time in more than a decade, building a school wasn’t part of the plan. When the district last built a stadium, in 1962, McKinney ISD had about five schools, including one high school. Now, its three high schools share 7,000-seat Ron Poe Stadium, which is on a two-lane road next to the administration building, a middle school and homes. Parking at the stadium is one of the biggest concerns; there are fewer than 400 spots. On Twitter: @NanetteLight

Summary: How much do Texans love football? Nearly two-thirds of voters in McKinney, Texas, just voted to spend $62.8 million on a new high-school football stadium. Fox News reports it will be the most expensive high-school stadium in the country. "We're visionaries," the Dallas Morning News quotes school district superintendent Rick McDaniel as saying. The stadium, which was included in a $220 million school bond measure, will seat 12,000 people and include an events center, the New York Times reports. It will be shared by three high schools. "Down south, football is a really big deal," the chairwoman of a pro-stadium group explains. The vote on Saturday ended months of intense debate. Proponents of the stadium argued it would boost the local economy and turn McKinney into a "destination city." Opponents said it was an "embarrassment" born out of a Friday Night Lights version of keeping up with the Joneses. "They look down and they see Allen," the leader of an anti-stadium group tells the Times. "Allen has a really nice stadium." A high-school stadium recently built just four miles away in Allen, Texas, cost $60 million. Another high-school football stadium currently being built in Katy, Texas, will cost a projected $62 million.

multi_news

en

Summarize: Dr Steven Forde followed a young woman wearing a mini skirt around a city centre, using a James Bond-style spy camera to film her legs, a tribunal heard. A senior doctor who followed a young woman dressed in a mini skirt around a city centre and filmed her using a secret camera hidden in his satchel 'had intended to take pictures of forest scenery', a tribunal heard. Dr Steven Forde, a consultant anaesthetist, was spotted acting suspiciously in York by a security guard, who called in support from the police. When asked what he was doing, Dr Forde, a former RAF medic who once served in Bosnia and Kosovo, is said to have admitted he had been filming the woman for five minutes, using a telescopic lens which protruded through a concealed hole at the bottom of the bag. The married father-of-three, who works at York District Hospital, also told officers that he had filmed women secretively before and that he had a stash of images at home, a medical tribunal heard today. A remote switch used to control the camera was found in the bag's front pocket, it was said. Dr Forde, from Haxby, near York, appeared today for the beginning of a Medical Practitioners Tribunal Service fitness to practice hearing in Manchester, where he faces suspension from the medical register if the allegation of misconduct is proved and deemed to have been sexually motivated. Admitting he had filmed the woman, he told the hearing that he had originally meant to take pictures of trees. 'I was looking for forest scenery. I wanted spring flowers, that sort of scene. I then went to the city centre,' he said. The doctor, 45, claimed the incident followed three'stressful events' in his professional life, including a a formal complaint made against him by a patient who said he was 'rude and aggressive'. He said he had to give evidence at the GMC after a medical student he was in charge of continued onto third year even though he hadn't been signed off. In a third incident he said he had to help transfer a three-week-old baby to Leeds hospital but the baby died. He said: 'I felt like my whole world had collapsed and this was the end and that's it. 'I found the experience one of the most stressful things I've ever done. Those legal practises - most of us are not used to this sort of environment. It doesn't justify what I did, but in my mind the stresses inhibited me from dealing with the behaviour that was causing this.' Explaining how he filmed the young woman, he said: 'I had the camera with me. I only took one lens. It is the lens for pictures in the medium to far distance. 'The camera was in the bottom of the bag. It was a messenger type bag with a side pouch and the camera in the bottom with an aperture cut at the front of the bag for the lens to see through and the lens was covered by a filter and there was a digital viewfinder plugged into the camera and that was hidden in the side pouch.' When asked by his lawyer Mark Ainsworth why the lens was covered by a filter and looking through the front of the bag, he added: 'To conceal the end of it so if somebody looked they wouldn't see what was behind it.' The bag used by Dr Forde, who works at York Hospital (pictured) but is currently suspended, contained a camera with a telescopic lens, a medical tribunal was told. He said he used the video mode on his camera to take moving footage and added: 'I took footage of a woman walking down the pavement through the centre of town. 'The security didn't see me recording the footage at the time but I had already recorded it before he saw me stop on the corner of the street. I went to record a woman walking towards me and I stopped and started to set up the camera up to record. 'It was quite a long sequence I had to go through to switch it on and start recording, switch the viewfinder on and try and find the subject then focus manually with my hand in the bag. So I had gone through this and by which time had changed my mind and decided not to film. I switched it off and carried on walking. 'Then I saw a man run across the street shouting "I'm detaining you for voyeurism" and I believed he must have been watching me earlier in the day when I had recorded the footage. He saw me fiddling with my bag and then I switched it off. 'The phrase legs, skirt and body came from the security man. He told police that's what I was filming but I was also recording her hands, head, feet, fingers - it was a full-length video.' He accepted he hadn't asked the woman for her permission to take the film. Dr Forde was originally charged with outraging public decency by using the concealed camera to take pictures of the woman's legs without her consent. However, he was acquitted of the charge on the day of his trial when prosecutors offered no evidence. Admitting he had filmed the woman, Dr Forde told the tribunal that he had originally meant to take pictures of 'forest scenery' Representing the General Medical Council (GMC), Natasha Tahta said: 'On May 9 last year, Dr Forde was seen by a security guard in York city centre acting suspiciously. 'He was found with a satchel canvas bag which had been adapted to contain a camera with a telescopic lens which protruded between a concealed hole at the bottom. There was a hand-held remote fire switch in the front pouch. 'Two police community support officers attended and they found Dr Forde carrying the bag containing the hidden camera with the telescopic lens and spoke to him. He admitted that he had been filming a young lady for about five minutes and he had done this before and had more images of other females at home. 'In due course he was charged with an offence of outraging public decency then acquitted when the CPS offered no evidence. 'The conduct amounts to misconduct as he videoed the legs and skirt and the lady was in a public place.' Dr Forde, who qualified as a doctor in 1991, was suspended from practicing as a doctor on an interim basis by the GMC after the allegation was made. He qualified as an anaesthetist in 1999 and for several years has held a post in York Hospital's anaesthetics department. He has also worked at York's Clifton Park Hospital. The doctor will give evidence this afternoon. The hearing continues. Sorry we are not currently accepting comments on this article

Summary: Dr Steven Forde filmed a woman's legs using a spy camera, tribunal hears. Anaesthetist was seen following woman wearing mini skirt around York. Camera was hidden in the bottom of his bag, Dr Forde admitted to police. But he claims he had planned on taking pictures of 'forest scenery' He told officers he had a stash of images of women at home, it was claimed. Dr Forde was charged with outraging public decency but was acquitted. He now faces a medical tribunal to decide whether he is fit to practice.

cnn_dailymail

en