--- license: apache-2.0 tags: - pretrained - mistral - DNA --- # Model Card for Mistral-DNA-v1-1.6B-hg38 (Mistral for DNA) The Mistral-DNA-v1-1.6B-hg38 Large Language Model (LLM) is a pretrained generative DNA sequence model with 1.6B parameters. It is derived from Mixtral-8x7B-v0.1 model, which was simplified for DNA: the number of layers and the hidden size were reduced. The model was pretrained using 10kb DNA sequences from the hg38 human genome assembly. ## Model Architecture Like Mixtral-8x7B-v0.1, it is a transformer model, with the following architecture choices: - Grouped-Query Attention - Sliding-Window Attention - Byte-fallback BPE tokenizer - Mixture of Experts ## Load the model from huggingface: ``` import torch from transformers import AutoTokenizer, AutoModel tokenizer = AutoTokenizer.from_pretrained("RaphaelMourad/Mistral-DNA-v1-1.6B-hg38", trust_remote_code=True) model = AutoModel.from_pretrained("RaphaelMourad/Mistral-DNA-v1-1.6B-hg38", trust_remote_code=True) ``` ## Calculate the embedding of a protein sequence ``` insulin = "TGATGATTGGCGCGGCTAGGATCGGCT" inputs = tokenizer(insulin, return_tensors = 'pt')["input_ids"] hidden_states = model(inputs)[0] # [1, sequence_length, 256] # embedding with max pooling embedding_max = torch.max(hidden_states[0], dim=0)[0] print(embedding_max.shape) # expect to be 256 ``` ## Troubleshooting Ensure you are utilizing a stable version of Transformers, 4.34.0 or newer. ## Notice Mistral-DNA-v1-1.6B-hg38 is a pretrained base model for DNA. ## Contact Raphaƫl Mourad. raphael.mourad@univ-tlse3.fr