Dataset Preview
gem_id (string)gem_parent_id (string)id (string)title (string)paragraphs (sequence)summary (sequence)target (string)references (list)
"animal-train-1"
"animal-train-1"
"2652"
"lytrosis unitaria"
[ "lytrosis (hulst) of louisiana vernon antoine brou jr. 2005. southern lepidopterists' news, 27: 7 .\nlytrosis sinuosa - wings are various shades of brown or yellowish brown with the median area being concolorous with the basal area of the wing .\na revision of the moth genus lytrosis (lepidoptera, geometridae) frederick h. rindge. 1971. american museum novitates, 2474: 1 - 21 .\nphotographs are the copyrighted property of each photographer listed. contact individual photographers for permission to use for any purpose .\nhtml public\n- / / w3c / / dtd xhtml 1. 0 transitional / / en\nurltoken\nupcoming events 2018 bugguide gathering in virginia july 27 - 29: registration and discussion photos of insects and people from the 2015 gathering in wisconsin, july 10 - 12 photos of insects and people from the 2014 gathering in virginia, june 4 - 7. photos of insects and people from the 2013 gathering in arizona, july 25 - 28 photos of insects and people from the 2012 gathering in alabama photos of insects and people from the 2011 gathering in iowa photos from the 2010 workshop in grinnell, iowa photos from the 2009 gathering in washington\ndisclaimer: dedicated naturalists volunteer their time and resources here to provide this service. we strive to provide accurate information, but we are mostly just amateurs attempting to make sense of a diverse natural world. if you need expert professional advice, contact your local extension office .\ncontributors own the copyright to and are solely responsible for contributed content. click the contributor' s name for licensing and usage information. everything else copyright © 2003 - 2018 iowa state university, unless otherwise noted .\neol content is automatically assembled from many different content providers. as a result, from time to time you may find pages on eol that are confusing .\nto request an improvement, please leave a comment on the page. thank you !\nhtml public\n- / / w3c / / dtd html 4. 01 transitional / / en\nurltoken\nonline list of [... ] the geometridae of the world (dec 2007), website (version 01 / 12 / 2007 )\nmaintained by malcolm j. scoble and axel hausmann. online list of valid and available names of the geometridae of the world, urltoken last update december 2007\ndisclaimer: itis taxonomy is based on the latest scientific consensus available, and is provided as a general reference source for interested parties. however, it is not a legal authority for statutory or regulatory purposes. while every effort has been made to provide the most reliable and up - to - date information available, ultimate legal requirements with respect to species are contained in provisions of treaties to which the united states is a party, wildlife statutes, regulations, and any applicable notices that have been published in the federal register. for further information on u. s. legal requirements with respect to protected taxa, please contact the u. s. fish and wildlife service .\nbiokids is sponsored in part by the interagency education research initiative. it is a partnership of the university of michigan school of education, university of michigan museum of zoology, and the detroit public schools. this material is based upon work supported by the national science foundation under grant drl - 0628151. copyright © 2002 - 2018, the regents of the university of michigan. all rights reserved .\nconfused by a class within a class or an order within an order? please see our brief essay .\nto cite this page: myers, p. , r. espinosa, c. s. parr, t. jones, g. s. hammond, and t. a. dewey. 2018. the animal diversity web (online). accessed at https: / / animaldiversity. org .\ndisclaimer: the animal diversity web is an educational resource written largely by and for college students. adw doesn' t cover all species in the world, nor does it include all the latest scientific information about organisms we describe. though we edit our accounts for accuracy, we cannot guarantee all information in those accounts. while adw staff and contributors provide references to books and websites that we believe are reputable, we cannot necessarily endorse the contents of references beyond our control .\nthis material is based upon work supported by the national science foundation grants drl 0089283, drl 0628151, due 0633095, drl 0918590, and due 1122742. additional support has come from the marisla foundation, um college of literature, science, and the arts, museum of zoology, and information and technology services .\nhtml public\n- / / w3c / / dtd xhtml 1. 0 strict / / en\nurltoken\nhodges, r. w. et al. , eds. 1983. check list of the lepidoptera of america north of mexico. e. w. classey limited and the wedge entomological research foundation, london. 284 pp .\ndue to latency between updates made in state, provincial or other natureserve network databases and when they appear on natureserve explorer, for state or provincial information you may wish to contact the data steward in your jurisdiction to obtain the most current data. please refer to\ndistribution data for u. s. states and canadian provinces is known to be incomplete or has not been reviewed for this taxon .\na location where the species occurs or has occurred and where there is potential for persistence or regular recurrence. for most species minimally verification of an adult or larva in association with suitable habitat including larval foodplant. minimum verification standards vary by species from genitalia dissection to decent photographs, but specimens are strongly recommended. it is usually advisable to rear larvae to the adult stage for positive identification .\nmost of these species are more or less landscape level moths that occupy a variety of wooded habitats and often adjacent shrublands and thickets. in the context of habitat separation, suitable habitat includes marginal habitat and unsuitable means sparsely wooded to treeless places without suitable larval foodplant. for the relatively few included species that are specialized feeders forest or woodland where the foodplant is absent or nearly so can be treated as unsuitable habitats. in particular for the obligate conifer feeders, forest tracts in which suitable (for that species) pines, spruces, firs, etc. comprise fewer than 4 canopy trees per hectare may be regarded as unsuitable. see habitat and food comments fields for species - specific information on what constitutes habitat when mapping occurrences .\nmoths in this group typically occur in large habitats (500 to > 100, 000 hectares) at substantial densities (certainly several to many per hectare per year) and utilize dominant or co - dominant trees or understory shrubs for larval foodplants. most species are polyphagous or feed on common trees or shrubs (such as oaks southward or birches northward; westward often a dominant conifer or aspen) or at least on widespread species (such as tulip tree, white pine, hickories in many mixed eastern forests) and are not highly localized. while the suitable habitat figure is arbitrary it takes into account that adults are not especially powerful fliers with most probably flying about a meter per second or about 3. 6 km per hour. they probably do not commonly move far out of forests or at least wooded situations and probably often turn back when they do while on the other hand source populations are probably usually large making isolation of occurrences from each other difficult. most of these moths are widespread within forested habitats and it is very unlikely that two collections only 10 (or even 20) kilometers apart in extensively forested regions would really be separate occurrences - - even if (as will often be true) habitat quality were not uniform .\nthis figure is arbitrary but a circle of two kilometers radius would define a habitat clearly smaller than most, but well above the smallest ones. it is probably unrealistically low in extensively forested areas. this figure should not be used however if forests are reduced to small woodlots and the landscape is more than 50% agricultural or otherwise essentially devoid of native tree cover. in such cases the inferred extent is simply the woodlot in which the collection was made. in general with habitats under 1000 hectares assume full occupancy .\nuse the generic guidelines for the application of occurrence ranks (2008). the key for ranking species occurrences using the generic approach provides a step - wise process for implementing this method .\nzoological data developed by natureserve and its network of natural heritage programs (see local programs) and other contributors and cooperators (see sources) .\nscoble, m. j. (ed .), m. s. parsons, m. r. honey, l. m. pitkin, and b. r. pitkin. 1999. geometrid moths of the world: a catalogue. volumes 1 and 2: 1016 pp. + index 129 pp. csiro publishing, collingwood, victoria, australia .\nthe small print: trademark, copyright, citation guidelines, restrictions on use, and information disclaimer .\nnote: all species and ecological community data presented in natureserve explorer at urltoken were updated to be current with natureserve' s central databases as of november 2016. note: this report was printed on\ntrademark notice :\nnatureserve\n, natureserve explorer, the natureserve logo, and all other names of natureserve programs referenced herein are trademarks of natureserve. any other product or company names mentioned herein are the trademarks of their respective owners .\ncopyright notice: copyright © 2017 natureserve, 4600 n. fairfax dr. , 7th floor, arlington virginia 22203, u. s. a. all rights reserved. each document delivered from this server or web site may contain other proprietary notices and copyright information relating to that document. the following citation should be used in any published materials which reference the web site .\nnatureserve. 2017. natureserve explorer: an online encyclopedia of life [ web application ]. version 7. 1. natureserve, arlington, virginia. available http: / / explorer. natureserve. org. (accessed :\nridgely, r. s. , t. f. allnutt, t. brooks, d. k. mcnicol, d. w. mehlman, b. e. young, and j. r. zook. 2003. digital distribution maps of the birds of the western hemisphere, version 1. 0. natureserve, arlington, virginia, usa .\ndata provided by natureserve in collaboration with robert ridgely, james zook, the nature conservancy - migratory bird program, conservation international - cabs, world wildlife fund - us, and environment canada - wildspace .\npatterson, b. d. , g. ceballos, w. sechrest, m. f. tognelli, t. brooks, l. luna, p. ortega, i. salazar, and b. e. young. 2003. digital distribution maps of the mammals of the western hemisphere, version 1. 0. natureserve, arlington, virginia, usa .\ndata provided by natureserve in collaboration with bruce patterson, wes sechrest, marcelo tognelli, gerardo ceballos, the nature conservancy - migratory bird program, conservation international - cabs, world wildlife fund - us, and environment canada - wildspace .\niucn, conservation international, and natureserve. 2004. global amphibian assessment. iucn, conservation international, and natureserve, washington, dc and arlington, virginia, usa .\ndata developed as part of the global amphibian assessment and provided by iucn - world conservation union, conservation international and natureserve .\nno graphics available from this server can be used, copied or distributed separate from the accompanying text. any rights not expressly granted herein are reserved by natureserve. nothing contained herein shall be construed as conferring by implication, estoppel, or otherwise any license or right under any trademark of natureserve. no trademark owned by natureserve may be used in advertising or promotion pertaining to the distribution of documents delivered from this server without specific advance permission from natureserve. except as expressly provided above, nothing contained herein shall be construed as conferring any license or right under any natureserve copyright .\n). your comments will be very valuable in improving the overall quality of our databases for the benefit of all users." ]
{ "text": [ "lytrosis unitaria , the common lytrosis moth , is a species of moth of the geometridae family .", "it is found in north america , including arkansas , georgia , iowa , massachusetts , new hampshire , new jersey , new york , north carolina , ohio , oklahoma , ontario , pennsylvania , south carolina , tennessee , texas , virginia , west virginia and wisconsin .", "the wingspan is about 50 mm .", "the larvae feed on rosa , crataegus , amelanchier , acer , quercus and viburnum species . " ], "topic": [ 29, 20, 9, 8 ] }
"lytrosis unitaria, the common lytrosis moth, is a species of moth of the geometridae family. it is found in north america, including arkansas, georgia, iowa, massachusetts, new hampshire, new jersey, new york, north carolina, ohio, oklahoma, ontario, pennsylvania, south carolina, tennessee, texas, virginia, west virginia and wisconsin. the wingspan is about 50 mm. the larvae feed on rosa, crataegus, amelanchier, acer, quercus and viburnum species."
[ "lytrosis unitaria, the common lytrosis moth, is a species of moth of the geometridae family. it is found in north america, including arkansas, georgia, iowa, massachusetts, new hampshire, new jersey, new york, north carolina, ohio, oklahoma, ontario, pennsylvania, south carolina, tennessee, texas, virginia, west virginia and wisconsin. the wingspan is about 50 mm. the larvae feed on rosa, crataegus, amelanchier, acer, quercus and viburnum species." ]
"animal-train-2"
"animal-train-2"
"2653"
"abantiades sericatus"
[ "abantiades sericatus tindale, 1932; rec. s. aust. mus. 4 (4): 513; tl: western australia, lake grace\nabantiades sericatus; [ nhm card ]; [ aucl ]; nielsen, robinson & wagner, 2000, j. nat. hist. 34: 856 (list )\nabantiades lineacurva. brookton highway, se of kelmscott, western australia. photo courtesy of paul hutchinson©\nabantiades lineacurva moore & edwards, 2014; aust. ent. 41: 30; tl: western australia, kojonup\nabantiades latipennis tindale, 1932; rec. s. aust. mus. 4 (4): 530; tl: victoria, lorne\nabantiades argentangulum moore & edwards, 2014; aust. ent. 41: 34; tl: yanchep national park, 5mil n of yanchep\nabantiades ocellatus tindale, 1932; rec. s. aust. mus. 4 (4): 514; tl: western australia, denmark\nabantiades marcidus tindale, 1932; rec. s. aust. mus. 4 (4): 515; tl: south australia, adelaide\nabantiades magnificus; [ aucl ]; nielsen, robinson & wagner, 2000, j. nat. hist. 34: 857 (list )\nabantiades fulvomarginatus tindale, 1932; rec. s. aust. mus. 4 (4): 534; tl: western australia, lennox\nabantiades equipalpus moore, 2014; aust. ent. 41 (4): 217; tl: western australia, 2km w of s. bullabulling\nabantiades aurilegulus tindale, 1932; rec. s. aust. mus. 4 (4): 520; tl: western australia ,\ngoldfields\nabantiades ocellatus; [ nhm card ]; [ aucl ]; nielsen, robinson & wagner, 2000, j. nat. hist. 34: 856 (list )\nabantiades marcidus; [ nhm card ]; [ aucl ]; nielsen, robinson & wagner, 2000, j. nat. hist. 34: 856 (list )\nabantiades aurilegulus; [ nhm card ]; [ aucl ]; nielsen, robinson & wagner, 2000, j. nat. hist. 34: 856 (list )\nabantiades latipennis; [ nhm card ]; [ aucl ]; nielsen, robinson & wagner, 2000, j. nat. hist. 34: 857 (list )\nabantiades fulvomarginatus; [ nhm card ]; [ aucl ]; nielsen, robinson & wagner, 2000, j. nat. hist. 34: 857 (list )\nabantiades antenniochrus moore, 2014; aust. ent. 41 (4): 224; tl: western australia, 31. 425653°s, 118. 426902°e, goldfields rd, 400m e of eyre highway, 6. 5km wsw of burracoppin\nabantiades hyalinatus; tindale, 1932, rec. s. aust. mus. 4 (4): 517; [ nhm card ]; [ aucl ]; nielsen, robinson & wagner, 2000, j. nat. hist. 34: 856 (list )\nabantiades labyrinthicus; tindale, 1932, rec. s. aust. mus. 4 (4): 522; [ nhm card ]; [ aucl ]; nielsen, robinson & wagner, 2000, j. nat. hist. 34: 856 (list )\nabantiades leucochiton; tindale, 1932, rec. s. aust. mus. 4 (4): 526; [ nhm card ]; [ aucl ]; nielsen, robinson & wagner, 2000, j. nat. hist. 34: 856 (list )\nabantiades hydrographus; tindale, 1932, rec. s. aust. mus. 4 (4): 528; [ nhm card ]; [ aucl ]; nielsen, robinson & wagner, 2000, j. nat. hist. 34: 857 (list )\nabantiades barcas; tindale, 1932, rec. s. aust. mus. 4 (4): 532; [ nhm card ]; [ aucl ]; nielsen, robinson & wagner, 2000, j. nat. hist. 34: 857 (list )\nabantiades albofasciatus; tindale, 1932, rec. s. aust. mus. 4 (4): 533; [ nhm card ]; [ aucl ]; nielsen, robinson & wagner, 2000, j. nat. hist. 34: 857 (list )\nabantiades aphenges; tindale, 1932, rec. s. aust. mus. 4 (4): 535; [ nhm card ]; [ aucl ]; nielsen, robinson & wagner, 2000, j. nat. hist. 34: 857 (list )\nabantiades (hepialidae); tindale, 1932, rec. s. aust. mus. 4 (4): 510; [ nhm card ]; [ aucl ]; nielsen, robinson & wagner, 2000, j. nat. hist. 34: 856 (list )\nthe female adult moths of this species basically have pale brown forewings with a sinuous pattern of white patches with black outlines, each forewing has two or three orange and blue eyespots. the hindwings are plain pale brown. the head and thorax are black, and the abdomen is brown. the wingspan is about 7 cms .\nthe males are similar, but have white forewings with the sinuous pattern, and have plain white hindwings. the moths have\nvolume 4, part 4 (1932), pp. 513 - 514, figs. 27, 28 .\nconfused by a class within a class or an order within an order? please see our brief essay .\nto cite this page: myers, p. , r. espinosa, c. s. parr, t. jones, g. s. hammond, and t. a. dewey. 2018. the animal diversity web (online). accessed at https: / / animaldiversity. org .\ndisclaimer: the animal diversity web is an educational resource written largely by and for college students. adw doesn' t cover all species in the world, nor does it include all the latest scientific information about organisms we describe. though we edit our accounts for accuracy, we cannot guarantee all information in those accounts. while adw staff and contributors provide references to books and websites that we believe are reputable, we cannot necessarily endorse the contents of references beyond our control .\nthis material is based upon work supported by the national science foundation grants drl 0089283, drl 0628151, due 0633095, drl 0918590, and due 1122742. additional support has come from the marisla foundation, um college of literature, science, and the arts, museum of zoology, and information and technology services .\nmany species show stricking purplish colors at the base of the hindwings and adjacent body that quickly fade in collection specimens. digital photography of fresh specimens is changing perceptions about the appearance of these species .\nexcavate near vertical tunnels that may branch near the ground surface and are almost horizontal when in contact with surface litter. larvae feeding callus formed at localized lesions. the feeding area is sometimes enveloped by callus and larvae continue feeding inside the resulting cavity\nfemale and male. brindabella ranges, new south wales. photo courtesy of david fischer©\nfemale, april 1, 2015, wittlesea, victoria, austrlaia. image courtesy of nick temby©\napril 1, 2015, wittlesea, victoria, austrlaia. image courtesy of nick temby©\ngleneagle state forest, armadale, western australia. 17 march, 2012. photo courtesy of paul hutchinson©\ngleneagle state forest, armadale, western australia. march, 2012. photo courtesy of paul hutchinson©\nholotype swan river, 1869. from oxford university museum. image courtesy of roman yakovlev\nholotype male. collected by nick tenby, ex fabian douglas collection. image courtesy of mike moore\nwe parsed the following live from the web into this page. such content is managed by its original site and not cached on discover life. please send feedback and corrections directly to the source. see original regarding copyrights and terms of use .\n=; [ nhm card ]; [ aucl ]; nielsen, robinson & wagner, 2000, j. nat. hist. 34: 856 (list )\n=; [ aucl ]; nielsen, robinson & wagner, 2000, j. nat. hist. 34: 856 (list )\naustralia (new south wales, victoria, tasmania). see [ maps ]\n=; tindale, 1932, rec. s. aust. mus. 4 (4): 517; [ nhm card ]; [ aucl ]; nielsen, robinson & wagner, 2000, j. nat. hist. 34: 856 (list )\n=; tindale, 1932, rec. s. aust. mus. 4 (4): 517 ♀; [ nhm card ]; [ aucl ]; nielsen, robinson & wagner, 2000, j. nat. hist. 34: 856 (list )\naustralia (queensland, new south wales, victoria). see [ maps ]\n=; tindale, 1932, rec. s. aust. mus. 4 (4): 522 ♂; [ nhm card ]; [ aucl ]; nielsen, robinson & wagner, 2000, j. nat. hist. 34: 856 (list )\n=; tindale, 1932, rec. s. aust. mus. 4 (4): 522; [ nhm card ]; [ aucl ]; nielsen, robinson & wagner, 2000, j. nat. hist. 34: 856 (list )\n=; tindale, 1932, rec. s. aust. mus. 4 (4): 522; [ aucl ]; nielsen, robinson & wagner, 2000, j. nat. hist. 34: 856 (list )\npielus leucochiton pfitzner, 1914; ent. rundschau 31 (17): 95; tl: australia\npielus magnificus lucas, 1898; proc. r. soc. qd 13: 61; tl: australia\npielus hydrographus felder, 1874; reise fregatte novara, bd 2 (abth. 2) (4): pl. 80, f. 3; tl: adelaide\npielus barcas pfitzner, 1914; ent. rundschau 31 (17): 95; tl: australia\npielus albofasciatus swinhoe, 1892; cat. het. mus. oxford (1): 289; tl: swan river\npielus aphenges turner, 1904; trans. r. soc. s. austr. 28: 247; tl: new south wales\n[ maps ] warning! the maps are automatically generated from the textual information, and the process does not always produce acceptable result; see about maps for more info .\nan epitome of the natural history of the insects of new holland, new zealand, new guinea, otaheite and other islands in the indian, sothern and pacific oceans ...\nreise der österreichischen fregatte novara um die erde in den jahren 1857, 1858, 1859 unter den behilfen des commodore b. von wüllerstorf - urbair. zoologischer theil. band 2. abtheilung 2. lepidoptera. rhopalocera\n- 120, (inhalts - verz .) 1 - 9 (pl. 1 - 74), (felder & rogenhofer, 1874), (5): pl .\nsystematische bearbeitung der schmetterlinge von europa, zugleich als text, revision und supplement zu j. hübner' s sammlung europäischer schmetterlinge, sechter un letzter band, 1843 - 1856\n( 1): (i) pl. i (1843), (3): (i) i - ii, pl. ii - iv (1844), (6): (i) pl. v (1844), (7): (i) pl. vi (1844), (8): (i) iii - x, pl. vii - viii (1844), (9): (i) pl. ix - xi (1844), (11): (i) pl. xii (1845), (13): (i) xi - xiv, pl. xiii - xiv (1846), (17): (i) pl. xvi (1846), (22): (ii) pl. i - iii (1847), (35): (i) pl. xv (1848), (36): (i) pl. xvii - xix (1848), (37): (i) pl. xx (1849), (? 38): (i) xv - xviii (1849), (38): (i) pl. xxi - xxii (1849), (40): (ii) i - ii - iv, pl. iv - ix (1849), (48): [\n- 36 (1852), (60): (ii) v - viii, pl. x - xiv (iv) 37 - 40 (1853), (65): (iv )\nrevision of the australian ghost moths (lepidoptera homoneura, family hepialidae) pt. i\nwalker, 1865 list of the specimens of lepidopterous insects in the collection of the british museum list spec. lepid. insects colln br. mus. 31: 1 - 322 ([ 1865 ]), 32: 323 - 706 (1865), 33: 707 - 1120 (1865), 34: 1121 - 1534 ([ 1866 ]), 35: 1535 - 2040 (1866 )\nif you have corrections, comments or information to add into these pages, just send mail to markku savela keep in mind that the taxonomic information is copied from various sources, and may include many inaccuracies. expert help is welcome .\nthis article has been rated as stub - class on the project' s quality scale .\nthis article has been rated as low - importance on the project' s importance scale .\nneed help improving this article? ask a librarian what' s this? at the national library of australia .\ntext is available under the creative commons attribution - sharealike license; additional terms may apply. by using this site, you agree to the terms of use and privacy policy. wikipedia® is a registered trademark of the wikimedia foundation, inc. , a non - profit organization." ]
{ "text": [ "abantiades sericatus is a moth of the hepialidae family .", "it is endemic to western australia .", "the wingspan is about 70 mm .", "adult females have pale brown forewings with a sinuous pattern of white patches with black outlines and two to three orange and blue eyespots .", "the hindwings are pale brown .", "males have white forewings with a sinuous pattern and white hindwings . " ], "topic": [ 2, 0, 9, 1, 1, 1 ] }
"abantiades sericatus is a moth of the hepialidae family. it is endemic to western australia. the wingspan is about 70 mm. adult females have pale brown forewings with a sinuous pattern of white patches with black outlines and two to three orange and blue eyespots. the hindwings are pale brown. males have white forewings with a sinuous pattern and white hindwings."
[ "abantiades sericatus is a moth of the hepialidae family. it is endemic to western australia. the wingspan is about 70 mm. adult females have pale brown forewings with a sinuous pattern of white patches with black outlines and two to three orange and blue eyespots. the hindwings are pale brown. males have white forewings with a sinuous pattern and white hindwings." ]
"animal-train-3"
"animal-train-3"
"2654"
"eupoca haakei"
[ "eupoca haakei is a moth in the crambidae family. it was described by solis and adamski in 1998. it is found at low elevations in south - eastern costa rica .\neupoca haakei is a moth in the crambidae family. it was described by solis and adamski in 1998. it is found at low elevations in south - eastern costa rica .\neupoca micralis is a moth in the crambidae family. it is found in mexico .\neupoca leucolepia is a moth in the crambidae family. it is found in brazil .\neupoca polyorma is a moth in the crambidae family. it is found in venezuela .\nthis page is based on the copyrighted wikipedia article eupoca haakei; it is used under the creative commons attribution - sharealike 3. 0 unported license (cc - by - sa). you may redistribute it, verbatim or modified, providing that you comply with the terms of the cc - by - sa\neupoca bifascialis is a moth in the crambidae family. it is found from southern mexico to north - central argentina .\neupoca sanctalis is a moth in the crambidae family. it is found from central costa rica south to northern colombia .\neupoca chicalis is a moth in the crambidae family. it was described by schaus in 1920. it is found from guatemala south - east to french guiana .\nthirty - one species of glaphyriinae (crambidae: pyraloidea) from costa rica are reviewed, including nine new species: aureopteryx olufsoni, eupoca haakei, glaphyria tetra spina, glaphyria spinacrista, glaphyria stellaspina, glaphyria spinasingularis, lipocosma rosalia, lipocosma pitilla, and lipocosma fonsecai. lipocosma teliferalis dyar is a junior synonym of lipocosma punctissimalis dyar, lipocosma plagalis schaus is a junior synonym of lipocosma ausonialis (druce), and parambia gleanealis dyar is a junior synonym of parambia gnomosynalis dyar. a key to the identification of costa rican species is provided. the presence of a pseudognathos in the male genitalia and modified scales on the area between cua 2 and cup of the hind wing are discussed .\nhtml public\n- / / w3c / / dtd xhtml 1. 0 strict / / en\nurltoken\nurn: lsid: catalogueoflife. org: taxon: 322c1faa - 4e2c - 11e8 - 9ed0 - fa163e792e6e: col20180626\nurn: lsid: catalogueoflife. org: taxon: 322c25e1 - 4e2c - 11e8 - 9ed0 - fa163e792e6e: col20180626\nurn: lsid: catalogueoflife. org: taxon: 322c277b - 4e2c - 11e8 - 9ed0 - fa163e792e6e: col20180626\nurn: lsid: catalogueoflife. org: taxon: 322dd07d - 4e2c - 11e8 - 9ed0 - fa163e792e6e: col20180626\nurn: lsid: catalogueoflife. org: taxon: 32504564 - 4e2c - 11e8 - 9ed0 - fa163e792e6e: col20180626\nurn: lsid: catalogueoflife. org: taxon: 32504772 - 4e2c - 11e8 - 9ed0 - fa163e792e6e: col20180626\nurn: lsid: catalogueoflife. org: taxon: 34c9903c - 4e2c - 11e8 - 9ed0 - fa163e792e6e: col20180626\nbeccaloni g. , scoble m. , kitching i. , simonsen t. , robinson g. , pitkin b. , hine a. & lyal c. (2018). lepindex: the global lepidoptera names index (version 12. 3, jan 2012). in: roskov y. , abucay l. , orrell t. , nicolson d. , bailly n. , kirk p. m. , bourgoin t. , dewalt r. e. , decock w. , de wever a. , nieukerken e. van, zarucchi j. , penev l. , eds. (2018). species 2000 & itis catalogue of life, 30th june 2018. digital resource at urltoken species 2000: naturalis, leiden, the netherlands. issn 2405 - 8858 .\nurn: lsid: catalogueoflife. org: taxon: 50e2c156 - 4e2c - 11e8 - 9ed0 - fa163e792e6e: col20180626\n. if you continue to use the site we will assume that you agree with this .\neol content is automatically assembled from many different content providers. as a result, from time to time you may find pages on eol that are confusing .\nto request an improvement, please leave a comment on the page. thank you !\nreview of the costa rican glaphyriinae (lepidoptera: pyraloidea: cramb\nby m. alma solis and david adamski\nm. alma solis, systematic entomology laboratory, psi, ars, usda, nat. mus. nat. hist. , mrc 168, washington, d. c. 20560 david adamski, systematic entomology laboratory, psi, ars, usda, nat. mus. nat. hist. , mrc 168, washington, d. c. 20560 follow\npublished in j. new york entomol. soc. 106 (1): 1 - 55, 1998 .\nhtml public\n- / / w3c / / dtd html 4. 01 transitional / / en\nurltoken\nnote: you should have a urltoken account to upload new topics and comments. please, create an account or log in to add comments\n* our website is multilingual. some comments have been translated from other languages .\nthere are no photos of this species on the website yet. you can offer your photo by logging into your account\ncurators: konstantin efetov, vasiliy feoktistov, svyatoslav knyazev, evgeny komarov, stan korb, alexander zhakov .\nspecies catalog enables to sort by characteristics such as expansion, flight time, etc. .\nthe length of the forewings is 7. 8 - 9. 5 mm. the ground colour of the forewings is brown mixed with white and pale brown scales. the distal part of the subterminal area is pale brown and the marginal line is brown. the hindwings are pale brown with a brown marginal line .\nlua error in package. lua at line 80: module' module: buffer' not found .\npopular: trivia, history, america, television, tv, usa, geography, world, ... more\nall fasciae on the forewings are dark brown near the costa, except for the light brown basal fascia. the antemedial, postmedial and subterminal lines are faint white .\nthe apical, subapical and tornal areas of the forewings are brown and the medial area is light brown. the antemedial and subterminal lines are white. the hindwings are uniform grey with a narrow marginal line .\npopular: trivia, history, america, television, tv, usa, geography, cities, ... more" ]
{ "text": [ "eupoca haakei is a moth in the crambidae family .", "it was described by solis and adamski in 1998 .", "it is found at low elevations in south-eastern costa rica .", "the length of the forewings is 7.8-9.5 mm .", "the ground colour of the forewings is brown mixed with white and pale brown scales .", "the distal part of the subterminal area is pale brown and the marginal line is brown .", "the hindwings are pale brown with a brown marginal line . " ], "topic": [ 2, 5, 20, 9, 1, 1, 1 ] }
"eupoca haakei is a moth in the crambidae family. it was described by solis and adamski in 1998. it is found at low elevations in south-eastern costa rica. the length of the forewings is 7.8-9.5 mm. the ground colour of the forewings is brown mixed with white and pale brown scales. the distal part of the subterminal area is pale brown and the marginal line is brown. the hindwings are pale brown with a brown marginal line."
[ "eupoca haakei is a moth in the crambidae family. it was described by solis and adamski in 1998. it is found at low elevations in south-eastern costa rica. the length of the forewings is 7.8-9.5 mm. the ground colour of the forewings is brown mixed with white and pale brown scales. the distal part of the subterminal area is pale brown and the marginal line is brown. the hindwings are pale brown with a brown marginal line." ]
"animal-train-4"
"animal-train-4"
"2655"
"polish cochineal"
[ "clockwise: kermes, armenian cochineal, polish cochineal, lac dye and american cochineal .\n], and hence its presence does not exclude the use of polish cochineal, whereas pp6 precludes the american one .\ncollecting cochineal bugs in peruvian highlands. (the collecting cloth is naturally dyed with cochineal. )\nthe scarcity of polish cochineal and its plant host today may be traced to extensive harvesting over the centuries. rather than collect the larvae alone, harvesters uprooted the entire plant. until the introduction of cochineal from the americas in the 16th century, the polish cochineal insect was an important trade commodity .\nchromatograms of the extracts of polish and american cochineal (obtained with ms and spectrophotometric detection) are apparently almost identical (fig .\npolish cochineal is another dye, which was widely used until the mid 19 th century as a textile dye. it was not used as a food dye. polish cochineal is also derived from an insect, the margarodes polonicus, found in eastern europe and parts of asia .\nidentification of polish cochineal (porphyrophora polonica l .) in historical textiles by high - performance liquid chromatography coupled with spectrophotometric and tandem mass spectrometric detection\n]. it is most probably the reason why this dye, obtained from polish cochineal, has not been studied for the last 25 years .\nuv–vis (287, 435, and 495 nm) and ms chromatograms (extracted negative ion) of extract from polish cochineal (cf. table\nidentification of polish cochineal (porphyrophora polonica l .) in historical textiles by high - performance liquid chromatography coupled with spectrophotometric and tandem mass spectrometric detection | springerlink\nan account of the polish cochineal: in a letter to mr. henry baker, f. r. s. from dr. wolfe, of warsaw\napparently identical chromatograms of extracts from american and polish cochineals in the range of 10. 7–12. 0 min are in fact crucial for differentiation between these two natural red dyestuffs. the chromatogram of the extract obtained from polish cochineal consists of peak at t\nparts of this work were presented at ix polish conference on analytical chemistry – poznán, poland .\nhaur jk. dziennik handlowy (in polish). 1787; i - ii: 27–8 .\napart from pp6, the extract of polish cochineal contains another colorant of relatively large concentration, pp7. this compound has been reported previously by wouters and verhecken [\nchemical differentiation between red animal dyes obtained from cochineal scale insects such as polish and american cochineal has been extremely difficult so far, since they have similar composition of their anthraquinone compounds. examination of the extract obtained from polish cochineal by hplc - dad - esi qqq ms allowed identification of 22 color compounds; the structures of 16 among them have not yet been proposed. most of them were\n- hexosides of kermesic and flavokermesic acids or their derivatives. the present paper introduces a fingerprint of color compounds present in polish cochineal and defines them, particularly pp6 (ppi ,\n- hexoside of flavokermesic acid), as its markers allow distinguishing of polish - cochineal reds from the american ones. usefulness of the selected set of markers for identification of polish cochineal has been demonstrated in the examination of textiles from the collection of the national museum in warsaw using the multiple reaction monitoring (mrm) method, originally elaborated on the basis of this study .\ncochineal dye was introduced into europe in the late 1500s by spanish explorers from south and central america. no information was provided on the source or nature of cochineal because the spaniards closely protected their supply. more on the history and origins of cochineal in latin america here dried cochineal looks like small silver - grey peppercorns or plant seeds. before microscopes where in use, european scientists argued for a long time as to whether cochineal was a plant, an animal or a mineral. we now know that cochineal is a female scale insect that lives on prickly pear cactus plants (opuntia or nopal) native to central and south america. scale insects are plant - sucking bugs that are covered by a white fluffy, protective coating and cochineal bugs produce carminic acid as a by - product to deter predators. crimson, fuchsia, raspberry and scarlet reds can be obtained from cochineal. the red colorant is used in drinks (e. g. campari) and in foods (under the code e120), and in drugs and cosmetics. polish cochineal, kermes, lac and st john’s blood are produced from different scale insects that are more or less closely related to true cochineal insects. the term cochineal may be applied either to the living or dried cochineal insects or to cochineal dye which is obtained from them. it takes about 155, 000 cochineal insects to produce 1 kilo of cochineal dye. more on cochineal insects (cochineal bugs or cochineal beetles)? click here .\nłagowska b, golan k, stepaniuk k. wiad entomol (in polish). 2006; 25: 5–14 .\nthese fabrics were dyed in cochineal by judy newland using eco - dye techniques .\n- glycosidic one; thus strong mineral acid causes its hydrolysis and formation of free aglycones more easily. consequently, kermesic and flavokermesic acids were determined in significantly larger amount in polish than in american cochineal .\nscience in the dyepot tiny cochineal insects produce a stunning red that has been valued since ancient times. these cactus - eating scale insects grow on prickly pear cactus right in our neighborhoods, but are cultivated in peru, which produces higher amounts of color. the coccid family includes american cochineal, polish and armenian cochineal, lac, and kermes – all bursting with carminic acid .\n475 → 341, 311, 282) as well, the isomers eluting at approximately the same time. since pp6 (ppi) has already been proposed by us as a marker of polish cochineal, its absence in other extracts suggests that those fibers were probably dyed with american cochineal species (table\nfigures of insects and eggs observed in poland, polish cochineal [ porphyrophora polonica ] or carmine scales. inscribed in pencil with instructions to printers. two sets of drawings mounted on a single backing sheet. plate 10 from the paper “further account of the polish cochineal... ”, by nathaniel matthew wolfe (1724 - 1784), philosophical transactions of the royal society, vol. 54 (1764) pp. 95 - 98 .\n10. 8 min). because of a relatively intensive chromatographic peak of pp6, this compound was proposed as the marker that would allow distinguishing between polish cochineal and other cochineal species. it also has to be noted that comparison of its uv–vis spectrum with the one of ppi presented by wouters and verhecken [\nkuwana. the latter is a new species of cochineal inventoried in algeria. the families of\npolish cochineal (porphyrophora polonica), like kermes and cochineal, are sessile, parasitic scale insects. they live on the roots of various herbs - especially those of the perennial knawel - found in central europe and other parts of eurasia. cochineal was used through the middle ages in the ukraine, lithuania, and eastern europe to supplement or replace the rare and costly kermes red. harvested just before the females reach maturity, usually around the saint’s day of john the baptist, the dye became known as saint john’s blood. polish cochineal was used to dye a variety of natural fabrics. the dye itself contains carminic acid with small amounts of kermesic acid .\nthere are two principal forms of cochineal dye: cochineal extract (e120 (ii) ) is a colouring made from the raw dried and pulverised bodies of insects with around 20% carminic acid; and carmine (e120 (i) ) a more purified colouring made from cochineal .\ncochinea red dye - the use of cochineal beetles as natural fabric dye in chinchero, peru .\nup until the end of the medieval period, the most extravagant, brilliant and enduring crimson red fabrics were dyed with valuable insect dyes: kermes, lac dye and polish and armenian cochineal. symbols of hierarchy and power, crimson... more\ncochineal extract is a bright - red natural dye obtained from the scale insect dactylopius coccus costa, known as american cochineal, and found in tropical and subtropical areas of south america and mexico. 1) the major pigment in cochineal extract is carminic acid (ca), which consists of an anthraquinone aglycone linked to a c - d - glucopyranose unit 2) (fig. 1). the anthraquinone aglycone in ca is kermesic acid, based on a study of european scale insects belonging to the kermes group known as polish cochineal. 3 )\nthe result of the present study clearly indicates that tandem mass spectrometric detection coupled with high - performance liquid chromatography is essential for the unequivocal identification of polish cochineal. the ms / ms fragmentation experiments enable fast and reliable evaluation of even limited number of samples .\na naturally - dyed and handwoven bag from patabamba, peru, using cochineal dyed yarn in lower half .\n]. however, this statistical method requires a large number of reference samples to create a correct model, which seems to be particularly difficult given the limited availability of polish cochineal. the present study demonstrates that detection of minor but characteristic compounds can also be an efficient tool for identification of polish cochineal in the historical samples, especially if access to the respective number of dye samples is restricted. nevertheless, if only appropriate reference materials are available, further studies using pls - da would be undertaken in order to validate the coherence of these two independent approaches .\n], the composition of colorants in polish and armenian cochineals is very similar; in both dyes pp2, pp6, pp7, pp10, or pp12 may be found .\n- glucoside of flavokermesic acid, present mainly in american cochineal). despite nearly the same retention times, they were differentiated on the basis of their different mass and spectrophotometric spectra. even though dcii was not noted in polish cochineal, this compound always accompanied pp6 in the extracts obtained from the historical threads. nonetheless, dcii is not a marker of any dye, and may be present in\nin the eighteenth century cochineal became known in the rest of europe and was much sought after. as demand for cochineal increased stricter laws about the production were enacted, which controlled the purity of the dye and guarded against illegal importation of cochineal. other countries took steps to learn about the cultivation of cochineal to circumvent the virtual monopoly spain had in the cochineal trade. in 1777 the french sent a botanist, thiery de menonville, to oaxaca to observe the production of cochineal. 12 menonville published the findings of his trip in 1787 in a book entitled traité de la culture du nopal et de l' education de la cochenille dans les colonies françaises de l' amérique; précédé d' une voyage a guaxaca. 13 the french attempted to cultivate cochineal in haiti but were unsuccessful. 14\nthe english also made attempts to learn more about the cultivation of cochineal so that they could grow their own crops. the botanist james anderson wrote a series of letters in the 1790s to a colleague in india regarding the importation of cochineal into hindostan. anderson sent samples of the nopal cactus and crates of cochineal bugs from mexico to his contact in india in an attempt to try to establish the cultivation of cochineal there, but the enterprise was ultimately unsuccessful. 15 there were also attempts to import cochineal to south carolina for cultivation. some estimated that one slave could tend to four acres of nopal. another writer suggested that one slave could tend to ten to twelve acres of the plants. the cultivation of cochineal appeared to be a very lucrative enterprise, but the nopal cactus did not take there. 16 in 1828, the dutch succeeded in establishing cochineal in java, but new spain remained the main source of cochineal .\non the populations of mealybugs in our study is the first in algeria. equal distribution of cochineal species is minimal ,\nthe quantitative determination of selected dyestuff components by high performance liquid chromatography, diode - array detection, and post - run data manipulation was used to recognize dyes on historic yarns prepared from dactylopius coccus (american cochineal), kermococcus vermilio (kermes), porphyrophora polonica (polish cochineal), porphyrophora hamelii (ararat cochineal), or kerria lacca (indian lac). study of scale - insect red dyes suggests a rather widespread use of mixed primary sources, not only of insect reds alone, but also in combination with plant reds and tannins .\na prickly pear in the phoenix valley provides a home for cochineal insects covered in a white bloom of very fine hairs .\nbooks for the serious dyer, dominique cardon’s natural dyes is a must read. a classic study is fred gerber’s 1978 book, cochineal and the insect dyes. for a fascinating history of cochineal, read amy butler greenfield’s, a perfect red. for a beautiful look at objects in museum collections, check out cochineal red: the art history of a color by elena phipps\n- d - glucopyranoside of flavokermesic acid (dcofka). its occurrence has already been reported in the case of american cochineal [\nthe presence of 10 species of cochineal (homoptera: coccoidea) belonging to eight genera and four families (table 1) .\ncochineal (dactylopius coccus) is an insect very like the kermes insect, and lives on some cacti or prickly pears. the cochineal beetle is a primarily sessile parasite, feeding on moisture and nutrients in the cacti or prickly pears that form its habitat .\nearly observers were confused about the source of cochineal. some thought the dye came from the seed of a plant while others correctly identified the source of the dye as an insect. 5 cochineal comes from a shield insect similar to the kermes. these insects lay their eggs on the leaves or pencas of the nopal cactus, also known as the prickly pear or indian fig. 6 wild cochineal, also known as grana silvestra, could be harvested up to six times a year. this cochineal was covered with a white hairy powder and produced a higher quality dye. cultivated cochineal, or grana fina, could be harvested three times a year. 7\neuropeans first became aware of cochineal in the new world in 1523 when hernán cortés heard about the existence of nocheztli or grana, which had been used as a dyestuff by the aztec and mexican indians since time immemorial. 3 specimens of cochineal were taken to spain in the 1520s and records show that cloth merchants in antwerp were buying cochineal in insect and powdered form in spain by the 1540s. 4\nas a natural dye, the red from polish cochineal is a mixture of colorants, the composition of which is very similar to other animal red dyes such as american or armenian cochineals. they all contain mainly carminic acid and many minor colorants (i. e. , flavokermesic acid, kermesic acid, dcii, dciv, dcvii) [\ncochineal extract is hydrophilic and stable to heat and light. cochineal extract changes color depending on the ph, without forming a sediment, and therefore it has been widely used as a natural dye for food additives, cosmetics, and pharmaceuticals. 1) however, allergic reactions probably induced by the intake of cochineal extract have been reported, and the reaction is likely triggered by proteins and peptides in the insect, d. coccus. 4 – 6) for this reason, highly purified ca prepared from cochineal extract is often used in food additives. however, further investigation into minor compounds in commercial products is required to maintain the quality assurance of cochineal extract and ensure food safety .\ncochineal remained one of the most important sources of red dyestuffs until the 1850s, when the first synthetic dyes, called aniline dyes, were produced. the introduction of red azo dyes in the 1880s provided a cheaper synthetic alternative to cochineal and production of it essentially ceased. 17\nbrandt (two closely related species) are very similar. moreover, due to the limited availability of polish cochineal caused by decrease in its population and its protection by law, the content of the main colorants determined by the authors of the studies until now constituted the only base for the identification of this dye in pieces of art. in this way\nin addition as a dye for textiles, cochineal became widely used as a food colouring. cakes, cookies, beverages, jam, jelly, ice cream, sausages, pies, dried fish, yogurt, cider, maraschino cherries and tomato products were brightened with it as were chewing gum, pills and cough drops. cosmetic rouge was developed with cochineal as the main ingredient. cochineal is still widely used in cosmetics .\nkawecki z, 1971. a note on some european lecaniidae (coccoidea) with new additions of the austrian, british, italian and polish fauna. bulletin de l’academie polonaise des sciences, 19: 255 - 260 .\nby the seventeenth century the production of cochineal had spread through all of new spain. around 1620, the governor of yucatán, antonio de figueroa had almost three million nopal seeds planted in that peninsula. the production of cochineal was a vital product in the trade between the americas and spain. 10 the cultivation of cochineal spread into central and south america and was successful in honduras, guatemala, san salvador, and nicaragua. 11\nthe aim of the study was to create a fingerprint of color compounds present in polish cochineal and to find its markers, which would allow distinguishing of this dye from other reds of animal origin, primarily american cochineal. for this reason, hplc - uv–vis - esi qqq ms system was used. the compounds separated on a reverse phase phenyl column were detected spectrophotometrically at various wavelengths as well as by the use of mass spectrometer in the negative ion mode under various acquisition conditions. ms detection performed in the full\ncochineal was already used as a colour by the aztec and maya peoples of central and north america. cochineal was a commodity of much value, even comparable to gold. cities send bags of cochineal to the capital tenochtitlán as a yearly contribute to the emperor. the spanish conquerors of central america saw the value of the dye, which produced a much better colour than the dyes used in europe at the time. the dye, which at the time was mainly used in cosmetics and textiles and to a lesser extend in foods, became very popular in europe. roman catholic cardinals robes were coloured with cochineal, as were the jackets of the british military. cochineal was a highly prized product and was regularly traded on the london and amsterdam commodity exchanges. as its origins were not known to most europeans, the american colonists bought their cochineal from europe, instead directly from mexico ...\ncarmine (made from cochineal insects) is much more concentrated than the traditional red dyes of madder root, kermes, polish cochineal and brazilwood. it was in high demand throughout europe, coloring the fabrics of royalty, nobility, and church leaders. for several centuries it was the most important insect dye used in hand - woven oriental rugs. michelangelo used carmine in his paints, and the dye lent distinction to the uniforms of the british redcoats (shown here), the hussars, the turks and the royal canadian mounted police .\nin addition to dye for fabric, cochineal became widely used as a food coloring. cakes, cookies, beverages, jam, jelly, ice cream, sausages, pies, dried fish, yogurt, cider, maraschino cherries and tomato products were brightened with it as were chewing gum, pills and cough drops. cosmetic rouge was developed with cochineal as the main ingredient. but while ever more diverse uses were found for cochineal, it’s origin remained a mystery .\nthis is the name of an azo dye, e124, which bears no resemblance with cochineal, but produces a similar colour, hence the (confusing) name .\ncochineal extract is the concentrated solution obtained after removing the alcohol from an aqueous - alcoholic extract of the dried bodies of a female insect (coccus cactic l .) .\napart from grown dyes, medieval dyers used also local, wild - growing plants, fungi and lichens, and also insects. a widely known dye were the larvae of a local (poland, lithuania, parts of germany) insect called polish cochineal (polish carmine scale) (porphyrophora polonica v. cocus polonicus) that produced a beautiful, rich scarlet. it was exported since the early middle ages to many west european countries. another scale insect producing beautiful shades of scarlet was so called kermes (kermes vermillio), imported to the cities of northern europe from the mediterranean. the use of both these insects were gradually abandoned with introduction of imported cochineal. few centuries earlier no less important dye was tyrian purple, in the times of the roman empire produced from sea snails (murex trunculus, murex brandaris). it was the most expensive dye of the antiquity .\nwitness the beautiful life cycle of a polish cochineal (porphyrophora polonica) and its host plant, the knawel. both are rather unassuming, which helps them avoid predation. the cochineal doesn' t like to bring it, but if forced it will step up (meaning, be chewed thoroughly enough that it releases foul - tasting red liquids .) while bug flour may be the salvation for an overcrowded, resource - depleted world, these critters probably won' t be factor into any waffles or baguettes. (illustration from johann philip breyn' s 1731 historia naturalis cocci radicum tincttorii quod polonicum vulgo audit. )\nin this paper, we described the isolation and structural elucidation of a novel anthraquinone compound, spiroketalcarminic acid (1), as a minor pigment isolated from commercial cochineal extract .\nis a scale insect known as polish cochineal. at times, it has been commercially cultivated to produce a red dye based on its carminic acid content. it was primarily cultivated in the area of eastern europe that now contains poland and ukraine. in the 1400 and 1500s, trade in the dye flourished. trade plummeted when the spanish began to import mexican cochineal from north america in the 1540s. it became no longer profitable to produce the dye and knawel cultivation was replaced by other crops. at the end of the 1700s when trade opened between eastern europe and the orient, the dye was once again in demand and\ncochineal comes from the cochineal insect, which produces carminic acid to protect itself from its insect predators. carmine dye is made from carminic acid, which is extracted from the female beetles’ body and eggs. this deep crimson dye is used to produce scarlet, orange, and other shades of red, and is found in cosmetics and as a food colorant .\none reason cochineal is prized is its stability as a dye. the color remains constant over time, and is one of the most resistant natural colorants to the effects of light, heat and oxidation, even more so than some synthetic colorants. you can identify carmine dyes in food and cosmetics as e120, cochineal, or natural red 4 on packaging labels .\nthe polish cochineal was dried using a lyophilizer, alpha 1–2 ld, martin christ (osterode am harz, germany). extraction of colorants was performed with the use of an ultrasonic bath, branson model 1210 (danbury, ct, usa) as well as with a water bath, memmert wb 10 (schwabach, germany), and the extract was separated from the residue using centrifuge mpw - 350r, mpw med. instruments (warsaw, poland) .\non the 1st july 2016, ttt member ana serrano presented and discussed her phd dissertation, with the title “the red road of the iberian expansion: cochineal and the global dye trade”, which aimed to explore the impact of american cochineal in the global trade, and its importance in the main european and asian textile centres, between the 16th and the 18th centuries .\ncarminic acid of analytical chemical grade was purchased from fluka (buchs, switzerland), kermesic acid was kindly donated by dr. ioannis karapanagiotis (ormylia art diagnosis center, greece), and flavokermesic acid was obtained from a mixture of natural product known as lac dye, which was purchased from kremer - pigmente (aichstetten, germany). polish cochineal was harvested by bożena łagowska and katarzyna golan (department of entomology, university of life sciences, lublin, poland) and kindly donated by jerzy holc (the head of conservation workshop of historical textiles at wawel royal castle, kraków, poland). american cochineal was purchased from kremer - pigmente (aichstetten, germany) .\nhowever, because of health concerns over synthetic colorants and food additives, there is a renewed interest in natural dyes. some artists prefer to use natural dyes, creating a market for carmine oil paints and watercolors. production of cochineal dyes, known to be non - toxic and non - carcinogenic, has once more become viable for applications in medicine, food production, and cosmetics. cactus crops in mexico, guatemala, and the canary islands are in use as commercial cochineal production sites. a small number of people are allergic to cochineal, and react with anaphylactic shock symptoms .\nuntil the end of the 15th century, the richest red fabrics were dyed with kermes, lac dye and polish and armenian cochineal. these insect dyes were collected from plant roots and tree branches growing in certain parts of europe and asia, and they were traded between both continents, by way of major commercial routes, such as the silk road. thus, they travelled great distances to reach the main textile industries, where they were used to colour fine and expensive cloths, meant for the wealthy elites .\nfull citations for books: greenfield, amy butler, 2005, a perfect red, harper perennial, new york. cardon, dominique, 2007, natural dyes, archetype publications, london. gerber, frederick, 1978, cochineal and the insect dyes, ormond beach, fl. phipps, elena, 2010, cochineal red: the art history of a color, yale university press, new haven, ct .\nthe insects are killed by immersion in hot water (after which they are dried) or by exposure to sunlight, steam, or the heat of an oven. each method produces a different colour which results in the varied appearance of commercial cochineal. the insects must be dried to about 30 percent of their original body weight before they can be stored without decaying. it takes about 155, 000 insects to make one kilogram of cochineal .\na multidisciplinary investigation, combining history, textile objects from museum collections, and chemistry, aimed to explore the impact of cochineal as a commercial product in the global circulation of dyestuffs, and its importance in... more\nin this tutorial, it is described step - by - step how to characterize chromatographic results of cochineal dyes found in fibre samples from historical textiles, through models developed with partial - least squares discriminant analysis... more\nin our evaluation of the purities of commercial products of cochineal extract; cochineal extract for food additives, carmine that is an aluminum salt of cochineal extract used as a natural dye for food additives and in cosmetics, 17) and a reagent of ca used as a standard, we found three remarkable minor pigments in all these samples. two of these pigments were identified as known compounds, dciv and dcvii as isomers of ca, by comparing their mass and nmr data with previously reported data. however, the mass spectral data of the other minor pigment did not agree with any previously reported data of minor compounds detected in the extracts of dried insects and traditional art objects .\n] also do not seem to be a solution to the problem of differentiation and identification of cochineal species. despite numerous advantages of these techniques, without separating the components of mixtures they are not able to detect discrete nuances in the composition of minor colorants between different cochineals, especially considering the dominant content of carminic acid in these dyestuffs. however, mass spectrometry coupled with high - performance liquid chromatography has already been used for identification of anthraquinones in american cochineal [\ncochineal it is neither toxic nor known to be carcinogenic. however, the dye can induce an anaphylactic - shock reaction in a small number of people, due to impurities in the preparation, not due to the carminic acid .\nin this tutorial, it is described step - by - step how to characterize chromatographic results of cochineal dyes found in fibre samples from historical textiles, through models developed with partial - least squares discriminant analysis (pls - da). this tutorial has been developed in the framework of the doctoral project “the red road of the iberian expansion: cochineal and the global dye trade”. you may find this tutorial, along with pls - da models, at urltoken .\nharvested cochineal insects were killed by immersion in hot water, steam, or baking in an oven. they were then dried and crushed. this method was developed by the aztec and mayan people of central and north america, where the cochineal insects’ natural cactus habitat is found. after columbus and the colonization of the americas, demand from europe increased the scale of production of this highly prized dye. nowadays, a variety of methods are employed to extract carmine dye .\n- hexosides of kermesic and flavokermesic acids, or deoxyerythrolaccin. five of them (i. e. , pp2, pp6 (ppi), pp7 (ppii), pp10, and pp12) are proposed as specific markers of polish cochineal because of their complete absence in american cochineal and the relatively high intensity of their chromatographic peaks. hence, it can be assumed that these compounds can also participate in the dyeing process by bonding with the fiber via various mordants. as a consequence, they can be detected and identified using advanced techniques, such as hplc - uv–vis or hplc - esi ms / ms. however, they can be observed in the extracts only when mild isolation procedure (with addition of formic acid instead of previously used hydrochloric one) is carried out. particular attention has to be paid to pp6 (ppi ,\nthe aim of this study was to define compounds of porphyrophora polonica l. by hplc - dad - esi qqq ms, and consequently to indicate markers for distinguishing of polish cochineal from other similar dyes of animal origin. the colorants separated on a reverse phase phenyl column were detected spectrophotometrically at 277, 287, 435, 495, and 525 nm, and examined by ms / ms in the negative ion mode. the obtained data formed the basis for the multiple reaction monitoring (mrm) method, used originally for identification of colorants in historical red textiles from the collection of the national museum in warsaw .\nnatural red dyes have long been associated with power and extravagance, as they were expensive to acquire and the dyeing process was complex and required specialized knowledge. until the end of the 15th century, cochineal, kermes and lac... more\ngranara de willink mc, 1998. reubicación sistemática de\nla cochinilla del delta\n( homoptera: coccidae). [ systematic relocation of the\ndelta cochineal\n( homoptera: coccidae). ] insecta mundi, 12: 149 - 153 .\nwhat do we see when we look in our red natural dye pots? passion, fire, fertility, blood, desire? each caldron of color is infused with history, tradition, and cultural meaning—all swirling with stories. the red dyes have invoked strong feelings and cloaked royalty since ancient times and this summer we will explore three red dyes: american cochineals, lac and madder. our cochineal investigation focuses on peru, a country that now produces the largest amount of red cochineal dye in the world .\na multidisciplinary investigation, combining history, textile objects from museum collections, and chemistry, aimed to explore the impact of cochineal as a commercial product in the global circulation of dyestuffs, and its importance in the main centres of textile production in europe and in asia. the outcome brought assertive interpretations about the investigated textiles and the dynamics of american cochineal in european and asian societies. this approach has shown to be a recommendable methodology to adopt in future projects for the characterization of insect dyes in cultural heritage objects .\ncochineal is one of the few natural and water - soluble colorants that resist degradation with time. it is the most light - and heat - stable and oxidation - resistant of all the natural colorants and is even more stable than some synthetic food colours .\napart from the aforementioned novel glycoside compounds, another constituent (co - eluted with pp15 at 27. 4 min) was found in the extract from polish cochineal. its [ m − h ] − ion at m / z 269 gives the ms / ms spectrum almost identical to that of flavokermesic acid, but does not consist of a signal corresponding to the loss of co 2. this similarity allowed its identification as deoxyerythrolaccin (doe, flavokermesic acid without the carboxylic group). this hypothesis seems to be justified by the fact that its o - glycosides (pp2, pp10, pp12, and pp13) are also identified in the extract .\nthe social meaning of textiles cannot be underestimated. all are created within a particular cultural context and reflect ways of thinking and acting on the materials available in that culture. in peru, the making of textiles extends into the deep past and cochineal (cochinilla) has been used in that cloth production since the nasca culture (ad 1 - 700), long before the inca created their brilliant red clothing. the center for traditional textiles of cusco is one peruvian weaving community still producing fine heritage textiles using local cochineal ,\nwith the introduction of commercial synthetic dyes in the late 19th century, the natural dye industry began to diminish. a process that involved the intensive manual labor of breeding the cochineal insects and handpicking them was no competition for laboratory production, which became increasingly inexpensive .\nexplore history once the spanish saw cochineal in the aztec plazas, they cornered the market and funded their empire on the backs of tiny scale insects. cochineal red spread from the americas to europe then to the middle east and textiles colored with this valuable dye can be found in collections all over the world. red was the color at the top of the heap, highly prized and its secrets protected. an in - depth history of this amazing dye can be discovered in amy butler greenfield’s wonderful book, a perfect red .\n; 25: 393–410), but specified only as compounds of unknown structures) that do not occur (e. g. , in american cochineal). the ms / ms experiments, complemented with uv–vis data, enable identification of mono - and di - ,\nyou' ll no doubt recall this comparison of a cochineal dude and dudette from doctor henry hartshorne' s 1881 houshold cyclopedia. females are fat and sedentary, whereas males have peace signs coming out of their butts and die almost instantly after fertilizing their mates' eggs .\nfor this, she undertook a comprehensive revision of historical publications and primary printed sources related to the trade and use of american cochineal as a red textile colorant, as well as of other eurasian insect dyes. since historical information is not always available in the literature, relevant evidence may also be found in the examination of historical textiles. therefore, interpretations based on the historiography were intertwined with luxurious historical textile objects (dating from the 15th to 17th centuries), by following a pioneering chemical method to determine the presence of cochineal on their red colours .\nlecanium persicae goidanichi kawecki, 1962: 17. type data: italy: western alps, cueno, on pinus sylvestris and on viscum album. syntypes, female and first instar. type depository: warsaw: museum of the institute of zoology, polish academy of sciences, poland. described: female and first instar. synonymy by kosztarab & kozar, 1988: 223. notes: syntypes include first and second instar larva .\nin the 19 th century the insects were imported and grown on a large scale on the canary islands and the mexican monopoly came to an end. in 1868, the canary islands exported six million pounds of cochineal, equivalent to 420. 000. 000. 000 insects... .\ntwo mg of lyophilized and ground polish cochineal was extracted with 250 μ l of methanol. the solution was kept in an ultrasonic bath for 15 min, and in a water bath (at 60 °c) for the next 15 min, then filtered over a 0. 22 μ m pet syringe filter. dilution of the extract with water (1: 1, v / v) resulted in immediate precipitation of a white solid, which was separated by centrifugation (10, 000 rpm, 70 min, 21 °c) through amicon ultra - 0. 5 centrifugal filter unit with ultracel - 3 membrane shut - off compounds above 3 kda (merck millipore ltd. , carrigtwohill, ireland). the obtained solution was analyzed as described above .\nana serrano developed a multidisciplinary phd project - combining history, textile objects from museum collections, and chemistry - to explore american cochineal’s long - distance trade between the 16th and the 18th centuries, as well as its impact in european and asian centres of textile production, in relation to traditional dyes .\nnatural red dyes have long been associated with power and extravagance, as they were expensive to acquire and the dyeing process was complex and required specialized knowledge. until the end of the 15th century, cochineal, kermes and lac insects were collected and traded throughout europe and asia. at the beginning of the 16th century, the castilians began exporting american cochineal from mexico, which was richer in colorant than the european and asian insects. this dyestuff became a great success in european and asian centres of textile production, and a lucrative commodity for the economy of the castilian empire throughout the colonial period. this phd project aims to take a closer look at the overall circulation of american cochineal as a commercial product and its dynamics in the process of revolutionizing ancient dyeing practices among 16th‐ and 18th‐century european and asian textile workshops. archlab access provided the opportunity to gain knowledge about the contents of th ...\nthe demand for cochineal fell sharply with the appearance on the market of alizarin crimson and many other artificial (food and textile) dyes discovered in europe in the middle of the 19 th century. trade in cochineal almost totally disappeared in the course of the 20 th century, but in recent years it has become commercially valuable again as many producers (and consumers) prefer natural colours over synthetic colours. however, most consumers are unaware that the ‘natural colouring e120' refers to a dye that is derived from an insect. it is thus not suitable for vegetarians and is banned by some religions .\nwiki user zyance approached this gaggle of giggling bugs on an opuntia cactus, their favorite gathering place. the matchhead - sized females also rebuffed him. the canaries are full of stuck - up cochineal due to the area' s history as a bug ranch. in 1868, locals exported 420 billion of the dye - making insects worldwide .\nextract of american cochineal for comparative analysis was prepared by dissolving 4 mg of dried powder in 1 ml of methanol. in this case, centrifugation was not required as precipitation did nor form. the obtained solution, before further analysis steps, was diluted 30 times with a mixture of methanol and water (1: 1, v / v) .\nnot that you' ve boiled down your dried insects into carmine, you are ready to make some kick - ass tie - dyed shirts or a historical replica of a british army uniform. seriously: the red coats used to march into battle wearing cochineal - bug threads, and the robes of catholic cardinals were buggy, too. (uglyagnes / flickr )\nkermes insects (kermes vermillio, kermes palestinensis) are scale insects from the mediterranean region that are parasitic on several species of dryland oak shrubs. a brilliant red dye is extracted from the shell of the female insects, which huddle immobile in clusters on the wood. their use has been documented since ancient times, when this color was known as the “king’s red” and treasured as a painter’s pigment. the dye is made using kermesic acid, produced by the kermes insects. cochineal replaced kermes as the red dye of choice when it was brought back to europe from the “new world” of america. the dyes are comparable in color quality and intensity, but cochineal dye is 10 or 12 times as effective as the kermes dye .\nmost europeans thought it was extracted from berries or cereals because the dried insects looked like grains of wheat. this misconception was promoted by the spanish, who had launched a brutal cover - up of the dye making process as soon as they realized cochineal’s potential. many new world natives unfortunate enough to have chosen a career in red dye production were simply put to death .\nf or centuries europeans sought the perfect red dye, red being a color much valued and somewhat difficult to obtain. red could be obtained from various plant sources such as madder root and related alizarin - based dyestuffs. the other main source of red came from insects. the best of these insect sources was american cochineal, which provided the best intensity of color and was most readily available. 1 a similar insect dye was known in europe in the form of the kermes insect (kermes vermilio), a shield - louse that lives on the host tree kermes oak. in the later middle ages these insects were gathered commercially in several mediterranean countries and sold throughout europe. kermes dyes have been found in the ecclesiastical burial wrappings in fourteenth and fifteenth - century england, at baynards castle in the fourteenth - century layers, and in anglo - scandinavian york. kermes fell out of use with the introduction of cochineal in the sixteenth century due to the simple fact that, while the two dyes were comparable in quality and color intensity, ten to twelve times as much kermes was needed to produce the same effect as cochineal. 2\nlac insects produce a red dye very similar to those of the cochineal and kermes insects, but are also known for their production of a glassy resin processed to produce shellac. also scale insects, the laccifer lacca or kerria lacca insects secrete a resin to protect themselves between hatching and maturing into adults. they are found in huge colonies on a variety of trees in southeast asia .\nmethanol of lc / ms purity was purchased from poch (gliwice, poland), formic acid (> 99. 5 %) of lc / ms purity, from fisher scientific (fair lawn, nj, usa), and hydrochloric acid (35–38 %) of analytical grade, from applichem (darmstadt, germany). demineralized water was made using milli - q system model millipore elix 3 (molsheim, france). examined fibers were taken from seven polish textiles dated to the 17th–19th century and provided by ewa orlińska - mianowska from the textile division of the national museum in warsaw .\nbetween the end of the 15th century and beginning of the 16th, the portuguese and the spanish expanded their empires to the americas. this eventually led to the exploitation and export of local sources. for instance, while the portuguese soon dedicated to the exploitation of brazilwood, the spanish came to establish a monopoly in american cochineal that was of paramount value, ranking in price after silver and gold among exports to spain .\nthe female insects laid hundreds of eggs on the nopal plant and thirty - five to forty days later the young hatched and fed on the nopal for five months. these insects were then gathered and dried by laying them in the sun or heating them over a low fire. 8 the dried bodies of the insects were then crushed and used with a mordant, in particular tin - chloride, to produce the brilliant cochineal red. 9\nthe purities of cochineal extract, carmine, and ca reagent were evaluated by uplc - pda - esi - tof / ms analysis. we found three remarkable minor pigments in all the samples and these pigments were observed as consecutive peaks on chromatograms (fig. 2). the first and second peaks were identified as two isomers of ca, dciv and dcvii, respectively, by comparing with ms and nmr data reported previously. 13) in aqueous conditions, ca equilibrates with dciv and dcvii and ca is a major compound, since the c - glucose moiety in ca is a stable glucopyranose form, whereas dciv and dcvii are unstable glucofranose forms. a kinetic study using purified dciv and dcvii previously revealed the equilibrium state between ca, dcvi, and dcvii in aqueous conditions. 15) thus, these two isomers (dciv and dcvii) are constitutive minor components of cochineal samples .\ncarmine (derived from cochineal) is used to color food and drinks red. carmine can be found in food such as meat, sausages, processed poultry products (meat products cannot be colored in the united states unless they are labeled as such), bakery products, cookies, desserts, icings, pie fillings, jams, preserves, gelatin desserts, juice beverages, varieties of cheddar cheese, yogurts, ice - cream and other dairy products, sauces and sweets .\nultimately, this has contributed to achieve an unparalleled view of the global circulation of american cochineal in the early modern world, as well as unique perspectives about its overall impact in european and asian dyeing traditions and patterns of consumption of red dye sources. indeed, it became clear that a gradual but clear adoption of this insect dye in europe and in west asia occurred, while local insect dyes kept a representative role in on - going practices, especially in east and southeast asia .\ndye technique various techniques work for the dyeing of materials using cochineal. my favorite method is to grind the dried bugs in a small coffee grinder dedicated to dye materials. weigh the required amount to get the desired shade. boil the ground dye matter for 15 minutes and add a pinch of cream of tartar. strain the liquid into a dyepot. repeat two more times without the cream of tartar, adding water as needed and pouring dye liquid from each boil into the dyepot. this may seem like a lot of work, but will extract the most dye from your precious stash of bugs. add fibers to the dyepot and simmer for at least 30 minutes. leave in the dye bath to cool. this bath can be used repeatedly until the water is clear. water is key in this process. cochineal is extremely sensitive to chemicals in the water. try one bath with your tap water to see the results. clear reds can usually be obtained by using distilled water, including rinsing in distilled water. as with all natural dyeing, experimentation will be your guide." ]
{ "text": [ "polish cochineal ( porphyrophora polonica ) , also known as polish carmine scales , is a scale insect formerly used to produce a crimson dye of the same name , colloquially known as \" saint john 's blood \" .", "the larvae of p. polonica are sessile parasites living on the roots of various herbs — especially those of the perennial knawel — growing on the sandy soils of central europe and other parts of eurasia .", "before the development of aniline , alizarin , and other synthetic dyes , the insect was of great economic importance , although its use was in decline after the introduction of mexican cochineal to europe in the 16th century . " ], "topic": [ 28, 8, 17 ] }
"polish cochineal (porphyrophora polonica), also known as polish carmine scales, is a scale insect formerly used to produce a crimson dye of the same name, colloquially known as " saint john's blood ". the larvae of p. polonica are sessile parasites living on the roots of various herbs — especially those of the perennial knawel — growing on the sandy soils of central europe and other parts of eurasia. before the development of aniline, alizarin, and other synthetic dyes, the insect was of great economic importance, although its use was in decline after the introduction of mexican cochineal to europe in the 16th century."
[ "polish cochineal (porphyrophora polonica), also known as polish carmine scales, is a scale insect formerly used to produce a crimson dye of the same name, colloquially known as \" saint john's blood \". the larvae of p. polonica are sessile parasites living on the roots of various herbs — especially those of the perennial knawel — growing on the sandy soils of central europe and other parts of eurasia. before the development of aniline, alizarin, and other synthetic dyes, the insect was of great economic importance, although its use was in decline after the introduction of mexican cochineal to europe in the 16th century." ]
"animal-train-5"
"animal-train-5"
"2656"
"tenrec"
[ "keeping lesser hedgehog tenrecs in captivity has helped biologists learn much about this tenrec species and tenrec biology in general. there are 4 other species of tenrec that do well in captivity: the common tenrec (the largest tenrec species), the greater hedgehog tenrec (the larger cousin of the lesser hedgehog tenrec) and the 2 species of streaked tenrec (tenrecs with little yellow and black stripes). there is still a vast amount to learn about these species and their wild cousins .\nembed this arkive thumbnail link (\nportlet\n) by copying and pasting the code below. < a href =\nurltoken\ntitle =\narkive species - common tenrec (tenrec ecaudatus )\n> < img src =\nurltoken\nalt =\narkive species - common tenrec (tenrec ecaudatus )\ntitle =\narkive species - common tenrec (tenrec ecaudatus )\nborder =\n0\n/ > < / a >\ntenrec has made managing our site easy and efficient. both our north america and greater china teams rely on tenrec to keep our site updated and secure. ”\nlowland streaked tenrec (hemicentetes semispinosus). photo by rhett a. butler / mongabay\n“we partnered with tenrec several years ago to help us improve both our web site functionality and design. tenrec exceeded our expectations, and consistently provides us with exemplary service. ”\n] was a problem for drawing final conclusions about tenrec colonization timing. it now appears that\ninformation on the common tenrec is currently being researched and written and will appear here shortly .\n[ … ] here and got me interested in the group. the amazing multipurpose tenrec introductory article: tenrec series: the amazing multi - purpose tenrecs eco facts the otter that is notter giant otter - shrews: tenrec series: the otter that is notter eco facts [ … ]\nghr sequences and compare it with the level of molecular divergence displayed within the malagasy tenrec clade .\n] to be the first malagasy tenrec genus to have diverged, its absence from poux et al. [\nthe common tenrec is endemic to madagascar, though has been introduced to nearby islands in the indian ocean .\nan omnivrous species, the common tenrec will eat food such as invertebrates, small mammals, and fruit .\nthe common tenrec is a solitary animal and attempts to avoid conspecifics; with the exception of mother and young .\nlesser and greater hedgehog tenrecs are the only tenrec species completely covered in spines. the spines are modified hairs .\n, the web - footed tenrec, has led to controversies. its specialized morphological features brought some authors to the conclusion that\n“ [ tenrec is ] always available and willing to find cost - conscious ways to bring my ideas to life. without hesitation i trust tenrec with our online reputation and our brand, and those are pretty precious assets for our firm. ”\n]; none comprised a taxon sampling broad enough to delineate the successive tenrec speciation events. the study by douady et al. [\nper and his team are very responsive, organized, and thoughtful. tenrec was able to take our very high - level design concepts and turn them into a well - designed, user - friendly application. most importantly, it is easy and enjoyable to work with tenrec. ”\n]) might help to resolve this issue, and subsequently to understand the morphological evolution of the aquatic specialization of the web - footed tenrec .\n“tenrec has been fantastic to work with on our mini sites. excellent client service and great people. they are a 5 - star vendor! ”\nlesser hedgehog tenrecs are one of 30 species of tenrec found on the island of madagascar. tenrecs are the most diverse mammalian family on the island .\n), and that the semi - aquatic behavior was an example of convergence acquired twice during tenrec evolution [ guth et al. [ 1959 ] in [\none of the most important of the common tenrec' s senses may be the long whiskers and the sensitive hairs on the back; these are used to detect vibrations. the common tenrec' s eyesight is better than that of most tenrecids and may also be an important sense. in addition, observations of captive\nthe common tenrec occurs on madagascar and on the comoro islands, between madagascar and africa. it has been introduced on reunion, mauritius, and the seychelle islands .\nmost of the tenrec species are not well known. scientists have not studied many of the tenrecs in the wild and not many of them are in zoos. the lesser hedgehog tenrec is an exception. the lesser hedgehog tenrec has been kept in captivity since the well - known author and conservationist gerald durrell brought them to the uk in the hope they would breed. in august 1967 they did just that! this was the first recorded breeding in the uk and there were more baby tenrecs to come .\n), which share a shrew - like appearance and a small size, remains more open. most earlier, molecular studies did not include more than five tenrec species [\nto cite this page: gorog, a. 1999 .\ntenrec ecaudatus\n( on - line), animal diversity web. accessed july 09, 2018 at urltoken\nasher rj, hofreiter m: tenrec phylogeny and the noninvasive extraction of nuclear dna. syst biol. 2006, 55: 181 - 194. 10. 1080 / 10635150500433649 .\nour results provide as yet the best resolved gene tree comprising all malagasy tenrec genera, and may lead to a revision of tenrec taxonomy. a timeframe of tenrec evolution built on the basis of this solid phylogenetic framework showed that morphological specializations of the tenrecs may have been affected by environmental changes caused by climatic and / or subsequent colonization events. analyses including various taxon sampling and data partitions allow us to point out some possible pitfalls that may lead to biased results in molecular dating; however, further analyses are needed to corroborate these observations .\nthe common tenrec has been an important food source for the human inhabitants of madagascar for thousands of years. in addition, as an insectivore it undoubtedly reduces the numbers of insect pests .\nasher rj, hofreiter m: tenrec phylogeny and the noninvasive extraction of nuclear dna. syst biol. 2006, 55 (2): 181 - 194. 10. 1080 / 10635150500433649 .\n] in order to compare results inferred from similar datasets and methods). these dates are quite close to the periods of appearance of extant tenrec genera: the radiation of tenrecinae and the split between\n]. the tenrec family (tenrecidae) comprises four subfamilies, the potamogalinae from continental africa, and the tenrecinae, geogalinae and oryzorictinae from madagascar. the malagasy tenrecs are divided into eight genera and 30 species [\n“i have now been through the processes of creating a new website, as well as completely overhauling an existing website, with tenrec. they have been my go - to web and internet resource for seven years and have been extremely helpful. customer service is a top priority for the tenrec team and they excel at client care. i highly recommend them if you are looking for a partner in your project – as opposed to just a vendor. ”\nis nested within the malagasy tenrec clade, and therefore plays no role when estimating the period of colonization. consequently, the window of colonization of madagascar by tenrecs could not be narrowed. as previously concluded in poux et al. [\n“tenrec is an invaluable business partner. our website is engaging with streamlined content and audience - focused design. our experience database and proposal generator are user - friendly technologies that allow me to respond to rfps and pitches quickly and effectively. ”\n). consequently, the results of the latter three studies are, as can be expected, rather similar. the present study, with the broadest taxon and gene sampling, estimates the tenrecs / golden mole split at 69 ± 4 mya, followed by the divergence between african and malagasy tenrecs at 47 ± 4 mya. the malagasy tenrec radiation began 29 ± 3 mya, and several diversification events spread over time gave rise to the totality of malagasy tenrec genera around between 20 ± 1 mya and 7 ± 1 mya (table\n]. furthermore, ka (i. e. , number of nonsynonymous substitutions per nonsynonymous site) and ks (i. e. , number of synonymous substitutions per synonymous site) of pairwise tenrec sequences were calculated using the program codeml from the paml package [\nyou could bring in several different kinds of animals to live in the trees, and the water, and burrow in the ground. or you could bring in the ancestor of the tenrec and wait for it to develop into different kinds of animals that can live in all of those different places .\n“the tenrec team has been doing an amazing job for many years helping us create and maintain our website. the level of knowledge and support is second to none no matter the nature of the issue or project, and it definitely makes my job easier knowing our website is in such good hands. ”\ntenrec has developed and managed numerous fenwick web applications over a 10 year span. they are deeply knowledgeable about online marketing for law firms, so go beyond “mere” coding and work with us to define and meet business goals for their projects. we couldn' t be happier with the results .\ntenrecs are a group of mammals that lives on the island of madagascar off the coast of east africa. there are also a few tenrec species in the forests of central and west africa. people have been very confused about what kind of animals tenrecs are, and even about what groups of animals are tenrecs. this confusion is because there are species of tenrecs that look like many different kinds of animals. some tenrecs have small round bodies with spikes all over them. they look almost exactly like hedgehogs. the fossorial tenrec with the scientific name oryzorictes hova digs in the ground and looks like a mole. there are several tenrec species that look like shrews. along rivers in the rain forests of africa there are three species of tenrecs with body shapes and lifestyles similar to otters. they are called otter - shrews, although they are neither otters nor shrews! for a long time people weren’t even sure that otter - shrews were tenrecs .\nmalagasy tenrecs belong to the afrotherian clade of placental mammals and comprise three subfamilies divided in eight genera (tenrecinae: tenrec, echinops, setifer and hemicentetes; oryzorictinae: oryzorictes, limnogale and microgale; geogalinae: geogale). the diversity of their morphology and incomplete taxon sampling made it difficult until now to resolve phylogenies based on either morphology or molecular data for this group. therefore, in order to delineate the evolutionary history of this family, phylogenetic and dating analyses were performed on a four nuclear genes dataset (adra2b, ar, ghr and vwf) including all malagasy tenrec genera. moreover, the influence of both taxon sampling and data partitioning on the accuracy of the estimated ages were assessed .\nwho are tenrecs related to? because the body shapes of several of the tenrec species resemble hedgehogs and shrews, people thought that tenrecs were related to these groups. scientists now think that this is wrong. by building family trees of mammal groups using genetic material, scientists now think that some of the closest relatives of tenrecs are elephants, aardvarks, and manatees !\nthis species is reported to be common on madagascar, and is not generally believed to be in need of special conservation efforts. introduced rats (genus rattus) may compete with the common tenrec in some circumstances. the iucn rates the species as being of\nleast concern ,\nit' s lowest category, and the species is not listed in the cites treaty .\nhow did this weird group of animals evolve into so many different body shapes and lifestyles? part of what explains the many different kinds of tenrecs is where they live. most tenrec species live on the island of madagascar where they have been for millions of years. dr. p. j. stephenson is a tenrec expert. he explains what happened once the tenrecs arrived in madagascar: “when tenrecs arrived (probably by rafting on logs or floating vegetation) there were no mammals so they evolved to fill many of the available niches. rodents don’t compete directly as they don’t feed on the same things. ” a niche is the way of life of an animal, what it eats and where it lives. in most habitats there are many different kinds of animals that compete for the same kind of niche. when the ancestor of the tenrec arrived on madagascar millions of years ago though there were few mammals to compete with the tenrecs. the tenrecs evolved to take over many different niches that they probably could not have if they had to compete with rodents, moles, shrews, hedgehogs, and other species .\nit is found in all natural forest formations and plantations, farmlands, secondary open wooded grasslands, and has even been recorded from urban centres. the largest tenrec species weighing up to 2 kg. it is omnivorous and enters seasonal torpor. this species has the highest reproductive potential of any mammal; the female gives birth to up to 32 young and may breed twice per year .\nis generally found near water sources in areas with ample brush and undergrowth for cover. it seems to be equally common in inland plateaus and coastal humid forests throughout madagascar, but it is absent in the arid southwestern districts. generally, the common tenrec is found in the eastern rainforests and in the gallery forests that border the river systems of the west. these animals are very common near paddy fields .\n]. these two studies found two different results concerning its phylogenetic position. the first study, comprising three mitochondrial genes (nd2, 12s rrna and trnavaline) and one nuclear marker (vwf exon 28), displayed, in a parsimony framework, the large - eared tenrec as the most basal of all malagasy tenrecs. this result was not influenced by the inclusion of morphological characters in the analyses. asher and hofreiter [\nwithin afrotheria the vast majority of the nodes received a high support, including the grouping of hyrax with sea cow and the monophyly of both afroinsectivora (macroscelidea + afrosoricida) and afroinsectiphillia (tubulidentata + afroinsectivora). strongly supported relationships were also recovered among all tenrec genera, allowing us to firmly establish the grouping of geogale with oryzorictinae, and to confirm the previously hypothesized nesting of limnogale within the genus microgale. the timeline of malagasy tenrec diversification does not reflect a fast adaptive radiation after the arrival on madagascar, indicating that morphological specializations have appeared over the whole evolutionary history of the family, and not just in a short period after colonization. in our analysis, age estimates at the root of a clade became older with increased taxon sampling of that clade. moreover an augmentation of data partitions resulted in older age estimates as well, whereas standard deviations increased when more extreme partition schemes were used .\nthe burrows of the common tenrec are usually near streams and are of two distict types. a hibernating burrow is between one and two meters long. the single entrance is plugged with soil during the period of torpor. the burrows of active common tenrecs are quite different; a y - shaped opening provides two open exit routes. the burrows serve the animals as buffers to extreme temperatures. tenrecs hibernate during the dry autumn months of may through september, when resources are limited. during this period of torpor, their bodies are cold to the touch .\nis one of the largest living insectivores. head and body length ranges from 265 to 390 mm. the coloration of the common tenrec varies geographically from grey - brown to red - brown. pelage is not dense and is a combination of hairs and blunt spines. the young have rows of white spines in longitudinal rows along their backs; these are replaced in the adult by a mane of stiff long hairs. the forelimbs are longer than the hindlimbs. the skull is cylindrical and the snout elongated. females generally have 12 nipples, but up to 29 have been recorded .\nks (i. e. , number of synonymous substitutions per synonymous site) are given in the lower left part of the table and ka (i. e. , number of nonsynonymous substitutions per nonsynonymous site) in the upper right part. the divergence between the two geogale ghr sequences (underligned) is greater than or equal to that between some other tenrec species (bold). geogale a is the sequence from the database (acc. nr. : dq202287), geogale b is our sequence. hemicent. stands for hemicentetes, and m. brevi. for microgale brevicaudata .\nwhen threatened or angered the common tenrec erects the ridge of long hairs on its back and vocalizes with hisses, squeaks, squeals, and\npiff\nsounds. if an animal is surprised in its nest it will display its truly enormous gape. if startled in the open it can run quickly to cover. disturbed young tenrecs produce an audible alarm signal through a process called stridulation, in which bristles on the midback are rubbed together. hearing this sound may cause littermates to scatter and run. stridulation may also help the young to locate one another or the mother to locate her young .\ntiming of tenrec speciation events and madagascar colonization. tree topology as in figure 1. divergence times were estimated from the concatenated dataset by a bayesian relaxed molecular clock method, with six time constraints from fossil calibrations (see material and methods). one of them, the paenungulate radiation is represented on the chronogram. black circles indicate the divergence from the non - malagasy sister group (node 2) and the initial divergence of malagasy tenrecs (node 3). standard deviations are indicated by grey bars, and 95% credibility intervals by open bars. the period of a putative land bridge between madagascar and africa at 45–26 mya [ 53 ] is shaded .\nthe complete phylogeny of the malagasy tenrec genera has now been resolved with strong support. these results should lead to a revision of the taxonomy with regard to the genus geogale (if it comprises more than one species) and the limnogale / microgale clade (if this last genus is truly paraphyletic). this solid phylogenetic and dating framework shows that the major morphological specializations of the tenrecs are not the result of fast adaptive radiations just after colonization, but would as well have been affected by ecological changes caused by climatic and / or subsequent colonization events; however, more work is still needed to understand the role of possible biotic interactions on the speciation processes of malagasy tenrecs .\njaws of tenrec ecaudatus in lateral view. these images demonstrate how adult size in an afrotherian may be reached in the absence of many permanent cheek tooth loci. the old individual above has its complete permanent dentition erupted, showing p4 - m2 worn down to their roots (umzc h5431j, image reversed). the individual below is larger, but retains its deciduous canine through dp4; their permanent successors plus m3 are still unerupted within the dentary (bmnh 70. 3. 10. 4). scale bar (in millimeters) applies to both specimens. the dotted line from the condyle to symphysis on the top specimen represents measure taken of maximum jaw length, quantified in figure 2 .\n]. our data also support these results, as the afrosoricida / macroscelidea clade (= afroinsectivora) is displayed with high confidence (pp = 1. 00 and bp = 93), and tubulidentata is found to be the sister group of this clade (pp = 1. 00 and bp = 95). with a smaller dataset (only one tenrec) the support for the afrosoricida / macroscelidea clade slightly increased (pp = 1. 00 and bp = 96). hence, enlarged taxon sampling cannot explain our strong phylogenetic results within the afrotherian clade. all four genes separately displayed afroinsectiphillia either as paraphyletic or weakly supported therefore the present results are not due to gene sampling biases. the retroposon analyses of nishihara et al. [\nhtml public\n- / / w3c / / dtd xhtml 1. 0 transitional / / en\nurltoken\nwarning: the ncbi web site requires javascript to function. more ...\ndepartment of zoology, university of cambridge, downing st, , cambridge cb2 3ej, uk .\nafrotheria comprises a newly recognized clade of mammals with strong molecular evidence for its monophyly. in contrast, morphological data uniting its diverse constituents, including elephants, sea cows, hyraxes, aardvarks, sengis, tenrecs and golden moles, have been difficult to identify. here, we suggest relatively late eruption of the permanent dentition as a shared characteristic of afrotherian mammals. this characteristic and other features (such as vertebral anomalies and testicondy) recall the phenotype of a human genetic pathology (cleidocranial dysplasia), correlations with which have not been explored previously in the context of character evolution within the recently established phylogeny of living mammalian clades .\nalthough data on the absolute timing of eruption in sengis, golden moles and tenrecs are still unknown, craniometric comparisons for ontogenetic series of these taxa show that considerable skull growth takes place prior to the complete eruption of the permanent cheek teeth. specimens showing less than half (sengis, golden moles) or two - thirds (tenrecs, hyraxes) of their permanent cheek teeth reach or exceed the median jaw length of conspecifics with a complete dentition. with few exceptions, afrotherians are closer to median adult jaw length with fewer erupted, permanent cheek teeth than comparable stages of non - afrotherians. manatees (but not dugongs), elephants and hyraxes with known age data show eruption of permanent teeth late in ontogeny relative to other mammals. while the occurrence of delayed eruption, vertebral anomalies and other potential afrotherian synapomorphies resemble some symptoms of a human genetic pathology, these characteristics do not appear to covary significantly among mammalian clades .\nmorphological characteristics shared by such physically disparate animals such as elephants and golden moles are not easy to recognize, but are now known to include late eruption of permanent teeth, in addition to vertebral anomalies, testicondy and other features. awareness of their possible genetic correlates promises insight into the developmental basis of shared morphological features of afrotherians and other vertebrates .\npmid: 18366669 pmcid: pmc2292681 doi: 10. 1186 / 1741 - 7007 - 6 - 14\nanalyses of character correlation. (a) principal coordinate analysis based on morphological characters from [ 48 ], plus those identified in figure 3. coordinates 1, 2 and 3 explain 35. 5% , 9. 4% and 6. 5% of variation, respectively (other axes do not exceed 5. 2 %). ccd - relevant characters are shown with polygons using abbreviations from figure 3. (b) correlation of number of thoracolumbar vertebrae with ratio of age at female sexual maturity to age at complete dental eruption. line represents least squares fit and does not comprise a significant correlation, remaining insignificant with outliers (petrogale, trichechus, procavia) removed. as in figure 3, dental eruption for the macropodid petrogale is based on p. concinna; vertebral number is based on p. penicillata .\ntraditionally included in the lipotyphla (= insectivora sensu stricto). various molecular studies (madsen et al. , 2001; murphy et al. , 2001 a, b; springer et al. , 1999) and syntheses of morphological and molecular data (asher et al. , 2003; liu et al. , 2001) support a clade containing tenrecs and golden moles, which stanhope et al. (1998) named afrosoricida. this name is inappropriate since this clade does not include soricids, and could lead to confusion with the soricid subgenus afrosorex hutterer, 1986. noting that tenrecomorpha butler, 1972 may be a prior, and more explicit name for this clade following simpson’s (1945) guidelines for naming superfamial taxa, bronner et al. (2003) nevertheless accepted afrosoricida because this name is entrenched in the recent literature .\nfollowing simpson (1931), the term\ntenrecoid\nhas also been widely misused as a general name for a vaguely defined grouping of (extinct and extant) taxa characterized by zalambdodonty, even though it has become clear that some of these were not technically zalambdodont, and that zalambdodonty may have arisen independently several times (e. g. broom, 1916). this further militates against its stricter nomenclatorial use, even at taxonomic ranks below order .\nthe supraordinal affiliation of the afrosoricida remains controversial. molecular data strongly support an affinity within the afrotheria, whereas morphological data suggest a closer relationship to lipotyphlans. lipotyphlan monophyly, however, is only weakly supported by cladistic analyses of morphological data (asher, 1999) and phylogenetic analyses of combined anatomical and molecular data strongly support the inclusion of afrosoricids within afrotheria (asher et al. , 2003) .\nmammal species of the world: a taxonomic and geographic reference (book, 2005) [ worldcat. org ]\nyour web browser is not enabled for javascript. some features of worldcat will not be available .\nyour list has reached the maximum number of items. please create a new list with a new name; move some items to a new or existing list; or delete some items .\nnote: citations are based on reference standards. however, formatting rules can vary widely between applications and fields of interest or study. the specific requirements or preferences of your reviewing publisher, classroom teacher, institution or organization should be applied .\nthe e - mail address (es) field is required. please enter recipient e - mail address (es) .\nthe e - mail address (es) you entered is (are) not in a valid format. please re - enter recipient e - mail address (es) .\ni thought you might be interested in this item at urltoken title: mammal species of the world: a taxonomic and geographic reference author: don e wilson; deeann m reeder publisher: baltimore: johns hopkins university press, ©2005. isbn / issn: 0801882214 9780801882210 0801882389 9780801882388 0801882397 9780801882395 oclc: 57557352\nwilson and reeder' s mammal species of the world is the classic reference book on the taxonomic classification and distribution of the more than 5400 species of mammals that exist today. the third edition includes detailed information on nomenclature and, for the first time, common names. each concise entry covers type locality, distribution, synonyms, and major reference sources. the systematic arrangement of\ninformation indicates evolutionary relationships at both the ordinal and the family level. this indispensable reference work belongs in public and academic libraries throughout the world and on the shelf of every biologist who works with mammals .\n- - publisher' s website .\nplease choose whether or not you want other users to be able to see on your profile that this library is a favorite of yours .\nthis indispensable reference work belongs in public and academic libraries throughout the world and on the shelf of every biologist who works with mammals .\na uniquely valuable compendium of taxonomic and distributional data on the world' s living and historically extinct mammalian species. contributors and editors alike deserve the thanks of all\nadd tags for\nmammal species of the world: a taxonomic and geographic reference\n.\nyou may have already requested this item. please select ok if you would like to proceed with this request anyway .\nwilson and reeder' s mammal species of the world is the classic reference book on the taxonomic classification and distribution of the more than 5400 species of mammals that exist today. the third edition includes detailed information on nomenclature and, for the first time, common names. each concise entry covers type locality, distribution, synonyms, and major reference sources. the systematic arrangement of information indicates evolutionary relationships at both the ordinal and the family level. this indispensable reference work belongs in public and academic libraries throughout the world and on the shelf of every biologist who works with mammals .\n- - publisher' s website .\nworldcat is the world' s largest library catalog, helping you find library materials online. learn more ››\ndon' t have an account? you can easily create a free account .\nthe placental mammalian clade afrotheria is now supported by diverse forms of genomic data, but interordinal relationships within, and morphological support for, the group remains elusive. as a means for addressing these outstanding problems, competing hypotheses of afrotherian interordinal relationships were tested through simultaneous parsimony analysis of a large data set (> 4, 590 parsimony informative characters) containing genomic data (> 17 kb of nucleotide data, chromosomal associations, and retroposons) and 400 morphological characters scored across 16 extant and 35 extinct afrotherians .\nparsimony analysis of extant taxa alone recovered the interordinal topology (afrosoricida, (( macroscelidea, tubulidentata), (hyracoidea, (proboscidea, sirenia) )) ). analysis following addition of extinct taxa instead supported afroinsectivora (afrosoricida + macroscelidea) and pseudoungulata (tubulidentata + paenungulata), as well as tethytheria (proboscidea + sirenia). this latter topology is, however, sensitive to taxon deletion and different placements of the placental root, and numerous alternative interordinal arrangements within afrotheria could not be statistically rejected. relationships among extinct stem members of each afrotherian clade were more stable, but one alleged stem macroscelidean (herodotius) never grouped with that clade and instead consistently joined pseudoungulates or paenungulates. when character transformations were optimized onto a less resolved afrotherian tree that reflects uncertainty about the group' s interordinal phylogeny, a total of 21 morphological features were identified as possible synapomorphies of crown afrotheria, 9 of which optimized unambiguously across all character treatments and optimization methods .\ninstability in afrotherian interordinal phylogeny presumably reflects rapid divergences during two pulses of cladogenesis – the first in the late cretaceous, at and just after the origin of crown afrotheria, and the second in the early cenozoic, with the origin of crown paenungulata. morphological evidence for divergences during these two pulses either never existed or has largely been\nerased\nby subsequent evolution along long ordinal branches. there may, nevertheless, be more morphological character support for crown afrotheria than is currently assumed; the features identified here as possible afrotherian synapomorphies can be further scrutinized through future phylogenetic analyses with broader taxon sampling, as well as recovery of primitive fossil afrotherians from the afro - arabian landmass, where the group is likely to have first diversified .\n], but morphological phylogenetic analyses of the placental mammal radiation continue to favor afrotherian polyphyly [ e. g. , [\n], whereas afrosoricids – which were formerly placed in the order lipotyphla alongside hedgehogs, shrews, moles, and solenodons (now eulipotyphla) – share a number of seemingly primitive morphological features with eulipotyphlans and cretaceous stem placentals. phylogenetic analyses of the longest available concatenation of afrotherian dna sequences [\nanother outstanding problem in afrotherian phylogenetics is the branching order among hyracoidea, proboscidea and sirenia within paenungulata. various types of genomic data have been collected in an effort to resolve paenungulate relationships [\n] that suggest an early preference for semi - aquatic habitus. if tethytheria is monophyletic, this adaptive pattern is best explained as having been due to common ancestry, whereas if the group is paraphyletic, semi - aquatic habitus either evolved convergently in early proboscideans and sirenians, or was an ancestral feature of paenungulata as a whole .\n] that otherwise might attract due to homoplasy rather than homology. the only recent phylogenetic analysis to have scored members of all extant afrotherian orders included only two undoubted fossil afrotherians, however, both of which were extinct paenungulates [\n], and which recovered a macroscelidean - paenungulate clade to the exclusion of perissodactyls and artiodactyls, did not sample aardvarks, tenrecs and golden moles, which lack some or all of the features that support the macroscelidean - paenungulate clade recovered in that study .\n] to create the single largest phylogenetic data set (at least 4, 590 parsimony informative characters) that has yet been brought to bear on the interrelationships of living and extinct afrotherians. included in the morphological partition are new data on recently published afrotherian fossil material from the paleogene of north africa [\n] as well as undescribed late eocene hyracoids, macroscelideans, and afrosoricids from egypt. parsimony analysis of these data reveals a new hypothesis of relationships within afrotheria, and highlights a central role for paleogene\nelephant - shrews\nin afrotherian phylogenetics .\nregardless of how morphological characters were treated [ i. e. , with selected multistate characters either unordered (= ua, unordered analysis), or ordered and scaled (= osa, ordered and scaled analysis) ], simultaneous analysis of extant taxa alone recovered paenungulata, tethytheria, a macroscelidea - tubulidentata clade, and a macroscelidea - tubulidentata - paenungulata clade to the exclusion of afrosoricida (fig .\n). aside from monophyly of paenungulata, these results are at odds with the relationships recovered by amrine - madsen et al. [\n], although among these supraordinal clades only paenungulata had high bootstrap support (fig .\n). with afrosoricida placed as the sister group of all other afrotherians, there was only one unambiguously optimized morphological synapomorphy of afrotheria in the osa (placement of the root of the zygomatic lateral to m3), none in the ua, but 24 (ua) to 30 (osa) ambiguous morphological synapomorphies of that clade. the macroscelidea - tubulidentata - paenungulata clade was supported by 69 (osa) to 71 (ua) ambiguously and 22 (ua) to 26 (osa) unambiguously optimized morphological synapomorphies .\nestimate of afrotherian interordinal phylogeny based on data from extant taxa alone. strict consensus of results from parsimony analyses of extant taxa only with all characters unordered (1 most parsimonious tree (mpt), tree length (tl) = 18428, consistency index (ci) = 0. 52, retention index (ri) = 0. 39, rescaled consistency index (rci) = 0. 26) and with some multistate characters ordered and scaled (1 mpt, tl = 18068, ci = 0. 52, ri = 0. 39, rci = 0. 26). intraordinal relationships are not shown, but in both trees are as in fig. 2. numbers above and below branches are bootstrap support values (1000 replicates) from analysis of the matrix with some multistate characters ordered and scaled (above) and with all multistate characters unordered (below) .\nphylogenetic relationships of living and extinct afrotherians. adams consensus tree summarizing results from parsimony analyses with all characters unordered (12 mpts, tl = 19478, ci = 0. 50, ri = 0. 44, rci = 0. 28) and with some morphological characters ordered and scaled (1 mpt, tl = 18689. 54, ci = 0. 50, ri = 0. 44, rci = 0. 28). branches depicted with dashes break down in the strict consensus of all 13 trees. values above and below branches are bootstrap support (1000 replicates) from analysis of the matrix with some multistate characters ordered and scaled (above) and with all multistate characters unordered (below). herodotiine taxa (alleged stem macroscelideans) are in bold face; asterisks identify\nwild card\ntaxa whose variable positions given different character treatments lead to decreased resolution in the strict consensus tree .\nparsimony analysis following addition of 35 extinct afrotherian species recovered a supraordinal branching pattern that is more consistent with amrine - madsen et al.' s [\n] tree based solely on molecular data. the macroscelidea - tubulidentata clade recovered in the analysis of extant taxa alone breaks down, and macroscelidea joined afrosoricida, forming a weakly supported afroinsectivora. the primary differences from amrine - madsen et al.' s [\n], and of hyracoidea as the sister group of tethytheria rather than of proboscidea alone. outside of paenungulata, the branching order among afrotherians was the same as in amrine - madsen et al.' s [\n] tree, but the root was placed between afroinsectivora and pseudoungulata rather than between afroinsectiphillia and paenungulata. inclusion of fossil taxa led to reduced bootstrap support for both paenungulata and tethytheria, in the former case due in part to the variable placement of the alleged stem macroscelidean\n, which in different equally parsimonious trees emerged as the sister taxon of either pseudoungulata, tubulidentata, paenungulata, or hyracoidea, but never as a sister group of crown macroscelidea. the lower support for tethytheria can be explained by the inclusion of primitive fossil proboscideans and sirenians, which reveal that a number of the apomorphies that were unambiguously optimized as tethytherian synapomorphies in the analysis of extant taxa alone are in fact more parsimoniously explained as homoplasies rather than homologies [ e. g. , [\nalthough it is interesting that the addition of fossil taxa led to an improved fit with the tree derived from maximum likelihood and bayesian analysis of the molecular data alone, closer examination reveals that this most parsimonious topology is not particularly stable. for instance, trees derived from analyses that were constrained to recover the interordinal arrangement (afrosoricida, (paenungulata, (macroscelidea - tubulidentata) )) were only two steps longer than the unconstrained tree, and could not be statistically rejected; nor could the alternative arrangement of a monophyletic afroinsectiphillia containing afroinsectivora (table\n). none of the three possible arrangements of the paenungulate orders were either well supported or rejected by statistical tests, and even afrosoricid diphyly (e. g. , with either tenrecoidea or chrysochloridae placed as the sister taxon of macroscelidea) could not be rejected (table\n' s placement as a stem sirenian in the present analysis. deletion of basal eocene taxa, such as the herodotiines\nstatistics for most parsimonious trees derived from analyses that were constrained to agree with alternative phylogenetic hypotheses. consistency index excludes uninformative characters. value for templeton test (p, calculated in paup 4. 0b10) is the probability of finding a more extreme t - value under the null hypothesis of no difference between the two trees (two - tailed test), arbitrarily calculated by comparing the first tree in each of the two alternative tree lists. results in bold are those that are present in the adams consensus of all equally parsimonious trees. os = ordered and scaled analysis; u = unordered analysis; na = not applicable .\ninterordinal relationships within afrotheria from (above) analyses constrained to agree with the alternative hypotheses exafroplacentalia (afrotheria, (boreoeutheria, xenarthra) ) and atlantogenata (boreoeutheria, (afrotheria, xenarthra) ), and (below) analyses run following deletion or addition of various extinct taxa. results followed by an asterisk are those that occur in the adams consensus of all equally parsimonious trees (the strict consensus of which was less resolved than the optimal topologies based on analyses including all taxa). os = ordered and scaled analysis; u = unordered analysis .\nthe phylogeny of the diverse paleogene paenungulate radiation has never been analyzed within the context of afrotherian monophyly. one of the novel results of this analysis is the placement of enigmatic\n], was placed as the sister group of elephantiforms to the exclusion of all other eocene taxa .\n] as the sister group of all younger hyracoids. in contrast to previous studies that positioned\n, including cranial remains, helps to place that genus as the sister taxon of crown macroscelidea with strong bootstrap support (fig .\nwas consistently placed alongside\npseudoungulates\nrather than macroscelideans (see discussion below). a placement of both herodotiines as stem macroscelideans could not be statistically rejected, however (table\n– does not alter the scheme of interordinal relationships supported by the full taxon set. regardless of how characters are treated ,\ndespite the placement of afrosoricids with macroscelideans in the analysis of living and extinct taxa, under this arrangement afrotherian monophyly is not unambiguously supported by any of the\nproto - ungulate\nfeatures that macroscelideans share with aardvarks and paenungulates. in fact the existence of any unambiguous morphological character support for afrotheria given this tree is dependent on whether delayed or accelerated optimization is used; under delayed transformation, there are four unambiguous synapomorphies of afrotheria regardless of how multistate characters are treated (presence of a naviculocalcaneal facet, scattered vomeronasal organ blood vessels [\n]). an additional four features [ presence of a small p3 protocone, presence of well - developed buccal cingula rather than stylar shelves, increase in lumbar vertebra number from 6 to 8, and testicondy (intrabdominal testes) ] emerge as unambiguous synapomorphies depending on treatment of certain multistate characters. under accelerated transformation, there are no unambiguous afrotherian synapomorphies, but there are 31 (osa) and 33 (ua) ambiguous synapomorphies of that clade .\ngiven that there can be little confidence in any of the proposed arrangements of afrosoricida, macroscelidea, or tubulidentata within afrotheria, an alternative, and perhaps more conservative, approach is to optimize characters onto an afrotherian phylogeny that is less resolved at the supraordinal level. with macroscelidea, tubulidentata, afrosoricida, and\n). of these characters, nine are congruently optimized as afrotherian synapomorphies regardless of how transformations are optimized (accelerated or delayed) or how multistate characters are treated (ordered and scaled or unordered) .\ncharacter state changes identified as unambiguous morphological synapomorphies of afrotheria when relationships among afrosoricida, macroscelidea, paenungulata, and tubulidentata are depicted as unresolved. osa _ at = ordered and scaled analysis, accelerated transformation; osa _ dt = ordered and scaled analysis, delayed transformation; ua _ at = unordered analysis, accelerated transformation; ua _ dt = unordered analysis, delayed transformation .\nthe instability of afrotherian interordinal relationships is remarkable given that all of the analyses performed here included at least 4, 590 parsimony informative molecular and morphological characters. molecular divergence estimates clearly indicate that cladogenesis among the stem lineages of tubulidentata, macroscelidea, afrosoricida, and paenungulata occurred rapidly, and probably in the latest cretaceous; according to the recent estimates provided by murphy et al. [\n], these clades had all diverged within the first 5 million years of crown afrotherian evolution. morphological evidence for these supraordinal divergences either did not accumulate along these short internal branches, or was subsequently\nerased\nby evolution along the much longer branches leading to ordinal crown clades .\nconsiderable ambiguity is introduced by missing data and different methods for optimizing character states onto slightly different afrotherian phylogenies, but it remains distinctly possible that there are a number of morphological synapomorphies of crown afrotheria, and that the ancestral crown afrotherian more closely resembled a\nproto - ungulate\nthan an\ninsectivore\n. for instance, some of the only character transformations that consistently optimized unambiguously onto the afrotherian stem on the less resolved tree (table\n. with characters unordered, the ancestral afrotherian is also reconstructed as having no parastyles and well - developed buccal cingula rather than stylar shelves, which again suggests that afrosoricids (which do have parastyles and stylar shelves) have undergone reversals to the dental character states observable in more primitive cretaceous placentals .\n) is placed in afroinsectivora with macroscelideans. herodotiine diphyly is probably an artifact of missing data, but the distribution of herodotiines on both sides of the afrotherian tree again lends some support to the idea that the paenungulate - like dental morphology of herodotiines may be primitive within afrotheria. the most likely explanation for herodotiine diphyly is that, in known parts ,\nhas somewhat paenungulate - like anterior premolars and incisors (personal observation). if some uniformity of herodotiine morphology is assumed and\nare assigned the character states of the herodotiine taxon that preserves those parts, then these taxa together join tubulidentata (osa) or pseudoungulata (ua adams consensus), but never macroscelidea, in parsimony analyses of the data set presented here. additional cranial or postcranial morphology of herodotiines should play a key role in future efforts to tease apart homology and homoplasy among early afrotherians: if herodotiines are in fact stem macroscelideans within afroinsectivora, then their detailed dental resemblances to paenungulates will either not be present in older and more primitive stem macroscelideans, or these features will emerge as plesiomorphic within afroinsectivora and afrotheria and will support a proto - ungulate origin for both clades .\nof the remaining morphological features that support afrotherian monophyly on the less resolved tree, none clearly point to either a\nproto - ungulate\nor\ninsectivore\norigin for the clade. under delayed transformation, at least one morphological feature that was previously thought to be a synapomorphy of paenungulata (loss of lunar - unciform contact) [\n] instead appears as a synapomorphy of afrotheria as a whole. other features that have already been identified as probable afrotherian synapomorphies, such as increased lumbar vertebral number [\n] also optimize unambiguously as afrotherian synapomorphies across all or most assumption sets. presence of a contact between the navicular and calcaneus, which occurs in proboscideans ,\n, and aardvarks as well as some macroscelideans, tenrecs, golden moles, and fossil hyracoids, is here identified for the first time as another possible morphological synapomorphy of crown afrotheria .\nthere are a few obvious deficiencies of the present study, some of which should be improved upon in future analyses. one obvious improvement that can be made is greater taxon sampling within placentalia (and mammalia more broadly), including a greater diversity of cretaceous mammals, as all such taxa should help to clarify ancestral character states for crown placentalia. one obvious criticism of the equally - weighted total evidence approach taken here is that\nrare genomic changes\n( rgcs) such as retroposons and chromosomal syntenies have been given equal weight to point mutations in dna sequences, the latter of which are surely much more prone to homoplasy [\n]. unfortunately there is no clear solution to this practical problem aside from arbitrary weighting of rgcs – which, in the absence of a strong theoretical framework for predicting the relative likelihood of, for instance, chromosomal rearrangements relative to point mutations, is here considered to be an untenable approach. the same criticism can certainly also be raised regarding delimitation and treatment of morphological characters (many of which may be of low phylogenetic utility), however the same problem holds [\n]; thus far, however, bayesian analyses of the current data set have failed to achieve convergence despite considerable computational effort, presumably due in large part to the numerous genomic and morphological characters missing in fossil taxa .\nsimultaneous analysis of ≤ 4, 590 parsimony informative genomic and morphological characters scored across 16 extant and 35 extinct afrotherians recovers a monophyletic afroinsectivora (afrosoricida + macroscelidea), pseudoungulata (tubulidentata + paenungulata), and tethytheria (proboscidea + sirenia) within paenungulata. none of these supraordinal clades are well - supported, however, and phylogenetic alternatives such as afroinsectiphillia, a (paenungulata, (macroscelidea, tubulidentata) ) clade, an afrosoricida - tubulidentata clade, afrosoricid diphyly, a hyracoidea - proboscidea clade, and a hyracoidea - sirenia could not be statistically rejected .\ndivergences among afrosoricida, macroscelidea, paenungulata, and tubulidentata must have occurred very rapidly in the late cretaceous, and unambiguous morphological evidence for afrotherian supraordinal clades aside from paenungulata either does not exist or has been overwritten by subsequent evolution through the cenozoic. on the optimal topologies derived from these analyses, identification of unambiguous morphological support for afrotherian monophyly is dependent on optimization method, but on a less resolved interordinal phylogeny a total of 21 unambiguous afrotherian synapomorphies are identified, 9 of which appear as such across all character treatments and optimization methods." ]
{ "text": [ "a tenrec is any species of mammal within the family tenrecidae , found on madagascar and in parts of the african mainland .", "tenrecs are widely diverse ; as a result of convergent evolution they resemble hedgehogs , shrews , opossums , mice and even otters .", "they occupy aquatic , arboreal , terrestrial and fossorial environments .", "some of these species , including the greater hedgehog tenrec , can be found in the madagascar dry deciduous forests . " ], "topic": [ 20, 4, 13, 20 ] }
"a tenrec is any species of mammal within the family tenrecidae, found on madagascar and in parts of the african mainland. tenrecs are widely diverse; as a result of convergent evolution they resemble hedgehogs, shrews, opossums, mice and even otters. they occupy aquatic, arboreal, terrestrial and fossorial environments. some of these species, including the greater hedgehog tenrec, can be found in the madagascar dry deciduous forests."
[ "a tenrec is any species of mammal within the family tenrecidae, found on madagascar and in parts of the african mainland. tenrecs are widely diverse; as a result of convergent evolution they resemble hedgehogs, shrews, opossums, mice and even otters. they occupy aquatic, arboreal, terrestrial and fossorial environments. some of these species, including the greater hedgehog tenrec, can be found in the madagascar dry deciduous forests." ]
"animal-train-6"
"animal-train-6"
"2657"
"neodactria caliginosellus"
[ "black grass - veneer - hodges # 5381 (neodactria caliginosella) - neodactria caliginosellus - bugguide. net\nspecies neodactria caliginosellus - black grass - veneer - hodges # 5381 - bugguide. net\nlandry, b. and r. l. brown. 2005. two new species of neodactria landry (lepidoptera: pyralidae: crambinae) from the united states of america. zootaxa 1080: 1 - 16\nphotographs are the copyrighted property of each photographer listed. contact individual photographers for permission to use for any purpose .\nhtml public\n- / / w3c / / dtd xhtml 1. 0 transitional / / en\nurltoken\nupcoming events 2018 bugguide gathering in virginia july 27 - 29: registration and discussion photos of insects and people from the 2015 gathering in wisconsin, july 10 - 12 photos of insects and people from the 2014 gathering in virginia, june 4 - 7. photos of insects and people from the 2013 gathering in arizona, july 25 - 28 photos of insects and people from the 2012 gathering in alabama photos of insects and people from the 2011 gathering in iowa photos from the 2010 workshop in grinnell, iowa photos from the 2009 gathering in washington\npresence in north carolina 19 pinned specimens (listed under crambus), including locally collected specimens (north carolina state u. )\npresence in south dakota; key to species (b. mcdaniel et al, journal of the lepidopterists' society, 1984, courtesy of yale u. , connecticut )\npresence in alberta list of collected specimens, localities, and collection dates (strickland entomological museum, u. of alberta )\ndisclaimer: dedicated naturalists volunteer their time and resources here to provide this service. we strive to provide accurate information, but we are mostly just amateurs attempting to make sense of a diverse natural world. if you need expert professional advice, contact your local extension office .\ncontributors own the copyright to and are solely responsible for contributed content. click the contributor' s name for licensing and usage information. everything else copyright © 2003 - 2018 iowa state university, unless otherwise noted .\nfound at outside cf lights in a wooded, suburban yard. id confirmed by hugh mcguinness .\nselect your preferred way to display the comments and click' save settings' to activate your changes .\nhtml public\n- / / w3c / / dtd xhtml 1. 0 strict / / en\nurltoken\nhodges, r. w. et al. , eds. 1983. check list of the lepidoptera of america north of mexico. e. w. classey limited and the wedge entomological research foundation, london. 284 pp .\ndue to latency between updates made in state, provincial or other natureserve network databases and when they appear on natureserve explorer, for state or provincial information you may wish to contact the data steward in your jurisdiction to obtain the most current data. please refer to\ndistribution data for u. s. states and canadian provinces is known to be incomplete or has not been reviewed for this taxon .\nuse the generic guidelines for the application of occurrence ranks (2008). the key for ranking species occurrences using the generic approach provides a step - wise process for implementing this method .\nzoological data developed by natureserve and its network of natural heritage programs (see local programs) and other contributors and cooperators (see sources) .\nlandry, b. 1995. a phylogenetic analysis of the major lineages of the crambinae and of the genera of crambini of north america (lepidoptera: pyralidae). memoirs on entomology, international 1: 1 - 245 .\npoole, r. w. , and p. gentili (eds .). 1996. nomina insecta nearctica: a checklist of the insects of north america. volume 3 (diptera, lepidoptera, siphonaptera). entomological information services, rockville, md .\nthe small print: trademark, copyright, citation guidelines, restrictions on use, and information disclaimer .\nnote: all species and ecological community data presented in natureserve explorer at urltoken were updated to be current with natureserve' s central databases as of november 2016. note: this report was printed on\ntrademark notice :\nnatureserve\n, natureserve explorer, the natureserve logo, and all other names of natureserve programs referenced herein are trademarks of natureserve. any other product or company names mentioned herein are the trademarks of their respective owners .\ncopyright notice: copyright © 2017 natureserve, 4600 n. fairfax dr. , 7th floor, arlington virginia 22203, u. s. a. all rights reserved. each document delivered from this server or web site may contain other proprietary notices and copyright information relating to that document. the following citation should be used in any published materials which reference the web site .\nnatureserve. 2017. natureserve explorer: an online encyclopedia of life [ web application ]. version 7. 1. natureserve, arlington, virginia. available http: / / explorer. natureserve. org. (accessed :\nridgely, r. s. , t. f. allnutt, t. brooks, d. k. mcnicol, d. w. mehlman, b. e. young, and j. r. zook. 2003. digital distribution maps of the birds of the western hemisphere, version 1. 0. natureserve, arlington, virginia, usa .\ndata provided by natureserve in collaboration with robert ridgely, james zook, the nature conservancy - migratory bird program, conservation international - cabs, world wildlife fund - us, and environment canada - wildspace .\npatterson, b. d. , g. ceballos, w. sechrest, m. f. tognelli, t. brooks, l. luna, p. ortega, i. salazar, and b. e. young. 2003. digital distribution maps of the mammals of the western hemisphere, version 1. 0. natureserve, arlington, virginia, usa .\ndata provided by natureserve in collaboration with bruce patterson, wes sechrest, marcelo tognelli, gerardo ceballos, the nature conservancy - migratory bird program, conservation international - cabs, world wildlife fund - us, and environment canada - wildspace .\niucn, conservation international, and natureserve. 2004. global amphibian assessment. iucn, conservation international, and natureserve, washington, dc and arlington, virginia, usa .\ndata developed as part of the global amphibian assessment and provided by iucn - world conservation union, conservation international and natureserve .\nno graphics available from this server can be used, copied or distributed separate from the accompanying text. any rights not expressly granted herein are reserved by natureserve. nothing contained herein shall be construed as conferring by implication, estoppel, or otherwise any license or right under any trademark of natureserve. no trademark owned by natureserve may be used in advertising or promotion pertaining to the distribution of documents delivered from this server without specific advance permission from natureserve. except as expressly provided above, nothing contained herein shall be construed as conferring any license or right under any natureserve copyright .\nall documents and related graphics provided by this server and any other documents which are referenced by or linked to this server are provided\nas is\nwithout warranty as to the currentness, completeness, or accuracy of any specific data. natureserve hereby disclaims all warranties and conditions with regard to any documents provided by this server or any other documents which are referenced by or linked to this server, including but not limited to all implied warranties and conditions of merchantibility, fitness for a particular purpose, and non - infringement. natureserve makes no representations about the suitability of the information delivered from this server or any other documents that are referenced to or linked to this server. in no event shall natureserve be liable for any special, indirect, incidental, consequential damages, or for damages of any kind arising out of or in connection with the use or performance of information contained in any documents provided by this server or in any other documents which are referenced by or linked to this server, under any theory of liability used. natureserve may update or make changes to the documents provided by this server at any time without notice; however, natureserve makes no commitment to update the information contained herein. since the data in the central databases are continually being updated, it is advisable to refresh data retrieved at least once a year after its receipt. the data provided is for planning, assessment, and informational purposes. site specific projects or activities should be reviewed for potential environmental impacts with appropriate regulatory agencies. if ground - disturbing activities are proposed on a site, the appropriate state natural heritage program (s) or conservation data center can be contacted for a site - specific review of the project area (see visit local programs) .\n). your comments will be very valuable in improving the overall quality of our databases for the benefit of all users .\nconfused by a class within a class or an order within an order? please see our brief essay .\nto cite this page: myers, p. , r. espinosa, c. s. parr, t. jones, g. s. hammond, and t. a. dewey. 2018. the animal diversity web (online). accessed at https: / / animaldiversity. org .\ndisclaimer: the animal diversity web is an educational resource written largely by and for college students. adw doesn' t cover all species in the world, nor does it include all the latest scientific information about organisms we describe. though we edit our accounts for accuracy, we cannot guarantee all information in those accounts. while adw staff and contributors provide references to books and websites that we believe are reputable, we cannot necessarily endorse the contents of references beyond our control .\nthis material is based upon work supported by the national science foundation grants drl 0089283, drl 0628151, due 0633095, drl 0918590, and due 1122742. additional support has come from the marisla foundation, um college of literature, science, and the arts, museum of zoology, and information and technology services .\na corn root webworm moth in anne arundel co. , maryland (7 / 8 / 2016). identification verified by hugh mcguinness / inaturalist and roger downer / bamona. photo by timothy reichard. (mbp list )\na corn root webworm moth in anne arundel co. , maryland (6 / 30 / 2016). identification verified by roger downer / bamona. photo by timothy reichard. (mbp list )\na corn root webworm moth in prince george' s co. , maryland (6 / 17 / 2010). photo by bob patterson. (mbp list )\na corn root webworm moth collected by john glaser. photo by larry line. (mbp list )\nuse of images featured on maryland biodiversity project is only permitted with express permission of the photographer." ]
{ "text": [ "neodactria caliginosellus , the corn root webworm or black grass-veneer , is a moth in the crambidae family .", "it was described by clemens in 1860 .", "it is found in north america , where it has been recorded from alabama , alberta , california , florida , georgia , illinois , indiana , maine , maryland , mississippi , north carolina , ohio , oklahoma , ontario , south carolina and tennessee .", "the habitat consists of grassy areas and fields .", "the wingspan is about 17 mm .", "the forewings are dark brown to blackish with black postmedian and subterminal lines .", "the hindwings are dark greyish brown .", "there is one generation per year with adults on wing in june and july in the northern part of the range .", "in florida , adults have been recorded on wing from february to november .", "the larvae feed on turf grasses and corn stalks .", "they have a pale white to grey body . " ], "topic": [ 2, 5, 20, 24, 9, 1, 1, 8, 8, 8, 23 ] }
"neodactria caliginosellus, the corn root webworm or black grass-veneer, is a moth in the crambidae family. it was described by clemens in 1860. it is found in north america, where it has been recorded from alabama, alberta, california, florida, georgia, illinois, indiana, maine, maryland, mississippi, north carolina, ohio, oklahoma, ontario, south carolina and tennessee. the habitat consists of grassy areas and fields. the wingspan is about 17 mm. the forewings are dark brown to blackish with black postmedian and subterminal lines. the hindwings are dark greyish brown. there is one generation per year with adults on wing in june and july in the northern part of the range. in florida, adults have been recorded on wing from february to november. the larvae feed on turf grasses and corn stalks. they have a pale white to grey body."
[ "neodactria caliginosellus, the corn root webworm or black grass-veneer, is a moth in the crambidae family. it was described by clemens in 1860. it is found in north america, where it has been recorded from alabama, alberta, california, florida, georgia, illinois, indiana, maine, maryland, mississippi, north carolina, ohio, oklahoma, ontario, south carolina and tennessee. the habitat consists of grassy areas and fields. the wingspan is about 17 mm. the forewings are dark brown to blackish with black postmedian and subterminal lines. the hindwings are dark greyish brown. there is one generation per year with adults on wing in june and july in the northern part of the range. in florida, adults have been recorded on wing from february to november. the larvae feed on turf grasses and corn stalks. they have a pale white to grey body." ]
"animal-train-7"
"animal-train-7"
"2658"
"cerithiopsilla antarctica"
[ "species cerithiopsilla antarctica (smith, 1907) accepted as cerithiella antarctica (e. a. smith, 1907 )\nspecies cerithiopsilla cincta thiele, 1912 accepted as cerithiella cincta (thiele, 1912) accepted as cerithiella antarctica (e. a. smith, 1907) (original combination )\ncerithiopsilla cincta thiele, 1912 accepted as cerithiella cincta (thiele, 1912) accepted as cerithiella antarctica (e. a. smith, 1907) (type by original designation )\nfor full functionality of this site it is necessary to enable javascript. here are the instructions how to enable javascript in your web browser .\nthe scientific data on this site is licensed under a creative commons attribution 3. 0 unported license .\ngriffiths, h. j. ; linse, k. ; crame, j. a. (2003). sombase - southern ocean mollusc database: a tool for biogeographic analysis in diversity and evolution. organisms diversity and evolution. 3: 207 - 213. , available online at urltoken [ details ]\nintergovernmental oceanographic commission (ioc) of unesco. the ocean biogeographic information system (obis), available online at urltoken [ details ]\neol content is automatically assembled from many different content providers. as a result, from time to time you may find pages on eol that are confusing .\nto request an improvement, please leave a comment on the page. thank you !\nhtml public\n- / / w3c / / dtd html 4. 01 transitional / / en\nurltoken\n, select family and click on' identification by pictures' to display all available pictures in sealifebase for the family .\n, select country and click on' identification by pictures' to display all available pictures in sealifebase for the country .\n, select ecosystem and click on' identification by pictures' to display all available pictures in sealifebase for the ecosystem .\ncfm script by, 30. 11. 04, , php script by, 05 / 11 / 2010, last modified by kbanasihan, 06 / 28 / 2010\n( a. gittenberger & goud in a. gittenberger, goud & e. gittenberger, 2000) [" ]
{ "text": [ "cerithiopsilla antarctica is a species of very small sea snails , marine gastropod molluscs in the family cerithiopsidae .", "it was described by smith in 1907 . " ], "topic": [ 2, 5 ] }
"cerithiopsilla antarctica is a species of very small sea snails, marine gastropod molluscs in the family cerithiopsidae. it was described by smith in 1907."
[ "cerithiopsilla antarctica is a species of very small sea snails, marine gastropod molluscs in the family cerithiopsidae. it was described by smith in 1907." ]
"animal-train-8"
"animal-train-8"
"2659"
"peristernia pulchella"
[ "peristernia - pulchella _ 01. jpg taken by reeve 1847: plate fig. 65 image page with metadata full resolution image\n- - - - - - - - - - - - - - - species: peristernia pulchella (l. a. reeve, 1847) - id: 1972653970\nreeve, l. a. 1847. conchologia iconica: or, illustrations of the shells of molluscous animals. vol. iv. - pp. [ unpaginated ], with many plates. london. (reeve) .\nhtml public\n- / / w3c / / dtd html 4. 01 transitional / / en\nurltoken\nversion 43. 0 went live 11 / 6 / 2018 - i hope that the majority of issues have been fixed. my email address is on the home page if you see anything wrong .\nhtml public\n- / / w3c / / dtd html 4. 01 transitional / / en\nsri lanka, 1 / 2 mi. w wellawalta, 3 mi. s colombo hbr .\n. each record tells when. see dataset links for citations & terms of use .\nthe prices for is valid in all major cities of india including bangalore, delhi, hyderabad, chennai, mumbai, kolkata and pune. please check instructions at the specific stores for any deviation .\nhenri frankfort, h. a. frankfort, john a. wilson, thorkild jacobsen" ]
{ "text": [ "peristernia pulchella is a species of sea snail , a marine gastropod mollusk in the family fasciolariidae , the spindle snails , the tulip snails and their allies . " ], "topic": [ 2 ] }
"peristernia pulchella is a species of sea snail, a marine gastropod mollusk in the family fasciolariidae, the spindle snails, the tulip snails and their allies."
[ "peristernia pulchella is a species of sea snail, a marine gastropod mollusk in the family fasciolariidae, the spindle snails, the tulip snails and their allies." ]
"animal-train-9"
"animal-train-9"
"2660"
"caesio caerulaurea"
[ "nick hope marked the creole, english common name\ngowana\nfrom\ncaesio caerulaurea lacepède, 1801\nas untrusted .\nnick hope marked the creole, english common name\nkibiri\nfrom\ncaesio caerulaurea lacepède, 1801\nas untrusted .\nnick hope marked the creole, english common name\nvaber - vaber\nfrom\ncaesio caerulaurea lacepède, 1801\nas untrusted .\na goldband fusilier, caesio caerulaurea, at mios kon island, raja ampat, indonesia. source: dennis polack / fishwise professional. license: cc by attribution - noncommercial - sharealike\n( of caesio azuraureus rüppell, 1830) froese, r. & d. pauly (editors). (2018). fishbase. world wide web electronic publication. , available online at urltoken [ details ]\n( of caesio caerulaureus lacepède, 1801) froese, r. & d. pauly (editors). (2018). fishbase. world wide web electronic publication. , available online at urltoken [ details ]\n( of caesio maculatus cuvier, 1830) froese, r. & d. pauly (editors). (2018). fishbase. world wide web electronic publication. , available online at urltoken [ details ]\n( of caesio nori montrouzier, 1857) froese, r. & d. pauly (editors). (2018). fishbase. world wide web electronic publication. , available online at urltoken [ details ]\n( of caesio coerulaureus lacepède, 1801) froese, r. & d. pauly (editors). (2018). fishbase. world wide web electronic publication. , available online at urltoken [ details ]\n( of caesio cearulaurea lacepède, 1801) froese, r. & d. pauly (editors). (2018). fishbase. world wide web electronic publication. , available online at urltoken [ details ]\n( of caesio caerulaureus lacepède, 1801) liu j. y. [ ruiyu ] (ed .). (2008). checklist of marine biota of china seas. china science press. 1267 pp. (look up in imis) [ details ] available for editors [ request ]\nlatin, caesius, bluish - grey, 1835; it is the same name given to the silvery metal (cs) (ref. 45335 )\nmarine; reef - associated; non - migratory; depth range 1 - 50 m (ref. 30874). tropical; 34°n - 31°s, 30°e - 116°w (ref. 94071 )\nindo - west pacific: red sea and east africa to samoa, north to southern japan, south to new caledonia. absent in the arabian (persian) gulf .\nmaturity: l m? range? -? cm max length: 35. 0 cm tl male / unsexed; (ref. 402); common length: 23. 5 cm sl male / unsexed; (ref. 37816 )\ninhabits coastal areas, primarily around coral reefs. found in schools in deep lagoons and along seaward reefs (ref. 9710), mixing with other species of fusiliers (ref. 48636). juveniles used as tuna bait fish. oviparous, with small pelagic eggs (ref. 402) .\nmating behavior is marked by six distinguishable patterns, namely: 1) nuzzling; 2) several males joining in courtship; 3) spiraling towards the surface; 4) pair spawning; 5) sperm release by sneakers; and 6) post spawning. nuzzling is done about 1 - 1. 5 hours before spawning. for most of the day the fish swam slowly in school. at nearly spawning time, one or two males approach a selected female and begin pecking and pushing her swollen abdomen with their snouts. interruption happens at this stage resulting in spawners returning to the school. with less than an hour until spawning, 2 - 6 males may attempt to get their abdomen as close to the female' s abdomen as possible. for the pair that completes this position, a spiraling ascent to the surface occurs followed by a release of both eggs and sperm while other males come in pursuit. these sneakers release sperm at the same spot where the initial pair had released their gametes. some spawnings may occur without sneakers getting involved in the process (ref. 37498) .\ncarpenter, k. e. , 1987. revision of the indo - pacific fish family caesionidae (lutjanoidea), with descriptions of five new species. indo - pac. fish. (15): 56 p. (ref. 1723 )\n): 24. 7 - 29, mean 28 (based on 814 cells) .\nphylogenetic diversity index (ref. 82805): pd 50 = 0. 5020 [ uniqueness, from 0. 5 = low to 2. 0 = high ] .\nbayesian length - weight: a = 0. 01349 (0. 00817 - 0. 02226), b = 3. 07 (2. 93 - 3. 21), in cm total length, based on lwr estimates for this species & (sub) family - body (ref. 93245) .\ntrophic level (ref. 69278): 3. 4 ±0. 45 se; based on food items .\nresilience (ref. 69278): high, minimum population doubling time less than 15 months (preliminary k or fecundity .) .\nvulnerability (ref. 59153): low to moderate vulnerability (26 of 100) .\ninhabits coastal areas, primarily around coral reefs. found in schools in deep lagoons and along seaward reefs (ref. 9710), mixing with other species of fusiliers (ref. 48636). juveniles used as tuna bait fish. oviparous, with small pelagic eggs (ref. 402) .\neol content is automatically assembled from many different content providers. as a result, from time to time you may find pages on eol that are confusing .\nto request an improvement, please leave a comment on the page. thank you !\nthe webpage text is licensed under a creative commons attribution - noncommercial 4. 0 license\nfroese, r. & d. pauly (editors). (2018). fishbase. world wide web electronic publication. , available online at urltoken [ details ]\n( of smaris mauritianus quoy & gaimard, 1824) froese, r. & d. pauly (editors). (2018). fishbase. world wide web electronic publication. , available online at urltoken [ details ]\nhong kong marine fish database. afcd. , available online at urltoken [ details ]\nthe goldband fusilier is of a blue - green colour with a single yellow stripe on its sides, inbetween two blue stripes. it has a black pectoral - fin axil, and a dark streak on each lobe of its forked caudal fin .\nconfused by a class within a class or an order within an order? please see our brief essay .\nto cite this page: myers, p. , r. espinosa, c. s. parr, t. jones, g. s. hammond, and t. a. dewey. 2018. the animal diversity web (online). accessed at https: / / animaldiversity. org .\ndisclaimer: the animal diversity web is an educational resource written largely by and for college students. adw doesn' t cover all species in the world, nor does it include all the latest scientific information about organisms we describe. though we edit our accounts for accuracy, we cannot guarantee all information in those accounts. while adw staff and contributors provide references to books and websites that we believe are reputable, we cannot necessarily endorse the contents of references beyond our control .\nthis material is based upon work supported by the national science foundation grants drl 0089283, drl 0628151, due 0633095, drl 0918590, and due 1122742. additional support has come from the marisla foundation, um college of literature, science, and the arts, museum of zoology, and information and technology services .\nhtml public\n- / / w3c / / dtd html 4. 01 transitional / / en\nurltoken\nspecial publication of the center for biodiversity research and information, no. 1, vol 1 - 3\ndisclaimer: itis taxonomy is based on the latest scientific consensus available, and is provided as a general reference source for interested parties. however, it is not a legal authority for statutory or regulatory purposes. while every effort has been made to provide the most reliable and up - to - date information available, ultimate legal requirements with respect to species are contained in provisions of treaties to which the united states is a party, wildlife statutes, regulations, and any applicable notices that have been published in the federal register. for further information on u. s. legal requirements with respect to protected taxa, please contact the u. s. fish and wildlife service .\nhtml public\n- / / w3c / / dtd xhtml 1. 0 transitional / / en\nurltoken\nnamed after the prominent golden stripe on its side, this small fusilier can be seen at many of our dive sites .\nsave my name, email, and website in this browser for the next time i comment .\nchaloklum diving, 25 / 29 - 30 moo 7, chaloklum village, koh phangan, suratthani 84280. thailand .\n< p > an evidence describes the source of an annotation, e. g. an experiment that has been published in the scientific literature, an orthologous protein, a record from another database, etc. < / p > < p > < a href =\n/ manual / evidences\n> more... < / a > < / p >\nhelp pages, faqs, uniprotkb manual, documents, news archive and biocuration projects .\nyou are using a version of browser that may not display all the features of this website. please consider upgrading your browser .\n< p > when browsing through different uniprot proteins, you can use the ‘basket’ to save them, so that you can back to find or analyse them later. < p > < a href =' / help / basket' target =' _ top' > more... < / a > < / p >\n< p > this will take you to the blast page where you can edit options < / p > < p > < a href =\n/ help / sequence - searches\n> more. . < / a > < / p >\nwe' d like to inform you that we have updated our privacy notice to comply with europe’s new general data protection regulation (gdpr) that applies since 25 may 2018." ]
{ "text": [ "caesio caerulaurea , the blue and gold fusilier , blue fusilier , gold-band fusilier or scissor-tailed fusilier , is a species of marine fish in the family caesionidae .", "it is widespread throughout the tropical waters of the indo-pacific area , including the red sea .", "this fish can reach a maximum size of 35 cm in length , but its common length is 23.5 cm . " ], "topic": [ 14, 13, 0 ] }
"caesio caerulaurea, the blue and gold fusilier, blue fusilier, gold-band fusilier or scissor-tailed fusilier, is a species of marine fish in the family caesionidae. it is widespread throughout the tropical waters of the indo-pacific area, including the red sea. this fish can reach a maximum size of 35 cm in length, but its common length is 23.5 cm."
[ "caesio caerulaurea, the blue and gold fusilier, blue fusilier, gold-band fusilier or scissor-tailed fusilier, is a species of marine fish in the family caesionidae. it is widespread throughout the tropical waters of the indo-pacific area, including the red sea. this fish can reach a maximum size of 35 cm in length, but its common length is 23.5 cm." ]
"animal-train-10"
"animal-train-10"
"2661"
"i ' ll have another"
[ "“it’s kind of sad. i would have liked to have had a lot of i’ll have anothers. ”\nabove / below: i' ll have another wins the 2012 kentucky derby .\nabove: i' ll have another and lava man in the post parade .\ni’ll have another’s dam archs gal edith showed talent in winning her only start .\ni’ll have another has a fluid gait with good extension and no wasted motion .\ni' ll have another wins the kentucky derby with mario gutierrez atop on saturday .\ni’ll have another is a product of the mr. prospector sire line through his son\nolder comments about i' ll have another - stud or dud? ...\ni’ll have another is currently based at trainer doug o’neill’s stable at betfair hollywood park .\nlouisville, ky. - - i' ll have another looked like just another horse at the kentucky derby .\ni' ll have another is scheduled to return home to california on sunday or monday .\ni' ll have another dropped to third on the backstretch as longview drive took second and creative cause started a move on the far turn, passing i' ll have another .\nwhen i’ll have another arrived, kimura’s impressions were confirmed, he said. i’ll have another can be easily distracted, so kimura tries to keep a distance from him to build trust .\nkentucky derby and preakness winner i' ll have another is headed to stud duty in japan .\ni’ll have another' s name appears in translation on a sign in front of his paddock .\nabove: preakness day at pimlico. below, i' ll have another before the race .\nabove: i' ll have another june 6... gotta love that odd cloud .\nall four of those wins for i’ll have another came with the unheralded jockey mario gutierrez aboard .\nwhen asked what i’ll have another meant to him, gutierrez said, “he’s my hero. ”\no' neill called i' ll have another' s injury a\nfreakish thing .\nit' s kind of sad. i would have liked to have had a lot of i' ll have anothers .\nelmont, n. y. – someday there may be another triple crown winner, but it won’t be i’ll have another .\nlouisville, ky. — canadian - owned i’ll have another didn’t seem to have the goods to win the kentucky derby .\ni' ll have another surprised a competitive field to win the 138th running of the kentucky derby .\njockey mario gutierrez, making his derby debut, called i' ll have another a steady competitor .\nlater, it was announced that i’ll have another would lead the post parade for saturday’s belmont stakes .\nlet' s take a look a some facts and race recaps from i' ll have another .\ni’ll have another’s offspring overall won’t be precocious. they’ll prefer to run at least a mile and should do well over all surfaces .\nowner j. paul reddam named i’ll have another for what he replies when his wife, zillah, asks him if he would like to have another cookie .\no’neill didn’t waste any time vowing that i’ll have another will go on to the preakness in two weeks .\nabove: heading down the homestretch, i' ll have another as he approached front - running bodemeister .\nabove / below: dual classic winner i' ll have another leaves pimlico to head to belmont park .\nthe main question was can i’ll have another win again? the answer proved to be a resounding yes .\ni’ll have another’s withdrawal is a devastating blow for america’s struggling race industry, which has been waiting 34 years for another triple crown winner .\nasked if i' ll have another has raced his last race, he said:' if i had to wager. i would say yes.'\nlike i' ll have another, both fillies have inherited their sire' s pace - stalking style but they have not won beyond 8. 5 furlongs .\nabove: the first time i photographed i' ll have another and lava man together was april 29 - the first morning they stepped out at churchill downs. jonny garcia was aboard i' ll have another and sabas rivera rode lava man .\nafter a rough start, i’ll have another is showing promise as a stud horse at japan’s big red farm .\nabove: after the winner' s circle celebration, i' ll have another was cooled down by friends .\nabove / below: buddies. . sort of... i' ll have another and lava man .\nabove: i' ll have another training at belmont park, a. k. a. big sandy .\nsb nation' s horse racing expert matt gardner reacts to i' ll have another' s preakness triumph .\nif so, i' ll have another will join an elite group of horses, including secretariat and whirlaway .\nthis was all known prior to i' ll have another' s injury. the degree is just different .\ni' ll have another became the first horse to win the derby starting from post position no. 19 .\ni' ll have another has retired, per nbc sports. his triple crown dreams have evaporated almost just 34 days after they arrived .\nabove / below: the newly retired i' ll have another with team o' neill, still politely posing. shortly thereafter, i' ll have another headed back to his regular barn (mark hennig' s) .\ni' ll have another becomes the 12th horse to have claimed the first two legs of the triple crown since 1978, but i' ll have another will try to become the only one to go on to win the belmont for the triple crown .\ni’ll have another is tentatively scheduled to leave for japan in august, after completing quarantine requirements, reddam said. there have been discussions with hollywood park officials about parading i’ll have another on a race day before the conclusion of the summer meeting july 15 .\nfootage of i' ll have another selling at the 2010 september yearling sale as part of the brookdale sales consignment .\nabove: bodemeister set the early pace in the preakness, as i' ll have another settled in behind him .\nabove / below: i' ll have another drove past a game bodemeister to add the preakness to his resume .\nwe have to go back to i’ll have another’s fifth dam patelin, a blue hen, to find a direct link to stakes winning quality .\nabove: i' ll have another, mario gutierrez up, and lava man, in the kentucky derby post parade .\nabove / below: cranky lava man with i' ll have another, who almost always looked surprised by that crankiness .\nalthough i’ll have another didn’t contest the belmont stakes, he certainly had the pedigree and running style to win the race .\ni’ll have another’s 2010 half - sister gloria s (by tapit) has yet to make her appearance on the track .\ni’ll have another, winner of the kentucky derby and preakness stakes last month, is bound for stud duty in japan .\ni' ll have another is the son of flower alley, out of the arch mare arch' s gal edith .\ni' ll have another is one of those nice case stories that slipped by and became the cinderella of the crop .\nbodemeister was on the lead by three lengths as they entered the stretch; i' ll have another would have to find second gear to catch him .\nshigeyuki okada, the farm’s owner, paid $ 10 million for i’ll have another after the horse’s career ended abruptly in 2012 .\nabove: heading for home, bodemeister was still in the lead, but i' ll have another loomed on the left .\nabove / below: ... doug o' neill removed i' ll have another' s saddle... .\nthere was nothing in o’neill’s handling of i’ll have another or his comportment throughout the triple crown series that would confirm this caricature .\ni’ll have another follows sunday silence and empire maker as outstanding american 3 - year - olds to stand at stud in japan .\ni' ll have another won the race, but creative cause was still considered by most the best on the west coast .\nbut on paper and on most fans' minds, it will be i' ll have another' s race to lose .\no’neill noticed swelling in i’ll have another’s left foreleg thursday afternoon, but with treatment the swelling subsided. o’neill sent i’ll have another to the track at 5: 30 a. m. friday – three hours earlier than usual – where he jogged and galloped .\ni’ll have another, ridden by mario gutierrez, edging bodemeister and mike smith at the finish of the 137th preakness stakes on saturday .\nabove / below: once settled in at pimlico, i' ll have another looked grand... and raring to go .\ni' ll have another settled in nicely in fourth place early and started his move slowly from the three - quarter mile pole .\nbode and another break well. bode, pretension, creative cause, then another. mario gutierrez asks another to go as they head into the stretch. i’ll have another catches bodemeister to win! !! !! the triple crown is alive !\nmario gutierrez celebrates after riding canadian - owned i' ll have another to victory in the 138th running of the kentucky derby on saturday .\no' neill didn' t waste any time vowing that i' ll have another will go on to the preakness in two weeks .\ngutierrez and i' ll have another will lead the post parade for the belmont stakes on saturday, the new york racing association said .\nwith i’ll have another out of the triple crown, there will be less controversy and maybe more clarity at belmont, dan packel writes .\ni' ll have another defeated bodemeister by more than one length at the 1¼ - mile classic, attended by a record churchill downs crowd .\ninstead of union rags and dullahan being i' ll have another' s most dangerous challengers, they are now the belmont' s favorites .\nsilver charm, real quiet, charismatic, war emblem, funny cide (gelding), smarty jones, big brown and i’ll have another .\ni’ll have another carries linebreeding to mr. prospector, northern dancer and way back in his seventh generation is some cross - breeding (through sire and dam) to bold ruler. i’ll have another also carries the blood of hail to reason through two of his top turf descendants, sadlers’ wells and roberto. i’ll have another’s pedigree is inclusive of the most popular modern bloodlines and should mix will with a wide variety of mares .\nin a thrilling stretch run, i' ll have another got to bodemeister in the red zone and edged him to win by a neck .\ni remember roy he told everyone to bet gem and how hes the best blah, blah. and i remember saying i will stick with i' ll have another. i never gave up on him after his saratoga flop and i wasn' t going to stop in the triple crown .\nhe' ll be my hero forever ,\ngutierrez said .\nwhat i' ll have another did for me is so amazing. he brought happiness to my life .\npurchased for $ 35, 000 as a 2 - year - old in training, i’ll have another is by flower alley, winner of the 2005 travers stakes. i’ll have another is the first stakes winner out of arch’s gal edith, a 10 - year - old mare by arch .\nsince then, 11 very talented colts have come to belmont with the same hopes as i' ll have another. but they all have fallen short of the challenge from the\ntest of the champion .\ni' ll have another was physically capable of competing on saturday, reddam and o' neill said, but it would not have been in the horse' s best interest .\no' neill said i' ll have another was being retired because he developed swelling in his left front tendon that was the beginning of tendinitis .\nabove: the next morning, i' ll have another was a bit tired... or maybe a bit bored with the surrounding hubbub .\npaul reddam and doug o' neill (right) console each other after announcing i' ll have another will not run in the belmont stakes .\no’neill said i’ll have another would return to his base at hollywood park on monday. his connections will sort out stallion plans at a later date .\nthough confident his horse could beat i’ll have another, dale romans, trainer of dullahan, said it was “devastating” that he’s not in the field .\nthings began unraveling for triple crown hopeful i' ll have another a day after the colt' s thrilling win in the preakness three weeks ago .\noverall, the quality of i’ll have another’s distaff line is solid, but not spectacular. the runners they produce are sound claiming / allowance types .\nat post time bettors made bodemeister the $ 1. 70 - 1 favorite over i' ll have another at $ 3. 20 - 1 .\ni’ll have another pulled off another win in dramatic come - from - behind fashion. the three - year - old colt overtook bodemeister in the final inches of the preakness on saturday afternoon .\nas far as i' m concerned i have confidence in enda kenny' s leadership .\ni’ll have another joins burgoo king (1932) and bold venture (1936) as the only horses to have won the kentucky derby and preakness, but not compete in the belmont .\ni' ll have another will be going for the elusive triple crown, but he will have to tame 10 throughout 1. 5 miles around the long belmont oval to achieve this .\nhe' ll be my hero forever ,\na somber gutierrez said .\nwhat i' ll have another did for me is so amazing. he brought happiness to my life .\ni' ll have another, winner of the kentucky derby and the preakness, came up with tendinitis in his left front leg and will not race .\nabove: marco carrillo, jonny garcia, beto gomez, davey meah, jack sisterson and tyler cerin follow i' ll have another around the paddock .\ni' ll have another cut loose on the home stretch to run down bodemeister and earn the first kentucky derby wins for his rider and trainer saturday .\nkentucky derby winner i' ll have another embarks on a journey to become the first triple crown winner in 34 years. up next: the preakness .\nthe scratch of i’ll have another will likely leave dullahan, the third - place finisher from the kentucky derby, as the probable favorite for the belmont .\no' neill declared i' ll have another\nfit and ready to go ,\nwhich obviously wasn' t the case as the day unfolded .\nsports fans were shocked today as i' ll have another was scratched from the belmont stakes on the eve of his historic run for the triple crown .\nowner j. paul reddam bought i' ll have another for just $ 35k at the 2010 september yearling sale as part of the brookdale sales consignment .\ntheir task was to ensure that shigeyuki okada, the farm’s owner, got the most out of i’ll have another, whom he bought for $ 10 million after the horse’s racing career ended in 2012. i’ll have another started only seven races, five of them wins, and earned $ 2. 7 million .\nproblems: i' ll have another is tended to after a bath at belmont park in elmont, n. y on june 7. i' ll have another' s bid for a triple crown ended with the shocking news that the colt was out of the belmont stakes due to a swollen left front tendon\nthey didn' t believe (i' ll have another) could have made it this far ,\ngutierrez said .\nbut even if they wanted me to pick (any horse in the field), i would have stayed with him .\ni’ll have another has been a steady stud who may ultimately justify the price okada paid for him. but his early exit from racing is a reminder of the fickle nature of the sport and the difficulty of winning three top races in five weeks. if i’ll have another had won the triple crown, he probably would not have ended up here .\nas a result, we were able to fully record i' ll have another' s historic run. that fate would not allow i' ll have another a chance at the last jewel of the triple crown was a frustrating footnote, to be certain - but, when he shone, no one was brighter .\nabove / below: doug o' neill, too, watched i' ll have another' s bath... and snapped a shot or two .\nbelow: by early afternoon, this was the scene at the barn when - in a shocker - i' ll have another' s retirement was announced .\ni' ll have another' s trainer will begin his 45 - day suspension, handed down by the california horse - racing authorities, on july 1 .\nlarry bramlage, the on - call veterinarian for the american association of equine practitioners, said by running in the belmont i’ll have another would exacerbate the injury .\nin an incredibly close final stretch between the three horses, i' ll have another prevailed by a nose over creative cause and half - length over blueskiesnrainbows .\nit was validation time for i' ll have another as he was able to win yet again, answering the challenge with everything going bodemeister' s way .\n“i’m afraid history is going to have to wait for another day, ” j. paul reddam, owner of i’ll have another, said at a somber press conference on the belmont backstretch. “we tried to be quiet, but i really thought he was going to run off and really show something. ”\n“the japanese have been big fans of flower alley really throughout his career, ” said case clay, president of three chimneys farm, where i’ll have another’s sire, flower alley, stands. “in the last two years, japanese breeders have been buying some very nice mares from america, and i’m guessing that he’ll get some very good mares. i think he’ll fit in quite nicely there. ”\no' neill said i' ll have another would return to his home base at betfair hollywood park in inglewood, calif. , in the next few days .\nmario gutierrez celebrates atop i' ll have another after winning the 138th running of the kentucky derby at churchill downs on may 5, 2012 in louisville, kentucky .\nabove: a near - collision between a loose horse, isleta, and i' ll have another on may 31 prompted a change in morning routines ...\ni' ll have another came out of a losing effort in the hopeful stakes at saratoga last september with shin problems and took the rest of the year off .\nscratched: triple crown hopeful i' ll have another at barn 2 following workouts at belmont park on friday, june 8, 2012 in elmont, n. y\ni’ll have another won his debut at hollywood park on july 3, before finishing second to creative cause in the grade 2 best pal at del mar in august .\nedwards told abc news that last minute injuries were not uncommon in horse racing, and after observing i' ll have another during training runs she is not surprised .\nlike their sire counterparts, certain distaff families produce more classic victors than others. i’ll have another is a member of family 23 - b (turk mare) .\ni' ll have another had won the robert b. lewis (g2) and was a far second betting choice ($ 4. 80 - 1) .\nthis year, six foals have been born to i’ll have another, including one with pisa no sunday, a descendant of sunday silence, who also won the first two legs of the triple crown .\ndullahan, union rags, paynter and street life will most likely have a say in this before the race is over. they are the top four challengers that i' ll have another will face .\ni' ll have another suffers a leg injury and won' t race in saturday' s belmont stakes, meaning the kentucky derby and preakness stakes winner will not have a shot at the triple crown .\ni' ll have another, with a finish of 2: 01: 83, earned nearly $ 1. 5 million of the $ 2. 2 million purse .\nretired racehorse those wer the days, a half - brother to i' ll have another shown winning at saratoga in 2011, is set to be offered for adoption .\nthere’s no doubt the major stud farms are courting i’ll have another’s owner paul redam and we’ll read the announcement within the next few months as to which stud farm will receive the honor of standing the son of flower alley .\njockey mario gutierrez rides i' ll have another to victory in the 138th kentucky derby horse race at churchill downs saturday, may 5, 2012, in louisville, ky .\nafter the news of i' ll have another' s scratch, new york racing association chairman steven duncker said he was disappointed for fans and the sport of thoroughbred racing .\nas friday’s press conference began, i’ll have another was led out of the barn by o’neill to be seen by the press. he later grazed as o’neill and reddam spoke .\n“when he first arrived, there were days that i couldn’t sleep and my stomach was upset, ” said kimura, one of five people dedicated to i’ll have another. “there was a lot of pressure. ”\ni kept telling everybody, from the first time i met him, i knew he was the one. i knew he was good .\nabove: but the mood was much more subdued friday morning. here, i' ll have another is hosed at 6: 30 a. m. , after a gallop .\ni' ll have another' s bid for a triple crown ended with the shocking news that the colt was out of the belmont stakes because of a swollen left front tendon .\nthe decision to scratch i' ll have another came after doug o' neill had called an audible and sent the horse out for a final gallop in secrecy early friday morning .\nby flower alley—arch' s gal edith (arch), i' ll have another entered stud in japan after being sold by owner j. paul reddam for $ 10 million .\nin the spring of 2012, half - brothers i’ll have another and those wer the days were riding high. i’ll have another was a dual classic winner on the brink of becoming the first triple crown winner since affirmed in 1978. meanwhile, those wer the days was riding a five - race winning streak of his own. but the story soon unraveled .\ni' ll have another has taken on his sire' s ability to stalk the pace and run with a target upfront. he has made it to 10 furlongs just fine .\nmario gutierrez comes down the front stretch atop i' ll have another to win the 138th running of the kentucky derby at churchill downs on may 5, 2012 in louisville, kentucky .\n“none of this yelling and screaming bothered him, ” said reddam, who has not visited i’ll have another in japan. “one of the great things about him was his temperament. ”\nwe prayed he kind of hit himself and that it was a little bit of skin irritation ,\nhe said as i' ll have another grazed in the grass behind him .\ni’ll have another was the odds - on favorite to win the grueling 1 - 1 / 2 mile (2, 414 meter) belmont stakes and end the 34 - year drought .\nnow optimizer and my adonis are this year' s middling horses. they face the same situation i' ll have another faced entering the kentucky derby a little over a month ago .\nconformation wise, i’ll have another is an average sized, yet powerfully built stallion who resembles his sire. his pasterns are a little long, but overall, he has good bone .\nnot many believed that the santa anita derby winner i’ll have another could become the first horse to win the kentucky derby from the no. 19 post, yet he went off at odds of 15 - 1, mainly because of bettors’ attraction to his name. after the victory, enthusiastic requests of “i’ll have another! ” were heard at bars from kentucky to new york .\ni' ll have another was trained by doug o' neill, who had a history of violations in california and was suspended 45 days in may after one of his horses was found to have an excessive level of carbon dioxide .\ni' ll have another is set to return to hollywood park on sunday or monday. the next step will be to plan for his stud career, o' neill and reddam said .\nabove: one team drf shooter, emily shields, was an i' ll have another fan from the get - go. she keyed in on him as he rounded the first turn .\n' i’ll have another is officially out of the belmont,' o' neill said on the dan patrick show this morning.' it’s not tragic, but it’s a huge disappointment.'\non his first trip to new york, i’ll have another finished sixth in the grade 1 hopeful run over a sloppy track at saratoga, a race from which he emerged with bucked shins .\ndoug o’neill went on the dan patrick show and said he’d likely rest i’ll have another for three months, and there was a chance the 3 - year - old will never race again .\ni’ll have another had a perfect record this year with four wins, all in stakes, including the grade 2 robert lewis stakes in february and the grade 1 santa anita derby in april .\n“i don’t blame you for everything—i blame dad for some things, too. ”\nthe last horse to come close was big brown in 2008, who had a dismal showing at the belmont after capturing the first two legs of the triple crown. can i' ll have another succeed where so many others have failed ?\nwhen i' ll have another returned to the barn after his friday gallop, he had inflammation in the same area, but again seemed to respond well in treatment, o' neill said .\ni’ll have another with hiroshi kimura, a handler at big red farm, which is hoping the horse will rival northern taste and sunday silence, two of the most productive sires in japanese history .\nabove: ... and a special window of time was allotted for belmont trainees only. here, i' ll have another gallops past the throng of media members as atigun stands out .\ni' ll have another – the winner of both the kentucky derby and the preakness stakes – will not race in the 2012 belmont stakes, according to his trainer, doug o' neill .\ni' ll have another was scheduled to break from the no. 11 post saturday and had been made the 4 - 5 morning - line favorite for the 144th running of the belmont stakes .\nin the same 2007 crop as sharp humor and any given saturday, i’ll have another’s sire flower alley got off to a slower start at stud. he has only six stakes winners from 126 runners. i’ll have another is a typical example of flower alley’s offspring, improving with age and racing. currently, his oldest crop are three year olds, so we should see more stakes winners as they grow into four and five year olds. only time will tell if flower alley will become a solid sire of older horses or if i’ll have another will be his only home run hit .\nat the top of the stretch creative cause was leading i' ll have another by a head and both had aim at a feisty blueskiesnrainbows, who didn' t want to surrender the lead .\no' neill said the horse could have rested for several months and got started again. but he said i' ll have another has\ndone so much that it was unanimous\namong the owners and trainers\nto retire him .\nand while i’m not entirely convinced, i suspect the right winner—like smarty jones—would have given the sport a much - needed bump .\ni’ll have another now has a chance to become the first triple crown winner since affirmed in 1978. his rival bodemeister will not race in the belmont stakes, set for june 9 at belmont park .\ndoug o' neill and owner j. paul reddam immediately gave i' ll have another two months off leading up to the santa anita derby, which he won by a nose on april 12 .\nfriday’s stunning announcement that i’ll have another was sidelined with tendinitis and not only would not be running in saturday’s belmont stakes but would also be retiring sent shockwaves through the racing community and the general public .\nbut gutiérrez did more than keep i’ll have another’s triple crown hopes alive with saturday’s win. the victory also gives the sport the much - needed hook it needs to maintain the interest of the masses .\nif you' re going to get a pet, get a winner. literally, you can probably afford a thoroughbred racehorse like i' ll have another, which reportedly sold for $ 10 million .\nunder a strong urging during the stretch, i' ll have another was able to catch bodemeister just after the final half - furlong pole and drew away to win clear by 1. 5 lengths .\ni' ll have another will face 10 contenders at the long distance of 1. 5 miles. it is an unknown distance for all of them, so what is equal is not an advantage .\nthen, track stewards said that for the belmont, i' ll have another would have to go without the nasal strip he wore in races this year, and exercise rider jonny garcia had visa problems and had to be replaced for several days .\nspectacular bid, alysheba, sunday silence, silver charm, smarty jones and big brown, as good as they were, didn' t win the triple crown. the question is, what chance does i' ll have another have, then ?\ni’ll have another’s scratch from the belmont also means that thoroughbred racing’s triple crown will go unclaimed for a 34th consecutive year. affirmed, in 1978, was the sport’s 11th and most recent triple crown champion .\ni' ll have another' s injury eliminated this year' s most prominent storyline and adjusted the odds at the last second. other than that, things are status quo in the horse racing world .\nbeside his big wins with i' ll have another, his other big wins are the g3 wilshire handicap in hollywood park this year and the 2009 g3 ballerina and 2007 g3 premiers, both at hastings .\ni' ll have another, under the thoroughbred radar all week, rallied to win the 138th kentucky derby going away in front of a record crowd of 165, 307 on a humid day in bluegrass country .\ni’ll have another is the most popular and valuable of the 240 horses at big red farm, too. the staff members, many of whom never saw him race, know they are caring for a champion .\ni' ll have another was\nlightly raced\nand competed in only two prep races leading up to the derby. he competed in the shadow of bodemeister, who was predicted to win the kentucky derby .\ni’ll have another’s trainer doug o’neill said the three - year - old looked fine after a final workout early friday but his leg started to swell after he cooled down and scans revealed the early onset of tendonitis .\ni' ll have another, who trains at hollywood park, was given his name by owner j. paul reddam, but not for the reason you would think. reddam doesn' t drink but does have an affection for his wife' s cookies .\ndespite his years away from the track, i’ll have another continues to have a strong following. a stream of fans, including some from the united states, visit him at the farm. he has more than 14, 000 likes on his facebook page .\nhis jockey is mario gutierrez, 25, who is certainly young and inexperienced but calm, cool and collected like the top veteran money riders. you wouldn' t know if you have only seen him on all four wins with i' ll have another .\nabout two hours before the press conference, o’neill, in a brief phone interview with daily racing form, called the injury to i’ll have another “a huge disappointment. at the same time what a horse, what a run. though it’s heartbreaking, it’s not tragic. we’ll be back with another one, hopefully next year. ”\ni' ll have another won the derby on may 5 and the preakness two weeks later - both with stirring stretch drives - to set up the highly anticipated belmont stakes and a triple try. only 11 horses have won the triple crown and the wait for another now stretches to 35 years - the longest drought ever .\ni' m afraid history is going to have to wait for another day ,\nsaid j. paul reddam, the colt' s owner .\ni’ll have another overhauled a tiring bodemeister to win by 1 ½ lengths. he paid $ 32. 60, $ 13. 80 and $ 9. he ran 1 ¼ miles in 2: 01. 83 .\nmaking his derby debut at 25, gutierrez got his chance to ride i' ll have another after trainer doug o' neill and owner j. paul reddam happened to see him at santa anita in southern california .\ni' ll have another overhauled a tiring bodemeister to win by 1½ lengths. he paid $ 32. 60, $ 13. 80 and $ 9. he ran 1¼ miles in 2: 01. 83 .\ni' ll have another' s bid for the first triple crown in 34 years ended stunningly friday when the chestnut colt was retired on the eve of the belmont stakes with an injury to his left front tendon .\nwhen i' ll have another powered his way into the national spotlight at churchill downs may 5, 2012, he also powered his way into my - and countless other - hearts. the preakness cemented the deal .\nabove: mario gutierrez hopped aboard i' ll have another in the winner' s circle. team o' neill gave a' tip of the hat' to their home track by donning yellow santa anita caps .\ntoday: i' ll have another, left, with exercise rider jonny garcia, accompanied by stablemate lava man, trains at belmont park, on friday, june 8, 2012, in elmont, n. y\nmay 5, 2012; louisville, ky usa; mario gutierrez aboard i' ll have another crosses the finish line to win the kentucky derby at churchill downs race track. mandatory credit: mark zerof - us presswire\ni' ll have another, the 12th horse to take the derby and preakness since 1978, will seek to avoid their fates. history may smile on i' ll have another' s duel with bodemeister, second in both triple crown races this year, as it recalls affirmed' s famed clash with alydar. bodemeister is the first horse since alydar to place second to a horse that took both the kentucky derby and preakness stakes .\ni' ll have another, seen here in the kentucky derby, also won the preakness and was seeking to becoming only the 12th triple crown einner before being retired prior to the belmont stakes due to a tendon injury .\nmeanwhile, i’ll have another was comfortably galloping along behind the blazing speed. gutierrez angled his colt clear on the final turn and took dead aim at bodemeister, who was clearly in front at the top of the stretch .\ni' ll have another' s grooms will lead him to the paddock about an hour before the running of the belmont, then to the winner' s circle where trainer doug o' neill will remove his saddle .\njockey mario gutierrez reacts after riding i' ll have another to victory in the 138th kentucky derby horse race at churchill downs saturday, may 5, 2012, in louisville, ky. (ap photo / mark humphrey )\nbut he was never accused of doing anything illegal to i' ll have another, and the colt, along with the other 11 belmont stakes entries, all came back negative in testing done wednesday by the state board .\ni’ll have another was retired with a tendon injury on the eve of the belmont stakes and was subsequently sold to japan for stud duty. those wer the days lost his final start before a knee injury ended his career .\nowner paul reddam said friday that a deal has been reached with shigeyuki okada’s big red farm on the island of hokkaido to stand i’ll have another beginning with the 2013 breeding season. financial terms were confidential, reddam said .\ntrainer doug o' neill leads i' ll have another out of his stable to announce the triple crown hopeful' s sudden retirement at belmont park on june 8. (kevin hagen / for new york daily news )\neleven horses were entered wednesday to take on i' ll have another in his bid to win the triple crown for the first time since affirmed swept the derby, preakness and belmont in 1978. only 11 horses have accomplished the feat, while 19 have been tripped up in the belmont after winning the first two legs .\nnow saturday' s race is largely irrelevant to casual viewers who would have watched in the hopes of seeing history in the making. dullahan, who ran third in the derby, was installed as the new 9 - 5 favorite after i' ll have another was scratched .\n“i never really dreamed i would be in a position to own racehorses, but i got very lucky in my life and it happened, ” said reddam, president and founder of cashcall inc. “i guess i’m still lucky. ”\n“i think he’ll be okay, ” she said. “time will tell. he’s super - sound now. ”\ni’ll have another made his way to the starting gate accompanied by his stable pony, lava man, another cheap purchase turned into a career winner of more than $ 5 million by o’neill. the trainer has made his name predominantly in southern california, although he’s won three breeders’ cup races .\nthe preakness horses are on the track and warming up. nothing out of the ordinary. the derby winner, i’ll have another, looks calm. bode baffert looks nervous. bodemeister is still the favorite at 2 - 1 .\nit typically takes a horse three to six months to recover from such an injury, but o' neill and j. paul reddam, i' ll have another' s owner, they will retire the horse to stud .\ni' ll have another, the winner of this year' s kentucky derby and preakness stakes, is out of saturday' s belmont stakes because of a leg injury and has been retired from racing, his team said .\ni’ll have another proved that at churchill downs. he backed it up at pimlico. now, everyone will be watching – and wagering - - to see if he and gutiérrez can cross the finish line first one more time .\nmoments after i' ll have another registered a rousing, come - from - behind victory in the 138th running of the kentucky derby, the horse' s trainer doug o' neill was already talking about the triple crown .\nreddam and trainer doug o’neill said that i’ll have another would need three to six months off before he could resume training. further, there was no guarantee that he would be able to return to the top level of competition .\nnew york (reuters) - i’ll have another was retired from racing after suffering a freak injury on the eve of saturday’s $ 1 million belmont stakes, ending his bid to win the elusive triple crown of american thoroughbred racing .\ninstead, i' ll have another now becomes only the third horse to win both the derby and the preakness and not compete at belmont. bold venture did not particpate in 1936 and burgoo king skipped the race in 1932 .\nboth wickedly perfect and i’ll have another were purchased as a result of the way dennis o’neill shops for horses and why the obs april sale fits his program. “i guess you could say i approach buying horses backwards, ” said dennis. “the [ under tack ] preview is number one, followed by conformation and finally i worry about pedigree. i was attracted to i’ll have another by his long, smooth stride and his pedigree was good enough. he breezed with that same stride you saw in the kentucky derby. to tell the truth, he was such a nice mover i thought he’d sell for more money. for me, a nice way of going is the most important part. ”\nwe' ll be there and we' ll be rooting ,\no' neill said .\ni won' t tell you who we will be rooting for .\nmeanwhile, i' ll have another was comfortably galloping along behind the speedsters. gutierrez angled his colt clear on the final turn and took dead - aim at bodemeister, who was clearly in front at the top of the stretch .\nhe also said i’ll have another communicated well with his jockey — “he would go when it was time to go” — and had a will to win. reddam said he hoped that the horse would pass that on to his progeny .\na series of minor setbacks for the horse and his handlers culminated with the biggest shocker of all: i' ll have another' s sudden retirement on the eve of the belmont stakes with an injury to his left front tendon .\nbefore i’ll have another was injured and withdrawn from the belmont stakes, people who care about horse racing hoped he could win the triple crown and give the sport an exciting and positive story. it hasn’t had many of those lately .\ni' ll have another, who captured the imagination of the horse racing world after winning the first two legs of the triple crown this year then abruptly pulling out of the belmont stakes, has found a new home in japan .\ni’ll have another stormed out of post no. 19 — the first winner from there in 138 runnings of the derby — and bided his time back in mid - pack while bodemeister set a blistering pace on a hot, muggy afternoon .\ni' ll have another, who won the kentucky derby and the preakness stakes with stirring stretch drives, was the 4 - 5 early favorite to win the belmont and become the 12th triple crown winner and first since affirmed in 1978 .\nreddam said he spoke to i' ll have another' s young jockey, mario gutierrez, to tell him and said\nhe reacted with sadness about the horse' s condition. then he asked if he could go home .\nvictor davila, now an exercise rider for eisaman equine in williston, sold i' ll have another in 2011 for $ 35, 000 at the ocala breeders' sales co. after breaking and training him at his bosses' farm .\ndoug o' neill said the decision to bring i' ll have another to the track shortly after 5: 30 a. m. on friday was to avoid congestion around the detention barn housing the 12 horses entered for the belmont .\ntriple crown hopeful i' ll have another is walked into barn 9 after a press conference announcing that he will be scratched from the belmont stakes at belmont park in elmont, new york, june 8, 2012. reuters / shannon stapleton\nfor the second straight race, the kentucky derby winner i’ll have another ran down the pace - setter bodemeister in deep stretch, winning the preakness stakes, the second leg of the triple crown, on saturday at pimlico race course in baltimore .\nridden by derby rookie mario gutierrez, i' ll have another caught front - runner bodemeister with a sixteenth of a mile left in the 1 1 / 4 - mile race and drew off to a win by a length and a half .\nmario gutierrez (l) comes down the final stretch atop i' ll have another ahead of bodemeister ridden by mike smith during the 138th running of the kentucky derby ahead of at churchill downs on may 5, 2012 in... more\nit looks like half of the field is talented enough to challenge i' ll have another on saturday. the unknown distance and the mere history of the triple crown suggests he would surely suffer an upset, and it could very likely happen .\n“i’m not asking for your hand in marriage—i’m asking you to pull me up off the floor. ”\nwith the two - year - old season winding down, what are his plans for the “offseason? ” i’m going to play a lot of golf, ” he said with a laugh. “i bought 15 or 16 horses this year, and i’ll spend the summer watching them develop with doug. he’s got about 60 horses in training at hollywood and i’ll have the babies at santa anita. ”\nwhile i’ll have another was getting ready for his date with destiny at churchill downs, dennis o’neill was back in ocala at the april sale, buying seven two - year - olds at prices ranging from $ 25, 000 to $ 100, 000, and true to his theory only the hundred grander worked as fast as: 10 flat. we caught up to him a day before he would catch a plane to baltimore and reunite with team i’ll have another for the preakness on saturday .\ni' ll have another' s improbable run has now come to an unexpected end. the horse was sold as a yearling in 2010 for $ 11, 000 and faced 15 - to - 1 odds in the derby before becaming the first winner ever to have started from post no. 19 .\nbut the tendon injury that prompted the immediate retirement of i’ll have another underscored the more banal truth: thoroughbred racehorses are fragile and injuries to them are commonplace. they have been bred for three centuries to produce maximum speed and stamina by carrying a powerful body on spindly, delicate underpinnings. their ankles, knees and legs are always vulnerable. i’ll have another was a different case only because his injury made front - page headlines and because it made more sense to retire a colt with future stud value than to bring him back to competition next year .\nobviously we' ll be having a parliamentary party meeting next week where i would assume this issue would be discussed .\nmario gutierrez (l) comes down the final stretch atop i' ll have another ahead of bodemeister ridden by mike smith during the 138th running of the kentucky derby ahead of at churchill downs on may 5, 2012 in louisville, kentucky. less\nniikappu - gun, japan — it was just after noon on a recent day at big red farm, one of japan’s largest horse breeders, time for hiroshi kimura to take the 5 - year - old stallion i’ll have another for a walk .\nat least for now, i’ll have another seems off to a good start in his new life. in the corner stall of the nicest stable on the 670 - acre farm, he welcomes visitors with a curiosity and playfulness befitting his relative youth." ]
{ "text": [ "i 'll have another ( foaled april 1 , 2009 ) is a north american thoroughbred race horse , bred in kentucky , owned by canadian businessman j. paul reddam and trained by doug o'neill .", "in may 2012 , ridden by mario gutierrez , he won the first two legs of the triple crown by taking the kentucky derby with a time of 2:01.83 .", "and the preakness stakes in 1:55.94 .", "on the day before the belmont stakes , he was scratched due to tendonitis , ending his chances of winning the triple crown , and retired from racing . " ], "topic": [ 22, 14, 0, 14 ] }
"i'll have another (foaled april 1, 2009) is a north american thoroughbred race horse, bred in kentucky, owned by canadian businessman j. paul reddam and trained by doug o'neill. in may 2012, ridden by mario gutierrez, he won the first two legs of the triple crown by taking the kentucky derby with a time of 2:01.83. and the preakness stakes in 1:55.94. on the day before the belmont stakes, he was scratched due to tendonitis, ending his chances of winning the triple crown, and retired from racing."
[ "i'll have another (foaled april 1, 2009) is a north american thoroughbred race horse, bred in kentucky, owned by canadian businessman j. paul reddam and trained by doug o'neill. in may 2012, ridden by mario gutierrez, he won the first two legs of the triple crown by taking the kentucky derby with a time of 2:01.83. and the preakness stakes in 1:55.94. on the day before the belmont stakes, he was scratched due to tendonitis, ending his chances of winning the triple crown, and retired from racing." ]
"animal-train-11"
"animal-train-11"
"2662"
"ptocheuusa paupella"
[ "ptocheuusa paupella (larvae) walking on seadhead' s petals. faro, algarve\nptocheuusa paupella (light fleabane neb) - norfolk micro moths - the micro moths of norfolk .\nenter the name or part of a name you wish to search for. the asterisk character * can be used as wildcard. e. g.' papilio *'. keep in mind that the search is only based on the full taxon name .\nwe are still having problems with the search feature. unfortunately we cannot give a timeline when the advanced search will be fixed .\nthe id resolving service for stable taxon ids is currently under maintenance. meanwhile, please use the name search in order to find the taxon page .\nmuseum für naturkunde leibniz - institut für evolutions - und biodiversitätsforschung invalidenstr. 43 10115 berlin germany e - mail: fauna - eu (at) mfn - berlin. de website: urltoken\nhtml public\n- / / w3c / / dtd xhtml 1. 0 transitional / / en\nurltoken\na new species of fish, pseudoliparis swirei, published in zootaxa (4358: 161 - 177) by gerringer, m. e et al. was voted among top 10 new species described in 2017 .\na new species of madagascan crickets described by mustafa ünal and george beccaloni in zootaxa was featured in a national geographic story. well done mustafa and george !\na new species of wolf spider, lycosa aragogi, is named after aragog—the famous fictional spider from “harry potter” book series by j. k. rowling. the new species is similar to the animatronic puppet version of the character used in the film “harry potter and the chamber of secrets”, which is actually based on a wolf spider. the naming of the new species is dedicated to the 20th anniversary of harry potter book series .\nmariah o. pfleger, r. dean grubbs, charles f. cotton, toby s. daly - engel\nidentification of nipaecoccus (hemiptera: coccomorpha: pseudococcidae) species in the united states, with descriptions of nipaecoccus bromelicola sp. n. and the male of n. floridensis beardsley\na small but rather attractive species, having a buff ground colour streaked whitish and with darker speckling .\nits distribution covers the southern half of england, with the odd record further north. it frequents generally damper habitats, and flies during june and again in august and september .\nukmoths is built, run and maintained by ian kimber, with thanks to the many kind contributors who provide photos and information .\nthe ukmoths facebook page is a great place to post your identification queries. more often than not you' ll get a positive id on most photos fairly quickly .\nlooking for a specific moth species? enter just part of the name below .\nprocache: v317 render date: 2018 - 07 - 09 04: 17: 18 page render time: 0. 2647s total w / procache: 0. 3319s\nhtml public\n- / / w3c / / dtd html 4. 01 transitional / / en\nurltoken\noccurs on damp grassland, ditches, woodland rides and at the edges of salt - marshes .\nrecorded in 4 (6 %) of 69 10k squares. first recorded in 1874. last recorded in 2017 .\nunderlying maps using digital map data © norfolk online lepidoptera archive - nola™ 2018. © james wheeler - n o r f o l k m o t h s 2007 - 2018. data © nola™ 2018\nlocal to locally common in southern england south of a line from the wash to the severn, very local further north and west with a few records from nottinghamshire, yorkshire, north wales and south - east ireland. a historic record from lancashire (1887) has not been repeated despite searches for the larvae in this area .\npulicaria dysenterica (common fleabane), see plant distribution map, inula crithmoides (golden - samphire), occasionally on mentha sp. (mint) and centaurea nigra * (common knapweed) .\n* this foodplant by e. s. bradford from two sites in kent .\nin europe also found on inula conyza (ploughman' s - spikenard) and i. montana .\nlarval feeding in common fleabane causes a small number of discoloured raised florets in the seedhead .\ndamp grassland, ditches, damp woodland rides, the edges of salt - marshes, rivers, canals and damp bases of muddy coastal cliffs .\ndouble brooded, from late may to early july and late july to early september. variable, according to the season, sometimes present in mid - july .\nlatest: 5th october 2003 (vc12), an exceptionally late date with the next earliest on 23rd september .\nlarva: feeding in the seedheads during july and again from mid september, overwintering fully fed through to the following may. a patch of raised and discoloured florets indicates its presence .\nadult: can be found resting on the flowerheads of the larval foodplant, flies at dusk and comes readily to mercury vapour light .\nalthough slightly variable in the extent of its ochreous - yellow markings on the white base colour, fresh specimens should not be confused with any other species in the british isles .\nhtml public\n- / / w3c / / dtd xhtml 1. 1 / / en\nurltoken\nnotes: local in damp grassland, ditches, woodland rides and saltmarshes throughout much of southern england, southern wales and southern ireland. in hampshire still reasonably common in the south - east of the county, but it has become scarce in recent years in north hampshire and on the isle of wight. wingspan 10 - 12 mm. comes readily to light, and is fairly distinctive. larva feeds within seedheads of common fleabane and golden - samphire, over - wintering as a pupa .\nhtml public\n- / / w3c / / dtd html 3. 2 / / en\na local and rare species in belgium, hitherto known only from two provinces. its a species of damp habitats .\nthe adults fly in two generations: from may till june and again from end of june till september. they come to light .\nbelgium, antwerpen, kapellen, 15 june 2005. (photo © chris steeman )\nresident. occurring singly, occasionally sparingly at mv light, in a very few places in both vice - counties, although often common at walberton. double - brooded, flying mainly in june, and again from early august to early september. the species has been associated with common fleabane in sussex. (pratt, 2011) .\na maximum of five species may be selected. the data for each species can be then viewed on the same page. tick the box below to select this species .\nws: 10 - 12mm; bivoltine jun, aug - sep; common fleabane (pulicaria dysenterica), golden samphire (inula crithmoides); common in damp grasslands, ditches, woodland rides and saltmarsh in s. england, mostly s of the wash - severn line .\n§1 foulness, essex, 14 / 07 / 2013; male; fw 5. 1mm §2 foulness, essex, 26 / 08 / 2017; male; fw 4. 9mm all images © chris lewis\nif you have images for this taxon that you would like to share with nbn atlas, please upload using the upload tools." ]
{ "text": [ "ptocheuusa paupella , the light fleabane neb , is a moth of the gelechiidae family .", "it is found from central and southern europe to the ural mountains .", "it is also found in turkey and india .", "the wingspan is 10 – 12 mm .", "the ground colour is buff , streaked with whitish and with darker speckling .", "adults are on wing in june and again from august to september .", "the larvae feed in the seedheads of pulicaria dysenterica , centaurea nigra and inula crithmoides . " ], "topic": [ 2, 20, 20, 9, 1, 8, 8 ] }
"ptocheuusa paupella, the light fleabane neb, is a moth of the gelechiidae family. it is found from central and southern europe to the ural mountains. it is also found in turkey and india. the wingspan is 10 – 12 mm. the ground colour is buff, streaked with whitish and with darker speckling. adults are on wing in june and again from august to september. the larvae feed in the seedheads of pulicaria dysenterica, centaurea nigra and inula crithmoides."
[ "ptocheuusa paupella, the light fleabane neb, is a moth of the gelechiidae family. it is found from central and southern europe to the ural mountains. it is also found in turkey and india. the wingspan is 10 – 12 mm. the ground colour is buff, streaked with whitish and with darker speckling. adults are on wing in june and again from august to september. the larvae feed in the seedheads of pulicaria dysenterica, centaurea nigra and inula crithmoides." ]
"animal-train-12"
"animal-train-12"
"2663"
"neobarbara"
[ "neobarbara is a genus of moths belonging to the tortricidae family. it contains only one species, neobarbara olivacea, which is found in china (qinghai) .\ngenus: neobarbara liu & nasu, 1993. tinea 13 (21 - 29): 245 .\ntype - species: neobarbara olivacea liu & nasu, 1993. reports on the collections made by the bou 2: 95 .\nhtml public\n- / / w3c / / dtd html 4. 0 transitional / / en\nby t. m. gilligan 1, j. baixeras 2, j. w. brown 3, and k. r. tuck 4\nurltoken is pleased to offer the complete world catalogue of the tortricidae (t @ rts)! this is a complete list of all world species, utilizing the world catalogue published in 2005 as the foundation for the database. version 3. 0 of the online catalogue contains 15, 099 records representing 10, 883 species. more than 1, 600 records have been updated from ver 2. 0 (jul, 2012), and more than 3, 000 records have been updated from the original catalogue. the database is completely searchable and contains photos of over 1, 200 type specimens .\nt @ rts will be updated regularly both with corrections from the original world catalogue and with additions since its publication. as such, these pages will serve as the most up to date information on current tortricid nomenclature. if you find any errors in the data presented here or have any questions / comments, please use the contact form to send the authors an email .\nwe are indebted to all of the original authors of the world catalogue (j. w. brown, j. baixeras, r. brown, m. horak, f. komai, e. metzler, j. razowski, and k. tuck) for providing the basis for this project. we would also like to thank the dozens of individuals who have provided corrections or updates to the database since it was first placed online in 2007 .\ngilligan, t. m. , j. baixeras, j. w. brown & k. r. tuck. 2014. t @ rts: online world catalogue of the tortricidae (ver. 3. 0). urltoken\n1 colorado state university, bioagricultural sciences and pest management, 1177 campus delivery, fort collins, co 80523, usa 2 institut cavanilles de biodiversitat i biologia evolutiva, universitat de valencia, apartat oficial 2085, 46071 valencia, spain 3 systematic entomology laboratory - usda [ retired ], smithsonian institution, p. o. box 37012, national museum of natural history, washington, dc 20013, usa 4 curator - microlepidoptera [ retired ], entomology department (dc2 - 2n), natural history museum, cromwell road, london sw7 5bd, uk\nunless noted, all images on these pages are copyright © 2003 - 14 by todd gilligan. please do not download, copy, print, or otherwise distribute any images from these pages without the permission of the author. contact form .\nhtml public\n- / / w3c / / dtd html 4. 01 transitional / / en\nurltoken\ntype specimens: type (s) china: qinghai, (? depository). .\nt @ rts: online world catalogue of the tortricidae (ver. 2. 0 )\nby gilligan, t. m. , j. baixeras, j. w. brown & k. r. tuck. 2012 .\nwe use cookies to optimise your experience when using this site. view our cookie policy and our new privacy notice .\nconfused by a class within a class or an order within an order? please see our brief essay .\nto cite this page: myers, p. , r. espinosa, c. s. parr, t. jones, g. s. hammond, and t. a. dewey. 2018. the animal diversity web (online). accessed at https: / / animaldiversity. org .\ndisclaimer: the animal diversity web is an educational resource written largely by and for college students. adw doesn' t cover all species in the world, nor does it include all the latest scientific information about organisms we describe. though we edit our accounts for accuracy, we cannot guarantee all information in those accounts. while adw staff and contributors provide references to books and websites that we believe are reputable, we cannot necessarily endorse the contents of references beyond our control .\nthis material is based upon work supported by the national science foundation grants drl 0089283, drl 0628151, due 0633095, drl 0918590, and due 1122742. additional support has come from the marisla foundation, um college of literature, science, and the arts, museum of zoology, and information and technology services .\nthe wingspan is about 10 mm. the forewings are olive - green with cream white tips of the scales. the hindwings are light greyish - brown .\nthe larvae feed on picea asperata, picea purpurea and picea wilsonii. the larvae have a cream - yellow body and dark brown head .\nneobisnius is a genus of large rove beetles in the family staphylinidae. there are at least 20 described species in neobisnius .\nneobike (龍通關) is a company and brand of folding bicycles, made in taiwan. the company manufactures copies of folding bicycle designs, including those originally created by brompton bicycle and dahon .\nneobernaya spadicea, common name the chestnut cowrie, is a species of sea snail in the cowrie family, cypraeidae .\npopular: trivia, history, america, cities, world, usa, states, television, ... more" ]
{ "text": [ "neobarbara is a genus of moths belonging to the tortricidae family .", "it contains only one species , neobarbara olivacea , which is found in china ( qinghai ) .", "the wingspan is about 10 mm .", "the forewings are olive-green with cream white tips of the scales .", "the hindwings are light greyish brown .", "the larvae feed on picea asperata , picea purpurea and picea wilsonii .", "the larvae have a cream-yellow body and dark brown head . " ], "topic": [ 26, 26, 9, 1, 1, 3, 23 ] }
"neobarbara is a genus of moths belonging to the tortricidae family. it contains only one species, neobarbara olivacea, which is found in china (qinghai). the wingspan is about 10 mm. the forewings are olive-green with cream white tips of the scales. the hindwings are light greyish brown. the larvae feed on picea asperata, picea purpurea and picea wilsonii. the larvae have a cream-yellow body and dark brown head."
[ "neobarbara is a genus of moths belonging to the tortricidae family. it contains only one species, neobarbara olivacea, which is found in china (qinghai). the wingspan is about 10 mm. the forewings are olive-green with cream white tips of the scales. the hindwings are light greyish brown. the larvae feed on picea asperata, picea purpurea and picea wilsonii. the larvae have a cream-yellow body and dark brown head." ]
"animal-train-13"
"animal-train-13"
"2664"
"agama planiceps"
[ "agama lionotus var. mwanzae loveridge 1923 agama agama mwanzae — mertens 1955: 53 agama planiceps mwanzae — loveridge 1957: 195 agama planiceps mwanzae kluge 1984 agama planiceps mwanzae — wermuth 1967: 21 agama mwanzae — broadley & howell 1991: 11 agama mwanzae — wagner et al. 2008 agama mwanzae — spawls et al. 2018: 232\ncyndy parr set\nimage of agama planiceps\nas an exemplar on\nagama\n.\nthe diet of the namibian rock agama (agama planiceps) consists mainly of insects – predominantly ants and termites .\nagama planiceps adult female, kunene river lodge, namibia. [ photo trevor hardaker © ]\nagama planiceps adult male, kunene river lodge, namibia. [ photo trevor hardaker © ]\nagama planiceps adult male, daan viljoen game reserve, namibia. [ photo trevor hardaker © ]\nagama planiceps immature male, daan viljoen game reserve, namibia. [ photo trevor hardaker © ]\nstudies on african agama vi. taxonomic status of the west african agama (sauria: agamidae) with prominent tail crests: agama boulengeri lataste 1886, agama insularis chabanaud, 1918 and agama cristata mocquard, 1905\nheideman, n. j. l. 1993. social organization and behaviour of agama aculeata aculeata and agama planiceps planiceps during the breeding season. j. herp. assoc. africa (42): 29 - 31 - get paper here\nstudies on african agama vii. a new species of the agama agama - group (linnaeus, 1758) (sauria: agamidae) from cameroon & gabon, with comments on agama mehelyi tornier, 1902\nagama aculeata merrem 1820: 53 agama aculeata duméril & bibron 1837: 499 (non merrem ?) trapelus (psammorrhoa) bibronii fitzinger 1843 (nom. subst .) saura spinalis wagler 1866 (nom. subst. , partim) agama infralineata peters 1877 agama aculeata — boulenger 1885: 351 agama pulchella bocage 1896 agama hispida aculeata — loveridge 1936: 52 agama hispida aculeata — fitzsimons & brain 1958 agama aculeata aculeata — auerbach 1987: 98 agama aculeata — pianka & vitt 2003: 123 agama aculeata aculeata — bates et al. 2014: 303 agama aculeata distanti (boulenger 1902) agama distanti boulenger 1902: 339 agama hispida var. distanti — loveridge 1923: 942 agama aculeata distanti — boycott 1992 agama aculeata distanti — bates et al. 2014: 30\nstudies on africa agama v. on the origin of lacerta agama linnaeus, 1758 (squamata: agamidae )\ncunningham, p. 2011. agama planiceps (peters, 1862) diet. african herp news (55): 19 - 20\nbillawer, w. h. ; heidemann, n. j. l. 1996. a comparative analysis of diurnal behavioural activities in males of agama aculeata aculeata and agama planiceps planiceps in windhoek, namibia. j. herpet. assoc. africa 45 (2): 68 - 73 - get paper here\nheideman, n. j. l. (1993): social organization and behaviour of agama aculeata aculeata and agama planiceps (reptilia: agamidae) during the breeding season. the journal of the herpetological association of africa 42 (1): 28–31 .\ncowley, t. & cunningham, p. 2004. agama planiceps peters, 1862 as prey item for black mongoose galerella (sanguinea) nigrata [ short note ]. herpetozoa 17: - get paper here\na. mwanzae was previously regarded as a subspecies of a. planiceps peters, 1862 (spawls et al. 2002) .\nwagner, p. ; barej, m. f. & schmitz, a. 2009. studies on african agama vii. a new species of the agama agama - group (linnaeus, 1758) (sauria: agamidae) from cameroon & gabon, with comments on agama mehelyi tornier, 1902. bonner zoologische beiträge 56 (4): 285–297 - get paper here\nwagner, p. ; krause, p. & böhme, w. 2008. studies on african agama iii. resurrection of agama agama turuensis loveridge, 1932 (squamata: agamidae) from synonymy and elevation to species rank. salamandra 44 (1): 35 - 42 - get paper here\nthis single small agama was perched on this little boulder in central etosha np, and was photo' d out the car window. etosha agama has a tiny range: it is essentially endemic to etosha park. ground agama has a much wider range throughout the interior of s. w. africa. we wanted it to be the etosha agama but the photo in branch (1998) looks better for ground agama — the etosha agama doesn' t seem to be this patterned. further, the 5th toe may be as long as the 1st toe (good for ground) instead of very short (as in etosha). this is probably ground agama but, either way, it is a lifer .\nadditions to the lizard diversity of the horn of africa – two new species of the agama spinosa group .\nwagner, p. , a. burmann & w. böhme 2008. studies on african agama ii - resurrection of agama agama kaimosae loveridge, 1935 (squamata: agamidae) from synonymy and its elevation to species rank. russ. j. herpetol. 15 (1): 1 - 7 - get paper here\nagama aculeata armata is treated here as a full species. synonymy: wermuth 1965, wagner et al. 2012 .\nsubspecies: agama planiceps mwanzae is now considered a separate species, a. mwanzae. distribution: see map in kissling et al. 2016: fig. 1. not in cameroon (p. wagner, pers. comm .) a. planiceps exhibits a striking sexual dimorphism: males have bright red head and a dark blue body while females have a head with light spots on dark base color (see back cover of iguana - rundschreiben 1 / 2006) .\nalthough i photographed this albino - like agama in a tree, it’s colouring is a mystery to me and i’m not sure whether it is a rock or tree agama. it could be a juvenile still getting its colours, or an adult doing its chameleon camouflage trick !\nmclachlan g r 1981. taxonomy of agama hispida (sauria: agamidae) in southern africa. cimbebasia ser. a 5 (6): 219 - 227\nkowalski, t. & barts, m. 2007. bildung eines gabelschwanzes bei agama lionotus lionotus boulenger 1896. sauria 29 (1): 54 - get paper here\nharlan, r. 1825. description of a new species of agama. j. acad. nat. sci. philadelphia 4: 296 - 305 - get paper here\ncarter aj, goldizen a, heinsohn r (2012) personality and plasticity: temporal behavioural reaction norms in a lizard, the namibian rock agama. animal behaviour 84: 471–477 .\nyarnell, richard w. and bethan haf jones 2001. notes on the behaviour and morphology of agama mwanzae in northern tanzania. african herp news (33): 4 - 9\nagama cornuta harlan 1825: 299 lacerta cornuta — cuvier 1819: 37 (fide gentry 1885) tapaya cornuta — cuvier 1829: 37 phrynosoma cornutum — gray in griffith 1831: 9 phrynosoma bufonium wiegmann 1828: 367 phrynosoma harlanii wiegmann 1834: 54 phrynosoma harlanii — duméril & bibron 1837: 314 tropidogaster cornutus — fitzinger 1843: 79 (fide gentry 1885) phrynosoma harlani — neill 1846: 99 phrynosoma planiceps hallowell 1852: 178 phrynosoma harlesii — brühl 1886 (in error) phrynosoma cornutum planiceps — boulenger 1885: 246 phrynosoma brevicornis e. g. boulenger 1916 phrynosoma cornutum — smith & taylor 1950: 99 phrynosoma cornutum — stebbins 1985: 139 phrynosoma cornutum — conant & collins 1991: 112 phrynosoma cornutum — liner 1994 phrynosoma cornutum — liner 2007\njustification: agama mwanzae has been assessed as least concern due to its large distribution and tolerance of anthropogenic environments. no specific threats have been reported and this species is not undegoing significant population declines .\nyarnell, r. w. and jones, b. h. 2001. notes on the behaviour and morphology of agama mwanzae in northern tanzania. african herp news 33: 4 - 9 .\nwagner, p. 2014. a new cryptic species of the agama lionotus complex from south of the ngong hills in kenya. salamandra 50 (4): 187 - 200 - get paper here\nholotype: zmb 750 ,\nin promontorio bonae spei\n, leg. v. borcke (actually a paralectotypus fide tillack, pers. comm. 22 jan 2014, wagner et al. 2012) lectotype: fig. 7 of seba (1735, ii, tomus 8) holotype: mnhn [ agama aculeata duméril & bibron 1837 ] syntypes: zmb 4217, 4218, 4219 [ agama infralineata peters 1877 ]\nboulenger, g. a. 1902. a new name for the common agama of the transvaal. ann. mag. nat. hist. (7) 9: 339 - 339 - get paper here\nbarts, m. & trapp, b. 2003. agama mwanzae loveridge 1923 - ostafrikanische selsenagame oder mwanzae - flachkopfagame. reptilia (münster) 8 (42): 51 - 54 - get paper here\nloveridge, a. 1923. notes of east african lizards collected 1920 - 1923 with the description of two new races of agama lionotus blgr. proceedings of the zoological society of london 1923: 935 - 969 .\nloveridge, a. 1923. notes on east african lizards collected 1920 - 1923 with the description of two new races of agama lionotus blgr. proc. zool. soc. london 1923: 935 - 969 - get paper here\nthis species is locally very abundant, but is strictly reliant on the presence of sheet rock outcrops (s. spawls pers. comm. 2014). this is the most common agama observed in the serengeti and masaai mara (s. spawls pers. comm. 2014) .\nleaché, adam d. ; rebecca a. chong, theodore j. papenfuss, philipp wagner, wolfgang böhme, andreas schmitz, mark - oliver rödel, matthew lebreton, ivan ineich, laurent chirio, aaron < br / > bauer, edem a. eniang, & sherif baha el din 2009. phylogeny of the genus agama based on mitochondrial dna sequence data. bonner zoologische beiträge 56 (4): 273–278 - get paper here\nwe asked several questions about the nature and consequences of the iiv of boldness in wild namibian rock agamas across two seasons. we found evidence that intraindividual variability in flight initiation distances differed significantly among individuals both within seasons and overall. additionally, though iiv increased slightly between seasons, iiv was highly repeatable, suggesting that iiv could be considered a ‘trait’ in this species. further, we found strong correlations between iiv and boldness. overall and in both the dry and the wet seasons, shyer individuals—those with higher mean fids—were less variable—had lower iivs. however, there was no effect of iiv on the mass of the agama. below we discuss iiv in the existing framework of personality and plasticity and its implications for this framework before considering our findings in more detail .\nthe study was undertaken at hobatere campsite (lat 70°53′37. 74′′s, long 19°28′31. 35′′e), 70 km north of kamanjab in northwestern namibia. a population of the namibian rock agama occupied the area (ca. 1. 0 × 0. 7 km) immediately around the campsite. we identified (see below) and studied 30 individuals; however, males were observed in 3 blocks of 10 each. the first block of 10 individuals was observed during february 2009, the second block during march 2009, and the third block during april 2009. the first block of males was observed at the end of the breeding season; males were observed courting females during this time (running in circles around females and head - bobbing). during the second and third blocks no courting behavior was observed. thus we call february “breeding season” and march and april “nonbreeding season. ”\nthe boldness of individual male agamas was repeatedly assessed by measuring flight initiation distances. a single observer (ajc) approached each male on foot at a constant speed (4 km / h; measured using a gps unit [ etrex, garmin, olathe, ks, usa ]) after a 10 min observation period (performed as part of another study: [ 16 ]) from a distance of approx. 20 m (range 10–35 m) depending on the position of the agama in relation to the observer at the end of the observation period. males were approached to test their fid when an observation period ended with the male basking prominently within his home range [ 17 ], or had been watched for at least 3 min in the case of those individuals (n = 2) that did not form part of the observational study (for details, see [ 16 ], [ 20 ]). the distance from the observer when the male fled was measured to the nearest 5 cm using a measuring tape. smaller fids are indicative of higher boldness [ 17 ] .\nschacki: angola. type locality: cubal (900 m. elevation), province benguella, angola .\ntype locality: neu - barmen, im hererolande, an der westküste von afrika, im 21. ° südlicher breite [ = otjimbingue, namibia ]\nnote: tdwg regions are generated automatically from the text in the distribution field and not in every cases it works well. we are working on it .\nsyntypes: zmb 4200 - 1 syntype. zisp 1140, 1 specimen, “otjimbingue” [ otjimbingwe, erongo region, namibia ]. received from zmb in 1868 .\nangel, fernand 1925. résultats scientifiques. vertebrata. reptiles et batraciens. [ mabuia (mabuiopsis) jeanneli, lygosoma graueri quinquedigitata, ablepharus massaiensis ]. in: voyage de ch. alluaud et r. jeannel en afrique orientale (1911 - 1912). - paris, 2: 1 - 63 .\nbarts, m. 2003. die agamen des südlichen afrikas. draco 4 (14): 70 - 79 - get paper here\nbarts, m. & wilms, t. 2003. die agamen der welt. draco 4 (14): 4 - 23 - get paper here\nbauer, aaron m. ; branch, william r. & haacke, wulf d. 1993. the herpetofauna of the kamanjab area and adjacent damaraland, namibia. madoqua (windhoek) 18 (2): 117 - 145 .\nboulenger, g. a. 1885. catalogue of the lizards in the british museum (nat. hist .) i. geckonidae, eublepharidae, uroplatidae, pygopodidae, agamidae. london: 450 pp. - get paper here\nboulenger, g. a. 1888. on new or little known south african reptiles. ann. mag. nat. hist. (6) 2: 136 - 141 - get paper here\ncimatti, e. 2007. namibia - introduction to a vast territory. reptilia (gb) (50): 58 - 67 - get paper here\nconradie w, bills r, and branch wr. 2016. the herpetofauna of the cubango, cuito, and lower cuando river catchments of south - eastern angola. amphibian & reptile conservation 10 (2) [ special section ]: 6–36 - get paper here\ncooper jr. , w. e. 2005. duration of movement as a lizard foraging movement variable. herpetologica 61 (4): 363 - 372 - get paper here\ngrubermann, m. 2013. einige fotografische beobachtungen an agamen in kenia, tansania, malawi, südafrika und namibia. iguana 26 (1): 23 - 33\nhellmich, w. 1957. herpetologische ergebnisse einer forschungsreise in angola. veröff. zool. staatssammlung münchen 5: 1 - 91 - get paper here\nherrmann, h. - w. ; w. r. branch 2013. fifty years of herpetological research in the namib desert and namibia with an updated and annotated species checklist. journal of arid environments 93: 94–115 - get paper here\nkissling, w. daniel; anne blach - overgaard, roelof e. zwaan & philipp wagner 2016. historical colonization and dispersal limitation supplement climate and topography in shaping species richness of african lizards (reptilia: agaminae). scientific reports 6: 34014, doi: 10. 1038 / srep34014 - get paper here\nlebreton, matthew 1999. a working checklist of the herpetofauna of cameroon. netherlands committee for iucn, 160 pp .\nloveridge, a. 1936. african reptiles and amphibians in the field museum of natural history. zool. ser. field mus. nat. hist. , chicago, 22 (1): 1 - 122 - get paper here\nmertens, r. 1938. amphibien und reptilien aus angola, gesammelt von w. schack. senckenbergiana, 20: 425 - 443\nmertens, r. 1955. die amphibien und reptilien südwestafrikas. aus den ergebnissen einer im jahre 1952 ausgeführten reise. abh. senckenb. naturf. ges. (frankfurt) 490: 1 - 172 - get paper here\nmonard, a. 1951. résultants de la mission zoologique suisse au cameroun. reptiles. mém. ifan, dakkar, ser. sci. nat. 1: 123 - 170 .\nmonard, albert 1937. contribution à l' herpétologie d' angola. arq. mus. bocage, lisbon 8: 19 - 153 .\npeters, w. c. h. 1862. übersicht einiger von dem, durch seine afrikanische sprachforschungen, rühmlichst bekannten, hrn. missionär c. h. hahn bei neu - barmen, im hererolande, and der westküste von afrika, im 21˚ südl. br. gesammelten amphibien, nebst beschreibungen der neue monatsber. akad. wiss. berlin 1862: 15 - 26 - get paper here\nschleicher, alfred 2015. reptilien namibias. namibia scientific society, 276 pp .\nthis database is maintained by peter uetz (database content) and jakob hallermann, zoological museum hamburg (new species and updates) .\nwe use cookies to enhance your experience on our website. by continuing to use our website, you are agreeing to our use of cookies. you can change your cookie settings at any time .\nalecia j. carter, anne w. goldizen, sara a. tromp; agamas exhibit behavioral syndromes: bolder males bask and feed more but may suffer higher predation, behavioral ecology, volume 21, issue 3, 1 may 2010, pages 655–661, urltoken\nindividuals within a population should adapt their behavior to suit their current physical and social environment (elgar 1989; childress and lung 2003). however, there is now evidence from diverse taxa such as birds (carere et al. 2005; quinn and cresswell 2005; de azevedo and young 2006), mammals (gosling 1998; reale et al. 2000; bremner - harrison et al. 2004), reptiles (lopez et al. 2005), fish (wilson et al. 1993; wilson and godin 2009), and invertebrates (mather and anderson 1993) that this is not always the case. indeed, it has been shown that some aspects of individual behavior are instead constrained within broad behavioral syndromes or “personalities” that can cause the maintenance of suboptimal correlations in behavior (after sih et al. 2004, reviewed in gosling and vazire 2002; dall et al. 2004; dingemanse and reale 2005), which can have a heritable component (drent et al. 2003) .\nduring focal observations, we also recorded the frequencies of a number of behavioral events. we recorded the number of times that males either head bobbed or did push - ups. as we were interested in the rate of signaling and both head - bobs and push - ups should be conspicuous movements to predators, we did not distinguish between the 2 types of signals; we refer to these behaviors collectively as signaling. we defined signaling as any movement of the head and / or torso along a vertical plane. a signaling event was recorded when such movement resulted in no net change in position of the head (i. e. , head moved up and down completely) .\nhome range estimation. although agamas do defend territories, we were unable to confidently define all boundaries; consequently, we refer to all spatial patterns measured as “home ranges. ” we quantified the sizes of the home ranges of the 30 observed males by taking gps positions of males. to get the most accurate estimations of the home ranges of the males, an observer moved through the study site at least daily to find the study individuals. if a male was observed in a new position, the observer returned to gps that position at a later time when the male was not there, to reduce disturbance. we also observed males for up to an hour at a time from a distance of more than 20 m away to observe any new positions that the males occupied during that time. new positions noted in this manner were recorded as mentioned above. positions of males were taken when the accuracy of the gps readings were 3 m or less .\nfeeding rates. we recorded feeding events of males during focal observations. a feeding event was recorded when the observer saw a male bite and masticate an object. males generally ate lepidopteran larvae, small orthopterans, and other insects, but we also observed males eating flowers and other soft plant material .\nwe used the average of the fids of the focal males as a measure of boldness. bolder males will have a shorter fid than shy males by our definition of boldness (risk taking). average male fids did not vary significantly with proximity to the campsite (bordering campsite [ n = 12 ] = 2. 60 ± 0. 55 m, within 50 m of campsite [ n = 8 ] = 4. 25 ± 0. 69, > 50 m from campsite [ n = 10 ] = 3. 78 ± 0. 73 m; analysis of variance, f 2, 29 = 1. 76, p = 0. 19), thus we did not include “campsite proximity” as a variable in the following model. repeatability (r) was calculated following the protocol described in lessells and boag (1987), and the standard error (se) was calculated following becker (1984) .\nwe investigated whether there were relationships between fids and the recorded behaviors using linear mixed effects (lmes) models with “month” as a random factor and fid as the response variable. as we were interested in risk - taking behavior, and both basking and moving presumably attract the attention of predators, we analyzed conspicuous behavior as the sum of time spent basking and time spent moving. proportions of time spent in each behavior were square root arcsine - transformed to break the bounds set by proportions. time spent in thigmothermy was log - transformed, and the exponential of the time spent in conspicuous behavior was used to satisfy normality assumptions. times spent sitting in shade and in other behaviors were overdispersed on analysis, thus we analyzed these data using spearman rank correlations. signaling was converted to a rate / time spent conspicuous, which was log - transformed to satisfy normality assumptions and analyzed as above. data were checked for overdispersion. data were analyzed using r (version 2. 7. 1 using the package “nlme”; r development core team 2008) .\nhome range size. we used minimum convex polygons (mcps) to estimate the home ranges of the observed males. we considered mcp estimation to be appropriate for this system as males are thought to be territorial and thus should not leave the boundaries of their home ranges once they have been established; we did not wish to overestimate their home range sizes by using other methods of analysis. mcps were calculated using r (version 2. 7. 1 using the package “adehabitat”; r development core team 2008). we investigated whether home range sizes of identified males related to their fids using a lmes model in r (version 2. 8. 1 using the package nlme, r development core team 2008) with month as a random factor; mcps were log - transformed to satisfy normality assumptions .\nfrequency of tail loss. for each pair of males, we assessed whether the whole - or half - tail male had the longer fid. we then used a χ 2 - test to compare the number of pairs in which half - tail males had longer fids than whole - tail males with the number of pairs showing the opposite pattern .\nfeeding rates. numbers of feeding events were converted to rates / 10 min and compared with males’ fids using a spearman correlation test .\nwe assessed each male' s fid on average 8 ± 0. 73 times (range = 4–18 times). male fid averaged 3. 14 ± 0. 39 m (range 0. 53–8. 75 m; average of each male' s average). fid did not vary significantly with time since last test within a day; thus, we believe there are no learning effects or habituation to the stimulus (lme; β ± se = −0. 0001 ± 0. 0004, degrees of freedom [ df ] = 129, t = −0. 30, p = 0. 76). ten males were tested during 2 periods (in february and in april) to investigate long - term repeatability of boldness. males increased their fid in april by an average of 0. 41 ± 0. 11 m (range 0. 04–1. 14 m); however, male fid was repeatable during the 2 time periods (r = 0. 95 ± 0. 033; figure 1). because of the difference in fids during the breeding and nonbreeding seasons for these males, data presented below were analyzed using the average of the february fids for all males observed during that time .\nthe relationship between the averages of individual males’ fids during february and april. the line represents the line of best fit for the regression .\nwe observed each of the 30 individual male agamas on average 10. 5 ± 0. 15 times (for a total of 3350 min, range = 9–15 times). we found that males spent, on average, 56. 6 ± 2. 1% of the time observed basking, 5. 9 ± 0. 4% moving, 28. 5 ± 2. 3% in thigmothermy, 3. 3 ± 0. 4% hiding, and 5. 7 ± 0. 7% doing other behaviors. there was a negative correlation between fid and time spent in conspicuous behaviors (β ± se = 16. 63 ± 4. 29, df = 26, t = −3. 87, p = 0. 006; figure 2). as expected given that males that spent more time being conspicuous spend less time hiding, there was a positive correlation between fid and time spent hiding (β ± se = −3. 28 ± 1. 12, df = 26, t = −2. 94, p < 0. 007). we did not find relationships between fid and any of the other behavioral categories tested (time spent in thigmothermy: β ± se = 2. 42 ± 1. 52, df = 26, t = 1. 60, p = 0. 12; time spent sitting in shade: r ± se = 0. 16 ± 0. 19, z = 0. 87, p = 0. 39; time spent in other behaviors: r ± se = −0. 17 ± 0. 19, z = −0. 93, p = 0. 35). male' s rates of signaling while conspicuous did not vary with fid (β ± se = −0. 73 ± 0. 66, df = 26, t = 1. 11, p = 0. 28) .\nthe relationship between male fids and the proportion of time spent in conspicuous behaviors (basking and moving) (averaged across all 10 - min focal observations of each male' s behavior). the line represents the line of best fit for the regression .\nmale home ranges averaged 457 ± 81 m 2 (range 21–1896 m 2). home range sizes decreased with increasing fids (lme; β ± se = −62. 3 ± 27. 1, df = 26, t = 2. 30, p < 0. 03; figure 3), suggesting that bolder males had larger home ranges .\nthe relationships between male fids and home range sizes. the line represents the line of best fit for the regression .\nwe recorded fids of 18 pairs of half - and whole - tail nearest neighbors. in 14 of the 18 nearest - neighbor pairs of males, the half - tail male had a shorter fid than the whole - tail male. these 14 pairs were significantly more than the 4 pairs showing the opposite pattern (χ 2 = 5. 56, df = 1, p = 0. 02), supporting our hypothesis that individuals with a shorter fid were at a higher predation risk\nmales ate at an average rate of 0. 35 ± 0. 07 events / 10 min. we found that fid and feeding rates were correlated using a spearman correlation test (r ± se = −0. 36 ± 0. 18, z = 1. 96, p = 0. 05; figure 4) .\nthe relationship between male fid and feeding rate / 10 min. the line represents the line of best fit, however, data were analyzed with a spearman correlation test (p = 0. 05) .\nbolder males were found to have larger home ranges than shyer males, suggesting a possible benefit to being bold. having a larger home range may give a male greater access to female agamas and / or resources such as insects or plant material (melville and swain 1999; vanpé et al. 2009). we are quite confident that we accurately estimated the home ranges of the observed males, but there is a chance that shyer males were unwilling to enter all parts of their home ranges when being observed, even from great distances. we hypothesize that shyer males suffer costs from having smaller home ranges; this should be tested in future studies. we predict that bolder males have larger home ranges because they are more aggressive and consequently fight more than shyer males and / or because they spend more time surveying their home range and can respond faster and more effectively to any invasion of the home range .\nwe also found that bolder males fed more than shyer males while being observed, which suggests another possible benefit to being bold. bolder males may find more to eat because they have larger / better home ranges or they may eat more because they are out foraging more; this also warrants further research. boldness is often correlated with levels of aggressiveness (verbeek et al. 1996), and aggressive males may be able to defend home ranges that produce better / more resources. alternatively, both shyer and bolder male agamas may have had the same opportunities to gain food but shyer males may have been unwilling to take those opportunities in the presence of a predator (the researcher). this kind of risk - taking behavior on the part of the bolder males may represent a significant benefit to bolder males if it causes them to gain more resources .\nwe predicted that shyer males would signal less than bolder males as signaling can be a risk - taking behavior (zuk and kolluru 1998) but found no correlation between boldness and signaling behavior. the majority of our study was undertaken during the nonbreeding season during which time signaling may not have been as important to males. bolder males may signal more during the breeding season and mitigate the cost of signaling during the nonbreeding season by decreasing their rate of signaling at that time. we suggest future studies should investigate this aspect of signaling behavior .\nour results demonstrate the importance of empirical research in the field of personality research. however, without long - term studies on this and other systems, we will not be able to accurately estimate the fitness of bolder and shyer individuals, which would require data on survival and reproductive success. we were not able to measure the repeatability of individual differences in the behaviors of our agamas, except for fid; this would require observations to be carried out over a longer time frame and should be the subject of further work. empirical data should thus form the basis of experimental studies in future research. we suggest that future studies should work to the following theoretical framework to determine the evolutionary and ecological significance of consistent individual differences in behavior in wild animals: 1) estimate the repeatability of behavioral variations, 2) test for behavioral syndromes, and 3) estimate the fitness consequences of these behavioral syndromes, preferably over the lifetime of the species under study .\nthe authors would like to thank ben barth, katherine forsythe, and claudia sick for their neon awesome help in the field, the braine family at hobatere lodge for logistical support and interesting discussions, and harry marshall for his help with creating figures .\nhome - range characteristics of an alpine lizard, niveoscincus microlepidotus (scincidae), on mt. wellington, southern tasmania\n© the author 2010. published by oxford university press on behalf of the international society for behavioral ecology. all rights reserved. for permissions, please e - mail: journals. permissions @ urltoken\noxford university press is a department of the university of oxford. it furthers the university' s objective of excellence in research, scholarship, and education by publishing worldwide\nfor full access to this pdf, sign in to an existing account, or purchase an annual subscription .\ncontinent: africa distribution: namibia (damaraland, kaokoveld) schacki: angola. type locality: cubal (900 m. elevation), province benguella, angola. type locality: neu - barmen, im hererolande, an der westküste von afrika, im 21. ° südlicher breite [ = otjimbingue, namibia ]\neol content is automatically assembled from many different content providers. as a result, from time to time you may find pages on eol that are confusing .\nto request an improvement, please leave a comment on the page. thank you !\ni’m always excited to come across agamas and lizards on our travels. they are usually such colourful subjects to photograph, but even those that lack colour are still fascinating because of their beautiful scales, spines and armoury, which the camera captures so well! we are lucky in southern africa to have such a huge variety of these little reptiles so my delight is bound to be ongoing as we come across more and more on our journeys around the country .\nagamas are quite common in namibia, especially in the rocky areas, although there are arboreal and terrestrial agamas as well. in southern africa there are eleven species, all quite similar in appearance but with different colours and marking. they tend to camouflage themselves by picking up the colour of the substrate they inhabit, however when they are breeding they are brightly coloured and it is easy to distinguish between the males and females. did you know that agamas can change their colours much like a chameleon does, with males being able to change themselves to resemble females when they are in danger ?\nfemales lay between 5 and 18 eggs in the middle of summer and these take about two months to hatch. don’t you love the ferocious mock teeth markings on her lips? very scary! !\ntree agamas (acanthocercus atricollis) usually have large blue heads and their diet consists of flying insects like grasshoppers, beetles and other goggas that inhabit the bark of trees .\nin central namibia we came across this attractive jordans girdled lizard. girdled lizards need the warmth of the sun to raise their body temperature, so they are known as heliotherms and as a result they are diurnal. they tend to eat anything that they can catch which means that their diet is wide and varied, even including vegetation if no insects or small invertebrates can be found. note how well he blends into his environment .\nthis black girdled lizard (cordylus niger) was basking in the sun at langebaan in the western cape. its dark colour serves the purpose of allowing it to absorb heat more effectively because it lives in an environment that has a lot of rain and mist .\nfinally, i’ll end off with a magnificent specimen of an augrabies flat lizard (platysaurus broadleyi), which, as its name suggests, was found in the augrabies falls area in the northern cape .\nunlike their girdled cousins, flat lizards have smooth skin that has an almost velvet finish. they also need the sun to initiate activity and then they spend their day searching for food, basking or interacting with other lizards. flat lizards tend to live on rocks as these quickly heat up bringing the lizards to their preferred temperature .\nconfused by a class within a class or an order within an order? please see our brief essay .\nto cite this page: myers, p. , r. espinosa, c. s. parr, t. jones, g. s. hammond, and t. a. dewey. 2018. the animal diversity web (online). accessed at https: / / animaldiversity. org .\ndisclaimer: the animal diversity web is an educational resource written largely by and for college students. adw doesn' t cover all species in the world, nor does it include all the latest scientific information about organisms we describe. though we edit our accounts for accuracy, we cannot guarantee all information in those accounts. while adw staff and contributors provide references to books and websites that we believe are reputable, we cannot necessarily endorse the contents of references beyond our control .\nthis material is based upon work supported by the national science foundation grants drl 0089283, drl 0628151, due 0633095, drl 0918590, and due 1122742. additional support has come from the marisla foundation, um college of literature, science, and the arts, museum of zoology, and information and technology services .\nhtml public\n- / / w3c / / dtd html 4. 01 transitional / / en\nurltoken\njavascript is turned off in your web browser. please turn it on to take full advantage of arctos, or try our html specimensearch option .\n< p > an evidence describes the source of an annotation, e. g. an experiment that has been published in the scientific literature, an orthologous protein, a record from another database, etc. < / p > < p > < a href =\n/ manual / evidences\n> more... < / a > < / p >\nhelp pages, faqs, uniprotkb manual, documents, news archive and biocuration projects .\nyou are using a version of browser that may not display all the features of this website. please consider upgrading your browser .\n< p > when browsing through different uniprot proteins, you can use the ‘basket’ to save them, so that you can back to find or analyse them later. < p > < a href =' / help / basket' target =' _ top' > more... < / a > < / p >\n< p > this will take you to the blast page where you can edit options < / p > < p > < a href =\n/ help / sequence - searches\n> more. . < / a > < / p >\nwe' d like to inform you that we have updated our privacy notice to comply with europe’s new general data protection regulation (gdpr) that applies since 25 may 2018 .\nhtml public\n- / / w3c / / dtd xhtml 1. 0 strict / / en\nurltoken\nthank you for taking the time to provide feedback on the iucn red list of threatened species website, we are grateful for your input .\nde silva, r. , milligan, h. t. , wearn, o. r. , wren, s. , zamin, t. , sears, j. , wilson, p. , lewis, s. , lintott, p. & powney, g .\nthis species is regularly found in the international pet trade (p. wagner pers. comm. 2014), with an export quota of 2, 000 animals per year set by the tanzanian government (j. beraduccii pers. comm. 2014). due to taxonomic changes that have not been reflected in quota documentation, other species are likely to be included in the trade under this name, including the similar a. dodomae (j. beraduccii pers. comm. 2014) .\nthis species is known to occur in the masai mara game reserve, serengeti and arusha national park (razzetti and msuya 2002, spawls et al. 2002). no conservation measures are required. export quota documentation needs to be updated to reflect modern agamid taxonomy. breeding studies in the field are needed to better - understand population demographics (p. wagner pers. comm. 2014) .\nto make use of this information, please check the < terms of use > .\nthank you for visiting nature. com. you are using a browser version with limited support for css. to obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in internet explorer). in the meantime, to ensure continued support, we are displaying the site without styles and javascript .\nnature is part of springer nature. © 2018 springer nature limited. all rights reserved .\nhtml public\n- / / w3c / / dtd xhtml 1. 0 transitional / / en\nurltoken\ncolouring: blue - purple back with an orange - red head, neck and throat. the tail is olive - yellow at the base, which changes to olive - red at the tip .\nbreeding: females lay small clutches of between 5 to 10 eggs, laid in soil beneath a slab of rock or in the cracks and crevices of rocks .\nsituated in the tiny town of uis, this lodge acts as a gateway to the brandberg mountain and other parts of the erongo region. the owner, basil, is a bastion of the local community and a font of knowledge on the area\nsmall private lodge consisting of thatched domed bungalows scattered amongst large granite boulders. it is well situated near twyfelfontein and several other major damaraland attractions\nthis camp was started by wilderness safaris and is now managed by the local community. expect luxury, desert elephants and rhino\nnamed after the abundant mopane trees found in the area, damara mopane lodge is part of a well established lodge group, known for quality lodges at reasonable prices. only 20km from khorixas and within driving distance of the highlights of the area\na good quality lodge located close to the rock engravings at twyfelfontein. excursions to the engravings and in search of desert adapted elephant are available\none of the most luxurious lodges in the area - accommodation is in luxury tents or more' solid' suites .\nas the name implies this is situated close to the rock engravings at twyfelfontein. a good quality lodge with reasonable rates .\ndoctype html public\n- / / w3c / / dtd html 4. 0 transitional / / en\nwinter is not a good time for herps in southern africa. most of them are in hibernation or rarely active in this colder part of the year. we did not see any amphibians at all, and the vast majority of lizards were a few out in the desert areas that were warm at mid - day. we also did not search very much for herps. rather, if we saw one, we were interested and tried to i. d. it (and usually tried to photograph it as well). so this is a very short listing of the herps of southern africa .\nthere is a great new field guide: branch (1998). it has distribution maps, lucid text, and color photos of all species. the revised edition i acquired over there had 83 new species added since the previous edition, so there has been a fair amount of recent taxonomic work on reptiles in southern africa. [ those marked with an asterisk (*) were lifers for us; this was most of them! ]\nthis was a common tortoise of the scrubby sand dunes in west coast np, a half - day' s drive up the coast from cape town. we saw something like 30 (!) during our few hours; many smaller ones were crossing the road or seen at the road' s edge. unfortunately this was the only species we saw alive, a dead tent tortoise psammobates tentorius was on the road enroute to brandvlei. about 30% of the world' s tortoises occur in southern africa, and 12 species are endemic to this region .\nthis thin small snake (about a foot long) was active at mid - day around our bungalow at augrabies falls np. it was' in - and - out' of little nooks in the outside of the chalet; it is a very fast diurnal predator on small lizards. sand snakes of this genus have venom that works on lizards, but is usually harmless to humans. there are 23 species of sand snakes in africa. this one was a cute little guy. although we were alert throughout the trip, this was the only snake we saw alive [ a mole snake pseudaspis cana was found dead on the road near brandvlei ]\na mid - sized stripey skink in etosha np and at nkwasa camp near rundu (below left) was thought to be this widespread species on the basis of range and overall appearance. there are other' striped' skinks but they seem to be more local and elusive. this species inhabits a wide range of habitats and is common around human habitation. it is possible that the lizard (below right) at the entrance to mahango game reserve in the caprivi strip is also this species. breeding males are said to have an orange - brown head with yellow - orange throat .\nthis medium - sized black skink (left) was photographed at canyon lodge in south namibia. another was seen at anib lodge in central namibia. it is the males that can get all - black (although they are suffused with bronze in some populations). females and young are dull olive .\nthese small (4 - 6 inch long) fast lizards were under very small bits of desert scrub at spitzkoppe, and ran ahead of me as i chased down the herero chat. branch (1998) says\nthese amazingly fast lizards can be seen in the heat of the day, dashing over open, sparsely vegetated sand and gravel flats .\nalthough also said to be dormant in winter, this photo matches the species well .\nthis lizard is endemic to a very short stretch of the orange river in westernmost south africa. fortunately, this stretch of river include augrabies falls. as branch (1990) says :\nthese beautiful lizards are common on the smooth granite walls of the augrabies falls .\nmales are colorful with dark blue throats, black bellies, and orange forelimbs. alas, the only ones i got close to were the stripey females or young (left). note the long toes for hanging on to vertical cliffs .\nseveral slunk along the muddy banks of the okavango river but dropped into the water when we got too close .\nthese colorful and very fast lizards were clinging to huge boulders around the base of spitzkoppe. females (below left) and youngsters were by far the majority of the 20 + seen; full males (below right) were scarce. the dominant male defends a territory that has a harem of females, and will not tolerate another male in its territory during the breeding season (branch 1998). these are comparatively large lizards (two feet long in males) but also quite shy. it took significant effort to get these shots .\nthis tiny gecko was on the woven shutters that fringed the sides of our individual bungalow at xaro camp in the okavango delta. branch (1998) says they typically forage high in trees for ants and termites but are known to forage on houses. this i. d. is primary on range, behavior, and size .\na few were seen daily on the okavango river. at this high water stage there were not many sandbars, and thus the few we saw were hugging the river banks, tucked under cover, and not very large. but you don' t want to swim in the okavango ...\nwe also encountered a variety of other interesting plants and animals; shown below is an active paper - wasp nest at spitzkoppe. richard was very interested in wildflowers, and took a good selection of photos. i find i have enough trying to i. d. the birds, mammals, herps, and sharks we saw. but southwestern africa is a spectacular part of this planet .\n: all photos on this page are © 2005 don roberson; all rights reserved. many other shots from this trip are scattered about this web site. check particularly bird families, mammals, and herps listings .\nbranch, b. 1998. field guide to snakes and other reptiles of southern africa. rev. ed. struik publ. , cape town\nit looks like your browser does not have javascript enabled. please turn on javascript and try again .\ntop searches rector & vice - chancellor water restriction articles apply bursaries and loans study fees student accommodation almanac 2017 my. sun term dates parking 2018 faculty yearbooks / calendar news and events convocation su staff list graduation ceremonies campus maps ethics hotline\ntwo stellenbosch university (su) scientists, prof bert klumperman and prof guy midgley, are the ...\n' orphan crops' and the impact of an invasive weed on subsistence farmers in nigeria are two of the topics ...\nforest - dwelling bird species are disappearing from some of south africa' s indigenous forests, with forest ...\nall rights reserved © 2013 stellenbosch university private bag x1, matieland, 7602, stellenbosch, south africa tel. : + 27 21 808 9111" ]
{ "text": [ "the namib rock agama ( agama planiceps ) is a species of agamid lizard that is native to granite rocky outcrops in northwestern namibia and southwestern angola . " ], "topic": [ 29 ] }
"the namib rock agama (agama planiceps) is a species of agamid lizard that is native to granite rocky outcrops in northwestern namibia and southwestern angola."
[ "the namib rock agama (agama planiceps) is a species of agamid lizard that is native to granite rocky outcrops in northwestern namibia and southwestern angola." ]
"animal-train-14"
"animal-train-14"
"2665"
"sphaeroma terebrans"
[ "sphaeroma terebrans: a threat to the mangroves of southwestern florida. - pubmed - ncbi\nassociated species: in addition to the close association of sphaeroma terebrans and its preferred host habitat, the red mangrove rhizophora mangle in the indian river lagoon, thiel (2000) reports that juveniles of the sphaeroma congener s. quadridentatum may be found living within family burrows of reproductive female s. terebrans .\nwood with bore holes made by s. terebrans. photo singapore science centre .\nthe aim of the present study was to provide a reliable and valid way to delimit s. terebrans. in this study, the validity of the mitochondrial coi gene as a dna barcode marker for the identification of three species of sphaeroma, namely, s. terebrans, s. retrolaeve, and s. serratum, was examined. to detect if there was any cryptic species in s. terebrans, the coi gene sequences of individuals with morphological differences were analysed. our study should be useful in the identification of the genus sphaeroma and for further research on s. terebrans .\nintraspecific genetic distances (kimura 2 - parameter) of s. terebrans with morphological differences based on coi sequences\nsystematics and ecology of sphaeroma (crustacea: isopoda) in the mangrove habitats of florida. in: proceedings of the international symposium on biology and management of mangroves\nthe rapid and effective identification of closely related wood - borer sphaeroma species is important for the research and restoration of eroded mangroves. identification of s. terebrans based on morphological characteristics alone is weak and, to some extent, ambiguous. based on morphological characteristics, some individuals of s. terebrans were previously named s. vastator (bate, 1866) and s. destructor (richardson, 1897). in this study, clear evidence was provided for the identification of s. terebrans individuals, which exhibited differences in morphological characteristics. the validity of using the mitochondrial coi gene sequence as a dna barcode for the identification of genus sphaeroma was examined, and included three sphaeroma species, namely, s. terebrans, s. retrolaeve and s. serratum, with c. fuscina voucher (sphaeromatidae) used as an outgroup. a distinct barcoding gap was found between the intraspecific and interspecific distances in each species. the nj phylogenetic tree consisted of four distinct clusters, each containing individuals from one species only. these results indicate that the partial mitochondrial coi gene is an effective dna barcode for the identification of the genus sphaeroma .\nspecies description: unlike many marine isopods, the mangrove boring isopod sphaeroma terebrans and other members of family sphaeromatidae have compact, convex bodies giving them an appearance similar to terrestrial isopods (pillbugs). also similar to terrestrial species, s. terebrans and most members of the family can roll into a ball (conglobulation). this represents a convergent evolution of form (species exhibit similarities in form and function but are not closely related). sphaeromatids to not represent a secondary marine invasion by a terrestrial isopod line (brusca et al. 2001). sphaeroma terebrans is reddish - brown in color and the pleotelson (the terminal body segment) is rough - surfaced and slightly pointed .\nsphaeroma terebrans, a wood - boring isopoda, is distributed worldwide in tropical and subtropical mangroves. the taxonomy of s. terebrans is usually based on morphological characteristics, with its molecular identification still poorly understood. the number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod are considered as the major morphological characteristics in s. terebrans, which can cause difficulty in regards to accurate identification. in this study, we identified s. terebrans via molecular and morphological data. furthermore, the validity of the mitochondrial cytochrome c oxidase subunit i (coi) gene as a dna barcode for the identification of genus sphaeroma, including species s. terebrans, s. retrolaeve, and s. serratum, was examined. the mitochondrial coi gene sequences of all specimens were sequenced and analysed. the interspecific kimura 2 - parameter distances were higher than intraspecific distances and no intraspecific - interspecific distance overlaps were observed. in addition, genetic distance and nucleotide diversity (π) exhibited no differences within s. terebrans. our results revealed that the mitochondrial coi gene can serve as a valid dna barcode for the identification of s. terebrans. furthermore, the number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod were found to be unreliable taxonomic characteristics for s. terebrans .\nsphaeroma terebrans, a wood - boring isopod, is destroying the prop roots of red mangroves along the southwestern coast of florida to such an extent that the ten thousand islands and mangrove fringes of the mainland are steadily shrinking. mangroves of the florida keys apparently are free of this wood borer .\npossible economic consequences of invasion: negative ecological impacts of sphaeroma terebrans boring on mangrove health would likely carry economic consequences as well, owing to the importance of mangroves both as nursery and refuge habitat as well as their role in preventing shoreline erosion. in addition to natural wood habitats, s. terebrans burrows in wooden boats, piers, pilings, and bridges which can result in negative economic consequences (poirrier et al. 1998) .\nirl distribution: in the irl, sphaeroma terebrans is found primarily in burrows excavated from the aerial roots of the red mangrove (rhizophora mangle) although it can also make burrows in fallen trees and in the roots of other species [ animal encyclopedia ]. the species likely occurs wherever red mangroves occurr within the irl .\nregional occurrence: the individuals from which sphaeroma terebrans was first described were collected in india, although the species now occurs in several mangrove forest systems worldwide including australia, sri lanka, east africa, south africa, costa rica, brazil, the eastern (north to south carolina) and gulf regions of the united states, and elsewhere (animal encyclopedia: sphaeroma terebrans). in addition to burrowing into living and dead wood, s. terebrans can burrow into other hard substrata such as hard packed sand (ray 2005). carlton and ruckelshaus (1997) indicate that the species has occurred in florida at least as far back as 1897. collection information for elsewhere in the u. s. is incomplete, but reports indicate s. terebrans also occurs in chesapeake bay (serc) and in lake pontchartrain, louisiana, where it is found in littoral cypress trees (poirrier et al. 1998, wilkinson 2004) .\ntemperature: as an inhabitant of intertidal mangrove aerial roots, sphaeroma terebrans appears capable of enduring reasonably wide daily and seasonal variations in temperature. individuals may occasionally experience lethal winter low temperatures, as reported in 1996 in lake pontchartrain la, for example (poirrier et al. 1998). since the distributional ranges of the tropical - subtropical mangrove tree species that serve as the primary hosts of this isopod are themselves temperature - limited, s. terebrans are probably only exposed to lethal low temperatures at their latitudinal distribution limits .\nsalinity: poirrier et al. (1998) relate work of authors from india indicating sphaeroma terebrans is extremely euryhaline. lethal salinities occurred below 0. 5 ppt and above 50 ppt, although a somewhat more narrow range between 4 ppt and 28 ppt was reported as optimum for growth and reproduction. boring activity was shown to decrease with sudden salinity increase. poirrier et al. (1998) indicated that s. terebrans was abundant in littoral cypress trees and other wooden structures in low salinity (0. 5 - 5 ppt) lake pontchartrain waters .\ntrophic mode: despite their wood boring habits sphaeroma terebrans has long been assumed to be a filter feeder or a grazer of the epiphytic material that grows on burrow walls (poirrier et al. 1998). recent morphological studies of the mouthparts and gut support the contention that s. terebrans is primarily a filter feeder (si et al. 2002). this is in contrast to wood boring isopods of genus limnoria who consume the wood they excavate as their principle food source. a laboratory feeding study by benson et al. (1999) complicates the established view somewhat by indicating that juvenile s. terebrans survive on a diet of pure cellulose significantly longer than individuals given no food. the authors also present enzyme assay analyses and electron microscopy findings further indicating that s. terebrans can use wood as a food source. the relative importance of wood in the natural diet of the species remains unknown .\nin this study, the mitochondrial coi gene was found to be an effective dna barcode for the identification of sphaeroma species, whereas the number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod were found to be invalid taxonomic characteristics. the phylogenetic relationships determined in this study will be of use for studying the species composition of sphaeroma in eroded mangroves in china and for establishing a good foundation for the restoration of mangrove ecosystems .\ninvasion history: sphaeroma terebrans was introduced to the united states more than a century ago. carlton and ruckelshaus (1997) cite an 1897 description by h. richardson as the first evidence of this species occurring in florida coastal waters. the early date of introduction and the wood - boring habit of the species suggest the species arrived on or in the hulls of wooden sailing ships (erdc 2005). carlton and ruckelshaus (1997) report that in the western atlantic, s. terebrans now occurs from brazil north into south carolina and from liberia to the congo in the eastern atlantic .\nh1 - h15: haplotype 1 - 15, sr: s. retrolaeve, st: s. terebrans, ss: s. serratum, cf: c. fuscina voucher .\nmangroves are biologically and globally important ecosystems (giri et al. , 2011). their aerial roots provide an important substrate in which many species of animals live and reproduce (nagelkerken et al. , 2008). sphaeroma terebrans, a wood - boring isopoda, is found worldwide in tropical and subtropical mangroves (estevez, 1978), where it preferentially burrows into the aerial roots for shelter and reproductive habitat (harrison & holdich, 1984; john, 1970). in recent years, substantial s. terebrans outbreaks have seriously affected mangrove stands in china, especially in hainan island (fan et al. , 2014) .\nthe effects of s. terebrans on mangroves have been studied by many researchers (estevez & simon, 1975; estevez, 1978; jones & icely 1981; kensley & schotte, 1999; perry, 1988; rehm & humm, 1973); however, the taxonomic standards of s. terebrans remain poorly understood. due to some minor morphological differences, including the number and arrangement of the tubercles on the pereonite, the structure of the pereopod, and the presence of tubercles furnished with bristle - like hairs on the abdomen, s. terebrans was previously named as s. vastator (bate, 1866) and s. destructor (richardson, 1897). based on morphological identification, estevez & simon (1975) concluded that s. vastator and s. destructor were synonyms of s. terebrans .\nthe numbers of teeth on the left and right exopod of s. terebrans are 3 and 3, respectively, for ss; 3 and 4 for sw; 4 and 4 for ww; 4 and 5 for wl; and 5 and 5 for ll. pl means that the propodus of the seventh pereopod of s. terebrans is long, whereas ps is short. the same in the following table .\nindividuals of s. terebrans had different numbers of teeth on the uropodal exopod and different lengths of the propodus of the seventh pereopod. these individuals were sorted into seven groups, with each group containing 10 individuals. the genetic distance and nucleotide divergence showed no variation among the different groups. therefore, these results revealed that the coi gene sequences of individuals with morphological differences were almost no difference. although harrison & holdich (1984) determined that the propodus of the seventh pereopod of subadult males is relatively short, our investigations showed that the length of the pereopodal propodus in s. terebrans was not necessarily linked with gender. previous research concluded that cosmopolitan s. terebrans was comprised of more than one species (baratti et al. , 2011, 2005), but morphological taxonomic details of s. terebrans were not mentioned. in our research, specimens in china were carefully checked according to morphological characteristics and were assigned into different groups, with molecular methods used for further identification. this combination of morphological taxonomy and molecular divergence should provide results of greater reliable .\nage, size, lifespan: the average size of female s. terebrans in the indian river lagoon is reported to be 8 - 10 mm for females and 6. 5 - 8. 5 mm for males and the lifespan is approximately 10 months (thiel 1999) .\npotentially misidentified species: at least two additional sphaeroma species also occur in florida, s. walkeri (also a florida non - native) and s. quadridentatum. distinguishing these species based only on appearance is beyond the abilities of non - experts, although habitat preference information may provide a partial remedy. nelson and dematriades (1992) indicate that sabellariid phragmatopoma lapidosa wormrock reefs are a preferred habitat for s. walkeri in the irl region of florida. s. quadridentatum reportedly does not burrow, instead opportunistically inhabiting crevices it finds (thiel 2000). florida is also home to related wood - boring isopods known as mangrove gribbles belonging to genus limnoria. limnoria species tend to be slightly smaller than s. terebrans .\nembryology: embryonic development occurs within the mother and early juveniles emerge fully formed. there is a degree of parental care in the species (short compared to other peracarid crustaceans), with female s. terebrans commonly hosting their offspring for a period of time in family burrows within mangrove aerial roots (thiel 1999, 2000). reproductive females in the irl typically hosted 5 - 20 juveniles in their burrows during this stage (thiel 1999) .\nabundance: mangrove boring isopods can be extremely abundant within their wood burrow habitats. poirrier et al. (1998) recorded densities of greater than 500 individuals per cubic decimeter of infested cypress wood in lake pontchartrain. where they occur in florida, s. terebrans can also be widespread. a survey conducted in tampa bay by brooks and bell (2005) indicated that 25% - 86% of the r. mangle aerial roots examined were occupied by the isopods .\nthe classic use of morphological characteristics for species delimitation can result in under - or over - estimation of biodiversity due to factors such as phenotypic plasticity (knowlton, 1993). dna barcode, which can supplement taxonomic datasets in the process of species delimitation (schindel & miller, 2005), is a practical tool that can be used for the identification of various species within a known taxonomic framework and for linking different biological life stages of the same species (feng et al. , 2011; puillandre et al. , 2009; schindel & miller, 2005). the mitochondrial coi gene has been proposed as a universal barcode, and has been successfully applied in the identification of portunidae, fish, bivalve molluscs, and hoverflies (blair et al. , 2006; hebert et al. , 2003; ma et al. , 2012; persis et al. , 2009; ståhls et al. , 2009). the coi gene sequences of s. terebrans have been analysed in america and africa (baratti et al. , 2005, 2011), with results suggesting that cosmopolitan s. terebrans is comprised of more than one species. therefore, its taxonomic status needs to be revaluated .\nthe genomic dna of s. terebrans and s. retrolaeve were obtained from the pereopods. dna extractions were performed using a takara minibest universal genomic dna extraction kit ver. 5. 0 following the manufacturer’s protocols. the primers mtd10 5' - ttgattttttggtcatccagaagt - 3' (roehrdan. 1993) and florence 5' - cctaaaaaatgttgagggaa - 3' were used for amplification of the mitochondrial coi gene (baratti et al. , 2005). we followed pcr protocols as per baratti et al. (2005). the pcr products were electrophoresed using 1% agarose gel and sequenced by shanghai majorbio bio - pharm technology co. , ltd .\nspence bate, c. , 1866. carcinological gleanings. . no. ii. — the annals and magazine of natural history (3) 17: 24 - 31. [ details ]\nboyko, c. b; bruce, n. l. ; hadfield, k. a. ; merrin, k. l. ; ota, y. ; poore, g. c. b. ; taiti, s. ; schotte, m. & wilson, g. d. f. (eds) (2008 onwards). world marine, freshwater and terrestrial isopod crustaceans database .\nschotte, m. , b. f. kensley, and s. shilling. (1995 - 2017). world list of marine, freshwater and terrestrial crustacea isopoda. national museum of natural history smithsonian institution: washington d. c. , usa [ website archived on 2018 - 01 - 25 ]. [ details ]\nschotte, m. , j. c. markham, and g. d. f. wilson. 2009. isopoda (crustacea) of the gulf of mexico, pp. 973–986 in felder, d. l. and d. k. camp (eds .), gulf of mexico–origins, waters, and biota. biodiversity. texas a & m; press, college station, texas. [ details ]\nliu j. y. [ ruiyu ] (ed .). (2008). checklist of marine biota of china seas. china science press. 1267 pp. (look up in imis) [ details ] available for editors [ request ]\nhtml public\n- / / w3c / / dtd xhtml 1. 0 transitional / / en\nurltoken\ndepartment of biology, university of south florida, 4202 e. fowler avenue, tampa, florida 33620 - 5200, usa\npublished in meps vol. 231. online publication date: april 23, 2002 print issn: 0171 - 8630; online issn: 1616 - 1599 copyright © 2002 inter - research .\nreproduction is sexual and occurs within the aerial root burrows excavated by the animals (thiel 1999) .\nthiel (1999) found reproductive individuals year - round in the indian river lagoon but noted twin reproductive peaks occurring in the fall and again in the late spring / early summer. reproduction occurs in a manner that is unlike that known from other isopods. mating in most isopods involves internal fertilization by means of a specialized male reproductive structure known as the appendix masculina. male\nlack this organ, however, and instead release sperm external to the female during mating and rely on water currents set up by the beating of the female pleopods to carry sperm into the genital opening (messana 2004) .\nmales typically abandon females after copulation and do not participate in extended care (see below) of the offspring (thiel 1999) .\nreport by: j. masterson, smithsonian marine station submit additional information, photos or comments to: irl _ webmaster @ urltoken page last updated: september 10, 2008\nwarning: the ncbi web site requires javascript to function. more ...\n* corresponding author, e - mail: nc. ude. usys. liam @ rjhssl\nthis is an open - access article distributed under the terms of the creative commons attribution license, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited .\nindividuals were sorted according to the following morphological characteristics: the number and arrangement of tubercles on the pereonite, number of teeth on the uropodal exopod, shape of the pleotelson, setae distribution, and length of the second and seventh pereopods. these are considered to be major characteristics for the diagnosis of\nspecimens were collected from hainan and beihai mangroves. all samples were preserved in 95% alcohol .\n). interspecific and intraspecific sequence divergences were calculated using the kimura 2 - parameter (k2p) model with the pairwise deletion option in mega 5. 0 (\n). haplotypes were identified and analysed using dna sp version 4. 1 (\n). based on the k2p model, neighbor joining (nj) and maximum likelihood (ml) trees were constructed using mega 5. 0 (\n) used as an outgroup. node supports for the two approaches (nj and ml) were inferred with bootstrap analysis (1 000 replicates) .\na1 - a5 are uropodal exopods with different numbers of teeth. b is the seventh pereopod with different propodus length .\nall haplotype sequences were aligned and edited, and no insertion or deletion sites were found in any of the sequences. the intraspecific distances in\n. no overlaps between interspecific and intraspecific distances were found, suggesting the existence of a distinct barcoding gap. the nj phylogenetic tree is shown in\nwere aligned and compiled. the intraspecific distances ranged from 0. 001 to 0. 003 within the ss, sw, ww, wl, and ll groups. the intraspecific distance between pl and ps was 0. 001 (\n) was 0. 555% , and ranged from 0. 200% (pl group) to 0. 866% (ww group) (\n) was found in the ww group (0. 004), while the lowest was found in the pl group (0. 000) (\nwas performed using nj and ml methods, which yielded similar results. the nj tree revealed that the three species of\nblair d, waycott m, byrne l, dunshea g, smith - keune c, neil km. 2006 .\ngiri c, ochieng e, tieszen ll, zhu z, singh a, loveland t, masek j, duke n. 2011 .\nnagelkerken i, blaber sjm, bouillon s, green p, haywood m, kirton lg, meynecke jo, pawlik j, penrose hm, sasekumar a, somerfield pj. 2008 .\npersis m, reddy acs, rao lm, khedkar gd, ravinder k, nasruddin k. 2009 .\npuillandre n, strong ee, bouchet p, boisselier mc, couloux a, samadi s. 2009 .\nståhls g, vujic a, pérez - bañon c, radenkovic s, rojo s, petanidou t. 2009 .\ntamura k, peterson d, peterson n, stecher g, nei m, kumar s. 2011 .\nthompson jd, gibson tj, plewniak f, jeanmougin f, higgins dg. 1997 .\nif you have images for this taxon that you would like to share with atlas of living australia, please upload using the upload tools .\nurn: lsid: biodiversity. org. au: afd. taxon: 1d8687bc - b672 - 4614 - af92 - b4a1e9184366\nurn: lsid: biodiversity. org. au: afd. taxon: c1c8debf - 5f88 - 4c8c - a23c - 6e9378aad2f1\nurn: lsid: biodiversity. org. au: afd. taxon: d1d45af6 - bb17 - 4cad - b465 - 9497afbba351\nurn: lsid: biodiversity. org. au: afd. taxon: b69f53b2 - c968 - 4919 - b798 - 97c216aff92e\nurn: lsid: biodiversity. org. au: afd. name: 370120\nexplore species occurrence records in the context of their environment. find records and model species distributions. export reports, maps and data .\nfind out how you can contribute to a citizen science project in your area, or explore one of the many citizen science projects supported by the ala .\ndid you see something? photograph something? contribute your sighting to the atlas of living australia .\nthe atlas of living australia acknowledges australia' s traditional owners and pays respect to the past and present elders of the nation' s aboriginal and torres strait islander communities. we honour and celebrate the spiritual, cultural and customary connections of traditional owners to country and the biodiversity that forms part of that country .\nu. s. department of the interior | u. s. geological survey url: urltoken page contact information: pubs warehouse contact page page last modified: march 12, 2012 17: 20: 47\nthis site uses cookies to improve performance. if your browser does not accept cookies, you cannot view this site .\nthere are many reasons why a cookie could not be set correctly. below are the most common reasons :\nyou have cookies disabled in your browser. you need to reset your browser to accept cookies or to ask you if you want to accept cookies .\nyour browser asks you whether you want to accept cookies and you declined. to accept cookies from this site, use the back button and accept the cookie .\nyour browser does not support cookies. try a different browser if you suspect this .\nthe date on your computer is in the past. if your computer' s clock shows a date before 1 jan 1970, the browser will automatically forget the cookie. to fix this, set the correct time and date on your computer .\nyou have installed an application that monitors or blocks cookies from being set. you must disable the application while logging in or check with your system administrator .\nthis site uses cookies to improve performance by remembering that you are logged in when you go from page to page. to provide access without cookies would require the site to create a new session for every page you visit, which slows the system down to an unacceptable level .\nthis site stores nothing other than an automatically generated session id in the cookie; no other information is captured .\nin general, only the information that you provide, or the choices you make while visiting a web site, can be stored in a cookie. for example, the site cannot determine your email name unless you choose to type it. allowing a website to create a cookie does not give that or any other site access to the rest of your computer, and only the site that created the cookie can read it .\nthese keywords were added by machine and not by the authors. this process is experimental and the keywords may be updated as the learning algorithm improves." ]
{ "text": [ "sphaeroma terebrans is a mangrove-boring isopod that was first documented in the united states as early as 1897 .", "it is 8 – 10 millimetres ( 0.31 – 0.39 in ) long , and is thought to have been introduced by wooden-hulled ships .", "the isopod is found throughout the gulf of mexico mainly in mangrove swamps of louisiana and florida .", "s. terebrans will also bore into boats , wooden pilings and other wooden structures .", "the burrowing activities of sphaeroma terebrans hinder the growth of mangroves , and its wood boring activities limits mangroves to the upper limits of the intertidal zone . " ], "topic": [ 24, 17, 24, 6, 18 ] }
"sphaeroma terebrans is a mangrove-boring isopod that was first documented in the united states as early as 1897. it is 8 – 10 millimetres (0.31 – 0.39 in) long, and is thought to have been introduced by wooden-hulled ships. the isopod is found throughout the gulf of mexico mainly in mangrove swamps of louisiana and florida. s. terebrans will also bore into boats, wooden pilings and other wooden structures. the burrowing activities of sphaeroma terebrans hinder the growth of mangroves, and its wood boring activities limits mangroves to the upper limits of the intertidal zone."
[ "sphaeroma terebrans is a mangrove-boring isopod that was first documented in the united states as early as 1897. it is 8 – 10 millimetres (0.31 – 0.39 in) long, and is thought to have been introduced by wooden-hulled ships. the isopod is found throughout the gulf of mexico mainly in mangrove swamps of louisiana and florida. s. terebrans will also bore into boats, wooden pilings and other wooden structures. the burrowing activities of sphaeroma terebrans hinder the growth of mangroves, and its wood boring activities limits mangroves to the upper limits of the intertidal zone." ]
"animal-train-15"
"animal-train-15"
"2666"
"pycnosteus"
[ "pycnosteus cf. tuberculatus: mark, 1956, lk. 81, joon. 5\npycnosteus tuberculatus rohon: mark - kurik, 2000, lk. 316, joon .\npycnosteus tuberculatus: märss et al. , 2008, lk. 221, joon .\npycnosteus palaeformis preobrajenski: obruchev, 1947, lk. 196, joon. l 4\npycnosteus imperfectus (preobr): mark, 1956, lk. 33, joon. 3a\npycnosteus palaeformis preobr. : mark - kurik, 2000, lk. 314, joon .\npycnosteus palaeformis preobrazhensky, 1911: novitskaya, 2004, lk. 178, joon. 104\npycnosteus tuberculatus (rohon, 1901): obruchev, 1940, lk. 768, joon .\npycnosteus tuberculatus (rohon): obruchev, 1947, lk. 196, joon. 1: 6\npsammolepis (pycnosteus) imperfecta preobr. : gross, 1933, lk. 12 - 13, joon .\npycnosteus palaeformis (pars): gross, 1935, lk. 12 - 16, joon. ii 1\npycnosteus palaeformis preobrazhensky, 1911: novitskaya, 1965, lk. 260, joon. text fig. 202\npycnosteus tuberculatus (rohon, 1901): novitskaya, 2004, lk. 179, joon. 106, 107\npycnosteus palaeformis preobrazhensky, 1911: obruchev, 1940, lk. 768, joon. text fig. 1d and3\npycnosteus imperfectus (obruchev): mark, 1956, lk. 74 - 76, joon. 1a, 2a\npycnosteus palaeformis preobrazhensky, 1911: obruchev, 1964, lk. , joon. text fig. 48, 49\npycnosteus palaeformis preobr. (pars): gross, 1930, lk. 5, 11, 13, joon .\npycnosteus palaeformis preobrazhensky, 1911: moloshnikov, 2001, lk. 73, joon. text fig. 1 - 6\npycnosteus palaeformis preobrazhensky, 1911: ivanov & lebedev, 2011, lk. , joon. text fig 10b, 10c\npycnosteus tuberculatus (rohon, 1901): halstead tarlo, 1965, lk. 73, joon. text fig. 18\npycnosteus palaeformis preobr. (pars): gross, 1933, lk. 13, joon. ii fig 22, 23\npycnosteus palaeformis preobrazhensky, 1911: halstead tarlo, 1965, lk. 69, joon. xviii 2, text fig. 16\npycnosteus palaeformis preobrazhensky, 1911: halstead tarlo, 1964, lk. , joon. iii 1, 3, text fig. 7\npycnosteus palaeformis preobrazhensky, 1911: obruchev & mark - kurik, 1965, lk. 135, joon. xxv 1 - 3 ;\npycnosteus palaeformis preobrazhensky, 1911: obruchev & mark - kurik, 1968, lk. , joon. text fig. 1, 2b\npycnosteus palaeformis preobrazhensky, 1911: glinskiy, 2014, lk. 981, joon. 2: 1 - 4; 3: 1 - 3\npycnosteus palaeformis preobr. : mark, 1956, lk. 76 - 77, joon. i 1; ii 1, text fig. 1b, 2b, 3a\npycnosteus tuberculatus (rohon): mark, 1956, lk. 77 - 81, joon. i 2 - 6; ii 2, 3; iii 1 - 3\npycnosteus tuberculatus (rohon, 1901): obruchev & mark - kurik, 1965, lk. 140, joon. xxvi 3; xxviii 1 - 3; xxix 1, 2; xxx 1 - 4 ;\nnote: [ 1 ] [ h73 ] suggests that pycnosteus cruised through vegetation, knocking small invertebrates loose and filtering them. [ 2 ] this evidence comes from tartuosteus as stated in [ t64 ]. tartuosteus may actually be a species of psammolepis; but, then again, psammolepis may turn out to be a pycnosteid... . atw020111 .\nhtml public\n- / / w3c / / dtd html 4. 01 / / en\nurltoken\nphylogeny: psammosteida: : (pycnosteidae + psammolepis) + psammosteidae) + * .\ncharacters: oral plates narrow relative to drepanaspis [ t64 ]; postorbital plate tapers gradually posteriorly [ t64 ]; branchial plates wider than drepanaspis ,\nand their lateral parts are solid and free\n[ t64 ]; branchial plates drawn out as sheets laterally and downturned [ t64 ]; cornual plates rectangular [ t64 ]; branchial opening at or medial to posterolateral corner [ t64 ]; ventral median plate convex [ t64 ]; median ventral plate with wide, open posterior notch [ t64 ]; very clear concentric lines of growth in median plates [ t64 ]; development of small, accessory dentine tubercles between main dentine tubercles [ t64 ]; fresh water [ h73 ] .\nreferences: halstead 1973) [ h73 ]; tarlo (1964) [ t64 ] .\ncharacters: postorbital elongated [ t64 ]; branchial plates enlarged by successive lines of growth [ h73 ]; branchial plates shortened and extended laterally to form large, thin down - turned\nwings\n[ h73 ] [ t64 ]; branchial plates show wear on anterior surface, as well as equally on dorsal and ventral surfaces [ h73 ] [ t64 ]; anterior marginal of branchial plate wings anteriorly concave (as in image) in some species [ t64 ]; ventral median plates, long, thin and elaborated ventrally as sled - like runners [ h73 ]; ventral plates show wear in middle region (suggesting horizontal position - - mouth well above substrate) [ h73 ]; deep median ventral plate with long shallow groove forming almost flat ventral surface with very steep sides laterally and anteriorly [ t64 ]; notch behind branchial plates filled in, in some forms (tartuosteus) by more tesserae [ h73 ] (? [ t64 ] says groove in median ventral plate is filled in - - which makes more sense); major plates show continuing concentric growth [ h73 ]; major plates also show some growth by accretion of tesserae [ 2 ] [ t64 ] .\nrange: middle devonian to late devonian of europe, russia & north america .\ncharacters: growth by addition of tesserae, with growth lines (rings of ornament) on major plates progressively smaller [ h73 ]; subsequent growth by progressive enlargement of component units (tesserae ?) of major plates, rather than concentric growth of whole plate (i. e. , growth by accretion of tesserae begins to dominate over concentric growth of plates) [ h73 ] [ t64 ]; median plates become covered with tesserae [ h73 ] [ t64 ] .\nimage: psammolepis venyukovi from [ t64 ]. see psammosteida for plate nomenclature. 020111 .\ncharacters: major median plates covered with superficial tesserae (probably ontogenetic process as in psammolepis) [ h73 ]; dorsal median plate highly variable, i. e. flat to concave, but usually with gently curving lateral margin and relatively broad flat keel [ t64 ]; very long postorbitals [ t64 ]; branchial plates extremely short and wide to become\njust solid arcuate plates forming the posterolateral corners of the carapace\n[ t64 ]; psammosteus may have been sexually dimorphic in width of dorsal median plate [ h73 ]; in psammosteus, branchial plates may have been moveable [ h73 ]; branchial plates with elongated tesserae covering proximoventral surface [ t64 ]; branchial plate distal end with distinct wear facets (suggesting it was moveable) [ t64 ]; growth largely by progressive enlargement of component units (tesserae ?) of major plates, rather than concentric growth of whole plate [ h73 ] .\nnote: [ 1 ] document gallica is a complete, indexed. pdf of eichwald' s (1860) treatise on russian fossils, with an extraordinary amount of detail on psammosteus. notwithstanding halstead' s [ t64 ] high opinion of this work, the information is omitted because (a) the author evidently thought psammosteus was a placoderm (b) the genus has been reorganized and redescribed a number of times since, so that the continuing validity of the material referred to psammosteus by eichwald is unclear; and, mostly, (c) my french is not up to accurate translation of 19th century anatomical or histological terms. 020111 .\n. karksilepis parva gen. et sp. nov. (chondrichthyes) from the burtnieki regional stage, middle devonian of estonia\n. psammosteiformes (agnatha) - a review with descriptions of new material from the lower devonian of poland. 2. systematic part\nganosteus tuberculatus: rohon, 1901, lk. 12 - 13, joon. 1: 2; 2: 23\nexcept where otherwise noted, content on this site is licensed under cc by - nc licence .\ntrionyx spinosus: kutorga, 1837, lk. 12, joon. iv 11\npsammosteus arenatus: woodward, 1895: goodrich, 1908, lk. 774, joon. 43: 4\nschizosteus (?) imperfectus preobrazhensky, 1911: obruchev, 1940, lk. 767, joon .\nhtml public\n- / / w3c / / dtd html 4. 01 transitional / / en\njavascript is required to use this web site. please turn it on before proceeding .\nscientists aim to describe a single' tree of life' that reflects the evolutionary relationships of living things. however, evolutionary relationships are a matter of ongoing discovery, and there are different opinions about how living things should be grouped and named. eol reflects these differences by supporting several different scientific' classifications'. some species have been named more than once. such duplicates are listed under synonyms. eol also provides support for common names which may vary across regions as well as languages .\neol content is automatically assembled from many different content providers. as a result, from time to time you may find pages on eol that are confusing .\nto request an improvement, please leave a comment on the page. thank you !\nwe' ve detected that javascript is disabled in your browser. would you like to proceed to legacy twitter ?\ntwitter may be over capacity or experiencing a momentary hiccup. try again or visit twitter status for more information .\nyou can add location information to your tweets, such as your city or precise location, from the web and via third - party applications. you always have the option to delete your tweet location history. learn more\nhere' s the url for this tweet. copy it to easily share with friends .\nby embedding twitter content in your website or app, you are agreeing to the twitter developer agreement and developer policy .\nnot on twitter? sign up, tune into the things you care about, and get updates as they happen .\nthis timeline is where you’ll spend most of your time, getting instant updates about what matters to you .\nhover over the profile pic and click the following button to unfollow any account .\nwhen you see a tweet you love, tap the heart — it lets the person who wrote it know you shared the love .\nthe fastest way to share someone else’s tweet with your followers is with a retweet. tap the icon to send it instantly .\nadd your thoughts about any tweet with a reply. find a topic you’re passionate about, and jump right in." ]
{ "text": [ "pycnosteus is an extinct genus of jawless fish from the devonian .", "it is thought to have cruised through vegetation , eating small invertebrates which it knocked loose . " ], "topic": [ 26, 12 ] }
"pycnosteus is an extinct genus of jawless fish from the devonian. it is thought to have cruised through vegetation, eating small invertebrates which it knocked loose."
[ "pycnosteus is an extinct genus of jawless fish from the devonian. it is thought to have cruised through vegetation, eating small invertebrates which it knocked loose." ]
"animal-train-16"
"animal-train-16"
"2667"
"dichomeris heriguronis"
[ "species dichomeris heriguronis - black - edged dichomeris - hodges # 2309 - bugguide. net\ndichomeris heriguronis (matsumura, 1931) replaces 2309 dichomeris picrocarpa. formerly a synonymy of dichomeris oceanis meyrick, 1920, this species has been elevated back to full species status and includes as a synonym 2309 dichomeris picrocarpa of authors (not meyrick, 1913) .\nmicrolepidoptera of hong kong: taxonomic study on the genus dichomeris hübner, 1818, with descriptions of three new... li, h. h. , h. zhen, r. c. kendrick & m. j. sterling. 2010. shilap revista de lepidopterología. 38 (149): 67 - 89 .\nhtml public\n- / / w3c / / dtd xhtml 1. 0 transitional / / en\nurltoken\nupcoming events 2018 bugguide gathering in virginia july 27 - 29: registration and discussion photos of insects and people from the 2015 gathering in wisconsin, july 10 - 12 photos of insects and people from the 2014 gathering in virginia, june 4 - 7. photos of insects and people from the 2013 gathering in arizona, july 25 - 28 photos of insects and people from the 2012 gathering in alabama photos of insects and people from the 2011 gathering in iowa photos from the 2010 workshop in grinnell, iowa photos from the 2009 gathering in washington\nadult - forewing narrow, light orangish - brown with 4 or 5 black spots or short streaks in median area, and outer margin bordered by broad black band; fringe orange or yellowish; labial palps dark gray or black, long and sickle - shaped, curving over head .\ninternationally the larvae feed on prunus yedoensis, p. persica, p. pseudocerasus, p. mume (ponomarenko, 1997) .\nmeyrick, e. 1913. descriptions of indian micro - lepidoptera 16. journal of the bombay natural history society, 22 (1): 182\nchecklist of gelechiidae (lepidoptera) in america north of mexico lee s. , hodges r. w. , brown r. l. 2009. zootaxa 2231: 1–39 .\npeterson field guide to moths of northeastern north america david beadle and seabrooke leckie. 2012. houghton mifflin .\nthe moths of america north of mexico: fascicle 7. 1, revision of north american gelechiidae family and... hodges, r. w. 1986. the wedge entomological research foundation .\ndisclaimer: dedicated naturalists volunteer their time and resources here to provide this service. we strive to provide accurate information, but we are mostly just amateurs attempting to make sense of a diverse natural world. if you need expert professional advice, contact your local extension office .\ncontributors own the copyright to and are solely responsible for contributed content. click the contributor' s name for licensing and usage information. everything else copyright © 2003 - 2018 iowa state university, unless otherwise noted .\nphotographs are the copyrighted property of each photographer listed. contact individual photographers for permission to use for any purpose .\nhodges, r. w. , 1986. moths of america north of mexico, fascicle 7. 1, p. 119; pl. 3. 23. order\nlee, s. , r. w. hodges, & r. l. brown, 2009, . checklist of gelechiidae (lepidoptera) in america north of mexico. zootaxa, 2231: 1 - 39 .\njavascript is disabled on your browser. please enable javascript to use all the features on this page .\nin a study of material of microlepidoptera in north korea that was collected during the zoological expeditions (1970s–1980s) conducted under a scientific agreement between polish and north korean academies of science, 17 species belonging to the superfamily gelechioidea are recognized. of the total, 11 species of gelechiidae, two species of oecophoridae, and two species of coleophoridae are newly reported from north korea. scrobipalpa atriplicella (fisher von rölslerstamm, 1841) of gelechiidae is reported for the first time from the korean peninsula. images of adults and genitalia of all species are given .\npeer review under responsibility of national science museum of korea (nsmk) and korea national arboretum (kna) .\n© 2016, national science museum of korea (nsmk) and korea national arboretum (kna). production and hosting by elsevier .\ncopyright © 2018 elsevier b. v. or its licensors or contributors. sciencedirect ® is a registered trademark of elsevier b. v." ]
{ "text": [ "the black-edged dichomeris or black-edged carbatina ( dichomeris heriguronis ) is a moth of the gelechiidae family .", "it is found in the north-eastern united states , korea , japan , china , taiwan and india .", "it has also been recorded in the netherlands , where it is an exotic species .", "the length of the forewings is 7.5-8.5 mm .", "the larvae feed on prunus species in korea . " ], "topic": [ 2, 20, 8, 9, 8 ] }
"the black-edged dichomeris or black-edged carbatina (dichomeris heriguronis) is a moth of the gelechiidae family. it is found in the north-eastern united states, korea, japan, china, taiwan and india. it has also been recorded in the netherlands, where it is an exotic species. the length of the forewings is 7.5-8.5 mm. the larvae feed on prunus species in korea."
[ "the black-edged dichomeris or black-edged carbatina (dichomeris heriguronis) is a moth of the gelechiidae family. it is found in the north-eastern united states, korea, japan, china, taiwan and india. it has also been recorded in the netherlands, where it is an exotic species. the length of the forewings is 7.5-8.5 mm. the larvae feed on prunus species in korea." ]
"animal-train-17"
"animal-train-17"
"2668"
"epermenia parasitica"
[ "parasitica of the family ichneumonidae of the ussr and adjacent countries. part 4. ophioninae\nhost ranges of parasitoids (hymenoptera: braconidae and ichneumonidae) reared from epermenia chaerophyllella (goeze) (lepidoptera: epermeniidae) in britain, with description of a new species of triclistus (ichneumonidae) .\nhtml public\n- / / w3c / / dtd html 4. 01 transitional / / en\nurltoken\nnb: the taxon name search is for single names only. for example, to locate dysodia vitrina flammata warren, 1904 you should enter flammata only .\nwe use cookies to optimise your experience when using this site. view our cookie policy and our new privacy notice .\nsend mail to wvdvorst @ urltoken with questions or comments about this web site. copyright © 2015 urltoken lepidoptera of the world last modified: 01 - 03 - 15\n* our website is multilingual. some comments have been translated from other languages .\ncurators: konstantin efetov, vasiliy feoktistov, svyatoslav knyazev, evgeny komarov, stan korb, alexander zhakov .\nspecies catalog enables to sort by characteristics such as expansion, flight time, etc. .\nhtml public\n- / / w3c / / dtd html + rdfa 1. 1 / / en\nexcept where otherwise noted, content on this site is licensed under a creative commons attribution cc by licence .\nhtml public\n- / / w3c / / dtd xhtml 1. 0 transitional / / en\nurltoken\nupcoming events 2018 bugguide gathering in virginia july 27 - 29: registration and discussion photos of insects and people from the 2015 gathering in wisconsin, july 10 - 12 photos of insects and people from the 2014 gathering in virginia, june 4 - 7. photos of insects and people from the 2013 gathering in arizona, july 25 - 28 photos of insects and people from the 2012 gathering in alabama photos of insects and people from the 2011 gathering in iowa photos from the 2010 workshop in grinnell, iowa photos from the 2009 gathering in washington\nniquette bay state park, colchester, chittenden county, massachusetts, usa july 14, 2011 size: 3. 5 mm\nselect your preferred way to display the comments and click' save settings' to activate your changes .\ndisclaimer: dedicated naturalists volunteer their time and resources here to provide this service. we strive to provide accurate information, but we are mostly just amateurs attempting to make sense of a diverse natural world. if you need expert professional advice, contact your local extension office .\ncontributors own the copyright to and are solely responsible for contributed content. click the contributor' s name for licensing and usage information. everything else copyright © 2003 - 2018 iowa state university, unless otherwise noted .\na new parasitoid of bazaria turensis (lepidoptera, pyralidae): campoplex bazariae sp. n. (hymenoptera, ichneumonidae )\nwarning: the ncbi web site requires javascript to function. more ...\na new parasitoid of bazaria turensis (lepidoptera, pyralidae): campoplex bazariae sp. n. (hymenoptera, ichneumonidae )\n1 the key laboratory for silviculture and conservation of ministry of education, beijing forestry university, beijing 100083, p. r. china\n2 general station of forest pest management, state forestry administration, shenyang 110034, p. r. china\nthis is an open access article distributed under the terms of the creative commons attribution license (cc by 4. 0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited .\na new solitary endoparasitoid of the larva of bazaria turensis ragonot, 1887 (lepidoptera, pyralidae) in qinghai province, china, campoplex bazariae sheng, sp. n. , belonging to the subfamily campopleginae (hymenoptera, ichneumonidae), is reported. illustrations of the new species are provided .\ncampoplex gravenhorst, 1829, belonging to the subfamily campopleginae (hymenoptera: ichneumonidae), comprises 209 species (yu et al. 2012), of which 15 are from the eastern palaearctic region (momoi 1977, uchida 1932, 1936, 1956, yu et al. 2012), 123 from the western palaearctic (six of them are found across the palaearctic) (horstmann 1985, 1993, 2008, meyer 1935, yu et al. 2012), 33 are from the nearctic region (yu et al. 2012), 30 from the oriental (gupta and maheshwary 1977), 11 from the neotropical, two from the afrotropical (townes and townes 1973). eleven species of campoplex gravenhorst have been known from china (gupta and maheshwary 1977, kokujev 1915, sheng and sun 2014, sonan 1930, uchida 1932). the diagnostic characters of the genus were elucidated by townes (1970) and expanded upon by gupta and maheshwary (1977) .\nthe hosts of campoplex gravenhorst mainly belong to coleophoridae, gelechiidae, pyralidae, tortricidae, yponomeutidae, etc. (aubert 1983, horstmann 1980, 1985, kusigemati 1987, shaw and aeschlimann 1994, yu et al. 2012) .\nin the last five years the authors have been exploring qinghai province, ningxia hui autonomous region and inner mongolia autonomous region, situated in northwestern china, and have collected large numbers of ichneumonids. in this article, one new species of campoplex is reported, reared from the larva of bazaria turensis ragonot, 1887 (lepidoptera, pyralidae), from qinghai province, p. r. china .\nmature larvae of the host, bazaria turensis, were collected on 28 august 2013 by mao - ling sheng. cocoons of the host were collected on 21 may 2014 by yan - ling zhang, from a forest where there had been an outbreak lasting at least three years, and brought to the laboratory. the forest is located in dulan county, qinghai province. the forest is a shrubbery composed of nitraria tangutorum bobrov, lycium chinense miller var. potaninii (pojarkova) a. m. lu and kalidium foliatum (pallas) moquin - tandon. mature larvae were maintained in a nylon cage at room temperature. the pupae were stored individually in glass tubes with a piece of filter paper dipped in distilled water to maintain moisture and plugged tightly with absorbent cotton. glass tubes are 60 mm long and 6 mm diameter. after the emergence of moths and parasitoids was complete, all remaining pupae were dissected to record their condition (i. e. status of moths, and parasitism) .\nspecimens were compared with material from the natural history museum (nhm), london, uk. morphological terminology is mostly based on gauld (1991) .\nimages of whole insects were taken using a canon power shot a650 is. other images were taken using a cool snap mps color attached to a zeiss discovery v8 stereomicroscope and captured with qcapture pro 7 .\ntype specimens are deposited in the insect museum, general station of forest pest management (gsfpm), state forestry administration, people’s republic of china .\ncampoplex gravenhorst, 1829. ichneumonologia europaea, 3: 453. type - species: ichneumon difformis gmelin, 1790. designated by westwood 1840 .\neye slightly or not at all emarginate opposite antennal socket. occipital carina joining hypostomal carina above base of mandible, or reaching directly to base of mandible. area superomedia and area petiolaris confluent, junction between them usually discernible, combined area moderately wide. area dentipara completely bordered by carinae. apex of propodeum usually not reaching middle of hind coxa. areolet usually present. 2m - cu inclivous. basal portion of first tergite subcylindric and less than 3. 0× as long as deep, suture between tergite and sternite approximately at or a little below mid - height. apex of male gonosquama rounded above or with a very shallow emargination. ovipositor sheath about 3–4× as long as apical depth of metasoma .\ncampoplex bazariae sp. n. holotype. female 1 habitus, lateral view 2 head, anterior view 3 head, dorsal view 4 mesoscutum 5 mesopleuron .\ncampoplex bazariae sheng, sp. n. holotype. female 6 areolet and pterostigma 7 propodeum 8 first tergite, lateral view 9 tergites 2–3 10 a, b cocoon .\nholotype, female emerged from cocoon of bazaria turensis on 20 july 2014 reared by yan - ling zhang, china: balong, 2860m, dulan county, qinghai province. paratypes: 2 females, same data as holotype. 1 male, same data as holotype except 15 september 2014. 1 female, 1 male, china: nuomuhong, 2690m, dulan county, qinghai province, 28 august 2013, mao - ling sheng .\nface finely coriaceous, with dense punctures. interocellar area with distinct punctures. postocellar line 1. 6–1. 7× as long as ocular - ocellar line. postscutellum with fine dense distinct punctures. first tergite from base to apex strongly evenly convex, smooth, shiny. second and subsequent tergites finely coriaceous. apical margins of tergites 6 and 7 with deep median triangular emarginations. ovipositor slightly, evenly curved upwards. head except mandibles and maxillary and labial palpi, mesosoma and all tergites entirely black .\nfemale. body length 7. 5–8. 0 mm. fore wing length 5. 5–5. 8 mm. ovipositor sheath length 2. 7–2. 9 mm .\ninner margins of eyes slightly convergent ventrally. narrowest width of face (fig .\n) approximately 0. 9× height of face plus clypeus, slightly convex, finely coriaceous, with dense punctures. clypeus shiny, with sparse punctures; apical margin slightly elevated and arched forwards. mandible short, with large punctures, upper tooth as long as lower tooth. malar area slightly concave, indistinctly granulose. malar space approximately 0. 30–0. 34× as long as basal width of mandible. gena in dorsal view approximately 0. 6× as long as width of eye, almost smooth, with sparse, fine punctures, posterior portion obviously convergent posteriorly. vertex (fig .\n) finely granulose, with indistinct, fine, shallow punctures. interocellar area with distinct punctures. postocellar line 1. 6–1. 7× as long as ocular - ocellar line. ocular - ocellar line 1. 0–1. 2× diameter of posterior ocellus. frons almost flat, rough, with dense, indistinct punctures. antenna with 37 flagellomeres. ratio of length from first to fifth flagellomeres: 4. 0: 3. 0: 2. 9: 2. 8: 2. 6. occipital carina complete, upper median portion evenly up - curved, lower end reaching base of mandible .\nlateral concavity of pronotum with dense oblique wrinkles, upper - posterior portion with dense coarse irregular punctures, distance between punctures 0. 2–0. 5× diameter of puncture, upper posterior margin with dense fine punctures. epomia distinct. mesoscutum (fig .\n) evenly convex, with distinct punctures, distance between punctures 0. 2–2. 5× diameter of puncture. notaulus vestigial. scutellum evenly, strongly convex, with dense distinct punctures, distance between punctures 0. 2–0. 5× diameter of puncture. postscutellum trapezoidally convex, with fine, dense, distinct punctures, anteriorly transversely concave. mesopleuron (fig .\n) with distinct punctures, distance between punctures approximately 0. 2–2. 5× diameter of puncture, in lower - front portion of speculum with dense oblique wrinkles. speculum approximately transverse - quadrate, smooth, shiny. upper end of epicnemial carina reaching about 0. 5 level of posterior margin of pronotum. mesopleural fovea consisting of short, shallow horizontal groove. mesosternum with punctures as that of mesopleuron, posterior transverse carina complete, strong. metapleuron slightly convex, with punctures as, or slightly denser than that of mesopleuron. submetapleural carina complete, strong. wings slightly brownish, hyaline. fore wing with vein 1cu - a distinctly distal of 1 - m. areolet (fig .\n) obliquely quadrangular, its petiole 0. 7–0. 9× as long as 2rs - m, receiving vein 2m - cu approximately 0. 7× distance from vein 2rs - m to 3rs - m. 2m - cu slightly inclivous. 2 - cu approximately as long as 2cu - a. hind wing vein 1 - cu almost vertical, about 3. 0× as long as cu - a. ratio of lengths of hind femur, tibia and tarsus 7. 5: 10: 12. 5. ratio of length of hind tarsomeres 1: 2: 3: 4: 5 is 10. 0: 4. 0: 2. 6: 1. 7: 2. 0. claws thin. base of fore claw with sparse pectination. base of hind claw with dense pectination. area spiracularis of propodeum (fig .\n) combined with area lateralis. areas basalis small, strongly convergent posteriorly, longer than its maximum width, smooth, shiny. area superomedia and area petiolaris confluent, junction point between them discernible. area superomedia smooth, shiny, costula connecting approximately at its middle or slightly behind middle. area petiolaris almost flat (indistinctly longitudinally concave), with dense distinct transverse wrinkles. area externa smooth, distinctly punctate. area dentipara slightly coarse, with indistinct, irregular wrinkles. area posteroexterna with oblique transverse wrinkles. areas spiracularis and lateralis with dense indistinct fine punctures. propodeal spiracle small, elongate - oval, connecting with pleural carina by a distinct carina, space between them shorter than its longest diameter, distance to lateral longitudinal carina longer than its longest diameter. apex of propodeum reaching 0. 25 of hind coxa .\n) approximately 2. 9 times as long as apical width, basal portion subcylindric, suture separating from sternite lying at mid height of segment; from base to apex strongly, evenly convex; smooth, shiny. spiracle located about at apical 0. 4 of first tergite. second and subsequent tergites finely coriaceous. second tergite (fig .\n) 1. 25–1. 43× as long as apical width. third and following tergites compressed. apical margins of tergites 6 and 7 with deep median triangular emarginations. ovipositor sheath approximately 1. 25× as long as hind tibia, 0. 65–0. 75× as long as total length of posterior seven tergites. ovipositor slightly curved upwards, with distinct subapical dorsal notch .\n). black, except the following. maxillary and labial palpi blackish brown. median portions of mandibles dark brown, or upper - median margins yellowish brown. tegula stramineous. all coxae and trochanters, except brownish apical margins of fore trochanter, black. fore femur, dorsal profiles and ventral apical portions of mid and hind femora reddish brown. basal ventral halves or more of mid and hind femora, apical portion of hind femur black. fore and mid tibiae, except outsides slightly yellowish, and tarsi brown to dark brown. ventral side of hind tibia reddish brown, dorsal side and tarsus dark brown. second, lateral margin of third and apical margins of fourth to sixth sternites grayish yellow to off - white. median portion of pterostigma dark brown. veins brownish black .\nmale. body length 8. 0–8. 2 mm. fore wing length approximately 6. 0 mm. median portion of frons with dense transverse wrinkles. apex of gonosquama more or less horny. median portion of mandible reddish brown. tegula yellow, median portion asymmetrically blackish brown. mid and hind tarsi dark brown .\nnitraria tangutorum bobrov (zygophyllaceae), kalidium foliatum (pallas) moquin - tandon (amaranthaceae) .\n, collected and reared by the local colleague, yan - ling zhang (director of forestry pest control and quarantine station of dulan, qinghai, china) .\n( brischke, 1880) and can be distinguished from the latter by the following combination of characters: petiole of areolet (fig .\n) 0. 7–0. 9× as long as 2rs - m; area superomedia smooth, shiny, flat, costula connecting at its middle; area petiolaris almost flat; second tergite approximately 1. 25–1. 43× as long as apical width; posterior portions of tergites 6 and 7 with deep median triangular emarginations; apical portions and basal ventral halves or more of hind femora black; ventral profiles of hind tibiae reddish brown, dorsal profiles darkish brown; median portion of pterostigma darkish brown .\n) (nhm): petiole of areolet approximately 0. 5× as long as 2rs - m; area superomedia rough, costula connecting at its anterior 0. 3; confluent areas superomedia and petiolaris distinctly longitudinally concave; second tergite as long as or slightly longer than apical width; posterior margins of tergites 6 and 7 truncate; hind femora and tibiae entirely reddish brown; pterostigma brown .\ncampoplex ovatus (brischke, 1880) (nhm) female 11 tergites 2–3 12 areolet and pterostigma .\nthe authors are deeply grateful to dr gavin broad (nhm) for providing specimens of other species for comparison and reviewing this manuscript. the authors also wish to thank yan - ling zhang (director of forestry pest control and quarantine station of dulan, qinghai, china) for her help in the course of exploration in qinghai province. this research was supported by the “twelfth five - year” national science and technology support program of china (grant no. 2012bad19b0701) and the national natural science foundation of china (nsfc, no. 31070585, no. 31310103033) .\nzhao y - x, sheng m - l (2014) a new parasitoid of bazaria turensis (lepidoptera, pyralidae): campoplex bazariae sp. n. (hymenoptera, ichneumonidae). zookeys 466: 43–51. doi: 10. 3897 / zookeys. 466. 8618\nthe ichneumonidae of costa rica, 1. introduction, keys to subfamilies, and keys to the species of the lower pimpliform subfamilies rhyssinae, poemeniinae, acaenitinae and cylloceriinae .\nichneumonologia orientalis, part iv. the tribe porozontini (= campoplegini) (hymenoptera: ichneumonidae) .\nrevision der mit difformis (gmelin, 1790) verwandten westpaläarktischen arten der gattung campoplex gravenhorst, 1829 (hymenoptera, ichneumonidae) .\nneue taxa der campopleginae aus den gattungen campoplex gravenhorst, diadegma förster und nemeritis holmgren (hymenoptera, ichneumonidae) .\nichneumonidea (hym .) a clarissimis v. j. roborowski et p. k. kozlov annis 1894–1895 et 1900–1901 in china, mongolia et tibetia lecti 2 .\nichneumonid parasites of pine tip borers in japan, with description of a new species (hymenoptera: ichneumonidae) .\na few host - known ichneumonidae found in formosa (hym .) (2) .\ndrei neue gattungen sowie acht neue und fuenf unbeschriebene arten der ichneumoniden aus japan .\nüber den fichtenwickler in hokkaido und seine parasiten, mit der beschreibung neuer arten .\ntaxapad 2012 – world ichneumonoidea 2011. taxonomy, biology, morphology and distribution .\nsign in to disable all ads. thank you for helping build the largest language community on the internet .\nhave a fact about epernon? write it here to share it with the entire community .\nhave a definition for epernon? write it here to share it with the entire community .\nhave a better pronunciation? upload it here to share it with the entire community .\nsimply select a language and press on the speaker button to listen to the pronunciation of the word. leave a vote for your preferred pronunciation." ]
{ "text": [ "epermenia parasitica is a moth in the family epermeniidae .", "it was described by meyrick in 1930 .", "it is found on java .", "the wingspan is 8 – 9 mm .", "the forewings are grey-whitish , with the apex of scales dark grey , forming a close rather irregular striolation , more or less largely suffused ochreous-brown except anteriorly .", "there are three small black dots in a longitudinal row in the disc from one-fourth to three-fourths and several dark grey transverse spots from the costa , as well as a black apical dot .", "the hindwings are grey . " ], "topic": [ 2, 5, 20, 9, 1, 1, 1 ] }
"epermenia parasitica is a moth in the family epermeniidae. it was described by meyrick in 1930. it is found on java. the wingspan is 8 – 9 mm. the forewings are grey-whitish, with the apex of scales dark grey, forming a close rather irregular striolation, more or less largely suffused ochreous-brown except anteriorly. there are three small black dots in a longitudinal row in the disc from one-fourth to three-fourths and several dark grey transverse spots from the costa, as well as a black apical dot. the hindwings are grey."
[ "epermenia parasitica is a moth in the family epermeniidae. it was described by meyrick in 1930. it is found on java. the wingspan is 8 – 9 mm. the forewings are grey-whitish, with the apex of scales dark grey, forming a close rather irregular striolation, more or less largely suffused ochreous-brown except anteriorly. there are three small black dots in a longitudinal row in the disc from one-fourth to three-fourths and several dark grey transverse spots from the costa, as well as a black apical dot. the hindwings are grey." ]
"animal-train-18"
"animal-train-18"
"2669"
"antaeotricha binubila"
[ "antaeotricha suffumigata walsingham, 1897; 98; tl: mount gay est. , grenada\nantaeotricha malachita meyrick, 1915; exot. microlep. 1 (13): 404; tl: british guiana\nantaeotricha parastis van gyen, 1913; bol. mus. nac. chile 5: 339; tl: collipulli\nantaeotricha platydesma meyrick, 1915; exot. microlep. 1 (13): 405; tl: british guiana\nantaeotricha praerupta meyrick, 1915; exot. microlep. 1 (13): 394; tl: british guiana\nantaeotricha brochota meyrick, 1915; exot. microlep. 1 (13): 396; tl: peru, yquitos\nantaeotricha carabophanes meyrick, 1932; exotic microlep. 4 (10): 289; tl: colombia, san antonio\nantaeotricha epignampta meyrick, 1915; exot. microlep. 1 (13): 395; tl: peru, pacaya\nantaeotricha gravescens meyrick, 1926; exot. microlep. 3 (8): 237; tl: colombia, minero\nantaeotricha iras meyrick, 1926; exot. microlep. 3 (8): 237; tl: peru, 12000ft\nantaeotricha isotona meyrick, 1932; exotic microlep. 4 (10): 291; tl: panama, trinidad river\nantaeotricha lysimeris meyrick, 1915; exot. microlep. 1 (13): 391; tl: peru, pacaya\nantaeotricha nerteropa meyrick, 1915; exot. microlep. 1 (13): 395; tl: peru, pacaya\nantaeotricha neurographa meyrick, 1922; exotic microlep. 2 (20): 614; tl: brazil, novo friburgo\nantaeotricha serangodes meyrick, 1915; exot. microlep. 1 (13): 400; tl: panama, chiriqui\nantaeotricha arystis meyrick, 1915; exot. microlep. 1 (13): 402; tl: british guiana, bartica\nantaeotricha camarina meyrick, 1915; exot. microlep. 1 (13): 401; tl: british guiana, mallali\nantaeotricha deltopis meyrick, 1915; exot. microlep. 1 (13): 390; tl: british guiana, bartica\nantaeotricha hapsicora meyrick, 1915; exot. microlep. 1 (13): 399; tl: brazil, sao paulo\nantaeotricha lecithaula meyrick, 1914; exot. microlep. 1 (13): 401; tl: british guiana, bartica\nantaeotricha monocolona meyrick, 1932; exotic microlep. 4 (10): 293; tl: bolivia, cochabamba, incachaca\nantaeotricha pactota meyrick, 1915; exot. microlep. 1 (13): 391; tl: british guiana, bartica\nantaeotricha paracrypta meyrick, 1915; exot. microlep. 1 (13): 405; tl: british guiana, bartica\nantaeotricha phaeosaris meyrick, 1915; exot. microlep. 1 (13): 394; tl: british guiana, mallali\nantaeotricha protosaris meyrick, 1915; exot. microlep. 1 (13): 406; tl: british guiana, bartica\nantaeotricha pseudochyta meyrick, 1915; exot. microlep. 1 (13): 393; tl: bartica, british guiana\nantaeotricha sparganota meyrick, 1915; exot. microlep. 1 (13): 389; tl: british guiana, bartica\nantaeotricha thesmophora meyrick, 1915; exot. microlep. 1 (13): 392; tl: british guiana, bartica\nantaeotricha trochoscia meyrick, 1915; exot. microlep. 1 (13): 396; tl: british guiana, mallali\nantaeotricha aglypta meyrick, 1925; exot. microlep. 3 (5 - 7): 174; tl: brazil, teffé\nantaeotricha amicula zeller, 1877; horae soc. ent. ross. 13: 317, pl. 4, f. 96\nantaeotricha capsulata meyrick, 1918; exotic microlep. 2 (7): 199; tl: french guiana, r. maroni\nantaeotricha cleopatra meyrick, 1925; exot. microlep. 3 (5 - 7): 166; tl: brazil, teffé\nantaeotricha congelata meyrick, 1926; exot. microlep. 3 (8): 236; tl: peru, cocapata, 12000ft\nantaeotricha cryeropis meyrick, 1926; exot. microlep. 3 (5 - 7): 167; tl: mexico, guerrero\nantaeotricha eucoma meyrick, 1925; exot. microlep. 3 (5 - 7): 168; tl: brazil, manaos\nantaeotricha hydrophora meyrick, 1925; exot. microlep. 3 (5 - 7): 171; tl: peru, iquitos\nantaeotricha manceps meyrick, 1925; exot. microlep. 3 (5 - 7): 172; tl: peru, jurimaguas\nantaeotricha milictis meyrick, 1925; exot. microlep. 3 (5 - 7): 163; tl: brazil, teffé\nantaeotricha nimbata meyrick, 1925; exot. microlep. 3 (5 - 7): 175; tl: peru, iquitos\nantaeotricha nitescens meyrick, 1925; exot. microlep. 3 (5 - 7): 171; tl: brazil, para\nantaeotricha orthriopa meyrick, 1925; exot. microlep. 3 (5 - 7): 166; tl: brazil, parintins\nantaeotricha percnogona meyrick, 1925; exot. microlep. 3 (5 - 7): 170; tl: peru, iquitos\nantaeotricha plerotis meyrick, 1925; exot. microlep. 3 (5 - 7): 165; tl: peru, pacaya\nantaeotricha resiliens meyrick, 1925; exot. microlep. 3 (5 - 7): 173; tl: brazil, parintins\nantaeotricha sana meyrick, 1926; exot. microlep. 3 (8): 235; tl: colombia, sosomoko, 2650ft\nantaeotricha sarcinata meyrick, 1918; exotic microlep. 2 (7): 200; tl: french guiana, r. maroni\nantaeotricha serarcha meyrick, 1930; exot. microlep. 3 (18 - 20): 556; tl: brazil, caraca\nantaeotricha sortifera meyrick, 1930; exot. microlep. 3 (18 - 20): 557; tl: bolivia, cochabamba\nantaeotricha stringens meyrick, 1925; exot. microlep. 3 (5 - 7): 164; tl: brazil, teffé\nantaeotricha suffumigata; duckworth, 1969, smithson. contr. zool. 4: 4; [ sangmi lee & richard brown ]\nantaeotricha superciliosa meyrick, 1918; exotic microlep. 2 (7): 198; tl: french guiana, r. maroni\nantaeotricha synercta meyrick, 1925; exot. microlep. 3 (5 - 7): 173; tl: brazil, parintins\nantaeotricha tornogramma meyrick, 1925; exot. microlep. 3 (5 - 7): 171; tl: brazil, parintins\nantaeotricha tractrix meyrick, 1925; exot. microlep. 3 (5 - 7): 172; tl: brazil, obidos\nantaeotricha xuthosaris meyrick, 1925; exot. microlep. 3 (5 - 7): 175; tl: brazil, teffé\nantaeotricha acronephela meyrick, 1915; exot. microlep. 1 (13): 392; tl: british guiana, bartica; mallali\nantaeotricha brachysaris meyrick, 1916; exot. microlep. 1 (16): 504; tl: french guiana, r. maroni\nantaeotricha campylodes meyrick, 1916; exot. microlep. 1 (16): 494; tl: french guiana, r. maroni\nantaeotricha coriodes meyrick, 1915; exot. microlep. 1 (13): 397; tl: british guiana, mallali; bartica\nantaeotricha encyclia meyrick, 1915; exot. microlep. 1 (13): 403; tl: colombia, san antonio, 5800ft\nantaeotricha euthrinca meyrick, 1915; exot. microlep. 1 (13): 399; tl: colombia, san antonio, 5800ft\nantaeotricha exusta meyrick, 1916; exot. microlep. 1 (16): 492; tl: french guiana, r. maroni\nantaeotricha glycerostoma meyrick, 1915; exot. microlep. 1 (13): 399; tl: colombia, san antonio, 5800ft\nantaeotricha helicias meyrick, 1916; exot. microlep. 1 (16): 502; tl: french guiana, r. maroni\nantaeotricha himaea meyrick, 1916; exot. microlep. 1 (16): 505; tl: french guiana, r. maroni\nantaeotricha incrassata meyrick, 1916; exot. microlep. 1 (16): 504; tl: french guiana, r. maroni\nantaeotricha insimulata meyrick, 1926; exot. microlep. 3 (8): 237; tl: colombia, san antonio, 6600ft\nantaeotricha staurota meyrick, 1916; exot. microlep. 1 (16): 493; tl: french guiana, r. maroni\nantaeotricha substricta meyrick, 1918; exotic microlep. 2 (7): 200; tl: : french guiana, r. maroni\nantaeotricha xylocosma meyrick, 1916; exot. microlep. 1 (16): 491; tl: french guiana, r. maroni\nantaeotricha (depressariidae); urra, 2014, bol. mus. nac. hist. nat. chile 63: 102 (note )\nantaeotricha celidotis meyrick, 1925; exot. microlep. 3 (5 - 7): 169; tl: peru, r. napo\nantaeotricha cycnomorpha meyrick, 1925; exot. microlep. 3 (5 - 7): 169; tl: brazil, r. trombetas\nantaeotricha fulta meyrick, 1926; exot. microlep. 3 (8): 234; tl: colombia, monte del eden, 9550\nantaeotricha gubernatrix meyrick, 1925; exot. microlep. 3 (5 - 7): 173; tl: peru, r. napo\nantaeotricha gymnolopha meyrick, 1925; exot. microlep. 3 (5 - 7): 174; tl: brazil, parintins, manaos\nantaeotricha haplocentra meyrick, 1925; exot. microlep. 3 (5 - 7): 170; tl: brazil, obidos, parintins\nantaeotricha melanopis meyrick, 1909; trans. ent. soc. lond. 1909 (1): 31; tl: peru, huancabamba\nantaeotricha mesostrota meyrick, 1912; trans. ent. soc. lond. 1911 (4): 708; tl: venezulea, carupano\nantaeotricha nuclearis meyrick, 1913; trans. ent. soc. lond. 1913 (1): 181; tl: peru, chanchamayo\nantaeotricha phryactis meyrick, 1925; exot. microlep. 3 (5 - 7): 167; tl: peru, r. napo\nantaeotricha sardania meyrick, 1925; exot. microlep. 3 (5 - 7): 168; tl: brazil, para, teffé\nantaeotricha sellifera meyrick, 1925; exot. microlep. 3 (5 - 7): 163; tl: brazil, parintins, manaos\nantaeotricha semiovata meyrick, 1926; exot. microlep. 3 (8): 234; tl: colombia, monte del eden, 9550ft\nantaeotricha teleosema meyrick, 1925; exot. microlep. 3 (5 - 7): 165; tl: brazil, parintins, teffé\nantaeotricha tritogramma meyrick, 1925; exot. microlep. 3 (5 - 7): 176; tl: brazil, parintins, teffé\nantaeotricha deridens meyrick, 1925; exot. microlep. 3 (5 - 7): 162; tl: bolivia, del sara, 1500ft\nantaeotricha nitrota meyrick, 1916; exot. microlep. 1 (16): 497; tl: french guiana, godebert, r. maroni\nantaeotricha ophrysta meyrick, 1912; trans. ent. soc. lond. 1911 (4): 708; tl: dutch guiana, onoribo\nantaeotricha albovenosa zeller, 1877; horae soc. ent. ross. 13: 321, pl. 4, f. 99; tl: chanchamayo\nantaeotricha arizonensis ferris, 2010; zookeys 57: 60; tl: arizona, cochise co. , hauchuca mts. , carr canyon, 5300'\nantaeotricha assecta zeller, 1877; horae soc. ent. ross. 13: 313, pl. 3, f. 94; tl: chanchamayo\nantaeotricha cathagnista meyrick, 1925; exot. microlep. 3 (5 - 7): 165; tl: brazil, r. trombetas, teffé\nantaeotricha christocoma meyrick, 1915; exot. microlep. 1 (13): 398; tl: peru, pacaya; conamano, r. ucuyali\nantaeotricha generatrix meyrick, 1926; exot. microlep. 3 (8): 239; tl: brazil, santa cruz, rio grande do sul\nantaeotricha thammii zeller, 1877; horae soc. ent. ross. 13: 306, pl. 3, f. 89; tl: chanchamayo\nantaeotricha vacata meyrick, 1925; exot. microlep. 3 (5 - 7): 170; tl: st. george' s, grenada\nantaeotricha albifrons zeller, 1877; horae soc. ent. ross. 13: 323, pl. 4, f. 100; tl: brazil ?\nantaeotricha amphilyta meyrick, 1916; exot. microlep. 1 (16): 503; tl: french guiana, st. jean, r. maroni\nantaeotricha anaclintris meyrick, 1916; exot. microlep. 1 (16): 499; tl: french guiana, st. jean, r. maroni\nantaeotricha axena meyrick, 1916; exot. microlep. 1 (16): 501; tl: french guiana, st. jean, r. maroni\nantaeotricha compsographa meyrick, 1916; exot. microlep. 1 (16): 491; tl: french guiana, st. jean, r. maroni\nantaeotricha diffracta meyrick, 1916; exot. microlep. 1 (16): 500; tl: french guiana, st. jean, r. maroni\nantaeotricha excisa meyrick, 1916; exot. microlep. 1 (16): 496; tl: french guiana, st. jean, r. maroni\nantaeotricha manzanitae keifer, 1937; calif. dept. agric. bull. 26: 334; tl: shingle springs, el dorado co. , california\nantaeotricha melanarma meyrick, 1916; exot. microlep. 1 (16): 500; tl: french guiana, st. jean, r. maroni\nantaeotricha oxycentra meyrick, 1916; exot. microlep. 1 (16): 497; tl: french guiana, st. jean, r. maroni\nantaeotricha palaestrias meyrick, 1916; exot. microlep. 1 (16): 502; tl: french guiana, st. jean, r. maroni\nantaeotricha pseudochyta; duckworth, 1969, smithson. contr. zool. 4: 4; [ nhm card ]; [ sangmi lee & richard brown ]\nantaeotricha purulenta zeller, 1877; horae soc. ent. ross. 13: 318, pl. 4, f. 97; tl: brazil ?\nantaeotricha tibialis zeller, 1877; horae soc. ent. ross. 13: 307, pl. 3, f. 90; tl: brazil ?\nantaeotricha vacata; duckworth, 1969, smithson. contr. zool. 4: 5; [ nhm card ]; [ sangmi lee & richard brown ]\nantaeotricha venatum; duckworth, 1962, proc. ent. soc. wash. 64 (2): 111; [ sangmi lee & richard brown ]\nantaeotricha amphizyga meyrick, 1930; ann. naturhist. mus. wien 44: 234, pl. 2, f. 12; tl: pará, belem\nantaeotricha enodata meyrick, 1916; exot. microlep. 1 (16): 493; tl: french guiana, godebert; nouveau chantier, r. maroni\nantaeotricha immota meyrick, 1916; exot. microlep. 1 (16): 502; tl: french guiana, r. maroni; british guiana, mallali\nantaeotricha orthotona meyrick, 1916; exot. microlep. 1 (16): 495; tl: british guiana, bartica; french guiana, r. maroni\nantaeotricha ribbei zeller, 1877; horae soc. ent. ross. 13: 309, pl. 3, f. 91; tl: chiriqui - vulcan\nantaeotricha smileuta meyrick, 1915; exot. microlep. 1 (13): 397; tl: british guiana, bartica; french guiana, s. laurient\nantaeotricha trichonota meyrick, 1926; exot. microlep. 3 (8): 235; tl: brazil, santa cruz, rio grande do sul; paraguay\nantaeotricha corvigera meyrick, 1915; exot. microlep. 1 (13): 390; tl: british guiana, mallali; peru, contamano, r. ucuyali\nantaeotricha diplophaea meyrick, 1916; exot. microlep. 1 (16): 494; tl: french guiana, godebert; st. jean, r. maroni\nantaeotricha laudata meyrick, 1916; exot. microlep. 1 (16): 496; tl: french guiana, st. jean and godebert, r. maroni\nantaeotricha praecisa meyrick, 1912; trans. ent. soc. lond. 1911 (4): 709; tl: brazil, rio de janeiro, são paulo\nantaeotricha demas; duckworth, 1962, proc. ent. soc. wash. 64 (2): 111; [ nhm card ]; [ sangmi lee & richard brown ]\nantaeotricha illepida; duckworth, 1966, proc. ent. soc. wash. 68 (3): 196; [ nhm card ]; [ sangmi lee & richard brown ]\nantaeotricha lampyridella; duckworth, 1962, proc. ent. soc. wash. 64 (2): 111; [ nhm card ]; [ sangmi lee & richard brown ]\nantaeotricha cyprodeta meyrick, 1930; exot. microlep. 3 (18 - 20): 556; tl: brazil, santa cruz, rio grande do sul; organ mtns, nova friburge\nantaeotricha floridella hayden & dickel, 2015; zookeys 533: 135; tl: usa, florida, marion co. , ocala national forest, fr 88, 3. 9mi se of sr 316, longleaf pine sandhills\nantaeotricha fuscorectangulata duckworth, 1964; proc. u. s. nat. mus. 116 (3495): 41, pl. 3 a; tl: south fork of cave creek, chiricahua mts. , arizona\nantaeotricha utahensis ferris, 2012; j. lep. soc. 66 (3): 168; tl: utah, san juan co. , 37°44. 90' n, 109°24. 75' w (2220m )\nantaeotricha humilis; duckworth, 1964, proc. u. s. nat. mus. 116 (3495): 37; [ nacl ], # 1019; [ nhm card ]; [ sangmi lee & richard brown ]\nantaeotricha decorosella; duckworth, 1964, proc. u. s. nat. mus. 116 (3495): 35, pl. 1 f; [ nacl ], # 1016; [ nhm card ]; [ sangmi lee & richard brown ]\nantaeotricha furcata; duckworth, 1964, proc. u. s. nat. mus. 116 (3495): 36, pl. 2 a; [ nacl ], # 1017; [ nhm card ]; [ sangmi lee & richard brown ]\nantaeotricha haesitans; duckworth, 1964, proc. u. s. nat. mus. 116 (3495): 40, pl. 2 f; [ nacl ], # 1022; [ nhm card ]; [ sangmi lee & richard brown ]\nantaeotricha irene; duckworth, 1964, proc. u. s. nat. mus. 116 (3495): 36, pl. 2 b; [ nacl ], # 1018; [ nhm card ]; [ sangmi lee & richard brown ]\nantaeotricha leucillana; duckworth, 1964, proc. u. s. nat. mus. 116 (3495): 32, pl. 1 d; [ nacl ], # 1014; [ nhm card ]; [ sangmi lee & richard brown ]\nantaeotricha lindseyi; duckworth, 1964, proc. u. s. nat. mus. 116 (3495): 30, pl. 1 b; [ nacl ], # 1012; [ nhm card ]; [ sangmi lee & richard brown ]\nantaeotricha manzanitae; duckworth, 1964, proc. u. s. nat. mus. 116 (3495): 43, pl. 3 c; [ nacl ], # 1025; [ nhm card ]; [ sangmi lee & richard brown ]\nantaeotricha osseella; duckworth, 1964, proc. u. s. nat. mus. 116 (3495): 34, pl. 1 e; [ nacl ], # 1015; [ nhm card ]; [ sangmi lee & richard brown ]\nantaeotricha schlaegeri; duckworth, 1964, proc. u. s. nat. mus. 116 (3495): 29, pl. 1 a; [ nacl ], # 1011; [ nhm card ]; [ sangmi lee & richard brown ]\nantaeotricha thomasi; duckworth, 1964, proc. u. s. nat. mus. 116 (3495): 39, pl. 2 e; [ nacl ], # 1021; [ nhm card ]; [ sangmi lee & richard brown ]\nantaeotricha unipunctella; duckworth, 1964, proc. u. s. nat. mus. 116 (3495): 31, pl. 1 e; [ nacl ], # 1013; [ nhm card ]; [ sangmi lee & richard brown ]\nantaeotricha vestalis; duckworth, 1964, proc. u. s. nat. mus. 116 (3495): 42, pl. 3 b; [ nacl ], # 1024; [ nhm card ]; [ sangmi lee & richard brown ]\naphanoxena acrograpta meyrick, 1915; exot. microlep. 1 (13): 387; tl: british guiana, bartica\nstenoma actista meyrick, 1913; trans. ent. soc. lond. 1913 (1): 186; tl: venezuela, palma sola; british guiana, r. demerata\nstenoma admixta walsingham, 1913; biol. centr. - amer. lep. heterocera 4: 170, pl. 6, f. 3; tl: mexico, guerrero, dos arroyos, 1000ft\nstenoma adornata meyrick, 1915; exot. microlep. 1 (14): 442; tl: peru, pacaya\nstenoma aequabilis meyrick, 1916; exot. microlep. 1 (17): 513; tl: french guiana, st. jean; godebert, r. maroni\nstenoma aggravata meyrick, 1916; exot. microlep. 1 (17): 514; tl: french guiana, r. maroni\nstenoma agrioschista meyrick, 1927; exot. microlep. 3 (12): 365; tl: texas, alpine, 5000 - 8000ft\nstenoma ammodes walsingham, 1913; biol. centr. - amer. lep. heterocera 4: 176, pl. 6, f. 18; tl: mexico, tabasco, teapa\nstenoma arachnia meyrick, 1915; exot. microlep. 1 (14): 429; tl: british guiana, bartica\ncryptolechia aratella walker, 1864; list spec. lepid. insects colln br. mus. 29: 724; tl: ega\nargocorys (meyrick, 1931) (stenoma); exotic microlep. 4 (2 - 4): 34\naphanoxena astynoma meyrick, 1915; exot. microlep. 1 (13): 388; tl: british guiana, mallali\nstenoma atmospora meyrick, 1925; exot. microlep. 3 (5 - 7): 209; tl: colombia, minero and sosomoco, 2650ft\naphanoxena balanocentra meyrick, 1915; exot. microlep. 1 (13): 387; tl: british guiana, bartica; mallali\nstenoma ballista meyrick, 1916; exot. microlep. 1 (17): 516; tl: french guiana, . maroni\ncryptolechia basiferella walker, 1864; list spec. lepid. insects colln br. mus. 29: 744; tl: ega\nstenoma basilaris busck, 1914; proc. u. s. nat. mus. 47 (2043): 45; tl: alphajuela, porto bello; trinidad r. , panama\ncryptolechia basirubrella walker, 1864; list spec. lepid. insects colln br. mus. 29: 719; tl: ega\nstenoma bathrotoma meyrick, 1925; exot. microlep. 3 (5 - 7): 189; tl: brazil, obidos\nstenoma bilinguis meyrick, 1918; exotic microlep. 2 (7): 202; tl: french guiana, r. maroni\nbracatingae (köhler, 1943) (stenoma); rev. soc. ent. arg. 12: 28\nstenoma caenochytis meyrick, 1915; exot. microlep. 1 (13): 415; tl: british guiana, bartica and mallali\nalphanoxena cantharitis meyrick, 1916; exot. microlep. 1 (16): 490; tl: french guiana, r. maroni\nstenoma caprimulga walsingham, 1912; biol. centr. - amer. lep. heterocera 4: 165, pl. 5, f. 33; tl: mexico, vera cruz, atoyae\ncapsiformis (meyrick, 1930) (stenoma); exotic microlep. 4 (1): 25\nstenoma carabodes meyrick, 1915; exot. microlep. 1 (14): 435; tl: british guiana, bartica\nstenoma carbasea meyrick, 1915; exot. microlep. 1 (14): 426; tl: brazil, novo friburgo\ncaryograpta (meyrick, 1930) (stenoma); exotic microlep. 4 (1): 26\nstenoma ceratistes walsingham, 1912; biol. centr. - amer. lep. heterocera 4: 159; tl: mexico, guerrero, amula, 6000ft\nstenoma chalastis meyrick, 1915; exot. microlep. 1 (13): 413; tl: british guiana, bartica\nchalinophanes (meyrick, 1931) (stenoma); exotic microlep. 4 (2 - 4): 42\nstenoma chilosema meyrick, 1918; exotic microlep. 2 (7): 208; tl: french guiana, godebert, r. maroni\nphalaena (tinea) cicadella sepp, [ 1830 ]; surinaam. vlinders 2 (20): 183, pl. 80\nstenoma cirrhoxantha meyrick, 1915; exot. microlep. 1 (15): 477; tl: french guiana, godebert, r. maroni\nstenoma cnemosaris meyrick, 1925; exot. microlep. 3 (5 - 7): 181; tl: brazil, para\nstenoma colposaris meyrick, 1925; exot. microlep. 3 (5 - 7): 185; tl: brazil, teffé\nstenoma comosa walsingham, 1912; biol. centr. - amer. lep. heterocera 4: 161, pl. 5, f. 30; tl: mexico, vera cruz, atoyac\nstenoma compsoneura meyrick, 1925; exot. microlep. 3 (5 - 7): 217; tl: brazil, para; french guiana, r. maroni\ncryptolechia confixella walker, 1864; list spec. lepid. insects colln br. mus. 29: 731; tl: ega\nstenopa coniopa meyrick, 1925; exot. microlep. 3 (5 - 7): 184; tl: brazil, obidos\nstenoma constituta meyrick, 1925; exot. microlep. 3 (5 - 7): 191; tl: french guiana, r. maroni\nstenoma constricta meyrick, 1926; exot. microlep. 3 (8): 226; tl: colombia, mt. socorro, 12500ft\ncryptoleciha costatella walker, 1864; list spec. lepid. insects colln br. mus. 29: 737; tl: ega\nstenoma cremastis meyrick, 1925; exot. microlep. 3 (5 - 7): 194; tl: peru, jurimaguas; brazil, manaos\nstenoma crypsiphaea meyrick, 1915; exot. microlep. 1 (6): 190; tl: brazil, para\nstenoma cycnolopha meyrick, 1925; exot. microlep. 3 (5 - 7): 186; tl: peru, r. napo\nstenopa cymogramma meyrick, 1925; exot. microlep. 3 (5 - 7): 193; tl: peru, r. napo, iquitos\nbrachyloma decorosella busck, 1908; proc. ent. soc. wash. 10 (1 - 2): 111; tl: montclair, n. j\nlarva on quercus ilicifolia, quercus marilandia duckworth, 1964, proc. u. s. nat. mus. 116 (3495): 35\nstenoma demas busck, 1911; proc. u. s. nat. mus. 40 (1815): 223; tl: st. jean, maroni r. , french guiana\nstenoma demotica walsingham, 1912; biol. centr. - amer. lep. heterocera 4: 159; tl: mexico, guerrero, amula, 6000ft\nstenoma desecta meyrick, 1918; exotic microlep. 2 (7): 203; tl: french guiana, r. maroni\ncryptolechia destillata zeller, 1877; horae soc. ent. ross. 13: 283; tl: chiriqui\nstenoma diacta meyrick, 1916; exot. microlep. 1 (17): 513; tl: french guiana, r. maroni\nstenoma diplosaris meyrick, 1915; exot. microlep. 1 (14): 418; tl: british guiana, bartica\ndirempta (zeller, 1855) (cryptolechia); linn. ent. 10: 154, pl. 1, f. 4\nstenoma discalis busck, 1914; proc. u. s. nat. mus. 47 (2043): 46; tl: trinidad river, panama\nstenoma discolor walsingham, 1912; biol. centr. - amer. lep. heterocera 4: 164; tl: guatemala, baja vera paz, san gerónimo\ndisjecta (zeller, 1854) (cryptolechia); linn. ent. 9: 368\nstenoma dissona meyrick, 1925; exot. microlep. 3 (5 - 7): 191; tl: brazil, manaos\nstenoma doleropis meyrick, 1915; exot. microlep. 1 (14): 421; tl: british guiana, bartica\nstenoma dromica meyrick, 1925; exot. microlep. 3 (5 - 7): 185; tl: brazil, parintins\nstenoma elaeodes walsingham, 1913; biol. centr. - amer. lep. heterocera 4: 178, pl. 6, f. 22; tl: mexico, vera cruz, atoyac\ncryptolechia elatior felder & rogenhofer, 1875; reise fregatte novara, bd 2 (abth. 2) (5): pl. 138, f. 67; tl: amazonas\nepicrossa (meyrick, 1932) (stenoma); exotic microlep. 4 (10): 294\naphanoxena episimbla meyrick, 1915; exot. microlep. 1 (13): 389; tl: british guiana, bartica; mallali\nstenoma ergates walsingham, 1913; biol. centr. - amer. lep. heterocera 4: 185, pl. 6, f. 30; tl: mexico, tabasco, teapa\nstenoma erotica meyrick, 1916; exot. microlep. 1 (17): 534; tl: french guiana, r. maroni\nstenoma exasperata meyrick, 1916; exot. microlep. 1 (17): 533; tl: french guiana, r. maroni\nstenoma falsidica meyrick, 1915; exot. microlep. 1 (14): 426; tl: dutch guiana, berg - en - daal\nstenoma fasciatum busck, 1911; proc. u. s. nat. mus. 40 (1815): 217; tl: cayenne, french guiana\nbritish guiana, french guiana, brazil (amazonas). see [ maps ]\nstenoma forreri walsingham, 1913; biol. centr. - amer. lep. heterocera 4: 172, pl. 6, f. 2; tl: mexico, durango, presidio\nstenoma fractilinea walsingham, 1912; biol. centr. - amer. lep. heterocera 4: 166; tl: mexico, tabasco, teapa\nstenoma fractinubes walsingham, 1912; biol. centr. - amer. lep. heterocera 4: 165, pl. 5, f. 32; tl: panama, chiriqui, volcan de chiriqui, 2000 - 3000ft\ncryptolechia frontalis zeller, 1855; linn. ent. 10: 159, pl. 1, f. 7\nstenoma fumifica walsingham, 1912; biol. centr. - amer. lep. heterocera 4: 162, pl. 5, f. 31; tl: mexico, vera cruz, atoyac\nstenoma glaphyrodes meyrick, 1913; trans. ent. soc. lond. 1913 (1): 186; tl: french guiana, st. laurient; brazil [? ], iquitos\nstenoma glaucescens meyrick, 1916; exot. microlep. 1 (17): 537; tl: french guiana, r. maroni\nstenoma gypsoterma meyrick, 1915; exot. microlep. 1 (14): 424; tl: british guiana, mallali\nstenoma habilis meyrick, 1915; exot. microlep. 1 (14): 427; tl: british guiana, bartica\naedemoses haesitans walsingham, 1912; biol. centr. - amer. lep. heterocera 4: 154, pl. 5, f. 21; tl: presidio, durango, mexico\nlarva on pithecellobium flexicaule duckworth, 1964, proc. u. s. nat. mus. 116 (3495): 41\nstenoma hemiscia walsingham, 1912; biol. centr. - amer. lep. heterocera 4: 163; tl: guatemala, san gerónimo\nstenoma heterosaris meyrick, 1915; exot. microlep. 1 (14): 418; tl: british guiana, bartica\naphanoxena homologa meyrick, 1915; exot. microlep. 1 (13): 388; tl: british guiana, bartica\nstenoma horizontias meyrick, 1925; exot. microlep. 3 (5 - 7): 188; tl: brazil, teffé\nnorth carolina, south carolina, missouri, tennessee, virginia, illinois, maryland, texas, indiana, new jersey, louisiana. see [ maps ]\nlarva on quercus sp. duckworth, 1964, proc. u. s. nat. mus. 116 (3495): 38\nhyalophanta (meyrick, 1932) (stenoma); exotic microlep. 4 (10): 294\nstenoma ianthina walsingham, 1913; biol. centr. - amer. lep. heterocera 4: 178; tl: panama, chiriqui, volcan de chiriqui, 2000 - 3000ft\nstenoma imminens meyrick, 1915; exot. microlep. 1 (14): 431; tl: dutch guiana, onoribo\ncryptolechia impactella walker, 1864; list spec. lepid. insects colln br. mus. 29: 742; tl: ega\nstenoma impedita meyrick, 1915; exot. microlep. 1 (14): 422; tl: peru, pacaya\ncryptolechia indicatella walker, 1864; list spec. lepid. insects colln br. mus. 29: 732; tl: ega\nstenoma infecta meyrick, 1930; ann. naturhist. mus. wien 44: 254, pl. 2, f. 20; tl: taperinha, para, brazil\nstenoma infrenata meyrick, 1918; exotic microlep. 2 (7): 202; tl: french guiana, r. maroni\nstenoma innexa meyrick, 1925; exot. microlep. 3 (5 - 7): 190; tl: peru, jurimaguas, iquitos\nstenoma insidiana meyrick, 1916; exot. microlep. 1 (16): 512; tl: french guiana, , r. maroni\n= stenoma disjecta; meyrick, 1925, exot. microlep. 3 (5 - 7): 192; [ nhm card ]\niopetra (meyrick, 1932) (stenoma); exotic microlep. 4 (10): 295\nstenoma ioptila meyrick, 1915; exot. microlep. 1 (14): 433; tl: british guiana, bartica\nstenoma irene barnes & busck, 1920; contr. nat. hist. lepid. n. am. 4 (3): 239, pl. 28, f. 7, 9, pl. 30, f. 1; tl: brownsville, texas\nlarva on sida sp. duckworth, 1964, proc. u. s. nat. mus. 116 (3495): 37\nstenoma irenias meyrick, 1916; exot. microlep. 1 (17): 537; tl: french guiana, st. jean, r. maroni\nstenoma isochyta meyrick, 1915; exot. microlep. 1 (14): 420; tl: british guiana, bartica\nstenoma isomeris meyrick, 1912; trans. ent. soc. lond. 1911 (4): 711; tl: brazil, tijuco\nstenopa isoplintha meyrick, 1925; exot. microlep. 3 (5 - 7): 193; tl: brazil, parintins\nisoporphyra (meyrick, 1932) (asapharca); exotic microlep. 4 (8 - 9): 286\nisosticta (meyrick, 1932) (stenoma); exotic microlep. 4 (10): 299\nithytona meyrick, 1929; trans. ent. soc. lond. 76: 514\nstenoma juvenalis meyrick, 1930; ann. naturhist. mus. wien 44: 240, pl. 2, f. 13; tl: taperinha, para, brazil\nauxocrossa lacera zeller, 1877; horae soc. ent. ross. 13: 328, pl. 4, f. 103\nstenoma lampyridella busck, 1914; proc. u. s. nat. mus. 47 (2043): 41; tl: cabima, panama\nstenoma lathiptila meyrick, 1915; exot. microlep. 1 (14): 425; tl: british guiana, bartica\nstenoma laxa meyrick, 1915; exot. microlep. 1 (14): 428; tl: venezuela, ciudad bolivar\nstenoma lebetias meyrick, 1915; exot. microlep. 1 (14): 433; tl: french guiana, s. laurent\nstenoma lepidocarpa meyrick, 1930; ann. naturhist. mus. wien 44: 239, pl. 1, f. 9; tl: taperinha, para, brazil\npsephomeres leptogramma meyrick, 1916; exot. microlep. 1 (16): 506\nnew hampshire, massachusetts, new york, pennsylvania, district of columbia, virginia, north carolina, na. georgia, alabama, arkansas, missouri, kansas, illinois, iowa, texas, oregon, louisiana, manitoba, nova scotia. see [ maps ]\nlarva on pyracantha crenulata, malus sp. , vaccinium corymbosum, acer sp. duckworth, 1964, proc. u. s. nat. mus. 116 (3495): 32\nleucocryptis (meyrick, 1932) (stenoma); exotic microlep. 4 (10): 295\nstenoma lindseyi barnes & busck, 1920; contr. nat. hist. lepid. n. am. 4 (3): 239, pl. 29, f. 2; tl: paradise; white mts. , arizona; fort wingate, new mexico\nstenoma lophoptycha meyrick, 1925; exot. microlep. 3 (5 - 7): 188; tl: brazil, parintins\nstenoma lophosaris meyrick, 1925; exot. microlep. 3 (5 - 7): 186; tl: brazil, r. trombetas\nloxogrammos (zeller, 1854) (cryptolechia); linn. ent. 9: 367, pl. 3, f. 17\nstenoma lucrosa meyrick, 1925; exot. microlep. 3 (5 - 7): 184; tl: brazil, obidos, parintins\nstenoma lunimaculata dognin, 1913; ann. soc. ent. belg. 57: 417; tl: san antonio, colombia, 2000m\nstenoma machetes walsingham, 1912; biol. centr. - amer. lep. heterocera 4: 162; tl: mexico, guerrero, amula, 6000ft\nstenoma macronota meyrick, 1912; trans. ent. soc. lond. 1911 (4): 716; tl: colombia, naranjito, r. dagua, 3900ft; dutch guiana, paramaribo\nstenoma mesosaris meyrick, 1925; exot. microlep. 3 (5 - 7): 178; tl: french guiana, r. maroni\nstenoma microtypa meyrick, 1915; exot. microlep. 1 (14): 422; tl: british guiana, bartica\nstenoma mitratella busck, 1914; proc. u. s. nat. mus. 47 (2043): 46; tl: porto bello, panama\nstenoma modulata meyrick, 1915; exot. microlep. 1 (14): 436; tl: british guiana, bartica\nstenoma monosaris meyrick, 1915; exot. microlep. 1 (14): 419; tl: british guiana, bartica and mallali\ncryptolechia murinella walker, 1864; list spec. lepid. insects colln br. mus. 29: 743; tl: ega\nstenoma mustela walsingham, 1912; biol. centr. - amer. lep. heterocera 4: 167, pl. 6, f. 1; tl: panama, chiriqui, volcan de chiriqui, 2000 - 3000ft\nnavicularis (meyrick, 1930) (stenoma); exotic microlep. 4 (1): 24\nstenopa neocrossa meyrick, 1925; exot. microlep. 3 (5 - 7): 193; tl: peru, r. napo\nnephelocyma (meyrick, 1930) (stenoma); exotic microlep. 4 (1): 27\nbritish guiana, dutch guiana, french guiana, paraguay. see [ maps ]\n: british guiana, r. demerana; dutch guiana, paramaribo; french guiana, st. laurient; paraguay\ncryptolechia nitidorella walker, 1864; list spec. lepid. insects colln br. mus. 29: 729; tl: ega\nstenoma notogramma meyrick, 1930; ann. naturhist. mus. wien 44: 243, pl. 1, f. 13; tl: breves, amazon delta\nstenoma notosaris meyrick, 1925; exot. microlep. 3 (5 - 7): 181; tl: brazil, para\ncryptolechia notosemia zeller, 1877; horae soc. ent. ross. 13: 298, pl. 3, f. 86; tl: cundai\nstenoma obtusa meyrick, 1916; exot. microlep. 1 (17): 513; tl: french guiana, st. jean, r. maroni\nstenoma ocellifer walsingham, 1912; biol. centr. - amer. lep. heterocera 4: 162; tl: mexico, durango; costa rica, volcan de irazu, 6000 - 7000ft, guatemala, san gerónimo, 2800ft\nstenoma ogmolopha meyrick, 1930; exot. microlep. 3 (18 - 20): 557; tl: brazil, santarem\nstenoma ogmosaris meyrick, 1915; exot. microlep. 1 (13): 415; tl: british guiana, mallali\nstenoma orgadopa meyrick, 1925; exot. microlep. 3 (5 - 7): 182; tl: brazil, para, parintins\nnew york, new jersey, north carolina, south carolina, west virginia, maryland, district of columbia, massachusetts, pennsylvania, illinois, arkansas, missouri, texas, california. see [ maps ]\nlarva on quercus alba, q. muehlenbergii duckworth, 1964, proc. u. s. nat. mus. 116 (3495): 34\nstenoma ostodes walsingham, 1913; biol. centr. - amer. lep. heterocera 4: 174; tl: guatemala, alta vera paz, panima, 1800ft\nstenoma ovulifera meyrick, 1925; exot. microlep. 3 (5 - 7): 182; tl: peru, jurimaguas\nstenoma oxydecta meyrick, 1915; exot. microlep. 1 (14): 426; tl: british guiana, bartica; mallali\ncryptolechia pallicosta felder & rogenhofer, 1875; reise fregatte novara, bd 2 (abth. 2) (5): pl. 138, f. 41; tl: amazonas\nstenoma paracta meyrick, 1915; exot. microlep. 1 (14): 425; tl: peru, chanchamayo and el porvenir; colombia, san antonio, 5800ft\ncryptolechia particularis zeller, 1877; horae soc. ent. ross. 13: 293, pl. 3, f. 82; tl: chiriqui\naphanoxena pellocoma meyrick, 1915; exot. microlep. 1 (13): 387; tl: british guiana, mallali\nstenoma percnocarpa meyrick, 1925; exot. microlep. 3 (5 - 7): 181; tl: brazil, teffé\nstenoma periphrictis meyrick, 1915; exot. microlep. 1 (15): 451; tl: british guiana, bartica\nstenoma phaeoneura meyrick, 1913; trans. ent. soc. lond. 1913 (1): 187; tl: british guiana\nstenoma phaeoplintha meyrick, 1915; exot. microlep. 1 (14): 424; tl: british guiana, bartica\nphaselodes (meyrick, 1931) (stenoma); exotic microlep. 4 (2 - 4): 39\nstenoma phaula walsingham, 1912; biol. centr. - amer. lep. heterocera 4: 160, pl. 5, f. 26; tl: guatemala, alta vera paz, panima, 1800ft\nstenoma phollicodes meyrick, 1916; exot. microlep. 1 (17): 533; tl: french guiana, st. jean, r. maroni\nstenoma planicoma meyrick, 1925; exot. microlep. 3 (5 - 7): 189; tl: brazil, santarem\nstenoma plumosa busck, 1914; proc. u. s. nat. mus. 47 (2043): 47; tl: trinidad river, panama\nstenoma polyglypta meyrick, 1915; exot. microlep. 1 (14): 427; tl: british guiana, mallali\nstenoma pratifera meyrick, 1925; exot. microlep. 3 (5 - 7): 222; tl: costa rica\nstenoma prosora walsingham, 1912; biol. centr. - amer. lep. heterocera 4: 161, pl. 5, f. 29; tl: panama, chiriqui, volcan de chiriqui, 2000 - 3000ft\nguatemala, panama, ecuador, west indies, british guiana. see [ maps ]\ncatarata pumilis busck, 1914; proc. u. s. nat. mus. 47 (2043): 36; tl: trinidad, panam\npyrgota (meyrick, 1930) (stenoma); exotic microlep. 4 (1): 25\npyrobathra (meyrick, 1931) (stenoma); exotic microlep. 4 (2 - 4): 33\nstenoma quiescens meyrick, 1916; exot. microlep. 1 (17): 514; tl: french guiana, godebert, r. maroni\ncryptolechia radicalis zeller, 1877; horae soc. ent. ross. 13: 286; tl: chiriqui\ncryptolechia reciprocella walker, 1864; list spec. lepid. insects colln br. mus. 29: 731; tl: santarem\npanama, surinam, french guiana, brazil (amazonas, para, bahia), peru. see [ maps ]\nstenoma rhipidaula meyrick, 1915; exot. microlep. 1 (14): 431; tl: british guiana, bartica\nstenoma rostriformis meyrick, 1916; exot. microlep. 1 (17): 532; tl: french guiana, st. jean, r. maroni\nstenoma scapularis meyrick, 1918; exotic microlep. 2 (7): 209; tl: french guiana, r. maroni\nquebec, new york, massachusetts, pennsylvania, delaware, maryland, district of columbia, virgina, north carolina, arkansas, missouri, illinois, iowa, texas, arizona. see [ maps ]\ncryptolechia schlaegeri zeller, 1854; linn. ent. 9: 372; tl: new york\nlarva on quercus alba duckworth, 1964, proc. u. s. nat. mus. 116 (3495): 30\nsciospila (meyrick, 1930) (stenoma); exotic microlep. 4 (2 - 4): 47\nstenoma segmentata meyrick, 1915; exot. microlep. 1 (14): 423; tl: british guiana, mallali\nstenoma similis busck, 1911; proc. u. s. nat. mus. 40 (1815): 222; tl: st. jean, maroni r. , french guiana\nstenoma spermolitha meyrick, 1915; exot. microlep. 1 (14): 432; tl: british guiana, bartica\nstenoma sterrhomitra meyrick, 1925; exot. microlep. 3 (5 - 7): 178; tl: brazil, teffé\nstenoma stigmatias walsingham, 1913; biol. centr. - amer. lep. heterocera 4: 184, pl. 6, f. 29; tl: guatemala, alta vera paz, sabo\nstenoma stygeropa meyrick, 1925; exot. microlep. 3 (5 - 7): 187; tl: brazil, manaos\nstenoma tectoria meyrick, 1915; exot. microlep. 1 (14): 429; tl: british guiana, bartica\nstenoma tempestiva meyrick, 1916; exot. microlep. 1 (17): 529; tl: french guiana, r. maroni\nstenoma tephrodesma meyrick, 1916; exot. microlep. 1 (16): 511; tl: french guiana, r. maroni\nstenoma tetrapetra meyrick, 1925; exot. microlep. 3 (5 - 7): 194; tl: brazil, teffé\nstenoma thylacosaris meyrick, 1915; exot. microlep. 1 (14): 419; tl: british guiana, bartica\nstenoma thomasi barnes & busck, 1920; contr. nat. hist. lepid. n. am. 4 (3): 240, pl. 30, f. 5; tl: palmerlee, arizona\nstenoma tinactis meyrick, 1915; exot. microlep. 1 (13): 414; tl: british guiana, bartica\nstenoma tribomias meyrick, 1915; exot. microlep. 1 (14): 417; tl: british guiana, bartica\ntricapsis (meyrick, 1930) (stenoma); exotic microlep. 4 (1): 26\nstenoma triplectra meyrick, 1915; exot. microlep. 1 (14): 423; tl: british guiana, bartica\nalphanoxena triplintha meyrick, 1916; exot. microlep. 1 (16): 490; tl: french guiana, st. jean, r. maroni\ncryptolechia tripustulella walker, 1864; list spec. lepid. insects colln br. mus. 29: 733; tl: ega\nathleta trisecta walsingham, 1912; biol. centr. - amer. lep. heterocera 4: 155, pl. 5, f. 24\nstenoma tumens meyrick, 1916; exot. microlep. 1 (16): 511; tl: french guiana, st. jean, r. maroni\nbrazil (amazonas), panama, costa rica, british guiana, french guiana. see [ maps ]\ncryptolechia umbriferella walker, 1864; list spec. lepid. insects colln br. mus. 29: 740; tl: ega\nlarva on quercus sp. duckworth, 1964, proc. u. s. nat. mus. 116 (3495): 32\nunisecta (meyrick, 1930) (stenoma); exotic microlep. 4 (1): 26\nstenoma venatum busck, 1911; proc. u. s. nat. mus. 40 (1815): 217; tl: st. jean, maroni river, french guiana\nvenezuelensis amsel, 1956; boletin ent. venezolana 10 (1 - 2): 303\ntexas, florida, mississippi, south carolina, new jersey. see [ maps ]\nvenezuela, panama, trinidad, colombia, french guiana, brazil (para, santa catharina), bolivia, peru. see [ maps ]\nxanthopetala (meyrick, 1931) (stenoma); exotic microlep. 4 (2 - 4): 41\nstenoma xylurga meyrick, 1913; trans. ent. soc. lond. 1913 (1): 188; tl: peru, chanchamayo\nstenoma zanclogramma meyrick, 1915; exot. microlep. 1 (14): 417; tl: british guiana, bartica\nstenoma zelotes walsingham, 1912; biol. centr. - amer. lep. heterocera 4: 159; tl: mexico, guerrero, amula, 6000ft\n[ afromoths ] de prins, j. & de prins, w. , 2013\nsangmi lee, richard brown & sibyl bucheli. gelechioidea - a global framework ;\n[ maps ] warning! the maps are automatically generated from the textual information, and the process does not always produce acceptable result; see about maps for more info .\nreise der österreichischen fregatte novara um die erde in den jahren 1857, 1858, 1859 unter den behilfen des commodore b. von wüllerstorf - urbair. zoologischer theil. band 2. abtheilung 2. lepidoptera. rhopalocera\n- 120, (inhalts - verz .) 1 - 9 (pl. 1 - 74), (felder & rogenhofer, 1874), (5): pl .\nergebnisse einer zoologischen sammelreise nach brasilien, insbesonderer in das amazonasgebiet, ausgeführt von dr. h. zerny. v. theil. micro - lepidoptera\ndelectus animalium articulatorum que in itinere per brasilian collegerunt dr. j. b. de spix et dr. c. f. ph. de martius\nnatuurlijke historie van surinaamsche vlinders, naar het leven geteekend. papillons de surinam dessinés d' après nature\n( 13): i - viii, 105 - 108, pl. 49 - 50 ([ 1843 ]) ,\n( 25): i - iv, 217 - 224, pl. 97 - 100 ([ 1847 ]) ,\n( 38): i - viii, 321 - 328, pl. 149 - 152 ([ 1852 ] )\nzeller, 1877 exotische microlepidopteren horae soc. ent. ross. 13: 3 - 493, pl. 1 - 6\nif you have corrections, comments or information to add into these pages, just send mail to markku savela keep in mind that the taxonomic information is copied from various sources, and may include many inaccuracies. expert help is welcome .\nconfused by a class within a class or an order within an order? please see our brief essay .\nto cite this page: myers, p. , r. espinosa, c. s. parr, t. jones, g. s. hammond, and t. a. dewey. 2018. the animal diversity web (online). accessed at https: / / animaldiversity. org .\ndisclaimer: the animal diversity web is an educational resource written largely by and for college students. adw doesn' t cover all species in the world, nor does it include all the latest scientific information about organisms we describe. though we edit our accounts for accuracy, we cannot guarantee all information in those accounts. while adw staff and contributors provide references to books and websites that we believe are reputable, we cannot necessarily endorse the contents of references beyond our control .\nthis material is based upon work supported by the national science foundation grants drl 0089283, drl 0628151, due 0633095, drl 0918590, and due 1122742. additional support has come from the marisla foundation, um college of literature, science, and the arts, museum of zoology, and information and technology services .\nbiokids is sponsored in part by the interagency education research initiative. it is a partnership of the university of michigan school of education, university of michigan museum of zoology, and the detroit public schools. this material is based upon work supported by the national science foundation under grant drl - 0628151. copyright © 2002 - 2018, the regents of the university of michigan. all rights reserved .\nhtml public\n- / / w3c / / dtd html 4. 01 transitional / / en\nurltoken\nnote: you should have a urltoken account to upload new topics and comments. please, create an account or log in to add comments\n* our website is multilingual. some comments have been translated from other languages .\nthere are no photos of this species on the website yet. you can offer your photo by logging into your account\ncurators: konstantin efetov, vasiliy feoktistov, svyatoslav knyazev, evgeny komarov, stan korb, alexander zhakov .\nspecies catalog enables to sort by characteristics such as expansion, flight time, etc. .\na taxon identifier is composed of name, author, year and attribute, all separated by a blank. these are all extracted from the original publication .\nthe name is reproduced exactly as proposed in the original publication. the name of a genus is made up of one word and species made up of two words (genus and species) separated by a blank .\nthe author' s name is made up of a string of letters, with no blanks, and multiple authors' names are separated by a comma. spelling of author' s name is based on the original publication. if there are more than three authors, only the names of the first two authors are shown, followed by\n, +\nand the number of omitted authors .\nattribute is enclosed in square brackets. this is rarely needed, but to differentiate homo - identifiers, this will contain the page, line or plate number of original publication .\nall diacritic marks, hyphens, and apostrophes are eliminated, thus only the following characters are used: a to z, a to z, 0 to 9, blank, comma, and opening and closing square brackets. although upper and lower cases are used for the convenience of human recognition, it is not case sensitive .\ncreated by dicky sick ki yu 1997 - 2012 please send me information about errors and omissions (contact information) with supporting references, possibly with pdf or hard copy .\nhtml public\n- / / w3c / / dtd xhtml 1. 0 transitional / / en\nurltoken\nagonoxeninae amblytenes meyrick, 1930 lunatica meyrick, 1930 anchimompha clarke, 1965 melaleuca clarke, 1965 auxotricha meyrick, 1931 ochrogypsa meyrick, 1931 homoeoprepes walsingham, 1909 homeoprepes hodges, 1978, missp. felisae clarke, 1962 sympatrica clarke, 1962 trochiloides walsingham, 1909 microcolona meyrick, 1897 transennata meyrick, 1922 nanodacna clarke, 1964 ancora clarke, 1964 indiscriminata clarke, 1965 logística (meyrick, 1931) (colonophora) vinacea (meyrick, 1922) (homaledra) nicanthes meyrick, 1928 rhodoclea meyrick, 1928 pammeces zeller, 1863 albivitella zeller, 1863 citraula meyrick, 1922 crocoxysta meyrick, 1922 lithochroma walsingham, 1897 pallida walsingham, 1897 phlogophora walsingham, 1909 problema walsingham, 1915 panclintis meyrick, 1929 socia meyrick, 1929 prochola meyrick, 1915 aedilis meyrick, 1915 agypsota meyrick, 1922 basichlora meyrick, 1922 catacentra meyrick, 1917 chloropis meyrick, 1922 euclina meyrick, 1922 fuscula forbes, 1931 holomorpha meyrick, 1931 obstructa meyrick, 1915 ochromicta meyrick, 1922 oppidana meyrick, 1915 orphnopa meyrick, 1922 orthobasis meyrick, 1922 pervallata meyrick, 1922 prasophanes meyrick, 1922 revecta meyrick, 1922 semiabata meyrick, 1922 sollers meyrick, 1917 subtincta (meyrick, 1922) (syntetrernis) syntentrernis meyrick, 1922 neocompsa meyrick, 1933 xiphodes meyrick, 1922 tocasta busck, 1912 priscella busck, 1912 zaratha walker, 1864 macrocera r. felder & rogenhofer, 1875 mesonyctia meyrick, 1909 pterodactylella walker, 1864 nivelventris r. felder & rogenhofer, 1875" ]
{ "text": [ "antaeotricha binubila is a moth in the depressariidae family .", "it was described by philipp christoph zeller in 1854 .", "it is found in brazil ( amazonas ) and surinam .", "the wingspan is 24-25 mm .", "the forewings are white , the dorsal half suffused with whitish-fuscous .", "there are two suffused transverse dark fuscous blotches on the dorsum in the middle and towards the tornus , reaching nearly half across the wing , the apex of the second giving rise to a short inwardly oblique streak of faint fuscous suffusion .", "a faint curved inwardly oblique fuscous shade from the tornus is more or less indicated for about half the breadth of the wing , in males continued by two or throe faint dots directed towards three-fourths of the costa .", "two or three fuscous marginal dots are found around the apex .", "the hindwings in males are whitish tinged with grey on the posterior half , in females light grey or whitish .", "the costal margin in males is somewhat expanded to beyond the middle , with moderate projection of hairscales suffused with grey beneath , and a long whitish subcostal hairpencil lying beneath the forewings . " ], "topic": [ 2, 5, 20, 9, 1, 1, 1, 1, 1, 1 ] }
"antaeotricha binubila is a moth in the depressariidae family. it was described by philipp christoph zeller in 1854. it is found in brazil (amazonas) and surinam. the wingspan is 24-25 mm. the forewings are white, the dorsal half suffused with whitish-fuscous. there are two suffused transverse dark fuscous blotches on the dorsum in the middle and towards the tornus, reaching nearly half across the wing, the apex of the second giving rise to a short inwardly oblique streak of faint fuscous suffusion. a faint curved inwardly oblique fuscous shade from the tornus is more or less indicated for about half the breadth of the wing, in males continued by two or throe faint dots directed towards three-fourths of the costa. two or three fuscous marginal dots are found around the apex. the hindwings in males are whitish tinged with grey on the posterior half, in females light grey or whitish. the costal margin in males is somewhat expanded to beyond the middle, with moderate projection of hairscales suffused with grey beneath, and a long whitish subcostal hairpencil lying beneath the forewings."
[ "antaeotricha binubila is a moth in the depressariidae family. it was described by philipp christoph zeller in 1854. it is found in brazil (amazonas) and surinam. the wingspan is 24-25 mm. the forewings are white, the dorsal half suffused with whitish-fuscous. there are two suffused transverse dark fuscous blotches on the dorsum in the middle and towards the tornus, reaching nearly half across the wing, the apex of the second giving rise to a short inwardly oblique streak of faint fuscous suffusion. a faint curved inwardly oblique fuscous shade from the tornus is more or less indicated for about half the breadth of the wing, in males continued by two or throe faint dots directed towards three-fourths of the costa. two or three fuscous marginal dots are found around the apex. the hindwings in males are whitish tinged with grey on the posterior half, in females light grey or whitish. the costal margin in males is somewhat expanded to beyond the middle, with moderate projection of hairscales suffused with grey beneath, and a long whitish subcostal hairpencil lying beneath the forewings." ]
"animal-train-19"
"animal-train-19"
"2670"
"muticaria"
[ "no one has contributed data records for muticaria brancatoi yet. learn how to contribute .\nfurther information: the door snail species found on the maltese isands is endemic and protected. it is often found in rock cavities and cracks near damp areas or valleys. it is categorised in the family clausiliidae. there were 4 subspecies described but they were later found through genetical study to be the same and do not merit any taxonomical importance (except perhaps of forms). these 4 mentioned subspecies were muticaria macrostoma macrostoma (cantraine, 1835); muticaria macrostoma scalaris (pfeiffer, 1848); muticaria macrostoma oscitans (charpentier, 1852); muticaria macrostoma mamotica (gulia, 1861). the specimens photographed here were from wied ta' zieta, limits of victoria, gozo (2009) .\nbeckmann, k. - h. 1990. beiträge zur kenntnis der landmolluskenfauna siziliens mit der beschreibung von muticaria neuteboomi spec. nov. (gastropoda pulmonata: clausiliidae). - basteria 54 (1 / 3): 75 - 85. leiden .\noriginal spelling was clausilia macrosoma, the spelling macrostoma is an unjustified emendation. but the spelling macrosoma has never been used, in 2007 there were about 100 google hits for muticaria - macrostoma and none for muticaria - macrosoma. the spelling macrosoma should be officially suppressed. code art. 33. 3. 1 allows us preliminarily to use the spelling macrostoma. no subspecies recognized by giusti et al. 1995 after their detailed study. references: westerlund 1884: 166 (considered as a snyonym of cl. syracusana), giusti et al. 1995: 348, sammut [ 2006 ]: urltoken (12 / 2006), welter - schultes 2012: 333 (range map) .\ncolomba, m. s. , reitano, a. , liberto, f. , giglio, s. , gregorini, a. & sparacio, i. , 2012. additional data on the genus muticaria lindholm, 1925 with description of a new species (gastropoda pulmonata clausiliidae). biodiversity journal, 3: 251 - 258. accessible here\nfor muticaria macrostoma a number of subspecific taxa have been described: m. m. oscitans, m. m. scalaris and m. m. mamotica (beckmann 1987). giusti et al. (1995) did not follow any subspecific ranking while bank (2013) again considered the subspecific taxa in his checklist. for a complete review of the m. macrostom a subspecies see giusti et al. (1995: 356 and following) .\nphilippi, r. a. 1836. enumeratio molluscorum siciliæ cum viventium tum in tellure tertiaria fossilium, quae in itinere suo observavit. [ vol. 1 ]. - pp. i - xiv [ = 1 - 14 ], 1 - 267, [ 1 ], tab. i - xii [ = 1 - 12 ]. berolini. (schropp) .\nshell usually decollated with 5 - 7 whorls remaining in adult shells, grey with brownish hue and white ribs, cervix with prominent basal keel, apertural margin detached and slightly protruded, columellaris weak, oblique and s - shaped, 3 short palatal folds present between suture and lunula, instead of a principalis, the lowest one connected to frontal upper palatalis, parallelaris prominent, lunula strong, dorsal and not connected to subcolumellaris. shells near siracusa are more slender, less densely ribbed and have a small gap between frontal upper palatalis and lowest principalis .\ncantraine, f. 1835. les diagnoses ou descriptions succintes de quelques espèces nouvelles de mollusques. - bulletins de l' académie royale des sciences et belles - lettres de bruxelles (1) 2 (11): 380 - 401 .\n12 - 19 (decollate down to 8 mm) x 3. 5 - 6 mm\non limestone rocks and rdum. usually in crevices or in vegetation near rocks, sometimes also under stones, in rick rubble and in rubble walls surrounding cultivated and abandoned fields .\nhtml public\n- / / w3c / / dtd xhtml 1. 0 strict / / en\nurltoken\nthank you for taking the time to provide feedback on the iucn red list of threatened species website, we are grateful for your input .\nbeckmann k. h. 1987. land - und süßwassermollusken maltesische inseln. heldia 1 (sonderheft 1): 1 - 38 .\nthis species is endemic to the maltese islands. the currently known extent of occurrence (eoo = 300 km²) is restricted, however the species is known from many localities and it is common and widespread all over its distributional range. population, habitat, eoo or aoo trends are known to be stable. only local\nsubspecies\nor morphs could be threatened by human activities or stochastic events but the species as a whole is not globally threatened. it is therefore assessed as least concern. the morph scalaris has a distribution of less than 1 km², and forma mamotica has a distribution of a few hundred square meters. form scalaris is not currently seriously threatened while forma mamotica could be threatened by building works in xlendi valley. subpopulations belonging to formae oscitans and macrostoma are abundant and not threatened .\nthe species is endemic to the maltese islands except for the island of fifla. it is common and widespread along its distribution range .\nthe present species is common and widespread all over the maltese islands. the populations consist of large numbers of mature individuals. the population trend is considered to be stable .\nthis species is found in rocky areas with garigue or steppe vegetation, coralline limestone karstland, drum edges and sides and the boulders screes at their bases. it is also found at the edges and sides of the steeper valleys cut in coralline rocks .\nonly local subspecies or morphs could be threatened by human activities or stochastic events, but the species as a whole is not globally threatened. some morphs have very restricted distributions, such as scalaris, (eoo; 1 km 2) and mamotica (eoo of a few hundred square metres). form scalaris is not currently seriously threatened while forma mamotica could be threatened by building works in xlendi valley. subpopulations belonging to formae oscitans and macrostoma are abundant and not threatened .\nsome population are in protected areas but there is not a global conservation project currently implemented. research upon the biology, ecology, distribution and threats to this species is suggested .\nto make use of this information, please check the < terms of use > .\nbank, r. (2017). classification of the recent terrestrial gastropoda of the world. last update: july 16th, 2017. [ details ]\n( of lamellifera monterosato, 1892) bank, r. (2017). classification of the recent terrestrial gastropoda of the world. last update: july 16th, 2017. [ details ]\nsp. nov. from south sumatra is described in this paper. it is compared with its closest congeners, from which it is geographically and reproductively isolated .\ncilia, d. p. & abbas, j. , 2012. a new species of hemiplecta albers, 1850 (gastropoda, pulmonata, ariophantidae) from sumatra, indonesia. biodiversity journal, 3 (2): 137 - 144. accessible here\na cluster of brachidontes pharaonis (fischer, 1870) from a globigerina limestone location on the ta' xbiex shore. barnacles, patellids, chitons and coralline algae are also visible .\ncilia, d. p. & deidun, a. , 2012. branching out: mapping the spatial expansion of the lessepsian invader mytilid brachidontes pharaonis around the maltese islands. marine biodiversity records, 5 (e28): 1 - 8. doi link\nthe invasive melanoides tuberculata (müller, 1774), a freshwater and brackish water snail, is reported from mosta and baħrija in malta. shells from these populations are morphologically distinct from a population at salini first recorded in 1981 .\nshells of melanoides tuberculata from malta - specimens from baħrija, mosta and salini .\ncilia, d. p. , sciberras a. & sciberras j. , 2012. two non - indigenous populations of melanoides tuberculata (müller, 1774) (gastropoda, cerithioidea) in malta. malaco, 9: 4 pp. accessible here\na new species of olivid neogastropod from west java, agaronia johnabbasi sp. nov. , is described according to conchological characters. it is distinguished from congeners by means of its distinctive morphology and colouration .\nagaronia johnabbasi cilia, 2012 (left specimen). for comparison - agaronia johnkochi voskuil, 1990 (middle specimen) and agaronia nebulosa (lamarck, 1811) (right specimen). all specimens are from west java (pangandaran bay) .\ncilia, d. p. , 2012. a new javan species of agaronia gray, 1839 (neogastropoda, olividae). novapex, 13 (1): 33 - 36 .\nthe second species is a slug, tandonia marinellii liberto, colomba, giglio & sparacio, 2012. the description is included in a paper which also mentions the first finds of rumina saharica pallary, 1901 from sicily, for which specimens collected by myself from the island of marettimo were examined .\nliberto, f. , giglio, s. , colomba, m. s. & sparacio i. , 2012. new and little known land snails from sicily (mollusca gastropoda). biodiversity journal, 3: 199 - 226. accessible here\nphalaenopsis is a very popular orchid genus originating from southeast asia, with several horticultural varieties. the fine specimen above was photographed in puerto de la cruz, in tenerife .\nlast friday saw the launch of the 4th volume of esm' s excellent series of papers dealing with, as the name of the society implies, the entomology of the maltese islands and their biogeographic context. the event was held under the patronage of his excellency dr. george abela, and three society members (including its chairman) delivered short speeches on the importance of scientific research, peer reviews, funding and the maintenance of high publication standards .\nthe scope of the talks ranged from the general, all - encompassing importance of works by luminaries such as max planck and thomas kuhn, to the specialized methodologies employed by scientists dealing in what the public may perceive as the\ndinja stramba ta' dud, nemel u nsetti oħra\n( lit. strange world of bugs, ants and other insects) .\non to the main issue at hand - and its contents. this collection contains :\ndr. david mifsud entomological society of malta p. o. box 9 marsa, mrs1000 malta\ninvariably translates to the drab affair shown below, copied and pasted from my own blog .\non the other hand, custom - built generators such as urltoken allow users to tweak fonts and designs according to personal taste (or lack thereof) to achieve far more interesting, attention - grabbing layouts. here' s one i finished earlier, in true pop - art abandon (click on image for a larger view) .\npalms are a common sight in malta, with the warm temperatures affecting the islands throughout most of the year being a perfect catalyst for their growth and proliferation. this said, indigenous species amount to just one - the low - growing, bushy chamaerops humilis l. , now practically extinct in the wild .\nnorth african species that may be distinguished by leaves arranged in wide silvery fronds. the picture beneath shows this species of palm affected by the\nchabaud is a canarian endemic which is frequently planted around the mediterranean, not least in malta. unfortunately it is also affected by the weevil in question and several stately specimens from around the island have been destroyed .\nthe 374th anniversary of birth of the' father of geology' nicolaus stensen, better known by his latinized name nicolas steno, is commemorated today on google with a doodle showing a stylized stratigraphic section similar to what he may have encountered to come up with his conclusions .\nsteno was featured on this blog together with his contemporary agostino scilla in a post from 2010 .\njuniper, yew, spruce and other specimens with textbook shown below, for observation during a lesson. photos taken at the základní škola lesní (an elementary school in liberec, the czech republic) .\na group of 27 biology teachers from church schools recently attended a week - long course in field biology jointly organised by the university’s department of biology and the curia’s secretariat for education at the university .\nit is widely recognised that the teaching of biology is most enriching and interesting for students when the learning process takes place ‘outside the classroom’ and in a ‘real world’ setting .\nthe course consisted of lectures, fieldwork and laboratory sessions, with a focus on the maltese environment. during the week, participants had the opportunity to put theoretical knowledge into practice through planning and preparation for fieldwork, surveying, sampling and data collection, and processing of the data collected .\nduring the shore ecology fieldwork, held on the għallis coast, participants identified flora and fauna that inhabit rocky shores, and collected data on the abundance of selected fauna. during the terrestrial ecology fieldwork, held at clapham junction and buskett, participants observed typical mediterranean vegetation communi­ties: garigue, steppe, maquis, and woodland .\nthe knowledge and applications learnt during the marine and terrestrial fieldwork sessions was synthesised during a site visit to għajn tuffieħa .\na variety of habitats was explored there, ranging from banquettes of posidonia oceanica wrack deposited on the sandy beach, to the terrestrial boulder scree that constitutes the typical maltese rdum habitat .\nthe lectures, field and laboratory sessions were led by joseph borg, patrick schembri and sandro lanfranco from the university’s biology department .\nl .), both of which have been traditionally used for food and medicine by settlers all over europe. further into the forest, as shade and shelter become predominant, ferns and mosses cover most of the clearing and make use of the abundant leaf litter .\nconifers of the area include pines (pinus sylvestris l .) and spruce (picea abies (l .) h. karst), sometimes bearing evidence of food - seeking woodpeckers on their old trunks. angiosperms such as beech (fagus sylvatica l .) are also common, with their deceased offering an excellent resource for several fungal specimens .\n( linnaeus, 1758) are two beautiful and conspicuous butterflies found within the forest and elsewhere .\nlinnaeus, 1758 was a surprising find, and one of the very few vertebrates making an appearance on the day .\nthis is just what you need to kill sinister sinistrals and restore your snail population to one made up of normal, dextral pests .\n, but what should have been a casual glance inside an antiques shop in santa cruz necessitated some brushing up on the matter. i could not resist leaving this singular item to gather dust on a shelf unless that shelf was mine .\na defunct (?) match factory in las palmas (capital city of gran canaria), fosforera canariense, produced this nice set of 24 matchboxes sometime last century after its foundation in 1935. information regarding such items is hard to come by, on - and - offline, therefore not much more is known at this stage .\n( marine snails) and features 24 species of molluscs (inexplicably consisting of one bivalve and 23 predominantly tropical, not - all - marine, gastropods) heavily inked onto a pale blue background. the way they are packaged makes it impossible to see what is on the hidden side of each matchbox, and where, presumably, the species identifications are printed .\nnow, i am sorely tempted to tear open the polythene covering holding the set together in order to read them; on the other hand, doing so will detract from the neatness and value of the boxed set. i' m a stickler for' accurate' identification (as opposed to mere\netc .) but these cardboard versions will have to remain a mystery, at least until curiosity gets the upper hand .\nthe 12th century legend goes that a turkish pirate by the name of ħassan, madly in love with a beautiful maltese girl, abducted her and to ...\nthis blog has been featured in a post on the nature blog network. the site features several interesting links and is strongly recommended ...\na cantareus aspersus (müller, 1774) going about its daily business. photo taken in mqabba .\nthe vast majority of sharks and rays frequenting maltese waters are innocuous to humans, and even the largest of them is a timid filter - feed ...\ninsular gigantism is an evolutionary process that leads to individuals in a population becoming progressively larger in size than their anc ...\ndorothea bate (1878 - 1951) was a british explorer and palaeontologist whose main interests were mediterranean pleistocene mammals. the first ...\nthe picture above shows a fossil skull of the miocene crocodilian tomistoma gaudensis (hulke, 1871) from the globigerina limestone of gozo ...\nthe highest cliffs in the volcanic island of tenerife, in the atlantic ocean, are found on its western side. these majestic geological featu ...\nthis beautiful reptile, from the qbajjar area in western gozo, is a juvenile specimen of the western whip snake, hierophis viridiflavu ...\nthe ariophantid hemiplecta belerang sp. nov. from south sumatra is described in this paper. it is compared with its closest congeners, from ...\nrescue operations to free 12 boys together with their soccer coach from the tham luang cave in thailand are underway but could take days to complete. the g ...\nlast wednesday i received an email from mike cole of cole ecological, forwarded by our good buddy tim pearce. attached to mike’s message was the jpeg bel ...\ni have set this posting for exactly 10 years from the first posting on blogger at 9: 18 am eastern time july 9, 2008. my motivation was to learn more about ...\nin an earlier post, i introduced you all to the fusulinids, a group of complex foraminiferans that were abundant during the later palaeozoic. in that post, ...\nthe lancet fluke (* dicroceolium dendriticum *) is one of the most well - known and oft - cited example of parasite host manipulation. but in most people' s mind, ...\nphoto by karen osborn so, every july 1st is the, now posthumous, birthday of nmnh curator kristian fauchald, who was one of the most prolific taxonomists p ...\non the heals of being inspired at # scifoo at googlex, i’m a little fired up. monday morning at the american library association meeting–after flight delay ...\n* female double - eyed fig - parrot * opopsitta diophthalma *, copyright aviceda. * * belongs within: * loriinae. * opopsitta *, the fig - parrots, is a genus of small, ...\nthere are a lot of cases where you may need the help of a committed locksmith so it is of utmost importance that you have the contact number of a reliable ...\nred - legged pademelons (* thylogale stigmatica *) are not sociable animals, but they put up with each other. but every now and then, especially towards the en ...\nmichaux, françois - andré. * the north american sylva *. v. 1 (1853). digitized by smithsonian libraries. urltoken * the north american sylva * i ...\nat 10: 15 this morning i deactivated my facebook account. i’ve had the account for over a decade. no more. i can no longer in good conscience participate in ...\nwe' ve switched over to a wordpress site! litc 2. 0 can be found at chasmosaurs. com. please update your rss feeds accordingly. this site will stay as - is fo ...\nthis list will be updated as regularly as possible. cricket radio: tuning in the nightsinging insects bug music\nla cochinilla ciega de la palma (* halophiloscia microphthalma *) procede de un ancestro extinto recientemente se acaba de publicar un excelente trabajo sobr ...\nsciberras, a. & sciberras, j. (2014) conservation of maltese landraces the times, december 13th: 6 .\nit' s been quite the academic year. the spring semester is now finished and final grades are just about finished. summer research is gearing up and i' ve got ...\ni don' t know if anybody out there is still following, but i am now writing at the lord geekington (wordpress) and biological marginalia (tumblr). some of t ...\nas part of the european heritage days, which this year will carry the theme “heritage built in stone”, heritage malta will be holding an open day of the ne ...\ngiant fanged death maggots that spit glowing green snot, plus epically bad 1970s couture .\nthe 15th meeting of the mid - atlantic malacologists took place yesterday at the delaware museum of natural history (dmnh) in wilmington, delaware. i counted ...\n[ image: the times logo ] thursday, january 31, 2013 by matthew xuereb, juan ameen both leaders pledge to solve armier problem [ image: the boathouses on publi ...\n* on fishermen and the charcoal factory * * a small trawler boat crusing by the mangroves of matang. * * a view of kuala sepetang fishing village. * afternoon s ...\ni haven' t posted in a while. this is for two reasons, one of which is very exciting: 1) getting adjusted to graduate school has been very consuming and... ...\nthought of sharing this funny picture with you this week. here' s a cat who decided to have a nap in one of the kids' play castles .\n( c) david p. cilia 2007 - 2011. awesome inc. theme. powered by blogger .\nhtml public\n- / / w3c / / dtd html 4. 01 transitional / / en\nall material and data on this webpage is under the copyright of the author of this site - stephen mifsud / urltoken / malta. (2002 - 2010 )\neol content is automatically assembled from many different content providers. as a result, from time to time you may find pages on eol that are confusing .\nto request an improvement, please leave a comment on the page. thank you !\nto receive our reports (print and / or electronic) and quarterly e - newsletter .\ncookies are not enabled. you must enable cookies before you can log in .\nthe main focus of the eunis species component is to provide relevant information about the european species protected by directives, conventions and agreements. the species assessed in the european red lists prepared by the iucn for the european commission are also included .\nthe distribution map is currently disabled. a new map solution will soon become available. in the meantime, please consult other species distribution map providers listed in the other resources panel below .\ntemplate updated on 09 may 2018 14: 41 from version 18. 4. 26\nthe european environment agency (eea) is an agency of the european union. legal notice\nwe use cookies to record some preference settings and to analyse how visitors use our web site. cookies do not contain any personal information about you. if you wish, see how to delete / disable cookies in your web browser. see also our privacy policy .\nsorry, preview is currently unavailable. you can download the paper by clicking the button above .\nenter the email address you signed up with and we' ll email you a reset link .\nthe family hydrobiidae is a large group of small snails with gills (not lungs) living in aquatic habitats, predominantly fresh and brackish. four representatives are found in the maltese islands, the largest of which is the freshwater\nis rare in malta but rather more frequent in gozo. colonies graze microscopic algae growing on submerged or perennially wet overhangs, and seem to prefer running, clear water. the blue - greyish shell, large shell size and habitat distinguishes it from a similar species ,\n( calcara, 1841), which will be discussed in a future post .\n* in taxonomy, a' cf.' indicates uncertainty in assigning a specific epithet to a specimen. the uncertainty in this case derives from anatomical differences between maltese\n( sowerby, 1847) is the only snail with an operculum (' door') which is native to the maltese islands. under a' biological species definition' it may be considered to be a local variety of\n( draparnaud, 1805), which also occurs in sicily; pfenninger et al. (2010) *, in their work on the dna of\nthe shell is very variable, and may be orange, white or purple, with or without bands .\n* pfenninger, m. , véla, e. , jesse, r. , arantzazu elejalde, m. , liberto, f. , magnin, f. , martínez - ortí, a. , 2010. temporal speciation pattern in the western mediterranean genus\np. fischer, 1885 (gastropoda, pomatiidae) supports the tyrrhenian vicariance hypothesis .\ndiffers from m. syracusana only in its shell shape (less slender), denser ribs and relationship between principalis and frontal upper palatalis. m. syracusana has 3 folds between lunula and suture (frontal upper palatalis and 2 sutural folds, the frontal upper palatalis running in a curve towards the apertural magin), in neuteboomi there are 3 sutural folds above the upper end of the lunula, the frontal upper palatalis begins as a 4th fold slightly in front of the upper end of the lunula (close to the lowest sutural fold) and runs straightly towards the aperture .\nin a rocky area with caved carved into the walls, 250 m altitude .\nthe encyclopedia of world problems and human potential is a collaboration between uia and mankind 2000, started in 1972. it is the result of an ambitious effort to collect and present information on the problems with which humanity is confronted, as well as the challenges such problems pose to concept formation, values and development strategies. problems included are those identified in international periodicals but especially in the documents of some 60, 000 international non - profit organizations, profiled in the yearbook of international organizations .\nthe encyclopedia includes problems which such groups choose to perceive and act upon, whether or not their existence is denied by others claiming greater expertise. indeed such claims and counter - claims figure in many of the problem descriptions in order to reflect the often paralyzing dynamics of international debate. in the light of the interdependence demonstrated among world problems in every sector, emphasis is placed on the need for approaches which are sufficiently complex to encompass the factions, conflicts and rival worldviews that undermine collective initiative towards a promising future .\nthe union of international associations (uia) is a research institute and documentation centre, based in brussels. it was established in 1907, by henri la fontaine (nobel peace prize laureate of 1913), and paul otlet, a founding father of what is now called information science .\nnon - profit, apolitical, independent, and non - governmental in nature, the uia has been a pioneer in the research, monitoring and provision of information on international organizations, international associations and their global challenges since 1907." ]
{ "text": [ "muticaria is a genus of small , air-breathing land snails , terrestrial pulmonate gastropod mollusks in the family clausiliidae , the door snails , all of which have a clausilium . " ], "topic": [ 11 ] }
"muticaria is a genus of small, air-breathing land snails, terrestrial pulmonate gastropod mollusks in the family clausiliidae, the door snails, all of which have a clausilium."
[ "muticaria is a genus of small, air-breathing land snails, terrestrial pulmonate gastropod mollusks in the family clausiliidae, the door snails, all of which have a clausilium." ]
"animal-train-20"
"animal-train-20"
"2671"
"xiphopenaeus"
[ "explore what eol knows about xiphopenaeus kroyeri (c. heller, 1862) .\natlantic seabob - xiphopenaeus kroyeri (c. heller, 1862) - overview - encyclopedia of life\ngusmão j, lazoski c, monteiro fa and solé - cava am. 2006. cryptic species and population structuring of the atlantic and pacific seabob shrimp species, xiphopenaeus kroyeri and xiphopenaeus riveti. mar biol 149: 491 - 502. [ links ]\nxiphopenaeus kroyeri (c. heller, 1862) – atlantic seabob, seabob, camarón siete barbas, crevette seabob (de l' atlantique )\nxiphopenaeus kroyeri. average growth curve (middle) estimated for males from ubatuba region sampled from january 2000 to june 2003, based on von bertalanffy’s growth model. outer curves: 95% confidence interval .\nxiphopenaeus kroyeri. average growth curve (middle) estimated for females from ubatuba region sampled from january 2000 to june 2003, based on von bertalanffy’s growth model. outer curves: 95% confidence interval .\nxiphopenaeus kroyeri. carapace length (cl) frequency histograms of males and females in the ubatuba bay from january 2000 and june 2003. lines represent the cohorts followed during the study period to describe individual growth .\nxiphopenaeus kroyeri. spatial variation of the abiotic factors (temperature, salinity and phi) and mean number (individuals per trawl set) of reproductive females and recruits from each bay sampled, from january 1998 to june 2003 .\ncastro rh, costa rc, fransozo a and mante - latto flm. 2005. population structure of the seabob shrimp xiphopenaeus kroyeri (heller, 1862) (crustacea: penaeoidea) in the littoral of são paulo, brazil. sci mar 69 (4): 105 - 112. [ links ]\n( of xiphopenaeus hartii smith, 1869) pérez farfante, i. ; kensley, b. (1997). penaeoid and sergestoid shrimps and prawns of the world. keys and diagnoses for the families and genera. mémoires du muséum national d’histoire naturelle. 175: 1 - 233. [ details ]\nfransozo a, costa rc, pinheiro maa, santos s and mantelatto flm. 2000. juvenile recruitment of the seabob xiphopenaeus kroyeri (heller, 1862) (de - capoda, penaeidea) in the fortaleza bay, ubatuba, sp, brazil. nauplius 8 (2): 179 - 184. [ links ]\ncosta rc, fransozo a, freire fam and castilho al. 2007. bundance and ecological distribution of the\nsete - barbas\nshrimp xiphopenaeus kroyeri (heller, 1862) (decapoda: penaeoidea) in three bays of the ubatuba region, south - eastern brazil. gulf caribbean res 19: 33 - 41. [ links ]\nxiphopenaeus kroyeri (heller, 1862) is widely distributed in the western atlantic (virginia, usa, to rio grande do sul, brazil) and the eastern pacific (mexico to peru) (pérez - farfante and kensley 1997). however, recently, gusmão et al. (2006) demonstrated through molecular data that x. kroyeri is distributed only in the atlantic, while xiphopenaeus riveti occurs in the pacific. x. kroyeri is the second most important fishery resource in abundance in the southeastern brazil, and is the most heavily exploited benthic shrimp species on the coast of the state of são paulo (d' incao et al. 2002, castro et al. 2005) .\nxiphopenaeus kroyeri. temporal variation in mean abundance (catch per unit effort) of reproductive females (unfilled bars), recruits, (dashed line) and means of bottom water temperature (solid line) during january 1998 to june 2003. error bars represent standard errors of means abundance (reproductive females and recruits) and standard deviation of mean temperature .\nantonio l. castilho, raymond t. bauer, fúlvio a. m. freire, vivian fransozo, rogério c. costa, raphael c. grabowski, adilson fransozo; lifespan and reproductive dynamics of the commercially important sea bob shrimp xiphopenaeus kroyeri (penaeoidea): synthesis of a 5 - year study, journal of crustacean biology, volume 35, issue 1, 1 january 2015, pages 30–40, urltoken\nxiphopenaeus kroyeri is a benthic species that ranges from the continental shelf of the western atlantic from north carolina (usa) to the state of rio grande do sul (brazil) and is most abundant at depths up to 30 m (boschi, 1963; iwai, 1973; holthuis, 1980; santos and ivo, 2000). the species spends its entire life cycle in the same environment, and it does not depend on estuaries for the development of juveniles (holthuis, 1980; castro et al. , 2005) .\nxiphopenaeus kroyeri (heller, 1862) has a wide geographical range throughout the western atlantic ocean, from cape hatteras, nc, usa to southern brazil (state of rio grande do sul) (costa et al. , 2007). of the various species targeted by southern brazilian fisheries, the sea bob shrimp is among the most important, and by weight is one of the top ten penaeoid - shrimp species taken worldwide in the commercial shrimp fisheries (d’incao et al. , 2002; silva et al. , 2013) .\nin brazil, x. kroyeri is one of the most important resources for the fishing industry and for the community structure of coastal marine species. the species was the primary crustacean caught in 2010 and represented 26. 7% of the total commercial catch of crustaceans reported in the country (mpa, 2012). xiphopenaeus kroyeri is caught throughout the coastal region, particularly along the subtropical shelves (ibama, 1993; dias neto and dornelles, 1996; paiva, 1997; ibama, 2008). furthermore, x. kroyeri represents the lowest trophic level among the commercially exploited species in this region (vasconcelos and gasalla, 2001) .\npenaeid shrimp are of great importance for coastal fisheries worldwide. the high commercial value of these shrimp and their distribution along continental shelves make them highly vulnerable to fishing, which has led to the overexploitation of most of these resources. currently, penaeid shrimp are considered to be the most valuable fishing commodity in the global market (gillett, 2008). fishing of the atlantic seabob, xiphopenaeus kroyeri (heller, 1862), warrants special attention because, among the top ten exploited shrimp species, x. kroyeri had the highest percentage catch increase between 1995 (18 802 t) and 2005 (52 411 t) (gillett, 2008) .\nfor xiphopenaeus kroyeri, it is difficult to propose a single pattern in conformity with these three models. our results showed that, the sediment type of the study area, the size of individuals also affected the catch pattern. at 20 m depth, the shrimps were only found at night, the individuals presented largest sizes, and the sediment was composed of sand and, consequently, at this depth, the shrimps would be considered of the type 1. in contrast, for the shallower depths, the type 3 pattern could be proposed because there was no great numerical change in catch rate between day and night. silt and clay predominated at those locations, suggesting that the water there may be more turbid. in this respect, both the juveniles and adults of x. kroyeri showed the same behavior .\no objetivo do presente estudo foi analisar a variação diuturna na abundância e no tamanho do camarão sete - barbas xiphopenaeus kroyeri na região de ubatuba / são paulo, durante o ano 2000. em cada estação do ano, as coletas foram realizadas no período diurno e noturno, em 9 transectos localizados nas profundidades de 2 a 40 m. um total de 28. 878 camarões foi obtido e apesar da maior taxa de captura observada durante o dia (15. 853 camarões), não houve diferença significativa em relação ao período noturno (13. 025). na maioria dos tran - sectos houve também uma maior taxa de captura de camarões durante o dia, no entanto, verificou - se que em locais com sedimentos com predominância de areia fina e muito fina, houve uma captura no período noturno. já em relação aos juvenis, a maioria dos indivíduos foi amostrada durante o dia. em consideração ao tamanho (cc) médio, obteve - se o valor de 14, 43 ± 4, 02 mm durante o dia e 14, 82 ± 4, 28 mm durante a noite, com significativa diferença (student' s t - test, df = 2. 429, t = 2, 27, p = 0, 02). verificou - se também que os maiores indivíduos foram capturados no período noturno. um único modelo dos três propostos na literatura para as espécies de peneídeos quanto ao padrão de captura diuturna não pode ser aplicado ao x. kroyeri. nossos resultados evidenciaram que tipo de sedimento não somente influenciou na taxa de captura entre os períodos analisados como determinou os modelos em que esta pode ser incluída .\nhtml public\n- / / w3c / / dtd xhtml 1. 0 transitional / / en\nurltoken\nsabrina m. simões i, ii; rogerio c. costa i, ii; adilson fransozo ii; antonio l. castilho ii, iii\ni labcam (laboratório de biologia de camarões marinhos e de água doce) departamento de ciências biológicas, faculdade de ciências, unesp, campus bauru av. luis edmundo carrijo coube, 14 - 01, vargem limpa, 17033 - 360 bauru, sp, brasil ii nebecc (núcleo de estudos em biologia, ecologia e cultivo de crustáceos), departamento de zoologia instituto de biociências, unesp, campus botucatu, distrito de rubião jr, s / n, 18618 - 970 botucatu, sp, brasil iii departamento de biologia, faculdade estadual de filosofia, ciências e letras de união da vitória praça coronel amazonas, s / n, centro, 84600 - 000 união da vitória, pr, brasil\npalavras - chave: abundância, distribuição, penaeidae, xipho - penaeus kroyeri .\nthe tropical marine shrimp fishery, mainly for penaeid shrimps, is a very old activity. in recent decades, the mechanization of fishing boats and the growth of shrimp fleets have intensified exploitation, which has caused declines and even collapse of these fisheries. in brazil, with the significant decline of the shrimp farfantepenaeus spp. since the 1980s (paiva 1997), the population of x. kroyeri, commonly called as\nsete - barbas\n, became the most important target and is already impacted because of continuous indiscriinate harvesting, especially in the state of são paulo (costa et al. 2007) .\nsediment type and depth have been emphasized as major variables affecting the distribution of the penaeid shrimps (dall et al. 1990). several studies have demonstrated the substrate influence on some shrimp biological processes, since shrimps live on the substrate or buried in it (fuss jr and ogren 1966). the majority of species remains buried during the day and emerge at dusk, i. e. , are most active in the period when they are least vulnerable to potential predators (minello et al. 1987, laprise and blader 1992, sogard and able 1994, dall et al. 1990, negreiros - fransozo et al. 1999). moctezuma and blake (1981) noted that juveniles remain unburied for a longer period than adults do, because they need more food as a result of their high growth rate. in addition, penn (1984) noted that the type of substrat can affect burying behavior: in locations with silt and clay sediments, the turbidity of the water may be higher, and here the catch does not differ among the periods. in sandy locations, turbidity is lower and the shrimps are more abundant at night .\nthus, the objective of the present study was to analyze the diel variation in abundance and size of individuals of x. kroyeri that were caught down to a depth of 40 m in the ubatuba region, on the northern coast of the state of são paulo. we also investigated whether a change in sediment type might alter the catch rate between the day and night periods. the present study also provided information on the periods and regions that juveniles are more vulnerable to the fishing, therefore serving as framework for the determination and implantation of management plans that propitiate a sustainable fishing .\nlocated along the northern coastline of the state of são paulo, the ubatuba region is an important area for crustacean research (mantelatto and fransozo 2000). the region is unique when compared to other areas along the brazilian southern coast. this coastal area is enclosed be within a system of inlets, bays, canals, bayous, and rivers bordered by mangroves that together form estuaries rich in nutrients that are favorable for the establishment and development of the marine fauna. in addition, ubatuba bay is fairly pristine and used as a standard for comparison with other marine habitats that are strongly influenced by humans (mantelatto and fransozo 1999) .\nthe collections were carried out in all four seasons of the year (summer, autumn, winter and spring) in day and night periods, in the ubatuba region (fig. 1), during the year 2000. the samples were taken along 9 bottom transects, at depths of 2, 5, 10, 15, 20, 25, 30, 35 and 40 m. we used a commercial fishing boat equipped with two mexican - type\ndouble rig\nnets. the mesh size of the nets was 20 mm knot - to - knot in the body, and 15 mm in the cod end. trawls were conducted along each transect for 30 minutes, over a distance of approximately 2 kilometers. specifics nets for the capture of the shrimp - white were used to prevent the capture of the animals buried in the substratum, i. e. , with lighter materials and a high number of floats. the boat speed was also changed from 1. 5 to 2 knots .\nwe obtained the total wet weight (in grams) of the x. kroyeri caught in each trawl. we, then, took a random 250 - g subsample, and the number of individuals was counted on each transect of each season. based on the data from the subsample and from the total biomass, it was possible to estimate the number of individuals for each transect, season, and period .\nall the individuals in the subsample were measured for carapace length (cl mm) in millimeters and were sexed. carapace length, means the distance from the orbital angle to the posterior margin ofthe carapace. the reproductive condition ofthe females was determined by the macroscopic observation of the gonads, adapted from bauer and lin (1994) and costa and fransozo (2004), with four stages of development: im = immature, ru = rudimentary (adults with undeveloped gonads), ed = developing, and de = developed. the reproductive status of males was assessed by examining the shape of the petasma, which is fused in adult individuals (castro et al. 2005) .\nthe sediment was measured on each transect of each season. details of the methodology are found in bertinietal. (2001). the abundance of shrimp was compared among the seasons of the year and the transects, by means of analysis of variance (one - way anova, p < 0. 05), complemented by tukey' s multiple - comparisons test, at the 5% probability level. for each transect and season, the chi - square test (x 2) was used to compare the abundance of juveniles and adults between the sampled periods (day and night). the carapace size of individuals in each season and on each transect was compared between the day and night periods, by means of student' s t - test. data were log - transformed prior to the analysis, to improve their normality (zar 1999) .\nthe highest mean values of sediment diameter (phi φ) were found in the transects of 5 to 15 - m depth in all seasons (table i) .\nthe estimated shrimp amount was of 28, 878 individuals: 22, 993 (80 %) in winter, 3, 042 (11 %) in summer, 2, 562 (8 %) in autumn, and only 281 (1 %) in spring. the largest number of specimens (24, 678) was obtained on the 2 and 10 - m transects; a total of 4, 200 individuals were found on the 15 to 25 - m transects. no shrimp were collected on the 30, 35 or 40 - m transects. the number of individuals differed between spring and winter (one - way anova, p = 0. 01, ms = 4. 16 and f = 3. 53). the results for the transect comparisons are given in table ii .\noverall, in spite of the higher catch rate during the day (15, 853 shrimp), there was a significant difference from the night samples (13, 025) (x 2 p = 3. 48 e - 62) .\nthe number of individuals increased at night in spring (205 ind. at night and 76 ind. in daytime - x 2: p = 1. 40 e - 14) and in summer (1, 711 ind. at night and 1, 331 ind. in daytime - x 2, p = 5. 58 e - 12). in the other seasons, the contrary was observed: in autumn, 977 shrimps were collected at night, and 1, 585 during the day (x 2, p = 3. 07 e - 33); and in winter, 10, 132 shrimps were caught at night, and 12, 861 in daytime (x 2, p = 2. 04 e - 72) (fig. 2) .\nthe number of individuals differed significantly on most transects (x 2 (1 - m) p = 7. 22 e - 30; (5 - m) p = 8. 02 e - 30; (10 - m) p = 8. 11 e - 25; (20 - m) p = 1. 22 e - 24; (25 - m) p = 3. 48 e - 10). on nearly all the transects, the abundance was greater during the day. however, this occurred only at the locations with muddier sediments (phi > 4). in contrast, at the 20 - m depth, shrimps were caught only at night. at this point, the values of (phi) decreased to close to 3, that is, very fine sand predominated (fig. 3). the same pattern was observed for juveniles, although the catches at the 10 (x 2, p = 0. 001), 15 (x 2, p = 0. 02) and 20 - m (x 2, p = 0. 07 e - 10) depths differed significantly (fig. 4) .\nthe overall mean size (cl) of individuals was 14. 43 mm in day samples and 14. 82 mm in night samples, which is a significant difference (student' s t - test, df = 2429, t = 2. 27, p = 0. 02). the largest individuals, including all those with a carapace length above 28 mm, were caught at night (fig. 5) .\ncomparing the seasons of the year, the mean size of the individuals was larger in night samples, but a statistical difference was apparent only in autumn (student' s t - test, df = 541, t = 2. 08, p = 0. 03) (fig. 6). in terms of spatial relationships, except for the 15 - m depth, the mean carapace size of adults collected at night was larger than the carapace size found in the day samples. the largest individuals were collected at the deeper localities, 15 and 20 m (fig. 7) .\nthe catch rate of individuals of x. kroyeri was slightly higher in daytime. this result contrasts with the majority of studies on marine shrimps, mainly of the super - family penaeoidea (see, fuss jr and ogren 1966, pérez - farfante 1971, cobb et al. 1973, bauer 1985, scelzo 2003). in the same region of this study, lopes et al. (unpublished data) found that for two species of pink shrimp, farfantepenaeus brasiliensis and f. paulensis, larger numbers of them were caught at night .\ndiurnal burying activity is common in the majority of penaeids (bishop et al. 2008). the burrowing behavior of penaeids is a strategy for energy conservation, as well as a means of defense against potential predators (kutty and murugopoopathy 1968, dall et al. 1990). shrimps that bury themselves in the substrate during the day are protected against predators that feed in this period, and are less active than those that do not bury .\npenn (1984) developed three models for burying behavior, based on studies with penaeids caught in the gulf of mexico: type 1 - strongly nocturnal, but often inactive or buried at night, although always buried during the day. the species included here are generally fished for in sandy substrates with relatively clear water; type 2 - generally nocturnal and continually active at night, and buried during the day but with a tendency to emerge occasionally. these species differ from type 1 in being generally associated with muddier substrates. such areas generally have more turbid water; type 3 - rarely bury themselves and almost continually active. these are almost exclusively found in areas of river discharge, which are characterized by high turbidity .\nlaboratory experiments with x. kroyeri corroborate our proposal, since the shrimps buried themselves during the day and emerged at night in sediments composed of fine and very fine sand. when the shrimps were placed on muddy substrates, they began to burrow, but stopped immediately when the water became turbid. they did not cover themselves completely with sediment, and remained with only their body inside the small hole that they had dug (f. a. m. freire et al. , unpublished data). according to penn (1984), other penaeid species such as penaeus indicus h. milne edwards, 1837, p. merguiensis de maan, 1888, and p. setiferus (linnaeus, 1767) do not burrow in very soft sediments because they are not capable of reversing the water flux that passes through their branchial chamber in order to avoid clogging (penn 1984) .\nseasonally, the wind action in the study region can also modify the pattern of capture of the individuals .\nthe suspension of the substratum is caused many times because the wind action (pedersen et al. 1995) and, consequently, increasing the turbidity of the water. in accordance with castro - filho et al. (1987), the strongest winds in the winter induces the penetration of tropical water straight to the direction to the coast, destroying the seasonal thermocline formed by the action of the south atlantic central water and directing these masses to the continental slope. although we did not analyze the wind action in the present study, this fact could have favored the increase of the water turbidity in the autumn and winter months and, consequently, allowing the increase of the individuals captured during the day .\nwith respect to size, our results agree with the findings of negreiros - fransozo et al. (1999), who collected the largest individuals at dusk. according to dall et al. (1990), juvenile penaeid shrimps do not show a strong response of burying behavior in relation to light as the adults do, which are more caught during the night. in part, this hypothesis can be supported here, in that the smaller individuals of x. kroyeri were caught in about the same numbers in both periods, and the larger individuals were collected more often during the night. however, the adults, even smaller - sized ones, when in shallower areas, showed the same behavior as the juveniles. experimental studies involving these demographic classes in different types of sediment between the day and night periods might elucidate this question .\nthe abundance of juveniles and adults varies seasonally in the study region (costa et al. 2007), mainly due to the changes of the monthly temperatures values. the present study corroborates the results above. moreover, beyond autumn and winter present values of bottom temperatures higher than spring and summer ones (costa et al. 2007), we also suggest that the highest number of individuals in this period could be the result of the offseason period (march to may) for all the shrimps. in this way, the unification of the closure period as presently proposed for the pink and seabob shrimps is supported by this study .\nin general, we can conclude that, for x. kroyeri, the sediment type is the main factor that affects the catch rate during the day and night periods. nevertheless, other studies involving the comparison of diel catch rates of this shrimp for different demographic classes (juveniles, adult males, and ripe and spent females) in relation to lunar phases and the tidal cycle may contribute to a greater understanding of its behavior .\nwe are grateful to the\nfundação de amparo à pesquisa do estado de são paulo\n( fapesp) for providing financial support (# 94 / 4878 - 8, # 97 / 12108 - 6, # 97 / 121063, # 97 / 12107 / 0, and # 04 / 07309 - 8). we are also thankful to the nebecc co - workers for their help during field work and to dr. janet reid for her great help with the english language. all experiments conducted in this study comply with current applicable state and federal laws .\nbauer rt. 1985. penaeoid shrimp fauna from tropical seagrass meadows: species composition, diurnal, and seasonal variation in abundance. proc biol soc wash 98: 177 - 190. [ links ]\nbauer rt and lin j. 1994. temporal patterns of reproduction and recruitment in populations of the penaeid shrimps trachypenaeus similis (smith) and t. constrictus (stimpson) (crustacea: decapoda) from the north - central gulf of mexico. j exp mar biol ecol 182: 205 - 222. [ links ]\nbertini g, fransozo a and costa rc. 2001. ecological distribution of three species of persephona (brachyu - ra: leucosiidae) in the ubatuba region, são paulo, brazil. nauplius 9: 31 - 42. [ links ]\nbishop jm, ye y, alsaffar ah, al - foudari hm and al - jazzaf s. 2008. diurnal and nocturnal catchability of kuwait' s commercial shrimps. fish res 94: 58 - 72. [ links ]\ncastilho al, pie mr, fransozo a, pinheiro ap and costa rc. 2008. the relationship between environmental variation and species abundance in shrimp community (crustacea: decapoda: penaeoidea) in south - eastern brazil. j mar biol assoc uk 88: 119 - 123. [ links ]\ncastro - filho bm, miranda lb and myao sy. 1987. condições hidrográficas na plataforma continental ao largo de ubatuba: variações sazonais e em média escala. boletim do instituto oceanográfico 35 (2): 135 - 151. [ links ]\ncobb sp, futch cr and camp dk. 1973. the rock shrimp, sicyonia brevirostris stimpson, 1871 (decapoda, penaeidae). mem hourglass cruises 3: 1 - 38. [ links ]\ncosta rc and fransozo a. 2004. reproductive biology of the shrimp rimapenaeus constrictus (decapoda: penaeidae) in the region of brazil. j crust biol 24: 274281. [ links ]\ndall w, hill bj, rothilsberg pc and staples dj. 1990. the biology of the penaeidae. advances in marine biology. blaxter jhs and southward aj (eds), san diego, academic press, p. 1 - 489. [ links ]\nd' incao f, valentini h and rodrigues lf. 2002. avaliação da pesca de camarões nas regiões sudeste e sul do brasil. atlântica 24 (2): 103 - 116. [ links ]\nfransozo a, costa rc, mantelatto flm, pinheiro maa and santos s. 2002. composition and abundance shrimp species (penaeidea and caridea) in fortaleza bay, ubatuba, são paulo, brasil. in: moddern approaches study 14 crustacea, briones e and alvarez f (eds), kluwer academic publishers, p. 117 - 123. [ links ]\nfuss jr cm and ogren lh. 1966. factors affecting activity and burrowing habits of the pink shrimp, penaeus duorarun burkenroad. biol bull 130: 170 - 191. [ links ]\nkutty mn and murugopoopathy g. 1968. diurnal activity on the prawn penaeus seisulcatus de haan. j mar biol assoc india 10: 95 - 98. [ links ]\nlaprise r and blader sjm. 1992. predation by moses perch, lutjanus russelli, and blue - spotted trevally, caranx bucculentus, on juvenile brown tiger prawn, penaeus esculentus: effects of habitat structure and time of day. j fish biol 40: 627 - 635. [ links ]\nmantelatto flm and fransozo a. 1999. reproductive biology and moulting cycle of the crab callinectes ornatus (decapoda: portunidae) from the ubatuba region, são paulo, brazil. crustaceana 72: 63 - 76. [ links ]\nmantelatto flm and fransozo a. 2000. brachyuran community in ubatuba bay, northern coast of são paulo state, brazil. j shellfish res 19 (2): 701 - 709. [ links ]\nminello tj, zimmerman rj and martinez ex. 1987. fish predation on juvenile brown shrimp, penaeus aztecus ives: effects of turbidity and substratum on predation rates. fish bull 85: 59 - 70. [ links ]\nmoctezuma ma and blake bf. 1981. burrowing activity in penaeus vannamei boone from the caimanero - huizache lagoon system on the pacific coast of mexico. bull mar sci 31 (2): 312 - 317. [ links ]\nnakagaki jm and negreiros - fransozo ml. 1998. population biology of xyphopenaeus kroyeri (heller, 1862) (decapoda: penaeidae) from ubatuba bay, são paulo, brazil. j shellfish res 17 (4): 931 - 935. [ links ]\nnegreiros - fransozo ml, reigada ald and naka - gaki jm. 1999. diel variations in decapod catch rate and size of captured individuals in a subtropical area of brazil. in: schram fr (org), the biodiversity crisis and crustacea, 1 st ed. , leiden, brill 2: 643 - 656. [ links ]\npaiva mp. 1997. recursos pesqueiros estuarinos marinhos do brasil. edições ufc, fortaleza, 278 p. [ links ]\npedersen ob, christiansen c and laursen mb. 1995. wind induced long term increase and short term flutuations of shallow waters suspend mater and nutrient concentrations, ringkobing fjord, denmark. international j mar biol 41: 273 - 287. [ links ]\npenn jw. 1984. the behavior and catchability of some commercially exploited penaeids and their relationship to stock and recruitment. in: penaeid shrimps - the biology and management, gulland ja and rpthschiid bj (eds), fishing news books limited, farnham, p. 173 - 186. [ links ]\npérez - farfante i. 1971. range extension of shrimp penaeus (melicertus) brasiliensis latreille, 1817 (decapoda, penaeidae). bull mar sci 21 (3): 745 - 746. [ links ]\npérez - farfante i and kensley b. 1997. penaeoid and segestoid shrimps and pawns of the world. keys and di - agnosese for the families and genera. editions du muséum national d' histoire naturalle. paris, 233 p. [ links ]\nscelzo ma. 2003. day and night abundance and density of juveniles pink shrimps farfantepenaeus notialis (pérez - farfante) and farfantepenaeus brasiliensis (latreille) in la restinga lagoon, margarita island, venezuela (deca - poda, penaeidae). nauplius 1: 1 - 13. [ links ]\nsogard sm and able km. 1994. diel variantion in immigration of fishes and decapod crustaceans to artificial seagrass habitat. estuaries 17 (3): 622 - 630. [ links ]\nzar jh. 1999. biostatistical analysis. prentice hall, new jersey, p. 1 - 663. [ links ]\n( of penaeus kroyeri heller, 1862) heller, c. (1862). beiträge zur näheren kenntnis der macrouren. sitzungsberichte der mathematisch­naturwissenschaftlichen classe der kaiserlichen akademie der wissenschaften in wien. 389 - ­426, plates 1 - 2. page (s): 425; plate 2, fig. 51. [ rio janeiro ] [ details ]\n( of xiphopeneus hartii smith, 1869) smith, s. i. (1869). notice of the crustacea collected by prof. c. f. hartt on the coast of brazil in 1867. transactions of the connecticut academy of arts and sciences. 2: 1 - 41, plate 1. page (s): 27, 40; plate 1, fig. 1. [ caravelas, estado da bahia, brazil ] [ details ]\npérez farfante, i. ; kensley, b. (1997). penaeoid and sergestoid shrimps and prawns of the world. keys and diagnoses for the families and genera. mémoires du muséum national d’histoire naturelle. 175: 1 - 233. [ details ]\nfelder, d. l. , álvarez. f. , goy, j. w. & lemaitre, r. (2009). decapoda (crustacea) of the gulf of mexico, with comments on the amphionidacea, . felder, d. l. , and camp, d. k. (eds), gulf of mexico - origins, waters, and biota. vol. 1. biodiversity. pp. 1019–1104 (texas a & m; university press: college station, texas). , available online at urltoken [ details ]\nde grave, s. & c. h. j. m. fransen. (2011). carideorum catalogus: the recent species of the dendrobranchiate, stenopodidean, procarididean and caridean shrimps (crustacea: decapoda). zool. med. leiden. 85 (9): 30. ix. 2011: 195 - 589 figs 1 - 59. (look up in imis) [ details ] available for editors [ request ]\n( of penaeus kroyeri heller, 1862) de grave, s. & c. h. j. m. fransen. (2011). carideorum catalogus: the recent species of the dendrobranchiate, stenopodidean, procarididean and caridean shrimps (crustacea: decapoda). zool. med. leiden. 85 (9): 30. ix. 2011: 195 - 589 figs 1 - 59. (look up in imis) [ details ] available for editors [ request ]\n( of xiphopeneus hartii smith, 1869) de grave, s. & c. h. j. m. fransen. (2011). carideorum catalogus: the recent species of the dendrobranchiate, stenopodidean, procarididean and caridean shrimps (crustacea: decapoda). zool. med. leiden. 85 (9): 30. ix. 2011: 195 - 589 figs 1 - 59. (look up in imis) [ details ] available for editors [ request ]\nen - atlantic seabob, fr - crevette seabob atlantique, sp - camarón siete barbas .\npenaeus kroyeri heller, 1862, s. b. akad. wiss. wien, 45 (1): 425 .\nwestern atlantic: north carolina (u. s. a .) to estado de santa catarina (brazil) .\ndepth 1 to 70 m, usually less than 27 m. bottom mud or sand. marine, brackish, exceptionally fresh; most plentiful in areas near river estuaries .\ntotal length of adult specimens 70 to 140 mm; maximum total length of males 115 mm .\nin the united states it is by far the most important commercial species from pensacola (n. w. florida) to texas. the annual catch in the united states (in metric tons) amounted to 2 100 (in 1973), 2 994 (in 1974), 3 182 (in 1975) and 514 (in 1976). in mexico it is\nalso taken at times near ciudad del carmen, but is not of commercial significance\n( lindner, 1957: 83). longhurst (1970: 275) reports commercial concentrations also off nicaragua, off eastern venezuela and off trinidad. mistakidis (1972) cited the following fishing grounds for this species: honduras, nicaragua, costa rica, colombia. in venezuela it\nis of commercial importance but its capture is not done intensively except locally\n( davant, 1963: 95). in the guianas it is the most common commercial shrimp in local fisheries. it is caught by local fishermen, sold fresh, dried, or frozen and is exported (holthuis, 1959: 72, 73). also in brazil the species forms the subject of an important fishery, especially in n. brazil but also as far south as santa catarina (see fao, 1964 and mistakidis, 1972); it is used mostly locally. the total catch reported for this species to fao for 1999 was 28 222 t. the countries with the largest catches were brazil (14 200 t) and guyana (10 396 t) .\nfao catalogue vol. 1 - shrimps and prawns of the world. an annotated catalogue of species of interest to fisheries. l. b. holthuis 1980. fao fisheries synopsis no. 125, volume 1 .\nhtml public\n- / / w3c / / dtd html 4. 01 transitional / / en\nurltoken\nmclaughlin et al. 2005. common and scientific names of aquatic invertebrates from the united states and canada: crustaceans. american fisheries society special publication 31\nproceedings of the biological society of washington, vol. 116, no. 1\nwilliams, austin b. , lawrence g. abele, d. l. felder, h. h. hobbs, jr. , r. b. manning, et al .\ndisclaimer: itis taxonomy is based on the latest scientific consensus available, and is provided as a general reference source for interested parties. however, it is not a legal authority for statutory or regulatory purposes. while every effort has been made to provide the most reliable and up - to - date information available, ultimate legal requirements with respect to species are contained in provisions of treaties to which the united states is a party, wildlife statutes, regulations, and any applicable notices that have been published in the federal register. for further information on u. s. legal requirements with respect to protected taxa, please contact the u. s. fish and wildlife service .\ncopyright © 1999 - 2018 john wiley & sons, inc. all rights reserved\nenter your email address below. if your address has been previously registered, you will receive an email with instructions on how to reset your password. if you don' t receive an email, you should register as a new user\nwe use cookies to enhance your experience on our website. by continuing to use our website, you are agreeing to our use of cookies. you can change your cookie settings at any time .\ninstituto de pesca – centro apta pescado marinho, av. bartolomeu de gusmão, 192, santos, sp, 11030–906, brasil\ndetermining the degree to which the physical and operational characteristics of vessels and environmental factors influence catch yield is important for the evaluation of variations observed in fishery yields. this analysis also benefits fisheries management by allowing more effective conservation of the resource and the fishing activity itself (maunder and punt, 2004) .\nthe capture of x. kroyeri is typically performed by artisanal fleets with vessels < 15 m in length that operate with one or two trawlnets and specifically target this species. this shrimp fishery is important economically and socially to many coastal communities (perez et al. , 2001; graça - lopes et al. , 2007; kolling et al. , 2008) .\nthe x. kroyeri fishery and the biology of the species have been well studied in brazil, with several studies conducted in the northeastern (coelho and santos, 1993; santos and coelho, 1998; santos and ivo, 2000; santos et al. , 2001; santos and freitas, 2006; silva and santos, 2006, 2007; santos and silva, 2008), southeastern (nakagaki and negreiros - fransozo, 1998; castro et al. , 2005; graça - lopes et al. , 2007; simões et al. , 2010) and southern (branco et al. , 1999; branco and moritz, 2001; branco, 2005; pezzuto et al. , 2008; campos et al. , 2009) parts of the country .\nfisheries are primarily managed using time area closures in waters along southeastern and southern brazil (18°20′s to 33°45′s). initiated in 1984, the designated period has already undergone several changes. the closure was initially implemented to manage the fishing of the shrimp species farfantepenaeus brasiliensis and f. paulensis, but it also prohibited the fishing of other shrimp species, including x. kroyeri, in the same area. only in the years 2006 and 2007 was the period of closure directed specifically at managing the fishing of x. kroyeri (franco et al. , 2009) .\nseveral biological characteristics of x. kroyeri, including its reproductive capacity, lack of dependence on estuaries and short life cycle, allow the species to efficiently recover from fishing mortality. despite this potential for recovery, however, there has been considerable concern since the 1970s about the stress on the population caused by commercial fisheries of the species (santos et al. , 1973; graça - lopes et al. , 2007; pezzuto et al. , 2008). variations in x. kroyeri catch rates over the years and a decrease in population size observed in stock assessments led to its inclusion in the national list of species of aquatic invertebrates and fish overexploited or threatened with overexploitation (“lista nacional das espécies de invertebrados aquáticos e peixes sobreexplotadas ou ameaçadas de sobreexplotação”) (d' incao et al. , 2002; mma, 2004; graça - lopes et al. , 2007) .\ncatch and effort data from commercial and recreational fishing are commonly used as an index of population trend when reported as cpue. this represents one of the most easily accessed sources of information for analysing fisheries stocks in exploitation (gulland, 1956; gavaris, 1980; nrc, 2000). however, the use of these data as an index of abundance necessitates methods for filtering out variations caused by factors other than abundance, such as technological changes in the fleet, season and area. this process has been widely performed in fishery studies using multiplicative models for the standardization of catch rates (large, 1992; goni et al. , 1999; punt, 2000; maynou et al. , 2003; battaile and quinn, 2004; tascheri et al. , 2010) .\nthe coefficients of multiplicative models are typically estimated by fitting generalized linear models (glms), which allows for the identification of factors that influence catch rates as well as the calculation of standardized indices of abundance (maunder and punt, 2004; venables and dichmont, 2004; xiao et al. , 2004) .\nalthough x. kroyeri fisheries and the biology of the species are well studied, no attention has been given to the standardization of x. kroyeri catch rates along the brazilian coast. this step is of the utmost importance for the development of indices of relative abundance, which can be used as a basis for management of the fishery and adjustment of the models for stock evaluation (maunder and punt, 2004) .\nto better understand the fishing dynamics of x. kroyeri, the present study aimed to (i) identify the factors that influenced the catch rates of x. kroyeri by double - rig trawling in the state of são paulo from 1990–2009, (ii) estimate a time - series with standardized indices of abundance for the species, (iii) identify patterns of x. kroyeri cpue, and (iv) assess whether the variation in species abundance in different fishing areas was associated .\ndata from the landings of double - rig trawlers in the fishing ports of cananéia, santos and ubatuba in são paulo state (figure 1) were used. a lengthy time - series of data is available for these ports. the information was collected using the census method, which involves interviews with fishermen at the time of landing as part of the fishing activity monitoring program of the são paulo fisheries institute (fao, 1999; ávila - da - silva et al. , 2007) .\ngeographic location of the fishing sectors and main fishing ports where x. kroyeri is landed in the state of são paulo (ubatuba, santos and cananéia) .\nfor the present analysis, we considered vessel (length and engine power) and travel data along with complete data for catch, effort and fishing area. the brazilian rule for seabob trawlnets limits the buoy line to maximum 12 m length and the mesh to at least 24 mm (sudepe, 1984). possible variations in the sizes of fishing nets per boat or trip were not taken into account .\nthe fishing area was divided into three sectors, defined by the radius of activity of the fleets based in each of the ports: (a) the northern sector, the area of operation of ubatuba fleets, bounded by latitudes 23°00′s and 23°50′s; (b) the central sector, the primary area of operation of santos fleets, extending from parallel 23°50′s to 24°30′s; and (c) the southern sector, with trips recorded in cananéia, between latitudes 24°30′s and 25°35′s. the latitudinal limits designate the area from the coastline with a perpendicular extension until the 50 m isobath (figure 1) .\nanalysis of the northern sector included data from 31 522 trips made by 172 vessels, which captured 2034. 3 t of x. kroyeri between 1990 and 2009. for the central sector, the analysis included data from 3242 trips made by 96 vessels, which captured 5842. 3 t of the species. for the southern sector, the analysis included data from 3651 trips made by 121 vessels, which captured 3442. 1 t of the species during the period. total effort was 50 738, 19 699 and 11 304 fishing days for northern, central and southern regions, respectively .\nthe fishing boats were categorized according to vessel length and engine power. the length categories were as follows: (i) small scale 1 (s - 1) for vessels < 10 m; (ii) small scale 2 (s - 2) for vessels between 10 and 12 m; (iii) intermediate scale 1 (i - 1) for boats between 12 and 15 m; and (iv) intermediate scale 2 (i - 2) for vessels > 15 m in length. these categories were determined using the fisheries legislation regulating the trawler fleets catching shrimp in the region as a reference. vessels that are 10 m or longer are legally required to complete and submit catch maps for all fishing trips, while boats that are 12 m or longer are not designated as artisanal for fishing licences. vessels that are 15 m or longer are included in the fishery vessel satellite tracking program (“programa de rastreamento de embarcações pesqueiras por satélite” – preps) (seap / pr et al. , 2006; mpa and mma, 2010; mpa and mma, 2011). the horsepower classes were (i) < 18 hp, (ii) 18–99 hp, (iii) 100–179 hp and (iv) ≥180 hp .\nfor the years 1990–2009, the months during which a fishing ban was enforced were identified. the months immediately following these periods were classified as opening months for fishing (table 1) .\nclosed periods (temporary bans on trawling) in the southeastern and southern regions of brazil from 1990–2009 .\nestimation of the magnitude of influence of year, month (january–december), length class (s - 1, s - 2, i - 1, i - 2), hp class (< 18, 18–99, 100–179, ≥180) and opening - month status (variable indicating whether the month was one open to fishing following a period of closure) on fishing cpue was carried out for each sector using analysis of deviance for glm fit (mccullagh and nelder, 1989; lindsey, 1997; venables and ripley, 1997; quinn and deriso, 1999). catch rate, or cpue, was measured as the landed catch (kg) per effective fishing days of each trip .\nthe cpue distribution for all sectors showed asymmetry, with lower values being the most frequent, mainly in the northern and southern sectors. for these sectors a log - normal distribution was the best fit for the cpue, while a gamma distribution was assumed for the central sector. thus, the glm technique was used to identify the magnitude of influence of the explanatory factors on the cpue of the species. the gaussian family and the identity link function on log transformed cpue were used for the northern and southern sectors, while a gamma distribution and a logarithmic link function on raw cpue data were used for the central sector .\nfirst the models were fitted considering all variables, without concern for their order and with no interactions. the effect of dropping terms from the models was explored by examining the akaike information criterion (aic) (akaike, 1974) of each single term. in a second step, variables were ordered based on their aic value. the definition of the final model terms with first - order interactions was performed using the stepwise method (backward and forward) based on aic values (venables and ripley, 1997). previous estimates were not fixed when one more effect was added .\nin the above equation, μ ymhlc is the expected cpue for month m of year y for a vessel of hp class h and length class l and takes into consideration whether the month was an opening month for fishing or not. α is the observed cpue of a vessel belonging to hp class < 18 and length class s - 1 in january 1990 for the northern and central sectors and from 1995 for the southern sector. β y is the abundance in year y relative to 1990 for the northern and central sectors and relative to 1995 for the southern sector. θ m is the abundance during month m relative to january. ϵ h is the efficiency of a vessel of class h with respect to the hp class < 18. ρ l is the efficiency of a vessel of class l relative to length class s - 1. γ c is the change in the capture rate in the case of an opening month for fishing .\nthe adjustment of the final model for each of the areas is exemplified by means of graphs for the type of vessel with greater temporal coverage by area." ]
{ "text": [ "xiphopenaeus is a genus of crustaceans in the suborder dendrobranchiata , the shrimps and prawns .", "two species are in this genus : xiphopenaeus kroyeri xiphopenaeus riveti likely , more species have not yet been described and named .", "these were previously considered to be two names for the same species , but genetic analysis confirms they are two distinct species .", "x. kroyeri occurs in the atlantic ocean , while x. riveti lives in the pacific .", "x. kroyeri , the seabob shrimp , is a very important food species fished off the coast of brazil . " ], "topic": [ 7, 11, 6, 13, 17 ] }
"xiphopenaeus is a genus of crustaceans in the suborder dendrobranchiata, the shrimps and prawns. two species are in this genus: xiphopenaeus kroyeri xiphopenaeus riveti likely, more species have not yet been described and named. these were previously considered to be two names for the same species, but genetic analysis confirms they are two distinct species. x. kroyeri occurs in the atlantic ocean, while x. riveti lives in the pacific. x. kroyeri, the seabob shrimp, is a very important food species fished off the coast of brazil."
[ "xiphopenaeus is a genus of crustaceans in the suborder dendrobranchiata, the shrimps and prawns. two species are in this genus: xiphopenaeus kroyeri xiphopenaeus riveti likely, more species have not yet been described and named. these were previously considered to be two names for the same species, but genetic analysis confirms they are two distinct species. x. kroyeri occurs in the atlantic ocean, while x. riveti lives in the pacific. x. kroyeri, the seabob shrimp, is a very important food species fished off the coast of brazil." ]
"animal-train-21"
"animal-train-21"
"2672"
"parktown prawn"
[ "right but surely the parktown prawn is named after the common prawn. crickets / wetas look a like weird prawns .\ni’m brave only in certain areas. the parktown prawn is not one of them .\nthe parktown prawn is capable of large jumps when threatened, often ejecting an offensive black fecal liquid .\na member of the king cricket family, aka the parktown prawn, is found across the southern hemisphere .\nparktown prawn - libanasidus vittatus - not actually a prawn, this species of king cricket is of the family anostostomatidae. it is not a true cric… | pinteres…\nthe parktown prawn (libanasidus vittatus) is – of course – not a prawn at all, but actually a six - legged insect belonging to the king cricket family, anastostomatidae. today, the first discovered parktown prawn is housed in the natural history museum of london .\nso there you have it. parktown prawns in a nutshell. or rather, parktown prawns in an exoskeleton .\n, three birds in the urban habitat that are able to take on the considerable size of the parktown prawn .\nparktown prawn - relationship with humans... parktown prawns seem to be more active at night... the parktown prawn is capable of large jumps when threatened, often ejecting an offensive black fecal liquid... by the johannesburg newspaper the star, tells that the parktown prawn was actually the result of an escaped genetic experiment by students from the university of the witwatersrand in the 1960s (thus ...\nmadam & eve on twitter :\nfor those unfamiliar with the\nparktown prawn\n... urltoken # doom…\ndie antwoord' s video fatty boom boom, featuring a\nprawn star\n, was released in october 2012. artwork for the video features a parktown prawn covered in vaginal mucus .\njohannesburg newcomers often ask me about parktown prawns, joburg’s most legendary insect. what do parktown prawns look like, people want to know. how big are they? do parktown prawns really exist ?\na fancied resemblance to a prawn accounts for its name. the parktown prawn is held in low regard by some, while gardeners value them for controlling garden snail populations and attracting the hadeda ibis .\na fancied resemblance to a prawn accounts for its name. the parktown prawn is held in low regard by some, while gardeners value them for controlling garden snail populations and attracting the hadeda ibis .\nthis post is dedicated to martina in jozi. martina, you will always be the queen of the parktown prawn blog. i miss you .\nthe purpose of this story is to convey just how petrifying a parktown prawn can be, even to a person like me who is relatively “brave” .\nthis time it includes pulling a parktown prawn from lady gaga’s vagina before the poor unfortunate superstar gets mauled and killed by a lion in downtown jozi .\nbrave enough to box in hillbrow, too craven to photograph a prawn… interesting .\ndie antwoord' s video for\nfatty boom boom\nfeatures a semen - coated parktown prawn living in lady gaga' s vagina. [ 8 ]\ntil that the prawns in the movie district 9 are not called that because of shrimp but are in reference to the parktown prawn which is a cricket native to south africa .\ndiscovered by william forsell kirby in 1899 in baberton, mpumalanga, parktown prawns became synonymous with the suburb (parktown in johannesburg) after the 1960’s, when they expanded rapidly in ‘prawn count’. this insect has a preference for the lush, leafy region of johannesburg .\nparktown prawns divide the people of joburg into two distinct groups: 1) prawn - lovers, who are fond of parktown prawns and praise their talent for controlling the population of snails in the garden; and 2) prawn - haters, who fear and loathe partown prawns more than any other animal on earth. i obviously fall into the second group .\nyep, definitely one thing in jozi i could do without. parktown prawns and traffic .\nused parktown prawns as part of an extended parody of south african politics of the time .\nso we’re thinking of opening an “old johannesburg” styled (think converted home, pressed ceilings, gas stoves, colonial decor) seafood restaurant in trendy parktown north, you guessed it “the parktown prawn”. call me if you’re interested in the franchise, we’re talking pp’s nationwide !\nas eminently depicted in district 9, and much to the fear of local residents, johannesburg is home to the loathsome and most terrifying insect of them all – the parktown prawn .\ntil that the prawns in the movie district 9 are not called that because of shrimp, but are in reference to the parktown prawn which is a cricket native to south africa .\nat face value the play tells the story of the encounter of a man called hennie with an insect — the notorious parktown prawn that terrorises the wealthy residents of this johannesburg suburb .\nthe enemy he was describing as something out of a true - life horror flick was the so - called parktown prawn, a giant insect that plagues johannesburg residents this time of year .\nunfortunately we don’t have a recording of the sound that a parktown prawn makes – perhaps you can try looking for videos on the matter? what i can tell you though is that when parktown prawns are distressed, they produce hissing sounds by rubbing their hind legs against their abdomen .\ndon’t squish the parktown prawn. don’t spray it with insecticide – you are wasting your money anyway. it is so many thousands times bigger than a mosquito that the poison will take ages to act – that is, if the prawn doesn’t metabolise it to a harmless compound first .\nthe parktown prawn aka parkmore prawn aka parkhurst prawn, libanasidus vittatus, is a monotypic species of king cricket found in southern africa. although a member of the cricket order orthoptera, it is placed in the family anostostomatidae, separate from that of the true crickets, gryllidae. the insect gets its english name from the suburbs of parktown, parkmore and parkhurst in johannesburg, south africa where they are frequently found. in angola, it is found in the southern savanna and semi - arid regions, whereas in namibia it is found throughout the territory. the parktown prawn is also related to the new zealand tree weta which is also in the family anostostomatidae .\nthe parktown prawn has a number of features which generally intimidate the average householder. on closer examination it’s clear that these features are evolutionary adaptations to its lifestyle as a big, solitary invertebrate .\ntil that the prawns in the movie district 9 are not called that because of shrimp, but are in reference to the parktown prawn which is a cricket native to south africa. : todayilearned\nneill blomkamp' s film district 9 features an alien race some humans disparagingly refer to as prawns. some film critics have speculated that the appearance of the aliens was inspired by the parktown prawn .\nneill blomkamp' s film district 9 features an alien race some humans disparagingly refer to as prawns. some film critics have speculated that the appearance of the aliens was inspired by the parktown prawn .\non a related note, i have a recent prawn shot from my bathroom, if you would like it. i used a looooooong zoom, and made stuart dispose of the prawn. yuk .\nthe parktown prawn, when burrowing a home, burrows head first and uses its spined hind legs to kick out the debris. the spined hind legs are also used to fend off competitors and predators .\nalthough the parktown prawn has been known for over 100 years, not much is known about these creatures. little is known about their act of courtship, except that it takes place in their burrows .\nmy childhood in johannesburg included diving under my bed while playing hide and go seek to find myself face to face with the biggest mole cricket (parktown prawn) i had ever seen. still have ptsd .\nlucky returned a few minutes later, prawn wrapped safely in the bag. and he brought me this .\na small boy is terrorised by a cooked prawn in suburbian australia whilst his sister laughs at his misfortune .\ni’m not scared of parktown prawns. i won’t handle them, but i find them interesting to look at .\nwe live in parktown, and now that the rains are here, these buggers are springing up everywhere. cheers\nthe parktown prawn is thought to have originated in the forests north and east of johannesburg, making it to the big city a few decades ago, perhaps clinging to the roots of a plant destined for a suburban garden .\nparktown prawn - libanasidus vittatus - not actually a prawn, this species of king cricket is of the family anostostomatidae. it is not a true cricket as true crickets are of the family gryllidae. this insect is endemic to southern africa and can reach a length of almost 3\n( 7. 62 cm) - image: © paul venter\n, has a dry climate, which was unsuitable habitat for the parktown prawn. with the arrival of suburban dwellers, cultivation provided lush, forest - like gardens, an environment more suited to the crickets which helped the insect thrive .\nthe parktown prawn' s jumping ability is not surprising, since it is actually a cricket. its scientific name is libanasidus vittatus, and it is one of 300 species of king crickets found in south africa, australia and new zealand .\nthe parktown prawn is south africa’s most famous king cricket. however, the ‘monstrous cricket’, described 200 years ago is an even more spectacular animal. to find out more about these exciting and unusual animals and the controversies surrounding them read on. did parktown prawns come from space or barberton – which is scarier? do king crickets sing love songs at night ?\nwow. you have really done a lot of research on parktown prawns. this post is unbelievably awesome. well done .\nthe parktown prawn, libanasidus vittatus', is a monotypic species of king cricket found in southern africa. although a member of the cricket order orthoptera, it is placed in the family anostostomatidae, separate from that of the true crickets, gryllidae. the insect gets its english name from the suburb of parktown in johannesburg, south africa where they are frequently found. in angola, it is found in the southern savanna and semi - arid regions, whereas in namibia it is found throughout the territory. the parktown prawn is also related to the new zealand tree weta which is also in the family anostostomatidae .\nalthough parktown prawns are depicted as menacing creatures they definitely play an important role in natural pest control as mentioned in the blog .\npeople that live closer and closer to me have been telling me their prawn stories, until someone that lives just two doors down said that their cat had caught one. nooooo! now the final straw – my friend just sent me a photo of a dead parktown prawn that she saw outside my house. i think i am going to faint / puke / run away screaming\nshe finds herself in a doctor’s surgery, where the doctor, played by comedian kagiso lediga, examines her and pulls a parktown prawn from her vagina. a healed lady gaga then leaves the surgery, only to be attacked by a lion and killed .\nif a prawn gets into your house, you must either find a prawn - lover who knows how to safely remove it, or run screaming from the room and just hope it’s gone when you come back. (i use the latter option. )\nnicely penned, when i was around 16 i woke up to discover a huge parktown prawn ensnared in my long curly hair and spent 20 horrifying minutes trying to pull \\ cut it out. i haven’t had long hair or slept under an open window since .\ni’ve been wanting to write a prawn post for years. even though they are not actually indigenous to this area, parktown prawns have become a part of joburg’s culture and folklore. part cricket - on - steroids, part giant cockroach, park prehistoric monster, parktown prawns — much like this massive city that they have adapted to so well — are one - of - a - kind .\nthe problem is, i don’t like to write blog posts without pictures and i don’t like to download pictures from the internet. but there is no way in hell that i will ever get close enough to a parktown prawn to properly photograph it. and even if i were brave enough to try, parktown prawns normally show up in my house at night, when good photography is impossible .\nparktown prawn is the familiar term south africans use for libanasidus vittatus, a monotypic king cricket species found in south africa, belonging to the anostostomatidae family. it is not considered a true cricket. adults are usually around 4 to 5 centimeters in length, with an antennae of 2 cm. parktown is an affluent suburb in johannesburg, where these crickets are commonly found, hence the name .\nin truth, libanasidus vittatus is no prawn, nor is it confined to parktown, a section of northern johannesburg. it is a king cricket. but it does avoid poorer neighborhoods, which tend to be dry, preferring the wet, leafy gardens of elegant old mansions .\ninsect of the year for the year 2000 may be the millennium bug. but here in the shady gardens (and sometimes the quiet bedrooms) of the northern suburbs, 1999 belongs to the real chitinous - skeletoned thing, the tiny scourge of johannesburg known as the parktown prawn .\nthe first parktown prawn was officially discovered in south africa in 1899 in a small mining town called barberton, east of johannesburg. their spread and rise to fame has in some ways mirrored that of johannesburg, which seems to have become their adopted home, over the intervening years .\ni noted above that parktown prawn is a misnomer. in fact, the original name was parkmore prawn, after a suburb in sandton. because parktown is so much better known than parkmore, that name came to be substituted, but that was definitely not the original name. i can confirm this both through a sunday times press cutting from 1980 that i came across and because i myself once lived in parkmore and can assure you that the place was swarming with the buggers. it was ill - advised to walk at night without shoes, even inside the house .\ni’ll never forget the first time i encountered a parktown prawn. it was a rainy night and i was sitting on the sofa. i turned slightly to my left and saw a prawn standing in the middle of the living room floor. i jumped up, shrieked, ran past the prawn and into the kitchen, and leapt onto the counter. i sat up there, shaking with terror, for about 30 minutes. i texted lucky, who wasn’t home. “throw a towel over it, ” he responded. “i’ll take it out when i come home. ”\ni went outside and found lucky, who came in to remove the prawn. i told lucky how i’d tried and failed to photograph it .\nas if the idea of a super - sized fighter cricket is not enough, i know of a grown man who, trembling under the watch of a parktown prawn is able to travel from a standing to a sitting - on - the - table position in under 0. 2 seconds !\nparktown prawn pub company limited was founded on 07 aug 2014 and has its registered office in cardiff. the organisation' s status is listed as\ndissolved\n. it had one director at the time it closed. the company' s first directors were lee david woolls, nicholas leith .\nthe answer to the last question is a definitive yes. you can read all about parktown prawns on wikipedia. definitely check it out because it’s a particularly entertaining wiki entry. my favorite line is: “accordingly they [ parktown prawns ] frighten nervous persons and they may chew carpets and fabrics. ”\nthey are named as such because parktown prawns are a hated large cricket which at times seem unkillable. and of course the aliens look like them .\nduring the 19th century and early 20th century henicus monstrosus was probably south africa’s best known king cricket, and was the only species discussed by skaife in the 1953 version of african insect life. this species has now undoubtedly lost its position as the best known species in southern africa to the “parktown prawn” .\nadult parktown prawns don’t sing to each other in the same way that the males of true crickets call to the females to advertise their availability and gene quality. instead, parktown prawns leave smellograms, scent marking their burrows to advertise their sex and maturity. so, the foul smelling goo that the agitated creature leaves on your sofa as you try to swat it with your newspaper doubles up as chanel no. 5 in the intimate world of prawn sex .\nmale and female parktown prawns live retiring lives in shallow spherical burrows, which they leave only to wander around our gardens in search of food and fellowship .\ni raced to the bedroom, slammed the door, pushed the towel under it, and quickly scanned the room for the prawn. the room seemed clear. but just in case, i grabbed my wooden club and held it aloft, standing in the middle of the room for several minutes. when i finally felt confident the prawn was not in the room with me, i settled in for a fitful night’s sleep. i never saw that prawn again .\ni, for one, have never heard of anything called a parktown prawn. when you google about moving to south africa, you get all kinds of results about crime – rape, murder, car jacking, home invasion etc. there are lots of articles about corruption and politics. i even googled about snakes and scorpions as a friend had written on her blog that she had almost trodden on a scorpion here. what i didn’t know about were these parktown prawns .\nthe “parktown prawn” has captured the imagination of the general public living in johannesburg and surrounding areas to such an extent that it has stimulated numerous articles in the local and international media, and has featured in publications such as time and the economist and has appeared on bbc and cnn international news broadcasts. they are also popular subjects for school projects. this species already has its own website, and two rampant parktown prawns have featured on a billboard advertising a local radio station .\n3) don’t ever try to squash a prawn. as explained on wikipedia: “the insects can jump actively and often eject offensive black fecal liquids when threatened” .\nbut this prawn is actually doing its level best to convince the terrified man that he needs to join the creatures communalist congress, which is trying to do battle with a prawn called hennie monster who is hell - bent on world domination. unfortunately all hennie the man wants to do is kill the messenger, literally .\nsouth africa’s notorious parktown prawn gets its name from the leafy johannesburg suburb where it has flourished and spread since migrating to the city from the moist eastern forests of the country’s lowveld escarpment. it is a large insect with a reddish colour and bristling legs, mouthparts and antennae, which might have been responsible for its nickname .\nin the 1980s, andrew buckland' s acclaimed play the ugly noo noo used parktown prawns as part of an extended parody of south african politics of the time .\nalthough doom and gloom surrounds the parktown prawn, they feed on garden snails, vegetable matter, and fallen fruit, thus implementing their own form of pest control. unfortunately for us, they also like to feed on rugs and textiles, wooden elements such as floor boards and furniture as well as pet food and dry oatmeal .\nprawn are apparently interested in a vicious faunal battle ring that functions in a manner similar to cockfights, which they produce using a species apparently indigenous to their homeworld .\nthe resilience and strength of the parktown prawn allowed two cartoon versions to become objects of humour in the well known south african cartoon strip madam & eve, inspiring fear in gwen anderson and eve sisulu. in the cartoons, the parktown prawns get' high' on insecticide (in reference to their size and how much poison is required to kill them), and produce two cricket - shaped indentations on the bottom of a frying pan with which they are swatted, in reference to their hard exoskeletons .\nthe resilience and strength of the parktown prawn allowed two cartoon versions to become objects of humour in the well known south african cartoon strip madam & eve, inspiring fear in gwen anderson and eve sisulu. in the cartoons, the parktown prawns get' high' on insecticide (in reference to their size and how much poison is required to kill them), and produce two cricket - shaped indentations on the bottom of a frying pan with which they are swatted, in reference to their hard exoskeletons .\nprawn is the south african name for shrimp that are caught off the coast of mozambique and famed for their large size. parktown is a suburb of johannesburg that gave its name to these creatures when they began appearing there a few years ago, though nearby neighborhoods - - parkhust, parkmore - - also claim it as an alliterative appendage .\ni thought\nprawn\nwas a racial slur name for a group of people irl. the\nnews footage\nat the beginning are real people talking about them ?\nthe parktown prawn is a cold - blooded insect, and therefore is very much a dozy creature on a cold day. it has a soft, but brittle exoskeleton or shell and opposed to popular belief can be killed when trodden on. (although entomologists would prefer to have them donated alive for public display or for their habitual studies) .\nit is basically a large cricket, hence it’s called the king cricket (common name parktown prawn). they can grow larger then 10cm with a red head and thorax, orange and black striped abdomen and large spiky orange legs. they have large mandibles which are capable of devouring just about everything. they are found in northern south africa and in angola .\n- they jump unpredictably and squirt nasty stuff all over the place! this is usually accompanied by equal amounts of' eeking' and jumping of the person trying to catch the prawn .\nmy name is pipa, i am a portuguese expat living in jhb for 1 month an a half. i have seen the parktown prawn when i went to view a house to let with my husband and daughter. the prawn was in the pool and i asked the real estate agent what that was. she said it was a garden keeper, it eats the snails and other insects. we ended up renting the house and we are moving in 2 weeks time. i just hope i don’t find one inside the house since they are attracted to light !\nto be honest, i always thought they were an introduced species, but according to wiki (yes there actually is a wiki entry for parktown prawns !) they’re actually from the barberton area .\nparktown prawns possess similar “ears” – located on their front legs – to those of crickets and long - horned grasshoppers. parktown prawns are orange to brown in colour, with darker brown to black stripes across their abdomen and are around 6 - 7 cm’s in size (or in some cases – even larger !) with antennae the size of their body. male parktown prawns have large tusk - like mandibles with which they grip and throw their prey over their shoulders! females on the other hand, possess a finely honed ovipositor of around 19mm, with which they lay around 80 to 200 eggs .\nextinction can' t come too soon for some people. jenny crwys - williams, a talk show host on radio 702, occasionally encourages listeners to call in and describe their worst prawn days .\nthis morning though, i walked into my spare bedroom and found myself face to face with a large prawn. as per usual, i screamed like a little girl and ran from the room .\ni hear that they are from madagascar and came over to the northern suburbs via cartons of bananas. they thrived as a result of the abundance of well watered gardens in joburg. but then hadedas came on to the scene in bigger numbers around 1995. they have a great liking for the parktown prawn. i used to shoot parktown prawns with my bsa air rifle, the rest of my family taking cover behind me. the best method to take care of them if you don’t want them excreting the smelly stuff. i know live in cape town and do not miss the hiss in the night .\nnow, i’m a bit of a bad - ass when it comes to looking after myself. i have prided myself on it for years, and it often frustrates rob that i just do certain things for myself that apparently a man is meant to do for me. well i can promise you one thing rob, you can sort out the parktown prawn when our paths cross. i’m being a huge girl about this thing\nthe basic parktown prawn nightmare is to wake up in the middle of the night with a 3 - inch insect gripped firmly to your bedclothes, refusing to let go and run away like any other self - respecting bug when confronted with an enormous human being. then, as your flailing grows more desperate, it lets loose its load of stinking goo. there goes one good night' s sleep and maybe several more .\nunfortunately parktown prawns do possess several distressing attributes, which cause many householders to think of them as disgusting creatures. they are frequently attracted to light and wander into houses, where they have even been discovered in beds .\na popular urban legend, fuelled by april fools' day articles published by the johannesburg newspaper the star, tells that the parktown prawn was actually the result of an escaped genetic experiment by students from the university of the witwatersrand in the 1960s (thus explaining the insects' sudden arrival in johannesburg at that time). the insect' s unusual strength, vivid orange colouring and size are seen to' confirm' this urban legend .\na popular urban legend, fuelled by april fools' day articles published by the johannesburg newspaper the star, tells that the parktown prawn was actually the result of an escaped genetic experiment by students from the university of the witwatersrand in the 1960s (thus explaining the insects' sudden arrival in johannesburg at that time). the insect' s unusual strength, vivid orange colouring and size are seen to' confirm' this urban legend .\nsince their diet includes both animal and plant material they can be described as omnivorous. in most gardens where these insects are now found, the garden snail has ceased to be a pest, so interestingly enough, the prawn\nthe pharmacist' s recollection of a hiss from his fearless prawn was not just a product of his overworked imagination. they make such a noise by rubbing their hind legs against their abdomens when disturbed or seeking a mate .\non youtube, fatty boom boom is described as “a bright and colourful african adventure, complete with wild animals, zef savages singing and dancing in the streets, and a special guest appearance by a sneaky little prawn star” .\nsince there is great interest in these insects there is also a great opportunity for public education by making appropriate information available. one opportunity for public awareness was the centenary of the description of l. vittatus in 1999. when the idea of celebrating the centenary of the parktown prawn was first suggested, some people thought this was a joke, but even this was part of the process of attracting attention. once one has an audience, the opportunity exists to provide information about crucial issues in museology and biodiversity. issues such as the biodiversity crisis, the age of collections and the need to collect and care for specimens, declining funding and even repatriation can be addressed (the holotype or primary specimen of the parktown prawn is an adult female collected in barberton and housed in the british museum - natural history). it is thought that this is the first time that the centenary of any insect has been celebrated .\ni just want to know about parktown prawns that are they dangerous. is it containing poison like snake or scorpion or it contains lightly poision. also i want to know is this creature can bite u or can effect u some how. i have lots of questions on my mind abt this ugly bt god creation prawn. well i will be waiting for ur answer althoug i can go to librery nd search nice book abt this prawn bt its nt my nature hehehe i mean i hate to read long storry and waist my time in short cut the long story short. please let me know as soon as possible for u. u can send me mail always with kind of knowledge. thanks\n2003 was the bicentenary of the description of the “monstrous cricket” henicus monstrosus (herbst), from the western cape province of south africa by herbst back in 1803. this was also the first king cricket (anostostomatidae) ever described. king crickets are best known in south africa as relatives of the “ parktown prawn “, libanasidus vittatus. forty four species of king cricket have already been described from south africa and there are many more that need to be described .\nprawns\nis the derogatory term that humans use for a sapient species of extraterrestrial insectoids that, for unknown reasons, stopped running upon the arrival on the planet earth. the term\nprawn\nhas led to a bit of confusion for some, as they are in fact not called this due to a resemblance to prawns, but instead this name was given to them by the local people of johannesburg, south africa, due to their resemblance to a species of pest from that area, known as the parktown prawn, a species of king cricket as opposed to a crustacean. their homeworld has seven moons. it is also possible that the species' true name is\npoleepkwa\n.\nthe prawn' s tough hide makes it newspaper - and slipper - resistant. at up to three inches long, it has enough body mass to shake off most household insecticides - - the first shot just makes it more jumpy .\nin truth, professor crump said, parktown residents should be grateful that it migrated here. given their druthers, prawns will eat garden snails all night long rather than hop into the dog dishes where they are often found on wet summer mornings .\nstories of their\nnight of the living dead\n- like resilience abound. one television report claimed that a prawn survived being flushed down a toilet, reappearing at a most delicate moment, much to the shock of a seated homeowner .\ni jump out of the window and run across the road to the neighbors house until my family returns. when i see the car pull in we all go inside. but the demon - hell - prawn is nowhere to be found .\nunfortunately we didn’t think to put anything next to the prawn for scale. but wiki says prawns grow to 7 - 8 centimeters (2. 8 inches), which is approximately the length of a man’s thumb. i’d say that’s about right .\nas much as the film’s message is about difference and tolerance, it is also about the aliens’ attempts – as e. t. (1982) might put it –' to go home'. at best, the prawns are viewed as ‘pests’ by the humans as they have inhabited their world. this, of course, is why wikus’ is tasked with overseeing the mass eviction of the alien prawns from the town to a huge camp out - of - town. unlike the parktown prawn though they do more than infest the home, they overrun the structures of social order and social categorisation as well. it is only when wikus begins metamorphosing into a prawn himself does he begin to understand these beings and begin to understand that social categories of place, space, home and alien are malleable, constantly shifting and, most importantly, socially generated. during his metamorphosis, and of possible interest to douglas, wikus also begins to see the humans with their powerful weaponry and interest in acquiring the alien weaponry as more dangerous than the prawns. just as the parktown prawn is mischaracterised as a prawn (they are actually king crickets), wikus, realises he has mischaracterised the district 9 aliens. they are more than bottomfeeders - they too have a society, and they too have families. most importantly, they too have homes, and the slums they are forced to inhabit on earth are not brought under control enough for the prawns' liking so as to appropriately function as a new' home' .\nthey are considered pests by some south africans, and held in high regard by others. they are most visibly prevalent after rain during summer, which is when they are most likely to be found indoors. parktown prawns seem to be more active at night .\nthen i reconsidered. i fetched my phone and crept back into the room. i got within four feet of the prawn. he moved one of his long tentacles, slightly. that hint of a movement was enough to send me screaming away again .\nfemale parktown prawns on the other hand can be easily identified by the long spear - shaped tip of their abdomen. this is not a sting, but rather an ovipositor, the device she uses to insert her eggs into the soil where they hatch into nymphs .\nthey are also known to chew on wooden floor boards and wooden furniture. gardens that have a high population of parktown prawns will have almost no snails, thus, they can be considered an effective and natural form of pest control. among their natural predators are the\nhi! nice post, great read. and i am also enjoying your blog a lot. 🙂 just a biologist’s note: they are not tentacles, but antennas! and yeah, i admit i would fit right into the prawn lovers’ group. 😛 nuno\nhi bili, no, parktown prawns are not poisonous and i don’t think they bite. they will, however, spray you with smelly fecal liquid. i’ve only heard about this – it’s never actually happened to me. otherwise they are totally harmless – just really disgusting .\nsomething that reminds me very much of parktown prawns, and which i’ve come across often in the klaserie (hoedspruit / kruger park) area are red romans… urltoken equally freaky and panic - inducing. something to check out with the locals, if you’re ever in that area .\nparktown prawn has strongly developed mandibles which are present in the final juvenile stage, and reach their growth peak in the adult stage. one of the largest males collected measures 53 millimetres (just over two inches) from the tip of the mandibles to the rear of the abdomen and 157 millimetres from the tip of the antennae to the hindfeet. the actual function of the mandibles of the males is at present unknown, although it has been noted that the males defend themselves by gripping and throwing the offender over its shoulder with the use of these strong mandibles .\nmy mom used to live in parktown in the 70s. she still recounts stories of the fokken prawns in the alleys after a night out, massive bloody things. she hates going back to jhb now, but i think that' s more to do with the crims in the alleys .\ntiny little parktown prawns are born which look just like mum and dad but without the spear or tusks. they will moult and grow, avoiding predators such as birds and rodents. that is until they reach maturity and go through the gamut of sex to get their genes into the next generation .\nbut, say the prawn' s defenders, why kill them? they are $ h harmless and, if you get them back out into your garden, will go about their useful job of getting rid of pesky snails and generally cleaning the place up like some small - scale vulture .\ni visited south africa once and the owner of the bed and breakfast i was staying in owned two baby meerkats. he allowed me to play with them for a few hours and i saw them eat a fair number of parktown prawns; it wasn' t pretty but it sure as hell was cute .\nnicole maritz is an online marketing executive at rentokil initial in johannesburg. although she is in love with nature and its elements, the creepy crawlies do sometimes get to her - especially jo' burg' s repulsively large, hissing parktown prawns! follow nicole on twitter for updates on the weird and the wonderful .\nhi pipa, welcome to joburg! i can’t believe you saw a prawn as soon as you arrived! it took me months to finally see one in real life. i think it is just something that we have to get used to…hopefully not too frequently though! good luck settling into your new home 🙂\nby far the best known king cricket species in south africa is libanasidus vittatus, otherwise known as the parktown prawn, a reference to the fact that they often stumble into swimming pools in the affluent suburbs of johannesburg, south africa. the natural habitat for this genus is in and around forests in mpumalanga, northern province and probably also zimbabwe. during the day they can be found in burrows or under logs. specimens have also been collected in gardens in johannesburg, randburg and pretoria. a few articles have been written on the biology these insects, but very little is known about any other species of african king crickets .\nsome years ago, i proposed that “proteas” was a namby - pamby name for our national cricket team and that we should simply call our team the king crickets affectionately known as the parktown prawns. think about it — they’re nimble, they’re quick, they’re scary, they will look great on tee shirts and bumper stickers…\nyou know what grossed me out even more? our cat brought a caterpillar type thing, half dead, but alas not all dead, to our doorstep. i think it might have been the embryo form of that prawn, it was so fat and green and ugly. now that really freaked me out !\nparktown prawns are actually king crickets – a large family of flightless insects found across the southern hemisphere including south america, australia and new zealand. in new zealand, they are known as wetas and fill a variety of ecological niches – possibly including that of mice, which were absent from the local fauna before humans arrived .\ni pop my head out of the shower again. try to see what could be causing it and start to climb out of the shower to get a better angle. as i put out my left leg i see the mother of all parktown prawns shoving the door open in arrogance, strutting into the bathroom like an angry bulldog .\nthese disgusting pests – featured as alien prawns in the movie, district 9 –are known to jump up to a distance of around a meter into the air when they are cornered, and also tend to excrete revolting black faecal liquids when threatened. furthermore, parktown prawns produce hissing sounds by rubbing their hind legs against their abdomen when they are distressed (\nshe worries that they may be threatened. another south africa native that has adapted to urban gardens, the hadeda ibis, enjoys prawn dinners. fat gray hadedas, named for their raucous'' hah - dee - dah'' cries, are on the increase and prawns'' are getting harder to find each year,'' professor crump said sadly .\nthe parktown prawn is one of the larger insects found in johannesburg homes. a large specimen may grow to be 10 cm (3. 9 in) or more, with long whip - like antennae extending to 10 cm (3. 9 in), but are usually around 4 cm (1. 6 in) to 5 cm (2. 0 in) in length, with 2 cm (0. 79 in) antennae. the exoskeleton is orange to light brown, with darker brown or black stripes along the thorax and abdomen, which gives it a toxic look to would - be aggressors. the legs have downward - facing hooked barbs, which allow it climb up walls and trees. a large specimen can jump more than a metre high .\na couple of years ago, i saw a star billboard with the legend, “where have all the parktown prawns gone? ” or something to that effect. well, so far as i can see, they’re still with us. in rainy weather, they emerge quite frequently around my fairmount home. even then, though, they are not nearly as numerous as they were in parkmore .\nif there are any current parkmore residents reading this, i’d be interested to learn whether the suburb is still prawn city. also a point of interest — are these creatures unique to south africa? i read somewhere that they mutated in the eastern cape and somehow found their way up to jo’burg. maybe there is someone out there who can go beyond the urban myth and tell us .\nfemale parktown prawns, on the other hand, possess a well - developed ovipositor, through which they lay their eggs (between 80 to 200 eggs). one of the largest females researched measures 64 millimetres from the front of its head to the tip of its ovipositor. the ovipositor is 19 millimetres long and the total length of the insect, including legs and antennae, is an astonishing 166 millimetres (six and a half inches) .\nwondering how to get rid of parktown prawns? as humans find these crawling insects (or should we say – ‘jumping insects! ’) to be hideously scary, hadidas seem to think they make the perfect mid - morning snack. these unsung heroes may help the casual intruder from entering your home but if you do encounter a more serious infestation of the third kind, contact the pest control experts for a solution to eliminate these critters from your home .\ni think that they [ the prawn ] do have a home planet, it' s pretty far away probably in the andromeda galaxy, but what i like is that they' ll live on the ship for thousands of years. obviously, there' s much more of a population on the main planet, but the ships will go out and get the minerals and the ore and whatever resources they need and then bring them all back home .\nfew americans - - even few new yorkers, who can keep their cool around cockroaches the size of the villain of'' men in black'' - - have heard of parkies. they are lucky. johannesburg is rife with stories of locals who have leapt shrieking from their beds, flung shoes out windows and nearly crashed their cars, all because they found themselves mandible to mandible with a big orange wiggly - antennaed, barbed - leg prawn .\nkorinkriek, once when i was in namibia i was approached by a huge yellow and black korinkriek. i was busy shovelling coals into the braai fire. i chopped the cricket in half with the spade upon which the front part of the beast turned around and started to eat the back half. self cannibalism was something i had never thought of before but here it was. sadly i did not photograph it for the scientists to comment on. about snails though, we still have plenty of snails in the garden so that is why i think that pp’s prefer themselves to snails? ? i don’t know if hadedas eat snails? ? one evening when i was out on a business visit, i received a desperate cry for help from my wife via cell phone. there was a prawn in the passage and she could not get from the bedroom into the kitchen. i was to come home immediately and save her. i agreed and two and a half hours later i arrived back at home to find her sitting on a stool, with her feet up in the air, waiting to be rescued whilst the prawn was sitting quietly in a corner. i figured that the prawn would just wonder off so i did not rush home. have never been forgiven. this is turning into an interesting topic. perhaps we should get 702 to have a session on pp’s ?\nuntil about 1965 the “prawn” was almost unknown in johannesburg, but then the populations increased for some unknown reason, and they started to become notorious. in 1985 it was suggested that they could have been introduced into johannesburg from somewhere near barberton, but we now know that these insects were already present in pretoria in january 1955, because there is a specimen in the transvaal museum, collected by george van son, who was curator of entomology at the time." ]
{ "text": [ "\" parktown prawn \" is a common name for libanasidus vittatus , a species of king cricket endemic to southern africa .", "it is unrelated to prawns , libanasidus being insects in the order orthoptera – crickets , locusts and similar insects .", "the king crickets are not really crickets either : they belong to the family anostostomatidae , whereas true crickets are in the gryllidae .", "the insect gets its english name from the suburb of parktown in johannesburg , south africa where they are common .", "in angola , it is found in the southern savanna and semi-arid regions , whereas in namibia it is found throughout the territory .", "the parktown prawn is related to the new zealand tree weta , which is also in the family anostostomatidae .", "the parktown prawn is held in low regard by many householders , but gardeners value them for controlling garden snail populations and attracting the hadeda ibis .", "the animal is omnivorous , with a diet that includes snails , other invertebrates , and vegetable matter .", "in urban environments , they will readily take food made available by suburban dwellers , including cat food and dog food and their droppings . " ], "topic": [ 25, 12, 28, 25, 20, 26, 23, 8, 15 ] }
"" parktown prawn " is a common name for libanasidus vittatus, a species of king cricket endemic to southern africa. it is unrelated to prawns, libanasidus being insects in the order orthoptera – crickets, locusts and similar insects. the king crickets are not really crickets either: they belong to the family anostostomatidae, whereas true crickets are in the gryllidae. the insect gets its english name from the suburb of parktown in johannesburg, south africa where they are common. in angola, it is found in the southern savanna and semi-arid regions, whereas in namibia it is found throughout the territory. the parktown prawn is related to the new zealand tree weta, which is also in the family anostostomatidae. the parktown prawn is held in low regard by many householders, but gardeners value them for controlling garden snail populations and attracting the hadeda ibis. the animal is omnivorous, with a diet that includes snails, other invertebrates, and vegetable matter. in urban environments, they will readily take food made available by suburban dwellers, including cat food and dog food and their droppings."
[ "\" parktown prawn \" is a common name for libanasidus vittatus, a species of king cricket endemic to southern africa. it is unrelated to prawns, libanasidus being insects in the order orthoptera – crickets, locusts and similar insects. the king crickets are not really crickets either: they belong to the family anostostomatidae, whereas true crickets are in the gryllidae. the insect gets its english name from the suburb of parktown in johannesburg, south africa where they are common. in angola, it is found in the southern savanna and semi-arid regions, whereas in namibia it is found throughout the territory. the parktown prawn is related to the new zealand tree weta, which is also in the family anostostomatidae. the parktown prawn is held in low regard by many householders, but gardeners value them for controlling garden snail populations and attracting the hadeda ibis. the animal is omnivorous, with a diet that includes snails, other invertebrates, and vegetable matter. in urban environments, they will readily take food made available by suburban dwellers, including cat food and dog food and their droppings." ]
"animal-train-22"
"animal-train-22"
"2673"
"round island burrowing boa"
[ "native to round island, a tiny island off the coast of mauritius, the round island burrowing boa preferred to live on the topsoil layers of ...\nthe round island burrowing boa (bolyeria multocarinata) is a species of snake that went extinct in 1975. the boa was native to a small island off the coast of mauritius called round island .\njones, c. g. (1988). round island boa eats serpent island gecko .\ncousin, the round island burrowing boa has not been seen since 1996 and is believed to be extinct. more\nthe round island burrowing boa is classified as extinct (ex), there is no reasonable doubt that the last individual has died .\nwikipedia article copyright notice: this article is licensed under the gnu free documentation license. it uses material from the wikipedia article\nround island burrowing boa\n.\nnative to round island, a tiny island off the coast of mauritius, the round island burrowing boa preferred to live on the topsoil layers of volcanic slopes. it was once found on several other islands around mauritius, but its population had dwindled by the 1940s, and it could only be found on round island after 1949. it was last seen in 1975 .\nkorsós z, trócsányi b, 2006. the enigmatic round island burrowing boa (bolyeria multocarinata): survival in the wild remains unconfirmed. african herp news 40: 2 - 7 .\nglenn, c. r. 2006 .\nearth' s endangered creatures - round island burrowing boa facts\n( online) - licensed article from wikipedia: the free encyclopedia. accessed\nfacts summary: the round island burrowing boa (bolyeria multocarinata) is a species of concern belonging in the species group\nreptiles\nand found in the following area (s): indian ocean (mauritius). this species is also known by the following name (s): round island bolyeria boa .\nin the mascarene islands with a description of the distinctive population on round island .\ndaszak, p. (1995). prevalence of endoparasites in round island reptiles .\nthe round island burrowing boa, or bolyeria, was a reptile native to the round island in mauritius. the reptile endemic to hardwood forest and palm savanna had a small habitat, ranging about 1. 5 to 2 square km. limited distribution had already made it vulnerable to extinction. more\nvinson, j. - m. (1975). notes on reptiles of round island .\ne) measure tail length, body length, weight and contemplate its essence, its zen, its remarkable burrowing boa - ness .\nfound only on round island off the north coast of mauritius in the indian ocean (5) .\nembed this arkive thumbnail link (\nportlet\n) by copying and pasting the code below. < a href =\nurltoken\ntitle =\narkive species - round island keel - scaled boa (casarea dussumieri )\n> < img src =\nurltoken\nalt =\narkive species - round island keel - scaled boa (casarea dussumieri )\ntitle =\narkive species - round island keel - scaled boa (casarea dussumieri )\nborder =\n0\n/ > < / a >\nalthough originally placed in the genus boa, this species differs so greatly from seemingly - related snakes that is now classified in its own genus and family (bolyeridae). the family’s only other member, the round island burrowing boa (bolyeria multacarinata), has not been seen since 1975 and is presumed extinct .\ncundall d, irish fj, 1989. the function of the intramaxillary joint in the round island boa, casarea dussumieri. journal of zoology 217: 569 - 598 .\nthe introduction of rabbits and goats to the island in 1840 resulted in damage to the vegetation, consequently causing soil erosion on the volcanic slopes and deterioration of palm forest habitat. this decline in habitat quality is thought to have been the main reason for the extinction of the round island burrowing boa .\nanother group of reptiles, the snakes, are so secretive that countless species have probably gone extinct without our even knowing that they existed in the first place. others that we were aware of have disappeared. a snake known as the round island burrowing boa was last reported from the island in the indian ocean in the 1970s. goats and rabbits brought to the small island by settlers are the presumed cause of its disappearance. like that of the dodo and the giant tortoise, the fate of the round island burrowing boa adds another mournful note to the sad ballad of human - caused extinction .\nd) ban all further travel to the island so that other burrowing boas, if they exist, can live in peace; whether it thrives will be a new mystery for the island .\nbolyeria multocarinata was formerly restricted to round island, a 151 ha volcanic islet approximately 0. 25 ha nne of mauritius .\nthe round island boa is now confined to round island, a tiny speck of habitat where perhaps 500 - 1, 000 individuals survive. a single wild population and limited number of captives place it at continued risk of extinction. the new population to be established on another mauritian island (where the snake formerly lived) is a vital step towards ensuring the species’ survival .\njustification: formerly restricted to round island, mauritius, this species has not been recorded since 1975. soil erosion and a general decline in habitat quality have been blamed for the extinction of this boa .\nthe island selected for the new round island boa population has been cleared of the introduced black rats, goats and rabbits that previously destroyed the habitat and prey base. the snake’s primary food, the telfair’s skink (leiolopisma telfairi), was released on the island in 2007 and is now well - established. like other mauritian reptiles, telfair’s skink has been eliminated from much of its range, but survives on round island and at the durrell wildlife trust .\nthe round island burrowing boa reached a length of about 1 m (39 in). preserved specimens have reported total lengths of 54 - 140 cm (boullenger 1893; vinson 1949; vinson 1975; bullock 1977). vinson (1949) even claimed that its maximum size was 1, 8 m. more\nmaisano ja, rieppel o, 2007. the skull of the round island boa, casarea dussumieri schlegel, based on high - resolution x - ray computed tomography. journal of morphology 268: 371 - 384 .\ncause of extinction: the introduction of non - native species of rabbits and goats to the island destroyed vegetation and upset the boa’s habitat .\nbullock, d. j. (1986). the ecology and conservation of reptiles on round - island and gunner quoin, mauritius .\nfor my present project of writing stories about extinct species, my challenge has been to figure out how to tell the story in such a way that the reader appreciates what has been lost. like a eulogy, the intention is to celebrate the species. round island is 22 kilometers north of mauritius, the former home of the dodo, and suffered from the introduction of rabbits and goats in the 19 th century, which destroyed the burrowing boa’s habitat. there is a recovery plan for the burrowing boa and it contains a poignant line that i used in the preamble: “staff on round island cherish the hope that the burrowing boa is not extinct, and it will be encountered some day. ” i was so touched by that dedication and love that i thought the rest of the recovery plan should reflect it, so i modified the plan into the present piece .\nthe boas to be reintroduced were collected from round island, and will first be monitored to assure that they are genetically diverse and disease - free .\nthe round island boa’s preferred habitat – forest and palm - dotted savannah – has been largely reduced to brushy scrub by agricultural development, introduced rabbits and goats. rat predation on young snakes and skinks has contributed to the species’ drastic decline .\nthe round island boa is oviparous, and changes in color from bright orange to grayish - brown as it matures. there are some indications that females remain with their eggs for a time. unique scalation lends the alternative common name of keel - scaled boa. juveniles and some adults (especially females) appear to be largely arboreal .\na) pay proper respects. its ancestors have lived on round island since it first boiled out of the ocean off the north coast of mauritius thousands of years ago .\nbloxam, q. m. c. b. and tonge, s. j. (1986) the round island boa casarea dussumieri breeding programme at the jersey wildlife preservation trust. dodo. j. jersey wildl. preserv. trust, 23: 101 - 107 .\nthis fossorial boa was found in the palm groves of mid - altitude top - soil layers on volcanic slopes .\nthe emptiness gapes at us. once there was a mystery barely glimpsed in a century and now there is a void that expands by the day. time is a labyrinth with myriad secret passages and what we wouldn’t give to find the one that undoes the sins of our fathers. that being what it is, the staff on round island cherish the hope that the burrowing boa is not extinct, and it will be encountered one day .\nd) note time, place, weather, any other animals present near resight. tune in to the boa’s zeitgeist .\nvinson, j. (1953). some recent data on the fauna and flora of round and serpent islands .\nhabitat loss has been rife throughout the mascarene islands. vast tracts of native forest (over 90 %) have been cleared to make way for agriculture and on round island the introduction of rabbits and goats has further damaged native flora (7); however, these were removed during the 1980’s. perhaps 500 adults remain (with a total population of approximately 1000 individuals) on the 159 - hectare round island (1) .\n]) and endangered (e. g. , the balearic island lilford’s wall lizard, [\nnorth, s. g. , bullock, d. j. , & dulloo, m. e. (1994). changes in the vegetation and reptile populations on round - island, mauritius, following eradication of rabbits .\nthe round island keel - scaled boa is one of the world' s rarest snakes (2). this slender snake may reach up to 1. 5 metres in length, the upper surface is generally dark brown whilst the underside is lighter with very dark spots. the body is covered in small, keeled scales that give rise to the species' common name (2) .\nhistorically inhabited tropical hardwood forest and palm savannah, but since the introduction of goats and rabbits to the island much of this habitat has been destroyed. as a result of habitat degradation the boa currently persists in degraded palm savannah and shrub layer vegetation (1) .\n) on barro colorado island. panama conserv genet. 2009, 10 (2): 347 - 358 .\nmcalpine df, 1983. correlated physiological color change and activity patterns in an indian ocean boa (casarea dussumeri). journal of herpetology 17: 198 - 201 .\nhallermann j, glaw f, 2005. evidence for oviparity in the extinct bolyeriid snake bolyeria multocarinata (boie, 1827). herpetozoa 19: 82 - 85. korsós z, trócsányi b, 2002. herpetofauna of round island, mauritius. biota 3: 77 - 84 .\nsmith bj: boa: an r package for mcmc output convergence assessment and posterior inference. j stat softw. 2007, 21 (11): 1 - 37 .\nthe durrell wildlife trust became the first institution to breed the round island boa, and maintains most of the captive population. founded by legendary conservationist and author gerard durrell, this unique organization focuses on critically endangered animals and plants, especially those overshadowed by pandas, rhinos and other “charismatic mega - vertebrates”. the trust was the first to breed the giant jumping rat, lesser antilles iguana, flat - tailed tortoise and scores of others (please see article below) .\nmac arthur rh, wilson eo: the theory of island biogeography. 1967, princeton university press, princeton, n. j\nbiber e: patterns of endemic extinctions among island bird species. ecography. 2002, 25 (6): 661 - 676 .\na) rejoice that for now, the burrowing boa has avoided slipping into legend like the many other mascarene species, including the dodo, giant tortoise, night - heron, rail, red rail, solitaire, gallinule, hoopoe starling, gray parrot, owl, kestrel, blue pigeon, giant skink, day gecko, shelduck, and flightless ibis. announce it to the wind, write a message in a cloud, commission a cantata for the prodigal serpent, so oblivious to its precarious fate .\ngroombridge j: genetics and extinction of island endemics: the importance of historical perspectives. anim conserv. 2007, 10 (2): 147 - 148 .\njamieson ig: has the debate over genetics and extinction of island endemics truly been resolved? . anim conserv. 2007, 10 (2): 139 - 144 .\njamieson ig: role of genetic factors in extinction of island endemics: complementary or competing explanations? . anim conserv. 2007, 10 (2): 151 - 153 .\n]) that are considered as least concern. moreover, the values are also lower to those reported for island squamate species described as vulnerable (e. g. , the komodo dragon, [\ngillespie rg, claridge em, roderick gk: biodiversity dynamics in isolated island communities: interaction between natural and human - mediated processes. mol ecol. 2008, 17 (1): 45 - 57 .\nbloor p, de laguna ihb, kemp sj: highly polymorphic tetranucleotide microsatellite loci for the eastern canary island lizard, gallotia atlantica. mol ecol notes. 2006, 6 (3): 737 - 739 .\nmauritius, an island nation off the coast of southeast africa, is best known to naturalists as the site of the dodo bird’s extinction (mauritius also is, in a sense, the reason i was hired by the bronx zoo and spared life as a lawyer – see article below for the story !). herp enthusiasts, however, know it as the habitat of several unique reptiles, all of which are now very rare or extinct. but we can delight in some news just released by the durrell wildlife trust – a new population of the round island or keel - scaled boas, casarea dussumieri, will soon be established in the wild. this unusual snake disappeared from nearly all of its range in the 1860’s, and its return is the culmination of 40 years’ worth of captive breeding and habitat restoration efforts .\nb) suggests that the species inhabited most of the island of la gomera from the coast throughout the xerophilic region (except in the laurisilva subtropical forest area at high altitudes) prior to the arrival of humans (ca. 2, 500 years ago) [\n. each of these three species of giant lizards is endemic to a single island, el hierro, tenerife, and la gomera, respectively. because of their restricted distribution, these three giant lizards are highly threatened and for many years they were thought to be extinct (figure\nmourer - chauviré, c. , r. bour, s. ribes, and f. moutou. 1999. the avifauna of réunion island (mascarene islands) at the time of the arrival of the first europeans. smithsonian contributions to paleobiology 89: 1 - 38 .\n]. yet, the extraordinary biodiversity of islands is relatively fragile. because island endemics have evolved in an environment protected by isolation, they are particularly susceptible to ecological threats (e. g. , predation by or competition with invasive species, habitat loss, and human pressure) [\none group of reptiles that clearly seem to have gone extinct are some of the giant tortoises that once lived on oceanic islands visited by early european adventurers. take, for example, the island of mauritius. less than a century after it was discovered by european explorers, one of its avian denizens, the dodo bird, had completely disappeared, and by the early 1700s the mauritian tortoise that inhabited the island had also been driven to extinction. the demise of the tortoises on mauritius and other islands is believed to have been the result of overexploitation by the first human visitors to the region .\n]. genetic data could allow discriminating between either alternative hypotheses by estimating whether population decline predated or not the arrival of humans to the island. moreover, the combination of ancient natural processes and more recent anthropogenic activities may have had a synergetic effect that could best explain the current threatened status of the species .\nlist of all endangered animals. list of all endangered plants. list of all endangered species (animals & plants). by species group (mammal, birds, etc)... united states endangered species list. browse by country, island, us state... search for an endangered species profile .\nin a family of their own. other lizard - eating snakes have analogous adaptations for grasping their hard - bodied prey, but no group takes this adaptation to such extremes as the bolyeriids. but think - on an island with no mammals and few birds, with little else but lizards to eat, selection is stronger than anywhere else for adaptations to saurophagy .\njustification of ecoregion delineation the mascarene islands are composed of three main islands: réunion, mauritius, and rodrigues, and some islets. although each island contains distinct flora and fauna, they were included in a single ecoregion due to their possession of some shared endemic species, their similar volcanic history and geophysical characteristics, and their wide separation by sea from other land masses .\ndescription location and general description this ecoregion covers the three main islands, réunion, mauritius, and rodrigues, and a number of smaller islets of the mascarene islands. the largest islands are the french dependent territory of réunion (2, 500 km2), and the island of mauritius (1, 900 km2), which together with rodrigues (110 km2) forms the single independent nation of mauritius. the nearest landmass is madagascar, 680 km northwest of réunion .\nthe giant lizard of la gomera (gallotia bravoana), is an endemic lacertid of this canary island that lives confined to a very restricted area of occupancy in a steep cliff, and is catalogued as critically endangered by iucn. we present the first population genetic analysis of the wild population as well as of captive - born individuals (for which paternity data are available) from a recovery center. current genetic variability, and inferred past demographic changes were determined in order to discern the relative contribution of natural versus human - mediated effects on the observed decline in population size .\nclearly, dinosaurs are not the only reptiles that have gone extinct; extinction in modern times has occurred. of course, the likelihood of people discovering a new island and subsequently causing the extinction of its native wildlife is close to nil. but a far greater threat exists: environmental complacency - - the mistaken belief that the world' s animals and plants are doing fine. they are not. and the time to protect the environment and preserve natural habitats is not when a specific plant or animal is endangered or borders on extinction. the time to act is now .\nafter its rediscovery, a conservation programme (within the framework of two eu life projects) was established on the island, focused mainly on captive breeding and on census monitoring of the natural population. for the captive breeding programme, nine founders (five females and four males) were captured in the wild between 1999 and 2000, and used to found the captive population. the founders reproduced successfully for the first time in 2001 at the recovery centre of la gomera giant lizard, resulting in about 40 captive - born offspring by 2005, and 121 captive - born individuals by 2010 [\npopulations since at least 13, 000 years ago, which could be related to environmental disturbances such as past climatic changes or volcanic eruptions. however, shorter generation time priors supported instead that the onset of the decline would be related to the human arrival to the islands about 2, 500 years ago. in fact, the 95% high posterior densities associated to the estimates were relatively large and thus, it is not possible to fully discriminate among competing scenarios, as well as to discard a synergetic effect of human activities and lon - term environmental or genetic factors in the decline of the giant lizard populations on the island .\nthe vegetation of the islands was originally quite diverse, ranging from coastal wetlands and swamp forests, through lowland dry forest, rain forest, and palm savanna to montane deciduous forests and finally (on réunion) to heathland vegetation types on the highest mountains. most of the original vegetation is now destroyed. moreover, almost all remaining native plant communities are badly degraded by introduced species (wwf and iucn 1994). major plant families include sapotaceae, ebenaceae, rubiaceae, myrtaceae, clusiaceae, lauraceae, burseraceae, euphorbiaceae, sterculiaceae, pittoscoraceae, and celastracea. on réunion much of the island has been reforested and now contains almost 40 percent forest cover (henkel and schmidt 2000) .\nlizards are another group of reptiles in which some species have disappeared in modern times. as if extinction of the dodo and the tortoise were not enough to lay at the feet of mauritius' s discoverers, a lizard known as the mauritianus giant skink disappeared during the 1600s. virtually all lizard species confirmed to have gone extinct have not been seen in at least a half century and most not since the 1800s. some were once found on caribbean islands, including jamaica and navassa island near haiti. the introduction of mongooses to jamaica is considered by some authorities to be a contributing factor in the demise of several lizard species. specimens of the now - extinct lizards were preserved in museums long ago thus confirming that they once existed .\ncurrent status mauritius has one of the highest human population densities in the world, 634 persons / km2 (cia 2000). on all of the mascarene islands, there has been a vast loss of the original forest habitat (stuart et al. 1990). on réunion, it is estimated that less than 40 percent of the island is covered with natural vegetation; on mauritius, only about 5 percent of the natural vegetation survives; and on rodrigues, the natural vegetation covers around 1 percent of the total land area. different agents have caused this loss of habitat. on réunion, forest and other habitat is cleared for agriculture and degraded through the introduction of alien plants. on mauritius, sugar cane, tea, and conifer plantations have replaced the natural vegetation. on rodrigues, the effects of feral animals and shifting cultivation have changed the forest habitats to a savanna with scattered trees, and introduced plants have then taken over the remaining habitats .\nhtml public\n- / / w3c / / dtd xhtml 1. 0 strict / / en\nurltoken\nthank you for taking the time to provide feedback on the iucn red list of threatened species website, we are grateful for your input .\ngland, switzerland, 5 july 2018 (iucn) – australia’s unique reptiles – including lizards and snakes – face severe threats from invasive species and climate change, with 7% of th ...\nthe value of medicinal and aromatic plant trade has increased three - fold in the past 20 years, but traditional harvesting practices are being replaced by less sustainable alternatives... .\na recently released iucn technical brief recommends increasing investments in sustainable land management practices, as well as better cooperation between agriculturalists and conservationists to conse ...\nhtml public\n- / / w3c / / dtd html 4. 01 transitional / / en\nurltoken\nmcdiarmid, roy w. , jonathan a. campbell, and t' shaka a. touré\nsnake species of the world: a taxonomic and geographic reference, vol. 1\ndisclaimer: itis taxonomy is based on the latest scientific consensus available, and is provided as a general reference source for interested parties. however, it is not a legal authority for statutory or regulatory purposes. while every effort has been made to provide the most reliable and up - to - date information available, ultimate legal requirements with respect to species are contained in provisions of treaties to which the united states is a party, wildlife statutes, regulations, and any applicable notices that have been published in the federal register. for further information on u. s. legal requirements with respect to protected taxa, please contact the u. s. fish and wildlife service .\nto make use of this information, please check the < terms of use > .\nbaillie, j. and groombridge, b. (eds). 1996. 1996 iucn red list of threatened animals. pp. 378. international union for conservation of nature, gland, switzerland and cambridge, uk .\ngroombridge, b. 1992. global biodiversity: status of the earth’s living resources. report compiled by the world conservation monitoring centre. chapman and hall, london .\ngroombridge, b. (ed .). 1994. 1994 iucn red list of threatened animals. iucn, gland, switzerland and cambridge, uk .\niucn. 1979. red data book vol 3: amphibia and reptilia. international union for the conservation of nature and natural resources, switzerland .\niucn. 1990. iucn red list of threatened animals. iucn, gland, switzerland and cambridge, uk .\niucn conservation monitoring centre. 1986. 1986 iucn red list of threatened animals. iucn, gland, switzerland and cambridge, uk .\niucn conservation monitoring centre. 1988. iucn red list of threatened animals. iucn, gland, switzerland and cambridge, uk .\ncan' t find a community you love? create your own and start something epic .\ndaniel hudon, originally from canada, is an adjunct lecturer in astronomy, physics, math, and writing in boston. he is the author of a nonfiction book, the bluffer’s guide to the cosmos (oval books, uk) and a chapbook of prose and poetry ,\nevidence for rainfall\n( pen and anvil). he has recent work appearing in written river, the chattahoochee review, { ex } tinguished and { ex } tinct: an anthology of things that no longer { ex } ist, clarion, riprap, paragraphiti, toad, and canary. some of his writing links can be found at urltoken he lives in boston, ma .\nb) preserve in pure ethyl alcohol for the curious to see that somewhere in the world, a single specimen of the species, not seen since 22. 08. 1975 and representing a lineage that is 150 million years old, exists .\nc) notify the international union for conservation of nature about the specimen, and that, contrary to our greatest fears, the species may not be extinct .\nb) capture in a cloth bag. lure with words from emily dickinson or elizabeth bishop. boas are suckers for short, sinuous lines .\nc) take photographs of complete body, head, scale, and cloacal pattern. make sure to get its best side .\nf) release animal and follow from a distance to observe behavior and movement. note its stealthy silence, its rapid sidewinding and concertina motions. once they are free, boas never look back .\nin the event of non - rediscovery, notify the wailing women and the griots. add a stone to the life cairn. the world we know is disappearing but try to cope as best you can .\nhtml public\n- / / w3c / / dtd xhtml 1. 0 strict / / en\nurltoken\nthis dutch butterfly a subspecies of the alcon blue was found mainly in the grasslands of the netherlands. while closely related species (pi ...\nthe stunning madeiran large white butterfly was found in the valleys of the laurisilva forests on portugal’s madeira islands. the butterfly & ...\nthe reintroduced population will be closely monitored by durrell wildlife trust staffers and other conservation organizations. in addition to establishing a new population, the project may serve as a template for future herp recovery efforts. i’ll post updates as they become available .\nthere are many other success stories, as well as failures. please post your own thoughts and examples below so that i can share them with readers and researchers. thanks .\nbeing born with a deep interest in animals might seem unfortunate for a native bronxite, but my family encouraged my interest and the menagerie that sprung from it. jobs with pet stores and importers had me caring for a fantastic assortment of reptiles and amphibians. after a detour as a lawyer, i was hired as a bronx zoo animal keeper and was soon caring for gharials, goliath frogs, king cobras and everything in - between. research has taken me in pursuit of anacondas, orinoco crocodiles and other animals in locales ranging from venezuela’s llanos to tortuguero’s beaches. now, after 20 + years with the bronx zoo, i am a consultant for several zoos and museums. i have spent time in japan, and often exchange ideas with zoologists there. i have written books on salamanders, geckos and other “herps”, discussed reptile - keeping on television and presented papers at conferences. a master’s degree in biology has led to teaching opportunities. my work puts me in contact with thousands of hobbyists keeping an array of pets. without fail, i have learned much from them and hope, dear readers, that you will be generous in sharing your thoughts on this blog and web site. for a complete biography of my experience click here .\nthatpetblog: hi snakie mom! i hope to answer some of your questions, and ...\nsnakiemommie: i have been told a few conflicting things that i want to kno ...\npms214: hi, i' ve thoroughly enjoyed reading this blog. very informat ...\nwildathart: neat article! !! i' m mostly commenting because callisoma scru ...\neyeballkid: for anyone having difficulty keeping an uromastyx healthy, i ...\nthat reptile blog is designed to help promote knowledge of the pet hobby. if you wish to reference or cite specific information from a blog post, we ask that you provide a link back to the original. the content on that reptile blog is copyright protected and may not be duplicated without written permission. if you have any questions on this policy, feel free to send us an email at blogs @ thatpetplace. com. © copyright 2013, all rights reserved .\neryx multocarinata boie 1827: 513 tortrix pseudo - eryx schlegel 1837: 19 bolyeria pseudo - eryx — gray 1842: 46 platygaster multicarinatus — duméril & bibron 1844: 497 (emendation) bolyeria multicarinata — gray 1849: 106 platygaster multicarinatus — jan 1861 platygaster multicarinatus — jan 1862: 247 bolieria multicarinata — boulenger 1893: 122 bolyeria multocarinata — stimson 1969: 4 bolyeria multocarinata — mcdiarmid, campbell & touré 1999: 213 bolyeria multocarinata — wallach et al. 2014: 108 bolyeria multomaculata — bauer 2017 (in error )\nconservation: may be extinct now (fide glaw, pers. comm .) type species: tortrix pseudoeryx schlegel 1837 is the type species of the genus bolyeria gray 1842 .\nbauer, a. m. 2017. book review: los anfibios y reptiles extinguidos. herpetofauna desaparecida desde el año 1500. herpetological review 48 (2): 467 - 468\nbauer, a. m. and r. günther 2004. on a newly identified specimen of the extinct bolyeriid snake bolyeria multocarinata (boie, 1827). herpetozoa 17 (3 / 4): 179 - 181 - get paper here\nboie, f. 1827. bemerkungen über merrem' s versuch eines systems der amphibien, 1. lieferung: ophidier. isis van oken 20: 508 - 566. - get paper here\nboulenger, g. a. 1893. catalogue of the snakes in the british museum (nat. hist .) i. london (taylor & francis), 448 pp. - get paper here\nduméril, a. m. c. and g. bibron. 1844. erpetologie générale ou histoire naturelle complete des reptiles. vol. 6. libr. encyclopédique roret, paris, 609 pp. - get paper here\ngoin, c. j. , goin, o. b. & zug, g. r. 1978. introduction to herpetology, 3rd ed. w. h. freeman & co. , san francisco\ngray, j. e. 1849. catalogue of the specimens of snakes in the collection of the british museum. edward newman, london, i - xv; 1 - 125. - get paper here\nguibé, j. & roux - estève, r. 1972. les types de schlegel (ophidiens) présents dans les collections du muséum national d' histoire naturelle de paris. zoologische mededelingen 47: 129 - 134 - get paper here\nhallermann, j. & glaw, f. 2006. evidence for oviparity in the extinct bolyeriid snake bolyeria multocarinata (boie, 1827) [ short note ]. herpetozoa 19: - get paper here\njan, g. 1862. ueber die familien der eryciden und tortriciden. archiv für naturgeschichte 28 (1): 238 - 252 - get paper here\njan, g. 1864. iconographie générale des ophidiens. 3. livraison. j. b. bailière et fils, paris - get paper here\nmcdiarmid, r. w. ; campbell, j. a. & touré, t. a. 1999. snake species of the world. vol. 1. herpetologists’ league, 511 pp .\nschlegel, h. 1837. essai sur la physionomie des serpens. partie descriptive. la haye (j. kips, j. hz. et w. p. van stockum), 606 s. + xvi - get paper here\nseung hoon, cha 2012. snake, the world most beautifull curve [ in korean ]. hownext, 304 pp. [ isbn 978 - 89 - 965656 - 7 - 3 ] - get paper here\nwallach, van; kenneth l. williams, jeff boundy 2014. snakes of the world: a catalogue of living and extinct species. taylor and francis, crc press, 1237 pp .\nthis database is maintained by peter uetz (database content) and jakob hallermann, zoological museum hamburg (new species and updates) .\noops. a firewall is blocking access to prezi content. check out this article to learn more or contact your system administrator .\nstand out and be remembered with prezi, the secret weapon of great presenters .\nneither you, nor the coeditors you shared it with will be able to recover it again .\nreset share links resets both viewing and editing links (coeditors shown below are not affected) .\nclassified as endangered (en - d) on the iucn red list 2002 (3), and listed on appendix i of cites (4) .\ninformation authenticated (12 / 6 / 03) by richard gibson, curator of herpetology, zoological society of london. urltoken\narboreal living in trees. endemic a species or taxonomic group that is only found in one particular country or geographic area. keel a structure that resembles the keel of a ship either in function or in shape. an example is the breastbone of flying birds, which have deep keels onto which the large breastbones attach .\nrichard gibson curator of herpetology zoological society of london regents park london nw1 4ry united kingdom richard. gibson @ urltoken http: / / www. urltoken\nterms of use - the displayed portlet may be used as a link from your website to arkive' s online content for private, scientific, conservation or educational purposes only. it may not be used within apps .\nmyarkive offers the scrapbook feature to signed - up members, allowing you to organize your favourite arkive images and videos and share them with friends .\nteam wild, an elite squadron of science superheroes, needs your help! your mission: protect and conserve the planet’s species and habitats from destruction .\nwildscreen is a registered charity in england and wales no. 299450 wildscreen usa is a registered 501 (c) (3) non - profit organisation in the usa\ngenetic analyses indicate that the only known natural population of the species shows low genetic diversity and acts as a single evolutionary unit. demographic analyses inferred a prolonged decline of the species for at least 230 generations. depending on the assumed generation time, the onset of the decline was dated between 1200 - 13000 years ago. pedigree analyses of captive individuals suggest that reproductive behavior of the giant lizard of la gomera may include polyandry, multiple paternity and female long - term sperm retention .\nthe current low genetic diversity of g. bravoana is the result of a long - term gradual decline. because generation time is unknown in this lizard and estimates had large credibility intervals, it is not possible to determine the relative contribution of humans in the collapse of the population. shorter generation times would favor a stronger influence of human pressure whereas longer generation times would favor a climate - induced origin of the decline. in any case, our analyses show that the wild population has survived for a long period of time with low levels of genetic diversity and a small effective population size. reproductive behavior may have acted as an important inbreeding avoidance mechanism allowing the species to elude extinction. overall, our results suggest that the species retains its adaptive potential and could restore its ancient genetic diversity under favorable conditions. therefore, management of the giant lizard of la gomera should concentrate efforts on enhancing population growth rates through captive breeding of the species as well as on restoring the carrying capacity of its natural habitat .\n] have shown that, after severe bottlenecks, some species have been able to persist for long periods of time with depleted heterozygosity levels. ecological factors, such as the quality of the habitat, environmental stability, the purging effect of selection, and specific life history traits (e. g. , mating systems and generation lengths) could counteract the impact of declines on population genetic variation [\n( arnold 1973) (subfamily gallotiinae) includes seven living lacertid species endemic to the canary islands that diversified upon colonization from the continent back in the early miocene, ca. 20 million years ago (mya) [\n] that is found in france, the iberian peninsula and maghreb. a recent phylogeny based on mitochondrial (mt) dna sequence data [\n, which inhabits eastern canary islands (fuerteventura and lanzarote), and a clade that includes all species living in western canary islands. this latter clade is divided into two monophyletic groups, one of small - bodied lizards ,\ndistribution of the small - bodied (sb) and the giant (g) lizards. the species classified as “critically endangered” by the iucn (2012) are also indicated with asterisks .\n]. field surveys in 2009 revealed that the whole population included ca. 160 individuals that inhabited isolated patches of < 20 km\n), and yet very little is known about the genetics and demography of its only known population .\nand it’s currently restricted geographical distribution. however, the possibility that decline could be the result of environmental stochastic processes such as ancient climate changes or geological (volcanic) events producing long - term fragmentation and isolation cannot be discarded [\ngiven the critical conservation status of the species, the study of its genetic variation was necessary to establish the best management strategy. in particular, it was important to determine whether observed reduction in population size was accompanied by depletion in levels of genetic diversity as well as to detect genetic signatures of past demographic changes (e. g. , bottlenecks) and date them. moreover, genetic data could help clarifying how historical processes (e. g. , sustained population isolation and genetic drift) and more recent events (e. g. , human pressure), coupled with the effect of life - history traits (e. g. , mating behavior), contributed to the evolutionary history of the species .\nhere, we analyze microsatellite data of g. bravoana for a total of 99 individuals (covering more than half of the total wild population and all 2001 - 2005 captive - born individuals) to estimate the overall amount of genetic variability of the species, and the allele frequency distribution between wild and captive individuals. different coalescence - based methods were applied to examine major population demographic changes and to estimate their timing. in addition, we combined information on pedigree and genetic data of captive animals from the breeding program to perform paternity analyses and gain insights on the mating system of the species. altogether, results presented here provide the genetic background needed for understanding the recent evolutionary history of g. bravoana and for implementing successful management and conservation plans for the species .\nwere monomorphic in wild samples. allele frequency homogeneity tests indicated that the probability of detecting population structure with the eight polymorphic microsatellites was relatively high (the overall power estimate from all runs was 0. 714 and 0. 628 for the chi - square and fisher exact tests, respectively), and statistically significant (data not shown). when\nwas set to zero (simulating no divergence among samples), the proportion of false significances (α error of type i) was in all cases lower than the intended value of 5% . only one (\n< 0. 05, results not shown), and therefore all loci were consequently regarded as independent from each other. the majority of loci showed an overall departure from hwe due to significant heterozygote deficiency when all 99 samples were analyzed together (table\n= allelic richness standardized to the smallest sample size using the rarefaction method of fstat 2. 9. 3 [\n1 bold f is values are significant probability estimates after q - value correction (* p < 0. 05) .\n= - 0. 039 ± 0. 024). the number of wild populations (and the assignment of individuals to each population) was estimated using bayesian inferences. our results indicate that in all cases the highest posterior probability value was found at\nthe wilcoxon test failed to detect recent bottlenecks under any kind of mutation model (iam, tpm and smm) of microsatellite evolution (p = 0. 156, p = 0. 156 and p = 0. 109, respectively). moreover, the allele frequency distribution obtained from the mode - shift indicator test followed a normal l - shape, indicating a larger proportion of low frequency allele classes in g. bravoana, and thus also supporting the absence of a recent genetic bottleneck .\nwere 70, 794 and 13, respectively. this corresponds to a reduction in effective population size (\n) of around 5, 400 times and that only 0. 02% of the original effective population survives at present. the decline was estimated to have occurred around 221 - 246 generations before present, and the time estimation of the onset of the decline varies depending on the generation time prior but not on the four time periods analyzed. for a\n) effective population size represented on a log10 scale. the colors of posterior densities represent three different assumed generation times in years for the prior set analyzed, which is represented by a gray dotted line .\n), calculated using msvar v1. 3, for the four prior sets analyzed. the colors of posterior densities represent the three different assumed generation times in years for the four prior sets analyzed, which are represented by gray dotted lines. the black vertical dashed line represents the four time periods tested (from left to right): 100; 500; 2, 500 and 10, 000 years (y) .\n). multiple paternity cases never involved more than two males. interestingly, in genetically monogamous pairings, a relatively high number of parental mismatches were detected i. e. , in five cases the assigned male did not correspond with the putative father. in two out of these five cases, the obtained genotype coincided with that of the male of the previous year’s crossing, in another two cases the genotype was of one of the founder males not involved in the breeding experiment, and in another case the proposed genotype did not match any of the males used for breeding (table\nm: monogamous, p: polygynous, ?: unknown. f is = wright’s statistics .\n, which shows an extremely reduced population number (ca. 160 individuals in the wild) and a severely reduced geographical distribution (< 20 km\n]. some of the methodological limitations related to the natural small population size were overcome by maximizing sampling effort in order to cover more than half of the wild population diversity of the species, and by using powerful statistical tools based on coalescence .\noverall, the eight polymorphic species - specific microsatellite loci used in this study showed no significant linkage disequilibrium, but otherwise very low levels of genetic diversity. the observed overall departure from hwe could be explained in terms of admixture of genetically distinct cohorts (whalund effect) given that the pattern of hwe departures changed completely when only the samples from the wild were analysed (only the\nb). levels of heterozygosity in the wild and captive populations were similar indicating that the captive population could be considered a sound representation of the genetic variability found in the wild. heterozygosity values herein reported are lower than those previously estimated for\n]). they are also lower to the values reported for critically endangered species such as e. g. , the reunion cuckoo shrike [\n]. however, given the large values of variance obtained, interpretation of the results should be taken cautiously, and a larger number of individuals need to be included in further analyses .\nwe failed to detect any population structure based on the bayesian clustering analysis, which suggests that individuals intermix freely in the single population of la mérica cliff. in fact, we observed that the wild population was in hwe suggesting random mating and gene flow between individuals. altogether, results indicate that g. bravoana is capable of actively dispersing across the different altitudinal patches despite the orographic difficulties of the steep terrain of la mérica cliff .\n]). the results of the coalescent analysis showed a long - term decline and estimated a strong reduction to a current effective population size of 13, what is congruent with the present day effective size of the population (as estimated through census monitoring campaigns). although the different coalescent analyses agreed on the number of generations since the decline of the population (around 230), dating the onset of the decline was more difficult and strongly dependent on what generation time was used as a prior. the longest generation time prior favored the hypothesis of a continuous decline of\nthe canary islands giant lizards are characterized by their larger body size, longer life span, and lower reproductive rates compared to small - bodied lizards. these are all life - history traits that contribute to genetic drift in small populations and eventually may lead to extinction. for instance, the longer generation times of the giant lizards would contribute to the overlapping of generations, and following the moran model [\n] for genetic drift, this would accelerate the genetic drift process in small populations. it would also contribute to a reduction in the fixation of mutations that could lead to higher fitness and adaptation and as well as a reduction in genetic diversity, the effective population size and allele frequencies. deleterious mutations under inbreeding could become fixed to a load untenable for the population and lead to extinction such as in the case of the giant skink of cape verde [\n]. however, genetic drift is stochastic in nature, and the process does not necessarily need to end in extinction, as is the case of the giant lizard of la gomera. the combined input of both genetic and ecological factors on population viability may explain long - term persistence of\n], evidence is accumulating for the capacity of many species (e. g. , the raso lark [\n,) to pass through historical bottlenecks and persist with small population sizes and low genetic diversity. moreover, it has been shown that minimal management and conservation actions for these threatened species were enough to enhance population growth rates [" ]
{ "text": [ "the round island burrowing boa ( bolyeria multocarinata ) is an extinct species of snake in the family bolyeriidae , in the monotypic genus bolyeria , which was endemic to mauritius .", "the species was last seen on round island in 1975 .", "no subspecies are currently recognized . " ], "topic": [ 26, 12, 5 ] }
"the round island burrowing boa (bolyeria multocarinata) is an extinct species of snake in the family bolyeriidae, in the monotypic genus bolyeria, which was endemic to mauritius. the species was last seen on round island in 1975. no subspecies are currently recognized."
[ "the round island burrowing boa (bolyeria multocarinata) is an extinct species of snake in the family bolyeriidae, in the monotypic genus bolyeria, which was endemic to mauritius. the species was last seen on round island in 1975. no subspecies are currently recognized." ]
"animal-train-23"
"animal-train-23"
"2674"
"brachycephalus fuscolineatus"
[ "its texture can also be found on brachycephalus fuscolineatus, which has yellow skin and a green - and - brown stripe on its back .\nbrachycephalus fuscolineatus. santa catarina: morro do baú, municipality of ilhota dzup 159 (holotype), dzup 158, 160, 401–5 (all paratypes) .\nbrachycephalus olivaceus is a greenish - brown, while brachycephalus auroguttatus has a bright - yellow head a colour that fades to brown on its limbs .\nbrachycephalus olivaceus is a greenish - brown colour (left), while brachycephalus leopardus sports yellow skin and dark spots (right). the first species of brachycephalus was described in 1842 by the famous german naturalist johann baptist von spix\neach of the frogs come in a variety of flashy, bright colours, likely meant to warn predators of the neurotoxins in the frogs' skin. on the right, the tiny frog brachycephalus fuscolineatus has yellow skin and a dark green - and - brown stripe running down its back\nbrachycephalus leopardus, as its name suggests, has yellow skin covered with dark spots .\nrecords of brachycephalus spp. altitude is provided in meters (above sea level) .\npie et al. (2013; as “ brachycephalus sp. nov. 1” )\nsiqueira et al. (2011; as “ brachycephalus sp. ”), (siqueira, vrcibradic & rocha, 2013; as “ brachycephalus sp. nov. ” )\nthe warty brachycephalus verrucosus is orange with brownish - green bumps, and shares its uneven complexion with brachycephalus fuscolineatus, which has yellow skin and a dark green - and - brown stripe down its back. brachycephalus leopardus gets its name from its yellow skin covered with dark spots; researchers observed one of these frogs piggybacking on another as part of the mating process called amplexus in which the male climbs onto the female' s back so he can fertilize her eggs as she releases them into the water .\nbrachycephalus nodoterga. são paulo: reserva biológica tamboré, municipality of santana de parnaíba mzusp 147711–6 .\nbrachycephalus pitanga. são paulo: sp 125, municipality of são luís do paraitinga dzup 407–9 .\nbrachycephalus ferruginus. paraná: olimpo, serra do marumbi, municipality of morretes mhnci 125, 128 .\nbrachycephalus hermogenesi. são paulo: ubatuba zuec 9715 (holotype), zuec 9716–25 (paratypes) .\nthis study, mhnci, pie et al. (2013; as “ brachycephalus sp. 3” )\nsilva, campos & sebben (2007; as “ brachycephalus cf. vertebralis ”), campos, silva & sebben (2010; as “ brachycephalus cf. vertebralis ”), campos (2011 )\nthe new brachycephalus mariaeterezae, for example, is bright orange with light - blue splotches along its backbone .\nthat isolation has produced 21 known species of brachycephalus frog - and the new arrivals push that count to 28 .\nas a group, brachycephalus, have been known to inhabit the cloud forests of southern brazil since the 1880s .\nhow small can a frog get? a new species of brachycephalus from brazil is dwarfed by a human fingertip .\nthis study, dzup, pie et al. (2013; as “ brachycephalus sp. nov. 1” )\nthe new brachycephalus mariaeterezae, for example, is bright orange with light - blue splotches along its backbone. brachycephalus olivaceus, true to its name, is the color of a greenish - brown olive. brachycephalus auroguttatus sports a bright - yellow head and coloration that fades to brown limbs (\naurogattatus\ntranslate to\ngold drop\nin latin) .\nbrachycephalus coloratus: urn: lsid: zoobank. org: act: d45d8c67 - 0f74 - 459e - 8fc6 - 048748ed254b .\npie et al. (2013; as “ brachycephalus sp. nov. 5”), pie & ribeiro (2015 )\ncunha, oliveira & hartmann (2010; as “ brachycephalus aff. hermogenesi ”), oliveira et al. (2011; as “ b. hermogenesi ”), pie et al. (2013; as “ brachycephalus sp. nov. 1” )\npie et al. (2013; as “ brachycephalus sp. nov. 7”), ribeiro et al. (2015 )\ncampos, silva & sebben (2010; as “ brachycephalus sp. 3”), campos (2011; as “bcu sp2” )\nbrachycephalus tridactylus. paraná: serra do morato, reserva natural salto morato, municipality of guaraqueçaba dzup 493–7, mhnci 10294, 10729–30 .\nfirkowski (2013; without species identification), pie et al. (2013; as “ brachycephalus sp. nov. 1” )\nfirkowski (2013; without species identification), pie et al. (2013; as “ brachycephalus sp. nov. 2” )\nfirkowski (2013; without species identification), pie et al. (2013; as “ brachycephalus sp. nov. 4” )\nfirkowski (2013; without species identification), pie et al. (2013; as “ brachycephalus sp. nov. 3” )\nbrachycephalus brunneus. paraná: caratuva, serra dos órgãos, municipality of campina grande do sul mhnci 1919–20, mnrj 40289–91 (paratypes) .\nresearchers found a pair of brachycephalus leopardus during part of their mating process called amlexus (right). the left image shows their habitat in brazil\nfinally, brachycephalus boticario is orange with darker, bumpy flanks. all of the frogs were found living in leaf litter on the forest floor .\nbrachycephalus “not identified” from “serra do salto, malhada district, municipality of são josé dos pinhais, pr” (firkowski et al. , 2016 )\nbrachycephalus pombali. paraná: morro dos padres, pico da igreja, municipality of guaratuba cfbh 8042 (holotype), 8043–53 (paratypes) .\npereira m dos s, candaten a, milani d, oliveira fb de, gardelin j, rocha cfd, vrcibradic d. brachycephalus hermogenesi .\nbrachycephalus mariaeterezae. the intensity of the light of the flash during photography led the light - blue coloration along their vertebral column to become less apparent .\nthis study, dzup, firkowski (2013; without species identification), pie et al. (2013; as “ brachycephalus sp. 2” )\nsuch high success in uncovering new species might indicate that the total number of brachycephalus is still underestimated ,\npie and his colleagues write in peerj .\npombal jr & izecksohn (2011; as “ b. ephippium ”), pie et al. (2013; as “ brachycephalus sp. 1” )\nover the course of five years of fieldwork, the team of researchers has provided the largest addition to the known diversity of brachycephalus, with seven new species .\nbrachycephalus auroguttatus. santa catarina: pedra da tartaruga, municipality of garuva dzup 375 (holotype), dzup 373–4, 376–85, 387–89 (all paratypes) .\nbrachycephalus ephippium. rio de janeiro: parque nacional serra dos órgãos mzusp 104140–7; vale de revolta mcz a–108655. são paulo: municipality of cotia mhnci 2611–16 .\nbrachycephalus quiririensis. santa catarina: serra do quiriri, municipality of campo alegre dzup 172 (holotype), dzup 171, 173–6, 524–30 (all paratypes) .\nbrachycephalus verrucosus. santa catarina: morro da tromba, municipality of joinville mhnci 9819 (holotype), mhnci 9820 (paratype), dzup 464–78 (paratypes) .\nvegetation at the type locality of brachycephalus coloratus, at 1, 144 m a. s. l. characterized by high - elevation forest (floresta ombrófila altomontana) .\nfirkowski (2013; without species identification), pie et al. (2013; as “ brachycephalus sp. nov. 5”), pie & ribeiro (2015 )\nbrachycephalus fuscolineatus pie, bornschein, firkowski, belmonte - lopes, and ribeiro in ribeiro, bornschein, belmonte - lopes, firkowski, morato, and pie, 2015, peerj, 3 (e1011): 18. holotype :\ndzup 159, by original designation. type locality :\nmorro do baú (26° 47′ 58″ s, 48° 55′ 47″ w; 680ma. s. l .), municipality of ilhota, state of santa catarina, southern brazil\n. urn: lsid: zoobank. org: act: 037b088c - aaa2 - 4bd4 - b6e9 - dfff7b753d8e\n, titled\nseven new microendemic species of brachycephalus (anura: brachycephalidae) from southern brazil ,\nwas published today in peerj, a peer - reviewed open access journal .\nfirkowski (2013; without species identification), pie et al. (2013; as “ brachycephalus sp. nov. 9”), ribeiro et al. (2015 )\nfirkowski (2013; without species identification), pie et al. (2013; as “ brachycephalus sp. nov. 4”), ribeiro et al. (2015 )\nfirkowski (2013; without species identification), pie et al. (2013; as “ brachycephalus sp. nov. 6”), ribeiro et al. (2015 )\nfirkowski (2013; without species identification), pie et al. (2013; as “ brachycephalus sp. nov. 7”), ribeiro et al. (2015 )\nfirkowski (2013; without species identification), pie et al. (2013; as “ brachycephalus sp. nov. 8”), ribeiro et al. (2015 )\npart of the brachycephalus family, these tiny frogs are among the smallest terrestrial vertebrates on earth, with adults usually no bigger than 1cm (0. 3 inches) in length .\nthe first species of brachycephalus was described in 1842 by the famous german naturalist johann baptist von spix, yet most species in the genus have been discovered only in the past decade .\npombal jr jp, izecksohn e 2011 uma nova especie de brachycephalus (anura, brachycephalidae) do estado do rio de janeiro. papeis avulsos de zoologia (sao paulo) 51 :\nbrachycephalus verrucosus has orange - hued skin covered with brownish - green bumps. it was found in morro da tromba, municipality of joinville, in the state of santa catarina, southern brazil\nbrachycephalus izecksohni. paraná: torre da prata, serra da prata, on the border between the municipalities of morretes, paranaguá, and guaratuba cfbh 7381–2, 7384 (all paratypes) .\nribeiro et al. (2015), seven new microendemic species of brachycephalus (anura: brachycephalidae) from southern brazil. peerj 3: e1011; doi 10. 7717 / peerj. 1011\nalves et al. (2009), campos, silva & sebben (2010; as “ brachycephalus sp. 2”), campos (2011), pie et al. (2013 )\nbrachycephalus mariaeterezae. santa catarina: reserva particular do patrimônio natural caetezal, top of the serra queimada, municipality of joinville mhnci 9811 (holotype), dzup 372, 393–9 (all paratypes) .\ngarey mv, lima amx, hartmann mr, haddad cfb 2012 a new species of miniaturized toadlet, genus brachycephalus (anura: brachycephalidae), from southern brazil. herpetologica 68: 266 - 271 .\nbrachycephalus albolineatus. santa catarina: morro boa vista, on the border between the municipalities of jaraguá do sul and massaranduba mhnci 10290 (holotype), mhnci 10295–10300, mnrj 90349 (all paratypes) .\npie mr, ribeiro le 2015 a new species of brachycephalus (anura: brachycephalidae) from the quiriri mountain range of southern brazil. peerj 3: e1179; doi 10. 7717 / peerj. 1179 .\npombal j, gasparini 2006 a new brachycephalus (anura: brachycephalidae) from the atlantic rainforest of espitrito santo, southeastern brazil. south american journal of herpetology. 1 (2): 87 - 93 .\nbrachycephalus leopardus. paraná: serra do araçatuba, municipality of tijucas do sul dzup 490 (holotype), dzup 478–89, 491–2 (all paratypes); morro dos perdidos, municipality of guaratuba dzup 274–83 .\nbrachycephalus didactylus. rio de janeiro: municipality of engenheiro paulo de frontin zuec 10825, mzusp 94621; sacra família do tinguá, municipality of engenheiro paulo de frontin zuec 1132–3, mzusp 13613–20, 64810–1, 94621 .\nsilva, campos & sebben (2007; as “ b. nodoterga ”), campos, silva & sebben (2010; as “ brachycephalus sp. 1”), campos (2011; as “bbm sp1” )\nunderstanding the ecological limits, geographical distributions, and altitudinal ranges of brachycephalus species is of considerable importance, particularly to direct more effective conservation actions. in the present study, we address the aforementioned aspects by reviewing the geographical and altitudinal distribution of brachycephalus based on records compiled from literature and museum specimens. in particular, expanding a previous effort by pie et al. (2013), we now include the entire literature on brachycephalus, which nearly tripled the number of sources in relation to that study. we analyze the geographical distribution and altitudinal amplitude of occurrence of the genus as a whole, as well as separately based on their species groups .\npie et al. (2013; as “ brachycephalus nodoterga ”), abbeg et al. (2015; as “clearly refers to another species (than b. nodoterga of pie et al. 2013) ” )\nfor animals like the brachycephalus frogs that are particularly sensitive to their environment, even the temperature change from mountain to valley forms a barrier. that leaves the population on each mountain top to slowly develop into a separate species .\ncondez th, clemente - carvalho rbg, haddad cfb, dos reis sf 2014 a new species of brachycephalus (anura: bracheycephalidae) from the highlands of the atlantic forest, southeastern brazil. herpetologica 70: 89 - 99 .\nbrachycephalus boticario. santa catarina: morro do cachorro, on the border between the municipalities of blumenau, gaspar, and luiz alves dzup 440 (holotype), dzup 414–5, 438–9, 444–5, 459 (all paratypes) .\nalves acr, sawaya rj, dos reis sf, haddad cfb 2009 new species of brachycephalus (anura: brachycephalidae) from the atlantic rain forest in sao paulo state, southeastern brazil. j. herpetology 43: 212 - 219 .\nclemente - carvalho rbg, giaretta aa, condez th, cfb haddad, dos reis sf 2012 a new species of miniaturized toadlet genus brachycephalus (anura: brachycephalidae) from the atlantic forest of southeastern brazil. herpetologica 68: 365 - 374 .\nafter nearly 5 years of exploration in mountainous areas of the southern brazilian atlantic rainforest, a team of researchers has uncovered seven new species of very tiny, brightly colored frogs from the genus known as brachycephalus. none are bigger than an adult thumbnail .\nhaddad cfb, alves acr, clemente - carvalho rbg, dos reis sf 2010. a new species of brachycephalus from the atlantic rain forest in sao paulo state, southeastern brazil (amphibia: anura: brachycephalidae). copeia 2010: 410 - 420 .\nbrachycephalus pernix. paraná: anhangava, serra da baitaca, municipality of quatro barras mnrj 17349 (holotype), cfbh 2597–8 (paratypes), mhnci 1818–9, 3000–4 (all paratypes), mhnci 1820, zuec 9433–7 (paratypes), dzup 539–55 .\nizecksohn (1971; as “ b. ephippium ”), pombal jr (2001; as “ brachycephalus cf. ephippium ”), pombal jr & izecksohn (2011), pie et al. (2013; as “ b. ephippium ” )\nribeiro (2006; as “ brachycephalus sp. aff. nodoterga ”), pombal jr & izecksohn (2011), pie et al. (2013), abegg et al. (2015), clemente - carvalho et al. (2016 )\nthe geographical distribution of brachycephalus coloratus is a new example among the few known cases of distinct species occurring in a single mountain range (“ serras ”). in this case, b. coloratus occurs in the serra da baitaca together with b. pernix .\nbrachycephalus olivaceus. santa catarina: base of the serra queimada, municipality of joinville mhnci 9813 (holotype), dzup 371 (paratype); castelo dos bugres, municipality of joinville mhnci 9814–8 (paratypes); morro do boi, municipality of corupá mhnci 10288–9 .\nbrachycephalus curupira (a, dorsal view and b, ventral view, from the left: mhnci 10292, mhnci 10287, holotype, mhnci 10286 paratypes) in contrast with the most morphologically similar congener, b. brunneus (c, dorsal view and d, ventral view, from the left: mhnci 10729 - 32). specimens were chosen to represent the most extreme variation in our sample of preserved specimens. inset: comparison between eye color in brachycephalus curupira (e, holotype) and b. brunneus (f, mhnci 10733) .\nseven adorable species of frog - each smaller than a thumbnail - have been discovered in the brazilian atlantic rainforest. part of the brachycephalus family, these tiny frogs are among the smallest terrestrial vertebrates, with adults usually no bigger than 1cm (0. 3 inches) in length\nspecies description: pie, bornschein, firkowski, belmonte - lopes & ribeiro in: ribeiro et al. (2015), seven new microendemic species of brachycephalus (anura: brachycephalidae) from southern brazil. peerj 3: e1011; doi 10. 7717 / peerj. 1011\nthe most obvious differences between brachycephalus species, including the seven new ones, is their skin. this can vary quite a lot in how bumpy and rough it is, and quite dramatically in its colour - with more vibrant tones normally reflecting higher levels of the deadly chemical tetrodotoxin .\nthis frog has warts: brachycephalus verrucosus has orange - hued skin covered with brownish - green bumps. an adult female of the species was collected on jan. 25, 2011, at morro da tromba, municipality of joinville, in the state of santa catarina, southern brazil .\n( 1) b. tridactylus, (2) b. brunneus, (3) b. pernix, (4) b. ferruginus, (5) b. coloratus, (6) b. pombali, (7) b. izecksohni, (8) b. curupira, (9) b. leopardus, (10) b. auroguttatus, (11) b. quiririensis, (12) b. olivaceus, (13) b. mariaeterezae, (14) b. verrucosus, (15) b. albolineatus, (16) b. boticario, and (17) b. fuscolineatus. the geographical locations of the new species are indicated in red .\nin the brachycephalus pernix group according to the original publication. condez, monteiro, and haddad, 2017, zootaxa, 4290: 395–400, suggested that this form requires taxonomic reassessment due to problems in the original diagnosis and description; see response from pie, ribeiro, and bornschein, 2017, zootaxa, 4350: 587–589 .\nalves, a. c. r. , l. f. ribeiro, c. f. b. haddad, and s. f. dos reis. 2006. two new species of brachycephalus (anura: brachycephalidae) from the atlantic forest in parana state, southern brazil. herpetologica v. 62: 221 - 233 .\nthe brightly colored little frogs are all part of the genus brachycephalus, a group known since the 1800s to inhabit the cloud forests of southern brazil. suspecting that more of these frogs might be hiding in the southern part of the atlantic forest, researchers led by marcio pie of the universidade federal do paraná hiked into the remote, misty rainforest in the states of parana and santa catarina. [ see photos of the tiny, colorful frogs from brazil ]\nbrachycephalus coloratus (( a) dorsal view, (b) ventral view, from the left: mhnci 10276, holotype, mhnci 10275 and mhnci 10277 paratypes) in contrast with the nearest congener, b. pernix (( c) dorsal view, (d) ventral view, from the left: mhnci 9806 - 07, mhnci 10157, mhnci 10160). specimens were chosen to represent the most extreme variation in our sample of preserved specimens .\nremarks. the type locality of brachycephalus coloratus is 7. 3 km distant in a straight line from the type locality of b. pernix (both species occur in the serra da baitaca). this geographical proximity between them could indicate that they represent sister species. indeed, preliminary genetic data seems to confirm this hypothesis (mj nadaline, pers. comm. , 2016). more detailed mapping of their distributions are still necessary to determine the extent to which these species are allopatric .\nbrachycephalus sulfuratus. são paulo: base of the serra água limpa, municipality of apiaí dzup 362. paraná: caratuval, near the parque estadual das lauráceas, municipality of adrianópolis dzup 139; corvo, municipality of quatro barras dzup 150–7; fazenda thalia, municipality of balsa nova dzup 221–4; mananciais da serra, municipality of piraquara mhnci 10302; recanto das hortências, municipality of são josé dos pinhais dzup 463; salto do inferno, rio capivari, municipality of bocaiúva do sul mhnci 9800 .\nbrachycephalus fitzinger is a genus of miniaturized diurnal toadlets (usually < 2. 5 cm in snout - vent length) that inhabit the forest floor of montane regions along the atlantic rainforest of southeastern and southern brazil (izecksohn, 1971; giaretta & sawaya, 1998; pombal jr, wistuba & bornschein, 1998; napoli et al. , 2011; pie et al. , 2013; see rocha et al. (2000) and pombal jr & izecksohn (2011) for reports of nocturnal activity). brachycephalus presents direct development and a reduction in the number and size of digits (hanken & wake, 1993; pombal jr, 1999; yeh, 2002). some species are aposematic (yellow, orange or yellow with light red), of which some were confirmed as harboring neurotoxins (tetrodotoxin and analogues; sebben et al. , 1986; pires jr et al. , 2002; pires jr et al. , 2003; schwartz et al. , 2007) .\nbrachycephalus curupira had a patchy distribution throughout approximately 700 m of transect along trails and within the forest in the type locality. it is possible that the abundance of the species is regulated by the quality of the leaf litter, which in turn is partly affected by vegetation and slope. we found higher abundance (one individual per ∼2–3 m 2) in areas dominated by chusquea sp. , whereas lower abundances (one individual each ∼6–7 m 2 and ∼15–16 m 2) were estimated in sites where chusquea sp. was less common .\nis the color of a greenish - brown olive. the first species of brachycephalus was described in 1842 by the german naturalist johann baptist von spix. but most species in the genus have been discovered only in the past decade. that' s due to their extremely remote habitats, which are difficult to reach .\nalthough getting to many of the field sites is exhausting, there was always the feeling of anticipation and curiosity about what new species could look like ,\nsaid marcio pie, a professor at the universidade federal do paraná, who led the project .\nin the present study, we describe two new species of brachycephalus from the state of paraná, southern brazil and assign them to the b. pernix group. this discovery is part of a continuing effort to investigate montane anurans of southern brazil (see bornschein et al. , 2015; pie & ribeiro, 2015; ribeiro et al. , 2015; bornschein et al. , 2016a; bornschein et al. , 2016b). these species are diagnosed through a combination of coloration patterns, morphological traits, genetic distances, and genealogical information from phylogenetic analyses (firkowski et al. , 2016) .\nthe area of occurrence of brachycephalus coloratus is within a land development (estância hidroclimática recreio da serra), more specifically in a region where a road is planned to be constructed, which raises severe concerns regarding the preservation of the species. on the other hand, contacts with a local resident indicated that areas above 1, 000 m a. s. l. will not be occupied, despite the original plans when the enterprise was approved by the municipality. furthermore, we obtained record of the new species at 130 m from the border of a state park—the parque estadual da serra da baitaca—and the potential occurrence of the species in this park should be a priority to design a conservation initiative. we suggest that the species should be considered as data deficient (sensu iucn, 2012) given the limited available information .\nseven new species of tiny frog have been discovered on seven different mountains in south - eastern brazil .\nthe cool\ncloud forests\nof this region have a unique climate, separated by warmer valleys that isolate the peaks like islands .\nthey are all less than 1cm long and many have colourful, poisonous skin to help them avoid becoming tiny meals .\nthe newly discovered species, reported in the open - access journal peerj, are the fruit of five years of expeditions into the wilderness .\nmarcio pie, a professor at the federal university of parana in nearby curitiba, said he had climbed more mountains than he can remember .\nit' s really exhausting ,\nhe told the bbc .\nthe mountains are not that high - most of them are 1, 000m to 1, 500m - it' s just that the trails are not particularly well marked .\nthese high forests near brazil' s southern atlantic coast are a fertile place for ecologists to explore, prof pie said, yielding more different species per square km than the amazon .\nthe little creatures are rather restricted in terms of just how different they can become. as some of the very smallest land - dwelling vertebrates, much of their anatomy is optimised to this tiny scale. for example, they typically have three toes and two fingers, instead of the five toes and four fingers found in most frogs .\npredicting what a new species might look like became a bit of a game for prof pie and his colleagues .\nit' s a really exciting experience, because we have a good expectation that each mountain top will have a new species, but we don' t know what it' s going to look like ,\nhe said .\nso we play around while we plan each trip, and try to anticipate what the species is going to look like .\nafter catching enough specimens, which usually involved rifling through leaf litter with their bare hands, prof pie' s team also did genetic tests to describe each new species .\nfinding them in the first place was probably the biggest challenge, he said .\nit takes a lot of practice and sometimes it' s very frustrating, to go up the mountain for many hours and come back empty - handed .\none of the frogs, b. olivaceus, was rather less colourful, making it even harder to find in the forest\noften the researchers would hear the frogs long before they saw them, but the creatures, whose principal predators are probably snakes, tend not to give away their location easily .\nyou can hear them singing and there' s probably hundreds of them, but you simply can' t catch them! because once you get closer, just from the vibration in the ground, they keep silent for, say, 20 minutes or half an hour. and then you have to go through the leaf litter very carefully with your hands ,\nprof pie said .\ntiptoeing scientists are the least of the frogs' worries, however. the unique climatic pockets of the cloud forests are vulnerable .\nthe researchers even spotted b. leopardus in the act of mating or\namplexus\nthe presence of these frogs with such small geographical ranges suggests to us that this particular area has been pretty stable for last the past 500, 000 years, in terms of the climate .\nif it had got warmer, probably the environment that characterises the cloud forests would have disappeared and would have led these species to extinction. whereas if it had changed in the other direction, probably they would have moved across the valleys and we would find these species together .\nbut at this point we' ve never found more than one species at each site .\nprof pie and his colleagues warn that keeping this remarkable variety of species alive may require captive breeding, as well as efforts to protect their habitat from invasive plant and animal species, logging, and other threats .\nmeanwhile, the effort to catalogue the frogs' diversity goes on. the team has already come across another four species, whose details they are yet to publish, and more mountain expeditions are planned .\nwe are very confident that we' re going to find even more species ,\nprof pie said .\nthere are many other locations where you tend to find a very similar climate and so probably the frogs are going to be there as well .\nben tapley, the team leader of herpetology at zsl london zoo, said the discovery was noteworthy .\nthe description of one, let alone seven species, is always extremely exciting ,\nmr tapley said .\namphibians are facing catastrophic and global decline and it is likely that many species have become extinct before they have even been described by science. species descriptions can inform conservation management and help prioritise much needed conservation action .\nthe president' s nomination, if confirmed by congress, could shape the us legal system for a generation .\n* will not find nomina inquirenda; use basic search (above) for that purpose .\nwill find all uses of\nhyl ...\nanywhere in a record: e. g. , hylarana, hyla, hylidae, hylinae, hylaedactyla .\nwill find all uses of\n... hyla\nanywhere in a record: e. g. , hyla, hylidae, plectrohyla, ptychadena hylaea, adenomera hylaedactyla\nwill find all records that contain stand - alone uses of hyla: e. g. , hyla, hyla arenicolor\ninterprets this as\nlithobates or pipiens\nso will find the union of all records that contain either\nlithobates\nor\npipiens\n: e. g. , lithobates omiltemanus, hylorana pipiens\ninterprets this as\nlithobates and pipiens\nso will return all records that have the character string\nlithobates pipiens\nanywhere within a record: e. g. , all members of the lithobates pipiens complex .\nknown only from the type locality (morro do baú, municipality of ilhota, state of santa catarina, southern brazil, 640 to 790 m elevation) .\nplease note: these links will take you to external websites not affiliated with the american museum of natural history. we are not responsible for their content .\nfor access to available specimen data for this species, from over 350 scientific collections, go to vertnet .\ncopyright © 1998 - 2018, darrel frost and the american museum of natural history. all rights reserved .\nhtml public\n- / / w3c / / dtd xhtml 1. 0 transitional / / en\n/ / urltoken\nadults are usually no bigger than 1cm (0. 3 inches) in length\nseven adorable species of frog - each smaller than a thumbnail - have been discovered in the brazilian atlantic rainforest .\nthe miniature frogs live on cloudy mountaintops in the isolated forests, making them vulnerable to threats such as climate change and deforestation .\nhas yellow skin and a green - and - brown stripe on its back .\nthey each come in a variety of flashy, bright colours, likely meant to warn predators of the neurotoxins in the frogs' skin .\nhoping that more of these frogs live in the southern part of the atlantic forest, researchers led by marcio pie of the universidade federal do paraná visited the rainforest in the states of parana and santa catarina .\n' although getting to many of the field sites is exhausting, there was always the feeling of anticipation and curiosity about what new species could look like', said professor pie .\nmeet' hellboy', the long - lost relative of triceratops with a ...\nwhat' s remarkable is not just their tiny size, but also their stunning markings .\nduring the course of their studies, researchers spotted one of these frogs piggybacking on another as part of the mating process, according to a report in livescience .\nthe frogs' are so diverse in their appearance because of their isolated, mountainous habitat. separated from other species, the frogs end up interbreeding in their own community, creating distinct markings that make them stand out from other frogs in the same genus\nthe frogs' are so diverse in their appearance because of their isolated, mountainous habitat .\nseparated from other species, the frogs end up interbreeding in their own community, creating distinct markings that make them stand out from other frogs in the same genus .\nluiz ribeiro, a research associate to the mater natura institute for environmental studies, is optimistic about the prospects for future studies .\n' this is only the beginning, especially given the fact that we have already found additional species that we are in the process of formally describing.'\ngunman blasts car driven by woman, 51, three times as she ...\n' this is what we call a miracle': baby boy is found alive ...\n' go back to your country': mexican grandfather, 92, is ...\n' this is the brexit that is in our national interest': ...\n# where' sboris? boris johnson' s stunning resignation as ...\nbeauty queen who was gang - raped as a teen gives back her ...\n' you wouldn' t look so good with your b * * * * * * s in your ...\nnew hair, don' t care! roseanne barr smiles as she debuts ...\nbody of canadian man, 62, is found half - eaten by his ...\n' it is made of rocket parts & named wild boar after kids' soccer team': elon musk shares footage of the ...\nchinese government start - up expands its plans to use powerful facial recognition technology to spy on ...\nbritain' s broadband speeds are so poor they are down to 35th in the world, lagging behind the likes of ...\nstarbucks will charge all uk customers a 5p paper cup levy in a bid to reduce waste as it reveals it will ...\nopen - plan offices make people chat less because employees stare at their screens in an effort to look busy ...\nfrom a lizardfish with male and female sex organs to the' deep sea dumpling', noaa reveals the weirdest ...\ngroundbreaking study using dna from 8, 000 - year - old skeletons reveals modern southeast asians descend from ...\ntwitter shares plunge after report says it has suspended 70 million fake accounts, fueling concerns around ...\napple launches ios 11. 4. 1 with' usb restricted mode' that prevents cops from cracking suspect' s iphones\nworld' s first floating nation begins selling its own' vayron' cryptocurrency ahead of 2022 launch in the ...\nbeing rich and successful really is in your dna: being dealt the right genes determines whether you get on ...\nthe pink planet: world' s oldest color pigments extracted from 1. 1 billion - year - old rocks deep beneath the ...\nrihanna has very tense exchange with hassan jameel on holiday in mexico... one month after singer' dumped saudi businessman'\nkristin cavallari and husband jay cutler list magnificent seven - bed nashville mansion for $ 7. 9m\nthe 19, 000 - square - foot home sits on 8. 5 acres\nkylie jenner flaunts new smaller pout... before making her lips bigger again with lipstick\nhailey baldwin confirms engagement to' incredible person' justin bieber... but has a condition for their highly - anticipated wedding\nkim kardashian shares cute video of daughter chicago... after the game said that she should run for president in 2020\nbritish boxer amir khan baffles fans as he points out' white stuff' on his nose while posing with 50 cent in la nightclub... before deleting the caption\ng - eazy turned away at canadian border and forced to cancel headlining gig... after cocaine arrest in sweden\n' you' re the love of my life... i' ll lead our family with honor': justin bieber confirms engagement and hints at baby fever while hailey flashes new band\nkylie jenner flashes underboob and her derriere in sheer orange ensemble... one day after revealing she took her lip filler out\nhailey baldwin' s ring from justin bieber is similar to blake lively' s $ 2m rock... and that may be because the model tweeted in 2012 she liked it\ntyra banks confirms life size 2 movie sequel starring francia raisa... as it appears lindsay lohan won' t return\nlucy hale flashes her toned midriff in a sports bra... as she remembers her grandma with new tattoo\nhailey baldwin and justin bieber passionately kiss in the bahamas... as news of engagement spreads\nselena gomez is seen with same mystery man she was with in may... after news her ex justin bieber is engaged to hailey baldwin\nkhloe kardashian reveals she stopped breast - feeding daughter true... three months after giving birth\ngiuliana rancic takes a hike with bill... as the couple vacation with friends ahead of her return to e! news\nkhloe kardashian shows off neon sign in true' s nursery... as she reveals it' s kris jenner' s handwriting\nciara and husband russell wilson dance as they head to south africa for their honeymoon... two years after wedding\nrapper del the funky homosapian falls off stage during gorillaz set... but he reassures fans he' s' alright' as he recovers in hospital\nmakeup artist joyce bonelli reaches out to the kardashian clan on instagram... after the famous family' fire' and unfollow her on social media\ndaddy daycare! jared kushner takes kids back to d. c. after weekend in new jersey - as ivanka dons a short dress for visit to a nyc asphalt company\nsofia richie, 19 poses in a bikini top just after scott disick' s ex kourtney kardashian, 39, did the same... and fans call her out for it\nnaomi campbell wows in flamboyant feathered gown... while ashley graham sizzles in plunging lace dress as they walk in dolce & gabbana show in italy\nnaya rivera sells her five - bedroom la home for a cool $ 3. 55 million after finalizing her divorce from ryan dorsey\nmel b' is unable to pay her back taxes amid ongoing divorce battle with stephen belafonte... as it' s estimated the pair owe up to $ 650k' to the irs\nkylie jenner rocks curve - clinging attire as she shows off body... and considers going back to blonde\ndakota johnson dons striped wrap dress in la... after calling co - star chris hemsworth' spectacular'\ncardi b hits back at troll who mocked her baby shower... as she shows off naked baby bump for photoshoot\nbuy your own celebrity hideaway! castle adored by michael douglas and jack nicholson goes on sale for $ 5. 2m (and even comes with treehouse )\nant - man and the wasp soars to $ 76 million on opening weekend... beating its prequel by $ 19 million\nliam payne and cheryl split: carefree 1d star returns to stage for first time since break - up... as he poses happily with his backing dancers in france\ntristan thompson goes house hunting alone as he checks out $ 2m property in la with its own basketball court... just minutes from khloe' s mansion\nchris hemsworth kicks off filming for the star - studded men in black spin - off as he cuts a sharp figure in london... 21 years after the first film hit screens\njill zarin admits she' s ready to date again after being spotted with handsome businessman... following beloved husband bobby' s death\ndj khaled cancels wireless performance due to' travel issues' just hours before his slot... as fans rage over his' vacation' snap\n13 reasons why villain justin prentice says he' s not bothered by social media trolls... and that getting attacked online means he' s doing his job as an actor\nfarm heroes saga, the # 4 game on itunes. play it now !\nit' s eye - wateringly expensive at $ 2, 999, but naim' s uniti atom is a revelation, an integrated amplifier than makes it easy to stream music at a quality you' ve probably never heard before .\nafter a day with the iphone x, while face id isn' t perfect, and the' notch' is an annoyance, the iphone x is a glimpse into the future of phones and the best handset of the market by a long way .\nthey aren' t cheap, but shinola' s $ 595 foray into headphones are the perfect accessory for design obsessives looking to upgrade their listening habits .\nwith the pixel xl, google has created a handset that is not only the best android device out there, but arguably matches the iphone 8 in terms of design and feel .\napple' s watch will free you from your phone - while making sure you don' t suffer the fear of missing out. it' s a huge step forward, and a compelling reason for the average user to buy a smartwatch .\nwhile the iphone x may have stolen the headlines, in fact the iphone 8 could be the sleeper hit of apple' s new range, offering the same power as the x but with features and a design users trust .\nwhile the design is impressive and easy to use, the game line up is disappointing .\nnaim' s incredible mu - so qb takes you back to the good old days - where the music captivates and enthralls, rather that simply being something in the background .\nit might not be a name familiar to the us market, but naim is a legendary british brand hoping to make a splash with the american launch of its $ 1499 mu: so speaker .\npeloton' s hi - tech bike lets you stream live and on demand rides to your home - and it' s one of the best examples of fitness technology out there - at a price .\nseven new species of miniature frogs, each fitting onto the tip of a thumb, have come out of hiding in the brazilian atlantic rainforest, scientists report in the journal peerj. the teeny - tiny frogs live on isolated mountaintops in cloud forests. here' s a look at the colorful cuties. [ read full story on the tiny frogs from brazil ]\nhas yellow skin and a dark green - and - brown stripe running down its back. it was discovered in october 2010 in the municipality of ilhota, state of santa catarina, southern brazil .\nsports yellow skin covered with dark spots (hence it' s\nleopardus\nspecies name) .\nduring part of their mating process called amlexus. the male climbs onto the female' s back and while piggybacking he fertilizes the eggs she releases into the water .\nwas found living in the leaf litter on the floor of patches of the cloud forest. the researchers spotted an adult male on oct. 29, 2012, at morro do cachorro, on the border between the municipalities of blumenau, gaspar, and luiz alves, state of santa catarina, southern brazil. this species is orange with darker, bumpy flanks .\nis the color of a greenish - brown olive. researchers collected an adult female of this species at the base of the serra queimada mountain in santa catarina' s municipality of joinville, on jan. 23, 2011 .\nsky islands\nin the southern brazilian atlantic forest. species evolve in isolation on these mountaintops, meaning most can be found only on one or two peaks .\nbefore becoming managing editor, jeanna served as a reporter for live science and urltoken for about three years. previously she was an assistant editor at scholastic' s science world magazine. jeanna has an english degree from salisbury university, a master' s degree in biogeochemistry and environmental sciences from the university of maryland, and a science journalism degree from new york university. follow jeanna on google + .\ndon' t sneeze - - you might blow away a newly discovered species .\nscientists have uncovered seven new species of teeny - tiny frogs, each smaller than a thumbnail, in the brazilian atlantic rainforest. the miniature frogs live on isolated mountaintops in the cloud forests .\nthe mountaintop habitats are like isolated islands, making the frogs vulnerable to threats such as climate change. illegal deforestation and cattle ranching also threaten the frogs' habitat, researchers report thursday in the journal peerj .\nthere, they discovered multiple new frog species, including the seven reported in their new paper. all of the frogs are less than 0. 4 inches (1 centimeter) long, and they come in a jellybeanlike array of bright colors. (the flashy hues are likely meant to warn predators of the neurotoxins in the frogs' skin, the researchers note. )\nthe frogs' mountainous habitat is key to their diversity. separated by valleys that the frogs cannot traverse, the pipsqueaks end up living in isolated communities, interbreeding until they evolve into completely separate species from the frogs a mountaintop over .\nthis is only the beginning ,\nstudy researcher luiz ribeiro of the mater natura institute for environmental studies said in a statement ,\nespecially given the fact that we have already found additional species that we are in the process of formally describing .\na group of\ntorrent frogs\nhas been documented using higher - pitched calls than most other frogs in the world .\nphoto: the frog huia cavitympanum, from the island of borneo, has evolved calls to be heard over the noise of rushing water. credit: professor t. ulmar grafe / university of brunei darussalam some frogs have evolved ultrasonic mating calls so they can be heard above the background rumble of the fast - flowing streams they depend on, say researchers .\nbiologist dr sandra goutte of sorbonne university in paris and her and colleagues studied the calls of a group of\ntorrent frogs\nin borneo, indonesia, malaysia, china and cambodia .\nthey discovered the frogs all had higher pitched calls than most other frogs in the world, and a few species even had ultrasonic calls .\nyou can see the frog calling but you cannot hear it ,\nsaid dr goutte, who carried out the research for her phd research .\nthe call of torrent frogs has most probably been constrained by the environment they live in - which is the torrents - that are really noisy .\nmale torrent frogs generally put out mating calls while sitting in vegetation next to fast - flowing streams. females lay their eggs on rocks and then the tadpoles thrive in the oxygen - rich waters nearby .\nthe problem is falling water makes a low pitched rumble of about 2 kilohertz that would mask the pitch of most frog mating calls, which are generally under 5 kilohertz .\ndr goutte and colleagues measured the call pitch of 70 species of torrent frogs, that range in size from 2 to 15 centimeters in body length .\nthey found that, on average, most of the frogs had calls that ranged between 4 and 10 kilohertz .\na few species had calls that consisted of frequency above 20 kilohertz, which is in the ultrasonic range, above the human range of hearing .\nfor example, the hole - in - the - head frog (huia cavitympanum), which is found in borneo, has purely ultrasonic calls .\nas a result we don' t hear anything, but the frogs do ,\nsaid dr goutte .\nwhile the large odorous frog (odorrana graminea), a species found in china, had partially ultrasonic calls .\nwe hear only a part of the call ,\nsaid dr goutte .\nco - author dr jodi rowley of the australian museum research institute said the calls of the large odorous frog vary in frequency from very low to extremely high - up to 44 kilohertz .\nthey' re much more like bird songs than most frog songs in their complexity and frequency modulation ,\nshe said .\nthere' s only a few other frogs known to call ultrasonically and they are all torrent dwelling .\nthe tiny amphibians live in mountain top regions in the southern brazilian atlantic rainforest that are extremely isolated. since their habitat is so limited they are extremely vulnerable to extinction. shown is the species\nfrogs in this genus have been known since the 1800s, but these seven species hadn' t previously been identified. these tiny frogs generally have three toes and two fingers, instead of the five toes and four fingers found in most frogs. all of the frogs are less than 0. 4 inches in length. they vary mostly in their skin color and texture. shown is the rough - skinned species\nthe frogs were all found living among leaves on the forest floor. their home - - cloud forests - - are highly sensitive to climatic changes .\nhas yellow skin with a greenish - brown stripe running down its back. the researchers believe there may be even more species of the frogs in the remote regions .\nthis is only the beginning, especially given the fact that we have already found additional species that we are in the process of formally describing ,\nsaid luiz ribeiro, a research associate to the mater natura institute for environmental studies, in a press release." ]
{ "text": [ "brachycephalus fuscolineatus is a species of frogs in the brachycephalidae family .", "it is very tiny and was one of seven new species described by lf ribeiro and a team of scientists from the mater natura - instituto de estudos ambientais in brazil .", "like all species in its genus , it is found in a very small strip of atlantic forest in the southeastern coast of the country , and has a vibrant colour pattern .", "the speciation seen in this genus is thought to be a byproduct of the rift between the valley versus mountain terrain and its particular microclimates , to which they are adapted .", "it might be in population decline due to habitat loss .", "its name is derived from the latin fuscus , meaning \" dark \" or \" swarthy \" , and lineatus , meaning \" of a line \" , alluding to the characteristic dark stripe across the dorsum of this species . " ], "topic": [ 29, 5, 23, 13, 17, 25 ] }
"brachycephalus fuscolineatus is a species of frogs in the brachycephalidae family. it is very tiny and was one of seven new species described by lf ribeiro and a team of scientists from the mater natura - instituto de estudos ambientais in brazil. like all species in its genus, it is found in a very small strip of atlantic forest in the southeastern coast of the country, and has a vibrant colour pattern. the speciation seen in this genus is thought to be a byproduct of the rift between the valley versus mountain terrain and its particular microclimates, to which they are adapted. it might be in population decline due to habitat loss. its name is derived from the latin fuscus, meaning " dark " or " swarthy ", and lineatus, meaning " of a line ", alluding to the characteristic dark stripe across the dorsum of this species."
[ "brachycephalus fuscolineatus is a species of frogs in the brachycephalidae family. it is very tiny and was one of seven new species described by lf ribeiro and a team of scientists from the mater natura - instituto de estudos ambientais in brazil. like all species in its genus, it is found in a very small strip of atlantic forest in the southeastern coast of the country, and has a vibrant colour pattern. the speciation seen in this genus is thought to be a byproduct of the rift between the valley versus mountain terrain and its particular microclimates, to which they are adapted. it might be in population decline due to habitat loss. its name is derived from the latin fuscus, meaning \" dark \" or \" swarthy \", and lineatus, meaning \" of a line \", alluding to the characteristic dark stripe across the dorsum of this species." ]
"animal-train-24"
"animal-train-24"
"2675"
"mylossoma duriventre"
[ "sara eckert added text to\nmylossoma duriventre\non\nmylossoma duriventre (cuvier, 1818 )\n.\nfernando jerep marked\npacu - peva (mylossoma duriventre )\nas trusted on the\nmylossoma duriventre\npage .\nkatja schulz marked\nmylossoma duriventre - credit sandra j. raredon, division of fishes, nmnh\nas trusted on the\nmylossoma duriventre\npage .\nspecies name: mylossoma duriventre synonym: mylossoma duriventre common name: silver mylossoma family: characidae order: characins class: actinopterygii maximum size: 20 cm / 8 inches environment: freshwater origin: amazon basin of peru and brazil temperament: peaceful company: mylossoma duriventre (silver mylossoma) is suitable for community aquariums with other species with similar size and demands. water parameters: temperature 24 - 27˚c / 75 - 80˚f; ph 5. 0 – 7. 8 aquarium setup: mylossoma duriventre (silver mylossoma) needs and aquarium with plenty of space to swim on. they prefer a planted aquarium but will often eat most plants. you might try to use hardier plants such as java fern and anubias or just use plastic plants. feeding: mylossoma duriventre (silver mylossoma) will accept most food. vegetables should be a part of their diet. breeding: we have no information about any successful breeding of mylossoma duriventre (silver mylossoma) in aquarium .\nhaff disease associated rhabdomyolysis is correlated with the ingestion of certain freshwater fish and shellfish and is caused by an unidentified toxin. we report the case of a patient who experienced rhabdomyolysis approximately 2 hours after ingestion of the freshwater fish mylossoma duriventre (pacu - manteiga) approximately 3 years after an outbreak had been reported in manaus, brazilian amazon .\na rabdomiólise associada à doença de haff é correlacionada com a ingestão de certos peixes e crustáceos de água doce, sendo causada por uma toxina não identificada. relatamos o caso de um paciente que apresentou rabdomiólise cerca de 2 horas após ingerir o peixe de água doce mylossoma duriventre (pacu - manteiga) cerca de 3 anos após o relato de um surto de doença de haff em manaus .\nthe first report of an outbreak of haff disease in brazil was in 2009, and one of the species associated with this 2008 outbreak was mylossoma duriventre. (11) further studies are necessary to identify the toxin involved and what induces its expression because the species of fresh water fish and crawfish in all the reports are eaten daily by many people in all the countries where outbreaks were described, without developing the disease .\nin october 2008, an outbreak of 27 cases of haff disease that were associated with the consumption of mylossoma duriventre (pacu - manteiga), colossoma macropomum (tambaqui) and piaractus brachypomus (pirapitinga) fish from the brazilian north amazon region was reported. (11) haff disease is considered an emerging disease, whose importance will increase as population growth leads to increasing consumption of freshwater fish, particularly in the brazilian amazon region .\nmonthly fishery production by species in the amazon river near the fishery grounds of óbidos, santarém and monte alegre, from january 1993 to december 2004. (brv) brachyplatystoma vaillanti, (bra) brachyplatystoma rousseauxii, (sem) semaprochiloduns taeniurus and s. insignis, (bfi) brachyplatystoma filamentosum, (hyp) hypophthalmus marginatus and h. edentatus, (myl) mylossoma duriventre, myleus schomburgki and metynnis argenteus, (lip) liposarcus pardalis, (pro) prochilodus nigricans, (pse) pseudoplatystoma fasciatum and p. tigrinum .\na 48 - year - old male patient who was taking finasteride for androgenic alopecia presented to the emergency room. he was returning from a 15 - day trip to the city of belém (pa) in the northern region of brazil. he reported that approximately 2 hours after ingesting a meal containing the fish mylossoma duriventre, he experienced sudden, progressive, diffuse and lancing abdominal pain, accompanied by two episodes of vomiting, progressive polymyalgia (predominantly in the lower limbs), asthenia and progressively disabling muscular weakness. the patient was completely lucid; he reported drinking a small amount of coffee a few seconds before the onset of symptoms, he denied experiencing fever, diarrhea, ingestion of alcohol or other medications and / or use of illicit drugs .\nhaff disease must be considered a cause of rhabdomyolysis in every patient with a history of ingestion of fresh water fish in the 24 hours preceding the onset of symptoms, or in those with changes in the laboratory values of muscle necrosis markers. haff disease must be considered in the differential diagnosis of acute abdomen if there is an epidemiologic history (ingestion of fresh water fish or crawfish 24 hours preceding the symptoms in the case of haff disease) and when other explanations for the causes of the acute abdomen have been excluded. the toxin and all fish species associated with the development of haff disease are still to be identified, but it seems that mylossoma duriventre is one of the species associated with haff disease in brazil and this is the second report linking its ingestion with haff disease .\nas expected, our results show that the fisheries production in the lotic environment of the lower amazon river was cyclic in nature. the annual peak production happened in the period from august to october (drought - flood season), with less expressive values from december to february (wet season). the years 1995, 1999, 2001 and 2002 stood out for having higher catches, while the years 1997, 2000 and 2003 presented the lower catch values (fig 3). out of all the species caught in the lotic environment, the most expressive ones during the studied period were: brachyplatystoma rousseauxii (28. 0 %), prochilodus nigricans (11. 1 %), semaprochiloduns taeniurus and s. insignis (8. 7 %), brachyplatystoma vaillanti (7. 6 %), brachyplatystoma filamentosum (7. 0 %), pseudoplatystoma fasciatum and p. tigrinum (5. 6 %), hypophthalmus marginatus and h. edentatus (5. 5 %), mylossoma duriventre, myleus schomburgki and metynnis argenteus (4. 2 %) and liposarcus pardalis (3. 8 %). these species accounted for 81. 4% of the catches in the analyzed period, accounting for a total of 4, 700 t with a monthly mean of 33 t (std = 28 t) .\ngreek, mylo = mill + greek, soma = body (ref. 45335 )\nfreshwater; benthopelagic; ph range: 5. 0 - 7. 8; dh range: ? - 20; potamodromous (ref. 51243). tropical; 22°c - 28°c (ref. 1672 )\nmaturity: l m? range? -? cm max length: 25. 0 cm sl male / unsexed; (ref. 39031); max. published weight: 1. 0 kg (ref. )\noccurs over mud and silt in streams and lakes. feeds on fish, insects, and plants (ref. 9133) .\njégu, m. , 2003. serrasalminae (pacus and piranhas). p. 182 - 196. in r. e. reis, s. o. kullander and c. j. ferraris, jr. (eds .) checklist of the freshwater fishes of south and central america. porto alegre: edipucrs, brasil. (ref. 39031 )\nphylogenetic diversity index (ref. 82805): pd 50 = 0. 6250 [ uniqueness, from 0. 5 = low to 2. 0 = high ] .\nbayesian length - weight: a = 0. 01862 (0. 01045 - 0. 03318), b = 3. 12 (2. 97 - 3. 27), in cm total length, based on lwr estimates for this species & (sub) family - body (ref. 93245) .\ntrophic level (ref. 69278): 2. 8 ±0. 36 se; based on food items .\nresilience (ref. 69278): high, minimum population doubling time less than 15 months (preliminary k or fecundity .) .\nvulnerability (ref. 59153): low vulnerability (21 of 100) .\nthis south american freshwater fish, a species of pacu, is a ...\neol content is automatically assembled from many different content providers. as a result, from time to time you may find pages on eol that are confusing .\nto request an improvement, please leave a comment on the page. thank you !\njust added to the 125g. they were in this tank previously when they were smaller than a nickel and the oscar ate one so they' ve been growing out in a 100g for a while. they' re almost at a silver dollar size. i' m pretty sure at this size rocky won' t eat them. time will tell .\nthe most beautiful school of silver dollars on the planet. (4. 5 - 7. 5 inches )\nhtml public\n- / / w3c / / dtd html 4. 01 transitional / / en\nurltoken\nspecial publication of the center for biodiversity research and information, no. 1, vol 1 - 3\ndisclaimer: itis taxonomy is based on the latest scientific consensus available, and is provided as a general reference source for interested parties. however, it is not a legal authority for statutory or regulatory purposes. while every effort has been made to provide the most reliable and up - to - date information available, ultimate legal requirements with respect to species are contained in provisions of treaties to which the united states is a party, wildlife statutes, regulations, and any applicable notices that have been published in the federal register. for further information on u. s. legal requirements with respect to protected taxa, please contact the u. s. fish and wildlife service .\nthis article is a stub. we cannot complete the encyclopaedia without your help. you can contribute to the aquarium wiki by expanding this article. dont be shy! .\nthis page was last edited on 13 december 2017, at 03: 03 .\ncontent is available under creative commons attribution - sharealike 3. 0 unported license unless otherwise noted .\nthe webpage text is licensed under a creative commons attribution - noncommercial 4. 0 license\nfroese, r. & d. pauly (editors). (2018). fishbase. world wide web electronic publication. , available online at urltoken [ details ]\n( of salmo trigintaradiatus larrañaga, 1923) froese, r. & d. pauly (editors). (2018). fishbase. world wide web electronic publication. , available online at urltoken [ details ]\n( of metynnis unimaculatus steindachner, 1908) froese, r. & d. pauly (editors). (2018). fishbase. world wide web electronic publication. , available online at urltoken [ details ]\n( of myletes albiscopus cope, 1872) froese, r. & d. pauly (editors). (2018). fishbase. world wide web electronic publication. , available online at urltoken [ details ]\n( of myletes orbignyanus valenciennes, 1850) froese, r. & d. pauly (editors). (2018). fishbase. world wide web electronic publication. , available online at urltoken [ details ]\n( of myletes duriventris cuvier, 1818) froese, r. & d. pauly (editors). (2018). fishbase. world wide web electronic publication. , available online at urltoken [ details ]\nhtml public\n- / / w3c / / dtd html 4. 01 transitional / / en\nhtml public\n- / / w3c / / dtd xhtml 1. 0 transitional / / en\nurltoken\nwarning: the ncbi web site requires javascript to function. more ...\ncorresponding author: oswaldo tolesani júnior, travessa frederico pamplona, 32 - copacabana, zip code: 22061 - 080 - rio de janeiro (rj), brasil. e - mail: rb. moc. girepus @ inaselotodlawso\nthis is an open access article distributed under the terms of the creative commons attribution non - commercial license which permits unrestricted non - commercial use, distribution, and reproduction in any medium, provided the original work is properly cited .\nin the summer of 1924, physicians near the königsberg haff shores along the baltic coast first recognized an outbreak of an illness characterized by sudden, severe muscular stiffness that was often accompanied by dark - colored urine. (1) no neurologic abnormalities, fever, splenomegaly, or hepatomegaly were observed. (1) the clinical spectrum of the disease varied, while most patients recovered quickly, a few patients died .\nin the following 9 years, similar outbreaks affecting an estimated 1, 000 individuals occurred seasonally in the summer and fall along the coast of the königsberg lagoon. the ingestion of fish, usually cooked, was common among those who became ill, and the species of fish associated with the sickness included burbot (lota lota), eel (anguilla anguilla), and pike (esox sp .). there were also reports of seabirds and cats dying after eating fish in the wild .\ndue to the absence of fever and because of the fairly rapid onset of symptoms after eating cooked fish, a toxin is believed to be the cause of haff disease. (2) several toxic etiologies have been proposed for the disease, (3) but none have been confirmed. they include arsenic poisoning, (3) which is still cited in modern medical dictionaries as the cause of haff disease. the toxin does not have an unusual smell or taste, and it might be thermostable because it is not destroyed upon cooking. (4 )\nfrom 1934 to 1984, other outbreaks similar to haff disease were described in sweden (5) and the former soviet union. (6, 7) the first two cases reported in the united states occurred in texas in june 1984. from 1984 to 1996, only four other cases were reported in the united states, two in los angeles and two in san francisco (both cities in california). in 1997 five cases of haff disease were reported in the united states (in california and missouri) during a 5 - month period (march to august), all of the cases were associated with the ingestion of buffalo fish (ictiobus sp .). (8) in 2001, more cases were reported in the united states that involved the ingestion of freshwater crayfish (cambaridae family) (9) in missouri and salmon in north carolina. (2) in september 2010, some cases of haff disease that were associated with the consumption of freshwater crayfish (parastacidae family) were reported in china. (10 )\nhis vital signs were within the normal range, except for his heart rate, which was elevated (at approximately 120 bpm). on physical examination, there was diffuse abdominal pain on palpation, and none of the following symptoms: pain localization, guarding, visceromegaly, palpable masses or peritoneal irritation signs .\nthe patient received intravenous analgesics and antispasmodic drugs, while diagnostic investigation was started. his initial laboratory tests revealed leukocytosis with neutrophilia and no elevation of c - reactive protein. abdominal computed tomography showed no significant abnormality. his abdominal pain was refractory to intravenous analgesia, including opioids, a fact that stood out to the physicians on duty .\nin the brazilian northern region, his total cpk and myoglobin were measured. they were both extremely elevated (total cpk: 4, 456u / l and myoglobin 37, 868. 5ng / ml). a diagnosis of rhabdomyolysis was made as the ratio of total cpk / cpk - mb was greater than 5 (\n). the patient was hospitalized, intravenous hydration was initiated, and the analgesic treatment was intensified .\nafter his admission to the intensive care unit (icu), intravenous bicarbonate was administered to promote urine alkalization and renal protection. the patient’s myoglobin (acute phase muscle injury marker) level reduced gradually, there was a sudden and transient elevation in the total cpk level followed by a gradual decrease in the level, as expected in cases of rhabdomyolysis with a benign course (\nthe patient maintained good hourly diuresis and his nitrogen waste was within the normal range. he was discharged from the icu on the 5 th day after admission, at which time he did not require further urine alkalization and the muscle injury markers continued to decrease. no fluid and electrolyte imbalance was observed during this period .\nthe patient was discharged from the hospital on the 8 th day after admission. he was asymptomatic, and his muscle injury markers were within the normal range .\nhaff disease is an emerging disease that was first described less than one century ago. it is characterized by symptoms of rhabdomyolysis associated with ingestion of fresh water fish. (1) a toxin is believed to be inducing the rhabdomyolysis and causing this disease, (2) but no toxin has been identified .\nsome fresh water fish species, (1 - 8, 11) and even crawfish species, (9, 10) seem to be implicated in the development of haff disease, and the disease seems to occur in outbreaks .\nin the case report, we describe an unusual presentation of haff disease, the patient who presented to the emergency room with an acute abdomen, suggesting that rhabdomyolysis should be considered a differential diagnosis for the acute abdomen when an epidemiologic history and other potential explanations for the abdominal pain have been excluded .\nthe diagnosis of haff disease is based on clinical suspicion, epidemiologic history (ingestion of freshwater fish in the 24 hours preceding the event), and the levels of muscle necrosis markers, particularly myoglobin and creatine kinase. it is worth emphasizing the importance of notifying the cases and obtaining samples of the meal ingested for toxin identification. differential diagnosis should include other toxidromes in which rhabdomyolysis is present (e. g. , arsenic, mercury, organophosphate poisoning) .\nhaff disease and all cases rhabdomyolysis should be treated aggressively to prevent severe metabolic and renal effects, which can lead to acute renal failure and other causes of morbidity and mortality .\nbuchholz u, mouzin e, dickey r, moolenaar r, sass n, mascola l. haff disease: from the baltic sea to the u. s. shore .\nleshchenko pd, khoroshilova nv, slipchenko lm, kaznacheĭ ria. observation of haff - uchs disease cases .\ncenters for disease control and prevention (cdc) haff disease associated with eating buffalo fish - - united states, 1997 .\nkrishna n, wood j. it looked like a myocardial infarction after eating crawfish... ever heard of haff disease ?\nzhang b, yang g, yu x, mao h, xing c, liu j. haff disease after eating crayfish in east china .\ndos santos mc, de albuquerque bc, pinto rc, aguiar gp, lescano ag, santos jh, et al. outbreak of haff disease in the brazilian amazon .\n: missing argument 2 for checkecotox (), called in / var / www / html / summary / speciessummary. php on line 1995 and defined in\n: missing argument 3 for checkecotox (), called in / var / www / html / summary / speciessummary. php on line 1995 and defined in\nlanguages of hunter - gatherers and their neighbors: a collection of lexical, grammatical, and other information about languages spoken by hunter - gatherers and their neighbors .\nfreshwater; benthopelagic; ph range: 5. 0 - 7. 8; dh range: ? - 20; potamodromous (ref. 51243). tropical; 22°c - 28°c (ref. 1672), preferred ?\npopular: trivia, history, america, cities, world, usa, states, television, ... more\noccurs over mud and silt in streams and lakes. feeds on fish, insects, and plants (ref. 9133) .\nplants / detritus + animals (troph. 2. 2 - 2. 79 )\ntrophic level estimated from a number of food items using a randomized resampling routine .\namazon, orinoco and paraguay - paraná river basins: argentina, bolovia, brazil, colombia, ecuador, paraguay, peru and venezuela .\n25. 0 cm sl (male / unsexed; (ref. 39031) ); max. published weight: 1, 000 g (ref. )\nbenthopelagic; potamodromous (ref. 51243); freshwater; ph range: 5. 0 - 7. 8; dh range: 20\npotamodromous. migrating within streams, migratory in rivers, e. g. saliminus, moxostoma, labeo. migrations should be cyclical and predictable and cover more than 100 km .\nthe following is a representative barcode sequence, the centroid of all available sequences for this species. no available public dna sequences. download fasta file\ncopyright © 1999 - 2018 john wiley & sons, inc. all rights reserved\nenter your email address below. if your address has been previously registered, you will receive an email with instructions on how to reset your password. if you don' t receive an email, you should register as a new user\ndiscover a faster, simpler path to publishing in a high - quality journal. plos one promises fair, rigorous peer review, broad scope, and wide readership – a perfect fit for your research every time .\nthis paper aims to describe the spatial - temporal variability in catch of the main fishery resources of the amazon river and floodplain lakes of the lower amazon, as well as relating the catch per unit of effort with anomalies of some of the amazon river, atmosphere and atlantic ocean system variables, determining the influence of the environment on the amazonian fishery resources. finfish landings data from the towns and villages of the lower amazon for the fisheries of three sites (óbidos, santarém and monte alegre), were obtained for the period between january 1993 and december 2004. analysis of variance, detrended correspondence analysis, redundancy analysis and multiple regression techniques were used for the statistical analysis of the distinct time series. fisheries production in the lower amazon presents differences between the amazon river and the floodplain lakes. production in the amazon river is approximately half of the one of the floodplain lakes. this variability occurs both along the lower amazon river region (longitudinal gradient) and laterally (latitudinal gradient) for every fishing ground studied here. the distinct environmental variables alone or in association act differently on the fishery stocks and the success of catches in each fishery group studied here. important variables are the flooding events; the soil the sea surface temperatures; the humidity; the wind and the occurence of el niño - southern oscillation events. fishery productivity presents a large difference in quantity and distribution patterns between the river and floodplain lakes. this variability occurs in the region of the lower amazon as well as laterally for each fishery group studied, being dependent on the ecological characteristics and life strategies of each fish group considered here .\ncitation: pinaya whd, lobon - cervia fj, pita p, buss de souza r, freire j, isaac vj (2016) multispecies fisheries in the lower amazon river and its relationship with the regional and global climate variability. plos one 11 (6): e0157050. urltoken\ncopyright: © 2016 pinaya et al. this is an open access article distributed under the terms of the creative commons attribution license, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited .\ndata availability: the environmental data and climate indexes are available in public repositories as follows: meteorological data are available in the website: urltoken. the sea surface temperature data are available in the website: urltoken. the hydrological data are available in the website: urltoken. climate indexes are available in the website: urltoken. the set of raw fishing data are obtained through the brazilian ministry of fisheries and the chico mendes institute for biodiversity conservation. the fishing data used here were processed by the authors of this paper as cpue (catch per unit effort) and were made available for plos one readers in the supplementary file (s2 cpue river and s3 cpue lake) .\nfunding: funding for translation and publishing was provided by the pro - reitoria de pesquisa e pos - graduacao (urltoken) and fundacao de amparo e desenvolvimento da pesquisa (urltoken) from universidade federal do para (urltoken). whdp was supported by brazilian ph. d. scholarships from the coordenacao de aperfeicoamento de pessoal de nivel superior of brazil (urltoken). rbs was supported by scholarship in research productivity pq cnpq 308646 / 2013 - 4 from the brazilian national council for scientific and technological development (urltoken). the funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. the specific role of this author is articulated in the' author contributions' section .\nfishing is a major activity in the amazon river since the origins of the earliest native communities in the region [ 1 ]. in the lower amazon, this activity is different from other regions due to the large amount of species explored, their production and their different impacts on each of the human communities present in the region [ 2 ]. the fishery in this region is essentially artisanal and based on a diversity of fishing methods, with different degrees of technological development. different fishing tactics are frequently applied, depending on the target species and the local environment [ 3 ], contributing to increase the uncertainties of our understanding of the fisheries in the amazon .\nthe estimated number of fish species in the amazon ranges from 1500–2000 to 8, 000 species according to different authors [ 4 – 5 ]. however, the commercially exploited species varies within a narrow range of six to twelve species that correspond to about 80% of the total fish biomass landed [ 2 ]. the composition of the catch is related to the specific environment that predominates where the fishery is made as well to the nature and costumes of the regional communities. this is well exemplified by the predominance of scale fishes relative to catfish in the central amazon region which is echoed in the fish supply of the local markets [ 2 ] .\nfish species exhibit adaptative tactics to cope with the seasonal changes in the hydrological cycle in the regions where they occur: either the floodplain lakes and / or in the main course of the amazon river [ 2 ]. in order to understand the dynamics and composition of these fish species, it is critical to document their adaptative tactics and, therefore, new research is needed to better understand the biological cycles, feeding strategies, metabolism, individual growth and development and migration behaviour of the amazonian fish. [ 6 – 14 ] .\nthe distribution and ecology of fishery resources in the amazon region are determined by the natural surroundings, availability of environments, meteorological characteristics and variability of the hydrological cycle. with a higher discharge, the amazon river floods its banks and expand itself over the surrounding floodplains [ 2 ]. thus, the flooding dynamics is expected to act over the fishery dynamics. early works show that there is a strong relationship between the amazonian hydrological cycle and the local fish catches throughout the year [ 15 ]. floodplains and wetland forests are extremely valuable in ensuring the success of amazonian commercial fisheries, which leads to the consequent need for their conservation [ 16 – 19 ] .\nto ensure a sustainable fishery and its long - term conservation, the concept of managing landscape units should be considered: we ought to understand the resources within the environment as a whole and their variability within the river - flooding plains system. likewise, when considering the climate variability and changes, the ecological approach taken to understand the fisheries should consider the meso to macro spatial scales. this is paramount if we aim to strengthen our public conservation policies and improve the management of the fisheries resources in the amazon river basin region. these aspects indicate the importance of understanding the direct interactions between the living resources and their environment [ 2 ] .\nsome authors have studied the variability of the hydrological cycle and its relationship with the dynamics, recruitment and catch of commercial species in inland waters, in diverse places in the world [ 20 – 32 ], but not in the amazon river basin. to contribute to this lack of knowledge, this paper aims to study the spatial - temporal variability in catch of the main fisheries resources in the lower amazon, considering the different aquatic environments, i. e. , the amazon river and the floodplain lakes. this paper also aims to describe the relationship between fishery productivity using the variable cpue (catch per unit effort) and anomalies of some environmental variables of the river - atmosphere - ocean system, determining the influence of the environment on the the success of the local fisheries .\nthe study area covers the fisheries grounds of óbidos, santarém and monte alegre, in the region of the lower amazon, between latitudes 1° 43’s– 2° 37’s and longitudes 55°55’w– 53°46’w (fig 1) .\nthe lower amazon and the subdivision in three areas: óbidos, santarém and monte alegre .\ninformation on catch per species and fishing effort from january 1993 to december 2004 was collected on a daily basis for each fishing trip by means of interviews with the skippers or those responsible on the vessels that dock in the major catch landing ports of the study area [ 15 ]. the time series of fisheries data included 163, 546 identification records of fishing units, where each record corresponds to a single fishing trip. with the selection of attributes–fishing boat and gill net–the series were reduced to 19, 484 records for the river environment and 37, 624 records for the floodplain lakes, only considering here the fisheries in the lower amazon. this selection is justified since it is known that gill net is the main fishing method in the lower amazon, and the fishing boats (boats with their own crew for catching fish) are the most representative units of this artisanal fleet, accounting for over 80% of all the fisheries production in the region [ 33 ]. a criteria for reducing the number of species studied here from all species caught in the lower amazon region included the use of a multivariate analysis (discussed later on this text). the analysis was performed over a number of fish families that represented about 80% of the local fish production in each of the two environments studied here: river and floodplain lakes .\ndue to the low abundances and small importance on the regional fisheries, some fish families were not considered here. they are: anostomidae, serrasalmidae and loricariidae at óbidos (for the river environment); loricariidae and doradidae at óbidos and clupeidae at monte alegre (for the floodplain lakes). the most representative fish families of our study area were the pimelodidae (in the amazon rover and especially during the dry season) and the hypophthalmidae (in the lakes and especially during the wet season) .\nthe hydrological data of the amazon river used here were the discharge (ard) for óbidos, water level (wl) for santarém and a spatial average of rainfall (rf) for the lower amazon region were obtained from the brazilian water management agency (ana, agência nacional de águas– urltoken). time series at the monthly temporal resolution were obtained for the same period of the fishery data, covering january 1993 to december 2004. the time series were used for calculating the climatology means of discharge, water level and rainfall for the lower amazon river region during the period analysed here .\nother meteorological data apart from rainfall were obtained from the ncep / ncar (national centers for environmental prediction / national center for atmospheric research) reanalysis project. we used data from both n / n reanalysis [ 34 ] and reanalysis 2 [ 35 ] databanks. monthly averages were used, distributed in a gaussian grid with a spatial resolution of 1. 8758 km x 1. 9058 km (latitude / longitude). the variables studied here were zonal (u) and meridional (v) wind surface (10 m) anomalies, surface (2 m) specific humidity (spfh), minimum air temperature (tmp), soil temperature (tmpsfc), potential evaporation (pevpr), latent heat flux (lhf) and runoff (runof). the meteorological data is publicly available on - line (urltoken) .\nmonthly sea surface temperature (sst) data were also obtained in a 4 × 4 km grid along the coast of pará and amapá states in the brazilian amazonia, as well as for the mouth of the amazon river. this oceanographic variable was obtained from the “optimum interpolation sea surface temperature version 2—first guess sst field” dataset, processed with the nlsst (non linear sea surface temperature) algorithm, available on the database of the pathfinder project v. 5. (pv5) developed by the nodc (national oceanographic data center - urltoken) and rsmas (rosenstiel school of marine and atmospheric science, —university of miami )\nin order to time correlate the oscillations found in the fisheries time series with climatological events possibly affecting the study region, we used time series of some known climatic indices. owing to known linkages of climatic events such as the el niño - southern oscillation (enso) and the variability of the sst fields in the atlantic ocean [ 36 – 40 ], we used the multivariate enso index (mei), the north atlantic oscillation index (nao) and the inter - hemispheric sst gradient of the atlantic (gita). the time series of mei and nao indexes were obtained from urltoken. the gita index was calculated by the diference between sst anomalies in the north and the south atlantic ocean [ 41 ] .\nin order to measure productivity, catch per unit of effort (cpue) was estimated here for each fishery and species. cpue is defined as the amount of fisheries resource caught by an effort unit employed. the cpue was estimated by using catch in tonnes divided by the effort (number of fishermen x fishing days). the cpue estimate was made by using the jackknife method, described as [\nis the effort for the same month and fishery. the jackknife method was selected since it is recommended for situations in which there is a lack of knowledge on the behaviour of the choosen variables, as is the case in the majority of fisheries studies [\nthe cpue, on the other hand, will be considered as being related not only to catching the resource, but also to the availability of the fishery environment, i. e. , both its catchability (q) and its abundance (a), as shown below :\nour amazonian fisheries data were grouped according to the taxonomic family and the monthly value of the cpue was estimated for each fishery site (óbidos, santarém and monte alegre) and fishery environment (river and floodplain lakes) .\nthere are two different fish markets in our study region. industrial fish processing companies are located in óbidos and santarém while local consumption markets are mainly located in santarém and monte alegre. this fact contributes for the fisheries dynamics in the lower amazon region. in order to improve our future multivariate statistical analysis, we took into account the fish market as well as the different fish sites and the environmental variables. a fish market index was produced here in order to account for the fisheries destination, aiming to take into consideration the economical drivers of the lower amazon fisheries. the market index is set to be 1 (one) when the monthly fish production was destined toward the industrial processing companies and 0 (zero) when it was destined toward the local consumption markets. the estimate of the market index was made using the following equations :\nis the marked index for the lake environment; pi is the catch of pimelodidae and hy is the catch of hypophthalmidae, the two more representative families in the two studied environments. market indexes were computed for the two different environments and also for the different fishery locals .\nin order to avoid possible distortions on our inferences as well as weak conclusions all our biological and environmental data were subject to a robust statistical method to test for the collinearity among all variables studied here. the method is described in [ 44 ]. when some of our variables are highly correlated we can opt on despise one or some of them aiming to not repeat our interpretations. following [ 45 ], we used here the pearson correlation method and used dispersion diagrams to analize the collinearity among our data .\nthe results from the pearson correlation analysis are seen in table 1 and fig 2. as expected, the analysis indicates that the flooding pulse of the amazon river floodplains is very correlated with the river' s discharge (correlation coeficient, cc = 0. 79). at the same time, the surface (soil) temperature is correlated to the air temperature (cc = 0. 80) and with enso events (cc = 0. 59). the sst anomalies of the continental shelf of amapá, amazon river mouth and pará are highly correlated among them (cc > 0. 90) .\n( ard) amazon river discharge, (wl) water level, (rf) rainfall, (u) zonal wind component, (v) meridional wind component, (tmpsfc) surface temperature, (tmin2m) air temperature, (spfh2m) specific humidity at 2 m height, (swsoilm) water content of the soil, (pevpr) potential evaporation, (runof) runoff, (lhf) latent heat flux, (ssta) sea surface temperature, (mei) multivariate enso index, (gita) atlantic i nter - hemispheric sea surface temperature gradient, (nao) north atlantic oscillation, (ap) continental shelf of amapá, (az) continental shelf of the amazon, (pa) continental shelf of pará .\npearson’s correlation coeficients between environmental variables. (p < 0. 05) .\nafter the collinearity tests, the environmental variables used here were reduced to the following: discharge anomaly of the amazon river (ard); rainfall (rf); water level (wl); zonal (u) and meridional (v) components of the wind; surface temperature (temp); air humidity (spfh); runoff (runof); latent heat flux (lhf); sea surface temperature (ssta); climatic indexes mei, gita and nao .\nmany distinct mathematical and statistical models have been applied into fisheries data. among them, the multivariate regression analysis like the autoregressive integrated moving average (arima) and the general linear model (glm) are highly recommended [ 46 – 53 ]. some authors also employ efficiency models relating fish production with some environmental variables [ 54 – 56 ]. the redundancy analysis (rda) is also a model largely employed in ecological studies to analyse data time series. this method when applyed to fisheries studies empirically assums that the several environmental variables regulate the fishery resources' dinamics as much as the fishery effort do [ 45 ]. this kind of analysis assumes a linear behavior for the variables studied allowing that the unkown variables fit into a linear regression model .\nfor all the variables analysed here, tests for normality were conducted and the data homocedasticity was analysed using the shapiro - wilk and bartlett tests, respectively, accepted for the significant level of p < 0. 05. the analysis of variance (anova) test was applied aiming to test the variance in the monthly average cpue according to the taxonomic family of the most abundant fish species in the lower amazon region. for the anova, the factors established were the taxonomic families, the fisheries region, the months and the years of the fisheries .\nordination was made for the three fishing grounds studies here (óbidos, santarém and monte alegre) as well as for their respective fishery environments (river and floodplain lakes) using the detrended correspondence analysis (dca) of the monthly averaged cpue [ 57 ]. the cpue values analysed here were logarithmically transformed before proceeding with the analysis [ 58 ]. dca is a statistical tool mainly used to explore the data and show initial relationships in one source of data, although it can also be used to choose between linear or unimodal ordination methods [ 59 ]. this analysis made possible to graphically visualize the variation in the associations between our variables .\nthe relationships between the monthly averaged cpue related to the taxonomic family and the environmental variables were analyzed using the rda and the multiple regression. rda was also employed using a matrix of explanatory variables (environmental variables) to quantify the variation in a matrix of response variables (cpue), assuming linear relationships between all variables [ 60 ]. rda is a tool that has been extensively used to analyze ecological relationships, e. g. between abundance data and environment variables. environmental data are used to extract patterns from the explained variation only. rda was he linear gradient analysis method. the focus scaling was on inter - species correlations and species score was divided by standard deviation. we also applied a fourth root transformation into our species data which were previously normalized and standardized. the forward selection of environment variables was made by manual selection with the best k of 24 variables and using monte carlo permutation tests with 9999 unrestrict permutations. the data set was then randomized and each variable was analyzed on its own .\nthe multiple regression method used here was the backward stepwise method applied to a confidence level of 2 (f fisher - snedecor value). the dependent variables were the cpue while the independent variables were the environmental variables and the market index. the fisheries data were transformed through the fourth root transformation. all regressions significant to p < 0. 05 were considered here for future analysis. all the statistical analysis from the anova and the multiple regression tests were made using the statistica7. 0 ® software resulting in several statistical models which relate cpue with the environmental variables and the market index. when performing the dca we used the pcord software run at the natural sciences museum in madrid, spain. the rda was run using the canoco program for windows 4. 54 [ 60 ] .\nfor the period 1993–2004, the estimated total fisheries production in the lower amazon region was 17, 482 t, with a monthly mean of 122 t (std = 49 t). august and september of 1994, 1995, 2001 and 2002 were the months with the highest catches. these months were part of interannual periods of ebb - drought in the amazon river basin. december 2002 and 2003, january and february 2000 and 2004 were the months with the lowest catches in the study region. these periods coincide with the wet period of the study region. the most caught species (81. 4% of total) were hypophthalmus marginatus and h. edentatus (26. 9 %), brachyplatystoma rousseauxii (11. 6 %), prochilodus nigricans (8. 6 %), plagioscion sp. and pachypops sp. (5. 4 %), pseudoplatystoma fasciatum and p. tigrinum (5. 3 %), liposarcus pardalis (5. 0 %), semaprochiloduns taeniurus and s. insignis (4. 5 %), pimelodina flavipinnis (3. 8 %), schizodon fasciatum and leporinus trifasciatus (3. 4 %) and brachyplatystoma vaillanti (3. 2 %). each fishing trip presented a mean fishing effort of 6 fishermen (std = 2 fishermen) and 4 fishing days (std = 1 day) .\nin the lentic environment associated to the amazon river, a rising trend was noted in total fish production, contrary to what commonly occurs in rivers. the years from 2001 to 2003 had the highest fish production, while the lowest productions were recorded in 1993 and from 1997 to 1999 (fig 4). the wet period between february and march presented the highest values while the lowest values were related to the amazonian drought - flood period, from october to december. the target species most caught in floodplain lakes during the study period were hypophthalmus marginatus and h. edentatus (50. 1 %), plagioscion spp. and pachypops spp. (7. 3 %), pimelodina flavipinnis (7. 1 %), liposarcus pardalis (6. 1 %) and prochilodus nigricans (4. 7 %), colossoma macropomum (3. 5 %) and pseudoplatystoma fasciatum and p. tigrinum (3. 2 %). these species accounted for 82. 2% of the total production of 12, 782 t in the study period. the fish production monthly mean was 89 t (std = 43 t) .\nmonthly fishery production by species in floodplain lakes near the fishery grounds of óbidos, santarém and monte alegre, from january 1993 to december 2004. (hyp) hypophthalmus marginatus and h. edentatus, (lip) liposarcus pardalis, (pro) prochilodus nigricans, (pif) pimelodina flavipinnis, (pac) plagioscion spp. and pachypops spp. (pse), pseudoplatystoma fasciatum and p. tigrinum, (col) colossoma macropomum .\nwhen we group the species caught into their taxonomic families, the presence of 20 families of five orders are noted. the most important families are the hypophthalmidae, pimelodidae, sciaenidae, prochilodontidae, loricariidae, anostomidae, cichlidae, clupeidae and doradidae. the evolution of the cpue by taxonomic family caught in the lower amazon indicates an interannual variation and specificities that vary according to the fishery environment. the families pimelodidae are mostly caught in the river (fig 5a) while hypophthalmidae are mostly caught in floodplain lakes (fig 5b). these two taxonomic groups account for a higher cpue observed in 1996 and 1999 .\ndiagram showing temporal variation in the average cpue by taxonomic family in the catches in the (a) amazon river, and in (b) floodplain lakes in the lower amazon, from january 1993 to december 2004. (hy) hypophthalmidae, (pi) pimelodidae, (sc) sciaenidae, (pc) prochilodontidae, (lr) loricariidae, (sr) serrasalmidae, (an) anostomidae, (ci) cichlidae, (cl) clupeidae, (dr) doradidae .\nduring the period of this study, the catch and cpue varied according to the environment and the fishing area not always being directly proportional (table 2). to illustrate this, in the river environment of santarém, the most caught family was pimelodidae with a monthly average of 12. 16 t, while the family with the highest cpue was hypophthalmidae, with, 10. 44 kg·fisherman - 1 ·day - 1 and a catch mean of only 787 kg per month. in the case of floodplain lakes, the highest catch was of hypophthalmidae in óbidos (18. 15 t per month) which coincides with the highest cpue (16. 40 kg·fisherman - 1 ·day - 1). cpue for the same hypophthalmidae family was also very high in monte alegre and santarém (16. 33 kg·fisherman - 1 ·day - 1 and 15. 10 kg·fisherman - 1 ·day - 1 respectively). in the lake environment, the loricaridae family presented a high cpue (10. 83 kg·fisherman - 1 ·day - 1), but ranks in low position among the most caught families in lakes (2. 06 t per month). we conclude that the fishing effort was not always directly related to the total catch .\nmonthly averaged fish production (kg) and cpue (kg·fisherman - 1 ·day - 1) per taxonomic family and fish caught and by artisanal driftnet fishery environment in the lower amazon .\nthe anova results for the correlations between the monthly averaged cpue and four spatial - temporal variables (year, month, fishing ground and taxonomic family, table 3) show that all the variables considered were found significant (p < 0. 5) except for the correlation between month and fishing ground in floodplain lakes (table 3, correlation lake 2 * 3). fig 6 presents a visual illustration of the anova results for the cpue correlations with the taxonomic family and the year for both the river and lake environments. fig 6a indicates that in the river, the family pimelodidae presents the highest cpue followed by the hypophthalmidae and prochilodontidae families. in the floodplain lakes, hypophthalmidae' s cpue stands out followed by loricariidae' s. the interannual variability can be accessed through the anova graphics seen in fig 6b where the year of 2001 (2004) is the one when the maximum (minimum) cpue was produced for the river environment. in the floodplain lakes, maximum (minimum) cpue was produced in 1994 (1995). the big discrepancies in cpue between one year to the other will be discussed later on this text .\ngraphic illustration of the results of the anova test for the average cpue for fisheries in the river (above) and floodplain lakes (below) in the lower amazon, by taxonomic family and year. (xa) level of the factor, (a) family and (b) year." ]
{ "text": [ "mylossoma duriventre , the silver mylossoma , is a species of freshwater serrasalmid fish endemic to tropical and subtropical south america .", "it grows to a maximum length of about 25 cm ( 10 in ) and a weight of 1 kg ( 2.2 lb ) .", "it is the subject of a local fishery , being known as palu in brazil and palometa in venezuela ( names it shares with several relatives ) . " ], "topic": [ 22, 0, 15 ] }
"mylossoma duriventre, the silver mylossoma, is a species of freshwater serrasalmid fish endemic to tropical and subtropical south america. it grows to a maximum length of about 25 cm (10 in) and a weight of 1 kg (2.2 lb). it is the subject of a local fishery, being known as palu in brazil and palometa in venezuela (names it shares with several relatives)."
[ "mylossoma duriventre, the silver mylossoma, is a species of freshwater serrasalmid fish endemic to tropical and subtropical south america. it grows to a maximum length of about 25 cm (10 in) and a weight of 1 kg (2.2 lb). it is the subject of a local fishery, being known as palu in brazil and palometa in venezuela (names it shares with several relatives)." ]
"animal-train-25"
"animal-train-25"
"2676"
"bicyclus dentata"
[ "bicyclus ephorus weymer, 1892; stettin ent. ztg 53 (4 - 6): 79\nbicyclus auricruda; [ bow ]: pl. 115, f. 2; [ nhm card ]\nbicyclus anynana; [ bk ]: 271, pl. 29, f. 419; [ afrl ]\nbicyclus vansoni condamin, 1965; bull. i. f. a. n. (a) 27: 1101\nbicyclus similis condamin, 1963; bull. i. f. a. n. (a) 25: 902\nbicyclus sylvicolus condamin, 1961; bull. i. f. a. n. (a) 23: 788\nbicyclus nachtetis condamin, 1965; bull. i. f. a. n. (a) 27: 1104\nbicyclus maesseni condamin, 1970; bull. i. f. a. n. (a) 32: 1071\nbicyclus xeneoides condamin, 1961; bull. i. f. a. n. (a) 23: 791\nbicyclus howarthi condamin, 1963; bull. i. f. a. n. (a) 25: 908\nbicyclus sambulos cyaneus condamin, 1961; bull. i. f. a. n. (a) 23: 783\nbicyclus sambulos unicolor condamin, 1970; bull. i. f. a. n. (a) 32: 1068\nbicyclus campina; [ bow ]: pl. 115, f. 3; [ nhm card ]; [ afrl ]\nbicyclus campinus carcassoni condamin, 1963; bull. i. f. a. n. (a) 25: 1164\nbicyclus matuta idjwiensis condamin, 1965; bull. i. f. a. n. (a) 27: 1440\nbicyclus sanaos melas condamin, 1965; bull. i. f. a. n. (a) 27: 1442\nbicyclus sophrosyne overlaeti condamin, 1965; bull. i. f. a. n. (a) 27: 1103\nbicyclus smithi eurypterus condamin, 1965; bull. i. f. a. n. (a) 27: 1445\nbicyclus ignobilis acutus condamin, 1965; bull. i. f. a. n. (a) 27: 1447\nbicyclus xeneas occidentalis condamin, 1965; bull. i. f. a. n. (a) 27: 1108\nbicyclus trilophus jacksoni condamin, 1961; bull. i. f. a. n. (a) 23: 796\nbicyclus saussurei angustus condamin, 1970; bull. i. f. a. n. (a) 32: 1073\nbicyclus suffusa ituriensis condamin, 1970; bull. i. f. a. n. (a) 32: 1076\n= bicyclus denina; lamas, 2010, shilap revta. lepid. 38 (150): (197 - 204 )\nbicyclus is a butterfly genus from the subfamily satyrinae in the family nymphalidae. the species are found in the afrotropical ecozone .\nbicyclus moyses condamin & fox, 1964; bull. i. f. a. n. (a) 26: 629\nbicyclus ignobilis eurini condamin & fox, 1963; bull. i. f. a. n. (a) 25: 1166\nbicyclus kenia; [ bafr ], 169; [ bk ]: 266, pl. 28, f. 403; [ afrl ]\nbicyclus mandanes; [ bafr ], 169; [ bk ]: 267, pl. 28, f. 404; [ afrl ]\nbicyclus vulgaris; [ bafr ], 170; [ bk ]: 267, pl. 28, f. 406; [ afrl ]\nbicyclus sandace; [ bafr ], 170; [ bk ]: 267, pl. 28, f. 407; [ afrl ]\nbicyclus ena; [ bafr ], 170; [ bk ]: 268, pl. 29, f. 409; [ afrl ]\nbicyclus buea; [ bafr ], 172; [ bk ]: 269, pl. 29, f. 411; [ afrl ]\nbicyclus golo; [ bafr ], 174; [ bk ]: 270, pl. 29, f. 416; [ afrl ]\nbicyclus safitza; [ afrl ]; larsen & vane - wright, 2012, shilap revta. lepid. 40 (157): 85\nbicyclus campus; [ bafr ], 178; [ bk ]: 271, pl. 29, f. 421; [ afrl ]\nbicyclus milyas; [ bafr ], 179; [ bk ]: 272, pl. 30, f. 423a; [ afrl ]\nbicyclus pavonis; [ bafr ], 179; [ bk ]: 272, pl. 30, f. 423; [ afrl ]\nbicyclus funebris; [ bafr ], 179; [ bk ]: 273, pl. 30, f. 424; [ afrl ]\nbicyclus sophrosyne sophrosyne; [ bafr ], 173; [ bk ]: 269, pl. 29, f. 413; [ afrl ]\nbicyclus smithi smithi; [ bafr ], 174; [ bk ]: 270, pl. 29, f. 415; [ afrl ]\nbicyclus xeneas; [ afrl ]; [ bow ]: pl. 117, f. 6 (text only); [ nhm card ]\nbicyclus safitza safitza; [ bafr ], 178; [ bk ]: 271, pl. 29, f. 420; [ afrl ]\nbicyclus mesogena mesogena; [ bafr ], 168 (text); [ bk ]: 266, pl. 28, f. 402; [ afrl ]\nbicyclus rileyi condamin, 1961; bull. i. f. a. n. (a) 23: 792; tl: cameroun, bitje - ja\nbicyclus jefferyi; [ bk ]: 268, pl. 28, f. 408; [ nhm card ]; [ bafr ], 170; [ afrl ]\nbicyclus istaris; [ bk ]: 269, pl. 29, f. 412; [ nhm card ]; [ bafr ], 172; [ afrl ]\nbicyclus mollitia; [ nhm card ]; [ bafr ], 173; [ bk ]: 269, pl. 29, f. 414; [ afrl ]\nbicyclus saussurei angustus; [ nhm card ]; [ bafr ], 177; [ bk ]: 270, pl. 29, f. 418; [ afrl ]\nbicyclus taenias; [ bow ]: pl. 118, f. 2 (text only); [ nhm card ]; [ bafr ], 179; [ afrl ]\ndicothyris karsch, 1893; berl. ent. z. 38 (1 / 2): 203; ts: mycalesis sambulos hewitson\nw. nigeria, cameroun, gabon, congo republic, zaire, equatorial guinea. see [ maps ]\nhewitsonii nyongensis (birket - smith, 1960) (mycalesis); bull. i. f. a. n. (a) 22: 550\nephorus bergeri condamin, 1965; bull. i. f. a. n. (a) 27: 1099\nmycalesis graueri rebel, 1914; ann. mus. wien. 28: 256\ns. nigeria - cameroun, gabon, fernando póo (macías nguema i .). see [ maps ]\nidiomorphus zinebi butler, 1869; ann. mag. nat. hist. (4) 3 (13): 19, pl. 9, f. 4; tl: gold coast\nkenya, e. zaire, uganda (toro). see [ maps ]\nmesogena mesogenina grünberg, 1912 ²; ergeb. dt. z. - afr. exped. 3 (zool. 1): 509\nmycalesis sambulos hewitson, 1877; ill. exot. butts [ 4 ] (mycalesis & idiomorphus): [ 65 ], pl. [ 34 ], f. 63 - 64; tl: gaboon\nc. kenya (highlands), loita, mau hills, n. tanzania, n. lake victoria, s. sudan. see [ maps ]\nmycalesis (?) kenia rogenhofer, 1891; ann. mus. wien 6 (3): 462, pl. 15, f. 8\nsenegal - w. kenya, tanzania (forests), uganda, zaire, gabon, angola. see [ maps ]\ngambia - angola, uganda, tanzania, w. kenya. see [ maps ]\nmycalesis tolosa plötz, 1880; stettin ent. ztg 41 (4 - 6): 197; tl: abo, aburi und victoria\nburundi, rwanda, tanzania, zaire, uganda, w. kenya. see [ maps ]\nmycalesis sandace hewitson, 1877; ill. exot. butts [ 4 ] (mycalesis & idiomorphus): [ 65 ], pl. [ 34 ], f. 65; tl: fernando po\nzululand - swaziland, e. transvaal, rhodesia - kenya, uganda. see [ maps ]\nmoçambique, rhodesia, zambia, zimbabwe - zaire, e. kenya. see [ maps ]\nrhodesia, mozambique, malawi, zambia, s. tanzania, s. zaire (shaba )\ne. tanzania (usambara mts. - iringa). see [ maps ]\nmycalesis albocincta rebel, 1914; ann. mus. wien. 28: 260, pl. 21, f. 33 - 34\nmycalesis neustetteri rebel, 1914; ann. mus. wien. 28: 257, pl. 21, f. 29 - 32\nmycalesis matuta karsch, 1894; ent. nachr. 20 (14 / 15): 228\nmycalesis persimilis joicey & talbot, 1921; bull. hill mus. 1 (1): 76, pl. 13, f. 38 - 40; tl: ruwenzori, western slopes\nw. tanzania (kungwe - mahale mts .). see [ maps ]\nmycalesis (monotrichtis) buea strand, 1912; archiv naturg. 77 (suppl. 4): 109; tl: buea; musake\nbrunnea (jackson, 1951) (monotrichtis); proc. r. ent. soc. lond. (b) 20: 97\nw. kenya, uganda, e. zaire, s. zaire. see [ maps ]\nmycalesis abnormis dudgeon, 1909; bull. ent. soc. lond. 1909: lii\nmycalesis fernandina schultze, 1914; ent. rundsch. 31 (9): 49; tl: fernando po\nsmithi poensis condamin, 1963; bull. i. f. a. n. (a) 25: 906\nmycalesis technatis hewitson, 1877; ill. exot. butts [ 4 ] (mycalesis & idiomorphus): [ 66 ], pl. [ 34 ], f. 67; tl: gaboon\ne. nigeria - cameroun, gabon, congo republic. see [ maps ]\nmycalesis nobilis aurivillius, 1893; ent. tidskr. 14: 269, pl. 6, f. 1 - 2\nmycalesis ignobilis butler, 1870; trans. ent. soc. lond. 1870 (1): 124; tl: gold coast\nmycalesis alboplaga rebel, 1914; ann. mus. wien. 28: 257, pl. 21, f. 27 - 28\nmycalesis elionas hewitson, 1866; ill. exot. butts [ 4 ] (mycalesis vii - viii): [ 59 ], pl. [ 31 ], f. 41 - 42; tl: old calabar\nmycalesis dekeyseri condamin, 1958; bull. i. f. a. n. (a) 20: 1348\nghana - cameroun, s. zaire (shaba), uganda. see [ maps ]\nmycalesis dubia aurivillius, 1893; ent. tidskr. 14: 270, f. 4\nzaire, uganda, rwanda, burundi, w. tanzania, kenya (montane). see [ maps ]\nburundi, rwanda, e. zaire (kivu), uganda, nw. tanzania, w. kenya (mt. elgon )\nmycalesis saussurei suffusa riley, 1921; trans. ent. soc. lond. 1921 (1 - 2): 240; tl: nw. rhodesia, solwezi\nrhodesia, moçambique, natal, swaziland - ethiopia, s. somalia, kenya, uganda, e. zaire, comoros, socotra. see [ maps ]\nmycalesis anynana var. neglecta thurau, 1903; berl. ent. z. 48: 119 [ dry - season ]\nkenya - tanzania, zambia, malawi, mozambique, rhodesia, botswana, s. africa, comoro is .\nanynana centralis condamin, 1968; bull. i. f. a. n. (a) 30: 603\nmycalesis safitza ab. semicoeca strand, 1910; soc. ent. 25 (2): 6; tl: usambara\nsw. tanzania (mpanda), zambia, malawi, n. rhodesia. see [ maps ]\nn. zambia, s. zaire (shaba), s. tanzania, w. tanzania. see [ maps ]\nsenegal - ethiopia, w. kenya - mozambique, zimbabwe. see [ maps ]\nw. africa, cameroun, c. a. r. , n. zaire, sudan, uganda, ethiopia\nmycalesis milyas hewitson, 1864; ill. exot. butts [ 4 ] (mycalesis v - vi): [ 57 ], pl. [ 30 ], f. 34; tl: white nile\nmycalesis pavonis butler, 1876; ann. mag. nat. hist. (4) 18: 481; tl: abyssinia\nfunebris orientalis (ungemach, 1932) (mycalesis); mém. soc. sci. nat. phys. maroc 32: 50\nguinea, sierra leone - gabon, c. zaire (kasai). see [ maps ]\nmycalesis uniformis bethune - baker, 1908; ann. mag. nat. hist. (8) 2 (12): 470; tl: makala - beni\nmycalesis hyperanthus bethune - baker, 1908; ann. mag. nat. hist. (8) 2 (12): 469; tl: makala; beni - mawambe\nnigeria, cameroun - gabon, congo republic, c. zaire. see [ maps ]\nmycalesis sciathis hewitson, 1866; ill. exot. butts [ 4 ] (mycalesis vii - viii): [ 62 ], pl. [ 32 ], f. 55 - 56; tl: old calabar\nguinea - nigeria, zaire, w. uganda (bwamba). see [ maps ]\nmycalesis feae aurivillius, 1910; ann. mus. stor. nat. genova (3) 4 / 44: 516; tl: moca, 1400m\nmycalesis analis aurivillius, 1895; ent. tidskr. 16: 113, f. 1; tl: camerun, yaunde\nmycalesis mildbraedi gaede, 1915; int. ent. zs. 9 (13): 71; tl: bezirk jaunde, cameroons\nmycalesis kenia var. inocellata gaede, 1915; ent. rundsch. 32: 50; tl: kitumu, s. kenya\nmycalesis (monotrichtis) hintzi strand, 1912; archiv naturg. 77 (suppl. 4): 110; tl: musake\nmycalesis campides strand, 1912; archiv naturg. 77 (suppl. 4): 110\nmycalesis owassae schultze, 1914; ent. rundsch. 31 (9): 49; tl: o - wassa, fernando - poo\nmycalesis noblemairei janet, 1894; bull. soc. ent. fr. 1894: cclvi; tl: french congo, niari\nmycalesis langi holland, 1920; bull. am. mus. nat. hist. 43 (6): 139, pl. 10, f. 10 (preocc. mycalesis langi de nicéville, 1883); tl: congo\nmycalesis erysichton ehrmann, 1894; j. n. y. ent. soc. 2: 77; tl: piquinini sess, liberia, west africa\nmycalesis eleutheria rebel, 1911; ann. mus. wien. 24: 412, pl. 14, f. 7 - 8\nmycalesis completa gaede, 1915; int. ent. zs. 9 (13): 71; tl: bezirk jaunde, cameroon\nmycalesis chapini holland, 1920; bull. am. mus. nat. hist. 43 (6): 140, pl. 7, f. 9; tl: congo\nmycalesis benitonis strand, 1913; archiv naturg. 79 a (7): 147; tl: alen\nmycalesis bibundensis strand, 1913; archiv naturg. 79 a (7): 148; tl: w. africa, bibundi in kamerun\nmycalesis subignobilis strand, 1913; archiv naturg. 79 a (7): 149; tl: spanish guinea, alen\nchecklist of afrotropical papilionoidea and hesperoidea; compiled by mark c. williams, 7th ed. (2008) (april 2007) ;\n[ ² ] this may require parentheses or not. i don' t have the necessary information for this taxon .\nverzeichniss einer von dem herren missionären e. laman und w. sjöholm bei mukinbungu am unteren congo zu sammengebrachten schmetterlings sammlung\nzoological results of the swedish expedition to central africa 1921. insecta 12. lepidoptera 1\nresults from the danish expedition to the french cameroons (1949 - 1950) xxvii. - lepidoptera\non lepidoptera recently collected in british east africa by mr. g. f. scott elliot\ndescription d' une espèce nouvelle de mycalesis (lep satyridae) (mission p. l. dekeyser et b. holas au libéria, 1948 )\nthe genera of diurnal lepidoptera, comprising their generic characters, a notice of their habitats and transformations, and a catalogue of the species of each genus; illustrated with 86 plates by w. c. hewitson\ndescriptions of some new species of diurnal lepidoptera, collected by mr. harold cookson, in northern rhodesia, in 1903 and 1904\nreise der österreichischen fregatte novara um die erde in den jahren 1857, 1858, 1859 unter den behilfen des commodore b. von wüllerstorf - urbair. zoologischer theil. band 2. abtheilung 2. lepidoptera. rhopalocera\n- 120, (inhalts - verz .) 1 - 9 (pl. 1 - 74), (felder & rogenhofer, 1874), (5): pl .\na list of the butterflies collected by mr. william bonny on the journey with mr. stanley from yambuya on the aruwimi river through the great forest of central africa; with descriptions of nine new species\nillustrations of new species of exotic butterflies selected chiefly from the collections of w. wilson saunders and william c. hewitson\na list of butterflies taken on the march to coomassie by lieutenant alwin s. bell, of the 2nd west - india regiment, between mansu and the river prah, with description of new species\nlepidoptera of the congo. being a systematic list of the butterflies and moths collected by the american museum of natural history congo expedition together with descriptions of some hitherto undescribed species\nnotes on some new or rare rhopalocera from eastern africa. revisional notes and descriptions of some new east african rhopalocera .\nnew lepidoptera collected by mr. t. a. barns, in east central africa. new forms of rhopalocera\ninsekten von baliburg (deutch - westafrika) gesammelt von herrn dr. eugen zintgraff\ndie insecten der berglandschaft adeli im hinterlande von togo (westafrika). 1. abtheilung: apterygota, odonata, orthoptera saltatoria, lepidoptera rhopalocera\nverzeichniss der von professor dr. r. bucholz in west - africa gesammelten schmetterlinge\nwissenschaftliche ergebnisse der expedition r. grauernach. zentralafrika. 1909 - 1911. lepidoptera\ndescriptions of two new species of lepidoptera collected by dr. w. j. ansorge in east africa\na list of the lepidoptera collected by mr. arthur h. neumann, in neumann, a. h. , elephant hungting in east equatorial africa in neumann ,\nneue tagfalter - formen aus usambara, gesammelt von herrn prof. dr. j. vosseler\nzoologische ergebnisse der expedition des herrn g. tessmann nach sud - kamerun und spanisch - guinea. lepidoptera\nneue rhopaloceren aus ost afrika. ergebnisse der nyassa - see - un kenya - gebirgs - expedition der hermann und elise geb. heckmann - wentzel - stiftung\ncontribution à l' étude des lépidoptères d' abyssinie (pt. 1, rhopalocères )\nweymer, 1892 exotische lepidopteren vi stettin ent. ztg 53 (4 - 6): 79 - 125\nif you have corrections, comments or information to add into these pages, just send mail to markku savela keep in mind that the taxonomic information is copied from various sources, and may include many inaccuracies. expert help is welcome .\neol content is automatically assembled from many different content providers. as a result, from time to time you may find pages on eol that are confusing .\nto request an improvement, please leave a comment on the page. thank you !\n© 2016, butterfly conservation society, ghana - african butterfly research institute - icom ltd .\nhtml public\n- / / w3c / / dtd xhtml 1. 0 transitional / / en\nurltoken\nwarning: the ncbi web site requires javascript to function. more ...\nformat summary genbank genbank (full) fasta asn. 1 xml insdseq xml tinyseq xml feature table accession list gi list gff3\nopens the highlight feature bar and highlights feature annotations from the features table of the record. the highlight feature bar can be used to navigate to and highlight other features and provides links to display the highlighted region separately. links in the features table will also highlight the corresponding region of the sequence. more ...\nfinds sub - sequences or patterns in the sequence and highlights the matching regions. the tool works with standard single letter nucleotide or protein codes including ambiguities and can match prosite patterns in protein sequences. more ...\nfinds sub - sequence or patterns in the sequence and highlights the matching region. the tool works with standard single letter nucleotide or protein codes including ambiguities and can match prosite patterns in protein sequences. more ...\nthis article is issued from wikipedia - version of the 7 / 18 / 2016. the text is available under the creative commons attribution / share alike but additional terms may apply for the media files." ]
{ "text": [ "bicyclus dentata , the dentate bush brown , is a butterfly in the nymphalidae family .", "it is found in western and central kenya , western uganda , tanzania , rwanda , burundi and the democratic republic of the congo .", "the habitat consists of semi-montane and montane forests .", "adults are attracted to fermenting fruit . " ], "topic": [ 21, 20, 24, 8 ] }
"bicyclus dentata, the dentate bush brown, is a butterfly in the nymphalidae family. it is found in western and central kenya, western uganda, tanzania, rwanda, burundi and the democratic republic of the congo. the habitat consists of semi-montane and montane forests. adults are attracted to fermenting fruit."
[ "bicyclus dentata, the dentate bush brown, is a butterfly in the nymphalidae family. it is found in western and central kenya, western uganda, tanzania, rwanda, burundi and the democratic republic of the congo. the habitat consists of semi-montane and montane forests. adults are attracted to fermenting fruit." ]
"animal-train-26"
"animal-train-26"
"2677"
"sea cucumber as food"
[ "sea cucumber in desserts, soaps move over konnyaku jelly as the famed sea cucumber from noto sea worms in .\nthe scale worm arctonoe pulchra may occur as a commensal on the red sea cucumber .\nwhitehouse mw, fairlie dp. anti - inflammatory activity of a holothurian (sea cucumber) food supplement in rats .\nthe enhancements will enable the company to increase the capacity of its cucumber - drying operation as well and undergo the canadian food inspection agency accreditation process .\nadditional information about sea cucumber management can be found on our commercial sea cucumber dive fisheries webpage .\nsome believe that the white sea cucumber possesses healing powers that can cure diseases such as cancer .\na caesar salad has layers of saltiness, from anchovies and cheese, as well as salt .\nsaito m, kunisaki n, urano n. collagen as the major edible component of sea cucumber .\nevaluating rotational harvest strategies for sea cucumber fisheries. an mse of the qld east coast sea cucumber fishery .\nsea cucumbers are not only rich in vitamins and minerals, but can also be a great food source .\nfood and agriculture organization of the united nations; rome, italy: 2004. advances in sea cucumber aquaculture and management; p. 425 .\nif you' re mad about japanese food or in the food and beverage business, you are likely to be captivated by this exhibition showcasing products from nearly every corner of japan .\nfood and agriculture organization of the united nations; rome: 2004. pp. 163–171 .\nchen j. overview of sea cucumber farming and sea ranching practices in china .\noverfishing of sea cucumbers may be a modern problem, though the fishery itself is more than 1, 200 years old. sea cucumbers have been harvested since as early as 800 ce. in the 1700s, indonesians traveled as far as australia to harvest sea cucumbers for trade with chinese merchants .\nfrom the modern medical viewpoint, sea cucumber is a valuable source of several kinds of substances that can serve as natural health products, and, perhaps, be developed as drugs. since sea cucumber is consumed as a food by a very small segment of the population outside east asia, most people do not have access to its beneficial components. thus, extracts of desired sea cucumber materials are put into easy - to - consume formats, such as capsules (hard and soft gelatin) and tablets .\nyaacob hb, kim kh, shahimi m, aziz ns, sahil sm. malaysian sea cucumber (gamat): a prospect in health food and therapeutic. proceeding of asian food technology seminar; kuala lumpur, malaysia. 6–7 october 1997; p. 6 .\nfrom the nutritional viewpoint, sea cucumber is an ideal tonic food. it is higher in protein (at 55 %) than most any other food except egg whites (at 99 %) and it has 10 - 16% mucopolysaccharides, substances that are used to build the cartilage. sea cucumber is lower in fat than most other foods .\nit can grow up to 7 feet long and has small tentacles around its mouth that bring in food .\ngreen tea is not only a popular tea but also a popular ingredient used in many food items nowadays .\na fruit jam made with white fungus (l) and milk pudding and porridge, both made with sea cucumber, are among the dazzling array of items in japan food 2016 .\nchosen as a symbol of the united states in 1782, the bald eagle represents virtues such as strength, courage, and freedom .\nwhich have many applications in pharmaceutical industry and also the cosmetics [ and food industry ] ,\nhe said .\nthe sea cucumber is an oblong shaped, gelatinous creature that is distantly related to starfish and sea urchins. the sea cucumber comes by its name honestly: it is indeed shaped like a cucumber. in fact, you could say it has a distinctly phallic appearance, which may account for its reputation as an aphrodisiac. another distinguishing feature is the tentacles around its mouth, which it uses to take in food .\n. the newly studied molecules were able to stimulate nerve cell growth in rat cells in the laboratory. the researchers revealed that similar molecules are also present in nine other species of the sea cucumber, as well as the eggs of sea urchins [\nif sea cucumber fishing resumes, you can say goodbye to the fish, the penguins and the flightless cormorants ,\nwarned dr. blanton, director of the charles darwin research station here, referring to the sea cucumber' s essential position in local food chains .\nas sea cucumbers are important for the health of lagoons, several south pacific countries have closed sea cucumber fisheries to protect stocks in recent years. (photo by jeff yonover )\ndescribed below are the important biological attributes and medicinal benefits of sea cucumbers as given in the literature .\nfisheries experts say that as far as they know, there has been no sustainable harvesting of sea cucumbers for at least 50 years. citing experiences on other pacific islands, conservationists predict that the sea cucumber population here would not recuperate after intensive harvesting .\nin japan, the insides of sea cucumbers are treated as separate food items called konowata. they are served on gunkan, which is a type of sushi. others prefer to pickle it. the naamako chaburi is a sea cucumber that has been marinated in tea and then served with vinegar on it .\nas far as we know, previously no comprehensive review article as such has ever been published covering the detailed nutritional, medicinal and pharmacological aspects of sea cucumbers. this review is an attempt to mainly compile an inclusive report covering the description of high - value components and bioactives as well as biological and medicinal properties of these multipurpose marine invertebrates, as one of the potential sources for functional foods and nutraceuticals. an updated overview of the distribution, fishery and trade of sea cucumbers is also presented, worldwide .\nthe chinese name for sea cucumber - hai shen - translates roughly into\nsea ginseng .\nit & apos; s unclear whether this is in recognition of the sea cucumber & apos; s reputation as an aphrodisiac, or because it is considered to be quite healthful. it may also have something to do with its slippery feel, as the texture of food weights more heavily in chinese cooking than other cuisines. in any event, the chinese have been harvesting sea cucumbers for centuries .\nthe color of a sea cucumber will depend on which species it belongs to .\n“the export market for wild sea cucumber species is expected to grow, ” said david moore, president of the canada sea cucumber processors association in a statement .\nfindlay ja, daljeet a, moharir ye. some constituents of the sea cucumber\nsea cucumbers are animals that live on the ocean floor and is a popular japanese food. the japanese and chinese people tend to like them because of their unique texture, but most westerners have a hard time eating this type of sea creatures. the same goes for the sea urchin, they are both considered the strangest food to eat for many .\nthere are various sub - species of sea cucumbers. some of them are harvested for food while others for medicinal purposes. also sea cucumbers have many health benefits, click here to read more .\nsea cucumber, having a cartilagenous body, serves as a rich source of mucopolysaccharides, mainly chondroitin sulfate, which is well - known for its ability to reduce arthritis pain, especially that of osteoarthritis as little as 3 grams per day of the dried sea cucumber has been helpful in significantly reducing arthralgia. chondroitin' s action is similar to that of glucosamine sulfate, the main building block of chondroitin .\n1st ed. blackwell publishing; oxford, uk: 2006. an overview of dietary supplements and functional food; pp. 1–35 .\nfood and agriculture organization of the united nations; rome, italy: 1990. p. 143. fao fisheries technical paper 2722 .\nuthicke s, purcell s. preservation of genetic diversity in restocking of the sea cucumber\nmojica ere, merca fe. lectin from the body walls of black sea cucumber (\nyamana y, hamano t, goshima s. seasonal distribution pattern of adult sea cucumber\nzhang s, yi y, tang h. bioactive triterpene glycosides from the sea cucumber\nwhat they can’t do is flee. all fishers need to start plucking them from the seafloor is a bucket. at the same time, they have a powerful incentive to harvest as many as they can. dried sea cucumber can sell for as much as us $ 100 per kilogram, koike notes. “it’s a highly lucrative fishery, ” she says. “it’s equivalent to abalone or shark fin. ”\nsilchenko as, avilov sa, kalinin vi, kalinovsky ai, dmitrenok ps, fedorov sn, stepanov vg, dong z, stonik va. constituents of the sea cucumber\nhawa i, zulaikah m, jamaludin m, zainal abidin aa, kaswandi ma, ridzwan bh. the potential of the coelomic fluid of sea cucumber as an antioxidant .\none of the sea cucumber saponins, representative of the structures commonly found in these organisms .\nliu hh, ko wc, hu ml. hypolipidemic effect of glycosaminoglycans from the sea cucumber\ncollin pd. inhibition of angiogenesis by sea cucumber fractions. 5, 985, 330 .\nyang said they could not precisely estimate the white sea cucumber' s market price in future, due to the uncertainty of the animals' nutrition and health as they develop .\nlawrence aj, afifi r, ahmed m, khalifa s, paget t. bioactivity as an options value of sea cucumbers in the egyptian red sea .\na question - and - answer sheet provided by atlantic sea cucumber ltd. says the resource has an enormous market in eastern and southeast asia where it is viewed as a delicacy .\n“innovative canadian processors are developing and positioning sea cucumber products for wholesale and retail customers globally. ”\nconand c, byrne m. a review of recent developments in the world sea cucumber fisheries .\njian j, bao - ling y. studies on resources and bioactive substances of sea cucumber .\n) report that there has been no recovery in catch levels or catch rates of commercial fisheries since that time, but their analysis does not include collection fisheries, such as sea cucumber .\nrepresented at the annual food japan show at suntec city convention centre are 300 exhibitors offering a collective guide to the wide - ranging specialties from 40 prefectures .\nfollow nyt food on facebook, instagram, twitter and pinterest. get regular updates from nyt cooking, with recipe suggestions, cooking tips and shopping advice .\nthe asian demand for sea cucumber has been so high that these have been collected from the u. s. and other countries (e. g. , australia, philipines) to get an adequate supply. the atlantic sea cucumber, cucumaria frondosa, has been collected primarily for food, but has recently been researched as a source of medicinal components, thanks to the efforts of coastside bio resources in maine, headed by peter collin .\nsome defend themselves by excreting a chemical known as holothurin. this chemical is not harmful to humans but it’s toxic to other sea - life creatures within the area. one particular predator of the sea cucumber is the haddock fish .\nthese marine invertebrates play many roles, from bottom - dwelling filter feeders to illicit delicacies. sea cucumbers are farmed and imported in large numbers in asia, where their demand as food has fueled a thriving black market. (find out why smuggling of this ocean creature may skyrocket. )\ncollin pd. process for obtaining medically active fractions from sea cucumber. 5, 876, 762 .\nfu x, cui z. anti - fatigue effects of lower polypeptide from sea cucumber on mice .\nfood and agriculture organization of the united nations; rome, italy: 2007. [ accessed on 18 may 2011 ]. capture production 1950–2005. available online :\nalthough there are many cultured and harvestable sea cucumber species, but around 20 species are reported with relatively high economic and food value. sea cucumbers, usually processed into a dried product know as “bêche - de - mer”, are valued as an important seafood, particularly in asian countries. commercially, the product “bêche - de - mer” can be graded into low, medium or high economic value depending upon several aspects such as species, appearance, abudance, color, odor, thickness of the body wall, and market trends and demands [ 23 ]. they are widely consumed by people in china, japan and south asia [ 70 ]. as a food commodity and medicinal cure, sea cucumbers are famous as bêche - de - mer or trepang over many centuries. they are valued as a nutritious dish among the aboriginal people of south east aisa [ 7, 20 ]. from nutritional view - point, sea cucumbers are ideal tonic and have an impressive profile of high - value nutrients such as vitamin a, vitamin b1 (thiamine), vitamin b2 (riboflavin), vitamin b3 (niacin), and minerals, especially calcium, magnesium, iron and zinc [ 22, 53 ] .\nas well as being able to load content faster than ever before, you' ll now find it' s much easier to find all the content you need about the asian business world .\nthe pacific sea cucumber (stichopus species and other members of the family holothurioidea) has been revered by chinese cooks since ancient times. in particular, sea cucumber meals have been offered on special occasions, especially new year celebrations. an ancient confucian recipe, translated roughly as\nthe eight immortals crossing the sea\nand made with sea cucumber, shark' s fin, and 5 kinds of fish and shellfish, is one of the classic banquet dishes. the sea cucumber is valued - along with several other delicacies, such as shark' s fin, ginseng, cordyceps, and tremella - as a disease preventive and longevity tonic. it was listed as a medicinal agent in the bencao congxin (new compilation of materia medica) by wu yiluo in 1757. the popular chinese name for sea cucumber is haishen, which means, roughly, ginseng of the sea. it is often known in medical literature as fangcishen (fang = four - sided, ci = thorny; referring to the spiky protrusions that emanate from four sides) or, in abbreviated form, fangshen .\nfield guide to the echinoderms (sea cucumbers and sea stars) of malaysia .\nusage of by - products in food to improve their health promoting properties is a potential field. in this case, isolation and production of compounds from sea cucumber, in high class purity, could lead to develop functional foods. it has been proven that by - products from echinoderms as well as sea cucumbers contain considerable amounts of different nutritiously important components. therefore, efforts should be devoted to explore the potential uses of sea cucumber - based biological wastes for value - addition. the magnitude / volume of sea cucumbers currently in use for medicinal, pharmaceutical, cosmoceutical and nutraceutical purposes is still not reflected in the literature and needs to be documented .\nsea cucumber harvested in the wild off nova scotia have a higher value than product farmed in asia as it is said to have more flavour, better texture, and a higher protein and nutrient content .\nsea cucumbers are one of the marine animals which are important as human food source, particularly in some parts of asia [ 7 ]. they are usually soft - bodied echinoderms comprising a diverse group of flexible, elongated, worm - like organisms, with a leathery skin and gelatinous body, looking like a cucumber. habitually, they tend to live on the sea floor in deep seas [ 8 ] .\nsoaring demand for the sea cucumber, a seabed dwelling invertebrate also known as beche - de - mer and trepang, is driving record prices in china' s luxury food market. one species, the pacific sandfish, was selling recently in hong kong for $ 1, 668 a kilo, while the japanese spiky sea cucumber can go for $ 2, 950 a kilo. other species sell for between $ 15 and $ 385 a kilo, depending on size and condition .\ntremblay, , sylvie .\nthe benefits of sea cucumber\nlast modified june 26, 2018. urltoken\ncollin pd. tissue fraction of sea cucumber for the treatment of inflammation. 5, 770, 205 .\nhamel jf, mercier a. early development, settlement, growth, and spatial distribution of the sea cucumber\nsun p, yi yh, li l, tang hf. studies on chemical constituents from the sea cucumber\nwu p, chen y, fang j, su w. studies on the chemical constituents from sea cucumber\ndolmatova ls, eliseikina mg, romashina vv. antioxidant enzymatic activity of coelomocytes of the far east sea cucumber\nin addition to being caught for food, sea cucumbers are prized for medicinal purposes. one study found that a protein extracted from a sea cucumber slowed the growth of the malaria parasite. it is also said that the animals can help cure impotence and increase longevity, but there is little evidence to support these claims .\nmany asian stores also carry dried sea cucumber, which resembles a piece of dried cement (fortunately it & apos; s not as heavy !) it also needs to be soaked for several hours before cooking .\nmost cultures in east and southeast asia consider the cucumbers as a delicacy. quite a number of dishes can be prepared with sea cucumbers. some of the most common ingredients that go with sea cucumber dishes include dried scallop, shitake mushroom and chinese cabbage .\n) is widely used in fisheries as a decision support tool for evaluating the consequences of a range of management strategies, while acknowledging system uncertainty. briefly, it involves developing a model to describe the fishery, with a focus on identification and modeling of uncertainties as well as portraying different representations of resource dynamics (\nprofessor mair was part of a recent south australian government trip to china where he visited huge sea cucumber farms .\nkumar r, chaturvedi ak, shuklab pk, lakshmia v. antifungal activity in triterpene glycosides from the sea cucumber\nrodriguez j, castro r, riguera r. holothurinosides: new antitumor non sulphated triterpenoid glycosides from the sea cucumber\nthere are a series of other bioactive and antiagent substances in sea cucumbers, such as triterpene glycosides, enzymes, amyloses, fatty acids, cytotoxins, etc. with potential capabilities to increase immunity, resist tumor and cruor, protect nerve tissue, ease pain and resist epiphyte as well as contribute to immunopotentiation, anticancer and anticoagulation [ 71, 76 ] .\nthere are several other studies being conducted with the sea cucumber. a patent has been submitted for the process of centrifuging collagen from sea - cucumber flesh into layers to be used in artificial corneal transplants, and the connective tissue of sea cucumbers might be perfect as replacements for torn tendons in humans. even certain cells, believed to be responsible for the regenerative healing process of the sea cucumber, are being isolated and tested to see if they can help speed up our own healing .\nit is a common species distributed from mexico to southeast alaska and has been observed at least as far west and north as the alaska peninsula, aleutian islands, and bering sea. the abundance of sea cucumbers in southeast alaska is greatest in the southern and western portions in protected bays and inlets .\nsylvie tremblay holds a master of science in molecular and cellular biology and has years of experience as a cancer researcher and neuroscientist. based in ontario, canada, tremblay is an experienced journalist and blogger specializing in nutrition, fitness, lifestyle, health and biotechnology, as well as real estate, agriculture and clean tech .\n“with the opening of our new plant in hackett’s cove, we’re pleased to be contributing to the vitality and growth of the sea cucumber processing industry in nova scotia. sea cucumbers from cold atlantic waters are a high - calibre export and we’re committed to educating asian consumers on their many merits as we grow these markets, ” said sam gao, ceo of atlantic sea cucumber ltd .\nwhen first caught, sea cucumber requires an extensive amount of preparation before making the transition from the ocean floor to your dinner plate. the complicated procedure takes place over several days and involves slitting open the belly and removing the guts, as well as washing and boiling the animal several times. fresh sea cucumber that has already been cleaned and soaked is sometimes available in asian markets, usually in the cold foods section or in containers of water .\nsea cucumber can be tricky to prepare. it' s mild flavor and fishy scent mean you' ll need to work with other ingredients to balance its flavors. start small by including some rehydrated and thoroughly cleaned sea cucumber in noodle soup, adding shiitake mushrooms, bok choi and chili oil for well - rounded flavor. as you get more experienced cooking with sea cucumber, try using it to make sushi, or braising it with your favorite vegetables .\npurcell sw, et al. sea cucumber fisheries: global analysis of stocks, management measures and drivers of overfishing .\nafter a yearlong moratorium on sea cucumber fishing, the controversy flared anew in september, when trade ministry officials recommended that ecuador' s president, sixto duran ballen, allow a six - month annual harvesting season for the sea cucumber .\nmojica ere, merca fe. isolation and partial characterization of a lectin from the internal organs of the sea cucumber (\nchludil hd, muniain cc, seldes am, maier ms. cytotoxic and antifungal triterpene glycosides from the patagonian sea cucumber\nzhong y, ahmad khan m, shahidi f. compositional characteristics and antioxidant properties of fresh and processed sea cucumber (\nkalinin vi, silchenko as, avilov sa, stonik va, smirnov av. sea cucumbers triterpene glycosides, the recent progress in structural elucidation and chemotaxonomy .\nthere are hundreds of varieties of sea cucumber found in oceans throughout the world. depending on where you travel, you & apos; ll find it called everything from the romantic sounding beche de mer to the somewhat less attractive sea rat. it is also sometimes referred to as a sea slug, somewhat confusing since the real sea slug is another animal entirely .\naccording to analysis by principles of traditional chinese medicine, the sea cucumber nourishes the blood and vital essence (jing), tonifies kidney qi (treats disorders of the kidney system, including reproductive organs), and moistens dryness (especially of the intestines). it has a salty quality and warming nature. common medicinal uses of sea cucumber in china include treating: weakness, impotence, debility of the aged, constipation due to intestinal dryness, and frequent urination. the sea cucumber properties may be compared with certain other common chinese tonics that are used in food therapy, such as cordyceps (dongchong xiacao; which tonifies yang and is less moistening) and tremella (yiner; which nourishes yin and is moistening, but is less effective as a blood tonic). for yin and blood deficiency, especially manifesting as intestinal dryness, sea cucumber is combined with tremella to make a soup. for impotence, frequent urination, and other signs of kidney deficiency, sea cucumber is cooked with mutton. for nourishing essence and blood in persons who suffer from emaciation, it is combined in soup with pork .\nmarukome, a popular miso paste brand, has revealed the secrets of restaurants to the public with two food marinades made with fermented rice and / or soy beans called' koji' .\nbesides, the main trade for the food purposes, there are perhaps hundreds of thousands of sea cucumbers that are marketed for aquarium industry; however information on species, their exact quantities and source countries are rarely available [ 12 ] .\nantonov as, avilov sa, kalinovsky ai, anastyuk sd, dmitrenok ps, kalinin vi, taboada s, bosh a, avila c, stonik va. triterpene glycosides from antarctic sea cucumbers. 2. structure of achlioniceosides a1, a2, and a3 from the sea cucumber\ngelcich s, et al. territorial user rights for fisheries as ancillary instruments for marine coastal conservation in chile .\nkaswandi ma, hing hl, sahalan az, farah f, ridzwan bh, samsudin mw, yasin msm, ali am. saponin from sea cucumber stichopus badionotus sluiter as potential cytotoxic agent on cem - ss t - lymphoblastic cell .\ndrazen jc, phleger cf, guest ma, nichols pd. lipid, sterols and fatty acid composition of abyssal holothurians and ophiuroids from the north - east pacific ocean: food web implications .\nmuniai c, centurion r, careaga vp, maier ms. chemical ecology and bioactivity of triterpene glycosides from the sea cucumber\nkalinin vi, aminin dl, avilov sa, silchenko as, stonik va. triterpene glycosides from sea cucucmbers (holothurioidea, echinodermata). biological activities and functions .\nboris johnson has resigned as british foreign minister. look back on his outlandish stunts and undiplomatic moments with our quiz .\nhamaguchi p, geirsdottir m, vrac a, kristinsson hg, sveinsdottir h, fridjonsson oh, hreggvidsson go. in vitro antioxidant and antihypertensive properties of icelandic sea cucumber (cucumaria frondosa). presented at ift 10 annual meeting & food expo; chicago, il, usa. 17–20 july 2010; presentation no. 282–04 .\nmost of the currently available functional foods and therapeutic agents are derived either directly or indirectly from naturally occurring sources, especially, the terrestrial food plants and marine species [ 2 – 4 ]. due to the rich oceanic biodiversity, marine organisms are valuable sources of nutritious foods as well as represent novel reservoirs of biologically active components, in particular bioactive peptides, and antimicrobial, anti - inflammatory and anticancer agents [ 4 – 6 ] .\nalthough it is mainly a trade exhibition (oct 27 - 28), it is open to the public on saturday (oct 29 - till 4. 30pm). just like in big japanese food fairs for consumers, you' re likely to chance upon surprising products such as common foods with a quirky twist .\nto prepare the sea cucumber after it is collected, the internal organs are removed, and dirt and sand are washed out of the cavity. it is then boiled in salty water and dried in the air to preserve it. when readied for use in making food, the hard, dried sea cucumber is softened. the process is quite lengthy, which is why this food tends to appear at special dinners and banquets more so than in day - to - day cuisine. to soften the dried sea cucumbers, the instructions are: place the sea cucumbers in a pot and add cold water to cover; soak for at least 12 hours; then cook over low heat for 1 to 2 hours; add more water, as necessary, to make sure that the water always covers the cucumbers; remove from heat and let cool to room temperature, then drain .\ntremblay, , sylvie .\nthe benefits of sea cucumber .\nhealthy eating | sf gate, urltoken 26 june 2018 .\na new processing plant at hackett’s cove will allow nova scotia to grab a bigger share of the lucrative asian sea cucumber market .\nhan h, yi y, xu q, la m, zhang h. two new cytotoxic triterpene glycosides from the sea cucumber\nwu m, xu s, zhao j, kang h, ding h. free - radical depolymerization of glycosaminoglycan from sea cucumber\nsu y, liu s, wu c. optimization of the preparation procedure and the antioxidant activity of polypeptide from sea cucumber .\nas officials and conservationists soon found out, hawai‘i was only the latest in a long string of coastal communities hit hard by a global sea cucumber fishery that has grown into a voracious, fast - moving, highly organized—and, at times, devastating—industry .\naside from the sea cucumbers themselves, the fishers may be the most vulnerable actors in the supply chain. while harvesting sea cucumbers may start out as an easy and lucrative operation, it doesn’t stay that way for long .\nan earlier version of this article mischaracterized maldon sea salt. it is not a solar sea salt .\nshe said globally, cucumaria frondosa — the main species of sea cucumber harvested off nova scotia — has been serially depleted through overfishing .\npurcell sw. managing sea cucumber fisheries with an ecosystem approach. in: lovatelli a, vasconcellos m, yimin y, editors .\nthe california sea cucumber, found from alaska to california, is one of 66 species harvested worldwide. photo by stuart westmorland / corbis\nsan miguel - ruiz je, garcía - arrarás je. common cellular events occur during wound healing and organ regeneration in the sea cucumber\nmurray ap, muniaín c, seldes am, maier ms. patagonicoside a: a novel antifungal disulfated triterpene glycoside from the sea cucumber\nhan h, xu q, tang h, yi y, gong w. cytotoxic holostane - type triterpene glycosides from the sea cucumber\nglobally, sea cucumber trade specifically intended for the food market has been mostly controlled by china hong kong sar (special administrative region), singapore and taiwan province of china. china hong kong sar have the largest entrepot controlling with contribution of 80 percent of the global import - export sea cucumber trade which might be attributed to the ability of the regions to serve as a corridor for goods to the hinterland of mainland china [ 68, 69 ]. traditionally, the lower value products have often been shipped to china hong kong sar for their re - export to china [ 11, 68 ] .\n“we didn’t have a good, solid baseline prior to this, ” sparks says. “it’s not like sea cucumbers were on our radar screen as an imminent fisheries concern. ”\nin this recently shot video, vitaly bazarov filmed what seems like an interminably long sea cucumber seen while he was diving in the red sea in egypt. the species is likely synapta maculata —a snake - like type of sea cucumber that is among the world’s longest, known to reach lengths of seven to 10 feet .\nthe total number of presently existing sea cucumber species is about 1250; however, recently, some new species have also been studied from the indo - pacific ocean, being popular as a center for rich biodiversity of holothuroidea. besides, there are several undescribed larger sea cucumber species living in shallow water which have not yet been systematically identified because there are rather a small number of holothurian taxonomists [\nwhile most people probably aren' t that interested in eatching one, humanity as a whole is certainly ready to benefit from the potentially live - saving technology currently being derived from the lowly sea cucumber. even if it does mean sticking them in your brain .\neriksson h, byrne m. the sea cucumber fishery in australia' s great barrier reef marine park follows global patterns of serial exploitation .\nhan h, yi y, li l, liu b, pan m, yan b, wang x. triterpene glycosides from sea cucumber\nogushi m, yoshie - stark m, suzuki t. cytostatic activity of hot water extracts from the sea cucumber in caco - 2 .\nwang h, yin h, jin h, ha j. the study of anti - fatigue effects of sea cucumber polypeptide on mice .\nchenghui l, beiwei z, xiuping d, liguo c. study on the separation and antioxidant activity of enzymatic hydrolysates from sea cucumber .\nthe sustainable management of natural resources is a fundamental challenge in the face of increasing human population and related demand for food, limited research and management capacity, and the drive for short - term economic development. benthic organisms that are shallow and have limited motility can be particularly susceptible to overharvesting, especially, such as in the case of sea cucumbers, when they are comparatively valuable and easy to harvest and store and where communities rely on these resources for food and income (1, 2). the value and demand for sessile marine resources, such as sea cucumber, are rising (3), resulting in the general overexploitation and even high extinction risk for some sea cucumber populations globally (3, 4), even in seemingly well - managed fisheries, such as in the great barrier reef marine park (gbrmp) (5, 6). globally, there is a need to assess fishery sustainability to meet increasingly stringent requirements for ecological sustainability, particularly in regions with high conservation value. however, gathering and analyzing suitable fishery - dependent and - independent data are often beyond the financial and logistical capacities of the fishery, particularly for multispecies fisheries .\nit is revealed that certain chemical compounds namely chondroitin, mucopolysaccharides and glucosamine, occurring in sea cucumbers, have beneficial effects in arthritis disorders. researchers have shown that usage of sea cucumber is beneficial in maintaining prostaglandins balance thus helping out in the treatment of musculo - skeletal inflammatory disorders such as osteoarthritis, rheumatoid arthritis and spinal arthritis [ 85 – 87 ]. two types of fucan sulfates have been isolated from sea cucumber (stichopus japonicus) body wall using chloroform / methanol solvent system. both types of fucan sulfates tested inhibited the osteoclastogenesis in an in vitro assay. this suggests that these compounds derived from sea cucumber are strong inhibitors of osteoclastogenesis [ 85 ]. therefore, sea cucumber - derived chondroitin sulfate and other related marine compounds can be a useful folk remedy for curing joint - pain and arthritis. the intake of dried sea cucumber is medicinally effective in suppressing arthralgia [ 85 – 87 ] .\nmat jam, mcculloch r, croft k. fatty acid and amino acid composition in haruan as a potential role in wound healing .\nthere are several research groups engaged in conducting preliminary studies on anti - angiogenic, anticoagulant, anticancer, ace inhibitory, anti - inflammatory and antitumor, etc. , activities of the sea cucumber. it is important to identify, isolate and elucidate the structure of related bioactives and the mechanisms involved for all such medicinal effects using more spectrochemical evidences and activity directed protocols as well as clinical human models. the antinutritional factors, if any, related to the underutilized or unexplored sea cucumber species should be appraised. there is also prompt need for authentication of nomenclature of many such underutilized or newer sea cucumber species. most importantly, sea cucumbers dietary intake and nutraceutical / medicinal dosages should be standardized on human clinical basis for attaining optimum functionality and physiological benefits .\nanother class of compounds is saponins, commonly identified as holothurins, from sea cucumber. the structural features of these compounds are quite comparable to those of the bioactives from ganoderma, ginseng, and other medicinally popular tonic herbs [ 22 ]. they have displayed a wide spectrum of biological effects such as hemolytic, cytostatic, antineoplastic, anticancer and antitumor activities [ 24, 90 – 93 ]. also, one recent study revealed that sea cucumber dietary saponins have shown preventive effect in alleviating the orotic acid - induced fatty liver in rats [ 94 ] .\ntremblay, , sylvie. (2018, june 26). the benefits of sea cucumber. healthy eating | sf gate. retrieved from urltoken\nduring the past three to four decades many efforts have been devoted to isolating numerous biologically active novel compounds from marine sources. many of such naturally occurring compounds are of great interest for potential drug development as well as an ingredient of new leads and commercially successful products for various industrial applications, especially, pharmaceuticals, agrochemicals, functional foods and nutraceuticals [ 4 ]. sea cucumbers are one of the potential marine animals with high food and medicinal value. the medicinal properties of these animals are ascribed to the presence of functional components with promising multiple biological activities .\nin summary, we use a quantitative modeling approach to show the advantages of a spatial rotational harvest strategy to improve management of australia’s gbr sea cucumber fishery. we find an improvement in biological and economic performance when implementing an rzs compared with no rzs as well as with increasing time between harvests up to 6 y. this result is robust across a suite of different species with different life history characteristics and fishing pressures, and it is supported by empirical observations of increases in average catches of most species and an increase in the average catch rate of white teatfish and prickly redfish over the 8 - y period since implementation of an rzs as well as the results from other systems on species, such as scallops and abalone. these findings suggest that the benefits of an rzs might apply to marine benthic resources globally. the greatest improvement was obtained for slow - growing species and species under higher fishing intensity. moreover, we show that these results are robust to a number of uncertainties in model parameterization and important structural assumptions, such as uncertain recruitment patterns, as well as under stochastic variability. our results support the use of rotational harvests to better manage sessile marine resources that are often severely overexploited but highly important to many communities worldwide .\ncomparison of risk performance statistics (defined as the probability of biomass being reduced below 40% of the comparable no fishing scenario) for nine major species targeted in the absence of an rzs compared with different cycle times of rzs implementations as indicated and for the same catch .\nin addition, the sea cucumber oil contains two anti - inflammatory fractions. one fraction has fatty acids characteristic of those found in fish; they can be used as a substitute for fish oil in reducing inflammatory byproducts of fat metabolism, and to nourish the brain and heart. the main compounds of interest in fish oil are epa (eicosapentaenoic acid also found in sea cucumber, and dha (docosahaenoic acid), unique to fish :\natlantic sea cucumber ltd. celebrated the grand opening of the facility on thursday, thanks in part to a $ 500, 000 loan from acoa .\nplaganyi ee, skewes td, dowling na, haddon m. risk management tools for sustainable fisheries management under changing climate: a sea cucumber example .\nvieira rp, mulloy b, mourão pa. structure of a fucose - branched chondroitin sulphate from sea cucumber. evidence for the presence of 3 -\nzeng m, xiao f, li b, zhao y, liu z, dong s. study on free radical scavenging activity of sea cucumber (\nmost of the sea cucumber exports from the latin america and the caribbean regions are from peru (26. 1 %) followed by ecuador (25. 9 %), chile (14. 1 %) and cuba (10. 1 %). about 14. 0% of sea cucumber exports are derived from countries where either this fishery is banned such as panama and costa rica or have no proper record (colombia) [\nthere are around 1, 700 species of sea cucumber, of which 66 are used for food. boiled and dried, the animal becomes known by its french name, beche - de - mer - - a dish rich in protein, minerals and fatty acids. in china the animal is a traditional remedy for hypertension, asthma, rheumatism, cuts and burns, impotence and constipation .\ndr steven purcell - urltoken aciar sea cucumber post harvest processing project for best methods to process sea cucumbers into high quality beche - de - mer that will attract the best prices from exporters. training, videos and village placed workshops have been developed for managing sea cucumbers\nsuggesting the uses of these multipurpose marine invertebrates as platform for the development of antileishmanial drugs from some other potential marine resources. some important pharmacological and medicinal properties of sea cucumbers - derived bioactives are presented in\ncite this article: ilima loomis “the sea cucumber’s vanishing act, ” hakai magazine, mar 30, 2016, accessed july 10th, 2018, urltoken .\nsteven purcell, a sea cucumber expert at australia' s southern cross university, said pacific stocks had\nall declined considerably\nover a decade. purcell and six other scientists said in a recent article in the academic journal fish and fisheries that sea cucumber stocks may have\nsuccumbed to pandemic overfishing .\nzhao y, li b, zeng m, dong s, liu z. study on antihypertensive activity of a lower - value sea cucumber protein hydrolysate .\nogushi m, yoshie - stark m, suzuki t. apoptosis - inducing activity of hot water extracts from the sea cucumber in human colon tumor cells .\nwu j, yi yh, tang hf, wu hm, zou zr, lin hw. nobilisides a–c, three new triterpene glycosides from the sea cucumber\nwu j, yi yh, tang hf, wu hm, zhou zr. hillasides a and b, two new cytotoxic triterpene glycosides from the sea cucumber\nthough it' s one of the most perfectly named living things on this planet, the sea cucumber, on first glance, isn' t among the most exciting aquatic species. distantly related to starfish and sea urchins, the sea cucumber in appearance lacks the brio and allure of its cousins, and except for a few variations among subspecies, the general body plan of the cucumber basically resembles a large, leathery sausage crawling along the ocean floor. yum .\njames beard, the father of modern american cookery, once asked, “where would we be without salt? ” i know the answer: adrift in a sea of blandness. salt has a greater impact on flavor than any other ingredient. learn to use it well, and food will taste good .\nas they move into deeper and deeper water, the collectors need a mask and fins and then, eventually, scuba gear—often rented from the traders they sell to. “on good days, they’ll earn a lot of money, but on bad days they can’t pay off the rent, ” erikkson says. “they get trapped in this credit arrangement with the traders. ” the work becomes increasingly dangerous, with some fishers diving as deep as 50 meters in pursuit of the increasingly scarce sea cucumbers .\nwhile much of the western world forgets about them or regards them with disgust because of their slimy, squishy texture, sea cucumbers are a delicacy in many parts of asia, often known as bêche - de - mer. they exist all over the world—from the poles to the tropics and from coastal shallows to the deep ocean floor—in a spectrum of sizes, textures, and colors. of roughly 1, 700 species, 66 are targeted for food .\ngold candy sprinkling real gold flakes onto food is nothing new, but this old - school candy drop from the ancient city of nara makes you wonder how maker ogontoh managed to produce such a resplendent - looking confection with only sugar and sugar syrup .\nanother group of functional substances namely, mucopolysaccharides and chondroitins, have also been identified in sea cucumbers. it has been seen that people suffering from arthritis and connective tissue disorders, are often devoid of these compounds. as such, sea cucumber - derived chondroitin sulfate can be exploited as a nutraceutical to ease joint - pain and arthritis like disorders [ 84 ]. it is for this reason that about 3 g / day serving of the dried sea cucumbers is medicinally effective in reducing arthralgia to a significant level [ 22 ]. the mechanism of action of chondroitin sulfate is considered to be similar to that of glucosamine sulfate; the latter compound is currently in use as therapeutic agent for easing osteoarthritis [ 85 – 87 ] .\nmany of these are gathered for human consumption and some species are cultivated in aquaculture systems. the harvested product is variously referred to as trepang, bêche - de - mer or balate. sea cucumbers serve a useful purpose in the marine ecosystem as they help recycle nutrients, breaking down detritus and other organic matter after which bacteria can continue the degradation process .\nthe crude extracts and pure fractions isolated from holothuria polii (a mediterranean sea cucumber), have shown concentration - dependent antifungal activity against some molds and yeasts as described by ismail et al. (2008) [ 150 ]. according to the data generated, the strains of aspergillus fumigatus were more sensitive to the tested fractions and extracts, whereas those from trichophyton rubrum were less responsive. besides the extracts, different bioactive compounds, most of them known as triterpene glycosides, have been isolated from sea cucumber offering antimicrobial activity. one of these bioactives, namely patagonicoside a, isolated from sea cucumber (psolus patagonicus) [ 118 ], is identified as disulfated tetrasaccharide using 1d and 2d nmr spectral information. furthermore, it is reported that patagonicoside a has good antifungal activity against pathogenic fungus (cladosporium cucumerinum). two newly identified sulfated triterpene glycosides, hemoiedemosides a and b, from the patagonian sea cucumber (hemoiedema spectabilis) exhibited considerable antifungal activity against phytopathogenic fungus (cladosporium cucumerinum), while the semi - synthetic desulfated derivative hemoiedemosides a was relatively less active [ 151 ] .\nzou z, yi y, wu h, wu j, liaw c, lee k. intercedensides a–c, three new cytotoxic triterpene glycosides from the sea cucumber\nmamelona j, pelletier em, lalancette kg, legault j, karboune s, kermasha s. quantification of phenolic contents and antioxidant capacity of atlantic sea cucumber ,\nkariya y, watabe s, kyogashima m, ishihara m, ishii t. structure of fucose branches in the glycosaminoglycan from the body wall of the sea cucumber\nli z, wang h, li j, zhang g, gao c. basic and clinical study on the antithrombotic mechanism of glycosaminoglycan extracted from sea cucumber .\ntradeoff curve between median risk performance (defined as probability of biomass being reduced below 40% of the comparable no fishing scenario; + 1 sd encompasses variation across nine species) and total revenue (million dollars) for rzss with the different cycle times (year) as indicated on the symbols .\na multitude of harvestable sea cucumbers species have been exploited with growing global demand due to their food and pharmaceutical uses [ 9 – 13 ]. the dehydrated sea cucumber is commercially sold, especially in asian markets with main business in china, followed by korea and indonesia and then japan. on the other hand, these are also exported in appreciable quantities to parts of the united states and northern australia [ 14, 15 ]. according to food and agriculture organization of the united nations (fao) report beche - de - mer production and apostichopus japonicas (selenka, 1867) catches by various countries for the period 1992–2001 was estimated to be 12, 331 t (metric ton) (dry weight) [ 16 ] .\n1 faculty of food science and technology, universiti putra malaysia, serdang, selangor 43400, malaysia; e - mails: moc. liamy @ rabdrob _ aras (s. b .); moc. oohay @ rawnaqf (f. a. )" ]
{ "text": [ "sea cucumbers are marine animals of the class holothuroidea .", "they are used in fresh or dried form in various cuisines .", "in some cultural contexts the sea cucumber is thought to have medicinal value .", "the creature and the food product are commonly known as bêche-de-mer in french , from portuguese \" bicho do mar \" ( literally \" sea worm \" ) , trepang ( or trīpang ) in indonesian , namako in japanese , balatan in tagalog and loli in hawaiian .", "in malay , it is known as the gamat .", "most cultures in east and southeast asia regard sea cucumbers as a delicacy .", "a number of dishes are made with sea cucumber , and in most dishes it has a slippery texture .", "common ingredients that go with sea cucumber dishes include winter melon , conpoy , kai-lan , shiitake mushroom , and chinese cabbage . " ], "topic": [ 2, 13, 2, 29, 27, 2, 17, 14 ] }
"sea cucumbers are marine animals of the class holothuroidea. they are used in fresh or dried form in various cuisines. in some cultural contexts the sea cucumber is thought to have medicinal value. the creature and the food product are commonly known as bêche-de-mer in french, from portuguese " bicho do mar " (literally " sea worm "), trepang (or trīpang) in indonesian, namako in japanese, balatan in tagalog and loli in hawaiian. in malay, it is known as the gamat. most cultures in east and southeast asia regard sea cucumbers as a delicacy. a number of dishes are made with sea cucumber, and in most dishes it has a slippery texture. common ingredients that go with sea cucumber dishes include winter melon, conpoy, kai-lan, shiitake mushroom, and chinese cabbage."
[ "sea cucumbers are marine animals of the class holothuroidea. they are used in fresh or dried form in various cuisines. in some cultural contexts the sea cucumber is thought to have medicinal value. the creature and the food product are commonly known as bêche-de-mer in french, from portuguese \" bicho do mar \" (literally \" sea worm \"), trepang (or trīpang) in indonesian, namako in japanese, balatan in tagalog and loli in hawaiian. in malay, it is known as the gamat. most cultures in east and southeast asia regard sea cucumbers as a delicacy. a number of dishes are made with sea cucumber, and in most dishes it has a slippery texture. common ingredients that go with sea cucumber dishes include winter melon, conpoy, kai-lan, shiitake mushroom, and chinese cabbage." ]
"animal-train-27"
"animal-train-27"
"2678"
"pilot whale"
[ "pilot w, manager at pilot whale cafe'. , responded to this review\npilot w, owner at pilot whale cafe'. , responded to this review\nnoaa. 2014. long - finned pilot whale (globicephala melas). urltoken\n3. the pilot whale hunted in the faroe islands is an endangered species .\n, pilot whale steaks are marinated, cut into small chunks, and grilled .\nshort - finned pilot whale (globicephala macrorhynchus )\n. noaa fisheries .\nfemale mortality rates as a function of the age of three matrilineal whale species, killer whale (triangles), long - finned pilot whale (diamonds) and short - finned pilot whale (squares), based on life tables from, and .\nmarsh h, kasuya t. ovarian changes in the short - finned pilot whale ,\nbreeding system and social structure in the faeroese pilot whale as revealed by dna fingerprinting .\nan analysis of pilot whale vocalization activity using hidden markov models. - pubmed - ncbi\na man tries to sever the spinal cord of a pilot whale during a grind .\n6. eating pilot whale is no longer necessary — there is plenty of food .\nname\npilot whale\nis believed to originate from the idea that the pods or herds were piloted by a leader whale .\ncontaminants in pilot whales appear to increase the risk of developing parkinson' s disease in those who often eat pilot whale (11) .\nthe effects of whale - watching on long - finned pilot whales have not been well studied .\nmarsh h, kasuya t. changes in the ovaries of the short - finned pilot whale ,\nannual pilot whale killings in the faroe islands – an ongoing debate. | icenews - daily news\nmercury from pilot whale meat adversely affects the foetal development of the nervous system (3) .\npilot whale cafe'. , hangnaameedhoo island - restaurant reviews, phone number & photos - tripadvisor\nheri joensen - today i had pilot whale meat for dinner. if... | facebook\n( cnn) seaworld' s beloved pilot whale has died after decades of performances in san diego .\nkasuya t, marsh h. life history and reproductive biology of the short - finned pilot whale ,\nwhilst the pilot whale may not be endangered, the level of brutality and depraved violence is shocking .\nbucket wielding locals were unable to save an old, sick pilot whale after it beached in canterbury .\nseaworld san diego announced the death of one of the park' s attractions, bubbles the pilot whale .\ntaruski ag (1976) sounds and behavior of the pilot whale. phd thesis, university of rhode island\nan adult male pilot whale with an attached / u. s. navy photo by ari s. friedlaender\nfolio, chapter 6, sulfur bottom the blue whale, never chased by whale men of nantucket .\nthe long - finned pilot whale (globicephala melas) is a large species of oceanic dolphin. it shares the genus globicephala with the short - finned pilot whale (globicephala macrorhynchus). long - finned pilot whales are known as such because of their unusually long pectoral fins .\nin 2012 the faroese killed 713 pilot whales. over 1, 000 pilot whales were killed in the 2013 season .\ngenus. the genus consists of 2 extant species, the short finned pilot whale and the long finned pilot whale. between these two species, the animals are found in marine waters all over the world. they are closely related to the extinct blunt - snouted dolphins. extant relatives of the whale include the risso’s dolphin, false killer whale, melon - headed whale and the\nand farewell spit is located on the north end of golden bay, a known hotspot for pilot whale strandings .\nlesley heal and a group of up to 30 others tended to a stranded pilot whale in akaroa on sunday .\nbubbles, believed to be the oldest pilot whale in a zoological park, has died at seaworld san diego .\nthe restaurant serves every part of the whale, often raw. she serves fine strips of carpaccio of whale, little strips of raw blubber, raw liver, raw heart, deep fried intestine, whale burgers and whale steak. elsewhere in japan you can get whale crackling - deep fried strips of whale skin - and even whale ice - cream made from the blubber .\nseaworld' s oldest pilot whale, bubbles, has died after performing to nearly 100 million visitors for five decades .\nthis whale was more loved than our own families, has brought more smiles to people then any pilot whale in the wild !\njenny thompson said in a post .\nfemale mortality rates as a function of the age of three matrilineal whale species, killer whale (triangles), long - finned pilot whale (diamonds) and short - finned pilot whale (squares), based on life tables from kasuya & marsh (1984), olesiuk et al. (1990) and bloch et al. (1993) .\nfor centuries the people of the faroes, an isolated archipelago halfway between scotland and iceland, have hunted the pilot whale .\noctavo, chapter 2, black fish fine oil for a smaller whale. he approaches as a pilot over the shoals .\njens mortan rasmussen, one such whaler, believes that pilot whale is still an important and sustainable food source for the islands .\nanother whale has died at seaworld, bringing the tally to six over the last year. this one, a short - finned pilot whale named bubbles, spent 50 years in a tank .\nthe long - finned pilot whale is one of two species of pilot whales that form relatively large pods in the open ocean. these species get their common name from their behavior of following a leader or “pilot” when transiting long distances. the two species of pilot whales are actually dolphins, not whales, and they are two of the largest species of dolphin, with only the killer whale growing larger .\n5 minutes video documenting parts of the pilot whale hunt having taken place in sandur, faroes islands, on june 5th 2012, with about 120 pilot whales killed. filmed and edited by hans peter roth\nclick... here... to see a large pilot whale group (. mov file with 18. 2 mb )\nclick... here... to see a pilot whale defecating (. mov file with 1. 7 mb) .\nall the hunted whales are used for their food, with pilot whale meat and flubber being the main products used by the faroese .\npilot whale population numbers are unknown, however they are not considered endangered. there are an estimated 1 million long - finned pilot whales and approximately 200, 000 short - finned pilot whales worldwide. pilot whales have been hunted for their meat, bone, oil, and for fertilizer, a practice which continues in some areas. because they easily adapt to captivity, pilot whales are also exhibited in many aquariums and zoos .\nbritannica, 2011 .\npilot whale\n( on - line). encyclopædia britannica online. accessed august 23, 2011 at urltoken .\nthe faroese have for centuries killed long - finned pilot whales (globicephala melas), and the pilot whale has in many ways been an important part of faroese life – both in regard to food and culture .\nwhale watchers were pleasantly surprised by a sighting of pilot whales off the orange county coast friday, a rare occurrence within the past few decades .\nthe short - finned pilot whale is the name of the second largest species of dolphin, only surpassed by the orca (orcinus orca) .\nbloch d, lockyer c. h, zachariassen m. age and growth parameters of the long - finned pilot whale off the faroe islands .\nclick... here... to see sequences of human - pilot whale research encounters (. mov file with 20 mb) .\nthe main threats that the species faces are marine traffic, pollution and nets. mass strandings also threaten long - finned pilot whale populations. .\n“it is with great sadness that this recommendation is provided, ” they said. “the pilot whale has kept many faroese alive through the centuries. ”\nclick... here... to see a human swimmer approaching a pilot whale underwater (. mov file with 9. 9 mb )\nclick... here... to see a pilot whale breaching 3 times in row (. mov file with 1. 8 mb )\nclick... here... to see a pilot whale frontally approaching a human swimmer (. mov file with 1. 9 mb )\nmillions of people are really angry with us, and they believe we are barbarians because of the pilot whale killing ,\nsaid mr sørensen .\nin japan, they eat several dishes prepared with short - finned pilot whales .\nthe long - finned pilot whale is a cetacean member of the delphinidae family, and one of the largest members of this group. although it is commonly called “whale, ” it is not a whale of the suborder mysticeti. however, this colloquial name comes from its size and behavior .\nanother theory points to pilot whales' highly sociable behaviour – when one whale loses its way and strands, its pod mates may swim to its aid .\nclick... here... to see human snorkelers swimming with a large pilot whale group (. mov file with 10. 4 mb )\nthere are two species of pilot whales – long finned and short finned. if you have sighted one in new zealand’s waters it is almost certainly a long finned pilot whale. they roam throughout the cold temperate waters of the southern ocean .\nclick... here... to see a spectacular in - water interaction with a single pilot whale (. mov file with 6. 3 mb). the whale emits unusual vocalizations and seems to be very excited .\nthe long - finned pilot whale has more neocortical neurons than any mammal studied to date, in fact having almost twice as many as humans. [ 14 ]\nmarsh h, kasuya t. changes in the role of a female pilot whale with age. in: pryor k, norris k. s, editors .\nclick... here... to see a pilot whale duo resting at the water surface (. mov file with 5. 3 mb) .\nclick... here... to see a swim encounter with a resting pilot whale group (. mov file with 5. 7 mb) .\nclick... here... to see a pilot whale subgroup slowly traveling along the coastline (. mov file with 6. 7 mb) .\ngrover said it was not uncommon for a whale to surface on its own, but in the case of pilot whales there was a danger of mass stranding .\npilot whales are in fact one of the largest members of the dolphin family, but they are treated as whales for the marine mammals protection regulations 1992. they were named pilot whales because it was thought that each pod followed a ‘pilot’ in the group .\nsongs of long - finned pilot whales. the cracking noise is caused by echolocation .\nmartin a, rothery p. reproductive parameters of female long - finned pilot whales (\nthey also formed a human chain to prevent refloated pilot whales returning to the beach .\npopulation trend data is insufficient to determine conservation status for short - finned pilot whales .\nembed this arkive thumbnail link (\nportlet\n) by copying and pasting the code below. < a href =\nurltoken\ntitle =\narkive species - long - finned pilot whale (globicephala melas )\n> < img src =\nurltoken\nalt =\narkive species - long - finned pilot whale (globicephala melas )\ntitle =\narkive species - long - finned pilot whale (globicephala melas )\nborder =\n0\n/ > < / a >\nembed this arkive thumbnail link (\nportlet\n) by copying and pasting the code below. < a href =\nurltoken\ntitle =\narkive species - short - finned pilot whale (globicephala macrorhynchus )\n> < img src =\nurltoken\nalt =\narkive species - short - finned pilot whale (globicephala macrorhynchus )\ntitle =\narkive species - short - finned pilot whale (globicephala macrorhynchus )\nborder =\n0\n/ > < / a >\nclick... here... to see a pilot whale group - vessel interaction from the underwater perspective (. mov file with 3. 6 mb )\nbubbles, a female pilot whale at seaworld in san diego that was believed to have been the oldest animal of her species in a zoological park, has died .\n“seaworld san diego is saddened to announce the passing of one of the world’s most beloved animals, bubbles the pilot whale, ” the company said on its website .\nthe strength of selection to increase the span of a life stage is dependent upon individuals at that stage being able to contribute towards individual fitness and the probability of their surviving to that stage. complete reproductive cessation and a long post - reproductive female lifespan as found in humans are also found in killer whale (orcinus orca) and short - finned pilot whale (globicephala macrorhynchus), but not in the long - finned pilot whale (globicephala melaena). each species forms kin - based, stable matrilineal groups and exhibits kin - directed behaviours that could increase inclusive fitness. here, the initial mortality rate and mortality rate - doubling time of females of these three closely related whale species are compared. the initial mortality rate shows little variation among pilot whale species; however mortality rate accelerates almost twice as fast in the long - finned pilot whale as it does in killer whale and short - finned pilot whale. selection for a long post - reproductive female lifespan in matrilineal whales may therefore be determined by the proportion of females surviving past the point of reproductive cessation .\nthe strength of selection to increase the span of a life stage is dependent upon individuals at that stage being able to contribute towards individual fitness and the probability of their surviving to that stage. complete reproductive cessation and a long post - reproductive female lifespan as found in humans are also found in killer whale (orcinus orca) and short - finned pilot whale (globicephala macrorhynchus), but not in the long - finned pilot whale (globicephala melaena). each species forms kin - based, stable matrilineal groups and exhibits kin - directed behaviours that could increase inclusive fitness. here, the initial mortality rate and mortality rate - doubling time of females of these three closely related whale species are compared. the initial mortality rate shows little variation among pilot whale species; however mortality rate accelerates almost twice as fast in the long - finned pilot whale as it does in killer whale and short - finned pilot whale. selection for a long post - reproductive female lifespan in matrilineal whales may therefore be determined by the proportion of females surviving past the point of reproductive cessation .\nthere are around 1 million long - finned pilot whales and 200, 000 short - finned pilot whales. although they are not endangered species, campaigners say a lack of regulation around such traditions in the faroe islands could see significant reductions in whale populations .\nthe center for whale research is a 501c3 nonprofit organization registered in washington state .\nkiller whale vision is well developed (white et al. , 1971) .\nfaroe islanders watch as men inspect whale carcasses taken during a grind in 1947 .\nthe observed upper limit through which a pilot whale may remained submerged without surfacing to breath is 15 minutes. typical submersion periods are generally several minutes below this upper threshold .\nvolunteers look after a pod of stranded pilot whales as they prepare to refloat them after one of the country’s largest recorded mass whale strandings. photograph: anthony phelps / reuters\nopinion: if ever there was a classic misnomer, it came when someone in their wisdom decided to name a particular species of cetacean, a\npilot whale\n.\nshort - finned pilot whales can be confused with their relatives the long - finned pilot whales, but there are various differences. as their names indicate, their flippers are shorter than those of the long - finned pilot whale, with a gentler curve on the edge. they have fewer teeth than the long - finned pilot whale, with 14 to 18 on each jaw. short - finned pilot whales are black or dark grey with a grey or white cape. they have grey or almost white patches on their bellies and throats and a grey or white stripe which goes diagonally upwards from behind each eye .\nover 230 beached pilot whales were massacred in consecutive grinds in the faroe islands in 1212 .\nthe echolocation ability of pilot whales is equal to that of bottlenose dolphins (tursiops truncatus). vocalizations or short - finned pilot whales are in a higher frequency and wider frequency range than those of long - finned pilot whales. they also exhibit group - specific calls .\nideally, researchers could fly over the area to look for other pilot whales in distress .\nsince late thursday, nearly 700 pilot whales stranded on, or near, the area .\npilot whales are social animals, which makes them more likely to beach in large numbers .\nhumans hunt short - finned pilot whales in varying capacities. no other known predators exist .\nthe southern hemisphere long finned pilot whale ranges throughout the southern ocean, but the abundance of the population is not well understood. a second sub species inhabits the north atlantic .\nclick... here... to hear underwater sound disturbance produced by a single vessel masking pilot whale click vocalizations (. mp3 file with 1. 6 mb )\nin a photograph taken saturday, volunteers prop up a pilot whale at farewell spit in new zealand. overnight, more than 200 of the stranded whales returned to the sea .\ncurrently, studies are underway to examine the fertility of the population since suspicion has been raised that reproductive functions may be decreased because of contaminants in pilot whale meat and blubber .\nthe debate about the pilot whale hunt in the faroe islands is unlikely to be solved this summer. many faroese consider the whale meat an important part of their food culture and history. animal rights groups and protesters condemn the harvest as being cruel and unnecessary .\nlong - finned pilot whales are active predators that eat mostly squid, including relatively large - bodied species. they will also eat bony fishes when they are common. in some areas, the long - finned pilot whale can be observed forming mixed species groups with sperm whales (another toothed whale that feeds preferentially on squid) and also with smaller dolphins .\naside from the faroe islands, a few pilot whales are taken opportunistically in greenland each year .\nmartin a. r, rothery p. reproductive parameters of female long - finned pilot whales (\neight pilot whales have stranded at taupata point south of farewell spit in golden bay this afternoon .\n25 dead short - finned pilot whales were discovered on kice island in the rookery bay reserve .\npilot whales are considered to be one of the most social marine mammals and while their herding instinct can help them survive in other circumstances, when a pilot whale beaches its cry of distress prompts other members of the group to come to its aid, often with fatal consequences .\nthe short - finned pilot whale is classified as data deficient (dd) on the iucn red list (1) and is listed on appendix ii of cites (3) .\nit’s possible that one of the ‘killer whales’ could have been the false killer whale .\nolesiuk, p. f. 2012. population biology of the resident ecotype of killer whale in british columbia. materials of the killer whale workshop, suzdal, russia .\nthe rescuers referred to the whale as “she” but said they didn' t know the gender. they said the whale had a healthy body weight and no visible injuries .\nthere was some confusion about the whale numbers during the strandings due to the large numbers involved but we have since reassessed the whale numbers and revised them to those figures .\nofficials believe a whale that washed ashore in new jersey died due to human interaction .\nthe whale was later shot by a department of conservation (doc) staff member .\npilot whale chalets is located on the main street, close to all amenities including restaurants; museums; gift shops and more. cheticamp sits in the shadow of the cape breton highlands national park and offers something for everyone. enjoy outdoor adventures like whale watching; swimming ;\non the wall is a plaque with a picture of a smiling cartoon whale and a caption:' authorised whale dealer'. shitoshi ito, who has been selling whale meat for 32 years, buys it from the government in 15kg blocks, cuts them down and sells them to sushi restaurants and supermarkets. particularly popular are his packs of' whale bacon' - little strips of whale meat and fat. before the ban, there used to be a daily auction of whale meat - but now his is the only stall.' i used to deal in grey whale, minke, blue whale, fin whale. after the ban, i can only deal in minke,' he said.' minke don' t have as much oil and don' t taste as good.' in the fish supermarket down the road, two whole chilled cabinets are dedicated to whale. you can buy 245g vacuum - packed blocks of blubber for about £20, packs of dried whale meat, or packs of boiled whale fat looking like maggots .\ndue to its highly social nature, the short - finned pilot whale is particularly susceptible to stranding in large groups, although the reasons for this are not always clear (7) .\nthe government says that the pilot whale population in the eastern north atlantic is approximately 778, 000, of which around 100, 000 are around the faroes. the faroese catch around 800 whales a year on average, it says. the long - term annual average catch of pilot whales in the faroe islands represents less than 1 percent of the total eastern north atlantic whale population, according to the spokesman for the faroe islands government. “it has long since been internationally recognised that pilot whale catches in the faroe islands are fully sustainable, ” he said .\nfrom the latest research results, the authors consider that the conclusion from a human health perspective must be to recommend that pilot whale is no longer used for human consumption (16) .\nthe imr was similar for the long - finned pilot whale (0. 015) and short - finned pilot whale (0. 017) and may reflect the level of intrinsic mortality, while the mrdt may reflect variation between the two species in susceptibility to age - dependent sources of extrinsic mortality such as disease, starvation or predation. however the cause of the observed differences in mortality rate acceleration between the two pilot whale species is unknown. both the studied populations are subject to exploitation by drive fisheries, and the level of exploitation by the faroese long - finned pilot whale fishery is historically higher than that by the japanese short - finned pilot whale fishery (bloch et al. 1993). however, drive fisheries result in the removal of entire family groups (amos et al. 1993) and remove all age classes equally; therefore the level of exploitation should not change the age distribution or the age - dependent selection gradient .\ndespite their name, pilot whales are in fact one of the largest members of the dolphin family .\npilot whales grow to about 7. 5m (25ft) and are common around new zealand’s waters .\nall those involved in the epic rescue of the stranded pilot whales can feel proud of what was together achieved by project jonah, whale rescue and hundreds of other volunteers working with doc staff .\nclick... here... to see a realtime sonogram of pilot whale call vocalizations recorded on 31. 08. 1996 (. mov file with 3. 1 mb) .\nclick... here... to see a realtime sonogram of pilot whale call vocalizations recorded on 23. 06. 2001 (. mov file with 4. 5 mb) .\nthe pilot whale catch in the faroe islands is a community - based activity, as it has always been, and the meat and blubber is divided fairly according to local and traditional customs .\nmortality rate acceleration and post - reproductive lifespan in matrilineal whale species. - pubmed - ncbi\nwhale meat is never sold... it is divided out amongst people in the community\nthe size and shape of a killer whale’s white areas and gray saddle vary among ecotypes .\ndoc staff are ready to respond should there be any further whale strandings in the area .\ndeb and simon ward invented a whale lifting machine, which volunteers trialled over the weekend .\nin the remote faroe islands, whale has traditionally comprised a large part of the diet .\ndoc operations manager andy thompson said the whale was an older female in very poor health .\nmemorandum of understanding concerning the conservation of the manatee and small cetaceans of western africa and macaronesia, convention on migratory species page on the long - finned pilot whale. unep / convention on migratory species\nkasuya t, matsui s. age determination and growth of the short - finned pilot whale off the pacific coast of japan. sci rep whales res inst tokyo. 1984; 35: 57–91 .\nclick... here... to see boat - based whale watching excursions with short - finned pilot whales from a helicopter perspective (. mov file with 11. 7 mb) .\nthe pilot whale population in the eastern north atlantic is approximately 778, 000, of which 100, 000 are around the faroe islands. the faroese catch around 800 whales a year on average .\nthe results of the above mentioned studies together with studies on the adult populations have revealed an even gloomier picture of the adverse health effects that are caused by contaminants in pilot whale meat and blubber .\nq: what are pilot whales? pilot whales are marine mammals that reach lengths up to 20 feet. they live in deep waters including the gulf of mexico and swim in large groups (called pods) of 10 – 100' s of individuals. pilot whales are protected under the marine mammal protection act .\na santa monica, calif. , sushi restaurant has been charged with serving endangered whale meat to its customers. two activists initiated the investigation by ordering kujira, japanese for whale meat, then stuffing some into their napkins for transport to an oregon laboratory. (the restaurant obligingly listed the order as\nwhale\non their receipt .) what does whale taste like ?\nthe japanese tend to savor the meat from the pilot whale so it often fall victim of their whaling efforts. since pilot whales travel in large groups the easily fall victim to whaling. there are complex set ups that move an entire group of them towards the beach so that they can be killed .\nthe gulf in the big bend region is extremely shallow. pilot whales travel in pods in water at least 30 feet deep, which would be 20 to 30 miles offshore. walsh said another pilot whale was found in nearshore waters near sarasota last week, raising concern that something may be affecting them .\namos b, schlötterer c, tautz d. social structure of pilot whales revealed by analytical dna profiling .\npilot whales are not listed as endangered, but little is known about their population in new zealand waters .\npeople turned out in their hundreds to help save the pilot whales after pods were stranded at farewell spit .\nbubbles was the oldest pilot whale in a zoological park, and performed at the aquarium' s san diego location for almost three decades, seaworld said. she was estimated to be in her 50s .\nthey had no doubts. with 800, 000 pilot whales in the north atlantic and with rarely more than 2, 000 a year taken in the faroes, the whale population was not under threat .\nthe short - finned pilot whale is in danger as a result of bycatch with gillnets, trawls and longlines, collisions with boats of any type, massive strandings and loud sounds that disturb their environment .\nnemiroff, l. (2009). structural variation and communicative functions of long - finned pilot whale (globicephala melas) pulsed calls and complex whistles. m. sc. thesis. dalhousie university .\nbloch d, lockyer c, zachariassen m. age and growth parameters of the long - finned pilot whale off the faroe islands. rep int whaling comm. 1993; special issue 14: 163–207 .\ntemperate and tropical oceans worldwide. there is little overlap with the long - finned pilot whale except in temperate waters of north and south atlantic as well as pacific waters off of peru and south africa .\nwith an average of around 1, 000 animals killed each year in the faroe islands, the practice is internationally considered sustainable. this represents less than 1% of the total estimated pilot whale stock .\nin 2012, pál weihe and høgni debes joensen of the faroese department of occupational medicine and public health formally recommended that from a human health perspective, pilot whale should no longer used for human consumption .\nthe growing scientific documentation has, during recent years, given rise to the anticipation that the time was approaching when it would be appropriate to recommend against any human consumption of pilot whale meat and blubber .\nin a statement posted online, the marine park said :\nseaworld san diego is saddened to announce the passing of one of the world' s most beloved animals, bubbles the pilot whale .\nwe drove on down to the shore where the sea was already bright pink with whale blood .\nactivists recently urged the european union to take action against denmark over the faroe islands’ whale hunt .\nthere is nowhere you won’t find the pilot whale. in fact, they are believed to be the most distributed whale in the world. they enjoy both the tropic and the temperate waters. generally you will find those with the shorter fins in the warmer waters. the two types of physical characteristic pilot whales tend to stay separate from each other. sometimes they do cross paths though during the migration process .\nthe main threat to the short - finned pilot whale is bycatch, or incidental take in fisheries, with the whales often becoming caught in fishing equipment such as gillnets, longlines and trawls (9) .\ndistinctive characteristics. it is very similar to the long - finned pilot whale and is often confused. the difference between them lies in the length of the pectoral flippers, which in this case are smaller .\njankowski, m. (2005). long - finned pilot whale movement and social structure: residency, population mixing and identification of social units. m. sc. thesis, biology, dalhousie university .\nwhale rescuers in new zealand have linked arms in neck - deep water to try and prevent about 200 pilot whales from stranding themselves again in a remote bay, where 300 of the animals died this week .\nbubbles, a short - finned pilot whale who lived at seaworld san diego, has passed away, the company announced on friday. she was the sixth animal to die at the marine parks since july .\nsp .). short - finned pilot whales show the tooth reduction typical of other squid - eating cetaceans .\nthe pilot whales are separated from the orcas at shamu stadium but can see them, jeansonne - becka said .\nto identify individual orcas. the whale' s dorsal fin varies in shape and size, often with distinctive nicks and scars. the saddle patch also differs from whale to whale in shape, size, color, and scarring. in the case of the southern resident orcas, individual identification allows cwr staff to maintain a precise census of the population; accounting for every whale on an annual basis .\nthe recent discovery of high levels of mercury, insecticides and other toxins in pilot whales means that whale meat consumption may have to be reduced. pregnant mothers on the islands have been counselled not to eat it .\nwhile humans keep destroying nature, species like the long - finned pilot whale fear for their survival on earth. since the nineteenth century, this and other cetaceans were hunted in the waters of newfoundland, greenland, denmark, iceland, norway, scotland and other countries for their meat, fat, and oil. over time, overfishing led to the gradual disappearance of the long - finned pilot whale in the north atlantic .\nheimlich - boran, j. r. 1993 social organization of the short - finned pilot whale, globicephala macrorhynchus, with special reference to the social ecology of delphinids. phd thesis, cambridge university, cambridge .\nbased on the demonstrated effects of mercury exposure and on a general assessment of polychlorinated biphenyls (pcbs), the following diet recommendations were issued in 1998 (4): “high pcb contents in blubber leads us to recommend that adults at the maximum eat pilot whale blubber once to twice a month. however, the best way to protect foetuses against the potential harmful effects of pcbs, is if girls and women do not eat blubber until they have given birth to their children. the mercury content of pilot whale meat is high and is one of our main mercury sources. therefore we recommend that adults eat no more than one to two meals a month. women who plan to become pregnant within three months, pregnant women, and nursing women should abstain from eating pilot whale meat. pilot whale liver and kidneys should not be eaten at all” .\nwhile many of seaworld' s animals die young, bubbles, who was estimated to be in her early - to mid - 50s, was the oldest pilot whale in a zoological park, according to seaworld .\npygmy right whale (single species); only in southern hemisphere, least known of baleen whales .\nparasites–including roundworms, tapeworms and flukes–may affect a killer whale’s health (heyning and dahlheim, 1988) .\nnoaa killer whale (orcinus orca) fact sheet: urltoken erwhale. htm (accessed april 2015 )\nwhale drives are not an annual festival or ritual, as is often wrongly claimed. whale drives in the faroe islands take place to provide food, and can happen at any time of the year .\npilot whales are dark black in color most of the time. some of them are a dark gray. there are two species of the pilot whale, but it is often very hard to tell them apart. they generally both get lumped into this basic category. one has a short fin while the other features one that is long. these whales are very large, and only the killer whale is bigger than they are .\nthe latin name is orcinus orca. common names are orca or killer whale, while other names include blackfish, grampus, and killer. most english - speaking scientists use the name killer whale, although orca is increasingly used, in particular by the general public. the name killer whale originated from the spanish whaler’s term “whale killer, ” based on their observations of orcas hunting other types of whales. i\nbut today in a statement to the islanders, chief medical officers pál weihe and høgni debes joensen announced that pilot whale meat and blubber contains too much mercury, pcbs and ddt derivatives to be safe for human consumption .\na theory that parasites affecting the nervous systems of pilot whales may be responsible for mass strandings is not well supported .\n. pilot whales are often referred to as “blackfish” along with a number of other species belonging to the dolphin family .\npilot whales are social animals, forming large pods containing 40 to 100 individuals. the pods exhibit close matrilineal relationships .\n“it’s just awful, this one will certainly make a dent in the new zealand pilot whale population, ” says liz slooten, a professor at the university of otago in new zealand who studies marine mammal biology and conservation .\nin a photograph taken saturday, volunteers prop up a pilot whale at farewell spit in new zealand. overnight, more than 200 of the stranded whales returned to the sea. marty melville / afp / getty images hide caption\nclick... here... to see a pilot whale subgroup with a newborn (. mov file with 2. 6 mb). this newborn still has fetal folds and is closely related with its mother .\nwhale watching expeditions bring people close to wild whales and help people learn about them, but the steady growth of recreational whale watching has raised some concerns with killer whale researchers (hoyt, 2001). in british columbia and the state of washington, killer whales are the most popular cetacean of commercial whale watching companies (hoyt, 2001). higher concentrations and closer proximity of boats can force whales away from their traditional habitats and reduce a killer whale’s echolocation abilities when hunting for prey (national marine fisheries service, 2008) .\nwe tested 6 long - finned pilot whale groups (1 tagged whale per group) encountered inside the vestfjord basin, norway. three whales were tested with kw, 2 whales with both ctrl and kw, and one whale was tested only with ctrl because of premature tag detachment. each stimulus lasted 15 min and was played back twice. the average duration of the killer whale sounds within each 15 min kw stimulus was 11 min 2 sec ±35 sec (mean ± sd, n = 3). a recovery period of 10 min separated the different playback trials performed to a tested whale. at the start of playbacks, the sound source was positioned to the side of the tagged whale’s path, at a distance of 2400±943 m (mean ± sem) .\npilot whale is considered as “data deficient” species in the red list of threatened species. they seem to do extremely well in captivity which can be a huge benefit if some severe forms of conservation need to take place later on .\nphysical characteristics. it is a little difficult to distinguish this species from the short - finned pilot whale (globicephala macrorhynchus) except for the length of the pectoral flippers which are larger in globicephala melas than those of its relative .\ndoc staff are keeping a watch on the shore around the taupata point area of golden bay for any pilot whales stranding .\npeople from a faroe island community kill pilot whales driven into a bay during a drive hunt, or\ngrind .\nmild - mannered, diminutive and smiling, mrs ohnishi makes an unlikely global agent provocateur. but while whale campaigners are demanding that the ban on hunting remains in force, she is quietly promoting the exact opposite. she helped set up the whale cuisine preservation association with 30 other whale restaurants in japan, and each year they organise food festivals.' our aim is to pass on whale cuisine to future generations,' she said .\nage - dependent survivorship and fertility of (a) the long - finned pilot whale; the dotted line indicates the proportion of females surviving () and the solid line indicates the proportion of females that were pregnant (); (b) the short - finned pilot whale; the dotted line indicates the proportion of females surviving and the solid line indicates the proportion of females that were pregnant (); (c) killer whale; the dotted line indicates the proportion of females surviving and the solid line indicates the number of viable calves produced per female () .\npilot whales are prolific stranders, and this behaviour is not well understood. there are recordings of individual strandings all over new zealand, and there are a few mass stranding\nhotspots\nat golden bay, stewart island, and the chatham islands. the biggest recorded pilot whale stranding was an estimated 1, 000 whales at the chatham islands in 1918 .\nfaroe islanders have been hunting for pilot whales for centuries, giving them valuable food stocks for the winter. but to animal rights activists, the kill is cruel and unnecessary. the bbc' s nick haslam witnessed a whale hunt .\nthe body of the short - finned pilot whale is dark grey or black, with a light grey patch on the chin and underside, in the shape of an anchor (4) (5) (6). this patch is lighter in younger animals (5). the short - finned pilot whale also has a light grey to white chevron just behind its head and another white patch underneath and behind its dorsal fin (4) (6) .\nin addition, the short - finned pilot whale is listed on appendix ii of the convention on international trade in endangered species (cites), which means that any international trade in this species should be carefully controlled (3). further research is needed into the impacts of various threats on the short - finned pilot whale, and its taxonomy also needs to be investigated, as it is possible that it may comprise more than one distinct species (1) .\n], there is considerable evidence that corpora albicantia persist throughout life in at least some cetaceans, as a record of ovulation events. the most comprehensive evidence of persistence comes from the short - finned pilot whale. marsh and kasuya [\nthe faroese have hunted the long - finned pilot whales in a tradition known as the grindadrap for as long as anyone can remember. the earliest mention of grindardrap is in a faroese book of law from 1298. it’s a non - commercial whale hunt organized by the community, it starts in spring, usually in may and occurs occasionally over the summer months, when the pods of pilot whale pass the islands. the hunt provides a source of local traditional food .\nhere, the attraction of long - finned pilot whales towards local herring - feeding killer whale sounds source is consistent with visual observations reported from the norwegian sea and from the strait of gibraltar where long - finned pilot whales have been seen approaching and chasing respectively herring - and tuna - feeding killer whales [ 26 ], [ 32 ], [ 33 ]. killer whales have been observed fleeing away from pilot whales which represent a unique case of killer whales avoiding another cetacean species .\nmost short - finned pilot whales have between seven and nine short, tough teeth on each side of the jaw, at the front of the mouth (4). the male short - finned pilot whale is longer and heavier than the female (2) (6) (7), and also has a much larger dorsal fin (6) .\none of the most highly publicised incidents was the case of lisa costello, whose 1992 run - in with a wild pilot whale (technically a dolphin species) was captured on film and can easily be found online. in the video, you can see lisa swimming with a large wild pilot whale near kealakekua bay in hawai’i. she gently caresses the animal while it is resting at the surface. the next moment, the pilot whale clamps down on her leg and drags her under water. over the following minutes, the animal repeatedly grabs her and lets her go, at one point diving down 30 or 40ft with her grasped firmly in his jaws. lisa barely survived the encounter. whether this was serious aggression, mild annoyance, or just a form of play behaviour on the part of the pilot whale is up for debate. there are no other reports of pilot whales attacking swimmers in areas where in - water interaction is known to occur. in fact, when you set aside lone sociable dolphins, attacks such as these on human swimmers are extremely rare .\nthe dorsal fin of the short - finned pilot whale is sickle - shaped or curved, and is broad and thick. it measures around 30 centimetres in height and sits far forward on the body, usually lining up with the pectoral fins. the pectoral fins, or flippers, are also curved like a sickle and are narrow and tapering, measuring about one - fifth to one - sixth of the body length (2) (6) (7) (8). this measurement is used to distinguish the short - finned pilot whale from the long - finned pilot whale, globicephala melas (2), although the two species can still be difficult to tell apart at sea (6) .\ncontributing to a killer whale’s streamlined shape, which helps increase swimming efficiency (reynolds & rommel, 1999) .\ntarpy, cliff. 1979. killer whale attack! national geographic, april: pp. 542 - 545 .\nwhale stranding volunteers learning a waiata about tohora / whales after this morning' s successful refloat. @ projectjonah urltoken\nfile photo - a faroe islands whale hunt on july 2015. (photo: sea shepherd / mayk wendt )\nwhale hunting in the faroe islands has received a bad reputation. but here’s what social media is getting wrong .\nwhale hunting in the faroe islands has received a bad reputation. but here’s what social media is getting wrong :\nit always travels from one place to another, but there is no information about the migration patterns that follows. the short - finned pilot whale goes to other locations depending on the movements of its prey or the changes in water temperature .\nit is necessary to emphasize that humans have much responsibility for the deaths of these cetaceans. in japan, the large number of catches are because the short - finned pilot whale, like other cetaceans, is consumed in various asian dishes .\nbaraff, l. s. and asmutis - silvia, r. a. 1998. long - term association of an individual long - finned pilot whale and atlantic white - sided dolphins. marine mammal science, 14: 155 - 161\nan anti - hunting campaign called sea shepherd claims that up to 1, 000 pilot whales are killed every year in the summer months and although whale meat is eaten by the local people, some of the meat is left to rot .\nfemale short - finned pilot whales reach sexual maturity at about 8 years of age, while males reach maturity later, at about 13 years. a typical male short - finned pilot whale will live for approximately 45 years and a typical female for about 55 years (2), although the female will usually stop reproducing after about 40 years old (7) .\npilot whales live in stable family groups, and offspring of both sexes stay in their mother' s pod throughout their lives .\nhundreds of pilot whales stranded on farewell spit on the south island of new zealand today (feb. 10, 2017) .\nthe situation has changed rapidly since the mass stranding yesterday of more than 400 pilot whales and the loss of many of them .\nseaworld orlando ’s four pilot whales have a new home in shamu stadium, where guests should soon be able to see them .\none of them being that the pilot whale is an endangered species, the hunt is illegal and the animal is gauchely hacked to death. the hunt is legal and the pilot whale is not an endangered species. looking at the imagery of the killings it really looks like a bloodbath. when the pods of pilot whale pass by the faroe islands they are herded toward a certified shore by boats. they are then gatherd in shallow waters and killed with a spinal lance, which should sever the spinal cord of the animal and cut off blood supply to the brain, so the animal looses consciousness and dies within seconds, if its done right – the hunters need a special license to be a part of the hunt." ]
{ "text": [ "pilot whales are cetaceans belonging to the genus globicephala .", "the two extant species are the long-finned pilot whale ( g. melas ) and the short-finned pilot whale ( g. macrorhynchus ) .", "the two are not readily distinguishable at sea , and analysis of the skulls is the best way to distinguish between the species .", "between the two species , they range nearly worldwide , with long-finned pilot whales living in colder waters and short-finned pilot whales living in tropical and subtropical waters .", "pilot whales are among the largest of the oceanic dolphins , exceeded in size only by the killer whale .", "they and other large members of the dolphin family are also known as blackfish .", "pilot whales eat squid primarily , and also fish .", "they are highly social , and studies suggest that both males and females remain in their mother 's pod , an unusual trait among mammals , also found in certain killer whale communities .", "short-finned pilot whales are one of the few mammal species in which females go through menopause , and post-reproductive females may contribute to the survival of younger members of their pods .", "pilot whales are notorious for stranding themselves on beaches , and are among the most common cetacean stranders .", "several theories have been proposed to account for this behavior .", "the conservation status of neither species has been determined , but they are subject to both direct and indirect bycatch in fisheries .", "whalers in a few countries continue to hunt pilot whales . " ], "topic": [ 26, 19, 10, 13, 19, 26, 19, 19, 19, 19, 19, 17, 19 ] }
"pilot whales are cetaceans belonging to the genus globicephala. the two extant species are the long-finned pilot whale (g. melas) and the short-finned pilot whale (g. macrorhynchus). the two are not readily distinguishable at sea, and analysis of the skulls is the best way to distinguish between the species. between the two species, they range nearly worldwide, with long-finned pilot whales living in colder waters and short-finned pilot whales living in tropical and subtropical waters. pilot whales are among the largest of the oceanic dolphins, exceeded in size only by the killer whale. they and other large members of the dolphin family are also known as blackfish. pilot whales eat squid primarily, and also fish. they are highly social, and studies suggest that both males and females remain in their mother's pod, an unusual trait among mammals, also found in certain killer whale communities. short-finned pilot whales are one of the few mammal species in which females go through menopause, and post-reproductive females may contribute to the survival of younger members of their pods. pilot whales are notorious for stranding themselves on beaches, and are among the most common cetacean stranders. several theories have been proposed to account for this behavior. the conservation status of neither species has been determined, but they are subject to both direct and indirect bycatch in fisheries. whalers in a few countries continue to hunt pilot whales."
[ "pilot whales are cetaceans belonging to the genus globicephala. the two extant species are the long-finned pilot whale (g. melas) and the short-finned pilot whale (g. macrorhynchus). the two are not readily distinguishable at sea, and analysis of the skulls is the best way to distinguish between the species. between the two species, they range nearly worldwide, with long-finned pilot whales living in colder waters and short-finned pilot whales living in tropical and subtropical waters. pilot whales are among the largest of the oceanic dolphins, exceeded in size only by the killer whale. they and other large members of the dolphin family are also known as blackfish. pilot whales eat squid primarily, and also fish. they are highly social, and studies suggest that both males and females remain in their mother's pod, an unusual trait among mammals, also found in certain killer whale communities. short-finned pilot whales are one of the few mammal species in which females go through menopause, and post-reproductive females may contribute to the survival of younger members of their pods. pilot whales are notorious for stranding themselves on beaches, and are among the most common cetacean stranders. several theories have been proposed to account for this behavior. the conservation status of neither species has been determined, but they are subject to both direct and indirect bycatch in fisheries. whalers in a few countries continue to hunt pilot whales." ]
"animal-train-28"
"animal-train-28"
"2679"
"ancylostoma duodenale"
[ "[ iron - deficiency anemia related to ancylostoma duodenale infection among ethiopian immigrants to israel ] .\npolymerase chain reaction - based differential diagnosis of ancylostoma duodenale and necator americanus infections in humans in northern ghana .\nancylostoma duodenale infection: a study of serum immunoglobulin g4 response to the excretory secretory antigen of adult worm .\n[ iron - deficiency anemia related to ancylostoma duodenale infection among ethiopian immigrants to israel ]. - pubmed - ncbi\nadult ancylostoma duodenale worm. anterior end with mouth parts visible. image courtesy of patrick w hickey, md .\nepidemiological evidence for a differential effect of hookworm species, ancylostoma duodenale or necator americanus, on iron status of children .\nparasitic hookworms cause these infections. the two major types of hookworms that cause infection are necator americanus and ancylostoma duodenale .\npolymerase chain reaction - based differential diagnosis of ancylostoma duodenale and necator americanus infections in humans in northern ghana. - pubmed - ncbi\nancylostoma duodenale infection: a study of serum immunoglobulin g4 response to the excretory secretory antigen of adult worm. - pubmed - ncbi\nepidemiological evidence for a differential effect of hookworm species, ancylostoma duodenale or necator americanus, on iron status of children. - pubmed - ncbi\nconsidering taking medication to treat hookworm infection caused by ancylostoma duodenale? below is a list of common medications used to treat or reduce the symptoms of hookworm infection caused by ancylostoma duodenale. follow the links to read common uses, side effects, dosage details and read user reviews for the drugs listed below .\nnote: description of ancylostoma caninum (dog hookworm) can be found here .\nthe hookworms, ancylostoma duodenale and necator americanus, cause significant gastrointestinal blood loss. in clinical studies, greater blood losses have been reported with a. duodenale. however, there has been no evidence that endemic a. duodenale infection has greater impact than n. americanus infection on the iron status of populations .\n. teeth of ancylostoma on the left and cutting plates of necator on the right .\nhuman hookworm disease is a common helminth infection that is predominantly caused by the nematode parasites necator americanus and ancylostoma duodenale; organisms that play a lesser role include ancylostoma ceylonicum, ancylostoma braziliense, and ancylostoma caninum. hookworm infection is acquired through skin exposure to larvae in soil contaminated by human feces (see the image below). soil becomes infectious about 9 days after contamination and remains so for weeks, depending on conditions .\nto cite this page: fetouh, n. 2003 .\nancylostoma duodenale\n( on - line), animal diversity web. accessed july 10, 2018 at urltoken\namong the ethiopian immigrant population, ancylostoma duodenale infection is a common cause of iron deficiency anemia. in young patients it should be ruled out before invasive and expensive investigations are performed .\nhookworm eggs examined on wet mount. eggs of ancylostoma duodenale and necator americanus cannot be distinguished morphologically. image courtesy of division of parasitic diseases, centers for disease control and prevention (cdc) .\nhookworm infection in humans is usually caused by one of two species of nematodes (roundworms) - necator americanus or ancylostoma duodenale. n. americanus is most common human - specific hookworm worldwide, distribution of a. duodenale is geographically more restricted. both n. americanus and a. duodenale are found in africa, asia and the americas. necator americanus predominates in the americas and australia, while only a. duodenale is found in the middle east, north africa and southern europe .\n42. 8% infection rate of predominantly n. americanus although with some a. duodenale infection\nsymptoms can take weeks or months to develop depending on the severity of infection, and the amount of iron in an infected person’s diet. ancylostoma duodenale can stay dormant in the body for eight months .\nhookworm is an intestinal parasite of humans. the larvae and adult worms live in the small intestine can cause intestinal disease. the two main species of hookworm infecting humans are ancylostoma duodenale and necator americanus .\namong the diseases imported by the ethiopian immigrants to israel are many parasite infections. hookworm infections, caused by the nematodes necator americanus and ancylostoma duodenale, involve the gastrointestinal tract, causing iron - deficiency anemia .\nthe hookworms, ancylostomo duodenale and necator americanus, cause significant gastrointestinal blood loss. in clinical studies, greater blood losses have been reported with a. duodenale. however, there has been no evidence that endemic a. duodenale infection has greater impact than n. americanus infection on the iron status of populations .\na duodenale is more geographically restricted than n americanus and is one of several anthropophilic members of the genus ancylostoma. it primarily infects humans and is responsible for classic hookworm disease. a duodenale resembles n americanus in appearance but is somewhat larger, with adult males measuring 8 - 11 mm and adult females measuring 10 - 13 mm .\nhumans can also become infected with the dog hookworm, ancylostoma caninum. however, this species is infertile in humans .\nthe mcdonnell genome institute and collaborators are sequencing the human hookworm, ancylostoma duodenale. hookworm diseases are extremely common in the tropics and sub - tropics, with a disease burden comparable to measles and exceeding that of diabetes and lung cancer .\ntaxonomic classification: all hookworms infecting humans are class nematoda, order strongylidea, family ancylostomatidae, and genera ancylostoma and necator .\nhsu y, lin j. intestinal infection with ancylostoma ceylanicum. new england journal of medicine 2012; 366: e20 .\nhookworm is a common, chronic, parasitic infection that is caused by the worms necator americanus and ancylostoma duodenale in human being. human beings are the main vectors of n. americanus and a. duodenale, and it is estimated that around 20% of the world population carries this parasite and suffer a huge volume of daily blood loss (approximately seven million liters) .\nanterior: note the ventral teeth in the buccal capsule of a. duodenale. n. americanus has ventral cutting plates .\nthe geographic distributions of the hookworm species that are intestinal parasites in human, ancylostoma duodenale and necator americanus, are worldwide in areas with warm, moist climates and are widely overlapping. necator americanus was widespread in the southeastern united states until the early 20th century .\nmonti jr, chilton nb, qian bz, gasser rb. specific amplification of necator americanus or ancylostoma duodenale dna by pcr using markers in its - 1 rdna, and its implications. molecular and cellular probes 1998; 12 (2): 71 - 78 .\nthe species give similar clinical manifestations of the infection, although a. duodenale can lead to a greater blood loss and anemia .\nneither necator nor ancylostoma multiplies within the host. if the host is not reexposed, the infection disappears after the worm dies. the natural life span for an adult a duodenale is about 1 year, and that for an adult n americanus is 3 - 5 years .\nsixty patients (64 %) had evidence of a. duodenale infection. the mean hemoglobin level was 11. 92. 3 g / dl in the ancylostoma group and 13. 81. 6 g / dl in the control group (p = 0. 0001). analyzing the data according to the patient' s sex revealed significant differences in the hemoglobin levels between the ancylostoma group and the control group. patients infected with a. duodenale had significantly lower mean corpuscular volume (mcv) and serum iron, and were likely to have eosinophilia and hypoalbuminemia .\nsignificant microscopic features: species of adult hookworms can be identified by the appearance of their mouths. structures are bilaterally symmetrical (mirror image on each side). ancylostoma duodenale has 2 prominent pointed ventral teeth and rarely a very tiny third tooth (fig. 2) ancylostoma ceylanicum has a cutting plate with a sharp dorsal end that looks like a tooth and a less distinct sharp ventral end (fig. 3). ancylostoma caninum has three prominent pointed ventral teeth (fig. 4) necator americanus is completely different and has a rounded ventral cutting plate (fig. 5) .\nhookworm is a soil - transmitted helminth (sth) and is one of the most common roundworm of humans. infection is caused by the nematode parasites necator americanus and ancylostoma duodenale. hookworm infections often occur in areas where human feces are used as fertilizer or where defecation onto soil happens .\nwalterspiel, j. n. , schad, g. a. , & buchanan, g. r. (1984). direct transfer of adult hookworms (ancylostoma duodenale) from dog to child for therapeutic purposes. journal of parasitology, 70 (2), 217 - 219 .\ninfection with n. americanus can occur only through skin penetration by l3 larvae. a. duodenale can infect humans upon swallowing of the larvae .\nsome a. duodenale larvae, following penetration of the host skin, can become dormant (in the intestine or muscle). in addition, infection by a. duodenale may probably also occur by the oral and transmammary route. n. americanus, however, requires a transpulmonary migration phase .\nfig. 2: apical view of the mouth of a. duodenale showing the 2 prominent pointed ventral teeth on each side. image from urltoken .\nalbonico m, stoltzfus rj, savioli l, tielsch jm, chwaya hm, ercole e, et al. epidemiological evidence for a differential effect of hookworm species, ancylostoma duodenale or necator americanus, on iron status of children. int j epidemiol. 1998 jun. 27 (3): 530 - 7. [ medline ] .\nverweij jj, brienen ea, ziem j, yelifari l, polderman am, van lieshout l. simultaneous detection and quantification of ancylostoma duodenale, necator americanus, and oesophagostomum bifurcum in fecal samples using multiplex real - time pcr. am j trop med hyg. 2007 oct. 77 (4): 685 - 90. [ medline ] .\non microscopy, n americanus can be differentiated from a duodenale on the basis of the cutting plates that it possesses in place of teeth (see the images below). [ 15 ]\n: humans are the only known reservoir of a. duodenale and n. americanus. the majority of infected individuals are asymptomatic due to low worm burden; however, eggs can be passed in feces\nfrom the above it can be seen that n. americanus is primarily a parasite of the tropical regions of the world, whereas a. duodenale is usually the lone species in temperate climates and has a spotty distribution in the tropics. the variations in distribution of these parasites are in large part due to the way the tropics were colonized by different groups of people who brought their parasites with them, as well as the fact that necator tolerates higher temperatures better than ancylostoma. it should be noted also that ancylostoma is a natural parasite of carnivores, whereas necator parasitizes herbivores. man has become the unwitting host of both species through his association with both types of animals .\nhookworm is an endemic in many tropical and subtropical areas, especially in areas where human feces are not disposed off in a sanitary manner. ancylostomiasis is the most prevalent hookworm infection and is second only to ascariasis in infections by parasitic worms. necator americanus is most common in the americas, central and south africa, south asia, indonesia, australia and pacific islands. ancylostoma duodenale is the dominant species in the mediterranean region and north asia .\na. duodenale is a human parasite that lives in the intestine. it is difficult to study in a laboratory setting and is particularly harmful to children, causing chronic anemia, stunting growth and imparing intellectual development .\nhuman infection with a duodenale or n americanus is estimated to affect approximately 439 million people worldwide. [ 17 ] these parasites drain the equivalent of all the blood from approximately 1. 5 million people every day .\nin the 492 children with hookworm positive faecal cultures, haemoglobin and ferritin concentrations decreased with increasing proportions of a. duodenale. among children with only n. americanus larvae, the prevalence of anaemia was 60. 5% and the prevalence of ferritin < 12. μ / l was 33. 1% , while in children with ≥50% a. duodenale larvae, the respective prevalences were 80. 6% and 58. 9% . when children were grouped by the prevalence of a. duodenale at the school level, children from high prevalence (≥20 %) schools had signficantly worse iron deficiency and anaemia than children from low prevalence schools .\nhaas, w. , haberl, b. , syafruddin, idris, i. , kallert, d. , kersten, s. , stiegeler, p. , & syafruddin. (2005). behavioural strategies used by the hookworms necator americanus and ancylostoma duodenale to find, recognize and invade the human host. parasitology research, 95 (1), 30 - 39. doi: 10. 1007 / s00436 - 004 - 1257 - 7\nschad, g. a. , murrell, k. d. , fayer, r. , el naggar, h. m. s. , page, m. r. , parrish, p. k. , & stewart, t. b. (1984). paratenesis in ancylostoma duodenale suggests possible meat - borne human infection. transactions of the royal society of tropical medicine and hygiene, 78 (2), 203 - 204 .\nin the 492 children with hookworm positive faecal cultures, haemoglobin and ferritin concentrations decreased with increasing proportions of a. duodenale. among children with only n. americanus larvae, the prevalence of anaemia was 60. 5% and the prevalence of ferritin < 12 microg / l was 33. 1% , while in children with > or = 50% a. duodenale larvae, the respective prevalences were 80. 6% and 58. 9% . when children were grouped by the prevalence of a. duodenale at the school level, children from high prevalence (> or = 20 %) schools had significantly worse iron deficiency and anaemia than children from low prevalence schools .\nsoil - transmitted helminths (sth) refer to intestinal worms that are transmitted to humans through contaminated soil. the three main species that infect humans are ascaris lumbricoides (roundworm), trichuris trichiura (whipworm), and necator americanus and ancylostoma duodenale (two species of hookworm). soil - transmitted helminths live in the intestines, where they produce thousands of eggs a day that are then passed in the feces of infected persons, contaminating the soil in areas where sanitation is poor .\nboth necator and ancylostoma species have worldwide distribution. a duodenale predominates in the mediterranean region, in northern regions of india and china, and in north africa. a ceylonicum is found in focally endemic areas in southern asia. n americanus predominates in southern china, southeast asia, the americas, most of africa, and parts of australia. this differential distribution is not absolute, and mixed infections may occur in individual patients. coinfection with ascaris or trichuris is common in many parts of the world .\nalthough n americanus infects only percutaneously, a duodenale can also infect by means of ingestion; however, in su ancylostoma may also lie dormant in tissues and later be transmitted through breast milk. this ability to enter dormancy in the human host may be an adaptive response evolved to increase the chances of propagation. if all larvae were to mature promptly during dry seasons of the year, females would release eggs onto inhospitable soil. eggs produced and released during the wet season have a much greater chance of encountering optimal soil conditions for further development .\nin addition, because a duodenale consumes more blood per worm than n americanus does, the severity of anemia may differ as a factor of the hookworm species that is causing the infection. severe anemia affects intellectual and physical development in children and cardiovascular performance in adults .\nhookworm eggs are passed in the feces of an infected person. if an infected person defecates outside (near bushes, in a garden, or field) or if the feces from an infected person are used as fertilizer, eggs are deposited on soil. they can then mature and hatch, releasing larvae (immature worms). the larvae mature into a form that can penetrate the skin of humans. hookworm infection is transmitted primarily by walking barefoot on contaminated soil. one kind of hookworm (ancylostoma duodenale) can also be transmitted through the ingestion of larvae .\nfig. 5: apical view of the mouth of n. americanus showing the rounded ventral cutting plate. image from urltoken. (the parasite named\na. duodenale\nat this site has 3 prominent pointed ventral teeth and is more likely to be a. caninum) .\nafter 2 moltings the parasites mature into adults and mate; intestinal blood loss begins just before egg production and continues for the life of the worm (up to 5 years); to ensure blood flow, adults release anticlotting agents (the agents were isolated and applied in therapeutics to block blood coagulation in several diseases); adult females: 10 to 13 mm (a. duodenale), 9 to 11 mm (n. americanus); adult males: 8 to 11 mm (a. duodenale), 7 to 9 mm (n. americanus )\na. duodenale and n. americanus infective larvae (il3) have different morphologies and these species can be identified from the il3 obtained after 7 days from a faecal culture (fig. 7). there appears to be no description of the morphology of the il3 of a. ceylanicum .\nduring this part of the migration, the larvae undergo 2 further molts, developing a buccal capsule and attaining their adult form. the buccal capsule of an adult a duodenale has teeth to facilitate attachment to mucosa, whereas an adult n americanus has cutting plates instead. a muscular esophagus creates suction in the buccal capsule .\nanybody can get hookworm. however, agricultural workers in endemic areas have a higher risk of being infected. the illness can be more serious in babies, children, pregnant women and people with poor diets. people can become infected with hookworm by walking bare foot on soil that contains infective larvae. other infection routes include drinking water or eating food contaminated with larvae. cases of mother to baby transfer of the hookworm ancylostoma duodenale have also been reported. hookworm larvae are capable of penetrating the skin in a few seconds. hence even sunbathing in the beaches or bathing / swimming / wading in pools, reservoirs or contaminated waters in the epidemic areas can quickly contract the larvae .\nin endemic areas, the highest prevalences are reported among school - aged children and adolescents, possibly because of age - related changes in exposure and the acquisition of immunity. [ 20 ] once infected, children are more vulnerable to developing morbidity because dietary intake often fails to compensate for intestinal losses of iron and protein, especially in developing countries. a fulminant form of acute gi hemorrhage associated with acute ancylostoma infection has been described in newborns .\nthe l3 larvae are 500 - 700 µm long (barely visible to the naked eye) and are capable of rapid penetration into normal skin, most commonly on the hands or feet. transmission occurs after 5 or more minutes of skin contact with soil that contains viable larvae. the skin penetration may cause a local pruritic dermatitis, also known as ground itch. ground itch at the site of penetration is more common with ancylostoma than with necator .\nhookworms ingest and digested some of the blood from the injured mucosa by means of a multienzyme cascade of metallohemoglobinases. each necator worm ingests 0. 03 ml of blood daily, whereas each ancylostoma worm ingests 0. 15 - 0. 2 ml of blood daily. inhibited host coagulation due to a series of anticoagulants directed against factor xa and the factor viia–tissue factor (tf) complex, as well as against platelet aggregation, further exacerbates blood loss .\nthe timing of anemia onset depends on the patient’s preexisting iron stores. in a study involving 492 children, the prevalence of anemia and the prevalence of ferritin levels lower than 12 μg / l were 60. 5% and 33. 1% , respectively, in those with n americanus infection, compared with 80. 6% and 58. 9% , respectively, in those with a duodenale infection. [ 22 ]\neach day in the intestine, a mature female a duodenale worm produces about 10, 000 - 30, 000 eggs, and a mature female n americanus worm produces 5000 - 10, 000 eggs (see the image below). after deposition onto soil and under appropriate conditions, each egg develops into an infective larva. these larvae are developmentally arrested and nonfeeding. if they are unable to infect a new host, they die when their metabolic reserves are exhausted, usually in about 6 weeks .\nin the search for possible vaccine targets, investigators have focused on hookworm molecular inhibitors of coagulation factors xa and viia - tf and metalloproteases that degrade hemoglobin and intestinal mucosal cells. the sabin vaccine institute has developed a 2 antigen human hookworm vaccine comprising recombinant necator antigens na - gst - 1 and na - apr - 1, each of which is required for hookworm use of host blood. [ 11 ] another antigen, ancylostoma - secreted protein 2 (asp - 2), appears necessary for chemokine receptor binding and invasion and has shown some promise in animal vaccine trials. the 3 - dimensional structure of na - asp - 2 has recently been reported and identified as a conserved tandem histidine motif necessary for catalytic or proteolytic activity. [ 12 ] unfortunately, this vaccine produced urticarial reactions among previously infected recipients, and its development was halted. [ 13 ]\nafter the l3 larvae have successfully entered the host, the larvae then travel through the subcutaneous venules and lymphatic vessels of the human host. eventually, the l3 larvae enter the lungs through the pulmonary capillaries and break out into the alveoli. they will then travel up the trachea to be coughed and swallowed by the host. after being swallowed, the l3 larvae are then found in the small intestine where they molt into the l4, or adult worm stage. the entire process from skin penetration to adult development takes about 5 - 9 weeks. the female adult worms will release eggs (n. americanus about 9, 000 - 10, 000 eggs / day and a. duodenale 25, 000 - 30, 000 eggs / day) which are passed in the feces of the human host. these eggs will hatch in the environment within several days and the cycle with start anew [ 15 ] .\naccording to the world health organization, approximately 1. 5 billion people worldwide are infected with soil - transmitted helminths .\nmorbidity resulting from sth infection is directly related to worm burden: light sth infection usually has no symptoms, while heavy infection contributes to anemia, malnutrition, growth stunting and low birth weight. moderate to heavy sth infection also leads to impairment of physical and mental growth, delayed educational advancement, and a negative impact on economic development .\ncurrently, the world health organization (who) estimates that 267. 5 million preschool - aged children and 568. 8 million school - aged children require treatment across 103 countries endemic to sth .\nthe greatest burden of disease for sth occurs among the populations in areas that lack access to clean water and sanitation .\nmoderate to high intensity infections can cause a range of symptoms including diarrhea, abdominal pain, general malaise and weakness, which can then lead to impaired cognitive and physical development .\nthe highest rates of infection occur among pre - school aged children, school - aged children, women of childbearing age, and adults in high - risk occupations such as tea - pickers or miners .\nthe impact of sth infection on women of childbearing age includes maternal anemia, low birth weight and high infant mortality .\ncontrol of soil - transmitted helminth infections can be achieved through regular mass drug administration (mda) with a single dose albendazole or mebendazole .\nthe who recommended strategy for sth control is to conduct regular periodic treatment of all at - risk populations in endemic areas, without previous individual diagnosis .\ncurrently, usaid provides technical and financial support to 19 sth endemic countries in their efforts to control sth infection. control efforts for sth within agency - supported countries have benefited from an integrated mda strategy, which treats multiple ntds simultaneously through the combined distribution of safe and effective donated drugs .\nthis strategy has resulted in significant gains of scaling up mda and reducing prevalence over the last decade of the agency program. looking to the future, the primary focus of agency support will be to continue to assist countries in maintaining these gains with sustainable sth programs .\nthe successes achieved to date in the control of sth could not have been achieved without dynamic public - private partnerships. the agency works closely with a broad range of public and private partners dedicated to the global control of sth. among these partners are the pharmaceutical companies johnson & johnson and glaxosmithkline, who provide mebendazole and albendazole through their global donation program to national ministries of health .\nguideline: preventive chemotherapy to control soil - transmitted helminth infections in at - risk population groups [ pdf, 1. 6mb ]\nhelminth control in school - aged children: a guide for managers (who) [ pdf, 2. 7mb ]\nconducting a school deworming day: a manual for teachers [ pdf, 1. 5mb ]\nhuman hookworms are found in tropical and subtropical regions between 30° north and south of the equator .\nis found in the mediterranean region, southeast asia, and scattered in the southern americas .\n( beigal, et al. , 2000; changhua, et al. , 1999; roberts and janovy jr. , 2000 )\n, where it may remain for intervals of time until it reaches the definitive host. in the paratenic host it may survive in the muscles where it is then transferred to humans via undercooked meat, including rabbit, lamb, beef, and pork. the eggs of\nare still within the muscle and are ingested with the meat, allowing for the adults to develop within the intestinal tract .\njuveniles of the species reside in the warmer regions of the world where the soil is preferably humus and loose with reasonable water drainage and good aeration. oxygen is necessary for the development of the eggs, whose metabolism is aerobic .\nhookworm eggs derive their nutrition from the host feces via absorption. therefore they must live in areas with soils of neutral phs and in shady areas, such as coffee, banana, and sugar plantations where the feces will remain intact long enough for them to develop into juveniles. they are extremely sensitive to sunlight, which can ultimately kill the juveniles. juveniles are also sensitive to high salt concentrations and acidic phs of soils .\nafter penetrating the skin, juveniles attach to blood vessels and begin to feed until reaching the adult stage. adult females remain attached and the males detach to find their mates. continual reinfection is promoted by repeated defecation by infected individuals in the same locals where they were originally infected. this may even lead to epidemics of\n( chilton and gasser, 1999; roberts and janovy jr. , 2000 )\nis an s - shaped worm because of its flexure at the frontal end. the worm is pinkish - white. adult male hookworms range in size from 8 - 11 mm long, whereas adult females range in size from 10 - 13 mm long. this species is dimorphic, with the males having bursa characteristics and needle - like spicules with small tips, which are distally fused. females have a vulva located approximately one - third of the body length from the posterior end. both male and female hookworms have two powerful ventral teeth in the adult forms of the parasite, one along each side of the buccal capsule; smaller pairs of teeth are located deeper in the capsule .\n, large paired sensilla on each side of the mouth, which allow them to locate their host. the larvae are rod - shaped and are about 0. 004 cm long .\n( ashton, et al. , 1999; carson - dewitt, 1999; d. w. , 1980; roberts and janovy jr. , 2000; williams, 1969 )\nthe hookworm life cycle is composed of seven steps, which are as follows. first, the\neggs are passed into the feces of the host. second, the embryo passes via and develops within the feces. the first stage rhabditiform juvenile then hatches once the egg is outside of the host. next, the filariform or infective juvenile develops after two molts. this stage is characterized by an arrest in development until a new host is reached. humans may be infected via the oral cavity by ingestion of undercooked meat. filiform juveniles infect by directly penetrating the skin of the host, usually a human. fifth, the juveniles then migrate through the circulatory system until they reach the lungs. sixth, once they have reached the lungs, the juveniles leave the circulatory system by finding their way into the alveoli and then migrating to the small intestine via the trachea. it takes about 5 - 6 weeks for the hookworm to reach the small intestine from the lungs. finally, the adult worms develop in the small intestine where they mate, and produce eggs that are sent off in the feces of the host to begin the process once more. adults form about 6 weeks after the initial infection .\na possible alternate root of infection may occur if juveniles are swallowed and develop normally without moving into the lungs. however, this is a very rare occurrence .\n( beigal, et al. , 2000; d. w. , 1980; roberts and janovy jr. , 2000 )\nboth males and females attach to the intestinal walls during their life span, but the male leaves at one point to search for a female to mate with. the average female life span is about one year, during which it may lay from 10, 000 - 30, 000 eggs a day during its adult life .\na female with his curved area over the female genital pore. the gubernaculum, made of cuticle tissue, guides spicules which extend through the cloaca and anus. males use spicules to hold the female during copulation .\n( barnes, 1987; beigal, et al. , 2000; d. w. , 1980; roberts and janovy jr. , 2000 )\nthe juvenile stages of the parasite move around in the outside environment prior to locating the host. the adult worms can move from one place to another along the intestine once inside of the host, thus increasing blood loss through the wounds that are left behind in the intestinal linings .\nthe larvae of the infective stage are usually stationary, until they sense vibrations in the soil as heat or carbon dioxide. they use environmental signals to flag their host and prepare for ingestion during their third larval stage. they do so by using neurons with dendritic processes that resemble cilia, which are mechanosensory, thermosensory and chemosensory. adult human hookworms move by flowing within the bloodstream from one local to another and then attach to the intestinal walls where they feed .\n( ashton, et al. , 1999; roberts and janovy jr. , 2000; williams, 1969 )\nthe larvae of the infective stage are usually stationary, until they sense vibrations in the soil as heat or carbon dioxide. they use environmental signals to flag their host and prepare for ingestion during their third larval stage. they do so by using neurons with dendritic processes that resemble cilia, which are mechanosensory, thermosensory and chemosensory .\nthe definitive host is where the parasite reaches sexual maturity. humans are the definitive hosts of\n. recent research shows that other definitive hosts may exist because of the ability to cross - infect different hosts. for example ,\nhookworm eggs gain nutrition via the host feces. after penetrating the skin, juveniles attach to blood vessels and begin to feed .\nthe larval stage is free - living where there is independent existence in the soil. they then penetrate the host' s skin by the secretion of digestive enzymes that dissolve the skin .\nyoung and adult worms feed on blood from the walls of the host' s intestine by attaching to the intestinal lining via their sharp buccal cavity teeth, which they also use to break open small blood vessels so that they can suck the blood from them .\npossess anticoagulant substances that are secreted to prevent blood clotting to the blood flowing from the wound .\n( brinksworth, et al. , 2000; chilton and gasser, 1999; d. w. , 1980; roberts and janovy jr. , 2000 )\nthese parasites are probably not preyed on directly, but are ingested from host to host. larval mortality is high as most of the parasites do not reach appropriate hosts .\n, where it may remain for intervals of time until it reaches the definitive host .\ninfected individuals are susceptible to malnutrition, protein and iron drain from the diet. other effects include stunted growth and below - average intelligence in developing children, lowered antibody response to infectious agents, and anemia due to heavy blood loss and iron - deficiency among other side - effects. in some cases, heavy infestations may lead to fatalities because of infection of other worms or malaria as well as excess blood loss and other types of complications. infants were recently recognized in the field of public health as being vulnerable. hookworm disease is more prevalent in females than males .\ntourists visiting areas where local sanitation is a problem should be careful of infestation, especially in regions with humid climates .\ntreatment is fairly simple with mebendazole, albendazole, and levamisole. the use of dietary supplementation is important to compensate for the loss in nutrients .\n( beigal, et al. , 2000; bennett and guyatt, 2000; changhua, et al. , 1999; roberts and janovy jr. , 2000; sen - hai, et al. , 1995 )\nnagla fetouh (author), university of michigan - ann arbor, teresa friedrich (editor), university of michigan - ann arbor .\nliving in sub - saharan africa (south of 30 degrees north) and madagascar .\nliving in the nearctic biogeographic province, the northern part of the new world. this includes greenland, the canadian arctic islands, and all of the north american as far south as the highlands of central mexico .\nliving in the southern part of the new world. in other words, central and south america .\nhaving body symmetry such that the animal can be divided in one plane into two mirror - image halves. animals with bilateral symmetry have dorsal and ventral sides, as well as anterior and posterior ends. synapomorphy of the bilateria .\nan animal which directly causes disease in humans. for example, diseases caused by infection of filarial nematodes (elephantiasis and river blindness) .\nforest biomes are dominated by trees, otherwise forest biomes can vary widely in amount of precipitation and seasonality .\nhaving a body temperature that fluctuates with that of the immediate environment; having no mechanism or a poorly developed mechanism for regulating internal body temperature .\n( as keyword in perception channel section) this animal has a special ability to detect heat from other organisms in its environment .\nfound in the oriental region of the world. in other words, india and southeast asia .\nreproduction in which eggs are released by the female; development of offspring occurs outside the mother' s body .\nrainforests, both temperate and tropical, are dominated by trees often forming a closed canopy with little light reaching the ground. epiphytes and climbing plants are also abundant. precipitation is typically not limiting, but may be somewhat seasonal .\nthe region of the earth that surrounds the equator, from 23. 5 degrees north to 23. 5 degrees south .\na terrestrial biome. savannas are grasslands with scattered individual trees that do not form a closed canopy. extensive savannas are found in parts of subtropical and tropical africa and south america, and in australia .\na grassland with scattered trees or scattered clumps of trees, a type of community intermediate between grassland and forest. see also tropical savanna and grassland biome .\na terrestrial biome found in temperate latitudes (> 23. 5° n or s latitude). vegetation is made up mostly of grasses, the height and species diversity of which depend largely on the amount of moisture available. fire and grazing are important in the long - term maintenance of grasslands .\nliving in cities and large towns, landscapes dominated by human structures and activity .\nashton, f. , g. schad, j. li. 1999. chemo - and thermosensory neurons: structure and function in animal parasitic nematodes .\nbeigal, y. , z. greenburg, i. ostfeld. 2000. letting the patient off the hook .\nbennett, a. , h. guyatt. 2000. reducing intestinal nematode infection: efficacy of albendazole and mebendazole (review) .\nbrinksworth, r. , s. harrop, p. prociv, p. brindley. 2000. host specificity in blood feeding parasties: a defining contribution by haemoglobin - degrading enzymes? .\nchanghua, l. , z. xiaorong, q. dongchuan, x. shuhua, p. hotez. 1999. epidemiology of human hookworm infections among adult villagers in hejiang and santai counties, sichuan province, china .\nchilton, n. , r. gasser. 1999. sequence differences in the internal transcribed spacers of dna among four species of hookworm .\nsen - hai, y. , j. ze - xiao, x. long - qi. 1995. infantile worm disease in china .\ndisclaimer: the animal diversity web is an educational resource written largely by and for college students. adw doesn' t cover all species in the world, nor does it include all the latest scientific information about organisms we describe. though we edit our accounts for accuracy, we cannot guarantee all information in those accounts. while adw staff and contributors provide references to books and websites that we believe are reputable, we cannot necessarily endorse the contents of references beyond our control .\nthis material is based upon work supported by the national science foundation grants drl 0089283, drl 0628151, due 0633095, drl 0918590, and due 1122742. additional support has come from the marisla foundation, um college of literature, science, and the arts, museum of zoology, and information and technology services .\nloukas et al. (2006) discussed the need for and prospects of developing a human hookworm vaccine. hotez et al. (2004) provide a broad review of issues related to human hookworm infection .\neol content is automatically assembled from many different content providers. as a result, from time to time you may find pages on eol that are confusing .\nto request an improvement, please leave a comment on the page. thank you !\ntogether, the hookworms infect an estimated 576 - 740 million individuals today of which 80 million are severely infected .\nthe morbidity associated with severe infection includes intestinal blood loss, anemia, and protein malnutrition .\nthe burden of infection is concentrated mostly among the world’s poorest who live on less than $ 2 a day .\na particularly vulnerable population is children in low and middle income countries as infection with hookworm can stunt growth and physical fitness and impair and intellectual and cognitive development .\nthe tragic irony of the situation is that there are readily available and cheap resources for treatment which often cost less than 2 cents per pill .\nthroughout this paper, we will explore the biological, epidemiological, and public health concepts associated with hookworm .\nfor example, it is imperative to understand the lifecycle of hookworm not just for the sake of knowing it but to understand critical points of intervention with treatment, vaccination, and public health campaigns .\ntogether, the sections all build towards the final goal of elimination of hookworm from many parts of the world .\nhookworm infection has numerous synonyms including acanthocheilonemiasis, ancylostomiasis, necatoriasis, and uncinariasis [ 1 ] .\ndocumentation of hookworm dates as early as the third - century b. c. when the authors of the hippocratic corpus referred to a disease characterized by intestinal distress, a yellow - green complexion, and a tendency to eat dirt .\nthe first definitive observations of hookworm, however, were not made until 1838 when angelo dubini discovered hookworm during an autopsy .\nreports of hookworm then began to increase throughout the world, first in egypt in 1846 and then in brazil in 1865 .\nby 1878, giovanni b. grassi and his colleagues had announced a method of diagnosis via microscopic examination of the feces for hookworm eggs .\nin 1880, edoardo perroncito first noted the correlation between hookworms and anemia among miners digging the st. gottard tunnel in the alps .\nsoon thereafter in 1881, the first antihelminthic drug, thymol, was developed and used as the drug of choice until the 1920’s .\nin 1898, arthur looss determined the life cycle of hookworm while charles w. stiles identified\nit was stiles who convinced the rockefeller foundation to initiate its $ 1 million campaign against hookworm in the united states using treatment, education, and latrine - building programs .\nalthough the campaign was unsuccessful in eliminating hookworm from the united states, the campaign has become a significant model in the history of hookworm elimination for its goal and size [ 2 ] .\nhookworm infection is generally considered to be asymptomatic, but as norman stoll described in 1962, hookworm is an extremely dangerous infection because its damage is “silent and insidious” [ 3 ] .\nthere are general symptoms that an individual may experience soon after infection. ground - itch, which is an allergic reaction at the site of parasitic penetration and entry, is common in patients infected with\nadditionally, cough and pneumonitis may result as the larvae begin to break into the alveoli and travel up the trachea. once the larvae reach the small intestine of the host and begin to mature, the infected individual may suffer from diarrhea and other gastrointestinal discomfort [ 5 ] .\nhowever, the “silent and insidious” symptoms referred to by stoll are really only related to chronic, heavy - intensity hookworm infections. major morbidity associated with hookworm is caused by intestinal blood loss, iron deficiency anemia, and protein malnutrition [ 6 ] .\nthey result mainly from adult hookworms in the small intestine ingesting blood, rupturing erythrocytes, and degrading hemoglobin in the host [ 7 ] .\nthis long - term blood loss can manifest itself physically through facial and peripheral edema; eosinophilia and pica caused by iron deficiency anemia are also experienced by some hookworm - infected patients [ 8 ] .\nrecently, more attention has been given to other important outcomes of hookworm infection that play a large role in public health .\nit is now widely accepted that children who suffer from chronic hookworm infection can suffer from growth retardation as well as intellectual and cognitive impairments [ 9 ] .\nadditionally, recent research has focused on the potential of adverse maternal - fetal outcomes when the mother is infected with hookworm during pregnancy .\nis transmitted orally, the early migrations of the larvae cause wakana disease which is characterized by nausea, vomiting, pharyngeal irritation, cough, dyspnea, and hoarseness [ 10 ] .\nprimarily infects dogs, but humans can be dead - end hosts that prevent the larvae from completing their life cycle [ 11 ] .\nthe incubation period can vary between a few weeks to many months and is largely dependent on the number of hookworm parasites with which an individual is infected [ 12 ] .\nworms are grayish white or pinkish with the head slightly bent in relation to the rest of the body .\nthis bend forms a definitive hook shape at the anterior end for which hookworms are named .\nthey possess well developed mouths with two pairs of teeth (figure 1) .\nwhile males measure approximately one centimeter by 0. 5 millimeter, the females are often longer and stouter .\nadditionally, males can be distinguished from females based on the presence of a prominent posterior copulatory bursa [ 13 ] .\nwith males usually 5 to 9 mm long and females about 1 cm long .\npossesses a pair of cutting plates in the buccal capsule (figure 1) .\njohn, david t. and william a. petri, jr. markell and voge’s medical parasitology: ninth edition. st. louis: saunders elsevier, 2006 .\nhotez, peter j. , simon brooker, jeffrey m. bethony, et al. “current concepts: hookworm infection. ” the newengland journal of medicine 351 (2004): 799 - 807 .\nhotez p, bethony j, bottazzi me, brooker s, buss p (2005) hookworm: “the great infection of mankind”. plos med 2 (3): e67\neggs can be found in warm, moist soil where they will eventually hatch into first stage larvae, or l1. l1, the feeding non - infective rhabditoform stage, will feed on soil microbes and eventually molt into second stage larvae, l2. l2, which is also in the rhabditoform stage, will feed for approximately 7 days and then molt into the third stage larvae, or l3. l3 is the filariform stage of the parasite, that is, the non - feeding infective form of the larvae. the l3 larvae are extremely motile and will seek higher ground to increase their chances of penetrating the skin of a human host. the l3 larvae can survive up to 2 weeks without finding a host. it is important to note that while\ndiagnostics of hookworm relies mainly on the recovery of the eggs from the stools .\nthe egg is unsegmented or in an early segmentation stage when passed, but sometimes when specimens have been allowed to stand at room temperature for a long period of time, a larva may be observed within the egg .\nit is rare that eggs hatch and that free larvae are found in the stool .\nrecent research has focused on the development of dna - based tools for diagnosis of infection, specific identification of hookworm, and analysis of genetic variability within hookworm populations [ 17 ] .\nbecause hookworm eggs are often indistinguishable from other parasitic eggs, pcr assays could serve as a molecular approach for accurate diagnosis of hookworm in the feces [ 18, 19 ] .\nthe most common treatment for hookworm are benzimidazoles (bzas), specifically albendazole and mebendazole .\nbzas kill adult worms by binding to the nematode’s beta - tubulin and subsequently inhibiting microtubule polymerization within the parasite [ 20 ] .\nin certain circumstances, levamisole and pyrantel pamoate may be used [ 21 ] .\nthey found that the efficacy of single - dose treatments for hookworm infections were as follows: 72% for albendazole, 15% for mebendazole, and 31% for pyrantel pamoate [ 22 ]. this substantiates prior claims that albendazole is much more effective than mebendazole for hookworm infections. also noteworthy is that the world health organization recommends anthelmintic treatment in pregnant women after the first trimester [ 23 ] .\nit is also recommended that if the patient also suffers from anemia ferrous sulfate (200mg) be administered three times daily at the same time as anthelmintic treatment; this should be continued until hemoglobin values return to normal which could take up to 3 months [ 24 ] .\nother important issues related to the treatment of hookworm are reinfection and drug resistance .\nit has been show that reinfection after treatment can be extremely high. some studies even show that 80% of pretreatment hookworm infection rates can be seen in treated communities within 30 - 36 months [ 25 ]." ]
{ "text": [ "ancylostoma duodenale is a species of the roundworm genus ancylostoma .", "it is a parasitic nematode worm and commonly known as the old world hookworm .", "it lives in the small intestine of hosts such as humans , cats and dogs , where it is able to mate and mature .", "ancylostoma duodenale and necator americanus are the two human hookworms that are normally discussed together as the cause of hookworm infection .", "they are dioecious .", "ancylostoma duodenale is abundant throughout the world , including in the following areas : southern europe , north africa , india , china , southeast asia , some areas in the united states , the caribbean , and south america . " ], "topic": [ 3, 3, 4, 3, 0, 14 ] }
"ancylostoma duodenale is a species of the roundworm genus ancylostoma. it is a parasitic nematode worm and commonly known as the old world hookworm. it lives in the small intestine of hosts such as humans, cats and dogs, where it is able to mate and mature. ancylostoma duodenale and necator americanus are the two human hookworms that are normally discussed together as the cause of hookworm infection. they are dioecious. ancylostoma duodenale is abundant throughout the world, including in the following areas: southern europe, north africa, india, china, southeast asia, some areas in the united states, the caribbean, and south america."
[ "ancylostoma duodenale is a species of the roundworm genus ancylostoma. it is a parasitic nematode worm and commonly known as the old world hookworm. it lives in the small intestine of hosts such as humans, cats and dogs, where it is able to mate and mature. ancylostoma duodenale and necator americanus are the two human hookworms that are normally discussed together as the cause of hookworm infection. they are dioecious. ancylostoma duodenale is abundant throughout the world, including in the following areas: southern europe, north africa, india, china, southeast asia, some areas in the united states, the caribbean, and south america." ]
"animal-train-29"
"animal-train-29"
"2680"
"olivella columellaris"
[ "worms - world register of marine species - olivella columellaris (g. b. sowerby i, 1825 )\nolivella columellaris - olividae - ecuador seashell - 9. 2mm - lot 3 on ebid united kingdom | 137295364\nwhat can we learn from confusing olivella columellaris and o. semistri\nby allison i. troost, samantha d. rupert et al .\nwhat can we learn from confusing olivella columellaris and o. semistriata (olivellidae, gastropoda), two key species in panamic sandy beach ecosystems ?\nwhat can we learn from confusing olivella columellaris and o. semistriata (olivellidae, gastropoda), two key species in panamic sandy beach ecosystems ?\nwhat can we learn from confusing olivella columellaris and o. semistriata (olivellidae, gastropoda), two key species in panamic sandy beach ecosystems ?\narticle: what can we learn from confusing olivella columellaris and o. semistriata (olivellidae, gastropoda), two key species in panamic sandy beach ecosystems ?\ndetails - what can we learn from confusing olivella columellaris and o. semistriata (olivellidae, gastropoda), two key species in panamic sandy beach ecosystems? - biodiversity heritage library\n- - - - - - - - - - - - - - - species: olivella columellaris (g. b. i sowerby, 1825) - id: 2012000040\nolivella, pachyoliva, panamic faunal province, sandy beach intertidal, shell growth (allometry), suspension feeder .\nresumen: el gasterópodo olivella columellaris habita las playas arenosas del pacífico oriental tropical. estos caracoles suelen realizar migraciones mareales ya que se alimentan de partículas en suspensión en la zona de resaca que se mueve con la marea. aunque este comportamiento posiblemente esté regulado por un reloj endógeno que sigue los ritmos mareales, o. columellaris fácilmente puede modificarlo. por ejemplo, cuando se crean pequeños canales que drenan el agua de las pozas (naturales o artificiales) generadas en marea baja, la alimentación suspensívora continúa mientras el agua esté corriendo, retrasándose así la migración mareal. dicha plasticidad en el comportamiento cuestiona la importancia de los ritmos endógenos en la regulación de las migraciones mareales de o. columellaris .\nallison i. troost, samantha d. rupert, ariel z. cyrus, frank v. paladino, benjamin f. dattilo, and winfried s. peters (2012). what can we learn from confusing olivella columellaris and o. semistriata (olivellidae, gastropoda), two key species in panamic sandy beach ecosystems? . biota neotropica. 12 (2). urltoken\nty - jour ti - what can we learn from confusing olivella columellaris and o. semistriata (olivellidae, gastropoda), two key species in panamic sandy beach ecosystems? t2 - biota neotropica ur - urltoken py - 2012 - 06 - 01 au - troost, alison i. au - rupert, samantha d. au - cyrus, ariel z. au - paladino, frank v. au - dattilo, benjamin f. au - peters, winfried s. kw - olivella kw - pachyoliva kw - panamic faunal province kw - sandy beach intertidal kw - shell growth / allometry kw - suspension feeder er -\n@ article { bhlpart109026, title = { what can we learn from confusing olivella columellaris and o. semistriata (olivellidae, gastropoda), two key species in panamic sandy beach ecosystems? }, journal = { biota neotropica }, url = urltoken publisher = { }, author = { troost, alison i. and rupert, samantha d. and cyrus, ariel z. and paladino, frank v. and dattilo, benjamin f. and peters, winfried s. }, year = { 2012 - 06 - 01 }, keywords = { olivella | pachyoliva | panamic faunal province | sandy beach intertidal | shell growth / allometry | suspension feeder | }, }\ntroost, a. i. ; rupert, s. d. ; cyrus, a. z. ; paladino, f. v. ; dattilo, b. f. ; peters, w. s. (2012). what can we learn from confusing olivella columellaris and o. semistriata (olivellidae, gastropoda), two key species in panamic sandy beach ecosystems? . biota neotropica. 12 (2): 101 - 113. , available online at urltoken [ details ]\nafter more than 2 years of preparations, the diatombase portal is now officially launched... .\nlast week - on may 30 and 31st – 8 thematic experts on talitridae came together for the first time during a lifewatch - worms sponsored workshop. the workshop took place at the hellenic centre for marine research in crete, where it was organized back - to - back with the 8th international sandy beaches symposium (isbs). the group focused on identifying relevant traits for the talitridae, and adding this data through the amphipoda species database... .\non 23 april 2018, a number of editors of the world register of introduced species (wrims) started a three day workshop in the flanders marine institute (vliz). these three days were used to evaluate, complete and improve the content of this worms thematic register (tsd)... .\nthe 2nd worms early career researchers and 3rd worms achievement award were granted respectively to françois le coze and geoff read. congratulations! ...\nin 2018, to celebrate a decade of worms' existence, it was decided to compile a list of our top marine species, both for 2017 and for the previous decade... .\nthe scleractinian corals are now accessible though their own list portal. this world list contains over 1 500 accepted names of extant species and is one of the most complete existing resources for scleractinian taxa ...\nsowerby i, g. b. (1825). a catalogue of the shells contained in the collection of the late earl of tankerville. london, privately published. vii + 92 + xxxiv pp. , available online at urltoken page (s): p. xxxiv [ details ]\nif you are generating a pdf of a journal article or book chapter, please feel free to enter the title and author information. the information you enter here will be stored in the downloaded file to assist you in managing your downloaded pdfs locally .\nthank you for your request. please wait for an email containing a link to download the pdf .\nsign up to receive the latest bhl news, content highlights, and promotions .\nbhl relies on donations to provide free pdf downloads and other services. help keep bhl free and open !\nthere was an issue with the request. please try again and if the problem persists, please send us feedback .\nhtml public\n- / / w3c / / dtd xhtml 1. 0 strict / / en\nurltoken\nthe star system calculates the number of pieces that were handled by conchology, inc. in the last 15 years :\nwe want to point out that the star system is only very reliable for philippine shells only, as we handle very few foreign shells in general. as time goes, the system will become more and more performant .\nenter your email address and we will send you an email with your username and password .\ne - mail jecilia sisican if you do not receive your email with your username and password .\n© 1996 - 2018 guido t. poppe & philippe poppe - conchology, inc. (0. 001 seconds. )\nhtml public\n- / / w3c / / dtd html 4. 01 transitional / / en\njavascript is required to use this web site. please turn it on before proceeding .\nallison i. troost, indiana university - purdue university fort wayne samantha d. rupert ariel z. cyrus, indiana university - purdue university fort wayne frank v. paladino, indiana university - purdue university fort wayne follow benjamin f. dattilo, indiana university - purdue university fort wayne follow winfried s. peters, indiana university - purdue university fort wayne follow\n© 2009 indiana university–purdue university fort wayne 2101 e. coliseum blvd. | fort wayne, in 46805 - 1499 | 260 - 481 - ipfw (4739 )\ntroost, alison i. rupert, samantha d. cyrus, ariel z. paladino, frank v. dattilo, benjamin f. peters, winfried s .\nhtml public\n- / / w3c / / dtd html 4. 01 transitional / / en\nthis amount includes applicable customs duties, taxes, brokerage and other fees. this amount is subject to change until you make payment. for additional information, see the global shipping program terms and conditions - opens in a new window or tab\nthis amount includes applicable customs duties, taxes, brokerage and other fees. this amount is subject to change until you make payment. if you reside in an eu member state besides uk, import vat on this purchase is not recoverable. for additional information, see the global shipping program terms and conditions - opens in a new window or tab\ndelivery time is estimated using our proprietary method which is based on the buyer' s proximity to the item location, the shipping service selected, the seller' s shipping history, and other factors. delivery times may vary, especially during peak periods .\nany international shipping and import charges are paid in part to pitney bowes inc. learn more - opens in a new window or tab\ninternational shipping and import charges paid to pitney bowes inc. learn more - opens in a new window or tab\ninternational shipping paid to pitney bowes inc. learn more - opens in a new window or tab\nany international shipping is paid in part to pitney bowes inc. learn more - opens in a new window or tab\n$ 1. 00 shipping for each additional eligible item you buy from shellmama .\nthis item will be shipped through the global shipping program and includes international tracking. learn more - opens in a new window or tab\nthere are 2 items available. please enter a number less than or equal to 2 .\n* estimated delivery dates - opens in a new window or tab include seller' s handling time, origin zip code, destination zip code and time of acceptance and will depend on shipping service selected and receipt of cleared payment - opens in a new window or tab. delivery times may vary, especially during peak periods .\nqualifying purchases could enjoy no interest if paid in full in 6 months on purchases of $ 99 or more. other offers may also be available .\ninterest will be charged to your account from the purchase date if the balance is not paid in full within 6 months. minimum monthly payments are required. subject to credit approval. see terms - opens in a new window or tab\nif the item differs greatly from the description or photos your money will be happily refunded. none specified\nshell / coral round 12 - 12. 9 mm size jewelry making beads ,\nunbranded shell / coral 12 - 12. 9 mm size jewelry making beads ,\ncopyright © 1995 - 2018 ebay inc. all rights reserved. accessibility, user agreement, privacy, cookies and adchoice\nthe photos in our gallery are in most cases just a sample from our stock, except when only one specimen is offered. we try to match the original color but it can vary if your screen is not correctly adjusted (gamma correction) .\nin order to give you the best experience, we use cookies and similar technologies for performance, analytics, personalisation, advertising, and to help our site function. by using ebid, you agree to our use of cookies to enhance your experience in accordance with our updated privacy policy of 25th may 2018. want to know more? view our privacy policy .\nitem is from australia, bids are aud (a $), gbp (£) prices are estimates .\nmeasure 9. 2mm - with full data except for date f + + / gem... a beautiful and rare shell !\naustralian customers can pay by direct bank deposit (preferred), paypal or cheque. overseas customers please pay by paypal unless other arrangements have been made\nprices quoted below are for regular airmail. please note that we can register and / or insure on larger orders. please enquire .\ncombining items in the one package is the most economical way to buy as postage stays the same up to 500grams .\nas postage figures vary dramatically from state to state and country to country please message us if you need an accurate quote .\nwe offer a money - back guarantee if not happy with the item. money will be refunded once the item has been returned in its original condition. return postage is the buyers responsibility .\nthis is a single item listing. if an auction is running, the winning bidder will be the highest bidder .\nebid has paid for another holiday\n- why? let' s take june 2014 as an example - sales £799. 09, invoice £16. 47... overall my sales on ebid in the last 12 months have given me a total of £99. 36 in fees. on ebay that would have been £496. 80. thats my families holiday accommodation paid for this year in savings .\n45 created tue 10 jul 2018 10: 41: 52 (bst). copyright © 1999 - 2018 ebid ltd\noops. a firewall is blocking access to prezi content. check out this article to learn more or contact your system administrator .\nneither you, nor the coeditors you shared it with will be able to recover it again .\nreset share links resets both viewing and editing links (coeditors shown below are not affected) .\nfor full functionality of researchgate it is necessary to enable javascript. here are the instructions how to enable javascript in your web browser .\nthe intertidal gastropod hydrobia ulvae was subjected experimentally in undisturbed core samples to different combinations of the presence or absence of light and of cover by seawater. as displayed in the field, a greater proportion of snails were active in the dark than in the light, and when covered by water as opposed to being provided only with a damp sediment surface. a slight, but... [ show full abstract ]\ndistribution and migrations of two cerithid snails on a sand flat in bermuda; ii. factors determinin ...\ntwo species of cerithid prosobranchs, baiillaria minima and cerithium lutosum, live on a sand flat in bermuda. the two species execute complex vertical migrations, but they respond differently to light intensity and to water level. this ensures that in the course of tidal and diurnal cycles their maxima of vertical distribution are sometimes in the same, sometimes in different layers of... [ show full abstract ]\nfloating of mud snailshydrobia ulvae in tidal waters of the wadden sea, and its implications in dist ...\njuvenile mud snailshydrobia ulvae disperse by floating at the water surface in summer. the routes of dispersal are determined by the hydrography of the specific area and can be successfully predicted by a hydrographic model. along these routes, juveniles may aggregate in temporary “satellite” sites. turnover of organisms was high at these sites. on average, an individual only stayed for 2 days... [ show full abstract ]\na crepuscular rhythm of locomotor activity in the freshwater prosobranch, melanoides tuberculata (mü ...\nmelanoides tuberculata, entrained to a l: d 12: 12 regimen, exhibits a crepuscular pattern of locomotor activity which persists for 6 to 7 days in both constant light and constant relative darkness at a period which deviates only slightly from 24 h, showing the rhythms to be endogenous. in constant conditions, the activity peaks drift relative to the times of the zeitgebers, but retain the... [ show full abstract ]\nwe use cookies to enhance your experience on our website. by continuing to use our website, you are agreeing to our use of cookies. you can change your cookie settings at any time .\nariel z. cyrus, jennifer swiggs, pilar santidrian tomillo, frank v. paladino, winfried s. peters; cannibalism causes size - dependent intraspecific predation pressure but does not trigger autotomy in the intertidal gastropod agaronia propatula, journal of molluscan studies, volume 81, issue 3, 1 august 2015, pages 388–396, urltoken\nautotomy, the active shedding of a body part, is a dramatic action some animals take to escape a predator' s attack. understanding the balance of benefit and costs of losing a body part in order to survive is a persistent problem in evolutionary ecology (maginnis, 2006). while the widely known shedding of tails in lizards represents the paradigmatic, most thoroughly studied example (bateman & fleming, 2009), autotomy is particularly common in various invertebrate taxa, where a variety of morphological structures are affected (fleming, muller & bateman, 2007) .\nin s. c. caliginosa, the predators against which autotomy is effective are specialized snail - eating snakes that attack the snails through the aperture of their shells. when determinate growth ceases, mature snails develop a constricted shell aperture which restricts the snakes' access to fully withdrawn snails (hoso & hori, 2008). therefore, most mature individuals survive snake attacks without having to shed their ‘tails’, although snake - induced autotomy does occur occasionally in mature snails. immature individuals are more vulnerable as they lack the protective constriction and therefore have relatively wide shell apertures. nonetheless, about half of the attacked young snails survive, mostly because they autotomize more readily than mature ones (hoso, 2012). the other subspecies of s. caliginosa, s. c. picta, lives on an island without snail - eating snakes; it does not develop apertural constrictions (hoso & hori, 2008) and autotomizes rarely (hoso, 2012) .\nwhat triggers autotomy in a. propatula in the wild remains obscure. cannibalistic attacks of larger specimens on smaller ones have been documented (rupert & peters, 2011; cyrus et al. , 2012), but no predation on a. propatula other than intraspecific aggression has yet been reported. this led rupert & peters (2011) to hypothesize that autotomy serves in the defence against cannibalism, although cannibalism - induced autotomy has not been directly observed in the wild. in this study, we further evaluated the effects of cannibalism in our costa rican study population of a. propatula. we estimated the frequency of autotomy and the proportion of cannibalism among all predation events, determined the role of body size for the success of cannibalistic attacks and conducted a direct test of the hypothesis that cannibalism triggers autotomy .\nspecimen was carefully lifted up by the shell without touching the soft body. snails treated in this manner do not retreat into their shell but continue to probe the air around them in what seems to be an attempt to reach solid ground (\n). the behaviour of hunter and bait was recorded (attack or no attack, success of attack, attempt to escape by burrowing or crawling away, etc. ;\n= 116), either until one had completely enclosed the other in its metapodial pouch, or until both moved away in different directions. finally, hunter and bait were photographed next to a ruler with a digital camera (sony cybershot dsc - h20) and shell lengths were measured on the photographs using imagej v. 1. 45s (\n) to establish the dependence of the success rate of predation attempts on the size ratio between hunter and bait .\nmorphological indicators of previous autotomy events and their distribution across the size spectrum of the study population of agaronia propatula. a. living snails viewed from below, showing a normal, uniformly coloured sole (left), a pink ‘tail’ (centre) and an incompletely regenerated white ‘tail’ (right). in bicoloured feet (centre and right), the border between the colours is always sharp and coincides with the darkly pigmented autotomy zone. b. size spectrum (shell length in classes 2 mm wide) and distribution of foot colourations in the active population. the median shell length (30. 4 mm) is indicated by a vertical line. unhatched portions of columns represent uniformly coloured feet, which were grey or pink as colour - coded. hatched portions represent bicoloured feet with white or pink tails as colour - coded. asterisks on top stand for individuals with incompletely regenerated, short and thin white ‘tails’ (as on the right in a) .\nduring the course of this project, we documented 108 successful predation events at our study site. predation events either were directly observed as successful attacks (29% of all cases), or\nsailing down the beach slope in the backwash with filled metapodial pouches were caught and examined (71% of all cases). in the latter case, several hours may have passed since the successful attack took place (\n( 68. 5% of the total); shell lengths of animals captured ranged from 7. 0 to 19. 3 mm, corresponding to predator - to - prey shell length ratios from 1. 47 to 5. 13. in six predation events (5. 6% of the total) victims were smaller\n( 22. 0 to 32. 1 mm shell length) and predator - to - prey shell length ratios ranged from 1. 45 (practically identical to the lower limit for\nprey) to 2. 14. in one of these six instances, about half of the victim was found consumed and, in another, only a small amount of tissue remained in the apex of the victim' s shell. these observations suggested that incompletely consumed prey was kept in the metapodial pouch as a food reserve. the remaining four victims of intraspecific predation were alive and active immediately after their rescue from the metapodial pouches; none had autotomized. intriguingly, two of the live victims had inflated metapodial pouches themselves, but these contained sand only. in no case was the prey' s shell damaged, indicating that\n). in four of these instances, both animals retreated after a more or less violent struggle in which they attempted to wrap their metapodia around the opponent. no animal involved ever withdrew into its shell; it rather seemed that the snails expanded their feet to maximum size, which evidently reduced the danger of being enclosed by the opponent' s foot. on two occasions the animals were submerged when the attack occurred; in both cases, the attacked snail rapidly assumed the sailing posture and moved away with the flow, leaving its opponent behind .\ntaken together, our field observations indicated that ‘tail’ autotomy on one hand, and intraspecific aggression as well as cannibalism on the other, occur at significant rates in a. propatula at our study site. thus, the hypothesis that autotomy serves as a defence mechanism against intraspecific predation appeared plausible. however, the hypothesis was not supported by direct observation of the process in the field .\nsince we had failed to observe cannibalism - induced autotomy in the field, we attempted to trigger it experimentally by ‘hunter - bait’ experiments. in these experiments, one active individual, the ‘bait’, was placed in the path of another, the ‘hunter’ (\n). without exception, the bait snail, irritated by being lifted up from the substrate briefly, started to burrow immediately. in 99 out of 116 trials (i. e. 85 %) the hunter attacked the burrowing bait, trying to seize it from above with the anterior foot and push it into the metapodial pouch. the bait, however, always attempted to escape by rapid burrowing or forceful movement to the side and only 40 attacks (35% of all trials) ended with the successful entrapment of the bait in the hunter' s pouch. most importantly, the bait never autotomized in these tests, even when almost subdued. snails that could not escape by moving rapidly or burrowing expanded their feet maximally in what looked like desperate attempts to exceed the opponent' s metapodial pouch in size (fig .\n) in its metapodium, whereas the ‘bait’ struggles to burrow while keeping its foot expanded .\nplot of 116 trials with hunter and bait sizes (shell lengths) as coordinates; dashed isolines mark equal size ratios. different symbols represent successful captures of the bait, unsuccessful attacks on the bait and no responses, as defined at top left. all attempted captures in which the size ratio was ≥1. 46 were successful, while all attempts with size ratios < 1. 18 were unsuccessful (with one exception); these two critical ratios are highlighted as solid lines. the distribution of hunter / bait size ratios in this experiment is not representative of natural cannibalistic events in the population, as hunters were intentionally selected to cover the widest possible size range more or less homogeneously .\nplotting bait versus hunter shell lengths revealed a clear dependence of the success rate of capturing attempts on the size ratio (fig. 2 b). when the hunter was at least 1. 46 times larger than the bait, the attack never failed (19 cases). this relation was practically identical to the minimum predator - to - prey size ratios that we had found in naturally occurring cannibalism events (1. 45) and in the predation on o. semistriata (1. 47; see above). in contrast, the bait almost always escaped (in 36 of 37 cases) when the hunter was less than 1. 18 times larger than the bait (fig. 2 b). when the size ratio was between these values, attacks were successful or not at about equal rates. it should be emphasized that the size ratio determined the success rate of the attacks, but had little effect on the decision to attack: in 79% of the trials in which the bait actually was larger than the hunter (size ratio < 1), the hunter attacked anyway (fig. 2 b) .\nwe inferred that if autotomy occurred in a. propatula as a response to cannibalistic attack, it would not be triggered during early stages of intraspecific aggressive interactions. moreover, we concluded that hunting a. propatula tend to attack conspecifics they encounter regardless of size, but that the success of intraspecific predation attempts depends on the size ratio between predator and prey. consequently, cannibalism must be common in a. propatula populations. the frequency of successful cannibalistic predation attempts in a population must be a function of population density since encounters are random, and also of the size spectrum of the population because success rates depend on size ratios (fig. 2 b) .\nwe concluded that a. propatula kills its prey in a process that takes several hours, with slow suffocation in the metapodial pouch being the most obvious candidate mechanism. due to enclosed sediment and water, the volume of the closed pouch can be much larger than that of the victim alone, which may explain the prolonged survival of the prey. our results confirmed that a. propatula approaches its shelled gastropod prey through the aperture without damaging the shell. the most important finding, however, was that all victims died without autotomizing, refuting the hypothesis that a. propatula performs autotomy in defence against cannibalistic attack .\nin his review of cannibalism in gastropods, baur (1992) concluded that among marine species, cannibalism occurs in opportunistic but not in specialized predators (compare paine, 1963; hughes, 1985), that the intraspecific predator usually is larger than its prey in shelled snails but not necessarily in shell - less slugs (compare leonard & lukowiak, 1984) and that the occurrence of cannibalism might correlate with environmental constraints such as limited periods for foraging activities. evidently, a. propatula fits this description .\nwhile we have not determined the absolute frequency of cannibalistic events in the study population, a rough estimate of the effects of cannibalism can be derived from the finding that 5. 6% of all predation events observed were cannibalistic. defining t as the average period between two successful hunts, and assuming that t is the same for all kinds of prey, the population will have a cannibalism - induced half - life period of 12 t. if t equals 5 d, for example, the original population will be halved in 2 months due to cannibalism alone. this assumption appears conservative; we have not observed t for cannibalism, but t for predation on o. semistriata probably is about 1 d as consumption was completed in less than 14 to 16 h in our tests. thus, cannibalism is a potentially significant factor in the population dynamics of a. propatula .\nto establish an arbitrary but intuitive unit of intraspecific predation pressure, we set the probability to be cannibalized when meeting a conspecific for a snail of median size (30. 4 mm shell length) to 1. the relationship between size and relative intraspecific predation pressure is given in figure 3 b. the odds for the smallest a. propatula found on our test beach to meet dangerously sized conspecifics are about nine times higher than those for individuals of median size, while the risk for the largest animals in the population approaches zero. the relative predation pressure on snails at the end of the 10th percentile (shell length 21. 3 mm) and the beginning of the 90th percentile (shell length 37. 7 mm) of the study population differs by a factor of 90! this strongly skewed distribution of predation risk confirms that large and small a. propatula play distinct trophic roles in a functionally size - structured population .\nwork in the parque nacional marino las baulas was conducted under research permits act - or - d - 015 and act - or - dr - 064 to w. s. p. from the costa rican ministerio de ambiente y energia. fieldwork in 2013 / 2014 was facilitated by a sabbatical leave granted to w. s. p. by indiana / purdue university fort wayne. we thank lucia delbene for assistance in the production of the\nnatural history observations of prophysaon andersoni (j. g. cooper), with special reference to amputation\noxford university press is a department of the university of oxford. it furthers the university' s objective of excellence in research, scholarship, and education by publishing worldwide\nfor full access to this pdf, sign in to an existing account, or purchase an annual subscription .\nerror. page cannot be displayed. please contact your service provider for more details. (32 )" ]
{ "text": [ "olivella columellaris is a species of small sea snail , a marine gastropod mollusk in the family olivellidae , the dwarf olives .", "with the very similar olivella semistriata it forms the subgenus pachyoliva .", "both species are suspension feeders .", "they use unique appendages of the propodium ( front part of the foot ) to deploy mucus nets which capture suspended particles from the backwash on sandy beaches of the tropical eastern pacific . " ], "topic": [ 2, 26, 12, 17 ] }
"olivella columellaris is a species of small sea snail, a marine gastropod mollusk in the family olivellidae, the dwarf olives. with the very similar olivella semistriata it forms the subgenus pachyoliva. both species are suspension feeders. they use unique appendages of the propodium (front part of the foot) to deploy mucus nets which capture suspended particles from the backwash on sandy beaches of the tropical eastern pacific."
[ "olivella columellaris is a species of small sea snail, a marine gastropod mollusk in the family olivellidae, the dwarf olives. with the very similar olivella semistriata it forms the subgenus pachyoliva. both species are suspension feeders. they use unique appendages of the propodium (front part of the foot) to deploy mucus nets which capture suspended particles from the backwash on sandy beaches of the tropical eastern pacific." ]
"animal-train-30"
"animal-train-30"
"2681"
"yellow - tailed black cockatoo"
[ "yellow - tailed black - cockatoo at... - cockatoo wingtag | facebook\ncarnaby’s black cockatoo, carnaby’s cockatoo, mallee cockatoo, ngoolark, short - billed black cockatoo, short - billed black - cockatoo, slender - billed black - cockatoo, slender - billed cockatoo, white - tailed black cockatoo, white - tailed black - cockatoo, white - tailed cockatoo .\nthe yellow - tailed black cockatoo competes with the palm cockatoo as australia’s largest cockatoo species. yellow - tailed black cockatoos reach a greater length, but palm cockatoos are heavier .\nalthough the yellow - tailed black cockatoo is one of six species of black cockatoo in australia, it is the only black cockatoo found in tasmania .\na yellow - tailed black cockatoo in sydney’s centennial park. photo: peter rae\na yellow - tailed black cockatoo in sydney' s centennial park. photo: peter rae\ncommon names include baudin' s black cockatoo or long - billed black cockatoo .\nmy experience with the yellow - tailed black cockatoos. it all started in 1984 when i purchased a pair of yellow - tailed black cockatoos .\nresearchers john martin and jessica rooke fit a gps tracker to a yellow - tailed black cockatoo .\nthis information is important for the long - term conservation of the yellow - tailed black - cockatoo population .\nthis and carnaby' s black cockatoo were known collectively as the white - tailed black cockatoo until formally classified as separate species .\ndescription of adults: not to be confused with the red tailed black cockatoo .\nthe yellow tailed black cockatoo has a beak adapted for digging into branches and trunks of trees to extract insect larvae .\nresearchers john martin and jessica rooke fit a gps tracker to a yellow - tailed black cockatoo. photo: peter rae\nsaunders, denis a (1979) .\ndistribution and taxonomy of the white - tailed and yellow - tailed black - cockatoos\nthe yellow - tailed black cockatoo is a large black cockatoo with round yellow marking on ear. the tail has pale yellow panels. the male has dark grey upper bill and pink ring round eye. the female has a paler bill and grey ring round eye .\nsaunders, denis a (1974) .\nsubspeciation in the white - tailed black cockatoo ,\nthe yellow - tailed black - cockatoo is a large (to 680mm) cockatoo clearly distinguished by its mostly black plumage, yellow cheek patch and yellow panels on the tail. the body feathers are edged with yellow giving a scalloped appearance. it has a short, mobile crest on the top of its head .\nportrait of a female yellow - tailed black - cockatoo (photo courtesy of b. hensen) [ bruny island, tas, march 2016 ]\nthe yellow - tailed black - cockatoo is found in south - eastern australia, from eyre peninsula, south australia to south and central eastern queensland .\nlateral view of a male yellow - tailed black - cockatoo (photo courtesy of m. eaton) [ ravensbourne np, qld, june 2016 ]\nfrontal view of a preening female yellow - tailed black - cockatoo (photo courtesy of m. eaton) [ cooroy, qld, december 2017 ]\nwildlife ecologist john martin and researcher jessica rooke look for yellow - tailed black cockatoos in sydney' s centennial park .\nthe yellow - tailed black cockatoos have a long breeding season. both sexes construct the nest, which is a large\nuntil recently, the short - billed black - cockatoo, c. latirostris, found in south - western australia, was considered a subspecies of the yellow - tailed black - cockatoo. this species has white, instead of yellow, panels in the tail. another similarly sized black - coloured cockatoo is the red - tailed black - cockatoo, c. magnificus. this species overlaps with the range of the yellow - tailed black - cockatoo in south - eastern queensland. it has red panels in the tail, and spotting on the body and head. the smaller (48 cm) glossy black - cockatoo, c. lathami, also has red panels in the tail .\nuntil recently, the short - billed black - cockatoo, c. latirostris, found in south - western australia, was considered a subspecies of the yellow - tailed black - cockatoo. this species has white, instead of yellow, panels in the tail. another similarly sized black - coloured cockatoo is the red - tailed black - cockatoo, c. magnificus. this species overlaps with the range of the yellow - tailed black - cockatoo in south - eastern queensland. it has red panels in the tail, and spotting on the body and head. the smaller (48 cm) glossy black - cockatoo, c. lathami, also has red panels in the tail .\nwestern australia black cockatoo workshop (2008). proceedings of the western australia black cockatoo workshop, august 2008. perth, western australia .\nthe yellow - tailed black - cockatoo is one of six species of black - cockatoo in australia. in recent years it has been in rapid decline because of native habitat clearance, with a loss of food supply and nest sites .\nfemale yellow - tailed black cockatoo in australia. it is eating banksia integrifolia. . image by tim from ithaca - some rights reserved. (view image details )\nnear - lateral view of a female yellow - tailed black - cockatoo (photo courtesy of b. hensen) [ st. albans, nsw, november 2017 ]\ndorsal view of a female yellow - tailed black - cockatoo (photo courtesy of r. plumtree) [ ensay south, east gippsland, vic, january 2017 ]\nyellow - tailed black cockatoo' s, while not uncommon are no where near as visible as their cousins, the sulphur - crested cockatoo (which are a daily sighting in most major australian cities) .\nthe yellow - tailed black - cockatoo is a large cockatoo. it is easily identified by its mostly black plumage, with most body feathers edged with yellow, not visible at a distance. it has a yellow cheek patch and yellow panels on the tail. the female has a larger yellow cheek patch, pale grey eye - ring (pink in males), white upper bill (grey - black in males) and black marks in the yellow tail panels. young birds resemble the adult female, but young males have a smaller cheek patch .\nthe yellow - tailed black - cockatoo occurs in a variety of habitat types, including eucalypt woodland, heathlands, subalpine areas, pine plantations and occasionally in urban areas .\nthis story rare birds: project tracks wild yellow - tailed black cockatoos for the first time first appeared on the sydney morning herald .\ndamage done by a yellow - tailed black - cockatoo to a young tree; yellow - tailed black - cockatos are known to take grubs, such as e. g. witchety grubs, that may have caused the initial damage to the plant' s core [ jilliby sca, nsw, july 2013 ]\nmale yellow - tailed black - cockatoo pulling seeds out of a cone (photo courtesy of r. plumtree) [ ensay south, east gippsland, vic, december 2013 ]\nfemale yellow - tailed black - cockatoo pulling seeds out of a cone (photo courtesy of r. plumtree) [ ensay south, east gippsland, vic, march 2014 ]\nseed cones of an introduced conifer (left) and one chewed by a yellow - tailed black - cockatoo... [ near glen innes, nsw, may 2014 ]\nsaunders, d. a. (1979) distribution and taxonomy of the white - tailed and yellow - tailed black - cockatoos calyptorhynchus spp. emu, 79: 215 - 227 .\nfig. 3. crypsis in feather lice: the white louse (neopsittaconirums albus) is a parasite ofthe sulfur - crested cockatoo (cacatua galerita), the black louse (n. borgiolii) is a parasite of the yellow - tailed black cockatoo (calyptorhynchus funereus). photos of sulfur - crested cockatoo by fir0002 / flagstaffotos, yellow - tailed black cockatoo by david cook, and lice by s. e. bush. from bush et al. (2010) .\nwildlife ecologist john martin and researcher jessica rooke look for yellow - tailed black cockatoos in sydney' s centennial park. photo: peter rae\nyellow - tailed black - cockatoo\ntlc\n- female, right, grooming male, left (photo courtesy of m. eaton) [ cooroy, qld, december 2017 ]\never the practical joker... male yellow - tailed black - cockatoo having fun chewing on the bark of a eucalypt tree [ bald rock np, nsw, october 2007 ]\nthe yellow - tailed black - cockatoo is found in south - eastern australia, through south australia, with an isolated population on the eyre peninsula, to south and central eastern queensland .\njessica’s project focuses on the well known yellow - tailed black - cockatoo. however, not many people know that this iconic species has been largely understudied, and is in significant decline. the project’s objectives are to investigate the species habitat, foraging and breeding ecology, with an overall aim of creating a management plan to help conserve the yellow - tailed black - cockatoo .\nr. plumtree reports spotting yellow - tailed black - cockatoos, race\nfunereus\n, occasionally at ensay south, east gippsland, vic .\nb. hensen reports spotting yellow - tailed black - cockatoos, race\nxanthanotus\n, on bruny island, tas, in march 2016 .\nsaunders, d. a. (1979). distribution and taxonomy of the white - tailed and yellow - tailed black - cockatoos calyptorhynchus spp. emu. 79: 215 - - 227 .\nthere are six species of black - cockatoo endemic to australia. the yellow - tailed black - cockatoo is one of the largest species, and found from central / south eastern queensland down to the eyre peninsula in south australia. in recent years, there has been a significant decline in yellow - tailed black - cockatoo numbers on the east coast. moreover, birds have begun to inhabit urbanised areas and forage on introduced pines. around sydney, yellow - tailed black - cockatoos forage in bushland, parks and golf courses on pine cones and a range of native plants, including banksia and hakea seeds .\nmaintain the cockatoo care program and use other opportunities to promote the recovery of baudin’s cockatoo .\na large cockatoo, the yellow - tailed black - cockatoo may reach 65 cm in length with mostly black plumage. most body feathers are edged with yellow and it has large yellow cheek patch and yellow tail panels. females have brighter cheek patches, a pale - grey eye - ring and dark spotting in the tail panels. both sexes have a short, erectable crest. in flight, yellow - tailed black cockatoos flap with a distinctive slow, deep wingbeat. the contact call is a high - pitched and distinctive\nkee - ow” but they may utter a raucous screech if alarmed .\nif you hear the distinctive call of the yellow - tailed black cockatoo in the parklands, take heed as you will be in for a feast for the eyes as a flock wheels over you .\nyou may have seen them slowly flapping in small to large flocks, or heard their distinctive, loud call around sydney. but what do we know about the yellow - tailed black - cockatoo ?\nlateral view of a female yellow - tailed black - cockatoo launching itself into the air (photo courtesy of l. scott) [ roseberry creek valley, near toonumbar np, northern nsw, january 2017 ]\nresearch featured in the' state of australia' s birds 2015' headline and regional reports indicates a significant decline for the yellow - tailed black cockatoo (and some other parrot species) in the east coast .\ni was out walking and came across this pair of yellow - tailed black - cockatoos, unfortunately i didn' t have my camera on me out the time .\nthe breeding season of yellow - tailed black - cockatoos depends on geographic latitude. in the se of australia it is restricted to the period from oct to may .\nbohner, f. (1984). first breeding of the white - tailed black cockatoo. bird keeping in australia. 27: 17 - 18 .\nmale yellow - tailed black cockatoo at wamboin, nsw, australia. the red eye - ring indicates that it is a male. image by david cook wildlife photography - some rights reserved. (view image details )\nyellow - tailed black - cockatoos feed in small to large flocks. their favoured foods are wood - boring larvae and seeds of native and introduced trees and ground plants .\nyellow - tailed black - cockatoos, race\nxanthanotus\n, feasting on seeds (photo courtesy of b. hensen) [ bruny island, tas, march 2016 ]\nthe yellow - tailed black - cockatoo inhabits a variety of habitat types, but favours eucalypt woodland and pine plantations. small to large flocks can be seen in these areas, either perched or flying on slowly flapping wings .\nyellow - tailed black - cockatoos are not as common as other cockatoo species west of the great dividing range. the first time we spotted one bird of race\nfunereus\nwas 25 km west of narrabri in 2003 .\nthe yellow - tailed black cockatoo inhabits a variety of habitat types, but prefers eucalypt woodland and pine plantations. they are found in south - eastern australia, from eyre peninsula, south australia to south and central eastern queensland .\nbirds in my backyard / yellow - tailed black cockatoo feeding it’s young the yellow - tailed black cockatoos have arrived in my backyard. (as with the sulphur - crested cockatoos we only get a couple of them turn up to where we live .) this year they have a young one with them which is good to see. i was fortunate enough to catch the male feeding him / her .\nif you are in the southern part of western australia, they would have been one of the white - tailed black cockatoos: either baudin' s black - cockatoo (calyptorhynchus baudinii) or carnaby' s black - cockatoo (c. latirostris). the white - tailed black cockies have white cheek patches and (unsurprisingly) a white panel with little to no black in the tail. these may possibly be mistaken for pale yellow in certain circumstances. we are in the process of adding more fact sheets and images to the site, but unfortunately we don' t have any white - tailed cocky images at this point. try entering\nwhite tailed black cockatoo\ninto a search engine to see some images of these lovely birds. cheers, jaynia\nassociations baudin' s cockatoo sometimes associates with carnaby' s cockatoo and the forest red - tailed black cockatoo (calyptorhynchus banksii naso) at sites where food is abundant (higgins 1999; saunders 1974b), most likely in jarrah - marri forest on the darling plateau. breeding, foraging and roosting areas also overlap on the southern swan coastal plain. carnaby' s cockatoo is listed as endangered and the forest red - tailed black cockatoo is listed as vulnerable under the epbc act 1999 .\n— geltonuodegis kakadu statusas t sritis zoologija | vardynas atitikmenys: lot. calyptorhynchus funereus angl. yellow tailed black cockatoo vok. gelbschwanz rußkakadu, m rus. траурный какаду, m pranc. cacatoès funèbre, m ryšiai: platesnis terminas… …\nwithin the genus, the two western australian white - tailed species, the short - billed and long - billed black cockatoo, together with the yellow - tailed black cockatoo of eastern australia form the subgenus zanda. the red - tailed and glossy black cockatoos form the other subgenus, calyptorhynchus. the two groups are distinguished by differing juvenile food begging calls and the degree of sexual dimorphism. males and females of the latter group have markedly different plumage, whereas those of the former have similar plumage. [ 4 ]\nthe baudin' s black cockatoo is one of two species of white - tailed black cockatoo endemic to south - western australia which were only separated taxonomically in 1948. it is closely associated with moist, heavily forested areas dominated by marri and is threatened by habitat destruction .\nyellow - tailed black - cockatoos can be very determined to [ literally ] get their grub (photo courtesy of m. eaton) [ ravensbourne np, qld, june 2016 ]\nyellow - tailed black - cockatoos large black - cockatoos that usually live in small to medium - sized flocks. their plumage is dimorphic, i. e. males and females are slightly different. both sexes have dull black plumage, with a small crest. grey edge lining of the feathers leads to a slightly scalloped appearance. male yellow - tailed black - cockatoos have small yellow ear patches, pink eye - rings, a dark - grey bill and two solid - yellow undertail panels. females have larger yellow ear patches, grey eye - rings, a light - grey bill and finely barred tail panels. the irises are dark, legs and feet are grey. juvenile and immature yellow - tailed black - cockatoos have a pinkish bill; they can be identified easily, because they are always begging for food with strident begging calls .\nthe forest red - tailed black cockatoo (calyptorhynchus banksii naso) also occurs within the range of baudin' s cockatoo, but baudin' s cockatoo is readily distinguished by the prominent whitish patch over the ear coverts, the white (as opposed to red) panels in the tail, and the distinctive contact call that is said to be very different from the harsh, metallic notes of the forest red - tailed black cockatoo (higgins 1999) .\ncarnaby’s black - cockatoo is often mistaken for the closely related baudin’s black - cockatoo (calyptorhynchus baudinii), and the two were previously considered to be the same species (4) (5). the only noticeable differences between the two species are that carnaby’s black - cockatoo produces a slightly longer contact call and has a shorter upper mandible, giving rise to its alternative common name of short - billed black - cockatoo (2) (3) (4) (5) (8) (9). carnaby’s black - cockatoo and baudin’s black - cockatoo also have slightly different feeding habits and habitat preferences (7) .\na pair of yellow - tailed black cockatoos flying at edithvale wetlands, melbourne, victoria, australia image by frankzed from melbourne, australia - some rights reserved. (view image details )\nthe yellow - tailed black cockatoo is found from central queensland to south australia' s eyre peninsula. it eats the seeds of native trees and pine cones but in urbanised areas is foraging on introduced pine cones in parks and on golf courses .\nnear - lateral view of a female yellow - tailed black - cockatoo - in this view one can clearly see the crossed alignment of the crest feathers (photo courtesy of b. hensen) [ st. albans, nsw, november 2017 ]\nsaunders, d. a. (1974c). the function of displays in the breeding of the white - tailed black cockatoo. emu. 74: 43 - 46 .\na fair number of yellow - tailed black - cockatoos, race\nfunereus\n, were also spotted at coolah tops np, 30 km east of coolah, nsw, in may 2009 .\nhere the cause of the damage: female yellow - tailed black - cockatoo pulling a grub out of the core of a branch of a white cedar tree (photo courtesy of b. hensen) [ st. albans, nsw, november 2017 ]\n55–60 cm; 610–900 g. male body plumage dusky black with upper body and wing - covert feathers finely edged buff; yellow ear - covert patch; broad yellow band in tail ...\ndescription: one of my favourite members of the parrot family would have to be the yellow - tailed black cockatoo. during autumn, these large black cockatoos form flocks that move around sydney in search of food. the males have a blackish bill, a red eye - ring and a dull yellow ear patch. the female has a whitish bill, a grey eye - ring and a bright yellow ear patch. both sexes have large yellow panels in a long tail that can be seen when the bird is in flight .\nnear - dorsal view of a male yellow - tailed black - cockatoo; note the skin - coloured eye ring and dark - grey bill, which distinguish it from females (photo courtesy of b. hensen) [ bruny island, tas, march 2016 ]\nthis species is conventionally accepted (christidis & boles 1994; sibley & monroe 1990). baudin' s cockatoo and carnaby' s cockatoo (calyptorhynchus latirostris) were formerly treated as a single species, the white - tailed black - cockatoo (c. baudinii) (higgins 1999; saunders 1979) .\nsaunders, d. a. (1974b). subspeciation in the white - tailed black cockatoo, calyptorhynchus baudinii, in western australia. australian wildlife research. 1: 55 - 69 .\nyellow - tailed black - cockatoos have been observed by us chomping on tree branches and young trees, apparently feeding on something under the bark, possibly in the (rotten ?) core, see below .\nhi dennis. given your locality and description, it is most likely that the birds you saw are yellow - tailed black - cockatoos. they only other black cockatoo in your area is the glossy black - cockatoo, however as yours were large with yellow on the cheeks and under the tail, it is very unlikely that they were glossies. yellow - tailed black - cockatopos are large, very impressive birds and have a gorgeous call, unlike the harsh screech of a sulphur - crested cockatoo. you can check out their call on the birds in backyards site at urltoken. yellow - tails forage for wood - boring insects by stripping bark and excavating holes in trees, hence the bits of falling branch you saw. they are also known to make a\ngrating\nnoise while they forage, which is probably the sound you heard. best regards, jaynia .\nchapman, t. (2008). forest black cockatoo (baudin' s cockatoo calyptorhynchus baudinii and forest redtailed black cockatoo calyptorhynchus banksii naso) recovery plan. department of environment and conservation, western australia. available from: urltoken. in effect under the epbc act from 21 - apr - 2011 .\nsorry dennis, i posted my last comment before it was finished! there are also red - tailed black - cockatoos in your area, however, it isn' t likely that they are what you saw if all your birds had yellow cheeks and yellow undertail panels. cheers, jaynia\n5th aug, 2010. approx 2 weeks ago i had the pleasure of two large glossy black cockatoos pecking at my tree after borers. i have tried to identify them by picture on the net but cannot find an identical likeness. it sounds like they are yellow tailed black cockatoos but the plumage on these birds was truly beautiful. glossy black but the tails were a soft yellow colour and the yellow was at the end of the tail feathers not mixed in with the black. the division of colour from black to yellow was very definate and almost scalloped across the span of the tail feathers. there was only two and the call was soft and inviting. sadly went for the camera but wasn' t quick enough. all other features seemed same as yellow tailed but cant find that elusive picture to prove it .\nforshaw, joseph m. & cooper, william t. 2002. yellow - tailed black - cockatoo calyptorhynchus funereus (shaw). pp 57 - 70 in: australian parrots / joseph m. forshaw; illustrated by william t. cooper alexander editions, robina, queensland .\nthe yellow - tailed black - cockatoo is found up to 2000m throughout south - eastern australia, from eyre peninsula to south and central eastern queensland. it is declining in numbers in parts of its range due to habitat fragmentation and loss of large trees used for breeding hollows .\nsaunders, d. a. (1974) subspeciation in the white - tailed black cockatoo, calyptorhynchus baudinii, in western australia. australian wildlife research, 1 (1): 55 - 69 .\nhi soraya. the identification depends on which state you saw the birds in. if you are in the eastern states of australia, then the birds were yellow - tailed black - cockatoos. when the tail is folded, sometimes the black in the panel is not visible; also, some birds don' t have a lot of black speckling. there is often a sharp distinction between the black and yellow. my guess is that this is most likely the species you saw .\nshephard, m. (1989). aviculture in australia: keeping and breeding aviary birds. melbourne: black cockatoo press .\nyellow - tailed black cockatoos are a little flighty around humans, which can make it difficult for scientists to capture them. but if you cruise up to one in a car, it won' t be particularly bothered .\nit is unclear whether such responses are adaptive or reflect resilience to habitat alteration. while some data are available, very little is known about the movements of yellow - tailed black - cockatoos and the mechanisms driving their behaviour .\nthis study will investigate yellow - tailed black - cockatoo movements around the sydney region, using gps tracking technology. additionally, diets will be investigated using isotopic analysis, given the probable importance of different types of foraging resources which drive the species’ distribution. overall, we have 4 main objectives :\nsaunders, d. a. (1974a). the occurrence of the white - tailed black cockatoo, calyptorhynchus baudinii, in pinus plantations in western australia. australian wildlife research. 1: 45 - 54 .\nyellow - tailed black - cockatoos feed in small to large, noisy flocks. the favoured food is seeds of native trees and pinecones, but birds also feed on the seeds of ground plants. some insects are also eaten .\nunlike the smaller sulphur - crested cockatoo, whose screech is like the sound of fingernails on a chalkboard, the yellow - tailed black cockatoo has a distinctive, almost mournful, cry. they are beautiful to watch in flight, dr martin said .\nit' s like they' re falling and they catch themselves; they really float along ,\nhe said .\nbyrne, m. , g. barrett, m. blythman, h. finn & m. williams (2015). the 2015 great cocky count: a community - based survey for carnaby' s black - cockatoo (calyptorhynchus latirostris) and forest red - tailed black - cockatoo (calyptorhynchus banksii naso). birdlife australia, floreat, western australia .\ndr martin, who works with the botanic gardens and centennial parklands, is part of the first study to track yellow - tailed black - cockatoos in the wild, which in sydney includes the eastern suburbs and industrial areas such as port botany .\nbirds australia (now birdlife australia) has been leading recovery efforts for the carnaby’s black - cockatoo, and in 2006 introduced the ‘great cocky count’, a survey completed by the community to map carnaby’s black - cockatoo abundance and estimate the population size (7) (15) .\nthere are three races of yellow - tailed black - cockatoos, all of which are endemic to australia. the range of yellow - tailed black - cockatoos extends along the south and east coast of australia, from about the tip of the eyre peninsula, sa, to about the tropic of capricorn in qld. especially in qld, but also in other areas, yellow - tailed black - cockatoos are also found in parts of the great dividing range, up to a few hundred km from the coastline. to the west of melbourne, vic, race\nwhiteae\nis found, whereas east of melbourne and up the east coast nominate race\nfunereus\nis found. race\nxanthanotus\npopulates all of tasmania and the islands along bass strait .\nis there anyone who doesn’t appreciate the sight of a flock of yellow - tailed black cockatoos (ytbc) flying overhead? it seems that very little is really known about them and you can help to change that and potentially influence planning for their conservation .\nlueka is a yellow - tailed black cockatoo. he is a wild - born bird who was donated to australia zoo by queensland parks and wildlife service. yellow - tailed black cockatoos can be found on the sunshine coast, so when you are visiting this beautiful area, keep an eye out for these guys in the sky. lueka is one of the' australian native' stars who appears in the daily crocoseum show. he is fantastic at carving up the sky with his acrobatics and is one of the craziest and most hyperactive birds that we have in the' bird show' .\ncarnaby’s black - cockatoo is legally protected in australia (2) (4), and international trade in this species should be strictly controlled under its listing on appendix ii of the convention on international trade in endangered species (cites) (6). a recovery plan has been prepared for carnaby’s black - cockatoo, and in 1999 a carnaby’s black - cockatoo recovery team was appointed to coordinate conservation efforts for this species (8) .\nyellow - tailed black - cockatoos can be found in various types of forest, from open to dense, often with cypress and / or black pine. they also go into areas with human activity (farms, parks) to feed on other seed cones, such as e. g. those of the white cedar tree .\nthe current recovery plan for the forest black cockatoos, which includes baudin’s cockatoo, includes a section on guidance for decision makers (chapman 2008) .\n- margins and patches of pale yellow in the tail. the male bird (illustrated at right) has a black bill, a dull yellow patch behind the eye, and a reddish eye - ring. females and immatures have a grey eye - ring, a light - coloured bill, and a brighter, more clearly - defined yellow cheek - patch .\nthe 2011 great cocky count suggested a worrying decline in the carnaby’s black - cockatoo population between 2010 and 2011. long - term monitoring is needed to better understand the population trends of this large but highly threatened cockatoo (15) .\nin flight, yellow - tailed black cockatoos flap with a distinctive slow, deep wingbeat. they are often seen flying in pairs, or trios comprising a pair and their young, although outside the breeding season they may coalesce into flocks of a hundred birds or more .\nthe clutch consisted of two eggs laid six days apart, which is normal for yellow - tails .\nfor information on surveys, see also the epbc act referral guidelines for three threatened black cockatoo species. note that the information provided below has, in part, been extrapolated from data on carnaby’s cockatoo, given the similarities in some behaviour .\nmore recently, marri and jarrah have experienced declines because of disease (marri canker), drought and extreme heat, leading to further degradation of forest red - tailed black cockatoo habitat (doherty et al. 2016; paap et al. 2012) .\ncarnaby’s black - cockatoo is classified as endangered (en) on the iucn red list (1) and is listed on appendix ii of cites (6) .\ncarnaby’s black - cockatoo (calyptorhynchus latirostris) is a large, black cockatoo endemic to south - western parts of western australia (2) (4) (7). its feathers are mainly black to brownish - black, with off - white edges, and it has a wide white band on the tail (2) (3) (4) (7) (8). carnaby’s black - cockatoo also has a whitish patch on the cheek, a short erectable crest on top of the head (2) (3), and a strong, curved bill, which has a flaky texture (4) (8) .\nbaudin' s black cockatoo (calyptorhynchus baudinii), also known as baudin' s cockatoo or long - billed black cockatoo, [ 2 ] is a large black cockatoo found in southwestern australia. the binomial commemorates the french explorer nicolas baudin. it has a short crest on the top of its head. its plumage is mostly greyish black and it has prominent white cheek patches and a white tail band. the body feathers are edged with white giving a scalloped appearance. adult males have a dark grey beak and pink eye - rings. adult females have a bone coloured beak, grey eye - rings and ear patches that are paler than those of the males .\nembed this arkive thumbnail link (\nportlet\n) by copying and pasting the code below. < a href =\nurltoken\ntitle =\narkive species - carnaby' s black - cockatoo (calyptorhynchus latirostris )\n> < img src =\nurltoken\nalt =\narkive species - carnaby' s black - cockatoo (calyptorhynchus latirostris )\ntitle =\narkive species - carnaby' s black - cockatoo (calyptorhynchus latirostris )\nborder =\n0\n/ > < / a >\n— taxobox | name = red tailed black cockatoo status = lc status system = iucn3. 1 status ref = [ iucn2006 | assessors = birdlife international | year = 2004 | id = 47938 | title = calyptorhynchus banksii | downloaded = 11 may 2006 database entry includes justification… …\nselection for habitat types on a larger scale. black rats in an area of\noutside of the breeding season, carnaby’s black - cockatoo generally moves to wetter coastal areas, where it feeds in heathlands and scrublands (4) (8) (10). plantations of introduced pines (pinus spp .) have also become important feeding and roosting sites for carnaby’s black - cockatoo during the non - breeding season (2) (4) (8). although many populations of carnaby’s black - cockatoo migrate, some may remain close to the breeding areas year - round (4) .\nthere are few records of the natural history of yellow - tailed black - cockatoos. further, locations of populations, particularly in new south wales, remain limited. if you have seen a bird or flock, or have any information relevant to this project, please help us by filling out the survey below :\nthe female has a larger, more defined yellow cheek patch than the male, pale grey eye - ring (pink in males) and a whitish upper bill (grey - black in males) .\nthe breeding habitat of carnaby’s black - cockatoo has also been extensively cleared (2) (4) (13). in addition, carnaby’s black - cockatoo is losing nesting sites as nesting trees are not regenerating, mainly due to grazing by sheep and rabbits (2) (3) (4) (8) (13). carnaby’s black - cockatoo is also facing increasing competition with other birds and with introduced bees for nest hollows. in particular, species such as the galah (cacatua roseicapilla) and the western corella (cacatua pastinator) are invading the range of carnaby’s black - cockatoo and out - competing it for resources (2) (4) (7) (8) (10) .\nyellow - tailed black cockatoos are raucous, noisy birds that are often heard before being seen. the usual call is a an eerie high - pitched wailing contact call ,\nkee - ow, kee - ow, kee - ow\n, made while flying or roosting. birds may also make a harsh screeching alarm call .\nyellow - tailed black - cockatoos have a long breeding season, which varies throughout their range, although in tasmania it is generally from october to february. both sexes build the nest in hollows of tall, mature trees, generally eucalypts. the hollow is lined with wood chips. the same tree may be used for many years .\nrowley, i. & boesman, p. (2018). yellow - tailed black - cockatoo (zanda funerea). in: del hoyo, j. , elliott, a. , sargatal, j. , christie, d. a. & de juana, e. (eds .). handbook of the birds of the world alive. lynx edicions, barcelona. (retrieved from urltoken on 10 july 2018) .\nthere are a number of small differences between the male and female carnaby’s black - cockatoo. the male has a dark greyish - black bill, a pink ring of skin around the eye and greyish - brown legs, whereas the female has a whitish bill, a grey eye ring and light grey to pinkish legs. the female carnaby’s black - cockatoo also has a slightly larger white cheek patch than the male (2) (3) (4) (8) .\nthe three species of the subgenus zanda have been variously considered as two, then as a single species for many years. in a 1979 paper, australian ornithologist denis saunders highlighted the similarity between the short - billed and the southern race xanthanotus of the yellow - tailed and treated them as a single species with the long - billed as a distinct species. he proposed that western australia had been colonised on two separate occasions, once by a common ancestor of all three forms (which became the long - billed black cockatoo), and later by what has become the short - billed black cockatoo. [ 5 ] however, an analysis of protein allozymes published in 1984 revealed the two western australian forms to be more closely related to each other than to the yellow - tailed, [ 6 ] and the consensus since then has been to treat them as three separate species. [ 4 ]\ninformation sheet baudin' s cockatoo calyptorhynchus baudinii (johnstone, r. , 2010b) [ internet ] .\nabk vol 11 issue 2. apr - may 1998 page 72 - 76 (black cockatoos )\nabk vol 9 issue 6. dec - jan 1997 page 267 - 270 (black cockatoos )\nsolar - powered gps tracking devices to 6 male and 6 female yellow - tailed black cockatoos. one of the aims of the project is to study the birds' foraging behaviour, habitat preferences and roosing locations, and examine how well they have adapted to the urban environment. the findings will be used to determine whether there is a need for a conservation program .\nlike basically all cockatoos, yellow - tailed black - cockatoos are primarily seed - eaters, where seeds include those in cones and nut - like fruit. the pair shown above showed a strong interest in the cones of a casuarina tree on which they were found sitting; if that is the case, it indicates that their bills are strong enough to crack those cones .\ndavies, s. j. j. f (1966). the movements of the white - tailed black - cockatoos (calyptorhynchus baudinii) in south - western australia. western australian naturalist. 10: 33 - - 42 .\nbaudin' s cockatoo is gregarious and is usually seen in trios or small groups. it occasionally gathers in flocks during the non - breeding season. it is easily confused with the very similar carnaby' s cockatoo. baudin' s cockatoo can be distinguished from carnaby' s cockatoo by its longer upper mandible and slightly shorter contact calls (higgins 1999; saunders 1974c). although there is some overlap between habitats, especially during the non - breeding season, baudin' s cockatoo occurs in wetter areas than carnaby' s cockatoo and generally avoids pine plantations, a habitat in which carnaby' s cockatoo is seen frequently. in addition, carnaby' s cockatoo mainly occurs in or near the wheatbelt eucalypt woodlands, especially those dominated by wandoo or salmon gum, and is only sometimes reported in forests of marri, jarrah or karri. conversely, baudin' s cockatoo mainly occurs in forests dominated by marri, jarrah and karri, and is only occasionally reported in wandoo woodland (higgins 1999; saunders 1974a, 1974b) .\nwe see yellow - tailed black - cockatoos, race\nfunereus\n, most regularly when going into the hills of the great dividing range, e. g. at bald rock np, northern nsw, in october 2007. also seen regularly between tamworth and gloucester, nsw, and e. g. in jilliby sca and watagans np, south of cessnock, nsw .\nvernes, k. , and mcgrath, k. (2009). are introduced black rats (\nsites identified by birdlife international as being important for baudin' s black cockatoo conservation are araluen - wungong, gidgegannup, jalbarragup, mundaring - kalamunda, north dandalup, the stirling range and the lakes. [ 10 ]\nyellow - tailed black - cockatoos have a long breeding season, which varies throughout their range. both sexes construct the nest, which is a large tree hollow, lined with wood chips. the female alone incubates the eggs, while the male supplies her with food. usually only one chick survives, and this will stay in the care of its parents for about six months .\nthe chick was reared and is now part of the establishment. those of you who have seen my video on breeding yellow - tailed blacks will remember\njackson\n, and yes, he might be older, but he still gets into all the mischief in the world! !\nyellow - tailed black - cockatoos, race\nfunereus\n, are also seen by us regularly along the nsw coastline, e. g. in royal np, 20 km south of sydney, some littoral rainforest and in other locations along the east coast of nsw and qld, including suburbs of major cities, but less frequently than in the major forests in the great dividing range .\ncale, b. (2003) carnaby’s black - cockatoo (calpytorhynchus latirostris) recovery plan 2002 - 2012. department of conservation and land management, western australian threatened species and communities unit, wanneroo. available at: urltoken\nbaudin' s black cockatoo is about 56 cm (22 in) long. it is mostly dark - grey with narrow vague light - grey scalloping, which is produced by narrow pale - grey margins at the tip of dark - grey feathers. it has a crest of short feathers on its head, and it has whitish patches of feathers that cover its ears. its lateral tail feathers are white with black tips, and the central tail feathers are all black. the irises are dark brown and the legs are brown - grey. its beak is longer and narrower than that of the closely related and similar carnaby' s black cockatoo. [ 7 ]\nhi all, i am new to this site and being interested to know the last week or so i came home in the afternoon and my husband signalling of be quiet. then we went under the tree and we saw 5 black yellow tailed bird we thought it must be a parrot or cockatoo who knows. anyway from that day we observed and it is a group of 5 large birds. my husband waited and saw them went to our small pond and the birds were having a drink. so from then on they are coming for morning and everning drinks in our little fish pond. time between 07: 00 to 07: 30 and 18: 00 - 20: 00 everyday. it feels so special to have these 5 birds in our front yard everyday. is this normal to come to a suburb? i would say it is black tailled yellow cockatoo after i have the information from the internet .\nthere has been little research published on yellow - tailed black cockatoos, ms rooke said .\na lot of people are under the false impression that the population is doing quite well ,\nshe said .\nbut some of the recent research has shown they' ve significantly declined along the east coast, so now more than ever we need to find out as much as we can about them .\nat curramore, awc is restoring forest cover to disturbed and cleared areas that have been invaded by lantana. awc’s active fire management program should also reduce the potential impacts of wildfires on rainforest and large hollow - bearing trees utilised by this species as breeding sites. a revegetation program has commenced at dakalanta, which is located on the eyre peninsula, which may eventually provide food and habitat for yellow - tailed black cockatoos .\nbanksia park bushcare volunteers recently observed some yellow - tailed black cockatoos boring into tea trees, apparently to extract wood - boring invertebrates. the group had intentionally planted hakeas and banksias to provide a food source for them so we were pleasantly surprised that the tea trees planted alongside were also providing food for the iconic species! jessica advises that literature suggests that yellow - tailed black cockatoos increase this behaviour during breeding time, and when juveniles are fledging (around june - july, although this is based on limited studies, and is said to change across their range). if your groups has any similar observation, please take the time to record them and upload the data to the easy to use survey. the more we can contribute to these citizen science type projects, the more chances we’ll have to help protect the habitat of the species being studied .\nwell i hope you enjoyed my little experience with yellow - tails. just remember - you could have a jackson waiting in the darkness just ready to pounce !\nhabitat fragmentation and loss is a major issue for this cockatoo, as land clearing contributes to loss of food plants and nesting hollows .\n— taxobox | name = glossy black cockatoo status = lc | status system = iucn3. 1 caption = c. l. halmaturinus on kangaroo island regnum = animalia phylum = chordata classis = aves ordo = psittaciformes familia = cacatuidae subfamilia = … …\ncarnaby’s black - cockatoo is endemic to southwest western australia, where it is mainly found between murchison river and esperance, and inland to coorow, kellerberrin and lake cronin (2) (3) (4) (8) (10) .\naustralian government - department of sustainability, environment, water, population and communities (2004) australian threatened species: carnaby’s black - cockatoo, calyptorhynchus latirostris. department of sustainability, environment, water, population and communities, canberra. available at: urltoken\naustralian government - department of sustainability, environment, water, population and communities (2004) australian threatened species: carnaby’s black - cockatoo, calyptorhynchus latirostris. department of sustainability, environment, water, population and communities, canberra. available at: urltoken\nrose, t. a. , and banks, p. b. (2007). impacts of black rats\nsince then we have seen yellow - tailed black - cockatoos, race\nfunereus\n, in the area a few times, e. g. on the northern edge of jack' s creek state forest, 20 km south of narrabri, following bohena creek into the pilliga scrub, and also 25 km west of narrabri and 20 km south - west of narrabri. the next sighting in the northern pilliga np came years later, in 2013 .\nthe epbc act referral guidelines for three threatened black cockatoo species includes baudin’s cockatoo and provide guidance on whether a proposed action is likely to have a significant impact and should be referred under the epbc act. the guideline includes information concerning surveys, habitat, significance and mitigation options. the referral guidelines should be considered in conjunction with the significant impact guidelines 1. 1 – matters of national environmental significance .\nthe glossy black cockatoo in an aviary situation prefer grey striped sunflower seed along with some fruits and vegetables. other seeds typically in a parrot mix are eaten in far less quantities. casuarina tree seed pod or nut should be offered to aviary birds if available .\na number of conservation measures are already in place for carnaby’s black - cockatoo. for example, a captive breeding programme is underway so that if extinction occurs in the wild, individuals are available for reintroductions. injured wild cockatoos are also rehabilitated and incorporated into the breeding programme. perth zoo is maintaining a stud book for captive carnaby’s black - cockatoos, and microchipping and dna analysis are being used to ensure that all captive birds have been legally obtained (2) (4) (8) (13). captive birds are also used to help educate the public about the threats to the carnaby’s black - cockatoo population (8) .\nthe following season i decided to pull some of her eggs and incubate them myself. this proved successful as after 30 days of incubation my first yellow tail chick hatched .\nto have had a devastating impact on native wildlife, especially in island ecosystems. black rat is likely to have arrived in\nwidespread. yet, its impacts on local wildlife have largely been overlooked. here, we review the potential for black rat\ndickman, c. r. , and watts, c. h. s. (2008). black rat ,\ndisease and competition, not just predation, as drivers of impacts of the black rat (rattus rattus) ...\nthe yellow - tailed black - cockatoo prefers seeds of native trees, ground plants and pine cones. some insects are also eaten. unlike other cockatoos, a significant proportion of the diet is made up of wood - boring grubs. birds place their ear against the surface of dead trees to listen for the sound of grubs beneath. if a grub is detected the bird will use their powerful bill to tear chunks from the tree to reach the grub, often leaving a small pile of woodchips at the base of the tree. such scarred, dead trees are a common sight in tasmanian forests .\n7th june, 2010 3. 30pm ish, canungra, queensland. saw 5 birds together, same description as for this bird, the yellow cheeks, the black coat was shiny black like a crow, the tail feathers showed horizontal blackish stripes across the yellowowish area, but the bird was twice the size of the yellow tail as described on site, well over 600 cm [ 2 ft ] maybe 3 foot in sitting position in heavy vine laden trees about 12 ft up. my home borders a sub tropical block, on canungra creek, the birds were not noisy, no bird sounds or squarks etc, just the opposite, and the noise they made that attracted my attention seems to sound like trees rubbing together and i sighted bits of branch falling from the area where they were perched. not good visual unfortunatly. they eventually dissapeared very quietley, i did not even sight them departing in flight. what were they if not the yellow tailed ?\ncarnaby’s black - cockatoo is very sociable and can often be seen in groups of three or more, and even in large flocks of hundreds or sometimes thousands of birds outside of the breeding season (2) (3) (4) (7) (8) .\nthe young carnaby’s black - cockatoo is initially brooded by the female for the first two weeks of life, after which both adults share in feeding it. after 10 to 12 weeks the young cockatoos fledge, but remain with the adults for up to a year, moving with them to the coast at the end of the breeding season to join larger flocks (4) (7) (8). carnaby’s black - cockatoo is a long - lived species that may potentially live for 40 to 50 years in the wild (4) (10)." ]
{ "text": [ "the yellow-tailed black cockatoo ( calyptorhynchus funereus ) is a large cockatoo native to the south-east of australia measuring 55 – 65 cm ( 22 – 26 in ) in length .", "it has a short crest on the top of its head .", "its plumage is mostly brownish black and it has prominent yellow cheek patches and a yellow tail band .", "the body feathers are edged with yellow giving a scalloped appearance .", "the adult male has a black beak and pinkish-red eye-rings , and the female has a bone-coloured beak and grey eye-rings .", "in flight , yellow-tailed black cockatoos flap deeply and slowly , and with a peculiar heavy fluid motion .", "their loud eerie wailing calls carry for long distances .", "the yellow-tailed black cockatoo is found in forested regions from south and central eastern queensland to southeastern south australia including a very small population persisting in the eyre peninsula .", "two subspecies are recognised , although tasmanian and southern mainland populations of the southern subspecies xanthanotus may be distinct enough from each other to bring the total to three .", "birds of subspecies funereus ( queensland to eastern victoria ) have longer wings and tails and darker plumage overall , while those of xanthanotus ( western victoria , south australia and tasmania ) have more prominent scalloping .", "unlike other cockatoos , a large proportion of the yellow-tailed black cockatoo 's diet is made up of wood-boring grubs , and they also eat seeds .", "they nest in hollows situated high in trees with fairly large diameters , generally eucalyptus .", "although , they remain common throughout much of their range , fragmentation of habitat and loss of large trees suitable for nesting has caused a population decline in victoria and south australia .", "in some places yellow-tailed black cockatoos appear to have adapted to humans and they can often be seen in parts of urban canberra , sydney , adelaide and melbourne .", "it is not commonly seen in aviculture , especially outside australia .", "like most parrots , it is protected by cites , an international agreement , that makes trade , export , and import of listed wild-caught species illegal . " ], "topic": [ 23, 23, 23, 23, 23, 23, 28, 23, 5, 23, 12, 28, 17, 23, 17, 17 ] }
"the yellow-tailed black cockatoo (calyptorhynchus funereus) is a large cockatoo native to the south-east of australia measuring 55 – 65 cm (22 – 26 in) in length. it has a short crest on the top of its head. its plumage is mostly brownish black and it has prominent yellow cheek patches and a yellow tail band. the body feathers are edged with yellow giving a scalloped appearance. the adult male has a black beak and pinkish-red eye-rings, and the female has a bone-coloured beak and grey eye-rings. in flight, yellow-tailed black cockatoos flap deeply and slowly, and with a peculiar heavy fluid motion. their loud eerie wailing calls carry for long distances. the yellow-tailed black cockatoo is found in forested regions from south and central eastern queensland to southeastern south australia including a very small population persisting in the eyre peninsula. two subspecies are recognised, although tasmanian and southern mainland populations of the southern subspecies xanthanotus may be distinct enough from each other to bring the total to three. birds of subspecies funereus (queensland to eastern victoria) have longer wings and tails and darker plumage overall, while those of xanthanotus (western victoria, south australia and tasmania) have more prominent scalloping. unlike other cockatoos, a large proportion of the yellow-tailed black cockatoo's diet is made up of wood-boring grubs, and they also eat seeds. they nest in hollows situated high in trees with fairly large diameters, generally eucalyptus. although, they remain common throughout much of their range, fragmentation of habitat and loss of large trees suitable for nesting has caused a population decline in victoria and south australia. in some places yellow-tailed black cockatoos appear to have adapted to humans and they can often be seen in parts of urban canberra, sydney, adelaide and melbourne. it is not commonly seen in aviculture, especially outside australia. like most parrots, it is protected by cites, an international agreement, that makes trade, export, and import of listed wild-caught species illegal."
[ "the yellow-tailed black cockatoo (calyptorhynchus funereus) is a large cockatoo native to the south-east of australia measuring 55 – 65 cm (22 – 26 in) in length. it has a short crest on the top of its head. its plumage is mostly brownish black and it has prominent yellow cheek patches and a yellow tail band. the body feathers are edged with yellow giving a scalloped appearance. the adult male has a black beak and pinkish-red eye-rings, and the female has a bone-coloured beak and grey eye-rings. in flight, yellow-tailed black cockatoos flap deeply and slowly, and with a peculiar heavy fluid motion. their loud eerie wailing calls carry for long distances. the yellow-tailed black cockatoo is found in forested regions from south and central eastern queensland to southeastern south australia including a very small population persisting in the eyre peninsula. two subspecies are recognised, although tasmanian and southern mainland populations of the southern subspecies xanthanotus may be distinct enough from each other to bring the total to three. birds of subspecies funereus (queensland to eastern victoria) have longer wings and tails and darker plumage overall, while those of xanthanotus (western victoria, south australia and tasmania) have more prominent scalloping. unlike other cockatoos, a large proportion of the yellow-tailed black cockatoo's diet is made up of wood-boring grubs, and they also eat seeds. they nest in hollows situated high in trees with fairly large diameters, generally eucalyptus. although, they remain common throughout much of their range, fragmentation of habitat and loss of large trees suitable for nesting has caused a population decline in victoria and south australia. in some places yellow-tailed black cockatoos appear to have adapted to humans and they can often be seen in parts of urban canberra, sydney, adelaide and melbourne. it is not commonly seen in aviculture, especially outside australia. like most parrots, it is protected by cites, an international agreement, that makes trade, export, and import of listed wild-caught species illegal." ]
"animal-train-31"
"animal-train-31"
"2682"
"giant cicada"
[ "i caught a giant cicada! scratch that - - a giant wet cicada .\nthe giant cicada (クマキリ, kumakiri) is an uncommon insect found in animal crossing: new leaf .\nthe\nsong\nof a giant cicada, recorded in boerne, texas on august 30, 2009. the photo is of another giant cicada spotted near the same time, but it is unliky that this cicada made the recorded noise. the ruler image shows the approximate size of the giant cicada. it is one big bug! and it makes one loud noise !\nnote, there are over 40 species of cicadas in texas, but the giant cicada is truly unique in terms of the sound it makes .\nsummer cicada sound # 60 minutes song of cicada. amazing sound # 1080p video\ngiant cicada necklace - insect jewelry - natural history - aged brass. $ 27. 00, via etsy. | cool clothes and related | pinterest | insects\ncicadas are emerging across much of the washington area, surprising locals who weren’t expecting the giant insects for four more years .\nthe wasp will carry the cicada to a burrow, where it will place the cicada .\nbatman cicada — a cicada with an unusual pattern on its back. (kevin ambrose )\ncicada videos and sounds alarm squawks and mating calls is also very helpful for identifying cicada sounds .\nevery now and then someone will email me about “a giant bee attacking a cicada”. these are not bees, these are cicada killer wasps. now is a good time to write about them because prof. chuck holliday is now retired and has shut down his cicada killer wasp website 1 .\nthe first jon & lynn cd was released march 1, 2010 on the jbq media label. this giant cicada ep is their second release. find them on the web at giantcicada. com .\ngiant cicadas range from central texas to central argentina (sanborn &. phillips 2013). this is the widest ranging cicada in the western hemisphere and has almost no variation in its song throughout its range .\na different catchphrase is shown when it is caught in the rain in new leaf. this trait is shared with the robust cicada, walker cicada, and evening cicada .\ngiant cicada is a group that makes music in the cracks. is this jazz, folk, americana, what? some of my favorite music doesn’t fit neatly in any genre, and i will add this to the list... giant cicada’s gift is to take these incongruous elements and have them make sense together. (lynn) stein is an emotional singer who never has to shout, and that really puts this album over the top .\nfeb. 21 - around 4: 00 pm one giant cicada was heard calling in the parking lot area, resaca de la palma state park, brownsville, cameron co. - melissa c jones, phd. , tpwd, habitat conservation coordinator\nin japan, it is known as the bear cicada (熊蝉 or kumazemi). it is the largest cicada in japan .\nthe cicada information on cicada mania is not limited to north america. we have some cicada photos and information for australia, asia, europe, and south america thanks to contributors around the world .\na cicada caught on locust lane in fairfax, va. we know a cicada is not a locust, but the nearest cicada drive is in martinsburg, w. va. (kevin ambrose )\nno one would confuse a horse with a cicada (visually and audibly speaking), but there was a famous horse named cicada .\nthere are many albums named cicada as well, such as cicada by cat scientist. that one comes up a lot in ebay .\nthe group’s bassist jon burr is the leader of the giant cicada. with the addition of violin, guitar, cajon drum, and bowed upright bass, the duo ventured farther down the paths of pop, dance, world and jazz and developed a vibrant new sound .\ndon' t see your cicada? search our database of 190 + cicadas of north america or the 17 / 13 year cicada page .\nthe giant cicada been rehearsing, recording, and performing in the new york area with a focus on material chosen for its appropriateness to their unique sound. their repertoire is drawn from 60’s pop, jazz, the great american songbook of standards, songs from around the world, as well as original tunes .\nevery 17 years, an army of giant bugs rises from the earth in the northeast. cicadas spend most of their lives underground, but eventually they shake off the dirt, come up for a little air and do some mating .\nalthough they prey on cicadas, cicada killers are preyed upon by a wasp called the velvet ant. the female velvet ant sneaks into the cicada killer’s tunnel and lays an egg in a nest cell. the cicada killer larva eats its cicada and grows; when it pupates, the velvet ant larva eats the pupa .\na cicada and rabbit garden statue in herndon, va. (emily clavadetscher )\na cicada nymph emerges in oakton, va. (stephen c. guptill )\nthis is a photo of a t. canicularis (dog day cicada) next to a t. davisi (southern dog day cicada) by by paul krombholz :\ncicadas are slow, clumsy bugs that are easily caught. they will fly directly into a predator — and they will also fly directly into the faces of people who are completely freaked out by giant, ugly locusts getting tangled in their hair .\na close - up of a summer cicada making some noise in franconia, pa .\ni don’t know much about japanese species. i recommend searching the web for a website about japanese wasps and hornets. i do like the suzumebachi (asian giant hornet) and have one in my collection, but i don’t know much more than that .\nas the name might indicate, giant cicadas are one of the largest species of cicada in the world. they used to live mostly in warmer western japan, but they' ve now also moved to urban eastern japan. though they' re now common in these areas, they aren' t well known in other parts of the world .\nif you haven’t seen a cicada killer wasp, they are largely black and pale yellow wasps, and are often found carrying a cicada (see image on this page) .\na cicada in clifton, va. , poses for a photo after molting. the cicada’s shell will harden and turn black within several hours after molting. (mark khosravi )\nbird calls can be mistaken for cicada song. some birds that can mimic sounds, such as lyrebirds, mockingbirds, and psittaciformes (parrots) could conceivably mimic cicada sounds .\nas the name might indicate, giant cicadas are one of the largest species of cicada in the world. they used to live mostly in warmer western japan, but they' ve now also moved to urban eastern japan. though they' re now common in these areas, they aren' t well known in other parts of the world .\ndescription: the second largest north american cicada. black, green and brown camo patterns .\nswamp cicada sings in a meadow in pickaway county, ohio usa. august 23, 2009\na close - up view of a cicada with drops of dew. (kevin ambrose )\nthe wasp will lay an egg under the left or right second leg of the cicada .\n“i dug up a white grub in my back yard. is it a cicada? ”\nthese places show up in twitter, and when i search for cicada photos on flickr .\nmaxwell demille’s cicada club is a vintage - style night club in los angeles, california .\na cicada in herndon, va. , is stuck in its exoskeleton after molting. a video of this cicada can be found at the bottom of this post. (kevin ambrose )\nhomepage: cicadas by genus and species: u. s. a. & canada cicada search\nthe latin root for the word for cicada is cicada. cicadas are called semi in japan, cigale in france, and cigarra in spain. names for cicadas in countries around the world .\n† kriang is the sarawak - malay word for cicada. the usual malay word is bringin .\na cicada is stuck in its exoskeleton after molting in herndon, va. (kevin ambrose )\nno, cicadas are not june bugs. many people confuse june bug larvae for cicada larvae .\ndavis w. t. 1944. the remarkable distribution of an american cicada: a new genus, and other cicada notes. journal of the new york entomological society 52: 213 - 223 .\nthe bug experts at urltoken (which, if you’re interested, has more information about these giant bugs than you’ll be able to consume in one sitting) confirmed our surprise visitors are brood x precursors and not the brood vi cicadas that are emerging in other parts of the country this year .\nthe bear cicada is japan' s largest cicada. the adults can emerge anywhere from july to the end of september. the populations have seen erratic increases and decreases all over japan in recent years .\nfig. 4. cicada killer wasp burrowing activity recorded during kingwood, wv study (1989) .\nmegatibicen resh aka resh cicada aka western dusk singing cicada. found in: ar, ks, la, ms, ne, ok, sc, tn, tx. season: july to fall .\nthe giant cicada is a living, buzzing creature making a new sound of songs you know and songs you will want to know, played by strings and percussion, and sung by the amazing vocalist lynn stein. their sound has been called “chamber punk. ” energetic, danceable, fun, beautiful. throbbing, energetic but gentle. rooted in jazz, bluegrass and baroque. funky and sweet .\nadult cicada killers feed on nectar and other sweet plant juices. to provide food for the young, female cicada killers hunt dog day cicadas (genus tibicen), using their stings to paralyze them, then stock their nests with one or two cicadas per cell. cicada killer larvae feed on the cicadas .\nan illustration of cicada tymbals from c. l. marlatt' s the periodical cicada. c shows the muscles and tendons connected to the tymbals, and d & e show the bending of the tymbal .\ncicada exoskeletons collected from a tree in oakton, va. , on tuesday afternoon. (kevin ambrose )\nsphecius hogardii (latreille, 1809 aka the caribbean cicada killer, is found in florida and caribbean countries .\nthe world' s largest species of cicada is the megapomponia imperatoria, which is native to malaysia. the largest species in north america is megatibicen auletes, aka the northern dusk singing cicada. other notably large cicadas include the bear cicada of japan (cryptotympana facialis), and tacua speciosa of south - east asia .\ndavis w. t. 1944. the remarkable distribution of an american cicada: a new genus, and other cicada notes. journal of the new york entomological society 52: 213 - 223. (full pdf )\nthe world' s loudest cicada is the brevisana brevis, a cicada found in africa that reaches 106. 7 decibels when recorded at a distance of 50cm (~ 20\n), according to researcher john petti .\nthe egg hatches, and the larvae begins to eat the cicada, while taking care to keep it alive .\nthere are about 3, 000 known species of cicada worldwide, according to the smithsonian natural museum of history .\nmeet the cicada killers. as the name implies, these wasps are predators of cicadas. there are four species found in the united states, but only one occurs in north carolina: the eastern cicada killer, sphecius speciosus .\nmegatibicen resonans aka southern resonant / great pine barrens cicada aka southern dusk singing cicada. found in al, fl, ga, la, ms, nc, sc, tn, tx, va. season: july to fall .\nasia: cicadae in japan, phantastic songs of the s. e. asian cicadas! , cicada sounds of borneo\nthese are people (in the form of bands), places and things named cicada. they often show up in flickr, twitter, ebay or amazon, when i’m searching for cicada insects. it is awesome that people name stuff after cicadas (but it can be annoying when you’re searching for cicada insects, and other stuff shows up) .\n© 1996 - 2018 cicada mania - 22 years of providing cicada information and fun on the web! all content on urltoken is owned and copyrighted by the content' s creator. site map | terms & conditions, privacy policy, and help\nthe 13 - or 17 - year life cycle of a periodical cicada begins when an adult female cicada lays her eggs in slits she cuts in the twigs and branches of trees. when the eggs hatch, they nymphs or juveniles drop to the ground and burrow into the soil. the growing cicada then spends the next 13 to 17 years underground as a nymph .\nchi·cha·rra f. (spanish) 1. - cicada 2. colloquial (persona) - chatterbox 3. spain: - nuisance\nholliday, c. , hastings, j. , and coelho, j. 2009. cicada prey of new world cicada killers, sphecius spp. (dahlbom, 1843) (hymenoptera: crabronidae). entomological news. 120: 1 - 17 .\nwonder which annual cicadas are in your area? try our u. s. a. & canada cicada search search tool .\na newly emerged adult cicada walks on the wrist of a boy in great falls, va. (hyungwon kang / reuters )\nbeen here for 13 years and this is first time we' ve heard this sound. starts at dusk and goes all night. was pretty sure it was a bird because i saw a bird in the top of 2 different trees the sound was coming from. (central texas) have learned from a youtuber that it is a giant cicado. thanks to all who researched .\ndescription: the scissor grinder looks a lot like linne' s cicada but their wing doesn' t have bend that linne' s cicada has. the scissor grinder also seems to have more of an orange coloration to the' arches' on its mesonotum .\nsphecius convallis (patton, 1879) aka the pacific cicada killer, is found in the u. s. a. and mexico .\nthe “biology of cicada killer wasps | prof. chuck holliday' s www page at lafayette college” website which is now archived at urltoken .\nno matter how hard she tries mrs. cicada killer can' t seem to fit the cicadas into her burrow @ cicadamania # insanity urltoken\njuly 18 - 20 -\ni am hearing giant cicadas in san antonio. 1 individual heard on 18 july 2017 and three heard on 20 july 2017. all all detected from one / same location in the morning. all quite by late morning. detected about 1 mile north - northwest of intersection of perrin beitel road and loop 410, san antonio, northeast bexar county, tx .\n- chris collins\ni had been thinking of them as the\nfire alarm\nor\nsmoke detector\ncicada because the call is so loud and rather annoying .\na cicada emerges from its exoskeleton during the early morning hours. its shell will harden and turn black within a few hours. (kevin ambrose )\nin contrast, female cicada killers are equipped with rather large stingers and venom adapted to paralyze cicadas (effective only on insects, not people) .\nsometimes the tunneling of this species disfigures lawns; the flip side is that it aerates the soil and helps rainwater to soak in. this species also provides us with drama: a cicada killer gliding with, then dragging, a huge, immobilized cicada to its nest is truly an impressive spectacle .\nannual cicada species are those that arrive every year (annually). each state has at least 4 species of cicadas. california as over 80 .\nbelow is a sampling of the many cicada photos shared with us. your information and feedback have been a great way to document this unusual emergence .\nthere are many bands with\ncicada\nin their name. these show up a lot in ebay and twitter. here is a partial list :\ncicadas are also famous for their penchant for disappearing entirely for many years, only to reappear in force at a regular interval. there are some 3, 000 cicada species, but only some share this behavior (the 17 - year cicada is an example). others are called annuals because, although individuals have multi - year lifecycles, some adults appear every year. the dog day cicada, for example, emerges each year in mid - summer .\ncicada killer wasps, genus sphecius spp. two species are present in texas (only four spp. occur in n. and c. america) :\npageflip cicada is a wireless bluetooth pedal designed to meet the needs of musicians and people with disabilities who struggle with the challenge and inconvenience of page turning .\nsphecius grandis (say, 1824), the western cicada killer, is found in the u. s. a. mexico and parts of central america .\ndo cicada’s use the same hole the next year? i have a video of a wasp digging a hole and appears to pull out a casing of some sort .\nthis pair of cicada killer wasps may be large and look menacing. but they hunt cicadas, are not aggressive toward humans and pose no threat to the public .\nthe megatibicen pronotalis walkeri (formerly known as tibicen walkeri) is the loudest cicada in north america, and can achieve 105. 9 decibels, measured at 50cm .\nare cicada experts still convinced that brood x cicadas are emerging four years early in the washington, d. c. , area and not some other smaller brood ?\nfull song of male cicada (purana sp .) as he sings & sways with the breeze. singapore, 28th december 2015. documented by leong tzi ming .\nproto - periodical: cicada species with proto - periodical life cycles might emerge every year, but every so many years they emerge in heavy numbers, like the okanagana .\nthe new zealand cicada fauna consists of 42 species and subspecies in five genera, although additional species are yet to be formally described. all are unique to new zealand .\nthe current cicada distribution map. cyan represents brood x and pink represents brood vi. brood x stragglers are thought to be emerging in the washington area. (urltoken )\nthe waning of the day, usually a silent hour in temperate climes, is in borneo marked by the commencement of a concert of noisy cicadas, who in legions fill the air with their deafening and varied clamour. one species { pomponia imperatoria; west .), which the malays have named\nkriang pokul anam ,\nor the\nsix o' clock cicada ,\nis a giant; one of the specimens we got measured nearly 7 1 / 2 inches across the wings. it begins at sunset, and the noise it makes is not unlike the braying of an ass in high treble, and can be heard at a distance of many hundred yards .\nyoung, a. m. 1983. on the evolution of cicada x host - tree associations in central america. acta biotheoretica 33 (3): 163 - 198 .\nresearchers and cicada enthusiasts have noted that the life cycles of periodical cicadas are prime numbers, i. e. the figure can' t be evenly divided into smaller integers .\nsphecius speciosus (drury, 1773) aka the eastern cicada killer, is found in ontario, canada, the u. s. a. mexico and parts of central america .\nvery interesting about the cicada killer wasps. the cicada here in our area must be so lucky because i’ve never seen or heard of the wasps in our area. we will get an occasional cicada each year, but the big swarms come out from underground every 17 years. it is pretty loud for the several weeks they are here. they leave holes in the yard where they first burrowed out from, seem to kill the tips of tree branches, then mate, lay eggs that somehow get underground till the next 17 year cycle .\ndescription: if the cicada has a white x on its back, it is a latifasciatus. repetitive, rhythmic, call like someone repeatedly running a scissor over a grinding wheel .\nsmall trees can be covered with a mesh cloth to prevent the females from laying eggs in the twigs. delaying the planting of trees during a cicada year may also be considered .\nif you find yourself outdoors in the eastern half of the u. s. after sunset and hear a cicada call, it is likely one of the following megatibicen or neotibicen species :\nan example of a young cicada nymph unearthed from the ground. note how its body is white, but it doesn’t have the cheetos / worm - like body of a beetle grub :\nsource: cicada researcher john cooley via magicicada. org. . tree photo by bigstock. the washington post. published on may 13, 2013, 7: 13 p. m .\ndr. o. beccari writes of this insect thus: –\none species (pomponia imperatoria, westw .), which the malays have named\nkriang † pokul anam\nor\nthe six o' clock cicada ,\nis a giant; one of the specimens we got measured nearly 7 1 / 2 inches across the wings. it begins at sunset and the noise it makes is not unlike the braying of an ass in high treble, and can be heard at a distance of many hundred yards .\nthe largest specimen, a male, in the sarawak museum is just short of 8 inches; and mr. distant records a female 216 mm. , (or 8 1 / 2 inches) across, from perak .\nvisit the songs of insects site for a nice photo and sound file of the dog day cicada. also by their book songs of insects – is is inexpensive and comes with a cd .\ncicada\ncomes from the latin, meaning\ntree cricket .\nwhile cicadas are often colloquially referred to as a kind of locust, they are not part of the locust family .\nso why would these wasps paralyze cicadas? as it turns out, each female cicada killer is a potential mother, and as nature mandates, these expectant mothers follow the call to secure and provide nourishment for their young, which in this case, happens to come in the form of cicadas. so it’s no wonder the occurrence of cicada killers coincides with the annual arrival of cicadas .\na 17 - year cicada cycle is nearing its end in ohio. a resident of mansfield, ohio, shared social video of her children cleaning up the mess. (richelle smart / facebook )\ninsect singers is a great new site from kathy hill and david marshall featuring dozens of cicada songs of north american cicadas. many of the sound files on this site are courtesy of insect singers .\nonce the cicada hatches from the egg it will begin to feed on the tree fluids. at this point it looks like a termite or small white ant. once the young cicada is ready, it crawls from the groove and falls to the ground where it will dig until it finds roots to feed on. it will typically start with smaller grass roots and work its way up to the roots of its host tree. the cicada will stay underground from 2 to 17 years depending on the species. cicadas are active underground, tunneling and feeding, and not sleeping or hibernating as commonly thought .\ncicada killer wasps (s. speciosus) will prey upon magicicada periodical cicadas 3. there is a bit of a myth that magicicada are able to avoid these wasps but that is not the case .\ndescription: the largest north american cicada. olive green to rusty brown with black, tan and white coloring. heavy white pruinosis. m on mesonotum typically partially ocluded by pruinosis. sings at dusk .\ncicada killers may begin to dig in sandy areas on playgrounds or in golf course sand traps. if practical, keep these areas wet or regularly churn the sand to discourage wasps from establishing their tunnels .\ncicada population densities are inconsistent, generally speaking, even during a normal, “on - schedule” emergence. many of the gaps in their populations are a result of destruction of their habitat by human activity .\nback at the burrow, she deposits the paralyzed cicada in a brood chamber. then she lays an egg and carefully tucks it beneath the cicada' s foreleg, beside the puncture wound from her sting. (the doomed creature looks, creepily, like a wizened old man with a baguette tucked under his arm .) the female then seals the chamber with dirt, the cicada still living and immobilized within it. a few days later the egg hatches and grub begins to eat the cicada alive, using the puncture wood as an entry point. later, the grub spins a cocoon, in which it metamorphoses into an adult wasp, emerging the following year. (footage of these behaviors has been kindly posted online by filmmaker sam orr, who is working on a documentary about the 17 - year cicadas. )\nthe high - pitched humming noise you hear in the video is the mating song of the male cicada. they make this noise by vibrating rib - cage like membranes called tymbals. the cicada’s empty abdomen serves as an echo chamber that amplifies the sound — and it can get pretty loud. cicadas have been known to produce humming as loud as 100 decibels, the equivalent of a power lawn mower or a motorcycle .\nlarge aggregations of cicada killers can build up over time. an estimated 40% of the developing larvae (a dozen or more per tunnel) may emerge as adults the following year so numbers can increase rapidly .\nwill cicada killers every go away? these wasps will stay and thrive where their basic needs are met. even if aggressive control measures kill the inhabitants, the site will remain attractive to new settlers in ensuing years .\nsueur, j. 2002. cicada acoustic communication: potential sound partitioning in a multispecies community from mexico (hemiptera: cicadomorpha: cicadidae). biological journal of the linnean society 75 (3): 379 - 394 .\ncicada killer wasps are often confused with european wasps (vespa crabro). european wasps are a more vibrant yellow color and feature more yellow than black. they also belong to an entirely different family of wasp: vespidae .\nannual: cicada species with annual life cycles emerge every year, for example, swamp cicadas (neotibicen tibicen) emerge every year in the united states, and green grocers (cyclochila australasiae) emerge every year in australia .\nmegatibicen figuratus aka the fall southeastern dusk - singing cicada. found in: al, ar, fl, ga, la, ms, nc, sc, tn, tx, va. season: july to fall .\nit’s tradition going back to the 1800s. legendary periodical cicada researcher c. l. marlatt called them stragglers back in 1898. the name has stuck around, regardless of whether the cicadas emerged before or after their brood .\nmegatibicen auletes aka the northern dusk singing cicada. this cicada can be found in these states: al, ar, ct, de, dc, fl, ga, il, in, ia, ks, ky, la, md, ma, mi, ms, mo, ne, nj, ny, nc, oh, ok, pa, sc, tn, tx, va, wv, wi. season: july to fall .\ni made this page for two reasons: 1) to point out insects and other animals that people commonly confuse with cicadas, and 2) list people, places and things named\ncicada\nthat clearly are not cicadas .\ntop, left to right: cicada egg, freshly hatched nymph, 2nd and 3rd instar nymphs. bottom, left to right: 4th instar nymph, teneral adult, adult. (photos by roy troutman and elias bonaros) .\nmaybe. just about every insect goes through a larval phase, and they pretty much all look alike to the novice. unlike beetle larvae, cicada larvae or nymphs are not long - bodied like grubs. long larvae = beetle larvae .\ncan cicada killer wasps be controlled? control may be desirable in situations where physical damage is occurring or the presence of the insects is causing significant distress. the wasps were controlled in a west virginia study by sprays of the pyrerthroid insecticides (cyfluthrin or cyhalothrin). applications were made directly into the burrows or only to the entrances where the wasps contacted the insecticides as they entered and left. broadcast sprays over the area where cicada killers were nesting were not effective in reducing their numbers .\nu. s. cicada expert john cooley points out on urltoken that because periodical cicadas emerge in such staggering numbers, there are enough cicadas to satisfy its predators, while also leaving plenty of insects to mate and continue to propagate the species .\ndescription: the lyric cicada, like most small neotibicen, has a green, black & brown camouflage look, but the key is lyric cicadas typically have black collars. its sound is like an angle grinder tool steadily grinding a slightly uneven surface .\nmy site gained fans because it was one of the first cicada websites on the web. i have always had an interest in nature, science and the outdoors, but cicadas really did not grab my attention until the brood ii emergence in 1996 .\nmales produce this species - specific noise with vibrating membranes on their abdomens. the sounds vary widely and some species are more musical than others. though cicada noises may sound alike to humans, the insects use different calls to express alarm or attract mates .\nwe humans, happily, have nothing to fear, although we' re very likely to encounter the insects. cicada killers live almost everywhere east of the rockies and south of ontario. moreover, like pigeons, coyotes, and white - tailed deer, they actually benefit from human activity and enjoy suburban living. the soft soil around home foundations, in gardens, and on golf courses and playgrounds is ideal for burrowing. some of the first research into cicada killer behavior was conducted beside two baseball fields in brooklyn .\nthe cicada killer, like other solitary wasps, has the capability to sting, but won' t unless handled or threatened. only female wasps have the ability to sting. stings inflicted by solitary wasps are usually not severe but reaction varies with each individual .\nthe cicada killer ranks most formidable in appearance of any wasp in the state. it is an exceptionally large species, with rusty clear wings and the black and yellow markings common of wasps. in addition to their size and coloration, their behavior identifies them .\nat least 3 different species of wasps construct nests in the ground in iowa. these\ndigger wasps\ninclude the cicada killer wasp, the largest wasp found in iowa. cicada killer wasps may be up to 2 inches long. they are black with yellow markings on the thorax and abdomen and they have rusty colored wings. the great golden digger wasp is slightly smaller. the abdomen is reddish - orange except at the tip which is black. a third species is 1 inch long and completely black with iridescent blue wings .\nfemale cicada killers dig extensive tunnels where their young will be raised, displacing several pounds of soil in the process. occasionally, it can result in some damage, such destabilizing a brick patio laid on sand. this is an instance when control may be needed .\nwhen young cicada nymphs hatch from their eggs, they dig themselves into the ground to suck the liquids of plant roots. they spend several early life stages in these underground burrows before surfacing as adults. the process varies in length but often takes a number of years .\ni love these things, so happy to get info on them. i had ones burrow blocked and she banged against my head a few times, with a cicada under her belly, when i moved she went into her nest. have seen no reason to kill them .\nwill cicada killers harm pets? some dogs and cats may catch cicada killers but usually only once. those that pick females probably will be stung, remember it, and associate the experience with the buzzing sound and warning colors. some may have a severe reaction to the venom, especially if stung in the mouth. if that is suspected, the animal should be taken to a veterinarian immediately. wasp flight begins in early morning and can continue until dusk. wasps remain in their burrows at night so encounters can be avoided by managing the activity of the pet .\ncicada imperatoria, westwood, arcan. ent. vol. i. p. 13, t. 51 (1842). dundubia imperatoria, walk. list hom. i. p. 47, n. 1 (1850). pomponia imperatoria, stål, berl. ent. zeit. x. p. 171 (1866); atkins. j. a. s. beng. vol. liii. p. 229, n. 67 (1885). cicada adusta, walk. list hom. i. p. 102, n. 1 (1850) .\ncicada killer wasps belong to the family crabronidae latreille, 1802; the tribe bembicini latreille, 1802 and the genus sphecius dahlbom, 1843 2. crabronidae comes from the latin word for hornet, bembicini comes from the greek word for buzzing insect, and sphecius is from the greek word for wasp .\nmild mannered female cicada killer wasps are active across kentucky during the summer, intent on their tasks of 1) digging underground burrows and 2) provisioning them with paralyzed cicadas that will be food for their grub - like larvae. the wasps will be very focused on these tasks for several weeks .\ncurrently, the cicada density around the d. c. area is very inconsistent. there are pockets of high concentrations in places such as springfield and herndon, while a few miles away in fairfax and oakton, there are few cicadas. is this common with an accelerated or out - of - cycle emergence ?\nnon - chemical a periodical cicada year is a time of feasting for a surprising array of creatures. birds and fish feed ravenously on the adult stage of these insects. grackles and crows voraciously dine on periodical cicadas. fish will literally gorge themselves on adult cicadas when they are abundant in trees and shrubs along a stream .\nare cicada killers dangerous? females have significant stingers which they plunge into cicadas to inject venom that paralyzes them. without doubt, their stings are painful. however, they are not aggressive and do not have nest - guarding instinct of honey bees and hornets. you can walk through areas where they are active without attracting attention .\ncicada killer females construct burrows that are small wonders of engineering and effort. several feet long, and featuring numerous individual brood chambers at their far end, they require the excavation of hundreds of times the insects' own weight in soil. the female killers manage the feat in just a few hours, using only their jaws and hind legs .\nt. canicularis has a green pronotal collar, green markings on its pronotum, and at least some, if not all, orange colors on its mesonotum (where the m is on the cicada’s back). t. canicularis sounds like (to me at least) a circular saw buzzing through a plank in wood in a neighbor’s garage .\nthe periodical cicada is a native north american species. it is the longest - lived insect in north america. no other insect in north america generates as much interest and curiosity as do periodical cicadas when they make their sudden, springtime emergence. they are widely distributed over the eastern half of the united states and occur nowhere else in the world .\ncicada imperatoria, westwood, arc. ent. ii, p. 14, t. 51, (1843): walker, list hom. b. m. i, p. 47: j. l. s. zool. i, p. 83 (1856): ibid, x, p. 84 (1867) .\nmid - august is approaching, and the “dog days” of summer are almost here. sirius (the dog star) and the constellation canis major will soon begin to appear in the early morning sky. now is also the time that tibicen canicularis, the dog day day cicada, is also making its presence known in the u. s. a .\nsome species of cicada killer wasps show a preference for female cicadas (s. hogardii), and some seem to prefer male cicadas (s. grandis), but it is not clear why. you might think that these wasps will take more males than females because of the loud sound the males cicadas make, but this is not the case 1 .\nperhaps it’s global warming or climate confusion. maybe it’s just really hard for a 17 - year cicada to count down the years while he’s buried underground. why this is happening is a total question mark, but a small fraction of the 17 - year cicadas — the ones we’re supposed to see in 2021 — are creeping out of their zombie caskets this week, four years early .\nthe cicada killer wasp and other digger wasps are solitary wasps; that is, they live independently rather than in colonies and do not depend on other members of a colony to share in the raising of young or the maintaining of a nest. other solitary wasps include the mud daubers and potter wasps. solitary wasps put paralyzed insects or spiders inside the nest as food for their offspring .\ncicada killer tunnels usually have a distinctive u - shaped collar of loose soil around the opening. individual tunnels are can range from 30 - to 70 - inches long and may run 12 - to 15 - inches below the surface. the first chamber is about a foot or so from the entrance. there are an average of 15 egg - shaped side chambers an a tunnel, each containing 1 to 3 paralyzed cicadas and an egg which hatches in 2 to 3 days. the grub - like wasp larva feeds for about 10 days, leaving only the cicada' s outer shell. during the fall, the larva spins a silken case, shrinks, and prepares to overwinter. development will be completed when wasps emerge next summer. there is one generation each year .\nthe invasion of periodical cicadas is over, but a second insect invasion looms. sphecius speciosus, the eastern cicada killers, have begun to emerge. and they make the national media hype over the cicadas look rather misplaced. hunting, warring, patrolling, tunneling, they do more in two months - - the length of their adult lives - - than periodical cicadas do in 17 years .\nbut don’t be afraid: cicada killers are not aggressive. in fact, they might even “appear to be curious, ” often flying up to and around you as though investigating your approach and intentions. unfortunately, this behavior sends many folks into a panic. interestingly, it’s the males who most often engage in this activity. but the males are, in fact, completely harmless: they lack stingers .\nevery new building, road or other construction destroys cicada habitat and divides the brood. their surprising numbers might make people think, “there are so many of them, how could they be endangered? ” but broods have gone extinct in the past (brood xi in connecticut in the 20th century) and have seemingly gone extinct (brood x in long island, n. y .) recently as well .\nas we humans replace more and more vegetation with concrete or shorter grasses, cicadas are finding it harder and harder to find a good place to molt. other issues that can interfere with a cicada’s ability to molt include: wind, rain, cold air, small predators like ants … if you’ve sprayed them with a pesticide that will kill them mid - molt as well (please don’t do that) .\ncicada killers often gather into leks – places where they congregate to breed and dig burrows to rear their young. all too often, as these insects increase in number, so do the incidents of human - wasp encounters. most extension agents, entomologists, pest - control companies and local museums, zoos and nature centers have come to expect a flurry of phone calls and emails from people as they stumble upon these insects .\na large and awesomely detailed cicada charm hangs from a\nmother and child\nstyle long / short aged brass chain with lobster clasp. insect charm is hollow backed and large - approximately 2 1 / 2 inches long on a 22 inch chain. perfect for the bug lover out there! (fyi i kept one of these for myself: d) comes gift boxed and ready to give. handmade in beautiful portland, or ♥\nbut unlike other wasp species that plague human summers, only the females of the cicada killers have stingers, and both their sting and their temperament are very mild. holliday has captured, tagged, clipped the wings of, and in other ways harassed thousands of them in the course of his research .\ni' ve done abominable things to these animals, and i' ve never had one try to sting me ,\nhe says. instead, when threatened, they fly away or, if trapped in a burrow, frantically beat their wings against its walls, producing a loud rattlesnake - like whir. male cicada killers are entirely stingless, and though they do tend to brusquely approach anything that moves inside their territory, including people, they' re simply on the lookout for rivals and potential mates. since humans are neither, they quickly break off their\nattacks .\nit goes back to the 1800s — by c. l. marlatt in his 1898 bulletin “an account of cicada septendecim, its natural enemies and the means of preventing its injury. ” straggling is nothing new — they’ve likely always straggled to some degree, as a way to ease high - density populations, or as a way to expand their population and territory, and perhaps as a hedge against disastrous natural events (great floods, storms) .\ncicadas belong to the order hemiptera, suborder auchenorrhyncha, superfamily cicadoidea and families cicadidae (the vast majority of cicadas) or tettigarctidae (only two species). leafhoppers, spittle bugs and jumping plant lice are close relatives of the cicada. hemiptera are different from other insects in that both the nymph and adult forms have a beak (aka rostrum), which they use to suck fluids called xylem from plants. this is how they both eat and drink .\ncicada imperatoria, w. luteo - fulva, capite et thoracis dorso maculis numerosis (magnitudine et formâ variis) nigris, mesothoraceque figurâ trifidâ notatis: pronoti lateribus in medio emarginatis; abdomine brunneo lateribus pallidioribus, maculâ in singulo segmento utrinque nigrâ; alis flavido - hyalinis venis fulvis; anticarum venis transversis subapicalibus fusco nebulosis, maculisque septem versus marginem fuscis. long. corp. unc. 3 1 / 8. expans. alar. unc. 8 1 / 4 .\nneotibicen pruinosus pruinosus aka scissor (s) grinder. found in al, ar, co, il, in, ia, ks, ky, la, mi, mn, ms, mo, ne, oh, ok, sc, sd, tn, tx, va, wv, wi. season: june – september. neotibicen pruinosus fulvus aka pale scissor (s) grinder cicada. found in: ks, ok. season: june – september .\nnot harmful to humans. only the females possess stingers, and they reserve these for use in subduing prey (cicadas). it is possible that a female cicada killer could sting a person, but only if it is handled roughly. persons allergic to wasp stings should stay away from all wasps. males can look threatening as they jealously patrol their territories, chasing away other males and even other kinds of insects that flutter into the area. but they lack stings and are harmless .\nyoung cicadas, or nymphs, usually live six to 18 inches underground, sucking sap from tree roots and growing to about 1. 5 inches. as they approach 17 years of age, the nymphs dig a tunnel to the surface with their front legs, creating a small mound of mud — a cicada hut — where they will exit. when ground temperatures reach 64 degrees, nymphs emerge from their tunnels and climb onto nearby trees, where they shed their skins, or molt .\nnest tunnels are dug in open areas such as lawns and pastures, usually in aggregations. loose, workable soils are preferred. a mound of excavated soil at the tunnel entrance is often conspicuous. these mounds often have a shallow furrow leading to the tunnel entrance, as if made by dragging a thumb. female cicada killers may live a month and produce tunnels four or more feet long in a single nest. although nests are not particularly deep, nine or ten cells per nest is not unusual .\nfemale cicada killer wasps capture annual cicadas in july and august and place them in cells located at the ends of tunnels they have dug in the ground. each tunnel is about the size of a quarter and extends 24 inches or more into the ground. one or two paralyzed cicadas are placed in each cell, and a single egg deposited before the cell is closed by the female, who flies away, never to return. the wasp grubs feed on the cicadas and develop into wasps that emerge the following summer .\nthe largest is the chorus cicada (amphipsalta zelandica), with a wingspan of 80 millimetres, and the smallest are species of maoricicada, with a wingspan of around 29 millimetres and a body length of 14 millimetres. the most closely related species are found in australia, norfolk island and new caledonia. studies show that the new zealand fauna came about from several invasions across the tasman sea from australia and perhaps new caledonia. they arrived within the last 11 million years, well after new zealand became isolated after separating from australia .\nafter that they hunt, for the so - called dog - day cicadas of genus tibicen. a killer paralyzes a cicada with a single sting, but getting it back to the burrow can be an all - day affair. it may be three times the killer' s own weight - - too heavy to properly fly with. instead she drags it up the nearest tree, then launches herself, prey in claw, and glides as far as possible toward her burrow. she may have to repeat the process half a dozen times." ]
{ "text": [ "the giant cicada ( quesada gigas ) , also known as the chichara grande , coyoyo , or coyuyo , is a species of large cicada native to north , central , and south america .", "one of two species in the genus quesada , it is the widest ranging cicada in the western hemisphere . " ], "topic": [ 27, 26 ] }
"the giant cicada (quesada gigas), also known as the chichara grande, coyoyo, or coyuyo, is a species of large cicada native to north, central, and south america. one of two species in the genus quesada, it is the widest ranging cicada in the western hemisphere."
[ "the giant cicada (quesada gigas), also known as the chichara grande, coyoyo, or coyuyo, is a species of large cicada native to north, central, and south america. one of two species in the genus quesada, it is the widest ranging cicada in the western hemisphere." ]
"animal-train-32"
"animal-train-32"
"2683"
"barbodes cataractae"
[ "barbodes is a genus of small to medium - sized cyprinid fish native to tropical asia. the majority of the species are from southeast asia. many species are threatened and some from the philippines are already extinct. several members of this genus were formerly included in puntius instead .\nhtml public\n- / / w3c / / dtd xhtml 1. 0 strict / / en\nurltoken\nthank you for taking the time to provide feedback on the iucn red list of threatened species website, we are grateful for your input .\ngland, switzerland, 5 july 2018 (iucn) – australia’s unique reptiles – including lizards and snakes – face severe threats from invasive species and climate change, with 7% of th ...\nthe value of medicinal and aromatic plant trade has increased three - fold in the past 20 years, but traditional harvesting practices are being replaced by less sustainable alternatives... .\na recently released iucn technical brief recommends increasing investments in sustainable land management practices, as well as better cooperation between agriculturalists and conservationists to conse ...\neschmeyer, w. n. (ed .). 2015. catalog of fishes. updated 7 january 2015. available at: urltoken. (accessed: 7 january 2015) .\noccurs in lake lanao. mindanao, misamis occident province, mucielagos bay, cascade river (e. capuli pers comm 1996 )\nto make use of this information, please check the < terms of use > .\nlatin, barbus = barbel + greek, oides = similar to (ref. 45335 )\nasia: cascade river, murcielagos bay, misamis occidental province, mindanao island, philippines .\nkottelat, m. , 2013. the fishes of the inland waters of southeast asia: a catalogue and core bibliography of the fishes known to occur in freshwaters, mangroves and estuaries. the raffles bulletin of zoology 2013 (suppl. 27): 1 - 663. (ref. 94476 )\nphylogenetic diversity index (ref. 82805): pd 50 = 0. 5000 [ uniqueness, from 0. 5 = low to 2. 0 = high ] .\nbayesian length - weight: a = 0. 00977 (0. 00375 - 0. 02544), b = 2. 98 (2. 75 - 3. 21), in cm total length, based on lwr estimates for this (sub) family - body shape (ref. 93245) .\ntrophic level (ref. 69278): 2. 8 ±0. 3 se; based on size and trophs of closest relatives\nresilience (ref. 69278): high, minimum population doubling time less than 15 months (preliminary k or fecundity .) .\nvulnerability (ref. 59153): low to moderate vulnerability (30 of 100) .\nhtml public\n- / / w3c / / dtd xhtml 1. 1 / / en\nurltoken\ndescribed from specimens collected from cascade river, murcielagos bay, misamis occidental, mindanao (ref. 280). reported from lake lanao 1986 survey (ref. 13446). also ref. 6376 .\npd 50 = 0. 5000 many relatives (e. g. carps) 0. 5 - 2. 0 few relatives (e. g. lungfishes )\nhigh, minimum population doubling time less than 15 months (preliminary k or fecundity. )\nour website has detected that you are using an outdated insecure browser that will prevent you from using the site. we suggest you upgrade to a modern browser .\nchinese academy of fishery sciences (2003) chinese aquatic germplasm resources database. : urltoken\nfroese, r. & d. pauly (editors). (2018). fishbase. world wide web electronic publication .\nhanel, l. and j. novák (2002) české názvy zivočichů v. ryby a ryboviti obratlovci (pisces) 3. , maloústí (gonorhynchiformes) - máloostní (cypriniformes). : národní muzeum (zoologické oddělení), praha .\nkottelat, m. (2013) the fishes of the inland waters of southeast asia: a catalogue and core bibliography of the fishes known to occur in freshwaters, mangroves and estuaries. : the raffles bulletin of zoology 2013 (suppl. 27): 1 - 663 .\nwu, h. l. , k. - t. shao and c. f. lai (eds .) (1999) latin - chinese dictionary of fishes names. : the sueichan press, taiwan. 1028 p .\noccurs in fast flowing streams and rivers with rocky bottom (ref. 41236) .\neol content is automatically assembled from many different content providers. as a result, from time to time you may find pages on eol that are confusing .\nto request an improvement, please leave a comment on the page. thank you !\neschmeyer, w. n. ; fricke, r. ; van der laan, r. (eds). (2017). catalog of fishes: genera, species, references. electronic version. , available online at urltoken [ details ]\npopular: trivia, history, america, cities, world, usa, states, television, ... more\nhtml public\n- / / w3c / / dtd xhtml 1. 0 transitional / / en\nurltoken\n0 - 0 of 0 records matching your criteria. plants / animals: 0 | systems: 0 | associations: 0 | alliances: 0\nthe small print: trademark, copyright, citation guidelines, restrictions on use, and information disclaimer .\nnote: all species and ecological community data presented in natureserve explorer at urltoken were updated to be current with natureserve' s central databases as of november 2016. note: this report was printed on\ntrademark notice :\nnatureserve\n, natureserve explorer, the natureserve logo, and all other names of natureserve programs referenced herein are trademarks of natureserve. any other product or company names mentioned herein are the trademarks of their respective owners .\ncopyright notice: copyright © 2017 natureserve, 4600 n. fairfax dr. , 7th floor, arlington virginia 22203, u. s. a. all rights reserved. each document delivered from this server or web site may contain other proprietary notices and copyright information relating to that document. the following citation should be used in any published materials which reference the web site .\nnatureserve. 2017. natureserve explorer: an online encyclopedia of life [ web application ]. version 7. 1. natureserve, arlington, virginia. available http: / / explorer. natureserve. org. (accessed :\nridgely, r. s. , t. f. allnutt, t. brooks, d. k. mcnicol, d. w. mehlman, b. e. young, and j. r. zook. 2003. digital distribution maps of the birds of the western hemisphere, version 1. 0. natureserve, arlington, virginia, usa .\ndata provided by natureserve in collaboration with robert ridgely, james zook, the nature conservancy - migratory bird program, conservation international - cabs, world wildlife fund - us, and environment canada - wildspace .\npatterson, b. d. , g. ceballos, w. sechrest, m. f. tognelli, t. brooks, l. luna, p. ortega, i. salazar, and b. e. young. 2003. digital distribution maps of the mammals of the western hemisphere, version 1. 0. natureserve, arlington, virginia, usa .\ndata provided by natureserve in collaboration with bruce patterson, wes sechrest, marcelo tognelli, gerardo ceballos, the nature conservancy - migratory bird program, conservation international - cabs, world wildlife fund - us, and environment canada - wildspace .\niucn, conservation international, and natureserve. 2004. global amphibian assessment. iucn, conservation international, and natureserve, washington, dc and arlington, virginia, usa .\ndata developed as part of the global amphibian assessment and provided by iucn - world conserv