diff --git "a/merges.txt" "b/merges.txt"
new file mode 100644--- /dev/null
+++ "b/merges.txt"
@@ -0,0 +1,33960 @@
+#version: 0.2
+Ġ t
+i n
+Ġ a
+r e
+Ġt h
+o n
+Ġth e
+Ġ s
+t i
+Ġ o
+e n
+a l
+e r
+Ġ c
+e d
+Ġ p
+Ġ w
+Ġ in
+e s
+Ġa n
+Ġo f
+Ġ f
+Ġ d
+Ġ m
+a t
+o r
+t h
+a n
+Ġan d
+Ġ b
+i s
+ti on
+a s
+en t
+i c
+in g
+r o
+a r
+Ġ re
+Ġt o
+Ġ h
+l e
+Ġ e
+i t
+u s
+a tion
+Ġs t
+e re
+u l
+a c
+v e
+e c
+Ġ l
+o m
+Ġ n
+i m
+Ġ g
+l y
+u r
+i g
+Ġw i
+Ġwi th
+u d
+e t
+o s
+c e
+Ġw as
+i f
+Ġf or
+o l
+Ġa s
+i l
+Ġc on
+o d
+i d
+o w
+Ġ on
+m ent
+a ti
+Ġw ere
+t s
+Ġo r
+a b
+u n
+Ġst ud
+a m
+ti c
+Ġ v
+re s
+e l
+t er
+u p
+Ġa l
+t ed
+Ġp er
+Ġ r
+Ġw h
+Ġe x
+g e
+Ġp ro
+Ġre s
+Ġb e
+i on
+at ed
+u c
+Ġth at
+Ġc om
+t r
+o t
+Ġ im
+Ġ is
+an t
+it y
+a d
+u t
+es s
+i r
+v er
+Ġ us
+ic al
+o c
+q u
+i z
+Ġc h
+i es
+at e
+Ġd e
+o re
+Ġstud y
+a in
+ig h
+Ġin c
+ig n
+u m
+p l
+Ġg ro
+Ġm e
+ab le
+Ġb y
+u re
+ent s
+Ġa t
+Ġp re
+Ġa c
+y s
+Ġcom p
+Ġgro up
+if ic
+i v
+o g
+i b
+Ġd is
+Ġs e
+i al
+Ġs h
+f ere
+a p
+Ġth is
+Ġd if
+o th
+a re
+Ġa d
+fere n
+Ġp ati
+Ġd ent
+Ġb et
+Ġh e
+Ġs ign
+Ġas s
+Ġc l
+ro m
+re at
+an d
+Ġa re
+Ġt w
+f f
+Ġm a
+o p
+p or
+Ġdif feren
+od on
+w e
+e m
+er s
+Ġs c
+en ce
+Ġtw o
+Ġbet we
+Ġbetwe en
+Ġsign ific
+Ġper i
+Ġor al
+a ge
+Ġf rom
+Ġa p
+i p
+Ġdent al
+Ġ it
+Ġsignific ant
+un d
+Ġc o
+iz e
+th er
+Ġin d
+i a
+Ġpati ents
+Ġ le
+Ġs ur
+ation s
+d ing
+or m
+Ġhe al
+o us
+Ġon e
+Ġs ize
+Ġt able
+u b
+t al
+Ġn ot
+Ġt reat
+ar y
+es t
+Ġh igh
+ti ve
+ac t
+p ec
+s e
+re e
+Ġc an
+Ġp ar
+Ġtreat ment
+Ġheal th
+in e
+Ġres ul
+Ġp os
+v al
+v i
+i tion
+s t
+Ġf o
+e e
+Ġin f
+an ce
+ve l
+ul l
+p er
+Ġh a
+ic h
+Ġsh ow
+en ti
+Ġan al
+re n
+Ġcon t
+ar i
+ff ec
+Ġp res
+Ġp l
+Ġstud ies
+u e
+el l
+Ġal l
+s ion
+on g
+Ġperi odon
+Ġf ull
+as e
+c h
+en d
+Ġwh ich
+u g
+il l
+Ġ ro
+Ġt r
+e ar
+Ġm ore
+Ġm od
+al ly
+ac h
+Ġcon s
+Ġre g
+c l
+Ġo b
+Ġac c
+Ġth an
+ati ve
+g es
+Ġn o
+Ġth ree
+Ġanal ys
+Ġha ve
+ul d
+Ġs am
+Ġus ed
+oc i
+Ġre c
+Ġinc l
+or s
+Ġus ing
+Ġre l
+Ġn e
+Ġp r
+Ġc ar
+Ġto oth
+i ve
+ee th
+Ġt eeth
+Ġresul ts
+as ed
+Ġa b
+Ġcl in
+Ġa f
+igh t
+Ġre por
+c es
+d uc
+f ac
+Ġs ub
+Ġin ter
+Ġaf ter
+Ġthe re
+Ġd at
+Ġ qu
+Ġ un
+Ġe ffec
+l ow
+f orm
+v ed
+Ġin t
+a y
+Ġl ow
+is t
+Ġ y
+Ġa m
+en s
+at er
+i ed
+on e
+ar d
+Ġme as
+Ġv ari
+Ġincl ud
+v en
+ul ar
+Ġass oci
+Ġ k
+Ġanalys is
+p le
+il d
+Ġv al
+i ti
+ol og
+Ġgroup s
+Ġw e
+an s
+as t
+Ġle vel
+ati s
+r ap
+p ro
+Ġclin ical
+s o
+Ġd et
+Ġpres ent
+le c
+os t
+Ġdat a
+are d
+i re
+Ġ en
+Ġh ad
+d ition
+Ġal so
+Ġo ther
+il ity
+Ġf ol
+Ġf act
+Ġinc re
+Ġrepor ted
+t ing
+ro l
+Ġg en
+y p
+Ġpar tic
+Ġthe ir
+u al
+Ġma y
+Ġp o
+Ġfol low
+om e
+Ġa ge
+Ġch ild
+Ġass ess
+Ġt im
+Ġper form
+p h
+Ġd ur
+tion s
+Ġo ut
+ug h
+e w
+Ġs uc
+Ġcar ies
+us ion
+as s
+Ġmod el
+g n
+Ġsur fac
+Ġs pec
+er m
+Ġf in
+atis tic
+Ġst atistic
+ol ar
+Ġ up
+on d
+id e
+os e
+Ġc or
+Ġmeas ure
+f t
+Ġme th
+ment s
+s tr
+al l
+Ġd es
+an ts
+Ġhigh er
+s er
+ac ter
+Ġdifferen t
+Ġe ach
+Ġbe en
+Ġthe se
+Ġh ow
+Ġh as
+Ġs o
+Ġcomp ared
+i x
+Ġcont rol
+Ġa r
+o ut
+am in
+u res
+Ġt est
+Ġim age
+Ġr is
+i le
+Ġin v
+Ġm ed
+Ġma x
+rap h
+Ġshow ed
+Ġperiodon tal
+val u
+en c
+Ġp h
+Ġmeth od
+Ġe valu
+Ġris k
+Ġo ver
+as es
+Ġn um
+k e
+Ġfo und
+m o
+p res
+Ġb i
+Ġc ell
+c t
+Ġm o
+Ġpartic ip
+ti s
+Ġc ol
+b er
+e ver
+a us
+u es
+is s
+og raph
+l u
+Ġhow ever
+Ġd enti
+Ġsignificant ly
+Ġtim e
+Ġd ec
+ere d
+Ġb oth
+Ġchild ren
+Ġob ser
+Ġo ur
+Ġc r
+or y
+Ġs ec
+j ec
+Ġro ot
+Ġa g
+ad i
+Ġc al
+ec h
+Ġwh o
+Ġb one
+vi ous
+at ing
+Ġfo ur
+t em
+iz ed
+Ġb ased
+i or
+Ġwh en
+it e
+f ore
+Ġacc or
+Ġperiodon ti
+Ġst r
+e x
+c c
+Ġdur ing
+Ġind ic
+o uld
+Ġ 1
+ul ation
+v id
+Ġch an
+Ġam ong
+Ġpro c
+Ġm ost
+Ġdis e
+l es
+Ġsuc h
+t ain
+Ġpre vious
+ic ro
+at es
+Ġim pl
+Ġs im
+Ġb r
+ys tem
+Ġlow er
+Ġs ystem
+Ġperiodonti tis
+Ġ und
+Ġon ly
+Ġsurfac e
+e p
+gn os
+Ġnum ber
+Ġus e
+Ġme an
+es ti
+Ġd ia
+Ġco uld
+Ġex amin
+ib le
+odon tic
+Ġdifferen ces
+a g
+Ġf ir
+Ġm an
+ac k
+Ġ 2
+at h
+Ġmax ill
+Ġdifferen ce
+a il
+Ġcomp ar
+Ġn on
+r ic
+ab ility
+n ess
+it er
+Ġsur g
+p os
+ing iv
+Ġdis c
+Ġaccor ding
+Ġs up
+Ġgen er
+Ġfir st
+Ġap pl
+Ġcl ass
+a ges
+Ġex per
+Ġor th
+Ġassoci ated
+p t
+Ġinclud ed
+Ġr adi
+Ġde f
+Ġad dition
+Ġs p
+ul t
+Ġdia gnos
+Ġ j
+Ġb ut
+Ġ ed
+Ġperform ed
+Ġf ur
+Ġsam ple
+tr ib
+Ġc are
+is tic
+k ing
+Ġval ues
+Ġm icro
+v ity
+Ġcom m
+Ġde m
+l ed
+Ġm ater
+Ġcons id
+o un
+Ġm in
+c r
+Ġt yp
+Ġres p
+u tion
+Ġparticip ants
+t e
+ion s
+Ġint o
+Ġfact ors
+ain ing
+Ġd ue
+Ġh y
+Ġy ear
+Ġfur ther
+Ġqu es
+Ġg ingiv
+por t
+Ġsub jec
+Ġf ive
+Ġex tr
+d s
+n a
+Ġeffec t
+en e
+Ġap pro
+Ġm and
+Ġp op
+Ġpati ent
+Ġpre val
+Ġmater ial
+Ġcal c
+Ġpro b
+Ġch ar
+Ġb ec
+Ġt iss
+Ġth ose
+Ġ i
+iv id
+Ġm al
+qu e
+Ġtr ans
+Ġobser ved
+t en
+Ġfor m
+vel op
+g th
+cl usion
+olog ical
+Ġm olar
+Ġout c
+Ġo p
+c ent
+Ġd i
+in ed
+u th
+ic i
+Ġc ur
+Ġw ell
+Ġde velop
+Ġfin ding
+ac e
+Ġg r
+Ġwh ile
+n ow
+on s
+a k
+Ġl es
+f ic
+aus e
+ac tion
+is h
+Ġde p
+i tive
+Ġcor re
+Ġl i
+er y
+Ġre duc
+Ġthe y
+enc y
+Ġs al
+Ġund er
+Ġchar acter
+Ġl im
+d er
+o ugh
+tion al
+Ġim p
+Ġpreval ence
+m s
+t or
+Ġpos t
+Ġc ro
+Ġlim it
+Ġimpl ant
+Ġorth odontic
+al ity
+Ġcon f
+in t
+res s
+Ġlevel s
+Ġpr im
+Ġdet ec
+Ġ 3
+Ġk now
+c er
+Ġcell s
+Ġp ain
+il ar
+Ġs er
+Ġrel ated
+Ġst at
+Ġdise ase
+Ġsim ilar
+Ġm et
+Ġv is
+Ġm on
+Ġb l
+Ġe m
+ul ti
+iz ation
+Ġf re
+Ġmaxill ary
+Ġstat us
+Ġcomp le
+Ġs in
+re ated
+Ġcan al
+Ġstatistic ally
+Ġo l
+Ġbec ause
+Ġin tr
+it s
+am m
+Ġne ed
+ab les
+Ġpop ulation
+Ġ 0
+ver s
+b r
+o od
+ac y
+Ġsc ore
+Ġfre qu
+Ġst and
+Ġ z
+ib ular
+Ġto tal
+Ġs ix
+at ure
+Ġe t
+at ory
+ter ior
+it al
+Ġw or
+Ġwh ere
+Ġsal iv
+Ġ er
+Ġassoci ation
+Ġm ain
+Ġsec ond
+Ġcon dition
+Ġinv esti
+Ġinvesti g
+s s
+am et
+Ġf ig
+ati c
+Ġques tion
+Ġl ess
+Ġsh ould
+l l
+Ġso ft
+Ġincre ased
+ti m
+Ġpl an
+o res
+Ġmethod s
+Ġd r
+Ġ end
+i an
+Ġinf orm
+Ġtiss ue
+Ġit s
+Ġradi ograph
+i um
+Ġc a
+Ġcharacter istic
+ear ch
+Ġres earch
+Ġs ug
+y m
+pec tive
+Ġinf l
+Ġc e
+Ġfinding s
+Ġstand ard
+Ġr an
+ech n
+Ġeffec ts
+Ġvari ables
+Ġinclud ing
+Ġind ivid
+olog y
+un c
+Ġl oc
+os s
+Ġfollow ing
+ar g
+us h
+Ġdet erm
+Ġt echn
+Ġsubjec ts
+ti t
+Ġchan ges
+Ġd id
+Ġa ffec
+Ġe l
+Ġob tain
+Ġm ulti
+res sion
+f er
+h ip
+Ġse lec
+Ġre m
+ul ated
+i e
+Ġthere fore
+Ġtyp e
+Ġwith out
+Ġinfl amm
+v ic
+Ġsam pl
+Ġs ome
+Ġim pro
+Ġshow n
+g r
+Ġf r
+Ġab out
+Ġcr iter
+Ġc ent
+v ing
+Ġindivid ual
+Ġsam e
+Ġare a
+Ġim port
+Ġse ver
+or d
+Ġperi od
+pres sion
+or t
+ent ly
+vi ew
+Ġproc ed
+o ur
+Ġs et
+Ġpos s
+Ġl ong
+Ġpr ac
+Ġmand ibular
+Ġpos itive
+Ġpre d
+Ġcharacteristic s
+Ġinc is
+p tion
+Ġre mo
+Ġprim ary
+Ġan y
+ar k
+Ġed uc
+Ġad j
+Ġind ex
+Ġassess ment
+Ġdes cr
+am ic
+Ġcorre l
+Ġt erm
+Ġc le
+Ġcriter ia
+Ġcompar is
+n ing
+Ġco un
+Ġinf lu
+Ġb as
+Ġg reat
+Ġc ases
+o b
+p ar
+Ġac ti
+Ġ id
+Ġex pl
+Ġgener al
+Ġles ions
+Ġacc ur
+Ġstatistic al
+in es
+Ġm uc
+Ġexper i
+im en
+Ġf lu
+h a
+Ġmed ical
+Ġdis trib
+Ġs m
+Ġim ages
+ate g
+Ġo cc
+tic al
+uc t
+Ġgingiv al
+Ġin s
+ar t
+Ġres tor
+Ġdes ign
+led ge
+Ġcon duc
+Ġap p
+iv ed
+Ġconsid ered
+Ġsurg ical
+Ġpar amet
+Ġbe fore
+Ġim m
+ren t
+ation al
+Ġknow ledge
+Ġincre ase
+Ġe ar
+g i
+Ġ ir
+Ġsc h
+Ġd o
+Ġsc al
+Ġi i
+Ġin str
+w are
+Ġl ine
+Ġthe n
+th ough
+e tic
+Ġt es
+Ġid enti
+Ġproc ess
+Ġo c
+Ġal though
+ad e
+on str
+Ġc b
+an c
+Ġb acter
+ter n
+Ġs mo
+Ġl oss
+Ġinf ec
+Ġpl a
+Ġquestion na
+Ġc y
+Ġre ce
+enti al
+Ġne g
+Ġdisc us
+Ġli ke
+Ġt reated
+om es
+Ġsc ores
+Ġqu ality
+w n
+Ġrel ations
+Ġinform ation
+ar ding
+el f
+iti es
+Ġobtain ed
+Ġs it
+ain ed
+Ġmeasure ments
+Ġpro t
+Ġrelations hip
+Ġdec re
+ech an
+Ġre view
+ur al
+Ġwith in
+Ġbe ha
+Ġun i
+Ġsampl es
+Ġreg arding
+Ġpro vid
+Ġm ight
+Ġbeha vi
+Ġre qu
+Ġr and
+Ġcb ct
+i ly
+Ġrand om
+ff ici
+st e
+ve ment
+ic ation
+Ġr ate
+are n
+Ġw ould
+Ġmo uth
+Ġg l
+if ied
+Ġmeasure d
+in al
+Ġp ot
+Ġpred ic
+Ġf ill
+Ġtechn i
+h es
+re d
+Ġp ath
+r ation
+Ġcur rent
+Ġcomm on
+Ġth ro
+Ġo per
+Ġspec ific
+Ġ if
+Ġexamin ation
+Ġmaterial s
+y n
+Ġp ub
+Ġan ti
+Ġc er
+Ġfor ce
+ire d
+Ġassess ed
+Ġdis t
+Ġup per
+Ġuni vers
+Ġpres ence
+cl ud
+Ġo s
+Ġthro ugh
+Ġd ire
+ess ion
+ate ly
+Ġconduc ted
+Ġstud ents
+Ġfact or
+Ġre pres
+Ġmodel s
+Ġneg ative
+Ġocc ur
+Ġp e
+ific ation
+ren gth
+Ġimport ant
+Ġpos ition
+Ġstr uct
+us t
+Ġa v
+Ġst rength
+am el
+Ġcol lec
+Ġpla que
+v ere
+Ġg end
+Ġsurg ery
+o f
+Ġm echan
+oth er
+i th
+er ative
+Ġf ac
+Ġposs ible
+Ġgreat er
+Ġp al
+Ġreg ression
+al ed
+Ġth us
+o ol
+Ġs elf
+a w
+y l
+Ġth ir
+Ġevalu ated
+Ġyear s
+Ġf em
+om et
+Ġidenti f
+Ġh ist
+i o
+Ġre ve
+0 0
+ti l
+Ġp aren
+Ġen amel
+Ġe th
+om en
+ven tion
+Ġoutc omes
+Ġt m
+Ġl o
+Ġcan cer
+Ġevalu ation
+Ġg u
+Ġval ue
+Ġcomparis on
+Ġst age
+Ġresul t
+Ġ es
+Ġf l
+ic k
+Ġdiscus sion
+Ġf unc
+Ġar ch
+o ver
+Ġper cent
+Ġmon th
+imen sion
+Ġcondition s
+Ġdistrib ution
+Ġn ec
+Ġpub l
+f ul
+oc k
+ti es
+Ġst ress
+Ġfem al
+Ġparamet ers
+Ġdem onstr
+Ġo ste
+Ġat t
+Ġsin ce
+Ġin iti
+Ġd imension
+Ġdevelop ment
+oun t
+it ed
+Ġover all
+Ġf ail
+Ġc aus
+Ġpro f
+o x
+Ġbr ush
+Ġintr a
+Ġextr action
+s ts
+Ġp ul
+Ġv i
+ater al
+Ġquestionna ire
+Ġd a
+Ġe vid
+Ġres pective
+Ġdef ec
+Ġeduc ation
+Ġs l
+er al
+Ġcomp os
+Ġoutc ome
+Ġappl ied
+Ġan g
+Ġse vere
+Ġdiagnos is
+Ġsch ool
+Ġma j
+Ġpresent ed
+im al
+Ġh yp
+Ġle ad
+Ġmolar s
+Ġdescr ib
+Ġpo int
+Ġgend er
+en gth
+Ġperform ance
+Ġmaj or
+c ess
+Ġc ateg
+id ence
+ic s
+Ġcom b
+Ġc ase
+Ġf e
+ment ation
+cl us
+Ġsurfac es
+Ġaccur acy
+Ġv er
+Ġgro w
+Ġex pos
+h ib
+ent al
+Ġper ce
+Ġs ens
+Ġw omen
+Ġm at
+ver age
+Ġdenti sts
+an e
+Ġconsid er
+Ġhy gi
+as tic
+Ġv it
+el ine
+Ġcalc ulated
+Ġsm all
+og en
+r i
+t a
+is e
+Ġanal y
+in ts
+on ding
+iti s
+Ġreve aled
+Ġ 5
+et y
+Ġv ol
+Ġph ys
+o id
+u ted
+Ġe p
+Ġdise ases
+u ally
+Ġs ol
+Ġcon clusion
+a v
+on ic
+Ġan terior
+Ġad hes
+ix ed
+Ġcorrel ation
+Ġthir d
+Ġp s
+n e
+Ġcons ist
+v ant
+Ġh ard
+Ġad ul
+Ġs oci
+Ġpro duc
+Ġinv ol
+Ġre d
+Ġex pression
+Ġrepres ent
+end ent
+Ġcon tr
+Ġit em
+Ġexper im
+Ġpot ential
+Ġw ater
+Ġcon cent
+Ġear ly
+is ed
+oc ol
+Ġme m
+Ġsur ve
+Ġab s
+Ġfrequ ency
+k ed
+Ġn orm
+op erative
+se qu
+c on
+Ġpar t
+Ġchan ge
+ish ed
+Ġinflu ence
+Ġunivers ity
+clud ed
+o und
+Ġthe rap
+Ġbas eline
+Ġprot ocol
+is ion
+Ġne w
+Ġinstr u
+Ġhygi ene
+in s
+Ġl iter
+Ġsaliv ary
+m an
+es is
+r al
+om ic
+feren ce
+Ġh and
+il m
+Ġprob le
+Ġindividual s
+Ġflu or
+k s
+v es
+in ation
+ain s
+Ġsever al
+Ġs ing
+Ġm or
+et s
+ce pt
+s c
+Ġval id
+Ġcom pl
+Ġbet ter
+Ġhealth y
+ograph ic
+Ġpul p
+Ġre as
+Ġanaly z
+u ce
+is m
+Ġl ength
+Ġbi as
+Ġexperi ence
+Ġevid ence
+clus al
+Ġsing le
+en ing
+Ġselec ted
+Ġc ap
+Ġth ick
+at al
+Ġr ati
+Ġle ast
+Ġrec ord
+Ġimp act
+c al
+g ro
+Ġpro v
+Ġmod er
+Ġoc clusal
+Ġap ical
+Ġreduc tion
+Ġal ign
+w ard
+at or
+Ġbe ing
+Ġy oun
+Ġyoun g
+Ġcro ss
+Ġdur ation
+ed ing
+Ġac id
+ial ly
+Ġd ay
+Ġre f
+Ġh os
+esti m
+Ġgrow th
+c o
+Ġce ph
+ffici ent
+Ġrespective ly
+Ġadul ts
+Ġreg ion
+Ġ estim
+im um
+Ġproced ures
+Ġlo ad
+Ġre le
+Ġh um
+Ġd m
+Ġinflamm atory
+m ore
+Ġdi ab
+omet ric
+Ġs oc
+Ġm id
+Ġdif fic
+h ol
+Ġeffec tive
+ir m
+ew ing
+p ital
+Ġse x
+ve olar
+Ġper s
+Ġsc an
+Ġshow s
+Ġpo or
+Ġhos pital
+Ġtr ial
+Ġbi of
+Ġwi d
+end ed
+Ġpo ly
+Ġser vic
+Ġs u
+Ġs ym
+Ġe ven
+Ġac h
+Ġind ep
+Ġfurther more
+Ġsaliv a
+Ġcateg or
+Ġp a
+ut e
+Ġdiagnos tic
+Ġex t
+Ġm ade
+ar ge
+Ġg ood
+Ġach ie
+Ġrel ative
+Ġsug ges
+Ġpercent age
+ut ure
+o u
+p e
+Ġl ab
+Ġsoft ware
+Ġacti vity
+Ġsit es
+Ġo h
+Ġl if
+Ġprac ti
+Ġanalys es
+Ġevalu ate
+Ġliter ature
+on al
+Ġb uc
+Ġe ight
+im ens
+Ġcro wn
+Ġdemonstr ated
+ed i
+Ġp ap
+Ġrel i
+Ġmicro b
+Ġan other
+Ġfollow ed
+Ġm iss
+ac ted
+Ġres in
+pt om
+Ġdescrib ed
+v ent
+Ġt um
+Ġde vi
+Ġs ide
+om m
+Ġindic ated
+ace ment
+Ġconf irm
+Ġse qu
+Ġwh e
+Ġmeas ures
+Ġvari ous
+Ġrecord ed
+x i
+Ġt ip
+Ġsc re
+Ġ u
+Ġr ates
+Ġpo ints
+Ġspec imens
+Ġresp ond
+Ġer r
+Ġwi ll
+Ġhigh est
+Ġa ut
+Ġh el
+Ġsin us
+Ġsurve y
+v ation
+p s
+Ġsmo king
+Ġor der
+Ġbr ack
+Ġinflamm ation
+Ġlike ly
+Ġpro per
+Ġman y
+Ġgu id
+Ġre t
+Ġh ab
+Ġl ight
+Ġsup er
+Ġceph al
+ure d
+Ġreduc ed
+Ġmuc os
+Ġre ference
+Ġfr act
+Ġwhe ther
+et es
+Ġf am
+Ġha ving
+Ġl as
+Ġdent in
+Ġprevious ly
+Ġav ail
+er g
+ic e
+Ġterm s
+Ġal veolar
+Ġcoun tr
+an ti
+Ġam ount
+ak en
+Ġca vity
+Ġtechni que
+Ġcomple te
+v ir
+Ġl ay
+Ġtr aining
+Ġdetec tion
+Ġd ig
+th etic
+Ġpos terior
+Ġimm un
+Ġdiab etes
+Ġb el
+fac ial
+Ġmoder ate
+Ġt em
+en ces
+Ġper man
+ical ly
+Ġro le
+Ġrec omm
+Ġm en
+Ġe ff
+Ġappro ach
+Ġ ul
+ic ations
+Ġmore over
+gr am
+it t
+Ġres ist
+Ġch ewing
+m a
+Ġse g
+Ġdenti st
+Ġj aw
+Ġmet a
+Ġsym ptom
+Ġcar r
+Ġatt ach
+Ġbuc cal
+Ġmiss ing
+on se
+Ġy ou
+Ġvol um
+Ġcomp on
+Ġresp onse
+Ġdiffic ult
+Ġperman ent
+Ġv ers
+Ġdep th
+Ġsoc ial
+Ġs w
+Ġs yn
+Ġp d
+Ġp ow
+Ġse al
+Ġse ven
+Ġinter vention
+Ġlimit ed
+b s
+Ġthe m
+Ġc ult
+Ġb ond
+ore d
+a f
+Ġir r
+i ther
+Ġa verage
+Ġp at
+ac ed
+Ġex p
+os is
+Ġradiograph s
+Ġaffec ted
+Ġhum an
+Ġde g
+og n
+Ġsuc cess
+enc ed
+Ġ2 0
+Ġs ti
+ol es
+Ġcon ven
+ver se
+Ġdis pl
+Ġmo vement
+Ġan xi
+Ġl arge
+Ġde vic
+Ġo d
+Ġdenti tion
+Ġmulti ple
+Ġfail ure
+Ġthick ness
+t o
+Ġf low
+Ġproced ure
+Ġrece ived
+Ġtherap y
+Ġdef ined
+Ġend odontic
+Ġtes ted
+Ġl ack
+op le
+Ġaddition al
+Ġiniti al
+Ġbrush ing
+i er
+Ġos cc
+Ġs um
+Ġg iv
+Ġpro por
+Ġinter val
+Ġmeasure ment
+in d
+Ġl og
+ment ed
+iti vity
+Ġdist ance
+is ted
+Ġn et
+Ġad d
+Ġall ow
+Ġadj us
+Ġprof ession
+Ġa ir
+Ġv ery
+Ġtim es
+Ġlimit ations
+Ġscal e
+Ġpe ople
+Ġsoci o
+w ay
+Ġpro g
+Ġpro m
+a ys
+Ġe qu
+Ġdetec ted
+Ġsever ity
+Ġmechan ical
+Ġanxi ety
+Ġw ear
+Ġre fer
+om y
+Ġappl ication
+Ġa uth
+Ġm es
+as ing
+Ġlas er
+Ġ 4
+Ġform ation
+Ġprac tic
+Ġmonth s
+Ġinter n
+ag ing
+Ġtes ts
+g an
+Ġ 6
+Ġs ite
+Ġf oc
+Ġm arg
+Ġplan e
+Ġ est
+Ġa x
+at ors
+Ġr ight
+Ġpre m
+Ġad m
+Ġcont in
+Ġsystem atic
+Ġran ge
+Ġdefec ts
+Ġitem s
+Ġnorm al
+Ġprofession al
+Ġt a
+Ġt aken
+Ġreg ard
+Ġavail able
+c le
+Ġf ib
+Ġdifferen ti
+Ġint ere
+Ġles ion
+Ġmem br
+Ġpracti ce
+Ġconven tional
+tr ation
+Ġloc al
+er ation
+pec t
+Ġrec ent
+str y
+Ġstr ong
+Ġincis or
+Ġincis ors
+Ġdire ct
+Ġes pec
+Ġprov ide
+or ption
+ro duc
+Ġdem ographic
+Ġresp ons
+Ġespec ially
+Ġol d
+Ġwhere as
+Ġfluor ide
+Ġfoc us
+Ġacc ess
+Ġab o
+Ġmal es
+par ation
+Ġang le
+Ġle ft
+Ġvari able
+Ġinvestig ated
+Ġbacter ia
+Ġidentif ied
+Ġexpos ure
+Ġf ree
+Ġm m
+Ġl ateral
+Ġdis tal
+Ġdenti stry
+Ġdeterm ined
+Ġfemal es
+i h
+Ġg o
+Ġradiograph ic
+Ġimpro ve
+Ġpoly m
+s ed
+Ġare as
+Ġco h
+Ġincl usion
+Ġimpl ants
+Ġset ting
+em ic
+Ġcomple x
+Ġlif e
+i el
+Ġf ew
+Ġor ig
+oc clusion
+Ġprovid ed
+Ġcollec ted
+Ġpal atal
+an g
+Ġex am
+ens ity
+Ġag ain
+Ġanti b
+res p
+Ġclass ification
+Ġinfec tion
+ens ive
+Ġmal occlusion
+Ġf ear
+Ġg el
+od y
+ay ed
+Ġcor resp
+Ġmax imum
+Ġrati o
+c tion
+Ġpro gram
+Ġpr ior
+Ġques tions
+Ġrequ ired
+Ġindep endent
+Ġvolum e
+Ġf ixed
+og ene
+Ġag ree
+Ġadhes ive
+Ġexperim ental
+u ous
+Ġcon trib
+ib ility
+Ġcl os
+Ġco vid
+Ġtreatment s
+Ġtm d
+Ġver tical
+Ġproble ms
+v ari
+Ġc t
+Ġf uture
+Ġpro te
+Ġeff ic
+Ġresist ance
+Ġpat tern
+Ġt e
+Ġpre c
+Ġbl ood
+Ġcle ar
+Ġhist ory
+Ġconsist ent
+Ġanalyz ed
+Ġcarr ied
+Ġbacter ial
+er o
+Ġl arg
+Ġrestor ations
+q ol
+fic ial
+tit ud
+Ġremo val
+Ġparen ts
+Ġa im
+Ġtyp es
+Ġbehavi or
+Ġint roduc
+Ġmand ible
+Ġline ar
+Ġred uce
+Ġbiof ilm
+ab ly
+Ġro t
+Ġdeterm ine
+Ġselec tion
+Ġpro s
+Ġfin al
+Ġsymptom s
+an ces
+Ġe le
+Ġex cluded
+Ġat titud
+g est
+p ing
+Ġd om
+Ġb o
+ro und
+iv al
+Ġag ed
+Ġsti ll
+Ġeffic acy
+Ġp an
+vir on
+f act
+Ġh al
+Ġad oles
+Ġappro x
+Ġii i
+Ġhab its
+Ġgiv en
+Ġto ol
+Ġapp ear
+Ġservic es
+i res
+Ġde ep
+Ġhe ight
+Ġhyp oth
+Ġs atis
+Ġst ep
+Ġhy per
+Ġsens itivity
+Ġpractic es
+t y
+in c
+Ġreas on
+in k
+Ġof ten
+Ġme ans
+Ġe ither
+is c
+ac tions
+Ġinc ome
+Ġheal ing
+ren ce
+Ġwor k
+Ġfunc tion
+Ġintere st
+w or
+Ġc p
+Ġb le
+Ġcont aining
+Ġsug gest
+Ġstruct ure
+Ġvit ro
+Ġsugges ted
+Ġprem olar
+Ġ 7
+ul ations
+ab l
+Ġres id
+Ġaffec t
+Ġcy cl
+Ġdecre ased
+n ed
+re g
+as is
+Ġe lec
+Ġac t
+Ġcons tr
+ke le
+Ġcer amic
+Ġnec ess
+gro up
+Ġc ari
+om a
+Ġch r
+ap ical
+Ġpl aced
+Ġda ily
+ogen ic
+on t
+at ric
+Ġperi apical
+Ġcont act
+Ġbi om
+m ark
+ro ph
+Ġpre vent
+Ġpre paration
+Ġen viron
+Ġcomm un
+Ġpost operative
+Ġcent ral
+Ġsol ution
+Ġabo ve
+o int
+Ġv ir
+Ġund ers
+Ġlay er
+y ch
+ar ch
+Ġdm ft
+Ġcephal ometric
+in eral
+or ing
+Ġsub sequ
+Ġproper ties
+Ġfam ily
+n ec
+Ġt ong
+Ġs pl
+Ġp ock
+Ġst ages
+oc h
+Ġinc idence
+Ġsh ap
+Ġcaus ed
+kele tal
+as c
+Ġhe ad
+pec ted
+Ġph ase
+Ġdevelop ed
+Ġcontr ast
+Ġd el
+Ġe cc
+Ġind uc
+Ġexamin ed
+pos ed
+Ġsup por
+Ġmor ph
+Ġauth ors
+e ed
+g ed
+ver y
+qu es
+Ġab ility
+Ġcompos ite
+Ġadoles c
+Ġm ark
+et r
+ow n
+Ġpartic ular
+Ġtiss ues
+a z
+Ġs us
+Ġst ability
+Ġclin ic
+Ġspec ial
+Ġphys ical
+Ġdevi ation
+g ing
+o y
+Ġneed ed
+Ġps ych
+Ġest abl
+Ġtong ue
+e qu
+Ġin hib
+Ġen h
+Ġcoh ort
+Ġw ee
+Ġz ero
+Ġcountr ies
+Ġs r
+Ġan s
+Ġm l
+Ġpres s
+Ġdet ail
+Ġsystem ic
+Ġce ment
+Ġs keletal
+Ġm ut
+ro s
+Ġmembr ane
+Ġble eding
+Ġb ene
+Ġro ugh
+Ġser um
+r qol
+is ts
+Ġpubl ic
+Ġmajor ity
+n er
+Ġs k
+Ġd ivid
+Ġst ate
+ur ing
+Ġtest ing
+Ġagree ment
+Ġp ur
+Ġst aining
+Ġn ine
+Ġres orption
+Ġincre asing
+Ġol der
+Ġlog istic
+Ġadjus ted
+Ġcorresp onding
+Ġunders t
+g en
+et er
+id es
+ast e
+Ġfac ial
+Ġref lec
+Ġsum m
+Ġs tim
+Ġf il
+iv ing
+Ġcol or
+Ġenviron ment
+Ġdat as
+Ġcomb ined
+Ġadm in
+f ied
+Ġl ast
+Ġad v
+Ġrepor t
+Ġso ur
+Ġar tic
+Ġmaxill a
+Ġtechni ques
+Ġtum or
+Ġadolesc ents
+Ġl and
+Ġex hib
+Ġconcent ration
+Ġu til
+b ers
+o v
+Ġ il
+Ġm ih
+ing s
+ten tion
+Ġdescr ip
+Ġdecre ase
+Ġ x
+Ġl ip
+Ġcon nec
+Ġpre ven
+Ġfill ed
+sc op
+Ġans w
+Ġpreven tive
+os ph
+Ġsignific ance
+Ġsup port
+Ġhy d
+Ġvis it
+Ġremo ved
+Ġan at
+le x
+Ġch em
+Ġvari ation
+anc ed
+ith el
+Ġapprox im
+Ġland mark
+Ġn or
+Ġcons um
+Ġsub st
+Ġcor onal
+Ġfrequ ently
+Ġidentif y
+Ġdevic e
+Ġa ware
+ing ual
+age ment
+io tic
+Ġrespond ents
+Ġb ack
+Ġgen e
+Ġsec tional
+Ġfemal e
+Ġpropor tion
+Ġnet wor
+Ġlarg er
+b l
+Ġp ol
+Ġb ody
+Ġpre gn
+Ġgr ad
+Ġw ay
+Ġreli ability
+ce p
+Ġfor ces
+Ġdep art
+Ġrem aining
+Ġdeg ree
+Ġpress ure
+Ġth ough
+iz ing
+Ġse en
+Ġse par
+Ġinv as
+Ġvi ew
+Ġfract ure
+Ġchr onic
+Ġb est
+Ġcon d
+am e
+Ġgingiv a
+Ġgingiv itis
+tion ed
+Ġh p
+Ġconcent r
+Ġsur v
+Ġep ithel
+o ts
+p ri
+re ad
+Ġw all
+Ġch ec
+Ġreg ular
+Ġindic ate
+ath er
+Ġvis its
+Ġmicrob i
+l or
+p a
+Ġd oc
+Ġim aging
+pl oy
+Ġsh ort
+Ġtooth br
+Ġrestor ation
+Ġdo es
+Ġabs ence
+Ġdivid ed
+Ġtoothbr ush
+Ġ 9
+as ts
+Ġto ward
+Ġcon cer
+og r
+Ġoh rqol
+Ġpow er
+Ġunderst and
+c in
+Ġs qu
+Ġtr a
+pos ition
+Ġcalc ul
+Ġpolym er
+iel d
+Ġpan or
+Ġ 8
+Ġin ser
+Ġle ar
+Ġresul ting
+Ġsit u
+Ġrelative ly
+Ġconfirm ed
+m i
+Ġfin ally
+Ġop tim
+i ance
+Ġw a
+at ures
+Ġb or
+im in
+Ġse em
+Ġfollow s
+Ġat trib
+Ġcomp are
+Ġph ot
+Ġindic ating
+Ġpanor amic
+Ġfo od
+Ġshow ing
+ex t
+Ġhel p
+Ġoper ative
+Ġrele vant
+Ġdig ital
+Ġm s
+Ġsurv ival
+Ġb re
+Ġrec ession
+Ġne ver
+Ġsub s
+Ġsub group
+Ġinstr uc
+m e
+Ġrec or
+Ġcollec tion
+Ġachie ved
+r u
+Ġs le
+Ġp cr
+oc y
+Ġse arch
+Ġaccor d
+Ġman agement
+Ġel astic
+Ġax is
+l ine
+Ġ ens
+��to p
+ly ing
+Ġrec ur
+Ġcompar ing
+Ġbrack et
+on omic
+Ġn ational
+Ġinclud e
+Ġknow n
+Ġconsider ing
+Ġcategor ies
+Ġinduc ed
+ul es
+Ġex clusion
+Ġass um
+ous e
+Ġar ti
+Ġelec tr
+Ġob es
+fac tion
+Ġsp ace
+Ġdimension al
+Ġprog ression
+asc ular
+Ġt ub
+on ia
+Ġs il
+ti d
+Ġm us
+it ud
+ot yp
+Ġmed ian
+Ġlong er
+hol d
+Ġaccord ance
+Ġa round
+Ġs n
+Ġc d
+us tr
+Ġg um
+Ġac ro
+Ġcol l
+Ġappro pri
+Ġimport ance
+Ġcle an
+Ġagain st
+Ġapproxim ately
+c om
+Ġt it
+ro p
+Ġst er
+Ġpl ate
+Ġpl acement
+Ġtooth p
+Ġexamin er
+Ġaddition ally
+Ġextr acted
+Ġprom ot
+l d
+er ic
+Ġc ir
+is ms
+Ġex pres
+Ġrec ru
+all en
+enc ing
+Ġclass ified
+Ġstruct ures
+Ġdimension s
+Ġrecomm ended
+Ġnecess ary
+Ġp en
+Ġb ar
+ic t
+Ġcons ent
+Ġprob ing
+ici ans
+Ġinvol ved
+Ġmucos a
+n ot
+Ġre ach
+Ġch allen
+ap s
+Ġwid e
+Ġattach ment
+Ġod ds
+Ġprote in
+Ġcari ous
+Ġsle ep
+Ġ ill
+on tal
+al ities
+Ġex ce
+ch ing
+Ġno ted
+Ġun til
+Ġmain tain
+Ġcent er
+yn amic
+Ġ20 1
+r ix
+Ġe as
+Ġe very
+Ġn at
+Ġcon sequ
+Ġpre p
+Ġmal e
+Ġperce ived
+u ter
+Ġim pression
+Ġpre vention
+Ġstatistic s
+Ġsystem s
+Ġdiagnos ed
+Ġcomm itt
+Ġvis ual
+Ġem ploy
+Ġrandom ly
+Ġfunc tional
+Ġcommitt ee
+b ial
+d le
+x imal
+Ġe con
+Ġl ingual
+Ġal ong
+Ġinc ub
+Ġmed ium
+Ġstr ateg
+icro bial
+Ġdesign ed
+anc y
+Ġmat rix
+Ġacro ss
+or b
+an tit
+ec t
+el ess
+Ġex cept
+Ġrepor ting
+Ġmain ly
+Ġav oid
+Ġerr or
+Ġhal f
+on y
+Ġc od
+or al
+Ġre pe
+Ġag ing
+tim icrobial
+m ost
+Ġt en
+Ġp ne
+Ġex pected
+Ġpro l
+Ġma gn
+ist ered
+Ġcompar able
+Ġtrans l
+Ġbehavi ors
+Ġda ys
+Ġdefec t
+Ġdepart ment
+Ġpne um
+Ġre al
+ec onomic
+Ġor gan
+Ġac tive
+Ġimpro vement
+Ġdire ction
+Ġhyd ro
+in ing
+is tration
+Ġal g
+Ġqu antit
+Ġdetec t
+Ġcanal s
+Ġcomparis ons
+g o
+Ġf it
+Ġf ile
+is ing
+ig ation
+Ġco e
+Ġreg ions
+Ġexamin ations
+Ġexperi enced
+Ġimm edi
+Ġtm j
+Ġcontin uous
+Ġrespons es
+Ġrough ness
+a x
+p re
+p ite
+Ġan timicrobial
+iv o
+form ation
+Ġmin eral
+Ġconf ound
+Ġmulti vari
+Ġcle ft
+Ġfill ing
+edi atric
+Ġcompon ent
+d rom
+l s
+Ġ ic
+fere d
+Ġap ex
+Ġob jec
+Ġdes pite
+Ġimpro ved
+Ġexpl ained
+Ġeth ics
+Ġsocio economic
+ogene ity
+Ġb ro
+Ġn as
+un g
+iz es
+Ġhigh ly
+ob l
+Ġwid th
+a ke
+Ġv ivo
+and s
+Ġem erg
+Ġsequ ence
+Ġvers ion
+Ġdatas et
+th eless
+Ġre ad
+Ġim ple
+Ġresul ted
+Ġgen etic
+Ġman ual
+Ġz ir
+Ġmid dle
+Ġlear ning
+Ġpneum onia
+Ġd na
+Ġm ild
+Ġh eter
+if y
+ib r
+Ġappro ved
+Ġarti ficial
+Ġnat ural
+f ort
+l ess
+u tions
+Ġpro posed
+uc le
+Ġyoung er
+Ġul tr
+Ġhypoth esis
+b ility
+or ith
+Ġb ur
+Ġh iv
+Ġse e
+Ġpar ti
+Ġmod ified
+Ġdat ab
+Ġincre ases
+Ġpredic t
+Ġtrial s
+Ġsyn drom
+Ġalg orith
+Ġzir con
+u ro
+y le
+Ġf ul
+Ġassoci ations
+Ġsecond ary
+Ġoccur red
+Ġpubl ished
+Ġprofessional s
+Ġappropri ate
+n s
+Ġt end
+re w
+Ġd am
+Ġd ynamic
+Ġre pl
+Ġh s
+Ġaccur ate
+Ġmuc h
+Ġspecific ity
+Ġpal ate
+Ġcomb ination
+Ġtem per
+Ġconcentr ations
+o facial
+r ing
+u x
+Ġg e
+uc tion
+igh ted
+Ġen c
+Ġop en
+Ġinvestig ate
+Ġcer tain
+Ġbrack ets
+Ġconsum ption
+i pl
+v ated
+Ġm y
+Ġm ixed
+Ġch ines
+Ġer up
+Ġcommon ly
+Ġinstru ments
+Ġsatis faction
+Ġchines e
+Ġc ut
+Ġb u
+ec tion
+ut es
+pl as
+ven ess
+Ġindic ates
+Ġmon it
+gr ad
+Ġload ing
+Ġd one
+Ġm r
+Ġh or
+Ġe v
+Ġclinical ly
+Ġmicro scop
+Ġirr adi
+Ġsr ta
+Ġinvas ive
+Ġecon omic
+a ir
+x y
+Ġm ill
+Ġst ain
+ac ti
+Ġl ed
+Ġinter ven
+Ġvari ations
+Ġph osph
+Ġdep endent
+Ġcompon ents
+Ġzircon ia
+Ġex ist
+Ġsign s
+Ġint ake
+Ġsl ight
+Ġcompl ications
+Ġreas ons
+Ġexam ple
+Ġshap e
+Ġestabl ished
+Ġbene f
+Ġepithel ial
+an es
+Ġcon cluded
+Ġal most
+Ġse m
+Ġappl ian
+Ġdef in
+Ġgr an
+Ġlimit ation
+Ġorig inal
+Ġanat om
+Ġapplian ces
+p ati
+w as
+ol d
+Ġas ked
+Ġrec ip
+Ġlow est
+Ġmal ign
+Ġconf idence
+Ġscre ening
+n ic
+Ġf p
+an sion
+iz ontal
+Ġcl ose
+00 0
+Ġeth nic
+Ġperce ption
+Ġinstru ment
+Ġexp ansion
+Ġdifferenti ation
+Ġintroduc tion
+Ġattrib uted
+Ġprep ared
+n al
+Ġrepor ts
+Ġcontrol s
+Ġcontrol led
+Ġdi amet
+Ġwor ld
+Ġins tit
+Ġarch w
+Ġexpos ed
+Ġbel ie
+Ġlandmark s
+Ġhor izontal
+Ġl ig
+Ġis s
+oc l
+Ġhe m
+Ġsc ans
+Ġsu fficient
+l ing
+Ġt ren
+Ġt arg
+Ġm ac
+Ġh ouse
+ur ation
+pec ts
+vi ties
+Ġreg en
+Ġsmall er
+Ġmen tioned
+Ġinterval s
+Ġmarg in
+Ġp and
+ro c
+Ġsc i
+Ġco v
+Ġindic es
+Ġmin isc
+fic ation
+Ġexpl ain
+Ġcompos ition
+Ġdifficult y
+Ġmorph ology
+Ġaware ness
+Ġd ensity
+Ġdis ord
+Ġap op
+Ġrel ation
+Ġli k
+Ġcomple ted
+Ġstandard ized
+Ġrestor ative
+Ġpap ill
+Ġrecomm end
+Ġminisc rew
+i ent
+an ium
+Ġde br
+Ġad vant
+Ġcont ent
+ell ing
+Ġmed ic
+Ġgener ally
+Ġintra oral
+Ġfe atures
+Ġwee k
+Ġultr as
+c s
+n t
+t reated
+Ġf av
+om at
+il ateral
+Ġpl ace
+Ġinter pre
+Ġdr y
+Ġran k
+Ġfl ap
+Ġpand emic
+b ite
+c are
+f e
+u k
+Ġ q
+Ġ ve
+Ġt f
+Ġs b
+Ġr ather
+ag en
+Ġproble m
+Ġattitud es
+Ġtra um
+k ers
+Ġf ilm
+Ġl ate
+el ines
+Ġqu anti
+Ġpop ulations
+ten sion
+Ġalign ers
+Ġtit anium
+Ġexpres sed
+en ed
+Ġm ar
+Ġm ass
+Ġm ust
+Ġb in
+Ġh om
+Ġscan ning
+Ġguid elines
+Ġseg mentation
+Ġcult ure
+Ġdispl acement
+Ġadd ress
+Ġantib iotic
+on es
+Ġd ys
+it tal
+il it
+Ġv ia
+ag ittal
+Ġinform ed
+Ġloc ation
+Ġeduc ational
+Ġmouth was
+Ġmes ial
+Ġbiom ark
+Ġpock et
+Ġdescrip tive
+ogr am
+Ġtoothp aste
+l and
+Ġ ess
+ti veness
+Ġp ass
+Ġof f
+Ġm ach
+or age
+Ġr a
+Ġac cept
+Ġad ult
+Ġintr usion
+Ġwor king
+Ġloc ated
+Ġflu id
+Ġreli able
+Ġappear ance
+Ġchec k
+Ġtoward s
+Ġanatom ical
+Ġc and
+Ġc op
+ar m
+ol ution
+Ġad equ
+Ġcan not
+Ġnum bers
+Ġdec ayed
+Ġplan ning
+Ġel ig
+Ġbehavi our
+Ġvalid ity
+in a
+Ġc f
+Ġp ast
+Ġf usion
+is sion
+Ġh er
+ur s
+Ġch o
+Ġgen es
+Ġcorre ct
+Ġol p
+Ġadj ust
+Ġfil es
+Ġbre ast
+a ft
+o k
+u tr
+Ġp m
+ac ent
+om atic
+Ġhealth care
+Ġcur ve
+Ġneed s
+Ġsampl ing
+Ġscal ing
+Ġeth ical
+co hol
+Ġmicrob ial
+Ġartic les
+Ġheter ogeneity
+Ġt ur
+it ing
+Ġn an
+Ġas pects
+Ġal cohol
+Ġwh at
+Ġres pect
+ap y
+Ġspec ies
+Ġinfec tions
+Ġes thetic
+Ġdoc u
+Ġobes ity
+Ġinterven tions
+Ġtarg et
+Ġs agittal
+Ġf ield
+or atory
+Ġad ap
+Ġtr ained
+Ġwe ight
+Ġsec tion
+Ġdr ug
+Ġrepresent ative
+Ġair way
+Ġresid ual
+Ġpsych ological
+Ġcand id
+d r
+g ue
+er ior
+Ġp or
+Ġan imal
+Ġd own
+it es
+Ġinc or
+Ġass ign
+Ġun treated
+Ġmo ve
+ograph y
+Ġ1 9
+Ġadj acent
+Ġsubsequ ent
+ov a
+Ġrepe ated
+Ġdisord ers
+c p
+c ence
+Ġ ,
+Ġ ur
+Ġco verage
+Ġcr an
+Ġmet ast
+Ġdr ill
+Ġrandom ized
+Ġvers us
+Ġnever theless
+u fact
+Ġd er
+th ers
+tr ic
+ir th
+Ġad verse
+Ġeffec tiveness
+Ġen rol
+Ġph en
+Ġman ufact
+Ġappl iance
+Ġcalc ium
+Ġtrans fer
+ane ous
+Ġhard ness
+Ġfocus ed
+Ġsour ce
+Ġa ug
+Ġf ati
+th es
+Ġb onding
+res t
+Ġal tern
+Ġch lor
+op ath
+Ġpr inc
+Ġab le
+Ġen g
+Ġobser vation
+Ġbl ock
+Ġinvestig ation
+Ġinfec ted
+Ġexhib ited
+Ġens ure
+Ġquantit ative
+Ġfati gue
+h e
+t t
+Ġh d
+ul ate
+el ing
+ib ration
+Ġspec imen
+Ġrequ ire
+Ġpe ak
+Ġrati os
+Ġpap er
+Ġrefer ral
+Ġintern al
+Ġhp v
+l ier
+Ġ ent
+Ġp ediatric
+Ġd l
+Ġm il
+Ġg erm
+Ġstud ied
+Ġus ually
+Ġint e
+Ġdi et
+Ġunder go
+Ġfrequ ent
+Ġapp oint
+Ġpa ir
+Ġachie ve
+Ġrecor ds
+Ġtemper ature
+c ers
+m d
+w ise
+Ġcr p
+Ġwho le
+Ġprob ability
+Ġoccur rence
+Ġext ent
+Ġcommun ity
+Ġvir t
+Ġprol if
+Ġmalign ant
+Ġpapill a
+Ġess ential
+b m
+Ġo thers
+er c
+Ġst re
+il i
+id ed
+Ġal ter
+Ġr c
+iv es
+Ġcons isted
+Ġparticip ate
+Ġreduc ing
+Ġimp acted
+Ġsug ar
+Ġcy to
+Ġestim ated
+ros pective
+Ġrecur rence
+h ere
+i ological
+p tions
+Ġan ova
+Ġm is
+Ġl in
+Ġl ater
+Ġn ucle
+Ġal one
+Ġsur ge
+Ġbr ux
+Ġmaxill ofacial
+Ġsup ple
+Ġsubjec t
+ak age
+Ġret rospective
+Ġbel ow
+Ġcir c
+Ġemploy ed
+Ġinte gr
+Ġs a
+ro ke
+Ġh ence
+Ġg ir
+ab ol
+Ġrec ogn
+Ġmed ia
+Ġquestionna ires
+Ġgl ass
+o h
+p ose
+re h
+en ding
+Ġf ace
+Ġas ym
+Ġdis s
+Ġpl us
+Ġab ut
+enc ies
+Ġsp eed
+Ġnec k
+Ġprec ision
+Ġc ad
+Ġre tr
+Ġcomp reh
+ific ations
+Ġinter action
+Ġmeas uring
+Ġbi ological
+Ġdec l
+Ġextr actions
+Ġfib ro
+Ġcycl ic
+Ġunderstand ing
+Ġmultivari ate
+i ous
+v ascular
+Ġ iv
+Ġa ff
+es thetic
+Ġb irth
+Ġn a
+ition al
+Ġacc um
+Ġcar b
+Ġmed i
+Ġcy t
+ox ic
+Ġservic e
+Ġtem por
+Ġadd ed
+Ġattitud e
+Ġsqu are
+Ġdiamet er
+Ġ "
+Ġb ase
+Ġe uro
+Ġcomp r
+reat ment
+Ġpl ay
+Ġne x
+amin ation
+ish ing
+Ġear lier
+Ġproduc tion
+Ġdom ain
+Ġtraum a
+u le
+Ġc am
+Ġf lex
+is tr
+Ġn od
+Ġr am
+Ġpro ximal
+Ġma ke
+Ġgener ated
+Ġinflu enced
+Ġproduc ed
+Ġsitu ation
+Ġfp m
+f or
+ur se
+Ġcomp uter
+Ġdent ine
+Ġun it
+Ġar t
+ingiv al
+ores cence
+Ġsuper ior
+Ġorig in
+w ays
+Ġp f
+Ġw r
+Ġan ch
+Ġst able
+Ġv r
+Ġinf il
+enti ally
+Ġk e
+Ġman if
+Ġdem ineral
+Ġmin im
+Ġgl ob
+gro und
+Ġmus cle
+Ġrecru ited
+Ġful ly
+Ġprolif eration
+Ġo t
+Ġp il
+ur ance
+Ġwh ite
+Ġpro gnos
+ys is
+and ibular
+Ġro ots
+Ġschool s
+Ġintern ational
+Ġclos ure
+Ġparticular ly
+Ġnetwor k
+Ġgir ls
+c us
+f s
+Ġf ore
+Ġd ose
+ic ate
+Ġn one
+id ine
+Ġsh or
+Ġcan ine
+Ġro ut
+Ġspec if
+Ġparticip ant
+Ġmin imum
+Ġprovid ing
+Ġep id
+etr y
+Ġinstruc tions
+Ġrecip roc
+Ġadequ ate
+Ġth res
+Ġthe r
+Ġis ol
+Ġint ensity
+Ġmet abol
+Ġsmo kers
+itt le
+Ġrefer red
+Ġspl int
+Ġback ground
+Ġev ents
+Ġmach ine
+Ġspecif ically
+b y
+p ed
+Ġb mi
+Ġst ated
+el s
+Ġhigh l
+Ġmod e
+Ġinter view
+ag ed
+Ġdevelop ing
+Ġalign er
+Ġmucos al
+Ġsuccess ful
+Ġdirect ly
+Ġbo ys
+Ġpremolar s
+Ġincub ated
+Ġcompreh ensive
+g g
+Ġo hip
+Ġp p
+ul us
+Ġres t
+Ġcont ext
+Ġpl as
+Ġacc ount
+Ġpr iv
+Ġnum er
+Ġsubjec tive
+Ġmon om
+Ġlead ing
+Ġext ensive
+Ġlab oratory
+Ġguid ed
+Ġsubsequ ently
+Ġdetail ed
+Ġdatab ase
+plas ia
+Ġmedic ine
+Ġmil k
+a ment
+h ex
+r on
+Ġa ges
+Ġc re
+Ġd s
+ic ular
+ro tid
+Ġr ay
+uc ted
+Ġall oc
+Ġobser v
+Ġmin or
+Ġem d
+unc tion
+Ġrem ains
+Ġexpl an
+Ġprovid es
+Ġmarg inal
+Ġsuppor ted
+Ġpregn ant
+otyp e
+Ġirradi ation
+Ġ enti
+Ġs ar
+en se
+Ġf ar
+ro w
+il ities
+Ġon ce
+Ġal t
+ess ions
+Ġat tention
+Ġsign al
+Ġvari ance
+Ġ1 0
+Ġran ging
+Ġcorrel ated
+Ġrece iving
+Ġpredic tion
+other apy
+Ġproduc ts
+Ġsk ill
+Ġslight ly
+Ġtren d
+Ġrout ine
+Ġc reated
+Ġm oth
+Ġh is
+Ġr ural
+Ġpl ot
+Ġsim ple
+Ġperiod s
+Ġlong itud
+Ġod ont
+Ġcontrib ute
+Ġparti al
+Ġeuro pe
+or gan
+Ġst roke
+ul a
+ac ts
+Ġr un
+op h
+Ġrec onstr
+Ġab und
+Ġcol le
+Ġli th
+Ġins urance
+Ġir reg
+Ġrepres ents
+Ġgu ide
+Ġdevi ations
+Ġcountr y
+Ġprog ress
+Ġadmin istration
+Ġdam age
+Ġaccept able
+Ġke y
+Ġpil ot
+Ġmoth ers
+a ff
+Ġs izes
+Ġb ite
+as k
+Ġre tention
+Ġl ines
+Ġpre operative
+Ġad op
+Ġle uk
+ari ly
+ch ed
+Ġran ged
+Ġoper ator
+Ġvit amin
+Ġcategor ized
+Ġsugges ts
+Ġsumm ary
+Ġseem s
+Ġnex t
+b a
+o pl
+Ġa esthetic
+Ġof fic
+Ġm g
+is ation
+Ġe ti
+Ġpro mo
+Ġac qu
+Ġtr ad
+Ġdec ision
+Ġ1 2
+Ġform ed
+Ġgr ade
+Ġfac ilit
+Ġparen ting
+Ġvi ol
+Ġimmun e
+Ġsetting s
+och em
+Ġpromot e
+Ġerup tion
+Ġincor por
+d own
+th e
+th esis
+it able
+ac tive
+Ġl ittle
+Ġex tern
+Ġus ers
+Ġtw ice
+Ġcol on
+Ġparamet er
+Ġreview s
+Ġhist ological
+Ġperce ptions
+Ġpers on
+Ġindep end
+Ġdom ains
+Ġinterest ing
+Ġinhib it
+Ġwide ly
+Ġill ustr
+Ġbiomark ers
+Ġchlor hex
+Ġcyto k
+Ġchlorhex idine
+e u
+i asis
+t ation
+Ġs ul
+Ġf al
+Ġl iving
+igh ts
+og ens
+Ġhe art
+Ġass ay
+Ġreg istered
+Ġcar d
+Ġab r
+fac e
+Ġar r
+Ġindic ators
+Ġresp ir
+Ġcro w
+Ġcaus es
+Ġvalid ation
+Ġrele ase
+Ġseal er
+Ġsubst anti
+Ġpregn ancy
+Ġstrateg y
+Ġcoe fficient
+Ġimmedi ately
+Ġultras onic
+Ġmove ments
+Ġmetast asis
+Ġvirt ual
+Ġpriv ate
+l i
+l er
+re p
+Ġc ost
+Ġp i
+Ġm d
+ge ther
+Ġy et
+Ġassess ing
+ici an
+Ġpock ets
+Ġalgorith m
+Ġassign ed
+Ġgerm an
+Ġan n
+Ġm c
+ol ith
+ot oxic
+Ġch i
+op s
+Ġsec tions
+ath ic
+Ġpreval ent
+Ġcent ers
+Ġfail ed
+ogen esis
+Ġfract ures
+erg y
+Ġrot ation
+Ġenh ance
+Ġchem ical
+Ġcond yle
+Ġbar ri
+1 6
+Ġt n
+Ġs uture
+Ġw ound
+Ġg a
+Ġsh e
+Ġpres ents
+Ġpr in
+Ġorth odon
+Ġresearch ers
+ym ph
+Ġel imin
+Ġestim ate
+Ġsuper im
+com it
+Ġmonit oring
+Ġabut ment
+Ġfibro bl
+Ġlongitud inal
+Ġextern al
+b le
+n el
+al le
+er ing
+at in
+Ġg ain
+os en
+Ġex cess
+Ġse pt
+Ġgr af
+Ġdevic es
+Ġprogram s
+Ġaim ed
+Ġsus cep
+Ġinser tion
+Ġobjec tive
+Ġirreg ular
+Ġsuscep ti
+b ack
+Ġc n
+or ph
+Ġb al
+Ġl act
+Ġn ear
+Ġwi l
+Ġcon ver
+Ġpar alle
+Ġrec ently
+olog ic
+Ġwe ighted
+Ġevalu ating
+Ġmost ly
+Ġcalc ulation
+Ġsimilar ly
+Ġdistrib uted
+Ġatt end
+Ġvi ability
+Ġaut o
+Ġansw ers
+Ġnetwor ks
+Ġarchw ire
+urs es
+Ġenrol led
+Ġlin ked
+Ġasym m
+Ġmanif est
+Ġglob al
+Ġfal se
+i tical
+p ut
+Ġs s
+ar ies
+Ġl ymph
+et ration
+Ġr ap
+Ġpro p
+Ġch osen
+Ġde b
+Ġqu al
+Ġam eric
+Ġmo lec
+Ġstr ati
+Ġappro val
+Ġtrans m
+Ġgr aft
+Ġcent r
+Ġpot entially
+Ġsuggest ing
+Ġpen etration
+Ġconfound ing
+Ġrespir atory
+b al
+Ġ ip
+Ġs d
+Ġs af
+er ve
+Ġin j
+Ġm ig
+Ġpro jec
+ot omy
+oc oc
+ub le
+Ġtr ue
+Ġpo ol
+Ġpain ful
+Ġfig ure
+Ġremo ve
+Ġbas is
+Ġcrown s
+Ġscre w
+Ġcomplete ly
+Ġhyper tension
+eu tic
+Ġcrow ding
+g f
+in ant
+Ġc m
+Ġc ause
+Ġre v
+Ġst e
+Ġst ar
+Ġst em
+iv ari
+Ġma king
+Ġclin icians
+Ġun cle
+Ġop ening
+Ġunder w
+Ġacti vation
+Ġprotocol s
+Ġsubs tit
+Ġsyndrom e
+Ġtrad itional
+Ġcentr if
+Ġuncle ar
+c ed
+Ġc ogn
+us p
+Ġl ps
+ig en
+Ġv ary
+Ġbe g
+Ġgener ation
+Ġmicro le
+Ġem ph
+Ġrem ained
+Ġcorrel ations
+Ġrelationship s
+Ġfac ult
+Ġprof ile
+oid s
+Ġpros pective
+Ġreflec t
+Ġsumm ar
+Ġhouse hold
+Ġelig ible
+Ġcran io
+Ġaltern ative
+Ġaccum ulation
+r y
+Ġre pro
+Ġto gether
+Ġn iti
+ab ric
+ial ysis
+Ġpar ts
+Ġcons ult
+Ġrec all
+Ġclin ics
+Ġsub m
+Ġassess ments
+Ġsuc king
+Ġbr az
+Ġcompar ative
+Ġtrans formation
+Ġbl ind
+Ġem p
+Ġplan ned
+Ġaffec ting
+Ġel der
+Ġoc clusion
+Ġmechan ism
+Ġmor tal
+Ġvalid ated
+Ġcap t
+Ġtum our
+Ġsw ed
+Ġintroduc ed
+Ġmut ans
+Ġoptim al
+Ġexist ing
+Ġdefin ition
+Ġepid em
+Ġunderw ent
+Ġmicrole akage
+Ġcranio facial
+Ġbraz il
+Ġs od
+Ġs ides
+Ġin equ
+Ġe ffici
+Ġn utr
+Ġg ut
+ter s
+Ġwh ose
+uc ial
+Ġco vari
+Ġinf erior
+Ġpartic les
+Ġcal ibr
+Ġpredic ted
+Ġpath way
+Ġoste obl
+Ġaut omatic
+Ġpattern s
+Ġtf ap
+Ġflex ural
+Ġshor ter
+Ġmortal ity
+1 0
+Ġa i
+er t
+Ġc all
+ic tion
+Ġl at
+Ġpre fer
+Ġac ute
+ary n
+ell a
+Ġro om
+Ġfin d
+Ġed ent
+Ġunder lying
+Ġscore d
+Ġtechn ology
+Ġcoun t
+Ġscal er
+Ġinvol ving
+Ġexperim ent
+Ġtherap eutic
+Ġsu itable
+Ġtip ping
+Ġta king
+Ġprec ise
+Ġadv anced
+Ġder ived
+Ġbrux ism
+Ġenti re
+Ġparalle l
+Ġinj ur
+r a
+t es
+Ġc c
+Ġm as
+or ation
+Ġre action
+Ġres tric
+Ġwe ak
+Ġcr ucial
+Ġdef ici
+ak ia
+Ġbas ic
+Ġunivers al
+Ġthrough out
+Ġiniti ally
+Ġcateg ory
+Ġattach ed
+ang u
+Ġact in
+Ġwee ks
+Ġpur pose
+Ġcalcul us
+Ġclean ing
+Ġreciproc ating
+Ġcentrif ug
+Ġfacult y
+o or
+Ġt ons
+Ġo wn
+Ġc v
+Ġh ere
+id ity
+Ġcomp uted
+Ġdif fer
+Ġcar cin
+Ġun its
+Ġen ergy
+Ġar ab
+Ġer os
+Ġins u
+Ġidenti fication
+Ġexp and
+ogn athic
+Ġele ment
+Ġmicrobi ome
+Ġmouthwas h
+Ġrepro duc
+n orm
+Ġc ore
+Ġb ilateral
+Ġe vent
+Ġst omat
+Ġg old
+Ġal read
+Ġch x
+Ġco urse
+Ġcan ines
+Ġthere by
+ens ile
+Ġover l
+Ġdisc rep
+Ġbec ome
+Ġdep end
+Ġaffec ts
+Ġcoun ts
+Ġparen tal
+Ġphys icians
+Ġadhes ion
+Ġpers onal
+Ġequ al
+ros is
+Ġcoll agen
+Ġthres hold
+Ġalread y
+p an
+r s
+y ag
+er v
+Ġal b
+Ġr s
+ot t
+Ġch ina
+Ġab norm
+Ġinter d
+olog ies
+ten ance
+Ġimp action
+Ġmain tenance
+Ġacti vities
+Ġexpl ore
+Ġrepresent ed
+Ġfluor id
+Ġbor ne
+Ġsubgroup s
+Ġmr na
+Ġinstit ution
+Ġaug mentation
+ivari ate
+Ġcogn itive
+d uce
+t m
+y g
+Ġt ext
+in o
+Ġd u
+Ġto m
+Ġcon e
+Ġco ord
+Ġpl ates
+Ġsub g
+iti z
+Ġparticip ating
+Ġdec id
+Ġradi ation
+Ġcer v
+Ġinstru mentation
+Ġhab it
+Ġcephal ogram
+Ġseg ment
+Ġviol ence
+Ġcard io
+Ġabr as
+Ġedent ul
+f y
+s tim
+u ary
+z ym
+Ġc ys
+Ġf abric
+Ġh our
+Ġas pect
+Ġr at
+ut ing
+Ġde pos
+Ġac cep
+ys tal
+ee k
+Ġcont ained
+cl ine
+Ġam pl
+Ġmicro organ
+Ġol ds
+Ġ0 5
+Ġrem ineral
+Ġcompl ain
+Ġanalyz e
+Ġsour ces
+Ġster ile
+Ġreach ed
+Ġconsequ ently
+Ġregen eration
+Ġdocu mented
+Ġcirc um
+Ġcyt otoxic
+Ġther m
+ochem ical
+Ġindepend ently
+Ġsept a
+Ġrap id
+w h
+Ġ ig
+Ġw nt
+Ġb es
+Ġre tain
+Ġh ome
+Ġe ating
+Ġr ated
+Ġco ated
+Ġpr f
+Ġph ases
+Ġuse ful
+Ġform s
+Ġcorre ction
+Ġbl ue
+Ġca rotid
+Ġposs ib
+Ġpath ology
+Ġcurrent ly
+Ġul cers
+to tic
+Ġrespons ible
+Ġdel i
+Ġsubst ance
+Ġtoothbrush ing
+Ġapop totic
+Ġelder ly
+Ġsod ium
+Ġtons ill
+Ġcerv ical
+Ġcardio vascular
+d en
+Ġb ox
+ac ity
+Ġpro tr
+ot om
+Ġde grad
+Ġtreat ing
+Ġinter face
+Ġk it
+Ġobser ver
+Ġmin imal
+Ġimp a
+Ġet ching
+Ġset up
+Ġfam il
+Ġutil ized
+Ġantibiotic s
+Ġcandid a
+opl akia
+Ġtn f
+d m
+Ġt ensile
+Ġd ate
+Ġm ic
+Ġm ix
+ac ing
+om al
+Ġv as
+Ġr d
+Ġro b
+Ġcr itical
+Ġsp ss
+Ġcomm erc
+Ġprob e
+Ġprob ably
+Ġcoun ter
+ste ad
+Ġgl ands
+Ġdire c
+Ġfl oor
+Ġestim ates
+Ġirr igation
+Ġfew er
+Ġphosph ate
+Ġrecommend ations
+opath ological
+Ġplas ma
+Ġcalibr ated
+Ġsubg ingival
+Ġdecid uous
+Ġimpa ired
+b o
+j et
+r yl
+Ġth in
+Ġw es
+Ġin stead
+Ġf sc
+Ġm ap
+Ġm ental
+ly s
+Ġv ital
+Ġr ins
+ire ct
+Ġen zym
+Ġsec re
+Ġvis ible
+Ġos a
+Ġlead s
+Ġdispl ayed
+Ġadjus ting
+Ġclos ed
+Ġact ual
+Ġmark ed
+Ġdetail s
+Ġcoll ab
+Ġprinc ip
+Ġanch orage
+Ġinfil tration
+Ġcolle ge
+Ġleuk oplakia
+Ġfibrobl asts
+Ġmig ration
+Ġfsc n
+in ding
+al low
+er i
+Ġd rop
+it us
+it ation
+Ġcon st
+Ġinc om
+Ġhe at
+ch a
+ist ent
+ens us
+Ġ1 6
+Ġorth ognathic
+Ġfl oss
+Ġpracti tion
+Ġsequ ences
+Ġapproach es
+Ġsw elling
+Ġ20 2
+Ġcontin u
+Ġregard less
+Ġcycl es
+Ġcov ered
+Ġdrug s
+Ġwr it
+Ġactin omy
+v a
+Ġs ut
+Ġan a
+or able
+ic ated
+Ġst atic
+Ġn ull
+Ġind igen
+Ġcont amination
+Ġanalys ed
+Ġincl ination
+Ġk er
+Ġover jet
+Ġj ust
+Ġcharacter ized
+br id
+ie f
+Ġrequ ires
+Ġpredic tive
+Ġerr ors
+Ġstrong ly
+Ġexam ine
+Ġceramic s
+Ġcond yl
+Ġiss ues
+Ġminiscrew s
+istr y
+Ġdegrad ation
+Ġindigen ous
+d l
+u an
+in ary
+Ġp ds
+Ġw ind
+Ġst ored
+Ġl angu
+Ġg ly
+oc om
+Ġinc id
+em ia
+Ġpos ts
+ch ild
+Ġvari ed
+Ġbi o
+Ġbi ops
+tis ts
+Ġj ud
+Ġstandard s
+Ġoccur s
+Ġschool child
+Ġinvol vement
+Ġul cer
+Ġpow ered
+Ġta ke
+Ġrot ary
+Ġenh anced
+Ġconcer ning
+ung al
+Ġundergo ing
+Ġodont ogenic
+Ġeffici ency
+Ġgut ta
+Ġcoord in
+Ġaccep ted
+Ġmicroorgan isms
+Ġbes ides
+Ġconst ant
+Ġwrit ten
+Ġwind ow
+c et
+p al
+u ate
+Ġo u
+Ġc reat
+es thes
+Ġst aff
+Ġl ost
+Ġn h
+Ġwi re
+Ġcon cept
+Ġco ating
+Ġsur round
+Ġ2 00
+Ġhy brid
+Ġposs ibility
+Ġprocess es
+Ġrandom ization
+Ġoper ation
+Ġconsist ency
+Ġcap acity
+Ġlay ers
+Ġclear ly
+Ġbenef its
+Ġasymm etry
+Ġameric an
+Ġinsu fficient
+Ġfamil ies
+Ġwes tern
+Ġschoolchild ren
+Ġp eek
+Ġm ell
+is al
+Ġh orm
+Ġh ost
+ul ating
+Ġn av
+Ġpro duce
+Ġac ad
+Ġass isted
+Ġind ent
+Ġind irect
+Ġpl astic
+Ġup on
+Ġdiagnos es
+Ġz inc
+Ġmechan isms
+Ġfunc tions
+Ġvol un
+Ġalign ment
+Ġseg ments
+Ġax ial
+Ġansw er
+Ġsepar ately
+Ġic d
+Ġadvant age
+Ġsurge on
+Ġstrati fied
+Ġmell itus
+m ic
+Ġt or
+re es
+Ġth ink
+Ġs bs
+Ġd en
+Ġb s
+ac es
+Ġl isted
+Ġr p
+Ġex act
+Ġex clud
+Ġde form
+Ġdis p
+Ġmod ulus
+Ġcal ibration
+Ġindic ator
+Ġchan ged
+cr ip
+Ġsal ine
+Ġser ies
+Ġdr ied
+Ġrece ive
+Ġstress es
+Ġte am
+fact ory
+Ġinhib ition
+Ġelectr onic
+Ġmagn ification
+fe eding
+Ġbreast feeding
+Ġdiet ary
+Ġcompr ised
+Ġeurope an
+Ġtonsill olith
+Ġnav igation
+b ac
+f ric
+p end
+Ġc s
+Ġc usp
+Ġto bac
+Ġn erve
+Ġg raph
+ab ony
+Ġal ways
+Ġper f
+Ġsc oring
+ill ary
+Ġdenti fric
+Ġag ents
+Ġsp read
+Ġmater nal
+ll ent
+Ġinflu encing
+Ġdiscus sed
+Ġpath ogens
+Ġoste ocl
+Ġadhes ives
+Ġmem bers
+Ġlab ial
+Ġtip s
+Ġallow ed
+ogene ous
+Ġadmin istered
+Ġexce llent
+Ġstrateg ies
+Ġimple mented
+Ġlig ament
+Ġadjust ment
+Ġalter ations
+Ġabund ance
+Ġcn n
+Ġdeb onding
+Ġemph as
+Ġpossib ly
+Ġtobac co
+i ans
+Ġ ide
+ti ous
+Ġc rest
+Ġm astic
+Ġm ta
+Ġb is
+Ġh oc
+it ted
+Ġn ar
+Ġg re
+Ġg et
+ol uc
+od ies
+Ġor d
+Ġwh y
+Ġex c
+Ġinc ons
+Ġdent ures
+por ted
+em comit
+Ġmod alities
+Ġag g
+Ġradi oluc
+Ġsp e
+Ġorthodontic s
+Ġprim er
+Ġdetec ting
+Ġintr abony
+Ġplan es
+Ġlif est
+Ġsequ encing
+Ġcult ured
+Ġcomplex ity
+Ġhypoth es
+Ġsr p
+Ġbene ficial
+Ġinser ted
+Ġassum ed
+Ġtub e
+Ġdebr is
+Ġskill s
+Ġeti ology
+Ġactinomy cet
+Ġcondyl ar
+Ġactinomycet emcomit
+k now
+t osis
+Ġt ap
+Ġthe ore
+Ġo x
+Ġd il
+le t
+Ġe mo
+et ric
+am ine
+Ġdent ure
+Ġha art
+Ġy our
+Ġam ino
+Ġk ap
+Ġdisc om
+Ġinvestig ations
+Ġpath ological
+Ġreve al
+Ġdistal ization
+Ġprote ins
+Ġpros thetic
+Ġsepar ate
+Ġsil ic
+itud e
+Ġexplan ation
+Ġbeg in
+Ġtom ography
+Ġactinomycetemcomit ans
+1 5
+c a
+d ps
+f fered
+o ad
+v able
+Ġf un
+Ġl s
+Ġn ature
+Ġwas h
+od em
+Ġper cha
+Ġr ad
+Ġincre ment
+Ġover bite
+Ġcr ystal
+Ġsim ulated
+Ġimpro ving
+Ġacti vated
+Ġflu orescence
+Ġpercent ages
+Ġpubl ication
+Ġfe ature
+Ġmat uration
+Ġeffective ly
+Ġcult ural
+Ġbo ard
+Ġmark ers
+Ġstim ulation
+Ġelectr on
+Ġimmedi ate
+Ġemerg ency
+Ġbenef it
+Ġstre pt
+Ġsubstanti al
+lys is
+Ġincom ple
+s ink
+in f
+Ġp is
+or ts
+us e
+ec ted
+if ier
+ati te
+Ġpro ved
+Ġres idence
+Ġres olution
+Ġat ten
+enti a
+Ġacc om
+Ġwe bs
+Ġen l
+Ġdes tr
+Ġj oint
+oun ts
+Ġdep ending
+Ġdr in
+Ġconsider ation
+Ġps or
+ne y
+Ġsoci odem
+Ġcompl iance
+Ġscan ned
+Ġhospital s
+Ġhel sink
+Ġpd t
+Ġseal ing
+Ġele vated
+Ġenvironment al
+Ġpol ic
+Ġeas ily
+Ġcho ice
+Ġmanufact ure
+Ġpool ed
+Ġste el
+Ġprefer red
+esthes ia
+Ġdiscom fort
+Ġincomple te
+Ġhelsink i
+d e
+n ish
+r up
+w ide
+Ġ uc
+Ġa h
+ed ed
+Ġp ac
+Ġan omal
+at ch
+ro tic
+Ġst art
+om andibular
+Ġn ame
+Ġg c
+ati ves
+res h
+Ġr as
+Ġbe am
+Ġis ch
+em a
+Ġob vious
+Ġvari ability
+acter ial
+Ġso und
+Ġcontrol ling
+Ġmo bility
+Ġsim ult
+Ġcur ves
+Ġvis ited
+ulti es
+Ġradiograph y
+Ġca v
+Ġdeterm ination
+Ġsol utions
+Ġdig it
+Ġdescrip tion
+Ġchallen ging
+Ġiss ue
+Ġadvant ages
+Ġappoint ment
+Ġdecl ar
+Ġcytok ines
+Ġorthodon tists
+Ġconsult ation
+Ġstrept ococ
+Ġsociodem ographic
+Ġsimult aneous
+o in
+Ġc i
+ent y
+Ġh g
+id ge
+Ġreg istration
+Ġinter pro
+Ġun li
+ast om
+lec t
+Ġcol d
+Ġmin i
+Ġop tions
+Ġimplant ation
+Ġloc k
+Ġdeterm ining
+Ġapp lying
+Ġcy cle
+Ġoper ating
+Ġmat ched
+Ġexperim ents
+Ġantib acterial
+Ġconstr iction
+Ġorgan ization
+Ġethnic ity
+Ġtur n
+Ġcarb on
+Ġmetabol ic
+Ġann ual
+Ġcarcin oma
+Ġcephalogram s
+Ġunli ke
+c ation
+d om
+g ent
+h ood
+t reatment
+Ġo ro
+Ġf erm
+Ġn urses
+ab il
+Ġpro ph
+Ġde h
+Ġde formation
+Ġat tr
+Ġass ist
+Ġne ither
+Ġclin ician
+Ġdec ay
+Ġperiodonti um
+Ġj ap
+Ġdem entia
+Ġintr ac
+Ġrem od
+ob ic
+Ġgl and
+Ġoste oc
+Ġabs orb
+Ġpa ired
+Ġwork ers
+Ġrecor ding
+Ġbelie ved
+Ġmac ro
+Ġdys plasia
+Ġaff ili
+Ġnumer ous
+Ġinteresting ly
+Ġip v
+Ġlangu age
+Ġdeclar ation
+Ġferm t
+Ġproph yl
+k t
+Ġt ask
+Ġs y
+Ġs ed
+ti le
+Ġc ity
+Ġp t
+ic es
+Ġe fficient
+Ġl ink
+om ia
+Ġg eri
+Ġme et
+Ġat tem
+Ġac tion
+Ġdent o
+Ġk in
+Ġrisk s
+pos es
+Ġdisc s
+Ġtrans port
+Ġrece pt
+Ġdecre ases
+Ġdist in
+Ġfe as
+Ġirr ig
+Ġte ach
+Ġcommun ication
+Ġvir al
+ocy tes
+Ġmicroscop e
+Ġapop tosis
+Ġdebr ide
+Ġblock s
+Ġrc ts
+Ġadop ted
+Ġexcess ive
+Ġcovari ates
+Ġsut ures
+Ġpsor iasis
+Ġgeri atric
+Ġc ure
+Ġin st
+es ted
+Ġd b
+an ted
+Ġb ott
+ec al
+Ġg ap
+Ġg ive
+Ġv ide
+Ġal le
+ir ing
+Ġsign ed
+Ġanal ges
+Ġmod ality
+ach e
+Ġcons ists
+Ġinclud es
+ew or
+Ġmed ication
+Ġcell ular
+Ġaccording ly
+Ġdem and
+Ġprob iotic
+Ġform ula
+Ġop md
+Ġinvestig ating
+Ġpred om
+Ġoper ators
+omet ry
+Ġcontr ary
+Ġret ur
+Ġbin ary
+Ġfore ign
+Ġcre ate
+Ġepidem iological
+Ġdefici ency
+Ġoro facial
+Ġdebride ment
+Ġa id
+Ġs ent
+Ġin jec
+Ġm ad
+Ġh arm
+Ġfor am
+Ġv s
+ad vant
+Ġde ath
+Ġde pression
+pl ant
+Ġac ce
+Ġdis advant
+Ġsh if
+Ġad here
+Ġno vel
+Ġk n
+Ġperform ing
+Ġparticip ation
+port un
+Ġtrans verse
+Ġop tion
+Ġop portun
+Ġdi vers
+Ġimp air
+Ġmet al
+Ġfrequ encies
+Ġremo ving
+Ġdo uble
+Ġpla ys
+Ġdist ances
+Ġnegative ly
+Ġcaus al
+Ġallow s
+Ġstep s
+Ġster oids
+Ġalgorith ms
+Ġenc our
+grad uate
+Ġsignal ing
+Ġsuperim position
+Ġmanifest ations
+Ġisch emic
+Ġforam en
+a wn
+o le
+p r
+s et
+Ġth or
+Ġo a
+er ost
+Ġp ack
+Ġin h
+Ġf resh
+Ġd g
+Ġd ich
+Ġb reat
+it ative
+Ġcomp rom
+ff er
+Ġpres er
+Ġcons ensus
+Ġbl ack
+Ġmain land
+Ġincis al
+Ġear r
+Ġpredic tor
+Ġos se
+Ġhist opathological
+over y
+Ġsurve ys
+Ġdiffic ulties
+Ġpers ons
+Ġext re
+Ġsyn thesis
+Ġele ments
+eed back
+Ġsk in
+Ġchallen ge
+Ġappoint ments
+Ġretr ie
+Ġprognos is
+Ġisol ated
+Ġpp d
+Ġmonom er
+Ġalloc ation
+Ġlith uan
+Ġbarri ers
+Ġnear ly
+Ġarab ic
+Ġker atin
+Ġkap pa
+b an
+Ġo m
+Ġin ade
+Ġre in
+it ol
+Ġst orage
+ul ner
+od e
+Ġv ascular
+Ġr are
+Ġr ct
+Ġdent inal
+vel ength
+ight ing
+Ġam el
+Ġar ter
+Ġindic ation
+Ġed ge
+Ġtrans form
+Ġtechn ical
+Ġstrength s
+Ġnec rosis
+Ġevid ent
+co h
+Ġfib er
+Ġappear s
+Ġsus p
+Ġestabl ish
+Ġx erost
+Ġwa velength
+Ġgum s
+Ġnas al
+Ġtend ency
+Ġve ct
+Ġpair s
+Ġobserv ational
+Ġpromo tion
+Ġacqu ired
+Ġsul f
+Ġinjur y
+Ġpractition ers
+Ġnh anes
+Ġicd as
+Ġnar row
+Ġinterpro ximal
+Ġlock down
+Ġinade qu
+h ard
+l ic
+Ġin pati
+Ġm un
+or der
+Ġb op
+it ated
+ul um
+ul ative
+ol ute
+Ġcon c
+Ġv ene
+Ġper pend
+ge al
+ot a
+Ġdis order
+ip s
+Ġsub t
+Ġspec t
+Ġcur v
+Ġvis ually
+Ġins ide
+ust om
+Ġcaus ing
+Ġabs olute
+Ġimmun oh
+Ġpur poses
+Ġpolymer ization
+acti le
+Ġregen erative
+Ġdemineral ization
+Ġgraf ting
+aryn geal
+Ġoverl ap
+Ġinterd ental
+Ġrob ust
+pal atal
+Ġtheore tical
+Ġbegin ning
+Ġdestr uction
+Ġuc l
+Ġdivers ity
+Ġdich otom
+Ġxerost omia
+Ġperpend icular
+Ġimmunoh ist
+f a
+k k
+l in
+Ġt actile
+Ġp u
+Ġf a
+Ġm el
+Ġb cl
+is ter
+is ions
+Ġh ong
+it osis
+Ġst ates
+Ġl d
+Ġfor ward
+un ct
+um b
+Ġdif fered
+Ġtw enty
+ff ee
+Ġind uce
+ari ties
+Ġchild hood
+Ġup r
+esti b
+Ġj an
+Ġcare gi
+Ġextr a
+Ġextr usion
+Ġem b
+Ġca vities
+Ġfr ail
+Ġgeneral ized
+Ġapp e
+anc ing
+Ġsmo oth
+Ġgend ers
+Ġgrow ing
+Ġsens itive
+Ġcross bite
+Ġbiof eedback
+Ġpropor tions
+Ġregard ed
+Ġconstr ucted
+Ġprevent ing
+Ġspl it
+och lor
+Ġx yl
+Ġconnec tive
+Ġtub ules
+Ġbro ad
+Ġemerg ence
+Ġworld wide
+Ġmac roph
+Ġtransfer red
+Ġsar s
+Ġgerman y
+Ġsd b
+Ġblind ed
+Ġfluorid ation
+Ġinstitution al
+Ġtor que
+Ġbreat h
+f ill
+k al
+Ġs we
+en ess
+Ġc cc
+Ġc ustom
+an k
+Ġb en
+Ġl ung
+Ġv ulner
+Ġv estib
+Ġcom orb
+Ġbet a
+Ġcl p
+op e
+Ġco ffee
+Ġinter actions
+Ġk ong
+Ġcor tical
+Ġcol our
+Ġcol ored
+Ġ1 4
+Ġsup ar
+Ġprim ers
+Ġel astom
+Ġscal es
+Ġprocess ing
+Ġinfec tious
+echan ical
+Ġarch es
+Ġnec rotic
+Ġdemonstr ate
+Ġang ular
+hol ds
+Ġseal ers
+Ġdifferenti al
+Ġsuppor ts
+Ġadv ance
+Ġthough t
+Ġbor der
+Ġrecur rent
+Ġcd t
+Ġmaintain ed
+Ġconfound ers
+Ġinterpre tation
+Ġur ban
+Ġqual itative
+Ġcomplain ts
+Ġbiops y
+Ġaccom pan
+Ġdb bm
+Ġinadequ ate
+a e
+c i
+i ver
+Ġc at
+Ġp aste
+Ġb ound
+Ġre actions
+Ġe g
+us ed
+ig g
+Ġcon v
+am ond
+Ġr t
+Ġwh om
+Ġch ains
+Ġcomp ound
+Ġcont ain
+Ġcont ains
+ong ed
+Ġperiodon t
+Ġpr on
+Ġinter m
+Ġfin anc
+pres s
+Ġstr ains
+ep t
+Ġmicro hard
+Ġsubjec ted
+Ġdi amond
+Ġprim arily
+Ġdr awn
+Ġran ges
+Ġloc ations
+Ġdecre asing
+hes ive
+Ġhyp ochlor
+Ġprov ision
+Ġscre en
+Ġauth or
+Ġmembr anes
+Ġlarg est
+Ġstate ment
+Ġdatas ets
+Ġconnec tion
+Ġhp dl
+Ġconcer n
+Ġelastic s
+Ġeas y
+Ġgran ules
+Ġlik ert
+Ġna ocl
+Ġsummar ized
+Ġreproduc ibility
+Ġstomat ology
+Ġdepos its
+Ġcommerc ial
+Ġindent ation
+Ġextre me
+Ġfa ecal
+Ġjan uary
+Ġelastom eric
+Ġmicrohard ness
+Ġhpdl cs
+8 9
+c y
+r h
+r in
+u tive
+Ġa ustr
+re ed
+Ġo g
+Ġc um
+Ġw ar
+Ġm ri
+Ġre pa
+Ġto o
+Ġon es
+Ġv ibration
+Ġwh it
+Ġch am
+Ġdis til
+Ġy ield
+Ġk t
+Ġk ee
+Ġspec tr
+Ġar th
+Ġmed ications
+Ġcompar t
+Ġdisc r
+Ġreduc es
+cer tain
+Ġdeterm in
+Ġpositive ly
+Ġpe kk
+Ġdescrib e
+Ġconclusion s
+Ġdm f
+Ġrespond ers
+Ġpd l
+Ġtool s
+Ġelec t
+Ġsuppor ting
+Ġmicrobi ota
+Ġsee king
+Ġfav orable
+Ġcop per
+Ġtempor omandibular
+Ġalt ered
+Ġrun ning
+Ġga ve
+Ġeros ive
+Ġabras ion
+Ġdeli very
+Ġsecre tion
+Ġcollab oration
+Ġemo tional
+Ġpac ifier
+Ġdistin ct
+Ġthor ough
+Ġucl p
+Ġhypochlor ite
+Ġcum ulative
+Ġdistil led
+1 3
+a king
+s in
+Ġs essions
+Ġc ast
+Ġf ric
+Ġd va
+Ġh ba
+Ġe c
+Ġor ient
+el ih
+Ġpre v
+Ġle t
+cl es
+Ġam ounts
+Ġk ept
+Ġdia gram
+Ġser ious
+Ġz one
+Ġrem ain
+Ġfr am
+ogen ous
+Ġmid palatal
+Ġlab eling
+Ġbond ed
+Ġhal itosis
+isc ipl
+Ġchem otherapy
+Ġchec ked
+Ġwa ve
+Ġbor n
+Ġphot ograph
+otyp es
+Ġrecru it
+Ġcod es
+Ġarchw ires
+Ġsci ences
+Ġlik elih
+Ġphen omen
+Ġsuscepti bility
+Ġswed en
+Ġmas ter
+Ġana er
+Ġsurround ing
+Ġacce ler
+Ġcurv ature
+Ġfaecal is
+iscipl inary
+Ġlikelih ood
+h th
+u ge
+Ġ ion
+Ġo vere
+Ġc ath
+Ġf ast
+Ġd w
+is es
+Ġh if
+Ġst abil
+et amine
+Ġcon gen
+Ġr ace
+Ġres our
+Ġres ins
+ign ific
+Ġat tain
+Ġdis ag
+Ġcl ar
+Ġsc c
+Ġun ited
+Ġup s
+Ġup reg
+Ġmo ti
+Ġexamin ers
+Ġorth op
+Ġj ob
+Ġj unction
+Ġextr act
+Ġcalc ifications
+Ġtrans plant
+Ġcur ric
+Ġwor se
+Ġadj unc
+Ġacti v
+Ġexperi ences
+Ġsm ear
+Ġfail ures
+con t
+Ġret reatment
+Ġcarr y
+Ġdeg en
+Ġdifferenti ated
+Ġimprove ments
+Ġspl ints
+Ġspecial ist
+Ġidentify ing
+Ġphot o
+Ġinstruc ted
+Ġobes e
+Ġimple mentation
+Ġbur den
+Ġparti ally
+Ġdatab ases
+Ġstain less
+Ġclose ly
+Ġsci enti
+Ġquanti fy
+Ġcolon ies
+Ġprin ted
+Ġsubstit utes
+Ġosteobl asts
+Ġdentifric e
+Ġlifest yle
+Ġgc f
+Ġvestib ular
+ignific ant
+a u
+b e
+m en
+n et
+y e
+Ġth umb
+��of fer
+Ġb ony
+ic ip
+ar tic
+Ġto ok
+it ect
+Ġn c
+Ġn ation
+Ġn ow
+Ġg over
+os ter
+if orm
+id er
+Ġv ess
+Ġr in
+feren ces
+Ġap hth
+Ġnot e
+Ġacc oun
+ive ly
+Ġvari ety
+Ġso uth
+Ġmethod ology
+Ġ1 1
+Ġappl ic
+Ġappl ications
+Ġfur cation
+Ġcare ful
+ten tive
+Ġreview ed
+Ġprovid ers
+Ġstruct ural
+Ġarch itect
+Ġphys iological
+Ġrepresent ing
+Ġlab el
+Ġmucos itis
+Ġprom ising
+Ġpolym orph
+Ġsatis fied
+Ġutil ization
+Ġconnec ted
+Ġinvas ion
+Ġmagn itude
+Ġhem od
+Ġmar ital
+Ġmouthwas hes
+Ġram us
+Ġprognos tic
+erv ative
+Ġedentul ous
+Ġrat s
+Ġanomal ies
+Ġmun icip
+Ġappe ared
+Ġxyl itol
+Ġperiodont ology
+Ġaustr al
+Ġaphth ous
+c enti
+o vir
+p i
+p ly
+p oint
+Ġt etr
+Ġa ther
+al g
+Ġc os
+Ġf if
+Ġf el
+Ġre tentive
+Ġh ar
+Ġh ol
+Ġe coh
+ec utive
+Ġg as
+os a
+am ed
+am ph
+Ġper m
+Ġper centi
+Ġcomp ress
+Ġdis ability
+Ġdif f
+em ber
+Ġco ver
+ther n
+Ġcons ervative
+Ġqu ad
+Ġun s
+ph a
+Ġi os
+Ġop tical
+Ġplan ing
+Ġgreat est
+Ġexpl ored
+ffici ents
+Ġthir ds
+Ġbrush ed
+Ġdiab etic
+Ġavail ability
+Ġattach ments
+Ġsw allow
+Ġcorresp ond
+Ġstim ulated
+Ġgrad ually
+Ġwall s
+Ġmicrobi ological
+Ġcoe fficients
+ipl es
+Ġmy op
+Ġgran ul
+Ġprinc iples
+Ġbal ance
+Ġattend ance
+Ġcall ed
+Ġlat ter
+Ġcv mi
+Ġacad emic
+Ġtonsillolith s
+Ġmastic atory
+Ġname ly
+Ġremod eling
+Ġfinanc ial
+Ġadjunc tive
+Ġrin se
+Ġecoh is
+1 2
+a h
+l f
+n as
+in ine
+on ion
+Ġc it
+le ms
+ec e
+os ity
+os cl
+un e
+Ġgro und
+Ġdis ting
+Ġrec essions
+Ġinter group
+ograph ics
+Ġobser vers
+Ġman ner
+pos ite
+Ġradi olog
+oun ced
+cr ib
+Ġtrans f
+Ġlimit s
+Ġmet ric
+Ġinflu ences
+Ġdo xy
+of lu
+Ġprof il
+Ġcompos ed
+Ġconsider able
+Ġestim ation
+Ġwill ing
+Ġequ ip
+Ġreflec ted
+Ġvisit ing
+Ġcalcul ate
+Ġmultivari able
+Ġinterpre ted
+Ġq lf
+Ġaddress ed
+Ġreferral s
+Ġsupple ment
+Ġram ec
+Ġoffic e
+Ġoffic es
+Ġwil lems
+Ġcapt ured
+wh ile
+Ġgre en
+Ġinpati ents
+Ġdetermin ants
+Ġgover n
+Ġdisting u
+h c
+r ane
+t on
+Ġ ery
+Ġt gf
+Ġs low
+Ġo w
+Ġc och
+Ġp se
+Ġd ap
+Ġm om
+ro gen
+Ġh r
+Ġl ist
+Ġv aries
+Ġr r
+Ġres ection
+Ġind eed
+Ġnot ably
+Ġpl ots
+Ġcons tit
+Ġcons ecutive
+Ġob str
+Ġrec overy
+Ġcar ri
+ard s
+Ġag reed
+Ġsim ulate
+Ġmean ing
+Ġclass es
+Ġdem ographics
+Ġits elf
+Ġset s
+Ġins ignificant
+Ġconduc t
+anc ies
+Ġfill er
+Ġvi able
+ins ic
+Ġscan ner
+Ġdeg rees
+Ġta x
+Ġstrong er
+Ġmalocclusion s
+Ġcontrib uted
+Ġconcer ns
+Ġcalcul ating
+ocy te
+Ġtransl ation
+Ġhydro xy
+Ġbelie ve
+Ġrecogn ized
+Ġfacilit ate
+Ġmolec ular
+Ġinequ ality
+Ġou ts
+Ġwebs ites
+Ġsubt yp
+Ġeg yp
+Ġrecruit ment
+Ġpse ud
+7 0
+b or
+l ish
+v ance
+Ġs en
+Ġp ut
+Ġp ay
+Ġf m
+Ġre jec
+Ġe ts
+Ġst op
+Ġg i
+il t
+ati tis
+tic ally
+Ġv dr
+Ġal pha
+Ġr idge
+Ġex pect
+Ġex tension
+Ġcl us
+Ġtr i
+Ġsub str
+Ġqu ar
+Ġcor on
+Ġsec tor
+Ġ1 3
+Ġman ually
+Ġchar t
+Ġdr aw
+Ġce j
+unc tional
+omet er
+Ġoste o
+Ġsl ice
+Ġanalyz ing
+Ġscre ened
+Ġgel s
+Ġmorph ological
+Ġepithel ium
+Ġms i
+Ġms l
+Ġassum ption
+Ġchallen ges
+Ġconsequ ences
+Ġcod ed
+Ġmicroscop y
+Ġmill er
+Ġrank l
+Ġnan op
+Ġeng lish
+Ġsurge ons
+Ġmonom ers
+Ġreconstr uction
+Ġreconstr ucted
+Ġirregular ity
+Ġsaf e
+Ġprojec t
+Ġprincip al
+Ġamel obl
+Ġswe et
+cont rol
+Ġather oscl
+Ġpercenti le
+Ġmyop ia
+oflu orescence
+Ġery th
+k es
+x illary
+y ond
+Ġt er
+Ġt ables
+Ġt cp
+Ġa kt
+Ġs fe
+al ateral
+al cin
+Ġan tic
+Ġd ialysis
+Ġm ir
+Ġst om
+om er
+om ial
+Ġv ar
+Ġbe yond
+uc id
+Ġch ain
+Ġsc ar
+Ġun able
+Ġun ilateral
+Ġun ivariate
+ast es
+all ing
+Ġfour th
+Ġstr ict
+Ġ1 8
+Ġbr ief
+Ġcalc ification
+Ġcriter ion
+Ġremo vable
+Ġeduc ated
+Ġocc up
+Ġprot ec
+Ġrequ iring
+Ġang les
+Ġmat ching
+Ġcontr alateral
+Ġrele vance
+Ġcategor ical
+Ġext ended
+Ġsinus es
+Ġallow ing
+Ġfib ers
+Ġbehavior al
+Ġgrad u
+Ġincub ation
+Ġcod e
+Ġpredict ors
+Ġhom ogeneous
+Ġpm u
+Ġminim ize
+Ġlith ium
+Ġtransm ission
+Ġsaf ety
+Ġdiscrep ancy
+Ġdepend s
+Ġig f
+Ġfun gi
+Ġatten ding
+Ġdrin king
+Ġcav itated
+Ġosteoc alcin
+Ġcath ep
+Ġcoch rane
+Ġnanop artic
+m ed
+r d
+Ġs i
+al th
+Ġc ere
+Ġc ma
+Ġp bl
+Ġin g
+Ġan esthesia
+Ġf t
+Ġm ul
+ro vers
+ar ing
+Ġre nal
+Ġe ms
+Ġst ained
+Ġl amin
+Ġn ig
+os an
+os oc
+Ġstud ent
+el ves
+Ġal p
+Ġcom fort
+Ġme h
+Ġpre treatment
+Ġsc r
+Ġcont rovers
+Ġro und
+Ġno ti
+Ġk ore
+Ġpresent ing
+Ġmodel ing
+Ġmo un
+Ġag ent
+Ġsim ulation
+Ġincis ion
+Ġimm ers
+Ġir an
+aren t
+Ġgl az
+Ġstruct ured
+Ġparen t
+Ġatt ended
+Ġang ulation
+Ġmor b
+Ġpulp otomy
+Ġsuper n
+anti tis
+Ġadm ission
+Ġfocus ing
+roph il
+Ġmut ation
+Ġexhib it
+Ġanat omy
+Ġseem ed
+Ġpromot ing
+ax is
+Ġelig ibility
+Ġbehaviour s
+Ġmedi ated
+Ġsubm andibular
+Ġdu w
+Ġvolun te
+crip tion
+Ġenl arge
+Ġpron ounced
+Ġphenomen on
+Ġhemod ialysis
+Ġfel t
+Ġcathep sin
+osoc ial
+5 0
+i ents
+y dr
+z er
+Ġp le
+Ġp ort
+Ġan gi
+Ġf as
+Ġf air
+Ġd im
+ac ill
+il ms
+Ġv ox
+Ġr na
+Ġres ol
+Ġac ryl
+Ġad ip
+Ġcl a
+Ġma kes
+Ġle g
+Ġcan cers
+Ġha z
+Ġun know
+Ġout put
+Ġmeth an
+Ġparticip ated
+Ġstr ain
+ep tid
+Ġdep ic
+Ġunder graduate
+Ġinvestig ator
+Ġinvestig ators
+Ġdistrib utions
+Ġdesign s
+Ġir re
+Ġoccur ring
+til age
+Ġoste otomy
+Ġcompos ites
+Ġfe el
+Ġsol id
+Ġnorm ally
+Ġsuper v
+iel ds
+Ġpsych osocial
+Ġpol ishing
+Ġsn p
+Ġtoothp astes
+Ġimpression s
+Ġsee k
+Ġconver ted
+Ġfloss ing
+Ġincons istent
+Ġbott om
+Ġrein for
+d t
+d ed
+g d
+r itis
+t ure
+on as
+Ġthe ms
+Ġo ct
+Ġc ig
+Ġf ungal
+or ies
+an ge
+Ġb it
+ic ans
+Ġn m
+ud e
+Ġr m
+Ġpro ven
+ot or
+ad es
+ore r
+ib ull
+Ġsh are
+ap p
+ap atite
+op os
+Ġle a
+ell ular
+Ġun iform
+Ġun control
+Ġwe ibull
+Ġout pati
+Ġfin ite
+Ġcor tic
+Ġdec line
+Ġobser ve
+Ġstr a
+Ġimpl antitis
+Ġnon s
+Ġtyp ical
+ds c
+Ġpop ular
+Ġol k
+Ġbas al
+Ġaccur ately
+Ġver ified
+Ġproduc t
+Ġnew ly
+Ġhel d
+Ġpol ished
+Ġdoc tor
+Ġquantit y
+Ġnas ion
+Ġful fill
+Ġadap tation
+Ġanimal s
+Ġalloc ated
+Ġillustr ated
+Ġsuscepti ble
+Ġstar ting
+Ġalb icans
+Ġcounter par
+Ġexclud ing
+Ġide al
+Ġjap an
+Ġprophyl axis
+Ġpredom inant
+Ġcomorb id
+Ġcham ber
+Ġfram ewor
+Ġscienti fic
+men tioned
+Ġcos ts
+Ġunknow n
+Ġthems elves
+2 3
+g ate
+h r
+t g
+Ġa ided
+Ġs ella
+Ġo xy
+Ġp ull
+Ġf dsc
+Ġm ature
+th ood
+Ġb cp
+ul in
+Ġn s
+Ġg dps
+os ing
+Ġcon j
+Ġon to
+Ġon set
+ab ilities
+Ġim bal
+og l
+Ġco ol
+Ġk h
+Ġdet erior
+Ġpo orer
+Ġtim ing
+Ġover c
+Ġmo tion
+Ġdec ont
+Ġsim pl
+Ġsp r
+Ġform at
+Ġop in
+Ġgr inding
+Ġimp acts
+Ġz op
+Ġca ution
+Ġresearch er
+Ġgl uc
+ox ide
+Ġsens ation
+Ġadul thood
+Ġdm fs
+Ġbiof ilms
+Ġtum ors
+Ġguid es
+anti b
+Ġseal ants
+Ġequ ival
+Ġgo al
+Ġgo ing
+Ġfunction ing
+Ġsepar ated
+Ġsitu ations
+Ġmus cles
+Ġcir rh
+Ġexpres s
+Ġvisual ization
+Ġhydro x
+Ġantimicrobial s
+Ġimple ment
+Ġvr f
+Ġelimin ate
+Ġauto antib
+Ġrev ision
+Ġfabric ated
+Ġ202 0
+Ġcontinu ed
+Ġsimultaneous ly
+Ġvect or
+Ġrepa ir
+Ġanaer obic
+Ġcongen ital
+Ġdisag ree
+Ġow ing
+Ġstom atitis
+Ġvar nish
+Ġmorb idity
+Ġcirrh osis
+c an
+l ation
+m ia
+p ps
+r ant
+y cin
+Ġt tm
+Ġa uc
+Ġs na
+al veolar
+er ment
+er osis
+Ġp ush
+Ġp lect
+Ġw ine
+Ġin put
+Ġan th
+Ġan ter
+Ġf und
+Ġm t
+Ġb ad
+us ti
+ere stim
+ur g
+am ous
+tic ed
+Ġv on
+Ġr h
+Ġim t
+Ġus age
+Ġch it
+Ġch air
+Ġad p
+op ro
+Ġperi ph
+Ġinf ants
+ch ool
+Ġun certain
+Ġvari ant
+Ġmeth amph
+Ġ1 00
+Ġund erestim
+Ġsp ont
+Ġj usti
+Ġcorre c
+vers ible
+Ġel ucid
+Ġsch ne
+Ġposition s
+Ġliter acy
+Ġpa e
+Ġpa ediatric
+Ġoh pps
+Ġequ ally
+Ġmes i
+Ġantib ody
+Ġmark er
+Ġsus pected
+Ġspecial ists
+Ġartic ular
+Ġutil izing
+Ġnor way
+Ġsqu amous
+Ġtop ical
+Ġprol onged
+Ġbu ffered
+Ġpapilla e
+Ġrest ored
+Ġobserv ations
+Ġexpand er
+Ġcys tic
+Ġcytotoxic ity
+Ġstreptococ cus
+Ġabsorb ance
+Ġdento alveolar
+Ġdiscr imin
+Ġcit ric
+Ġnanopartic les
+Ġenlarge ment
+Ġacryl ic
+Ġstra ight
+Ġoxy gen
+Ġttm c
+Ġplect in
+Ġmethamph etamine
+Ġspont aneous
+Ġschne ider
+b it
+m p
+t ors
+Ġs ided
+Ġo id
+Ġo uter
+Ġp ix
+Ġin verse
+Ġof fered
+Ġd iv
+Ġm im
+Ġb ivariate
+Ġto x
+Ġh ns
+ac c
+Ġl ive
+Ġl ibr
+om ineral
+im m
+Ġg n
+ce ll
+tr action
+ir able
+Ġse paration
+Ġad ding
+we ight
+Ġit al
+Ġpres chool
+Ġqu ite
+ens ities
+Ġpresent ation
+Ġen ough
+Ġother wise
+Ġgen otype
+ugh t
+Ġcor ro
+Ġph arm
+Ġmethod ological
+Ġmo ist
+Ġdec ember
+Ġindic ations
+Ġchan ging
+Ġdia gn
+ack s
+Ġgener ate
+Ġed a
+Ġli qu
+tor ic
+Ġser ve
+Ġcomple tion
+tim e
+Ġstandard ization
+ob acill
+Ġimm ature
+Ġdemonstr ating
+ox ib
+Ġhyp omineral
+Ġver ify
+Ġmat ch
+Ġconsist ing
+Ġmoder ately
+Ġregion al
+Ġload ed
+Ġpers pective
+Ġaut ofluorescence
+Ġsw it
+Ġapprox imal
+Ġresid ents
+Ġnor th
+Ġgrad es
+Ġhydro gen
+Ġpor tion
+tt es
+Ġmis es
+Ġnod e
+Ġhighl ighted
+Ġbarri er
+Ġlact obacill
+Ġvary ing
+Ġemp ow
+Ġbrazil ian
+Ġrd c
+ocom pati
+Ġcoordin ates
+Ġrp d
+Ġmanufacture r
+Ġdeh isc
+Ġimpair ment
+Ġaccompan ied
+cy cline
+Ġdoxy cycline
+Ġhydroxy apatite
+Ġbit ewing
+Ġcomorbid ities
+Ġchit osan
+Ġoid p
+Ġhns cc
+l ist
+s i
+Ġs f
+Ġs ock
+ed ic
+Ġp it
+Ġan b
+Ġf ed
+Ġf ine
+Ġf ields
+Ġm it
+Ġb ul
+Ġre verse
+Ġe toric
+Ġst ere
+ud ed
+Ġon line
+ab ial
+ter ing
+Ġr ig
+Ġr ays
+Ġch rom
+Ġcomp et
+iv ered
+Ġdis inf
+Ġsc at
+Ġab str
+Ġab use
+Ġint act
+Ġinv isal
+Ġmo b
+Ġcol ony
+Ġ1 5
+Ġmean while
+Ġexamin ing
+Ġradi ological
+Ġsimilar ity
+Ġpath ogenic
+Ġposition ed
+Ġposition ing
+Ġabs orption
+Ġcompl ication
+Ġpers ist
+Ġaut om
+Ġbel ong
+Ġtem pl
+Ġresist ant
+Ġcoh orts
+Ġte le
+Ġbiom echanical
+Ġdel ivered
+Ġmut ations
+Ġansw ered
+Ġpen etr
+Ġten sion
+Ġmicroscop ic
+Ġtren ds
+Ġcheck list
+Ġdrill s
+Ġsupple mented
+Ġpromo ted
+Ġdiscrep ancies
+Ġimmunohist ochemical
+Ġccc ds
+Ġresour ces
+Ġarchitect ure
+Ġouts ide
+Ġegyp t
+Ġatheroscl erosis
+Ġing red
+Ġmul tic
+Ġcla im
+Ġdecont amination
+Ġliqu id
+Ġetoric oxib
+Ġinvisal ign
+c ox
+m m
+s on
+y ing
+in ol
+ti st
+er a
+Ġd c
+Ġd p
+Ġm other
+ro se
+Ġe ver
+Ġn g
+Ġn p
+Ġr aw
+ver ages
+Ġch ile
+Ġdis rup
+em atic
+Ġsc ap
+Ġpl at
+Ġtr ain
+Ġtr igg
+Ġmod ification
+Ġno ticed
+Ġun p
+lec tion
+Ġen amic
+ew ise
+Ġinv ited
+ke y
+Ġbi ocompati
+Ġdiagnos ing
+Ġed ta
+Ġop posite
+Ġcur ing
+Ġ3 0
+Ġmet agen
+Ġlong est
+Ġadj unct
+ob acter
+Ġapp ly
+Ġpal at
+Ġoste ogenic
+Ġinvol ves
+Ġprom in
+Ġenh ancing
+Ġelastic ity
+Ġenc od
+Ġsci ence
+Ġlik ewise
+Ġcandid iasis
+Ġot us
+Ġwil cox
+Ġprotr usion
+Ġperf ect
+Ġinst ance
+Ġshif t
+Ġswallow ing
+Ġcig are
+Ġframewor k
+Ġoverc ome
+Ġwilcox on
+r us
+Ġs es
+ti a
+en sion
+Ġp et
+Ġd pa
+Ġm f
+Ġm ice
+Ġm otor
+Ġb f
+Ġb ic
+Ġto ugh
+Ġst l
+Ġl c
+Ġg aps
+ol abial
+Ġas ian
+Ġr ms
+Ġpro gr
+Ġcom e
+Ġim tm
+Ġch ance
+Ġdis il
+ap se
+Ġsign alling
+Ġap dt
+Ġanal og
+Ġro c
+Ġne ural
+Ġcar tilage
+Ġun f
+Ġk ind
+Ġval u
+Ġdet r
+Ġris e
+Ġdec isions
+Ġcr c
+Ġman n
+Ġradi otherapy
+Ġbec ame
+Ġform er
+Ġgr am
+Ġimp s
+Ġser ved
+Ġ0 0
+Ġz yg
+Ġcent re
+Ġins pec
+Ġprocess ed
+Ġgl oss
+Ġfl at
+Ġpubl ications
+Ġpart ly
+Ġprov in
+Ġimmun os
+Ġendodontic s
+Ġpropor tional
+Ġmarg ins
+Ġct g
+Ġshap ed
+Ġspecial ized
+Ġreflec ts
+Ġstim ulus
+Ġdepart ments
+Ġten ax
+Ġtransl uc
+Ġmineral ization
+Ġpredict able
+Ġsyndrom ic
+Ġplace bo
+Ġquanti fied
+Ġbiomark er
+Ġcf m
+Ġur gent
+Ġpediatric ians
+Ġintegr ated
+Ġinfil tr
+Ġmd as
+Ġswed ish
+Ġabnorm al
+Ġabnorm alities
+Ġremineral ization
+Ġrins ing
+Ġdeform ities
+Ġpis a
+Ġpolic y
+Ġci om
+Ġrecept or
+Ġmel an
+Ġupr ighting
+Ġfrail ty
+Ġmacroph age
+Ġvulner able
+Ġog s
+Ġcurric ulum
+Ġprotec tive
+Ġnoti ce
+Ġduw l
+Ġcounterpar ts
+Ġanth rop
+opro te
+Ġempow erment
+Ġprogr amm
+5 8
+e th
+k er
+o ints
+r il
+r ia
+w th
+w an
+Ġ ure
+Ġ ib
+Ġt p
+Ġt as
+in ated
+ti ves
+Ġp ict
+Ġd f
+Ġd ye
+Ġm ouse
+Ġb and
+Ġb ands
+Ġh u
+ac ari
+ac ryl
+im ination
+Ġus s
+Ġus es
+Ġde position
+Ġcomp an
+em at
+Ġsc en
+Ġap position
+Ġind ia
+Ġfo rest
+ell ow
+Ġmod es
+Ġob t
+Ġint ended
+one y
+olog ous
+ast oma
+Ġspec ified
+adi an
+Ġdisc ol
+Ġgener ations
+te gr
+Ġi o
+Ġform ing
+Ġgr adi
+Ġem g
+Ġz ones
+Ġwor ks
+Ġobtain ing
+Ġimpro ves
+Ġsch ed
+Ġdist ress
+Ġintra operative
+Ġconsider ably
+Ġconsist ently
+Ġinvol ve
+Ġoh s
+Ġpap acari
+Ġdig itiz
+Ġjaw s
+Ġdispl ay
+Ġflow able
+Ġendodontic ally
+Ġcontrib ution
+Ġte gd
+Ġsatis factory
+Ġreason able
+Ġdel ayed
+Ġstim ul
+Ġtop ic
+Ġpromot es
+Ġmaintain ing
+Ġnas olabial
+Ġrepl acement
+Ġmill im
+Ġbin ding
+Ġpass ive
+Ġdrill ing
+Ġmanufact uring
+Ġent ered
+Ġstre t
+Ġincorpor ation
+Ġstar ted
+Ġinequ alities
+Ġdu o
+Ġtherm al
+Ġenzym e
+Ġjud ge
+Ġox ide
+Ġaffili ation
+Ġattem p
+Ġtetr acy
+Ġamelobl astoma
+opos terior
+Ġanter oposterior
+Ġadp j
+Ġdiagn ose
+Ġplat form
+Ġpapacari e
+Ġtegd ma
+7 4
+b i
+h i
+p ass
+on ym
+en es
+en esis
+al s
+Ġc ured
+Ġc ame
+Ġp el
+Ġp eptid
+Ġw is
+Ġd os
+Ġd up
+or ial
+an ol
+Ġb b
+le ts
+ac tic
+Ġl p
+ud i
+Ġcon ce
+Ġcon clud
+id s
+id ent
+Ġper for
+Ġex h
+Ġex ists
+Ġex erc
+Ġgroup ed
+Ġdis cl
+Ġse p
+Ġsc aps
+Ġco x
+ch ym
+Ġtr ism
+Ġmod ifications
+Ġne utr
+Ġaf ric
+Ġint en
+Ġy ellow
+Ġfol d
+Ġdes ired
+Ġar g
+Ġag enesis
+pos ing
+Ġdisc ipl
+Ġclass ify
+Ġsp an
+Ġbl inding
+Ġwor th
+Ġwor ds
+Ġer a
+Ġmulti d
+Ġhygi en
+Ġpulp al
+Ġcap ping
+Ġthick ening
+Ġref lex
+Ġdepth s
+Ġlack ing
+Ġclos ing
+Ġcp i
+ocy cl
+Ġsil ver
+Ġmineral ized
+Ġrepl aced
+Ġhem is
+Ġoff ers
+Ġintegr ity
+Ġnone theless
+Ġsuccessful ly
+Ġnutr ition
+Ġevent ually
+Ġtherm ocycl
+Ġmix ture
+Ġord inal
+Ġattr ition
+Ġvide o
+Ġpreser vation
+Ġlithuan ian
+Ġemb ed
+Ġadvance ment
+Ġconv olution
+Ġupreg ulated
+crib ed
+Ġprofil es
+Ġgovern ment
+Ġsen ior
+Ġvolunte ers
+Ġvox el
+Ġoutpati ent
+Ġdetr im
+Ġinspec tion
+Ġscen ari
+Ġwis dom
+Ġtrism us
+f ungal
+h and
+l o
+n ce
+y les
+z o
+Ġ ud
+Ġthe ory
+Ġp ig
+Ġp ure
+Ġp og
+Ġf iss
+Ġd on
+Ġre n
+Ġn ative
+Ġg p
+Ġv ast
+Ġv gg
+Ġr ich
+Ġr ating
+Ġex ported
+Ġch ip
+Ġpre par
+Ġcl ock
+em en
+end it
+Ġne uro
+Ġaf ore
+Ġen a
+Ġen able
+Ġso le
+Ġdec ided
+Ġ2 4
+Ġmin utes
+Ġform al
+Ġend oc
+Ġindivid ually
+Ġselec tive
+Ġrem ark
+Ġprac tical
+Ġpred is
+Ġapp arent
+ffici ently
+Ġpath ways
+Ġanti fungal
+Ġvit ality
+Ġnorm ative
+Ġhand ling
+Ġref r
+Ġrele ased
+Ġexp endit
+ang er
+Ġcontrib uting
+Ġcari ogenic
+Ġlip s
+Ġview s
+Ġregular ly
+go ing
+acti vity
+acti vation
+anes e
+Ġdefin itive
+Ġquanti fication
+Ġcf u
+Ġtarget ed
+Ġcran ial
+Ġrequire ments
+Ġmetabol ism
+Ġincorpor ated
+Ġautomatic ally
+Ġcc u
+Ġedentul ism
+Ġfabric ation
+Ġrins ed
+Ġincid ents
+Ġhorm ones
+Ġradioluc ent
+oin tegr
+Ġfeas ibility
+Ġpack age
+Ġcomprom ised
+Ġcaregi vers
+Ġorient ation
+Ġcareful ly
+ovir us
+Ġmoun ted
+Ġfas ter
+Ġconj unction
+Ġpromin ent
+Ġdisil icate
+Ġimmunos up
+Ġneutr al
+1 8
+r ical
+t age
+t aken
+z en
+Ġ rom
+Ġt ca
+ti vity
+Ġp k
+Ġp y
+Ġw ors
+Ġm aps
+Ġb all
+Ġh und
+om icro
+ur b
+Ġas king
+Ġcon ometric
+am a
+Ġex er
+Ġex clus
+uc as
+uc tive
+ad j
+Ġch ew
+Ġsh ar
+Ġco urses
+Ġsur pr
+Ġpr ism
+fac ts
+Ġevalu ations
+Ġdec ades
+Ġbr ain
+Ġdef ine
+Ġcur ved
+ak es
+Ġca ucas
+Ġcorrel ate
+Ġfill ings
+Ġfl av
+Ġcomb ining
+Ġfe eding
+Ġsens or
+Ġsoci ety
+ward s
+Ġacid s
+Ġpers istent
+Ġfract ured
+Ġequ ation
+Ġwear ing
+Ġta i
+ang ed
+Ġchr on
+Ġcement o
+Ġwall is
+Ġsqu ared
+Ġbre ak
+Ġclean ed
+Ġ201 8
+Ġtransl ated
+Ġcut ting
+Ġbu ffer
+Ġmonit or
+Ġinstit ute
+Ġfav our
+he ad
+Ġpair wise
+Ġbrux ing
+Ġrecogn ition
+Ġtempor ary
+Ġmolec ules
+Ġcentrifug ation
+Ġhabit ual
+Ġcircum st
+Ġretain ed
+Ġcontinu ing
+Ġincid ent
+Ġdg a
+Ġosse ointegr
+Ġretrie ved
+Ġsulf ur
+Ġcompound s
+Ġwhit ney
+Ġyield ed
+Ġspectr um
+Ġarth ritis
+Ġphotograph s
+osa ic
+Ġmetric s
+Ġpseud ovirus
+Ġrejec ted
+Ġsubstr ate
+Ġmir r
+Ġgluc ose
+Ġperiph eral
+Ġtough ness
+Ġvalu able
+Ġzyg omatic
+Ġgradi ent
+Ġtetracy cline
+Ġdetrim ental
+Ġafore mentioned
+a i
+d ul
+e es
+f il
+i ers
+l imin
+Ġ ult
+Ġ xi
+Ġt an
+Ġt ended
+Ġa rom
+Ġa way
+Ġa lex
+Ġs ession
+Ġw ays
+Ġin ner
+Ġin here
+Ġf ing
+Ġf enes
+Ġd ark
+Ġm ent
+Ġm osaic
+or ic
+Ġb on
+ic ill
+Ġre active
+Ġh c
+om b
+Ġn d
+Ġn ight
+Ġg pt
+ur t
+ce l
+Ġv sc
+res pective
+Ġal d
+Ġr b
+Ġr he
+Ġres orb
+ot rop
+Ġch in
+um in
+Ġpre limin
+Ġcomp ression
+Ġdis tor
+Ġse mi
+oth el
+Ġad en
+ff ering
+Ġco up
+Ġreg imen
+Ġreg ister
+Ġun c
+Ġy emen
+Ġk rus
+Ġwe b
+Ġpo iss
+Ġag p
+Ġsup r
+Ġexper ts
+Ġradi ology
+Ġsp ot
+Ġtyp ically
+Ġextr ac
+Ġbec omes
+Ġunder taken
+Ġbl ot
+Ġend othel
+Ġce mentation
+Ġfr ag
+Ġparamet ric
+Ġir respective
+Ġreview ers
+Ġmechan ics
+Ġeth anol
+Ġvit a
+Ġep is
+Ġhand pi
+gro wth
+Ġalign ed
+Ġhum ans
+Ġachie ving
+Ġmen tion
+Ġcycl ing
+Ġconstr ain
+Ġconstr uct
+Ġvir us
+Ġtoothbrush es
+Ġconsequ ence
+Ġdetect able
+Ġbro th
+Ġread s
+Ġread ing
+Ġhs v
+Ġge ometric
+Ġmar pe
+Ġpass ing
+Ġsa udi
+Ġinterview s
+Ġperson nel
+Ġtumour s
+Ġrestric ted
+Ġhour s
+Ġdirec ted
+Ġdirec tions
+Ġdisp arities
+Ġagg reg
+Ġretur n
+Ġarter y
+Ġkee p
+Ġphoto lysis
+Ġvess els
+Ġmunicip alities
+Ġfif th
+Ġimmers ed
+Ġequival ent
+Ġimt ms
+Ġlibr ary
+Ġlactobacill us
+Ġthermocycl ing
+Ġcircumst ances
+Ġinhere nt
+Ġpoiss on
+0 4
+9 5
+e per
+h s
+h aps
+n c
+o ted
+t ary
+v ine
+Ġt aste
+in ations
+re ct
+Ġs ud
+Ġs ense
+Ġo roph
+Ġo md
+en tical
+Ġc u
+Ġc el
+Ġin e
+Ġf at
+Ġm b
+as ant
+it n
+Ġn os
+tic s
+Ġper haps
+Ġus a
+Ġde al
+Ġde eper
+ys gg
+iv en
+Ġap ril
+Ġtr uth
+Ġrel apse
+Ġun re
+ph one
+Ġar m
+Ġdec om
+Ġ2 3
+ath ers
+Ġsp aces
+Ġmal form
+Ġform ulations
+Ġbl x
+tim es
+Ġdr iven
+Ġposs ess
+Ġterm inal
+Ġid entical
+Ġexperi encing
+Ġocc as
+Ġimm ig
+Ġsmo ked
+Ġprot otype
+Ġuni que
+Ġoste op
+Ġdevelopment al
+ount ered
+ox y
+ox yl
+Ġda i
+Ġhyp o
+Ġdescrib ing
+ta ke
+Ġ5 0
+Ġvol tage
+av y
+Ġnorm ality
+Ġbuc c
+Ġpap ers
+Ġrespond er
+Ġvolum es
+af ter
+Ġrefer ring
+Ġmes h
+Ġaim s
+Ġbo vine
+Ġcp itn
+Ġconstr uction
+Ġsus tain
+Ġadmin istr
+Ġsubst ances
+Ġwa iting
+Ġtub es
+Ġbar s
+Ġill ness
+Ġenc ountered
+Ġdiamet ers
+Ġhouse holds
+omat ous
+Ġbin omial
+Ġhom ogeneity
+Ġphen otype
+Ġpeak s
+Ġnucle ar
+Ġnod es
+Ġabund ant
+Ġcytok ine
+Ġsuperim posed
+Ġcapt ure
+Ġnutr itive
+Ġrestric tions
+Ġeros ion
+Ġenzym es
+Ġmarked ly
+Ġcreat ing
+Ġosteocl ast
+Ġhypothes ized
+Ġpis f
+Ġteach ing
+Ġalle vi
+Ġclar ify
+Ġdegen eration
+Ġradiolog ist
+Ġsubtyp es
+Ġschneider ian
+Ġtox ic
+Ġabstr acts
+Ġexh aled
+Ġud ma
+Ġpog onion
+Ġsurpr ising
+Ġosseointegr ation
+Ġbon fer
+Ġkrus kal
+Ġendothel ial
+b re
+d es
+n ers
+o um
+o tid
+r ax
+t ered
+w here
+z e
+Ġ qol
+Ġt t
+er ies
+Ġp c
+Ġp v
+Ġin ability
+Ġf athers
+Ġd ut
+Ġd ense
+Ġb m
+Ġb od
+ar tile
+us ted
+ul ed
+Ġn urs
+im ent
+ur is
+et al
+os ens
+od es
+uc cal
+ot e
+qu artile
+pl es
+Ġcomp ati
+ial s
+ap er
+Ġhe avy
+Ġap art
+Ġle akage
+end er
+Ġreg ul
+Ġreg istry
+Ġtooth ache
+Ġinter quartile
+ens ed
+Ġvari ants
+Ġk id
+Ġwe alth
+Ġup ward
+Ġinv ag
+Ġcol um
+Ġcr ack
+Ġman aging
+Ġj our
+Ġmicro g
+te en
+Ġmand atory
+Ġconf ig
+br al
+Ġet ch
+Ġwor d
+Ġend o
+Ġce mented
+Ġmulti fact
+Ġmuc oad
+Ġoc n
+Ġpredic ting
+red ict
+Ġiniti ated
+Ġsl ot
+Ġfe br
+Ġphys i
+Ġphys ician
+Ġabs cess
+Ġcap able
+Ġconfirm ing
+Ġaut ologous
+Ġeff orts
+Ġlarge ly
+Ġmes io
+Ġpros thesis
+oma xillary
+roph ic
+Ġcommun ities
+Ġpostoperative ly
+Ġnor thern
+Ġfood s
+Ġhelp ful
+Ġsil ness
+Ġeas ier
+Ġavoid ing
+Ġic u
+Ġsyndrom es
+Ġadap ted
+Ġdown ward
+bm t
+Ġminim ally
+ron i
+Ġprogress ive
+Ġorthodon tist
+Ġelimin ated
+Ġgraf ts
+Ġscrew s
+Ġsubstit ute
+Ġinjur ies
+Ġcentrifug ed
+Ġdisp ers
+Ġemphas ized
+Ġspe aking
+Ġcrystal l
+Ġfeas ible
+Ġharm ful
+Ġdichotom ized
+Ġextreme ly
+Ġcompart ment
+Ġattain ment
+Ġpolymorph ism
+Ġdistingu ish
+Ġantic ip
+Ġcontrovers ial
+Ġopin ion
+Ġmob ile
+Ġingred ients
+Ġunp redict
+Ġunf av
+Ġanthrop ometric
+acryl ate
+Ġembed ded
+Ġhund red
+adj usted
+Ġnurs ing
+Ġmultifact orial
+Ġmucoad hesive
+3 8
+7 5
+8 1
+c ular
+d ay
+f r
+f ts
+h ow
+l oad
+m on
+o fer
+p ir
+u ed
+x ial
+Ġ ions
+Ġt un
+on ate
+Ġo i
+er n
+Ġc ities
+ed ents
+Ġw et
+Ġf ix
+Ġm ess
+Ġm arch
+Ġb ss
+Ġh m
+ul y
+ac er
+Ġl a
+Ġl ich
+Ġl tt
+Ġn ic
+il st
+Ġcon comit
+id al
+id ing
+ab led
+Ġv enti
+Ġv ick
+Ġwh ilst
+um er
+pl an
+Ġsh allow
+ers ens
+Ġsc tg
+Ġap b
+Ġap n
+ia xial
+act ing
+Ġfo a
+Ġcont amin
+Ġcont our
+Ġpl ans
+Ġtr act
+Ġreg ulations
+Ġfin ishing
+Ġcr ude
+Ġ2 5
+Ġsp ine
+Ġhy rax
+Ġmet all
+ulti m
+Ġcondition ing
+arg ed
+Ġsome times
+Ġfr ont
+Ġgreat ly
+art oum
+Ġconduc ting
+Ġapp ra
+Ġprovid er
+Ġsl s
+Ġhyp ersens
+Ġmid w
+Ġsystematic ally
+Ġlocal ized
+Ġcontrib utes
+Ġct cc
+Ġartic le
+Ġ201 9
+Ġmagn etic
+Ġtmj s
+Ġread ings
+Ġhs ct
+Ġtemper atures
+Ġerup ted
+Ġbu ild
+Ġcop ing
+Ġcf nas
+Ġincor rect
+Ġretr action
+Ġcam era
+Ġsar me
+Ġcolon ization
+Ġbal anced
+Ġdefinition s
+Ġepidem i
+Ġfluorid ated
+Ġosteocl asts
+Ġtap er
+Ġaffili ated
+Ġattem pt
+Ġsusp ension
+Ġpu fa
+Ġnation ality
+Ġapplic able
+Ġequip ment
+Ġmeaning ful
+Ġlea ving
+Ġfulfill ed
+Ġcool ing
+Ġkh artoum
+Ġdiv ision
+acc ur
+Ġtele phone
+Ġmf c
+oprote in
+Ġprism a
+Ġrb f
+Ġbonfer roni
+Ġfebr uary
+Ġlich en
+Ġconcomit ant
+Ġvick ers
+a res
+d i
+f low
+f lex
+g one
+m ds
+t ex
+Ġ ultim
+Ġa e
+re am
+Ġth reat
+Ġs ib
+ti um
+en h
+Ġc as
+Ġp anc
+Ġp bs
+Ġw c
+Ġw ant
+Ġin accur
+Ġan t
+Ġan onym
+Ġf us
+Ġd ed
+Ġm if
+Ġm tt
+Ġb odies
+Ġto ler
+Ġl uting
+Ġn ac
+Ġg ma
+Ġwi der
+os in
+Ġas pir
+Ġon going
+Ġper me
+Ġis o
+Ġse aled
+Ġse eded
+Ġdent ofacial
+Ġbet el
+Ġsc ope
+Ġind ustr
+ous ly
+st ream
+Ġro s
+Ġne ut
+Ġinter s
+Ġy o
+Ġover weight
+Ġamong st
+Ġund es
+Ġ2 7
+Ġ2 9
+Ġsurg eries
+Ġfirst ly
+Ġsp ring
+Ġmin istry
+Ġextr insic
+Ġmand ib
+Ġcalc ulations
+Ġi ot
+Ġop mds
+Ġcharacter ization
+Ġbl ast
+Ġz ro
+vic e
+Ġfr ontal
+Ġcle fts
+ob uccal
+Ġpath ogenesis
+Ġdemonstr ates
+Ġiniti ation
+Ġcontr ad
+Ġsu ffered
+Ġsu fficiently
+Ġpa rotid
+Ġlas ers
+Ġcult ures
+Ġregard s
+Ġmm p
+Ġrot ated
+Ġpros th
+Ġact ually
+roph ot
+Ġmark et
+Ġinhib ited
+Ġsubs et
+Ġassum e
+Ġelectr ic
+Ġreach ing
+Ġexce ption
+ect in
+Ġorgan ic
+Ġbro wn
+Ġdefin ite
+Ġhem at
+Ġproblem atic
+Ġdrill ed
+Ġphen otypes
+Ġdiss atis
+Ġtempor al
+Ġpf as
+Ġhighl ight
+Ġcontext ual
+Ġnumer ical
+Ġinhibit ory
+Ġlact ofer
+Ġconver sion
+Ġreflect ance
+Ġremineral isation
+Ġrd na
+Ġprincip le
+Ġwindow s
+Ġcreat inine
+Ġincons ist
+Ġradioluc ency
+Ġspe ech
+Ġox id
+Ġwash ed
+Ġsy ring
+Ġsed ent
+Ġtransport ation
+Ġrecept ors
+Ġanalges ic
+Ġprobiotic s
+Ġadhere nce
+Ġosse ous
+Ġkeratin ized
+Ġspect rophot
+Ġbreath ing
+Ġfric tion
+Ġacceler ated
+Ġovere x
+Ġmoti vation
+Ġorthop edic
+Ġaccoun ting
+Ġaustral ia
+Ġsupplement ary
+Ġglaz e
+zer land
+Ġhaz ards
+Ġmethan ogens
+Ġirre versible
+imm une
+Ġpharm ac
+Ġswit zerland
+Ġbul k
+Ġ00 1
+Ġtas ks
+Ġconclud e
+chym al
+Ġmultid isciplinary
+Ġconvolution al
+Ġprepar ations
+Ġtai wan
+Ġchron ological
+Ġprelimin ary
+Ġextrac ellular
+Ġnic ot
+Ġlactofer rin
+2 0
+4 7
+c ious
+d am
+h y
+i i
+m ber
+m osph
+s ted
+z yg
+Ġt s
+re qu
+al ign
+Ġp ear
+Ġw est
+Ġw its
+Ġan not
+Ġd imin
+Ġd anger
+at um
+an ia
+Ġb ending
+Ġb iaxial
+Ġh rqol
+it a
+it ting
+ac r
+ve mber
+ly tic
+Ġwi res
+et erm
+Ġfor ty
+Ġcon ve
+Ġv l
+Ġcom es
+Ġis q
+Ġch ose
+Ġat mosph
+Ġac et
+Ġac know
+Ġac uris
+Ġass ays
+Ġco il
+Ġco hesive
+Ġpar af
+Ġinf ant
+Ġpl acing
+Ġno vember
+Ġk a
+raph s
+Ġmo ved
+Ġtime ly
+Ġdec edents
+Ġfir ing
+Ġexper t
+Ġdef lection
+Ġless er
+Ġdist urb
+Ġcollec t
+Ġinstru mented
+Ġlength s
+Ġacid ic
+Ġguid ance
+Ġeff ort
+Ġsymptom atic
+Ġmes en
+Ġintere sted
+Ġpolym ers
+Ġclos er
+Ġprec eding
+Ġnecess ity
+Ġstate ments
+Ġexhib iting
+Ġgrad ual
+Ġconcentr ated
+ather apy
+ogr aft
+Ġoperative ly
+Ġsearch ed
+Ġsil icate
+Ġster oid
+Ġpen icill
+Ġexce l
+Ġreal istic
+Ġactive ly
+Ġtend s
+Ġmonit ored
+Ġtf a
+Ġmass eter
+Ġmanufact ured
+Ġthres holds
+Ġsul cus
+Ġauto immune
+Ġmanifest ation
+Ġprojec tion
+Ġmic rom
+Ġgly c
+Ġexclud e
+Ġhypothes es
+Ġmeet ing
+Ġvide os
+Ġvene er
+Ġbound ary
+Ġfric tional
+Ġtransplant ation
+alg ia
+Ġrr na
+Ġter ti
+Ġbrief ly
+Ġnig dul
+Ġsupern umer
+Ġcorro bor
+Ġbiocompati bility
+Ġarom atherapy
+Ġepis odes
+Ġoroph aryngeal
+Ġmalform ations
+Ġkid ney
+81 13
+Ġpanc re
+Ġiot n
+Ġsedent ary
+Ġsupernumer ary
+3 58
+d ba
+g ence
+l ass
+l ined
+m art
+o king
+p cr
+t ability
+t te
+w ha
+x im
+Ġt akes
+en et
+Ġc k
+Ġp ie
+Ġp ips
+Ġp bmt
+Ġin n
+Ġd fs
+Ġb il
+ic it
+Ġh o
+le uk
+Ġe osin
+Ġst ay
+Ġl ub
+Ġl av
+ur ized
+os por
+ol is
+ati al
+Ġal kal
+Ġr ub
+Ġr ater
+Ġr nc
+Ġbe au
+ad a
+ad s
+Ġde le
+pl ied
+Ġgro wn
+ap h
+Ġcl r
+Ġperi operative
+Ġap atite
+ip h
+Ġcan adian
+Ġpl wha
+Ġall ogene
+ch es
+Ġtr ap
+Ġtr action
+Ġmod ule
+Ġreg ulation
+Ġob l
+Ġthere after
+Ġen velop
+Ġpo in
+Ġperform ances
+Ġdur ations
+Ġcor tex
+Ġar row
+Ġchan nel
+Ġ2 8
+Ġsup press
+Ġsp atial
+Ġed m
+Ġhy flex
+Ġtrans ition
+Ġdi ode
+Ġgr a
+Ġconf lic
+Ġvis c
+Ġneed ing
+Ġwor ked
+Ġsecond ly
+Ġend ed
+Ġstandard ised
+Ġel se
+Ġfr ame
+Ġfr ank
+Ġcent ered
+par ative
+Ġins ight
+Ġsmo ke
+Ġloss es
+Ġprot ect
+Ġpath ologies
+Ġpub er
+Ġpub med
+Ġintra ven
+Ġver bal
+Ġproduc ing
+Ġmem ory
+Ġvalid ate
+Ġcompl icated
+Ġpulp itis
+Ġhospital ization
+Ġsym m
+Ġmiss ed
+Ġu k
+Ġret ro
+Ġsyn erg
+oles ter
+Ġ4 0
+Ġintern et
+Ġfree hand
+Ġexam ples
+Ġrot ational
+Ġpan el
+Ġdeep est
+asc ial
+Ġdel ay
+ov ered
+Ġoptim ize
+Ġinstruc tion
+Ġassum ing
+Ġavoid ed
+Ġpredict ability
+Ġinstit utions
+Ġq pcr
+Ġadjust ments
+Ġdocu mentation
+Ġnucle i
+oh ydr
+Ġcarb ohydr
+Ġcompr ising
+Ġther mo
+Ġaesthetic s
+Ġinhibit ors
+Ġsubstanti ally
+Ġprin ting
+ococ cus
+Ġinterd isciplinary
+Ġdeli ver
+Ġbox es
+Ġcommerc ially
+Ġcollab or
+Ġcoordin ate
+Ġhorm one
+Ġagg ress
+Ġmanufacture rs
+Ġstreptococ ci
+Ġsed ation
+Ġretur ned
+Ġinjec ted
+Ġdisadvant aged
+Ġtransform ed
+Ġoverlap ping
+Ġcustom ized
+Ġcdt b
+iver gent
+Ġhar ves
+Ġquad rant
+Ġmom ent
+Ġtax a
+Ġscr atch
+Ġkore a
+Ġresol ved
+Ġsuperv ision
+Ġcortic oster
+Ġpredominant ly
+Ġbelong ing
+Ġtempl ate
+Ġmetagen omic
+Ġdf dba
+Ġdigitiz ed
+Ġexclus ively
+Ġhandpi ece
+Ġjour nal
+Ġhypersens itivity
+Ġnac lo
+Ġneut rophil
+Ġyo uth
+Ġsyring e
+Ġpear son
+Ġmesen chymal
+Ġbeau ti
+Ġallogene ic
+h ab
+h op
+i ro
+k en
+r t
+r an
+r ants
+w a
+x cl
+Ġt g
+Ġs enti
+Ġo il
+al e
+Ġc xcl
+Ġp olar
+Ġw arm
+Ġan emia
+Ġf ren
+Ġd n
+at t
+Ġb t
+Ġre p
+Ġre parative
+Ġh et
+Ġl me
+Ġn amed
+ig ence
+ol i
+am p
+Ġv ap
+res tal
+Ġwh tr
+Ġex isted
+Ġpro xim
+Ġim pos
+Ġim ported
+Ġus er
+Ġus ual
+ap ex
+ap sed
+rom ycin
+em b
+em y
+est inal
+Ġinf er
+ari th
+ch art
+Ġcons cious
+Ġne u
+Ġne igh
+Ġqu ick
+Ġun adjusted
+form ed
+Ġam alg
+ard ed
+Ġwe ights
+Ġar ise
+pres sed
+Ġbi os
+Ġ2 2
+Ġsp m
+Ġdi ast
+Ġdi verse
+Ġli ver
+Ġunder gone
+Ġcomple ment
+Ġ0 1
+Ġselec t
+Ġsm art
+Ġprot ection
+Ġpredic tions
+Ġdist ant
+Ġposition al
+of ascial
+Ġfac ilities
+Ġthir ty
+Ġpul mon
+Ġsl iding
+Ġcomb inations
+Ġfe ed
+Ġep oxy
+Ġcap itation
+Ġestim ating
+Ġpoor ly
+Ġsu ffer
+ptom atic
+Ġhel ps
+Ġret inol
+Ġsyn thes
+Ġpow der
+Ġdispl ace
+Ġflow chart
+Ġgiv es
+Ġgiv ing
+Ġaccess ible
+Ġantib odies
+Ġele vation
+Ġprevent ed
+az ole
+Ġcement um
+Ġadv oc
+Ġgrad ing
+Ġconcer ned
+Ġpolymer ase
+Ġwa x
+Ġsn b
+Ġeas tern
+Ġobjec t
+Ġobjec tives
+ify ing
+Ġge o
+Ġmy algia
+Ġmy ofascial
+Ġlig ature
+Ġfav ored
+Ġra ised
+Ġcheck up
+Ġcho ose
+Ġcorrect ly
+Ġ19 9
+Ġhd p
+Ġdecl ared
+Ġpf ass
+Ġdemineral ized
+Ġisol ation
+Ġhighl ights
+oph il
+Ġarr ay
+Ġprop olis
+Ġprecise ly
+Ġreproduc ible
+wh at
+Ġacad emy
+Ġperf usion
+Ġsilic on
+Ġsilic one
+Ġdigit ally
+Ġkin ds
+Ġopportun ities
+Ġencour aged
+Ġlithuan ia
+Ġcaregi ver
+Ġcompart ments
+Ġlet ter
+Ġaccoun ted
+Ġcompress ive
+Ġcorrespond s
+Ġgranul omatous
+Ġtransf ected
+Ġcoron ally
+Ġadmission s
+Ġpae k
+Ġdehisc ence
+Ġtransluc ency
+Ġmelan oma
+Ġperfor ation
+Ġinten tion
+Ġdon or
+Ġcaucas ian
+otid e
+Ġappra isal
+Ġcas p
+Ġmandib les
+Ġdanger ous
+eterm ined
+Ġlub ric
+Ġharves ted
+Ġimpos s
+Ġamalg am
+Ġpulmon ary
+1 16
+g ian
+h an
+l ind
+n ia
+o ked
+s a
+Ġa er
+Ġa os
+on ectin
+Ġs onic
+en z
+Ġc ess
+Ġw l
+es p
+Ġm w
+at a
+at uration
+an al
+an ian
+Ġb ay
+ro gate
+ar r
+Ġh t
+Ġh app
+Ġe ast
+Ġe ct
+us ive
+Ġl ot
+om ics
+om orph
+Ġn f
+ur ally
+am pl
+Ġper oxide
+Ġr i
+um ina
+Ġgro ss
+op ic
+Ġsur rogate
+st and
+Ġinf r
+Ġro ll
+Ġtr u
+Ġanalys e
+Ġsub d
+Ġinter leuk
+Ġun co
+ost e
+Ġspec ulated
+Ġfin land
+Ġfin nish
+Ġmeth yl
+Ġso u
+Ġar p
+Ġmo i
+Ġcal ip
+tem ber
+Ġchan ces
+Ġsim ply
+Ġman age
+Ġclass ical
+Ġsp s
+Ġmin d
+Ġmal ays
+Ġtrans cription
+Ġform ulation
+Ġconf ined
+int roduc
+Ġol factory
+Ġwor n
+Ġsome what
+Ġcoun s
+Ġins ulin
+Ġcy lind
+Ġrece iver
+Ġdiscus s
+Ġoper ated
+Ġes rd
+Ġsl ope
+Ġcap ability
+Ġcap ital
+Ġcap ita
+Ġmid line
+Ġsex t
+Ġext end
+Ġret rom
+Ġsti r
+Ġmes ially
+Ġcontin ue
+Ġdom inant
+Ġbiom ater
+Ġunderst ood
+Ġconnec ting
+Ġconsum ed
+Ġdoc tors
+Ġplate let
+Ġexce eded
+Ġ201 3
+Ġemploy ment
+Ġcontinuous ly
+Ġic c
+Ġhs p
+Ġcertain ly
+Ġbu ilt
+Ġbelie fs
+Ġdry ness
+Ġfluid s
+Ġnan os
+Ġhd i
+Ġent er
+ili ary
+Ġasym ptomatic
+Ġabut ments
+Ġmedi ators
+Ġshor ten
+Ġexplan atory
+Ġrev ised
+Ġosteobl ast
+Ġcentrifug al
+Ġtext ure
+Ġcys t
+Ġcomplain t
+Ġjud ged
+Ġrp m
+Ġdil uted
+Ġrad ical
+Ġassist ant
+Ġanalges ics
+Ġdemand ing
+Ġinjec tion
+Ġelect ro
+Ġthorough ly
+Ġlet ters
+Ġobstr uction
+Ġclus ter
+Ġadip onectin
+ogl ob
+Ġhydrox ide
+Ġmt bs
+urg ical
+Ġmesi obuccal
+Ġsock et
+Ġautom ated
+Ġbf b
+Ġprovin ce
+Ġib m
+Ġjudge ments
+74 116
+Ġdup l
+Ġexerc ise
+Ġsep tember
+Ġgp f
+Ġsole ly
+Ġexpendit ures
+Ġment on
+Ġresorb able
+Ġdut ch
+Ġunfav orable
+358 74116
+Ġvisc osity
+Ġelse where
+Ġaggress ive
+Ġproxim ity
+Ġhdp cs
+Ġcess ation
+ampl ing
+1 1
+5 3
+a vi
+a que
+c ine
+d x
+d ered
+f l
+i able
+k y
+l amm
+l ands
+t able
+u it
+u ff
+Ġ ;
+Ġ ign
+in ess
+Ġa que
+Ġa ux
+Ġs and
+Ġp ic
+Ġf ro
+Ġf ish
+Ġf to
+Ġm ult
+Ġm art
+Ġm oney
+ar se
+Ġre ag
+Ġre position
+Ġl ing
+om as
+Ġn b
+Ġn in
+ol ds
+Ġcon ical
+Ġcon verse
+id azole
+un ately
+ter dam
+Ġr me
+Ġres on
+ot ella
+iz ations
+ys t
+Ġdis traction
+em ploy
+Ġap ices
+ip id
+Ġpres um
+Ġpres cription
+Ġcons ort
+Ġrec t
+Ġpr one
+Ġpr ice
+Ġsub cl
+Ġun employ
+Ġint ell
+Ġy es
+Ġam mp
+Ġen ables
+Ġen com
+Ġgen omic
+ph y
+ph osph
+Ġmax im
+Ġperiodontal ly
+ex ts
+Ġimpl ications
+Ġbr ing
+Ġlower ing
+Ġsup ine
+Ġgener a
+Ġj c
+Ġj et
+Ġj une
+Ġj oints
+Ġed x
+Ġed ema
+Ġtrans p
+Ġem t
+Ġstand ing
+Ġz ls
+Ġer k
+Ġsecond s
+Ġshould er
+Ġran ks
+Ġel imination
+Ġcoun ted
+Ġexpl oratory
+Ġgeneral iz
+Ġsm ile
+Ġsurgical ly
+Ġoc s
+Ġbacter i
+Ġrequ ested
+Ġanti gen
+Ġtm ds
+Ġdescrib es
+Ġsmall est
+Ġps g
+Ġref ers
+Ġrespond ed
+Ġimmun ological
+itt ance
+Ġsyn ch
+Ġlog arith
+Ġ6 0
+ero zyg
+Ġconstr uc
+Ġcari ogram
+Ġenviron ments
+Ġestabl ishing
+Ġsk ull
+Ġdivid ing
+Ġx en
+scop ic
+Ġnor we
+com ing
+Ġtit les
+Ġrepe at
+Ġrepl ic
+plas m
+Ġphosph oric
+Ġinstrument al
+Ġrecommend ation
+Ġultras ound
+Ġaddress ing
+Ġpass ed
+Ġra ise
+Ġesthetic s
+Ġpor cine
+Ġenrol l
+Ġalter ation
+Ġintegr ation
+Ġpf os
+Ġextensive ly
+Ġrun x
+Ġcolle ag
+Ġeti ological
+Ġfacilit ated
+Ġss i
+Ġabras ive
+Ġampl ification
+Ġprotr action
+Ġgly co
+Ġdeform ity
+Ġexc ision
+Ġfun nel
+inf lamm
+Ġdrin ks
+Ġpolic ies
+Ġjap anese
+Ġirrig ated
+Ġaid s
+Ġopportun ity
+Ġpaste urized
+Ġinterm olar
+Ġprev otella
+Ġovere stim
+Ġdw elling
+Ġaustral ian
+Ġcover ing
+Ġrr t
+Ġcere b
+Ġft cp
+Ġangi ogenesis
+Ġuncontrol l
+Ġimplement ing
+Ġautoantib ody
+Ġpix el
+Ġmim ic
+Ġencod ing
+Ġcigare ttes
+Ġure a
+Ġdiscol oration
+Ġsched uled
+Ġexer ted
+Ġflav our
+Ġfing er
+Ġrhe um
+Ġblot ting
+Ġoccas ion
+Ġadministr ative
+Ġrbf dps
+Ġprosth odontic
+Ġparaf unctional
+Ġterti ary
+Ġpancre atic
+Ġalkal ine
+aph yl
+Ġhet erozyg
+Ġdisplace ments
+Ġimposs ible
+Ġtru eness
+introduc tion
+Ġaque ous
+Ġmult in
+Ġencom pass
+inflamm atory
+h er
+i j
+i end
+l ings
+o ff
+p p
+r anted
+v as
+Ġ ice
+Ġt in
+Ġt gn
+Ġt ang
+Ġth read
+Ġs ic
+Ġp g
+Ġw ard
+Ġin tim
+Ġf s
+Ġd est
+Ġd ensities
+Ġb id
+Ġb ath
+Ġb ones
+is ition
+ic le
+ic idal
+Ġre activation
+Ġre hab
+Ġh oles
+us s
+Ġst aphyl
+ere l
+ec es
+Ġl ib
+Ġl ll
+Ġl acr
+ud d
+et ting
+Ġon c
+am s
+Ġv ent
+Ġv ac
+Ġal i
+Ġper u
+Ġr ft
+Ġex ten
+Ġbe h
+Ġbe verages
+tr ict
+Ġim per
+ut ation
+ut able
+ir ms
+Ġde em
+Ġgro o
+Ġpre ferences
+Ġcomp ens
+Ġdis ch
+Ġsh ared
+Ġad s
+Ġdent ate
+Ġma f
+Ġle ct
+Ġheal ed
+Ġcan cell
+Ġpar ish
+Ġpres cribed
+ch s
+Ġtr ib
+Ġsub tr
+Ġun ex
+Ġun stim
+form in
+Ġint ensive
+Ġam b
+Ġk ing
+ire c
+ograph ical
+Ġag ar
+Ġ2 1
+Ġdisc ern
+Ġsup ply
+Ġsp ain
+Ġed s
+Ġdi ver
+Ġdep r
+Ġcro p
+Ġconf irms
+Ġmet ron
+Ġmet formin
+Ġintr insic
+Ġce ments
+Ġtechn ologies
+Ġel is
+Ġfr iend
+ord ance
+Ġpred etermined
+ob i
+Ġexpl aining
+Ġrandom ised
+Ġpath f
+Ġsl ices
+Ġsol uble
+av ir
+Ġmoder n
+Ġsex es
+Ġlab els
+Ġproper ty
+Ġguid eline
+Ġvolum etric
+Ġsw ab
+Ġpat ency
+Ġadoles cent
+Ġhyper d
+Ġhyper plasia
+Ġpur ified
+Ġexhib its
+Ġil c
+Ġlip id
+ame th
+Ġattrib utable
+Ġens ured
+Ġsn ps
+Ġ201 0
+Ġvisual ized
+Ġcod ing
+Ġheter ogeneous
+Ġbur s
+Ġcut off
+Ġexist ence
+Ġrecip ient
+Ġinterpre ting
+Ġdry ing
+Ġadequ ately
+Ġtur key
+Ġpor phy
+Ġdl ms
+Ġvirt ually
+Ġminor ity
+Ġacqu isition
+Ġillustr ate
+Ġarr ival
+Ġtransm ittance
+Ġarab ia
+Ġmap ping
+Ġmastic ation
+Ġdisadvant ages
+Ġvene ering
+press ive
+Ġwar ranted
+Ġkee ping
+Ġdegen erative
+Ġlabel ed
+Ġwilling ness
+Ġquar ter
+Ġcere bral
+Ġuncontrol led
+Ġelucid ated
+Ġstere omicro
+Ġpersist ence
+obacter ium
+eth yl
+Ġobt uration
+Ġmillim et
+Ġshar p
+Ġbreak down
+Ġmirr or
+Ġyemen i
+Ġfix ation
+Ġventi lation
+Ġsib lings
+Ġundes irable
+Ġrub ber
+Ġpoin ted
+Ġconflic ting
+Ġintraven ous
+Ġsynerg istic
+Ġcorticoster oids
+Ġbeauti fil
+Ġneigh b
+Ġdiast ema
+Ġinterleuk in
+Ġsou thern
+Ġconverse ly
+Ġnorwe gian
+Ġcolleag ues
+Ġrehab ilit
+Ġlacr imal
+Ġdeem ed
+Ġunstim ulated
+Ġmetron idazole
+3 2
+7 9
+c ill
+d al
+l ines
+l ict
+n d
+n ight
+o ud
+p ation
+s terdam
+Ġt u
+Ġt ag
+Ġs ay
+Ġs ph
+Ġc us
+Ġc asts
+Ġc ott
+Ġp ec
+Ġf u
+Ġf er
+Ġm pa
+th y
+an th
+as one
+ic ine
+ro id
+ar ant
+Ġe at
+Ġe ase
+Ġe cl
+Ġl ists
+Ġl ives
+im e
+Ġg ast
+Ġwith dr
+if iers
+ab ec
+Ġr uss
+Ġex ec
+Ġex acer
+Ġpro ce
+tr uct
+ad icular
+Ġch e
+Ġde ad
+Ġme g
+Ġcomp action
+Ġsh ear
+Ġad h
+por al
+Ġnot ewor
+Ġcan ada
+Ġpos iti
+Ġha ir
+Ġcont acted
+ch icine
+Ġro x
+Ġtr ac
+Ġtr acing
+Ġsub l
+Ġinter rup
+Ġafter wards
+Ġam sterdam
+Ġpartic le
+ew ed
+Ġup d
+Ġup ar
+Ġup take
+Ġso ught
+Ġover s
+Ġover view
+Ġover night
+Ġcol chicine
+Ġag o
+Ġimpl anted
+ag ingival
+Ġ2 6
+Ġgener ating
+Ġsp ite
+Ġsp acing
+Ġj uly
+Ġed ges
+Ġmicro s
+Ġchar ts
+Ġop posed
+Ġgr s
+Ġconf ident
+Ġconf lict
+Ġ3 1
+Ġser ial
+Ġsug ary
+Ġloc ally
+Ġrem n
+Ġcent ur
+Ġadj u
+Ġgingival is
+Ġos cill
+Ġimportant ly
+Ġfl or
+Ġsens ory
+Ġanaly tical
+Ġwid esp
+Ġcategor ised
+Ġgood ness
+Ġsurvey ed
+Ġsuper ficial
+Ġseg mented
+Ġpractic ed
+Ġadm itted
+Ġlocal ities
+Ġprior ity
+Ġshap es
+Ġinduc ing
+Ġsuppor tive
+Ġenh ances
+Ġml si
+scop y
+Ġhyd rophil
+Ġtra its
+Ġpolymer ized
+Ġtop ography
+Ġelectr ical
+Ġfit ting
+Ġapex es
+Ġenc oun
+Ġirradi ated
+Ġgran ule
+Ġtraum atic
+Ġcf ss
+Ġaug ust
+thes es
+ili ar
+Ġsupple ments
+Ġretrospective ly
+Ġdiss ol
+Ġorigin ally
+Ġot u
+Ġbackground s
+Ġhighl ighting
+Ġplas m
+Ġincorpor ating
+Ġillustr ates
+Ġfibrobl ast
+Ġprop ensity
+Ġstomat ological
+Ġ202 1
+Ġexact ly
+Ġdentifric es
+Ġord ered
+Ġwash ing
+Ġwebs ite
+Ġprophyl actic
+Ġalle le
+Ġencour age
+Ġpu i
+Ġextra oral
+Ġmacroph ages
+Ġvulner ability
+Ġion omer
+Ġvess el
+Ġapplic ability
+Ġexpect ations
+Ġoccup ation
+Ġdepic ted
+Ġimbal ance
+Ġautoantib odies
+Ġdisagree ment
+Ġital ian
+Ġnotice able
+Ġhygien ists
+Ġscenari os
+Ġsupr agingival
+Ġcompati ble
+Ġcolum n
+Ġepidemi ology
+enh am
+Ġoxid ative
+Ġoverex pression
+Ġpharmac ological
+Ġfeed back
+Ġbay es
+Ġcalip er
+Ġcylind rical
+Ġretrom olar
+Ġfro zen
+Ġreag ent
+Ġreson ance
+Ġenroll ment
+Ġstaphyl ococcus
+erel astic
+Ġexten ding
+Ġelis a
+Ġhyperd ivergent
+ameth asone
+Ġcus ps
+Ġcott on
+Ġgast ro
+Ġexacer b
+Ġnotewor thy
+Ġwidesp read
+Ġhydrophil ic
+c ts
+f old
+f unction
+g ia
+i ac
+k ish
+m er
+m ec
+m od
+s ide
+t ate
+y es
+y cl
+in vas
+Ġs un
+Ġs ial
+en in
+al ment
+Ġc atal
+Ġc iel
+Ġc restal
+Ġp un
+Ġp um
+Ġm ps
+Ġm olds
+Ġb iting
+ar c
+ar in
+Ġre tic
+Ġre ally
+Ġh ap
+Ġh sc
+Ġh ier
+Ġh ind
+Ġn it
+Ġn ose
+Ġn bm
+Ġn urse
+Ġg h
+Ġg onion
+ur ity
+os ed
+if ies
+ol ingual
+il ver
+Ġor ific
+am es
+tic ul
+Ġv ic
+el astic
+Ġal umin
+Ġr ce
+Ġr ab
+Ġr ule
+Ġpro cl
+Ġpro inflammatory
+ant ation
+ign s
+pl ace
+Ġme ticul
+Ġpre ference
+Ġgroup ing
+Ġdis tric
+Ġcl oud
+op o
+odon tia
+Ġap ne
+Ġco op
+ub ation
+se al
+Ġpar a
+Ġpres erve
+ell ed
+ch anged
+Ġtr y
+ach ing
+Ġrel ax
+Ġab ilities
+Ġun m
+Ġun com
+Ġun fort
+Ġun he
+Ġvari ances
+Ġmeth acrylate
+Ġdes irable
+Ġover d
+Ġover growth
+Ġmo ving
+Ġbr idge
+ail s
+Ġradi us
+Ġop c
+ish ment
+der g
+amm etry
+Ġet c
+Ġcondition ed
+Ġplan mec
+ores cent
+ian g
+Ġfr c
+Ġindex es
+ob ser
+Ġins ights
+Ġrequ est
+Ġpot ent
+Ġos tium
+ith romycin
+aw s
+Ġhist omorph
+Ġgu arant
+Ġconsider ations
+Ġrepresent ation
+Ġabs ent
+ral gia
+Ġthick er
+Ġacid ogenic
+Ġref used
+Ġref uge
+Ġload s
+Ġsoc ially
+Ġsu ffering
+Ġmicrob es
+Ġimmun ity
+af ts
+Ġsti ff
+Ġest onia
+Ġax es
+Ġnormal ized
+Ġfib rin
+Ġlocal ization
+Ġclear ance
+Ġpros theses
+wor ds
+Ġhead s
+Ġinhib iting
+Ġreflec ting
+Ġstim ulate
+Ġanat omic
+Ġback ward
+ogr ammetry
+ogr afts
+Ġlear n
+Ġhelp ed
+Ġsubs ets
+Ġens uring
+Ġarti facts
+Ġexce ed
+Ġ201 2
+Ġvisual ize
+Ġemerg ed
+Ġge ographic
+Ġmill ing
+Ġlig atures
+Ġq rt
+Ġbehaviour al
+Ġher bal
+Ġtur kish
+Ġmetast atic
+tt age
+Ġhd l
+Ġnucle otide
+Ġcad her
+Ġfore head
+Ġcomprehensive ly
+Ġds pp
+Ġodont obl
+Ġkey words
+ochem istry
+Ġinhibit or
+Ġshe et
+Ġip s
+Ġemph asis
+Ġsubm itted
+Ġampl itude
+Ġmic ron
+Ġpractition er
+Ġbiops ies
+Ġconcept ual
+Ġindirect ly
+Ġteam s
+Ġide a
+Ġlifest yles
+Ġsilic a
+Ġrad icular
+Ġenl arged
+Ġkin derg
+Ġcure ttage
+Ġinst ances
+Ġinh ab
+Ġretrie val
+Ġrare ly
+Ġarter ial
+Ġconc ur
+Ġconc ordance
+Ġben ign
+Ġben ch
+Ġcat enin
+Ġarth ralgia
+Ġoffer ing
+Ġuns atis
+Ġradiolog ists
+Ġequip ped
+Ġmom ents
+Ġtri os
+Ġsupern at
+Ġspr ings
+Ġfund ament
+Ġuncertain ty
+Ġunderestim ation
+Ġelucid ate
+Ġital y
+Ġdisinf ection
+Ġtrigg er
+Ġpalat ine
+Ġcompan y
+Ġpeptid es
+Ġconce alment
+Ġclock wise
+Ġsulfur ic
+otrop ic
+Ġconfig uration
+Ġcrystall ization
+Ġanticip ated
+Ġunpredict ability
+Ġcontamin ated
+Ġinconsist ency
+Ġspectrophot ometer
+Ġnicot ine
+Ġconve x
+Ġka plan
+Ġsynthes ized
+Ġintell igence
+Ġcereb ro
+Ġrheum at
+Ġheterozyg ous
+Ġbeh ind
+Ġpositi ves
+Ġsubl ingual
+Ġadju vant
+Ġbayes ian
+invas ive
+Ġciel ab
+Ġhier arch
+Ġdistric ts
+Ġplanmec a
+Ġcadher in
+1 4
+5 6
+a ments
+e en
+i k
+i ence
+o zo
+p es
+p ex
+y roid
+Ġ vel
+Ġt i
+in ical
+in ate
+in ance
+Ġa ap
+Ġs aw
+ti r
+Ġc ulti
+Ġc ensus
+Ġp ell
+Ġp unct
+Ġf oss
+Ġf anc
+Ġd d
+Ġd ors
+Ġd sc
+Ġd hc
+Ġm old
+at ase
+Ġb ed
+Ġb if
+as h
+ro om
+ro wn
+ro scopy
+ar a
+ar b
+Ġto ld
+Ġh pl
+Ġl ys
+Ġg f
+Ġg ained
+ol us
+Ġas ep
+Ġv a
+Ġv pt
+Ġal iz
+Ġr ational
+ge ar
+uc h
+tr y
+tr ained
+ant om
+ad y
+ad ed
+Ġstudy ing
+Ġinc on
+Ġme ier
+Ġac tions
+Ġac ycl
+Ġdis par
+Ġbet amethasone
+rom onas
+Ġsc s
+Ġsc ds
+ip t
+Ġco inc
+ther lands
+ia gnos
+Ġcan tile
+Ġpl aces
+Ġall oy
+Ġtr abec
+Ġcons ul
+Ġincl ined
+Ġrel ies
+Ġne o
+Ġne therlands
+Ġsub c
+Ġinter facial
+Ġun changed
+so ft
+rol og
+Ġage ing
+ph ere
+Ġout bre
+Ġsuc rose
+Ġfin ished
+Ġar res
+amin er
+Ġmed ial
+Ġobser ving
+Ġstr ips
+Ġfir m
+Ġdisc arded
+Ġclass ifications
+Ġdef ining
+Ġresp onding
+Ġwell be
+Ġpost graduate
+Ġ3 6
+Ġvis co
+Ġol l
+Ġwor st
+Ġwhere by
+Ġca f
+Ġran ked
+Ġrem ote
+Ġsampl ed
+Ġfr action
+Ġsmo ker
+Ġrandom isation
+Ġcer ti
+Ġcer as
+Ġbrush es
+Ġsl ide
+Ġsl ides
+Ġver tically
+Ġmat ter
+Ġmor ning
+Ġproper ly
+Ġfam iliar
+Ġbond s
+Ġdispl aced
+Ġlack ed
+Ġ6 2
+Ġdifferenti ate
+Ġaccess ing
+Ġte a
+Ġstep wise
+Ġhyper l
+Ġwork flow
+Ġ7 9
+Ġnecess it
+Ġhead gear
+Ġmorph ologies
+az ol
+Ġpsych ometric
+Ġadv ised
+Ġconnec tions
+Ġoptim um
+Ġattrib utes
+Ġtop ics
+Ġcd c
+Ġic g
+Ġwidth s
+Ġge ometry
+Ġge ographical
+Ġmill ion
+Ġphosph atase
+Ġmar king
+Ġdys function
+Ġmach ined
+Ġdocu ment
+Ġadap tive
+Ġeng aged
+Ġsa ved
+Ġspeed s
+Ġcad a
+Ġdecl ined
+Ġna h
+Ġmedi ation
+Ġisol ates
+Ġsignal s
+organ ic
+Ġann ually
+Ġga uge
+Ġprin ter
+Ġqual ification
+Ġnutr itional
+Ġlat est
+Ġmas ked
+Ġrestric tion
+Ġexpand ed
+Ġdepos ited
+Ġampl ified
+Ġrapid ly
+Ġvolun tary
+Ġcs amin
+Ġtap ered
+Ġrad ial
+Ġah i
+Ġcarbon ate
+Ġunlike ly
+Ġmacro des
+Ġcure ttes
+Ġkn ock
+Ġfresh ly
+Ġvect ors
+Ġld c
+Ġinterm edi
+Ġspectr a
+Ġprev ents
+Ġstabil ized
+Ġactiv ating
+Ġdiff ers
+Ġobstr uctive
+Ġkore an
+Ġple asant
+Ġreinfor ce
+Ġns cl
+Ġimbal anced
+Ġhydrox yl
+Ġpix els
+Ġmim ics
+Ġmoist ure
+Ġrig id
+Ġdp bm
+Ġpict ure
+Ġstimul i
+Ġstret ching
+Ġattemp ts
+Ġafric an
+Ġendoc rown
+Ġalex net
+Ġconstrain ts
+oxyl in
+Ġhypo plasia
+Ġae ti
+Ġded icated
+Ġindustr ial
+Ġacknow led
+Ġpenicill in
+ran ial
+Ġnanos ilver
+Ġrect ang
+Ġsubcl inical
+Ġgeneraliz ability
+Ġvac u
+Ġpathf ile
+Ġporphy romonas
+Ġrehabilit ation
+Ġtrac ings
+Ġcentur y
+Ġapne a
+Ġunfort unately
+obser ver
+Ġcerebro vascular
+Ġrheumat oid
+Ġhpl c
+Ġaliz arin
+Ġoutbre ak
+Ġwellbe ing
+1 9
+6 0
+c ending
+d p
+f oli
+l ay
+m y
+n atal
+o a
+r ine
+r ich
+r ied
+t roke
+u ity
+Ġt b
+Ġt ill
+Ġt ail
+Ġa verages
+re c
+Ġs ighted
+ti g
+en amel
+Ġc itiz
+Ġp ter
+Ġin organic
+Ġf all
+Ġf used
+Ġd omes
+Ġm p
+Ġm bl
+Ġb ac
+Ġb ig
+Ġb igg
+Ġre ferences
+Ġh f
+Ġh udd
+le y
+Ġe hs
+it ants
+us ia
+Ġst ack
+Ġst aging
+ac ies
+Ġl ic
+Ġl ds
+Ġn ations
+Ġn ilt
+im es
+Ġfor t
+id ges
+Ġex ert
+Ġex foli
+Ġpro st
+ot ation
+Ġim ag
+Ġch olester
+Ġpre f
+Ġpre natal
+iv eness
+Ġdis abled
+Ġse ated
+Ġad vice
+Ġcl ot
+Ġco f
+ub lic
+Ġnot able
+Ġpos itivity
+vi an
+Ġfo v
+Ġcont acts
+Ġpl aus
+Ġtr ache
+Ġreg ulated
+Ġacc id
+Ġinter fere
+Ġint ensities
+Ġk ary
+Ġgen otypes
+Ġmodel ed
+erm al
+Ġdifferent ly
+Ġso on
+Ġar te
+Ġmax imal
+Ġbi ased
+Ġbi ases
+Ġbi ochemical
+Ġperiodonti st
+Ġ1 7
+ag l
+Ġsup erelastic
+Ġsp ent
+Ġsp ir
+Ġi ac
+Ġi od
+Ġop g
+Ġpost ure
+Ġcro s
+Ġconf usion
+Ġ3 7
+Ġcomple ting
+Ġz r
+Ġsix ty
+Ġet ched
+Ġend ogenous
+Ġmulti mod
+Ġterm in
+Ġcoun ting
+Ġsch em
+Ġdo ing
+Ġscal ed
+Ġneg atives
+Ġneg lect
+Ġstrength en
+Ġmonth ly
+Ġhyp odontia
+Ġfe a
+Ġfe eling
+Ġpart ner
+Ġhospital ized
+Ġu a
+Ġlight ness
+ma xillary
+Ġold est
+Ġgo etting
+Ġwork place
+Ġble aching
+Ġresid ent
+Ġnecess arily
+ont in
+Ġbiom ass
+Ġinduc es
+Ġadolesc ence
+Ġclinic opathological
+Ġmut ant
+Ġincreasing ly
+Ġreflec tion
+Ġfil ter
+Ġlast ly
+Ġtumor ous
+scop e
+Ġview er
+Ġ9 4
+Ġoptim ized
+Ġoptim istic
+Ġassum ptions
+Ġsn uff
+Ġ201 4
+Ġprep are
+Ġorgan isms
+Ġfit ted
+Ġmalign ancy
+Ġcho osing
+Ġassign ment
+Ġder iv
+Ġaltern ate
+Ġaltern atives
+Ġeng agement
+Ġsupple mentation
+Ġsa id
+Ġrecogn ize
+Ġdiss ection
+Ġbirth s
+Ġmanif ested
+Ġdemineral isation
+Ġglob ally
+Ġray pex
+Ġmc f
+Ġenhance ment
+Ġameric a
+Ġbeg ins
+Ġsummar izes
+Ġcomparative ly
+Ġcv m
+Ġhome ost
+Ġdrop out
+Ġheat m
+Ġana esthesia
+Ġbio active
+Ġcreat es
+Ġden aturation
+crip t
+Ġexc av
+Ġdil ution
+Ġobvious ly
+Ġintrac lass
+Ġrecording s
+Ġteach ers
+Ġdg ct
+Ġtransform ing
+Ġspect roscopy
+Ġupr ight
+Ġwhit ening
+Ġstabil ization
+Ġmoti v
+Ġpolymorph isms
+Ġgas tric
+Ġcarri er
+Ġcarri ers
+Ġsubtyp e
+Ġscar ce
+Ġgradu ates
+Ġlamin a
+Ġhaz ard
+23 2
+Ġdeterior ation
+Ġjusti fied
+Ġcorrec ted
+Ġpae ks
+Ġdiscrimin ant
+Ġclaim ed
+Ġprogramm e
+Ġpict ures
+Ġcompan ies
+Ġpel let
+Ġdos age
+Ġbb pe
+Ġhemis phere
+Ġcemento enamel
+Ġfenes tration
+Ġpv p
+Ġbod enham
+75 232
+Ġmetall ic
+Ġultim ately
+Ġperme ability
+Ġdissatis faction
+Ġpie z
+Ġcarbohydr ates
+Ġsenti ment
+Ġfren ch
+Ġrep ublic
+Ġdangerous ness
+Ġunemploy ed
+Ġuncontroll ability
+Ġflavour s
+Ġcancell ous
+irec tional
+79 75232
+Ġche il
+Ġovers ampling
+Ġalumin um
+Ġrefuge es
+Ġstiff ness
+Ġfundament al
+Ġfoss a
+Ġacycl ovir
+Ġcantile ver
+Ġvisco elastic
+Ġceras mart
+Ġnah co
+Ġcitiz ens
+Ġdomes tic
+Ġbigg er
+Ġhudd art
+Ġcholester ol
+Ġmultimod al
+Ġgoetting en
+2 2
+8 0
+g et
+g ma
+l ated
+l ight
+o ys
+o ber
+o ks
+r f
+s h
+y d
+z d
+z ech
+Ġt ight
+Ġt etric
+Ġt exts
+in ar
+in der
+Ġa a
+on duc
+ti z
+Ġo pt
+er up
+Ġc zech
+Ġp ip
+Ġw al
+Ġin acti
+Ġf ist
+Ġf ather
+Ġf zd
+Ġd ic
+Ġd ro
+Ġd ens
+Ġd ual
+Ġd ice
+Ġd pr
+or ous
+th ma
+Ġb d
+Ġb os
+Ġb hi
+is tal
+Ġre ality
+Ġre uter
+Ġh all
+Ġh gf
+Ġe al
+Ġe gg
+us tration
+Ġst v
+Ġst ro
+ul s
+Ġl r
+Ġl igation
+om onas
+Ġn ick
+Ġn erv
+Ġg on
+Ġg ot
+Ġg ently
+ur ated
+ur face
+os al
+ce mic
+Ġas thma
+il ibr
+od ent
+od istal
+ati le
+Ġv ill
+Ġv iment
+Ġr ib
+Ġex on
+Ġpro pose
+Ġres erv
+Ġres net
+Ġbe aring
+ot al
+oc ity
+Ġch ief
+Ġat cc
+Ġac ts
+og ingival
+Ġsh r
+Ġsh ang
+ap pro
+Ġcl en
+Ġsc l
+Ġsc op
+ip ping
+Ġfo res
+Ġha em
+Ġro d
+Ġro i
+Ġtr ack
+Ġtr aced
+Ġrel ating
+Ġinter act
+Ġinter can
+Ġun a
+Ġk ol
+olog ist
+so ver
+Ġdet erg
+Ġgen otoxic
+str uct
+Ġar ms
+Ġar bit
+Ġph y
+adi ly
+Ġnon invasive
+pos able
+Ġdisc ontin
+Ġgener ational
+Ġsp ear
+Ġj ama
+Ġmicro soft
+Ġi oss
+Ġi hc
+Ġtrans ient
+Ġop aque
+Ġimplant ology
+Ġknow ing
+Ġmon olith
+vers al
+Ġdr ink
+Ġstandard ize
+Ġel apsed
+Ġproced ural
+Ġexpl oring
+Ġflu orescent
+ha i
+Ġir on
+Ġsch olar
+Ġsch ematic
+Ġscal ers
+Ġsit ting
+Ġreview ing
+Ġoper ations
+Ġcer am
+Ġfac em
+Ġlo ose
+Ġsl im
+clus ive
+Ġ5 6
+Ġps i
+Ġexpression s
+Ġhum idity
+Ġsex ual
+Ġscan ners
+Ġpa id
+Ġdiagnostic s
+Ġlab or
+Ġconfirm ation
+Ġconfirm atory
+Ġsequ ential
+Ġret est
+erg ed
+Ġpd gf
+Ġirr itation
+Ġexp ensive
+Ġdispl ays
+Ġequ ations
+Ġlife time
+Ġprior i
+Ġclos est
+Ġrot ations
+etr ical
+Ġmut ated
+Ġsk ewed
+Ġlast ing
+Ġutil ised
+Ġchem ok
+Ġconsum ing
+cep ts
+Ġshort est
+Ġconsequ ent
+Ġincub ator
+Ġrepe ti
+Ġorgan ized
+Ġbro ken
+Ġnas oph
+Ġread ability
+Ġbur sts
+Ġrepl ace
+Ġopen ed
+Ġmill ed
+Ġsem inar
+Ġfav or
+Ġhom ogenous
+Ġaccept ance
+Ġher pes
+Ġnan o
+Ġdown reg
+Ġaug mented
+opath ic
+Ġent r
+Ġmis align
+Ġcre ation
+Ġhis pan
+Ġadop ting
+Ġacqu ire
+Ġfacilit ates
+Ġhistological ly
+Ġindepend ence
+Ġarr ived
+Ġpi ece
+Ġelimin ating
+Ġmolec ule
+Ġste ady
+Ġemp ir
+Ġosteobl astic
+Ġcys ts
+Ġcircum ference
+Ġdirec tional
+Ġposts troke
+Ġsurround ed
+Ġ200 7
+Ġhorm onal
+Ġadvantage ous
+Ġemphas ize
+Ġget ting
+Ġcrystal s
+Ġatten u
+de hy
+Ġdeh ydr
+Ġassist ance
+Ġintrac ranial
+Ġpt v
+Ġirrig ants
+Ġdisadvant age
+Ġopportun istic
+Ġinh er
+Ġvascular ized
+Ġrobust ness
+Ġelect roph
+Ġperm ission
+Ġdiff use
+Ġtransf ection
+Ġconsecutive ly
+Ġoccup ational
+Ġnig er
+Ġple i
+Ġangi ogenic
+Ġreinfor ced
+Ġoct ober
+Ġmesi odistal
+Ġhypomineral ised
+Ġdehisc ences
+Ġsock ets
+Ġscat ter
+Ġcigare tte
+Ġgloss itis
+Ġflat ten
+Ġworks hop
+Ġattemp ted
+Ġremark able
+Ġimmunosup pressive
+Ġdistor tion
+Ġcoup led
+Ġdecom position
+Ġallevi ate
+Ġinvag inated
+Ġphysi ologic
+load ed
+Ġmess age
+Ġmidw ives
+Ġlichen oid
+Ġatmosph ere
+Ġck d
+Ġneutrophil s
+Ġcheckup s
+Ġcasp ase
+oglob in
+Ġaux iliary
+Ġsand bl
+Ġmart ens
+Ġlogarith mic
+Ġglyco lysis
+Ġprosthodontic s
+Ġmultin omial
+Ġunex pected
+Ġcrop ped
+Ġstereomicro scope
+Ġrox ithromycin
+Ġrab bit
+Ġunm et
+Ġinhab itants
+Ġconcur rent
+Ġvel ocity
+Ġknock down
+Ġpter yg
+Ġcros sover
+Ġreuter i
+Ġviment in
+Ġshang hai
+Ġintercan ine
+Ġmonolith ic
+Ġhispan ic
+Ġdehydr ated
+" ,
+2 6
+2 23
+9 18
+a is
+b g
+g bo
+n o
+o ir
+u ts
+v ar
+w s
+y an
+z z
+Ġ ys
+Ġt al
+Ġa w
+Ġa ver
+Ġth yroid
+on ge
+Ġs an
+Ġs omat
+Ġo v
+en viron
+Ġp th
+Ġp ess
+Ġw ent
+Ġw om
+Ġw ards
+Ġin appro
+es ts
+Ġan ten
+Ġof d
+Ġf tir
+Ġd t
+Ġd um
+Ġd ress
+Ġm i
+at us
+ro ot
+Ġre ly
+Ġto day
+Ġh ri
+le vel
+Ġe z
+Ġe yes
+Ġst one
+Ġst ai
+ul ts
+ul atory
+Ġl ies
+Ġl ived
+Ġl dl
+om nia
+im b
+Ġg ent
+ud ine
+Ġcon cepts
+Ġor b
+Ġper ic
+Ġper tain
+Ġcom ments
+tr ations
+ot es
+ut aneous
+ir n
+ver ty
+oc er
+oc ation
+oc king
+Ġde v
+ain age
+og or
+Ġdis trict
+Ġdis posable
+Ġhe ights
+Ġma kers
+Ġsc ais
+Ġind ian
+Ġinf ra
+Ġcont ents
+Ġro les
+Ġro oted
+Ġtr ay
+Ġreg ime
+Ġanalys ing
+Ġrel ig
+Ġrel uct
+Ġsub traction
+Ġun erup
+Ġk u
+Ġk ill
+Ġlevel ing
+ost aining
+Ġen rich
+Ġmay be
+Ġpo verty
+Ġso f
+Ġcol omb
+ber g
+Ġsec tioned
+Ġfour teen
+Ġindic ative
+Ġbr an
+ag on
+ag er
+Ġman g
+Ġcompar ability
+Ġnon c
+Ġdisc overed
+Ġclass room
+Ġj u
+Ġmicro pl
+Ġmicro struct
+Ġcomm it
+Ġmin ute
+Ġcalc ified
+Ġprob es
+Ġprob able
+Ġi root
+Ġtrans g
+Ġtrans versal
+Ġdep ended
+Ġlimit ing
+int estinal
+Ġem er
+Ġfre ed
+Ġtotal ly
+Ġfig s
+Ġdr ainage
+Ġradiograph ically
+Ġinfl amed
+par amet
+Ġsm irn
+uct u
+Ġins tal
+Ġins omnia
+Ġapp end
+Ġdo ub
+Ġbacter icidal
+Ġpla ques
+Ġcy lin
+Ġprot ozo
+Ġfac ed
+Ġgu ard
+Ġfl uctu
+Ġatt ack
+Ġperce ive
+Ġ5 2
+Ġ5 7
+Ġsol ub
+Ġhard ly
+Ġmem ber
+Ġfluor osis
+Ġcap illary
+Ġcap abilities
+cal e
+Ġhum id
+Ġdm p
+Ġbiof unctional
+ou ts
+vir al
+Ġimmun ostaining
+Ġsw iss
+Ġseal ant
+Ġadd itive
+Ġ4 8
+Ġcontin ues
+Ġrespons ibility
+Ġgo ogl
+iel ding
+Ġreason ably
+Ġresid ential
+roph obic
+Ġhead ache
+Ġpsych i
+Ġpur ch
+Ġpur ification
+Ġadv ances
+Ġx gbo
+Ġhyd rophobic
+pri ate
+Ġ8 2
+Ġlear ned
+Ġms a
+ocy tic
+Ġsn oring
+Ġappropri ately
+Ġclean lin
+Ġtit le
+Ġplate lets
+Ġnat urally
+Ġapex dal
+Ġbro ther
+Ġev olution
+Ġgran ulation
+Ġbelie f
+Ġhem oglobin
+Ġve get
+Ġmar ried
+Ġcho ices
+Ġpm j
+Ġtarget ing
+Ġadap t
+Ġpor ion
+Ġrepeated ly
+Ġrequire ment
+Ġrc f
+Ġsugar s
+Ġdiss olution
+Ġaff lu
+Ġaff irm
+Ġcompr ises
+Ġnod ule
+Ġsuperior ity
+Ġanch or
+Ġrest ore
+Ġsar c
+Ġroutine ly
+aff in
+Ġcn ns
+Ġqual ified
+Ġstrati fication
+Ġstar ts
+Ġeffici ently
+aryn x
+Ġcc n
+Ġweak ness
+Ġdefici encies
+Ġalb anian
+Ġampl ic
+Ġretain er
+otom ies
+Ġsetup s
+Ġmix ing
+ocom ial
+Ġemphas izes
+Ġreveal s
+Ġreveal ing
+Ġanomal y
+Ġintrac anal
+Ġkn ew
+Ġsuperimposition s
+Ġimmunohist ochemistry
+Ġemb ase
+Ġccc s
+Ġbound aries
+Ġprovision al
+Ġcurric ula
+Ġquantify ing
+Ġmunicip ality
+Ġdiff usion
+Ġdistingu ishing
+Ġstop ped
+Ġclus ters
+Ġdraw back
+Ġgradu ation
+Ġlamin ate
+Ġcomfort able
+Ġfair ly
+Ġdim er
+Ġleg al
+ange ment
+Ġlea ve
+Ġsimpl ified
+Ġspr ay
+Ġfed eral
+Ġmultic ent
+Ġnp v
+Ġpel lets
+Ġdos es
+Ġafric a
+Ġdiscipl ining
+Ġspan ish
+Ġscenari o
+Ġremark ably
+Ġpredis posing
+Ġfenes trations
+Ġine v
+Ġnos ocomial
+Ġbucc olingual
+osens ory
+Ġmicrog raphs
+Ġant agon
+Ġfus obacterium
+Ġlav ender
+Ġquick ly
+Ġect opic
+Ġdupl icate
+ipid emia
+Ġconstruc ts
+Ġwithdr aw
+Ġremn ants
+Ġgastro intestinal
+Ġpun ishment
+Ġgh ost
+Ġorific e
+Ġmicron ucle
+Ġbench mark
+Ġunsatis factory
+Ġconvex ity
+Ġpunct ure
+Ġfanc a
+Ġcerti fied
+Ġintermedi ate
+Ġaeti ology
+Ġrectang ular
+Ġplaus ible
+Ġspir al
+Ġhomeost asis
+Ġegg er
+Ġnick el
+Ġnerv ous
+Ġgon ial
+ilibr ium
+Ġreserv oir
+Ġscop us
+Ġarbit r
+Ġphy tate
+Ġspear man
+Ġfacem ask
+dehy de
+Ġelectroph ores
+223 918
+Ġsomat osensory
+environ ment
+Ġinappro priate
+Ġanten atal
+Ġcylin der
+Ġgoogl enet
+Ġxgbo ost
+Ġcleanlin ess
+223918 5
+4 5
+f urt
+i ation
+m etic
+m ogor
+o tic
+p oints
+t ons
+u tious
+y r
+Ġt ell
+Ġt ds
+Ġa ic
+Ġa ud
+Ġth al
+Ġs ure
+Ġs ds
+Ġs dr
+ti se
+Ġo ss
+al ing
+Ġp ir
+Ġp fe
+Ġw el
+Ġw ds
+Ġw elf
+Ġan x
+Ġf ta
+Ġd ied
+Ġd yn
+Ġm h
+or f
+Ġb p
+Ġb us
+Ġb ow
+ar ten
+Ġre act
+Ġre versible
+Ġh an
+Ġh old
+Ġh oney
+Ġe f
+Ġe i
+Ġe ba
+it an
+Ġl n
+Ġl onge
+om od
+Ġn y
+Ġn ut
+Ġg ic
+os ening
+ce ption
+ol ated
+ol itan
+Ġas ia
+Ġas certain
+Ġcon tig
+id enti
+id den
+Ġor s
+Ġv ivid
+Ġv ice
+el ve
+Ġal ve
+Ġper p
+Ġper ir
+Ġr ing
+Ġpro ve
+Ġpro of
+Ġcom ment
+tr a
+tr ans
+ant on
+ir r
+oc ar
+Ġch ond
+Ġat rophic
+Ġcomp ut
+Ġdis app
+Ġsh ir
+Ġcl ones
+em ble
+Ġind ones
+ub e
+pec ific
+Ġcan cel
+Ġpar affin
+st able
+st atic
+Ġinf usion
+Ġpl ayed
+Ġperiodon tics
+Ġreg ulate
+Ġacc ounts
+Ġrec omb
+Ġrel ate
+fac es
+Ġinter faces
+Ġun stable
+Ġint ens
+Ġint ubation
+Ġy a
+ater ally
+Ġk i
+Ġk il
+ast ing
+Ġincre ments
+Ġcor poral
+Ġph one
+Ġph yl
+Ġcr is
+ex is
+ag g
+pt y
+Ġmicro environment
+Ġextr ap
+Ġpreval ences
+Ġdi oxide
+Ġdevelop s
+ak ers
+Ġdep ict
+Ġpost ulated
+Ġpost treatment
+cer ous
+Ġmet rop
+Ġem br
+Ġem pty
+Ġfig ures
+Ġca utious
+Ġresearch es
+Ġmulti level
+Ġselec ting
+gr ade
+Ġperiod ic
+ob ase
+Ġid i
+Ġmuc ous
+Ġsm d
+Ġsm ell
+Ġdesign ing
+Ġdesign ated
+Ġfill apex
+yn thesis
+Ġcollec tive
+Ġhist ologic
+Ġlo e
+Ġlo oking
+Ġlo osening
+Ġfl aps
+Ġarch ae
+Ġoste ogenesis
+Ġoste ocytes
+Ġoste ocyte
+Ġprof ound
+Ġpul sed
+Ġ5 5
+Ġ5 9
+oid al
+Ġep pend
+Ġtherap ies
+Ġhand s
+Ġpulp s
+Ġyoung est
+Ġload ings
+Ġmid azol
+Ġlas ted
+Ġdig ested
+Ġbel onged
+Ġpow dered
+Ġconven ience
+Ġest rogen
+Ġprem ature
+Ġta q
+Ġdistal ly
+ink age
+Ġ7 5
+Ġresid ue
+roph y
+Ġvir ul
+Ġshap ing
+Ġstim ulating
+Ġadmin ister
+Ġsepar ator
+Ġ9 5
+Ġpower ful
+Ġphot ogrammetry
+Ġsubs id
+ocy t
+Ġsearch ing
+Ġexce eding
+ect omy
+Ġtransl ations
+Ġread er
+Ġtend er
+Ġdam aging
+Ġrepl antation
+Ġcertain ty
+plas mic
+Ġirradi ance
+Ġtarg ets
+Ġdisord ered
+Ġultras on
+Ġdys bi
+ogram s
+Ġcop ies
+Ġadverse ly
+Ġeng age
+Ġeng ine
+Ġent ry
+Ġlin ks
+Ġnucle us
+Ġnucle atum
+Ġiv obase
+Ġaff ord
+Ġflex ibility
+Ġanch ored
+Ġpp v
+Ġskill ed
+Ġplot ted
+Ġpreoperative ly
+Ġadop tion
+Ġarr anged
+Ġpi eces
+Ġmd p
+Ġlymph ocytes
+Ġrev isions
+Ġsubm uc
+Ġemp tive
+aryn g
+Ġpersonal ized
+Ġretain ers
+Ġenzym atic
+Ġgly cemic
+Ġulcer ation
+Ġcs i
+Ġcav itation
+Ġintrac ellular
+Ġremod elling
+Ġirrig ant
+Ġadhere nt
+Ġimpair ments
+Ġcomprom ise
+Ġspect rom
+Ġcomorb idity
+Ġaccompan ying
+Ġcat ast
+Ġauthor ities
+Ġdiscr imination
+Ġattain ed
+Ġtransplant ations
+Ġcarry ing
+Ġnc op
+Ġfif ty
+Ġhr k
+Ġconstit uted
+Ġconstit ute
+Ġcarri age
+Ġeryth emat
+Ġstrict ly
+Ġgradu ated
+Ġglaz ing
+Ġport able
+Ġdepic ts
+Ġirre le
+Ġcortic o
+Ġhypomineral ization
+Ġrig idity
+Ġchrom os
+Ġtempl ates
+Ġpenetr ate
+Ġmultic ore
+Ġprovin ces
+Ġpeptid e
+Ġfiss ures
+Ġrom exis
+Ġfavour able
+Ġtan z
+Ġsud an
+Ġdeal ing
+Ġimmig ration
+Ġbucc ally
+Ġsustain ed
+osens itiz
+Ġtun nel
+Ġinaccur ate
+Ġtoler ance
+Ġhemat oxylin
+Ġannot ation
+Ġinn ate
+Ġarrow s
+Ġfrank furt
+Ġpuber ty
+Ġdeliver ing
+Ġpolar ization
+Ġcomplement ary
+Ġadvoc ated
+Ġsext ants
+Ġling ually
+Ġtgn cs
+Ġfs r
+Ġlib yan
+Ġsubtr acting
+Ġking dom
+avir us
+Ġmillimet ers
+Ġtu key
+Ġadh ered
+Ġinterrup ted
+Ġprocl ination
+Ġmeticul ous
+Ġcoop eration
+Ġrelax ation
+Ġguarant ee
+Ġsupernat ant
+Ġva ult
+Ġincon clusive
+Ġhyperl ipidemia
+Ġcada ver
+Ġmacrodes igns
+Ġaccid ents
+Ġarte facts
+Ġtermin ology
+Ġhall and
+Ġshr inkage
+Ġclen ching
+Ġkol mogor
+Ġnasoph aryngeal
+Ġmisalign ment
+Ġys m
+Ġwom an
+Ġez bite
+Ġorb ital
+ocer amic
+Ġfreed om
+Ġsmirn ov
+Ġelectrophores is
+Ġwelf are
+Ġlonge vity
+Ġperir adicular
+Ġmetrop olitan
+Ġeppend orf
+Ġmidazol am
+Ġdysbi osis
+Ġkolmogor ov
+2 000
+9 0
+a rest
+c ode
+d ens
+e em
+e ast
+h u
+h el
+h ou
+j ing
+r ust
+s he
+u its
+y th
+y ad
+y tes
+Ġt il
+in i
+in ter
+in ity
+in ous
+in ized
+on ella
+Ġs tic
+Ġs ore
+Ġs ized
+Ġo mic
+en ic
+al c
+al dehyde
+Ġc oc
+Ġc ied
+Ġc chs
+Ġc anton
+Ġp es
+Ġp ist
+Ġin ex
+Ġan k
+Ġof ficial
+Ġf st
+Ġf ung
+Ġf etal
+Ġd ab
+Ġd ss
+Ġm re
+Ġm erged
+or ate
+an o
+Ġb ord
+Ġb az
+Ġb atch
+is ite
+ic f
+ic ap
+ar th
+Ġre r
+Ġre ass
+Ġh on
+Ġh ole
+le mm
+Ġe lu
+us cular
+ac ial
+Ġl ying
+om ing
+ur able
+ur fact
+os c
+ol l
+ol ic
+ol one
+od i
+od ynamic
+Ġon t
+Ġor ange
+am n
+am atic
+Ġr idges
+ge usia
+Ġres c
+Ġbe gan
+oc al
+iz er
+ore c
+Ġpre requ
+iv ation
+Ġdis ap
+Ġsh se
+Ġsh aring
+Ġad ren
+and ria
+Ġtw elve
+Ġco unc
+Ġtable t
+Ġfo ot
+Ġinf requ
+Ġpres crib
+Ġall ograft
+ch er
+ill ance
+ill onella
+Ġmod ules
+Ġob st
+Ġno ise
+Ġne pal
+Ġne arest
+Ġinter ference
+Ġqu in
+Ġun ple
+form s
+Ġy ielding
+Ġdur ability
+Ġout lined
+str u
+Ġar c
+Ġar ising
+Ġmethod ologies
+Ġevalu ates
+Ġsec ure
+Ġsec tors
+Ġag ric
+Ġag gr
+Ġcal var
+Ġstr ata
+Ġimpl icated
+Ġsim ulating
+Ġbr af
+ag ers
+Ġman aged
+Ġmaxill omandibular
+ric es
+Ġdisc re
+Ġdisc overy
+Ġsp ut
+ult ure
+Ġj n
+Ġextr uded
+Ġcharacter ised
+Ġstat a
+Ġvis ion
+Ġneed le
+Ġer b
+Ġdr ive
+Ġdr amatic
+Ġdeterm inant
+Ġfr ied
+Ġbas el
+ob e
+Ġexpl icit
+Ġmuc ogingival
+Ġrestor able
+Ġir f
+Ġcb cts
+Ġneg l
+Ġgl ide
+Ġpath ogen
+Ġpath ologic
+Ġstrength ening
+Ġcollec ting
+Ġmechan ically
+Ġregression s
+Ġhist opath
+Ġlo zen
+Ġfl ush
+Ġfl aring
+Ġiniti ate
+ox id
+Ġpul pect
+Ġvi ewing
+Ġcomb ines
+Ġver te
+Ġsens itiz
+Ġmat rices
+Ġsol ve
+Ġsoci etal
+Ġmem ories
+Ġsurve illance
+Ġnorm s
+Ġpart y
+Ġapical ly
+pe ared
+Ġlab elled
+Ġtip ped
+Ġaut on
+Ġimmun ore
+Ġanxi ous
+Ġthickness es
+Ġlack s
+Ġ6 3
+Ġ6 5
+Ġ6 6
+Ġest eem
+Ġaccess ed
+Ġaccess ibility
+ero tic
+Ġrot ating
+Ġele ven
+Ġhyper ch
+Ġ7 1
+Ġ7 6
+Ġcycl ospor
+Ġprevent able
+Ġspecial izing
+Ġinhib its
+Ġpol and
+Ġpol ish
+Ġgrad ed
+Ġview ed
+Ġ9 0
+Ġ8 6
+Ġphot os
+Ġphot osensitiz
+line ar
+otyp ing
+Ġplate au
+Ġ201 7
+Ġbu ffering
+Ġfp ms
+Ġethnic ities
+Ġhorizontal ly
+Ġmac rol
+Ġve illonella
+Ġmar row
+Ġaddress es
+Ġdys geusia
+Ġcop ings
+Ġpm bg
+Ġpm icf
+Ġnan jing
+Ġchlor ide
+Ġent ering
+Ġsa os
+Ġdiss em
+Ġdiss ip
+Ġbiological ly
+Ġfibro us
+Ġcarb oxyl
+Ġcyt ometry
+Ġcomputer ized
+cus sion
+Ġexplan ations
+Ġenti ty
+Ġfar si
+Ġprogress ively
+Ġadop t
+Ġmg j
+Ġabr aded
+Ġelimin ates
+Ġattend ees
+Ġasymm etric
+Ġlymph ocytic
+Ġprop ag
+Ġtransm itted
+Ġmig r
+Ġsummar ised
+ra id
+ystal line
+Ġig g
+Ġthin ner
+Ġgly cer
+Ġjud g
+Ġbs p
+Ġosteocl astic
+Ġturn over
+Ġmacro scopic
+Ġpt u
+Ġkin ematic
+Ġteach er
+Ġanalges ia
+Ġmad s
+Ġkn ee
+Ġom ds
+Ġsusp ic
+Ġestablish ment
+Ġdichotom ous
+Ġbroad er
+13 04
+Ġec ological
+Ġacceler ate
+Ġresour ce
+Ġupreg ulation
+Ġjob s
+oster one
+12 47
+Ġsupplement al
+Ġslow ly
+Ġhr b
+Ġeryth ema
+alth y
+Ġimmers ion
+Ġfeel ings
+Ġnons urgical
+Ġjusti fy
+Ġinverse ly
+Ġlive ware
+Ġpit ch
+Ġcompet ency
+Ġscat tered
+Ġdiscl osing
+Ġhemis ection
+Ġpig s
+Ġfiss ure
+Ġren der
+Ġneuro lemm
+Ġformal in
+Ġwors ened
+Ġalex andria
+otrop y
+Ġcoup ling
+Ġfrag ment
+Ġfrag ments
+Ġconstrain t
+Ġvirus es
+Ġine ffec
+Ġimmig rants
+Ġregul ates
+Ġoi irr
+Ġmidw if
+Ġaspir ation
+Ġdimin ished
+Ġdisturb ances
+Ġobl iter
+Ġbios urfact
+Ġht cs
+Ġri yad
+Ġinfr ared
+Ġbiomater ials
+Ġreposition ing
+Ġreplic as
+Ġbid irectional
+��disch arge
+Ġlect ures
+Ġtrib ochemical
+Ġpec king
+Ġoscill ation
+Ġdissol ved
+Ġretic ulum
+Ġkinderg arten
+Ġpell icle
+Ġbif ur
+Ġtrabec ular
+Ġacknowled ged
+Ġvacu um
+Ġlic ensed
+Ġheatm ap
+Ġfist ula
+Ġdic om
+Ġentr ance
+Ġempir ical
+Ġplei otropy
+Ġsandbl asting
+Ġappend ix
+Ġsolub ility
+Ġarbitr ary
+Ġshir az
+Ġrecomb inant
+Ġirrele vant
+Ġomic ron
+Ġcied e
+Ġdisap peared
+Ġcounc il
+Ġunple asant
+Ġaggr av
+Ġsensitiz ation
+Ġkinematic s
+1304 1247
+Ġriyad h
+2 5
+2 00
+3 0
+7 3
+8 04
+9 2
+a q
+b acter
+e i
+f ies
+g t
+k i
+p rom
+p tive
+p ens
+t arily
+v ered
+z i
+Ġt re
+Ġt ab
+Ġt el
+Ġt ie
+Ġt rees
+in ally
+Ġa z
+Ġa ce
+Ġthe ories
+Ġs on
+Ġs as
+Ġs el
+ti oh
+er ated
+er ical
+er ate
+Ġc ot
+Ġp iv
+Ġp age
+Ġw tioh
+Ġin ver
+Ġan esthetic
+Ġf h
+Ġf oci
+Ġd h
+Ġm end
+Ġm ast
+Ġm ss
+Ġm io
+Ġm sc
+Ġm ask
+at ers
+or on
+or rh
+th ing
+an n
+Ġb a
+as ic
+Ġre adily
+Ġre imb
+Ġto uch
+Ġh ot
+Ġh ous
+Ġe ye
+it or
+it ance
+ation ally
+Ġst ock
+ul i
+Ġl am
+Ġl ad
+Ġl ysis
+Ġl odi
+Ġn om
+Ġn cel
+Ġn yst
+Ġn ames
+im ax
+Ġg ather
+ig ible
+Ġwith stand
+os ol
+id is
+ati z
+un tary
+am am
+Ġv en
+Ġv es
+Ġv ort
+el ian
+ter m
+Ġr ug
+Ġpro xy
+uc d
+Ġcom ing
+ir a
+Ġinc enti
+um ination
+pl astic
+Ġme als
+Ġpre treated
+Ġac ting
+og le
+og onal
+ib ilities
+Ġhe ated
+Ġcl sa
+rom y
+ence ment
+Ġperi oste
+Ġoral is
+Ġap c
+Ġap e
+Ġco res
+Ġle x
+st age
+Ġha pl
+ari o
+Ġpl ant
+Ġpl ier
+Ġall ografts
+Ġro ds
+Ġtr is
+Ġmod ulate
+Ġreg imens
+Ġreg ulating
+Ġne ph
+Ġinter inc
+Ġinter active
+Ġqu it
+Ġun w
+Ġun nec
+Ġlow ered
+ens es
+Ġk its
+Ġwe igh
+Ġspec ulate
+erm idis
+Ġdes ire
+Ġris ing
+Ġinv est
+Ġmed it
+Ġmed line
+Ġph aryngeal
+Ġover f
+Ġfound ation
+Ġbi ot
+Ġmo od
+tis ing
+Ġdec ade
+Ġcr i
+Ġag a
+ite k
+Ġbr and
+Ġsystem ically
+Ġman ager
+Ġsup posed
+Ġsup plied
+Ġorth ogonal
+Ġradi ologic
+Ġj ord
+Ġj oin
+Ġmicro t
+Ġcomm encement
+Ġmin ipl
+Ġyear ly
+Ġchar ge
+Ġbec oming
+Ġi e
+Ġtrans duc
+Ġform ul
+ici ous
+Ġgr it
+Ġgr ays
+Ġreduc tions
+Ġunder lined
+Ġimp ly
+Ġ3 4
+Ġ3 5
+Ġintr usive
+Ġplan us
+ores t
+Ġend s
+Ġmulti plied
+Ġfr actions
+Ġfr uit
+Ġcorrel ates
+Ġgeneral ization
+Ġmedical ly
+Ġsm h
+Ġthro at
+Ġunivers ally
+Ġos f
+Ġfac ility
+Ġpal pation
+Ġhist or
+Ġeth yl
+Ġlo ok
+Ġcaus ality
+Ġsl a
+Ġver ification
+Ġanaly tic
+itis h
+Ġproduc es
+Ġinvol untary
+Ġcontr action
+Ġitem ized
+Ġalign ing
+Ġpoly s
+Ġoh l
+ptom ycin
+Ġu z
+Ġvers a
+Ġsyn thetic
+Ġpd c
+Ġequ ilibrium
+Ġ4 6
+Ġintern s
+Ġintern ationally
+Ġest on
+Ġfib rosis
+Ġstrong est
+Ġrespons ibilities
+Ġdistal izing
+Ġgo es
+Ġgo ogle
+Ġte en
+Ġaim ing
+Ġintroduc ing
+Ġpros per
+Ġ7 3
+Ġresid ing
+Ġunders c
+och ond
+Ġmorph ometric
+Ġpress ures
+Ġfil tered
+Ġtumor igen
+Ġdescrip tions
+Ġapproxim ate
+Ġpol itical
+Ġcond ensed
+Ġconcentr ates
+Ġinser t
+Ġphot obi
+Ġms is
+Ġmus cular
+Ġsn acks
+Ġster il
+Ġrecru iting
+Ġconsent ed
+Ġreal ized
+Ġmineral isation
+Ġobjec tions
+fort able
+Ġtend encies
+Ġerup t
+Ġev ol
+Ġgran ted
+Ġve in
+Ġra ising
+Ġpm ta
+Ġnan ocom
+Ġmil an
+Ġstre ptomycin
+Ġsa ving
+Ġbase ment
+Ġcam p
+Ġwr ist
+Ġminim ized
+Ġminim izing
+Ġepid ermidis
+Ġcre vic
+Ġfacilit ating
+Ġperson ality
+Ġarr angement
+Ġmc at
+Ġtn m
+Ġbal ancing
+Ġlact ate
+Ġcapt uring
+Ġweak er
+Ġdefici ent
+Ġelement ary
+Ġcircum maxillary
+Ġbox pl
+Ġprotr uded
+Ġdrop ped
+Ġdrop outs
+Ġ202 2
+Ġlangu ages
+Ġindent ations
+Ġvolun tarily
+Ġdeform ations
+Ġcs bs
+Ġgraph s
+Ġspread ing
+Ġspread she
+Ġaccom pl
+Ġpt g
+Ġefficient net
+Ġbott le
+Ġpredom inance
+Ġcomprom ising
+Ġpreser ved
+Ġpreser ving
+lic ates
+Ġsmooth ed
+Ġborder line
+Ġcontain er
+Ġprev ail
+Ġclar ity
+Ġactiv ate
+Ġarchitect ures
+Ġhol ds
+Ġcompress ing
+Ġdiabetic s
+Ġcorrespond ed
+Ġtax onomic
+Ġgi ant
+Ġopin ions
+Ġfund ing
+urg ery
+Ġrh il
+Ġunderestim ated
+cell ular
+Ġfed eration
+Ġmit ochond
+Ġcompet ence
+Ġchile ans
+Ġdisrup tion
+Ġbiocompati ble
+Ġbic arb
+Ġtransluc ent
+Ġinfiltr ated
+Ġmillim eter
+Ġstret ched
+Ġdup licates
+Ġhygien ist
+Ġimmunosup pression
+Ġzygomatic omaxillary
+Ġsurprising ly
+Ġregul atory
+Ġdispers ion
+Ġdispers ive
+how ever
+Ġwet tability
+Ġinters ection
+Ġ29 3
+Ġcontrad ict
+Ġdefinite ly
+47 6
+Ġacet ate
+Ġmicrom echanical
+Ġbil aterally
+Ġenvelop e
+Ġpuber tal
+Ġcollabor ative
+Ġjournal s
+emb led
+Ġinfer red
+Ġneu rolog
+Ġunco ated
+Ġmalays ia
+Ġfish ery
+Ġtransp arent
+Ġxen ograft
+Ġoverestim ated
+Ġperu vian
+Ġgroo ves
+Ġdiver gence
+Ġdepr ived
+Ġuncom fortable
+Ġunhe althy
+Ġoverd ent
+Ġips ilateral
+Ġhierarch ical
+Ġasep tic
+Ġneo plasm
+Ġarres ted
+Ġiod ine
+Ġpiez on
+Ġcitizens hip
+Ġstro be
+Ġfores try
+Ġdownreg ulated
+Ġtransg ender
+Ġemer ge
+Ġprotozo an
+Ġpsychi atric
+Ġdyn am
+Ġmh di
+omod ulation
+Ġny ucd
+ocar cin
+Ġcris is
+Ġsubsid ized
+Ġfung us
+Ġont ario
+Ġagric ulture
+Ġjn k
+Ġpulpect omy
+Ġcyclospor ine
+Ġsuspic ion
+Ġneurolemm oma
+Ġineffec tive
+prom ised
+Ġmend elian
+Ġreimb urse
+Ġnyst atin
+Ġvort ex
+Ġincenti ves
+Ġinterinc isal
+Ġunnec ess
+Ġgrays cale
+Ġtumorigen esis
+Ġphotobi omodulation
+Ġnanocom posite
+Ġbicarb onate
+5 00
+6 7
+b iotic
+b irth
+c ing
+c ium
+d h
+f en
+f ield
+g a
+g l
+g raphs
+i ant
+j ian
+k n
+o ti
+p tic
+p lying
+r it
+r am
+r ystalline
+v ision
+w ith
+y ed
+Ġt c
+Ġt ro
+Ġt ess
+in yl
+Ġth rom
+on ed
+on ing
+Ġs ick
+Ġs orption
+ti al
+ti les
+Ġo st
+Ġc red
+ed ical
+Ġp ak
+Ġp its
+Ġp amam
+Ġf ever
+Ġf bs
+Ġm ist
+Ġm itek
+at ching
+or tic
+or ally
+th is
+Ġb ases
+Ġb ind
+Ġb iph
+as il
+ic ating
+ro up
+ro red
+ar til
+Ġre vers
+Ġto wn
+Ġh uge
+Ġe k
+Ġe hr
+Ġl ens
+Ġl ining
+Ġn ail
+Ġn ights
+ly cer
+ig lycer
+ud ing
+os keletal
+ce mia
+ol id
+il ed
+id a
+ab s
+am ing
+am ide
+am ount
+am cin
+res ults
+Ġal umina
+Ġr bl
+ot ome
+ical cium
+iz an
+Ġch en
+Ġch at
+Ġch ips
+ain d
+Ġinc ip
+Ġat p
+Ġat yp
+Ġpre clud
+Ġpre trained
+og h
+Ġdis k
+Ġdis abilities
+Ġse man
+Ġse vent
+ial it
+Ġsh ock
+Ġsh ah
+Ġhe avi
+Ġcl one
+Ġtw in
+op ress
+op aper
+Ġsc ler
+Ġco vers
+Ġco arse
+Ġle uc
+Ġle fort
+Ġtable ts
+Ġnot es
+Ġpar as
+Ġpar ad
+Ġpar amount
+ine ph
+ee p
+per i
+Ġall ergy
+ch ar
+Ġtr ied
+Ġmod est
+Ġmod ulating
+cl ass
+Ġno tion
+Ġrec overed
+Ġrel ie
+Ġab bre
+Ġaf raid
+Ġinter p
+Ġinter cept
+Ġqu id
+Ġqu ery
+Ġun e
+Ġun et
+Ġint ense
+ay er
+ist an
+ist ing
+Ġam ph
+Ġk g
+Ġk s
+olog ists
+Ġgen ome
+Ġpo orest
+Ġout per
+Ġout li
+Ġspec ially
+Ġtest osterone
+Ġnum b
+Ġbi k
+Ġbi ology
+Ġcol a
+Ġcol i
+Ġcol gate
+Ġcol orec
+Ġdec ide
+Ġour s
+Ġcr aters
+Ġag ency
+Ġstr ip
+ex aminer
+ag inous
+ag roup
+Ġ2 000
+Ġnon can
+Ġgener ates
+Ġclass ic
+Ġclass ifier
+Ġsp p
+Ġsp arse
+Ġed ar
+Ġdem ands
+Ġconsid ers
+te k
+Ġprob and
+Ġprob abilities
+Ġi at
+Ġi an
+ten ess
+Ġform ulated
+ak er
+ak ed
+Ġli e
+Ġsal es
+Ġcharacter ize
+Ġimp ed
+Ġimp lying
+Ġdetec tor
+Ġmet er
+Ġmon oc
+Ġmon ocl
+Ġem ail
+Ġintr agroup
+br asil
+Ġz e
+Ġer ad
+atic s
+Ġquestion able
+Ġless ons
+Ġsoft ened
+Ġran king
+unc tions
+Ġmulti l
+Ġrem ember
+Ġfr ialit
+Ġcent res
+Ġincis ions
+Ġeduc ating
+Ġins p
+Ġir is
+Ġrece ipt
+Ġprot aper
+Ġpredic ts
+Ġanti se
+Ġanti viral
+Ġdist inc
+Ġpe ers
+omet rical
+Ġnec ro
+Ġoste otomies
+Ġiniti ating
+Ġintra examiner
+Ġdefec tive
+eral d
+Ġsevere ly
+Ġschool ing
+Ġexpos ures
+ta king
+Ġ5 4
+Ġvol atile
+Ġsol ved
+Ġhard ware
+Ġhand icap
+Ġcap s
+Ġcross head
+Ġpoly phosph
+Ġsu it
+Ġeight y
+Ġreli ably
+omm on
+Ġsequ enced
+Ġu v
+Ġsinus itis
+Ġcephal ospor
+Ġdig es
+Ġimmun ocom
+Ġconven ient
+Ġadd ic
+Ġair bor
+Ġprom p
+Ġ4 1
+Ġ6 1
+Ġ6 4
+Ġfree ze
+Ġorig ins
+Ġcontrib ut
+Ġcontrib utions
+Ġct bs
+Ġte hr
+Ġbo ost
+Ġhyper t
+Ġcp c
+Ġ7 2
+Ġact u
+Ġcontact ing
+Ġbiom edical
+Ġcommun ications
+Ġabove mentioned
+Ġdel usion
+Ġspecial ty
+Ġsumm ed
+Ġsumm ing
+Ġfil ms
+osph ate
+Ġchem ically
+ithel ial
+Ġcond yles
+Ġchec king
+Ġphot omicro
+Ġphot odynamic
+Ġens emble
+Ġgum my
+not e
+Ġ201 5
+Ġecon om
+Ġfit c
+Ġconfound er
+Ġemerg ing
+Ġrepl icate
+Ġinterven tional
+Ġcomposition al
+Ġmedic aments
+Ġfav oring
+Ġinterpre t
+Ġve h
+Ġve gf
+Ġsb brasil
+Ġmesial ization
+Ġra j
+Ġpm um
+Ġpor osity
+Ġquantitative ly
+Ġrecogn izing
+Ġretr usion
+Ġram al
+Ġpf na
+Ġdemineral ised
+Ġinterview ed
+Ġplas ter
+Ġnumer acy
+Ġds d
+Ġminor ities
+oph ys
+Ġleuk ocytes
+Ġtrad ition
+Ġincorpor ate
+Ġillustr ating
+Ġsul ci
+Ġcondyle on
+Ġgraf ted
+Ġconver gence
+Ġss b
+Ġrap d
+Ġconsult ants
+Ġentire ly
+Ġown ers
+Ġhere in
+Ġexpand ing
+Ġoverl oad
+fy ing
+Ġpossib ilities
+bo ok
+Ġsecre ted
+Ġsut ural
+Ġ200 5
+Ġden otes
+Ġgraph ene
+Ġemphas izing
+Ġnar r
+Ġexc ised
+Ġradioluc encies
+Ġtheore tically
+Ġemo tions
+Ġpac ifiers
+Ġosteoc onduc
+Ġalle les
+Ġshif ts
+Ġrein stru
+Ġvene ers
+Ġsubt le
+Ġec ology
+Ġfast ing
+Ġorthop antom
+Ġperm utation
+Ġquad as
+Ġslow er
+Ġexpect ancy
+Ġtri amcin
+Ġsubstr ates
+Ġquar ters
+Ġcoron avirus
+Ġmir rored
+Ġcontrovers y
+Ġdepic ting
+Ġpull s
+Ġdeterior ated
+Ġchrom at
+Ġbic usp
+Ġanalog ue
+Ġprogramm es
+emat ological
+Ġstimul ates
+Ġarg inine
+Ġarg ued
+Ġdiscipl ines
+Ġrating s
+Ġrefr ig
+Ġrefr active
+Ġexpendit ure
+Ġpy ram
+Ġwors ening
+Ġaden ocarcin
+Ġunc ommon
+Ġsud den
+Ġfat ty
+Ġosteoclast ogenesis
+Ġtoxic ity
+Ġbod ily
+Ġinvag ination
+Ġunpredict able
+fr ame
+Ġmetall oprotein
+Ġultim ate
+Ġdissatis fied
+Ġts al
+Ġdimin ish
+Ġatmosph eric
+Ġacet on
+Ġcorrobor ated
+Ġho ok
+Ġeosin ophil
+Ġobl ig
+Ġenvelop es
+Ġfrank fort
+Ġvap or
+Ġaer osol
+Ġsubd iv
+Ġbiomater ial
+Ġradical s
+Ġpic o
+Ġnin th
+Ġnin ety
+Ġmaxim ize
+Ġrepeat ability
+Ġdest ro
+Ġali qu
+Ġimper f
+Ġads orption
+Ġads orb
+Ġneighb our
+Ġneighb oring
+Ġruss ia
+Ġproce ed
+Ġupd ated
+Ġflor ida
+Ġplasm ids
+Ġhistomorph ometric
+Ġdispar ity
+Ġtrache ost
+Ġgent le
+Ġpertain ing
+Ġreluct ance
+Ġafflu ent
+Ġsarc oma
+Ġmulticent er
+Ġaic r
+Ġindones ia
+Ġidi opathic
+Ġadminister ing
+Ġcatast rophic
+Ġbord ers
+Ġadren al
+Ġfried man
+Ġlozen ges
+Ġauton om
+Ġphotosensitiz er
+Ġrender ing
+804 476
+Ġcot inine
+Ġpiv otal
+Ġoverf itting
+Ġaga rose
+Ġuz b
+Ġcontradict ory
+Ġpak istan
+Ġbiph asic
+artil aginous
+Ġincip ient
+ineph rine
+Ġabbre vi
+Ġoutli ers
+Ġcolorec tal
+Ġnoncan cerous
+Ġcephalospor ins
+Ġairbor ne
+Ġtehr an
+Ġphotomicro graphs
+Ġtriamcin olone
+804476 9
+, .
+a ved
+b ites
+c ul
+d ec
+e z
+e tical
+g ans
+i us
+n n
+o ul
+o ub
+q hi
+r ial
+t w
+t ude
+u a
+v izan
+w r
+w ell
+x a
+y tic
+Ġt qhi
+in is
+Ġa es
+Ġa ure
+re l
+Ġth ail
+Ġth aw
+Ġs at
+al o
+al p
+al istic
+er ved
+Ġc g
+Ġc ow
+ed ics
+Ġp oles
+Ġw u
+Ġin oc
+Ġin ference
+Ġin activation
+Ġin lay
+Ġan ton
+Ġf ell
+Ġf alling
+Ġd uct
+Ġd ash
+Ġm iti
+Ġm ath
+Ġm ism
+Ġm pi
+at osis
+or otation
+th al
+th ere
+Ġb h
+Ġb ms
+Ġre per
+Ġre form
+Ġh b
+Ġh ered
+it ally
+ul o
+ul arities
+ac char
+Ġl u
+Ġl os
+Ġl um
+Ġl af
+Ġl amp
+Ġl aws
+Ġn est
+Ġn ich
+im eter
+Ġg t
+Ġg w
+Ġg tr
+Ġg arg
+ly mer
+ig m
+Ġwith e
+et ed
+Ġas k
+il ing
+il iter
+il arities
+Ġcon ference
+od ed
+od or
+Ġon coh
+ati veness
+Ġor gans
+am ple
+Ġv an
+Ġv ig
+Ġv ibr
+el ation
+Ġal to
+Ġper cussion
+Ġr up
+Ġr aces
+Ġr acial
+Ġres or
+Ġres usp
+ion al
+uc tions
+uc cess
+ot ox
+Ġis otropic
+ad ing
+ad ays
+Ġus ability
+Ġch eek
+ies t
+Ġde x
+ain e
+Ġat rophy
+Ġac uity
+Ġcomp ares
+Ġcomp uls
+og g
+ib ly
+Ġdis pro
+Ġse at
+Ġsh ade
+Ġhe par
+Ġhe ma
+op eri
+em t
+Ġap par
+ip ei
+Ġnot md
+pec tives
+Ġpos tal
+Ġall erg
+ch ange
+Ġtr unc
+Ġtr iang
+Ġtr icalcium
+Ġmod ifying
+Ġreg istr
+cl ock
+Ġacc ident
+Ġthan ks
+ges tion
+Ġrel ief
+Ġtooth dec
+Ġab i
+Ġab er
+Ġqu inol
+Ġint estinal
+Ġy out
+Ġy ogh
+Ġam oun
+Ġk ar
+Ġwe are
+Ġwe aken
+Ġpresent ations
+lec ted
+Ġen abl
+Ġen abled
+Ġreported ly
+Ġout line
+ass emia
+Ġar rest
+mo id
+lu x
+lu or
+Ġdenti tions
+Ġtime point
+Ġdec alc
+Ġcr acks
+Ġsec ured
+Ġimpl ied
+Ġsim ul
+Ġbr ight
+Ġbr ist
+Ġbr ands
+Ġund oub
+ep ithelial
+Ġman ip
+Ġnon paramet
+Ġgener ic
+Ġappl ies
+Ġclass ifiers
+Ġexper tise
+Ġradi ance
+Ġsp ons
+Ġj o
+Ġcare er
+te es
+Ġhy al
+Ġprob ase
+Ġi q
+Ġmal i
+Ġmal ay
+Ġmal odor
+Ġtrans well
+Ġwell s
+Ġsal vizan
+Ġunder weight
+Ġunder take
+Ġunder taking
+Ġlim b
+Ġimp rec
+Ġconf lu
+Ġ3 2
+Ġ3 9
+Ġser ves
+Ġbl ade
+Ġbl ank
+Ġcomple teness
+Ġ0 3
+Ġz o
+Ġend point
+Ġel ab
+Ġmulti f
+Ġmulti plying
+Ġrem ission
+Ġsome thing
+gr aft
+Ġfr uits
+Ġcoun ties
+par t
+Ġexpl ains
+Ġexpl oration
+Ġmuc operi
+Ġflu ency
+Ġsm hr
+Ġir aq
+Ġoc ular
+ffici ency
+Ġgl ut
+Ġunivers ities
+Ġstrength ened
+Ġlo op
+imension al
+Ġstress ful
+Ġprof ess
+Ġintra observer
+Ġpul ver
+Ġsl ic
+Ġ5 1
+Ġ5 8
+Ġ5 00
+Ġthird ly
+Ġcontr aind
+Ġcompl iant
+Ġcross bites
+Ġrele asing
+Ġmid point
+Ġpers pectives
+Ġpoly ol
+Ġsym ph
+Ġeven ly
+Ġlab elling
+Ġmiss ense
+Ġwhe y
+Ġaut ogenous
+Ġaut orotation
+Ġguid ing
+Ġcult uring
+Ġpat ch
+Ġpat ches
+Ġexp ose
+Ġta ipei
+Ġdifferenti ating
+Ġgo at
+Ġtmd dx
+Ġprote ase
+Ġte fl
+Ġprec ip
+Ġpros pects
+Ġele v
+Ġpan ic
+Ġhypoth etical
+wor k
+Ġ7 0
+Ġ7 7
+och rom
+Ġshap iro
+Ġinduc tion
+Ġcorresponding ly
+Ġfil tek
+Ġutil ity
+Ġx ive
+Ġansw ering
+Ġgrad uate
+Ġshort com
+Ġtra it
+Ġ8 7
+Ġinser ts
+Ġinser ting
+Ġsle e
+ocy cline
+Ġsearch es
+Ġens ures
+Ġmus cul
+itud es
+Ġill umina
+Ġemploy ee
+Ġtmj oa
+Ġread y
+Ġgenetic s
+Ġgenetic ally
+Ġdam aged
+Ġmy c
+Ġbu ff
+Ġmill iliter
+Ġphosph ory
+Ġlig ated
+Ġhem orrh
+Ġmargin ally
+roc ytes
+Ġrecommend s
+Ġhom ology
+Ġess entially
+Ġaccept ability
+Ġcf na
+Ġtur ned
+Ġtransfer ring
+opath y
+Ġdl p
+Ġmis d
+Ġnucle ic
+Ġcirc ular
+Ġcirc ulation
+Ġcirc ulating
+Ġcirc adian
+Ġintegr al
+Ġna ive
+Ġcarb ide
+Ġcyt ological
+Ġorigin ated
+Ġwr ong
+Ġfore ns
+Ġisol ate
+Ġsimple x
+Ġprogress es
+opl astic
+16 9
+Ġsept um
+Ġlact ating
+Ġss bs
+Ġprop ria
+Ġcovari ate
+Ġcovari ance
+angu inis
+Ġelement al
+Ġstomat ognathic
+Ġoverl o
+Ġdepend ence
+Ġcollagen ase
+Ġalb ania
+Ġdepos it
+Ġremineral izing
+Ġvas opress
+Ġcounter clock
+Ġmap k
+Ġrins es
+Ġincid ences
+Ġbio activity
+Ġou a
+Ġgraph ic
+Ġhypothes ize
+15 7
+Ġwash out
+Ġelectron ically
+Ġdeh yd
+Ġabsorb ed
+Ġsy br
+Ġsed iment
+Ġdistin ction
+Ġcure tte
+Ġgap dh
+Ġinjec tions
+Ġvs p
+Ġencour aging
+ole mia
+Ġkeratin ocytes
+Ġkeratin ocyte
+Ġarter ies
+Ġsusp ended
+Ġwavelength s
+Ġsulf ate
+Ġnarrow er
+Ġnarrow est
+Ġinpati ent
+Ġkt w
+Ġorient ed
+Ġanaer ob
+Ġion izing
+Ġdw ell
+Ġcongen itally
+Ġextract ing
+Ġactiv ates
+Ġnow adays
+Ġhol ding
+Ġgranul oma
+Ġgranul omas
+rogen ic
+Ġegyp ti
+Ġquar tile
+Ġcoron ary
+Ġdraw ing
+Ġosteo arth
+Ġeryth ro
+Ġvox els
+Ġadip osity
+Ġleg s
+Ġsuperv ised
+Ġpopular ity
+Ġbasal oid
+Ġsimpl er
+Ġdisagree ments
+Ġrh amn
+Ġcorrec tive
+Ġdiscrimin ate
+Ġcompet ent
+Ġmob il
+Ġingred ient
+Ġever x
+Ġencod er
+Ġsched ule
+Ġdisplay ing
+Ġdiscl os
+Ġdiscl osed
+Ġdiscipl ine
+Ġchip ping
+Ġchew ed
+Ġmirr ors
+Ġunc over
+Ġunre alistic
+Ġosteop er
+Ġallevi ation
+Ġcompati bility
+Ġcolum ns
+Ġinaccur acies
+Ġcorrobor ate
+Ġgra vity
+Ġsymm etry
+ophil us
+Ġlubric ation
+Ġmalays ian
+Ġsext ant
+Ġreposition ed
+Ġsynch ro
+Ġintim a
+Ġimper ative
+Ġgroo ve
+Ġparish es
+Ġamb ulatory
+Ġfriend s
+Ġfer mented
+anth ion
+Ġexec uted
+Ġflor a
+Ġhap a
+Ġdors al
+Ġconsul ted
+Ġreinforce ment
+Ġfall s
+Ġexfoli ated
+Ġkary o
+Ġexcav ation
+Ġcheil itis
+Ġdens enet
+Ġrib s
+Ġdeterg ents
+Ġscholar s
+Ġchemok ines
+Ġinher itance
+Ġniger ia
+Ġflatten ed
+Ġaver aged
+Ġku wa
+Ġenrich ed
+Ġcommit tees
+Ġguard ians
+Ġhumid ified
+Ġpurch ased
+Ġthal assemia
+Ġanx io
+Ġalve olus
+Ġcomput ational
+Ġcancel led
+Ġtanz ania
+Ġcadaver ic
+Ġpist on
+Ġank yl
+Ġresc ue
+Ġprerequ isite
+Ġfoot note
+Ġinfrequ ent
+Ġprescrib ing
+Ġobst ac
+Ġcalvar ial
+Ġnegl igible
+Ġpropag ation
+Ġjudg ment
+Ġobliter ation
+Ġbiosurfact ant
+Ġbifur cation
+Ġsel dom
+Ġinver ted
+Ġmsc s
+Ġhous ing
+Ġven ous
+Ġperioste um
+Ġie hr
+Ġformul as
+Ġteen agers
+Ġprosper o
+Ġcrevic ular
+Ġboxpl ots
+Ġspreadshe et
+Ġefficientnet b
+Ġmitochond rial
+Ġoverdent ure
+Ġreimburse ment
+Ġunnecess ary
+Ġthrom b
+Ġrevers ed
+Ġseman tic
+Ġiat rogenic
+Ġmonoc rystalline
+Ġmonocl onal
+Ġimmunocom promised
+Ġactu ator
+Ġdelusion al
+Ġadenocarcin oma
+Ġaceton ide
+Ġsubdiv ision
+Ġtracheost omy
+Ġaure us
+Ġthail and
+Ġmath ematic
+Ġmism atch
+Ġoncoh ematological
+Ġalto gether
+Ġresusp ended
+uccess ful
+Ġappar atus
+Ġnotmd dx
+Ġtrunc ated
+Ġregistr ies
+Ġtoothdec ay
+Ġyout ube
+Ġyogh urt
+Ġenabl ing
+Ġundoub ted
+Ġnonparamet ric
+Ġtefl on
+Ġshortcom ings
+Ġcounterclock wise
+Ġosteoarth ritis
+" .
+0 5
+4 0
+4 6
+8 3
+b one
+c at
+d a
+d ers
+e f
+e valu
+e ties
+i as
+i lection
+k a
+n is
+n ian
+n utr
+o ter
+o form
+o ured
+p ers
+p inal
+r ate
+s m
+s u
+t an
+u ates
+u tical
+v o
+v is
+y ads
+Ġ erm
+re ci
+Ġth ing
+Ġth ai
+on ec
+on ucle
+Ġs is
+Ġs ort
+Ġs bl
+Ġs oph
+Ġs anguinis
+Ġo val
+al es
+al ation
+er ves
+Ġc odon
+Ġc ree
+Ġc ens
+Ġc me
+ed ip
+Ġp ns
+Ġp ca
+Ġw it
+Ġw kt
+Ġw enz
+Ġin qu
+Ġan co
+Ġan emic
+Ġf c
+Ġf ee
+Ġf asc
+Ġd or
+Ġd an
+Ġd ol
+Ġd uc
+Ġd og
+Ġd yads
+Ġm x
+Ġm ich
+at o
+at ter
+at tr
+at eness
+or osis
+or kers
+an a
+Ġb g
+Ġb ub
+Ġb ites
+Ġb md
+Ġb olus
+as ted
+ent an
+ic in
+ro us
+ro cal
+ro fen
+Ġe als
+it ate
+it ably
+Ġst ad
+Ġst yle
+ac in
+ac et
+Ġl f
+Ġl cr
+Ġl ob
+Ġl osing
+om iting
+Ġn r
+Ġn if
+Ġn af
+im etric
+Ġg ath
+Ġg aining
+Ġg was
+ur ic
+Ġwi ld
+et ary
+et one
+et te
+os ynthesis
+ol aryng
+ol ayer
+Ġas ter
+Ġas cending
+il ding
+il ient
+un t
+Ġv omiting
+el a
+el itis
+ter ious
+up rofen
+Ġal a
+Ġper oxid
+Ġr z
+Ġr fa
+Ġex cep
+Ġex ogenous
+Ġex change
+Ġres ilient
+Ġbe ar
+Ġbe we
+Ġbe ads
+ot est
+ad ow
+ess ive
+ir ability
+qu am
+Ġch elation
+Ġde ion
+Ġpre pro
+Ġse oul
+Ġsh of
+Ġsh ares
+ap e
+rom a
+rom o
+Ġma h
+odon tist
+em bl
+Ġsc rap
+Ġsc aff
+Ġperi otest
+Ġco operative
+Ġind is
+ub er
+Ġnot ing
+Ġcan on
+Ġpar k
+Ġfo il
+Ġfo ki
+Ġha emat
+Ġpl enty
+ell ation
+ell ate
+Ġall oys
+ch ond
+ch lor
+end ments
+ill in
+Ġtr ich
+Ġtr ipl
+Ġtr ying
+Ġtr uly
+Ġtr iglycer
+Ġmod ify
+Ġacc omm
+Ġno xa
+Ġrec over
+Ġrel ied
+Ġab lation
+Ġsub chond
+Ġinter im
+Ġinter fer
+Ġinter con
+Ġinter observer
+Ġun in
+Ġun av
+Ġint ro
+Ġint agl
+ay ered
+Ġy at
+Ġy ag
+Ġy aw
+Ġam p
+Ġam oxic
+Ġam orph
+Ġam endments
+Ġmeas urable
+Ġk ine
+rap ped
+Ġdet ach
+ost in
+Ġfol ds
+Ġgen us
+Ġgen otyping
+Ġassess es
+ph ine
+Ġout lier
+ose al
+Ġcor ners
+Ġdes cending
+Ġdes irability
+Ġdes quam
+Ġar ith
+Ġimage j
+Ġinv is
+Ġph r
+ograph ies
+Ġcr y
+Ġag rees
+Ġproc rust
+Ġimpl ies
+Ġimpl ication
+Ġbr ittle
+Ġbr aces
+Ġmean time
+ag land
+Ġfir mic
+ath ion
+Ġdisc over
+Ġsup pression
+Ġsup pressed
+Ġsp ee
+Ġj un
+Ġj emt
+Ġbut ton
+Ġbut tons
+Ġdem arc
+Ġmin ocycline
+Ġchar ting
+Ġmal formation
+Ġtrans pl
+Ġtrans cript
+Ġcur ative
+ace tic
+ace utical
+Ġsal t
+Ġpost p
+Ġconf er
+Ġprim e
+Ġ3 3
+Ġ3 8
+Ġmon olayer
+Ġem ission
+Ġem erald
+Ġol ig
+Ġstand s
+Ġquestion ed
+Ġend points
+Ġinform ative
+unc iation
+Ġloc ators
+Ġdeterm ines
+Ġtechn ically
+Ġmulti stage
+Ġrem ind
+Ġrem inder
+Ġcent ric
+Ġpred ilection
+Ġcoun ty
+Ġbas ically
+ob ia
+Ġmuc otome
+Ġsm iling
+Ġapp reci
+Ġdo ts
+Ġbacter ium
+Ġmouth s
+Ġgl omer
+Ġfill ers
+Ġpath ologist
+Ġpath ophys
+Ġfactor ial
+Ġfac ing
+Ġfac ts
+Ġhist ology
+Ġoste omy
+Ġoste osynthesis
+Ġpul se
+Ġver b
+Ġsens ations
+Ġmat urity
+Ġvit apex
+Ġep ig
+av es
+av age
+Ġps p
+Ġps is
+Ġps mart
+Ġsoci eties
+Ġrepresent ativeness
+Ġhand le
+Ġhand book
+Ġmor se
+Ġday time
+Ġdm t
+Ġmid stream
+Ġsu ff
+Ġpa i
+Ġachie vement
+Ġachie vable
+Ġoh at
+Ġbuc co
+Ġdevi ance
+Ġsequ entially
+Ġrespond ent
+Ġaut ops
+Ġdentin oid
+Ġadd iction
+Ġair ways
+Ġprom pt
+Ġequ ality
+Ġ4 5
+Ġpractic ing
+Ġpractic ability
+Ġ6 9
+Ġfib roc
+Ġagree ments
+Ġbo ok
+Ġdeep ly
+Ġdeep ened
+Ġ7 8
+Ġresid ed
+Ġcommun icate
+nec ted
+asc us
+Ġpublic ly
+Ġadv ise
+Ġutil ize
+Ġutil izes
+Ġlip ids
+Ġchem o
+Ġchem ot
+Ġapproxim ation
+Ġconsum e
+Ġgingiva e
+pa ired
+Ġshort coming
+Ġ9 2
+Ġ9 6
+Ġ9 8
+Ġ8 5
+Ġbre aking
+Ġsubs urface
+Ġsil encing
+Ġappropri ateness
+Ġsleep ing
+Ġsleep iness
+Ġill ustration
+Ġ201 1
+Ġ201 6
+Ġemploy ees
+Ġmagn itudes
+Ġtransl ators
+Ġtransl ocation
+Ġhydro lysis
+Ġhydro static
+Ġhydro chlor
+Ġmineral ised
+Ġobjec ts
+Ġultr avi
+Ġbur st
+Ġdam ascus
+Ġdynamic s
+Ġrepl acing
+Ġbu ilding
+Ġinterven e
+Ġanatom ically
+Ġrecip ients
+Ġrecip rocal
+Ġmalign ancies
+Ġlig and
+Ġcomposition s
+Ġmedic ament
+Ġweek ly
+Ġhom ogen
+Ġdys reg
+Ġoff set
+Ġcop y
+Ġdocu ments
+Ġadap tability
+Ġresidual s
+Ġur inary
+Ġmetast ases
+Ġeng land
+Ġblock ed
+Ġprolif erative
+Ġcyto plasm
+Ġcyto plasmic
+Ġgir l
+Ġdiss ected
+Ġiv w
+Ġaccum ulated
+Ġaccum ulate
+Ġmedi ast
+Ġplay ing
+Ġnex co
+Ġnod ules
+Ġot olaryng
+Ġfore part
+Ġcre vice
+Ġobserv able
+Ġlongitud inally
+Ġirreg ularities
+Ġprogress ed
+Ġleuk a
+Ġviol ent
+Ġmc g
+Ġshe ets
+Ġcn v
+Ġwil k
+Ġasymm etrical
+ivari able
+Ġalternative ly
+abric ated
+Ġcc k
+Ġmas ks
+Ġabnorm ality
+Ġcoord ination
+Ġig a
+otom ized
+Ġmic rol
+Ġrob in
+Ġhybrid ization
+Ġden om
+Ġbis gma
+Ġprosthetic s
+Ġosteoc artilaginous
+Ġsy ria
+Ġshif ting
+Ġinh alation
+Ġsusp icious
+Ġdichotom ised
+fill ed
+Ġlung s
+Ġinterm itt
+Ġrepa ired
+Ġcham bers
+Ġdmf ts
+Ġelect romy
+Ġremain der
+Ġfram es
+Ġstabil ize
+Ġorthop a
+Ġactiv ator
+Ġnation wide
+Ġhol der
+Ġcompress ed
+Ġuns uccessful
+Ġconstit u
+Ġput ative
+Ġclus tering
+Ġatheroscl erotic
+Ġter rit
+Ġlamin ates
+Ġmoun ting
+Ġincision al
+Ġduw ls
+Ġoutpati ents
+Ġconj ug
+Ġexpress ing
+Ġrh yth
+Ġperiph ery
+Ġgn athion
+Ġcorro dens
+Ġpharm aceutical
+Ġmoist ur
+Ġswit ch
+Ġlactobacill i
+Ġstere olith
+Ġchrom atin
+Ġdisinf ect
+Ġscat tering
+Ġchile an
+Ġtrain ees
+obacter ia
+Ġpalat ally
+Ġperfect ly
+oprote ins
+Ġib uprofen
+Ġinten tional
+Ġdon ors
+Ġpredis pose
+Ġcaucas ians
+Ġfing ers
+Ġaggreg ation
+Ġmb g
+Ġpossess ed
+Ġpossess es
+Ġoccas ions
+Ġosteop orosis
+Ġabscess es
+Ġctcc s
+Ġanonym ous
+Ġanonym ized
+Ġcontrad ic
+Ġinconsist encies
+Ġnicot in
+20 6
+ii i
+Ġacknow ledge
+Ġpenicill ins
+Ġbil ayered
+Ġho oks
+Ġdele terious
+Ġsuppress es
+Ġretro grade
+olester olemia
+Ġcarbohydr ate
+att le
+Ġect od
+oste al
+Ġcouns el
+Ġcouns elling
+Ġdiscuss ing
+Ġextend s
+Ġign ored
+Ġpresum ed
+Ġbacteri ome
+Ġbacteri omes
+Ġsynch ron
+Ġoverestim ation
+Ġmimic king
+Ġoccasion ally
+Ġvent ral
+Ġali ke
+Ġdisch arged
+Ġlect ure
+Ġfriend ly
+Ġruss ian
+truct ure
+Ġencoun ter
+Ġencoun tering
+Ġcatal ytic
+Ġpum p
+Ġhind iii
+Ġodontobl asts
+Ġculti vable
+Ġdors um
+iagnos ed
+Ġconsul ting
+Ġsubc utaneous
+Ġnecessit ates
+Ġtail ored
+Ġstack ing
+Ġprost ate
+Ġprost agland
+Ġpref abricated
+Ġschem e
+Ġschem es
+Ġderiv atives
+Ġmotiv ational
+Ġinacti v
+Ġdro ps
+Ġbos nian
+Ġuna ware
+Ġunerup tion
+Ġcolomb ian
+Ġmang ostin
+Ġmicropl ate
+Ġinstal led
+Ġveget able
+Ġamplic on
+Ġinev itably
+Ġantagon ist
+Ġchond rocytes
+Ġdisapp ear
+Ġkil wa
+Ġphyl a
+Ġarchae a
+Ġvirul ence
+Ġtender ness
+Ġultrason ographic
+Ġengine ering
+Ġspectrom etry
+hel d
+inter pre
+Ġhon code
+Ġquin tiles
+Ġdiscre te
+Ġerb ium
+Ġhyperch olesterolemia
+Ġphotos hop
+linear ity
+Ġdissem ination
+Ġdissip ation
+Ġtre phine
+Ġdh cp
+Ġrug ae
+Ġjord an
+Ġjoin point
+Ġminipl ates
+Ġeston ian
+Ġaccompl ished
+Ġprevail ed
+Ġneurolog ical
+Ġtess ellation
+Ġheavi ly
+Ġscler osis
+Ġparad igm
+Ġnumb ered
+Ġinsp ire
+Ġantise ptic
+Ġdistinc tive
+Ġboost ing
+Ġveh icle
+Ġreinstru mentation
+Ġimperf ec
+Ġadsorb ed
+Ġabbrevi ations
+rel ations
+Ġsat urated
+Ġwu han
+Ġdash ed
+Ġlaf h
+Ġdispro por
+Ġweare rs
+Ġmucoperi osteal
+Ġbuff alo
+Ġforens ic
+Ġvasopress ors
+Ġegypti an
+Ġrhamn ol
+Ġanxio lytic
+Ġundoubted ly
+nutr ition
+Ġcree p
+edip ine
+Ġwenz hou
+Ġanco va
+Ġnif edipine
+Ġgath ered
+Ġaster is
+Ġperoxid ase
+Ġshof u
+Ġaccomm od
+Ġsubchond ral
+Ġintagl io
+Ġamoxic illin
+Ġamorph ous
+Ġprocrust es
+Ġfirmic utes
+Ġosteomy elitis
+1 00
+2 4
+5 7
+8 5
+8 6
+: .
+a j
+a id
+d omy
+e as
+f ession
+g ens
+g pt
+g onal
+h ang
+i of
+k ee
+l a
+l eration
+l iest
+m in
+m es
+n oma
+n els
+o let
+p uration
+p uts
+q hc
+r ans
+s k
+s y
+s elf
+t z
+t ory
+t ress
+t md
+u ok
+u ze
+v m
+v p
+x aminer
+Ġ ut
+Ġ ire
+Ġt v
+Ġt ac
+Ġt ear
+Ġt ied
+in ium
+re ted
+Ġth p
+Ġs or
+Ġs ad
+Ġs ess
+Ġs por
+Ġs int
+Ġs kele
+Ġs ask
+ti ms
+en ers
+en edi
+Ġc is
+Ġp on
+Ġp ad
+Ġw anted
+Ġw atching
+Ġin active
+Ġin ception
+Ġin gestion
+Ġan im
+Ġf v
+Ġd as
+Ġd ot
+Ġd erm
+Ġd he
+Ġm er
+Ġm chs
+or k
+an cer
+Ġb ill
+Ġb imax
+as al
+ic o
+ic ity
+ic ates
+ic ited
+ro ud
+ar tilage
+Ġre ti
+Ġre evalu
+Ġh h
+Ġh im
+Ġh ur
+Ġh omes
+Ġh idden
+Ġst ating
+Ġst ellate
+ul er
+ac cept
+ac ious
+Ġl up
+Ġl ond
+Ġn ond
+Ġn erves
+im ilar
+Ġg ee
+Ġg amm
+Ġg ains
+Ġg ogn
+Ġg rew
+ur ations
+ig uous
+Ġwi ls
+ud al
+et ected
+os us
+os ystem
+if f
+if t
+if iable
+Ġfor ced
+ol a
+Ġcon form
+Ġcon ca
+ati bacter
+ab domy
+Ġv w
+Ġv pi
+Ġper t
+Ġr f
+Ġr it
+Ġr ules
+Ġr ld
+Ġr uled
+Ġwh r
+Ġex oc
+Ġpro pos
+Ġres h
+Ġres ide
+Ġres ected
+uc ity
+Ġim agen
+ant a
+ir jian
+oc o
+oc clusal
+iz ers
+Ġinc omes
+um atic
+pl us
+pl ay
+pl akia
+pl oys
+Ġme ant
+Ġat om
+Ġcomp ly
+Ġdis g
+Ġse v
+Ġse iz
+Ġsh aking
+Ġad ver
+Ġad seal
+Ġhe p
+Ġhe ard
+Ġhe most
+Ġass embled
+Ġcl ust
+Ġtw i
+Ġma il
+op aus
+Ġoral ly
+age al
+ip ids
+Ġco val
+Ġco ag
+Ġsur pass
+ous tic
+Ġnot ch
+Ġnot with
+est ing
+Ġpar v
+Ġha attr
+ren ces
+Ġcont em
+ari us
+ffec ted
+Ġpl ain
+Ġpl ug
+Ġro ute
+Ġtr ic
+Ġtr im
+Ġtr imes
+Ġmod ifiable
+Ġcons ents
+Ġcons olid
+Ġrec essive
+Ġpr ist
+Ġpr int
+Ġinter occlusal
+Ġinter play
+Ġqu oti
+Ġun id
+Ġun less
+Ġun accept
+form aldehyde
+Ġy ork
+Ġam r
+Ġk en
+Ġk vp
+ast y
+Ġen ding
+Ġpo res
+Ġtim ed
+Ġout ward
+ew an
+ass ed
+Ġfin ish
+Ġup loaded
+ond er
+Ġcor tis
+Ġso aked
+Ġar i
+Ġph arynx
+Ġmo h
+Ġmo tions
+Ġcol ors
+Ġtime frame
+Ġsec urity
+Ġfour ier
+vid one
+Ġdise ased
+Ġsim ulations
+Ġsim ilarities
+ag a
+ag ic
+iter ate
+Ġsup ra
+Ġsup puration
+Ġdef ense
+Ġsp end
+Ġj ia
+Ġj unctions
+Ġmicro vascular
+Ġdem irjian
+Ġmin ip
+ivid ed
+Ġmal nutrition
+Ġtrans ill
+Ġtrans itional
+Ġop posing
+Ġgr and
+Ġgr ay
+Ġunder p
+Ġunder line
+Ġimp utation
+Ġorthodontic ally
+Ġconf ocal
+Ġser opos
+Ġmon ocyte
+Ġem ploys
+Ġstatus es
+Ġ0 6
+Ġ0 00
+Ġz n
+Ġsix th
+Ġwor ding
+Ġsaliv arius
+Ġcondition er
+Ġend otox
+Ġinform ing
+Ġloc ate
+Ġloc ating
+Ġloc ality
+Ġtechn ician
+Ġel ong
+gr an
+Ġfr ustration
+Ġpred ef
+Ġpred nis
+Ġeduc ate
+ob ulin
+par tic
+Ġgeneral ize
+Ġgeneral izing
+Ġsm a
+Ġconduc ive
+Ġear liest
+Ġsch wan
+Ġneg lected
+Ġreview er
+Ġrequ ests
+aren cy
+Ġfac es
+omet r
+Ġidentif ies
+Ġlo oked
+Ġfl o
+Ġfl aws
+Ġoste onec
+Ġcaus ative
+ox acin
+Ġintra orally
+Ġcomb ine
+Ġphys ically
+av ia
+Ġanterior ly
+Ġps r
+Ġhard er
+Ġnew s
+Ġnew ton
+man n
+Ġhand led
+Ġhand held
+Ġfluor ides
+Ġlength ening
+Ġestim ator
+Ġpoly v
+Ġpa ulo
+Ġpa ucity
+Ġoh qol
+Ġscre ens
+Ġhel ping
+Ġlay ered
+Ġposterior ly
+Ġimmun ochemical
+Ġimmun ode
+Ġimmun ofluorescence
+Ġimmun oglob
+ma x
+Ġseg reg
+Ġvers ions
+Ġsw oll
+Ġexp enses
+Ġsti gma
+Ġprom ise
+Ġ4 7
+Ġfoc al
+Ġprem align
+Ġintere xaminer
+Ġfocus es
+Ġfree zer
+Ġcomplex es
+Ġantib iof
+Ġfear s
+Ġeffic acious
+Ġprec eded
+Ġblood stream
+Ġclear fil
+Ġpan els
+Ġpan avia
+Ġheight ened
+Ġhypoth al
+Ġhyper activity
+Ġfunction ally
+Ġresid ues
+reg arding
+Ġbiom echan
+Ġdel im
+Ġdel ta
+Ġmark s
+az i
+Ġpsych o
+Ġml p
+Ġmut ual
+Ġrough ly
+Ġsk ipping
+Ġlogistic al
+Ġfil tering
+Ġil iac
+Ġthough ts
+Ġshort ly
+Ġ9 1
+Ġ9 7
+Ġsqu ares
+Ġtra vel
+Ġcalcul ates
+Ġcalcul ator
+Ġpolymer izing
+Ġ8 0
+Ġ8 9
+Ġoptim ization
+Ġoptim izing
+Ġsubs ample
+otyp ic
+Ġcir cle
+Ġchallen ged
+Ġill iterate
+Ġmaintain s
+Ġemploy ing
+Ġavoid ance
+Ġten fold
+Ġtransl ate
+Ġhydro f
+Ġapex it
+Ġbro ught
+Ġnas omaxillary
+Ġemerg encies
+Ġzircon ium
+Ġdam ages
+Ġcut aneous
+grad uates
+acti veness
+Ġphosph or
+Ġbenef ici
+Ġfp d
+Ġpapill ary
+Ġquanti fies
+Ġcf a
+Ġher tz
+Ġpm ma
+Ġ19 70
+Ġ19 73
+Ġur ic
+Ġur ine
+Ġenrol ment
+Ġphen ol
+Ġaug ment
+thes e
+Ġeng aging
+Ġalter ing
+Ġmis interpre
+Ġintegr ate
+abol ic
+Ġretr acted
+Ġretr uded
+Ġdecl ining
+Ġfibro tic
+Ġmedi ans
+for ward
+Ġorigin ate
+Ġwr iting
+Ġvr fs
+Ġminim ise
+Ġepid emic
+Ġmetabol ites
+Ġpriv acy
+oph ageal
+the tiz
+Ġcolon izing
+Ġillustr ations
+Ġcard iac
+Ġcrow ded
+Ġann ex
+Ġchemical s
+Ġsuture d
+Ġga uze
+Ġlat ency
+Ġampl ify
+Ġmicroorgan ism
+Ġtonsill ar
+Ġprotr uding
+Ġactinomy ces
+Ġconstant ly
+Ġnh i
+Ġtor sion
+Ġden ied
+Ġbis phosph
+Ġgre ece
+Ġexc reted
+Ġincrement al
+Ġdestr uctive
+atch ewan
+Ġsound s
+Ġhg s
+Ġcarbon ated
+Ġattr activeness
+Ġharm on
+Ġacce leration
+Ġpack ages
+Ġinh om
+Ġinh aled
+Ġamel ior
+Ġconc res
+Ġmel ting
+Ġbroad ly
+Ġben z
+Ġadvance ments
+Ġpron unciation
+Ġec m
+Ġorient ations
+Ġphenomen a
+Ġclar ified
+Ġsouth east
+Ġcos metic
+Ġhar v
+Ġquad rants
+Ġprofil ometer
+Ġgovern orate
+Ġconduct ance
+Ġtax on
+Ġpseud omonas
+Ġpay ment
+Ġrejec t
+Ġgi omer
+Ġsafe ly
+Ġamelobl astic
+Ġround ed
+Ġvolunte er
+Ġdim eth
+Ġresol ve
+Ġrm ta
+Ġuniform ly
+Ġnons pecific
+Ġcool ed
+Ġrh abdomy
+Ġchair side
+Ġunderestim ate
+Ġcorrec tions
+Ġlibr aries
+Ġpit uit
+Ġdisinf ected
+Ġabstr act
+Ġbelong s
+Ġtele vision
+Ġclaim s
+Ġtrigg ered
+Ġmetagen omics
+Ġpalat inal
+Ġinfiltr ating
+Ġinfiltr ates
+Ġure mia
+Ġobt urated
+Ġjudge ment
+Ġarg u
+Ġfiss ured
+Ġgp u
+Ġapparent ly
+Ġfavour ing
+Ġpseudovirus es
+Ġrhe ological
+Ġdistor tions
+Ġaggreg atibacter
+Ġinherent ly
+Ġcu ts
+Ġdecom pression
+Ġosteop romo
+Ġdense ly
+Ġbm f
+Ġmicrog aps
+Ġharmful ness
+Ġepidemi ologic
+Ġthreat ening
+Ġcontrad iction
+Ġspectrophot ometry
+Ġvl ogg
+Ġglyc oproteins
+Ġpie zo
+Ġinn ov
+Ġsymm etric
+Ġsymm etrical
+Ġretro cl
+Ġneu rom
+enz a
+Ġhapp en
+Ġhapp ened
+stand ing
+Ġinfr as
+Ġsubd ivided
+Ġunco vered
+Ġmethyl ene
+Ġelectro des
+Ġign ore
+Ġling u
+Ġjc qhc
+Ġtransp arency
+Ġconstruc ting
+Ġintim ate
+Ġonc ology
+Ġcompens ate
+Ġdepr ivation
+Ġsay ing
+Ġsph en
+Ġmicros urgery
+Ġoscill ating
+Ġplasm id
+Ġwashing ton
+Ġvic tims
+Ġpara formaldehyde
+Ġunhe aled
+Ġrational e
+Ġendocrown s
+Ġtb c
+Ġbig gest
+Ġcheil ion
+tiz ing
+Ġinacti vated
+Ġbos nia
+Ġvill ages
+Ġhaem ophilus
+Ġuna ffected
+Ġdiscontin ued
+Ġrepeti tive
+Ġpteryg oid
+Ġpteryg omaxillary
+zz le
+Ġtal k
+Ġtal king
+Ġdress ing
+Ġperic oron
+Ġrelig ious
+Ġmicrostruct ure
+Ġaffirm ative
+Ġdrawback s
+Ġwithdraw al
+Ġmicronucle i
+Ġaud io
+Ġoss ification
+Ġbus y
+Ġef u
+Ġln cr
+tra umatic
+Ġintens ified
+Ġextrap olated
+Ġcautious ly
+Ġerythemat ous
+Ġchromos ome
+Ġtil ted
+osc opic
+Ġsput ter
+Ġdramatic ally
+Ġexplicit ly
+Ġhistopath ologic
+Ġverte br
+Ġmigr ated
+Ġmidwif ery
+pens able
+Ġhapl otype
+Ġtris omy
+Ġethyl enedi
+Ġundersc ores
+Ġdynam ically
+Ġtro uble
+Ġatyp ical
+Ġshah roud
+peri enced
+Ġamph oter
+Ġnecro tizing
+Ġeconom ical
+Ġnarr ative
+Ġbicusp id
+Ġdestro yed
+tw o
+Ġcow orkers
+acchar ides
+Ġlu is
+Ġnich e
+Ġrup ture
+Ġcompuls ory
+Ġallerg ic
+Ġquinol ones
+Ġimprec ise
+Ġelab or
+Ġsymph ysis
+Ġmuscul oskeletal
+Ġmyc obi
+Ġhemorrh age
+Ġoverlo oked
+Ġsediment ation
+Ġerythro plakia
+Ġosteoper io
+Ġkaryo lysis
+Ġankyl osis
+Ġmathematic al
+Ġbg li
+Ġstad t
+Ġprepro cess
+Ġindis pensable
+uber tal
+Ġcanon ical
+Ġtrich omonas
+Ġtripl icate
+Ġinterfer ing
+Ġjun ior
+Ġdemarc ated
+Ġepig ene
+Ġfibroc artilage
+Ġultravi olet
+Ġmediast inal
+Ġleuka emia
+Ġintermitt ent
+fession al
+uok a
+Ġire land
+Ġsess ile
+Ġsint ered
+Ġskele ton
+Ġsask atchewan
+Ġbimax illary
+Ġlup us
+Ġlond on
+Ġwils on
+Ġrld d
+Ġclust ered
+opaus al
+Ġcoval ent
+Ġnotwith standing
+Ġhaattr tmd
+Ġtrimes ter
+Ġquoti ent
+Ġunaccept able
+Ġcortis ol
+Ġpredef ined
+Ġschwan noma
+Ġosteonec rosis
+Ġswoll en
+Ġpremalign ant
+thetiz ed
+Ġpituit ary
+Ġosteopromo tive
+Ġpericoron itis
+2 50
+6 3
+6 5
+6 00
+9 9
+a o
+a ire
+a acetic
+b u
+b st
+b ond
+b ws
+c ase
+c ast
+c ified
+c yl
+e it
+f am
+f ici
+f ord
+f iable
+g c
+g h
+h l
+h ion
+h ops
+h rs
+i et
+i qu
+j oy
+k on
+m u
+m ing
+m ix
+n es
+o j
+o ke
+o eu
+p op
+p yr
+p inephrine
+r uc
+s agittal
+w arr
+y a
+y ren
+z a
+Ġt ar
+Ġt one
+in form
+in ator
+in ucle
+Ġa u
+Ġa traumatic
+re pres
+Ġth uring
+Ġth ings
+on to
+Ġs ro
+Ġs ig
+Ġs ap
+Ġs ich
+Ġs ms
+Ġs tit
+Ġs anti
+Ġs omatic
+Ġs anger
+Ġo ag
+en g
+en ol
+en na
+al an
+er atin
+Ġc ts
+Ġc up
+Ġc iv
+Ġc ub
+Ġc ited
+Ġp end
+Ġp pt
+Ġp ier
+Ġp lex
+Ġw ing
+Ġw ren
+Ġw aves
+es pan
+es thetized
+Ġan tr
+Ġan ces
+Ġan ne
+Ġan esthes
+Ġan esthetized
+Ġf i
+Ġf n
+Ġd ial
+Ġd eline
+Ġm ise
+Ġm ma
+Ġm cp
+at s
+at able
+or ie
+an ha
+an asal
+Ġb am
+Ġb und
+is able
+is ters
+tion ally
+ic able
+ic tions
+ing e
+ing ly
+Ġre ch
+Ġre used
+Ġre activity
+Ġh am
+Ġh cl
+Ġh ots
+Ġe ther
+Ġe ll
+Ġe hrs
+us ing
+us cript
+Ġst ains
+ac eration
+ec ting
+Ġl b
+Ġl l
+Ġl ign
+Ġl ined
+Ġl aw
+Ġl ister
+om n
+om echanical
+Ġn t
+Ġn ore
+Ġn st
+Ġn ause
+Ġn ss
+Ġn uts
+im us
+im onas
+Ġg ates
+Ġg ame
+Ġg mm
+Ġg dp
+ly mp
+ur a
+ur ons
+os ine
+os arc
+Ġfor s
+ol ished
+Ġas b
+Ġas ks
+il k
+il es
+il ization
+Ġcon vention
+od er
+od yn
+id i
+am i
+am us
+Ġv ag
+Ġv io
+Ġal arm
+Ġal ert
+Ġper ine
+Ġr l
+Ġr uler
+Ġex agg
+ge e
+Ġpro ves
+Ġpro active
+Ġres trict
+Ġres embl
+Ġbe ij
+uc l
+uc osal
+Ġim posed
+ad der
+iz ol
+Ġch ee
+Ġde ple
+Ġde pro
+Ġde gran
+um ar
+um eration
+Ġme x
+ys plasia
+Ġcomp ute
+Ġcomp uting
+iv ity
+iv ors
+iv udine
+og o
+og ly
+ib acter
+Ġdis reg
+Ġsh ann
+Ġsh eep
+Ġad vent
+feren ti
+Ġhe in
+Ġsign ing
+Ġsign ifies
+Ġass ent
+Ġcl sm
+and er
+op es
+Ġperi o
+ip ital
+Ġit t
+ia z
+Ġle e
+Ġle ath
+Ġle pt
+est ation
+Ġpar anasal
+Ġpos e
+Ġpos ter
+vi e
+st ud
+ull ous
+Ġcont exts
+ari ous
+Ġpres sed
+Ġpres crip
+Ġpl ated
+Ġall opl
+end a
+end ar
+Ġro di
+Ġtr ip
+Ġtr yp
+Ġtr ace
+Ġtr imm
+Ġtr izol
+Ġmod ifies
+Ġcons or
+Ġreg ained
+Ġno vo
+Ġno zzle
+Ġincl inations
+ors hip
+Ġrel ates
+Ġrel atives
+Ġne oplastic
+Ġcar ing
+Ġcar lo
+Ġrepor ter
+Ġsub epithelial
+Ġinter l
+Ġinter cus
+Ġinter acts
+Ġinter relations
+Ġun res
+Ġun ion
+Ġun equ
+Ġun identi
+Ġun ivariable
+Ġint u
+Ġinclud able
+Ġk erm
+Ġk ang
+Ġk etamine
+Ġk yr
+Ġen for
+Ġen joy
+Ġen umeration
+rol imus
+Ġpo le
+Ġpo ured
+Ġpo vidone
+ph in
+Ġdur able
+Ġsuc tion
+gn ath
+Ġspec ify
+Ġup coming
+Ġar ises
+Ġph antom
+Ġevalu ators
+mo h
+Ġbi oceramic
+lu tion
+Ġdec oder
+Ġag enda
+Ġcal orie
+Ġcal endar
+Ġstr ub
+Ġstr atum
+ex isting
+Ġchan g
+Ġchan nels
+Ġbr itish
+Ġund erm
+Ġund ecal
+ep e
+ag o
+Ġman oeu
+Ġman uscript
+ack et
+Ġsup pl
+Ġradi op
+Ġsp ms
+Ġsp ind
+Ġsp ots
+ult ural
+Ġj b
+Ġj e
+Ġbut term
+Ġed ans
+istic ated
+Ġmicro c
+Ġmicro p
+Ġmicro et
+Ġmicro cr
+Ġcomm ission
+Ġmin ax
+Ġhy ogo
+Ġsubjec tivity
+Ġextr acts
+Ġpop ulated
+Ġprob it
+Ġi ib
+Ġtrans position
+Ġtrans ported
+Ġtrans bond
+Ġform ulate
+Ġdevelop ments
+Ġgr id
+Ġgr ained
+ak o
+Ġsal ts
+Ġunder lines
+Ġunder graduates
+Ġcharacter izing
+Ġlim bs
+Ġpost ural
+Ġpost men
+Ġconf identi
+Ġpain less
+Ġmon te
+Ġmon ocytes
+Ġbl ur
+Ġbl ocking
+Ġol faction
+Ġintr as
+Ġ0 2
+Ġ0 4
+br acket
+Ġz w
+Ġz x
+Ġz oster
+Ġer g
+Ġinform atics
+Ġca udal
+Ġinfl ated
+Ġel icited
+Ġmulti pl
+Ġmulti lay
+Ġrem ed
+ie tic
+Ġimpro per
+our able
+Ġset t
+Ġeduc ators
+Ġterm ination
+Ġcle ans
+Ġcle avage
+Ġmuc o
+Ġmuc oc
+Ġocc ipital
+Ġins ured
+art ens
+Ġrestor ing
+Ġir b
+Ġtes ter
+Ġbacter oid
+Ġsmo other
+Ġdist o
+Ġthrough put
+other ap
+Ġfac ulties
+Ġpal is
+Ġpal sy
+aw a
+Ġgu ang
+Ġfl ask
+Ġarch ive
+Ġarch ives
+ful ly
+Ġoste oin
+Ġatt acks
+Ġfail ing
+Ġprof essions
+ox ane
+Ġvi enna
+Ġevid enced
+Ġsl ots
+Ġhyp oxic
+Ġcase in
+Ġver ruc
+Ġexpos es
+Ġsol ving
+Ġsol vent
+av itated
+Ġcontr asts
+Ġnew er
+Ġcompl ied
+Ġcap ac
+Ġref ine
+Ġmid sagittal
+Ġpers isted
+Ġsu ite
+Ġcategor ization
+Ġsugges tions
+Ġlif espan
+Ġeight een
+Ġpap ules
+Ġu rogen
+Ġwill i
+Ġsurvey or
+Ġlight ing
+Ġcephal ometry
+Ġimmun o
+Ġresist or
+Ġjaw bone
+Ġseven th
+Ġthem es
+Ġsuccess ive
+Ġod d
+to ire
+Ġlog it
+Ġ4 2
+Ġprem ium
+Ġcoh ere
+Ġcomplex ities
+ang ers
+Ġprior itiz
+Ġct nn
+Ġlinear ity
+Ġfinal ize
+Ġdom inated
+Ġbo ole
+Ġstill birth
+Ġcari ology
+Ġprevent ative
+Ġhead set
+Ġdel ib
+Ġdel ays
+Ġmorph oj
+Ġsus pect
+Ġspecial ization
+Ġspecial ties
+Ġpur ity
+Ġreflec tive
+Ġfil tration
+Ġfil ters
+Ġcolor imetric
+Ġadv isable
+Ġx rd
+Ġx anth
+Ġlip oprotein
+Ġconnec tor
+Ġconsum ers
+Ġpol lution
+Ġsepar ating
+Ġview ers
+Ġcond ens
+Ġsurv ivors
+Ġmicrobi ology
+Ġmicrobi omes
+Ġ9 3
+Ġ9 9
+Ġ8 1
+Ġ8 8
+Ġwa ist
+Ġbre warr
+Ġsubs pinal
+me th
+Ġtop ographies
+Ġacro seal
+Ġcir cles
+Ġreach es
+Ġprep onder
+Ġecon omics
+Ġprol ong
+Ġtransl ational
+Ġreal d
+Ġorgan ism
+Ġalg inate
+Ġmineral s
+Ġconfound ed
+ucle ated
+Ġrepl ication
+Ġhs d
+Ġmy co
+Ġev ap
+acti vated
+Ġphosph ol
+Ġlig ating
+Ġhouse kee
+Ġdebr ief
+Ġmedic ated
+Ġplace ments
+Ġq alp
+Ġsb c
+Ġquanti ties
+Ġhom o
+Ġpass age
+Ġoff s
+Ġra ises
+Ġcho king
+Ġadjust able
+Ġbreast f
+Ġpm rs
+Ġtur ns
+Ġweight ing
+Ġcandid ates
+Ġpor ous
+Ġdown stream
+Ġ19 80
+Ġ19 83
+Ġder ive
+Ġent ails
+Ġsa ve
+Ġglass y
+Ġiv ig
+Ġaff inity
+Ġaccum ulations
+Ġmedi ate
+Ġcyt ometric
+Ġtempor arily
+Ġcompr ise
+ament ale
+Ġds am
+Ġodont ology
+oph osphate
+Ġreconstr uctions
+Ġcytok eratin
+Ġsul ph
+Ġmc d
+Ġmc i
+Ġmc m
+Ġmc n
+Ġsuperim posing
+orph ism
+Ġconver ting
+Ġlymph oma
+Ġprop ex
+Ġdeb ate
+Ġdeb ilit
+Ġtransm ucosal
+Ġsd d
+Ġprojec ts
+Ġprojec ted
+Ġprojec tions
+Ġpool ing
+Ġcm f
+Ġcogn ition
+Ġconsult ant
+Ġconsult ations
+Ġrecall ed
+Ġblind ness
+Ġcalibr ate
+Ġcall s
+Ġlat ent
+Ġprefer able
+Ġexperiment ally
+Ġrestric ting
+Ġweak ening
+Ġcarcin omas
+Ġinsu fficiently
+Ġinsu fficiency
+Ġevent ual
+Ġalb eit
+Ġexplore r
+Ġsegment al
+Ġtherm oco
+Ġuseful ness
+Ġfamil ial
+Ġmic ra
+Ġcounter act
+bo ud
+Ġbio inform
+Ġgutta flow
+Ġ200 3
+Ġperf luor
+Ġide ally
+Ġgre y
+Ġord inary
+Ġagg ression
+Ġspe ak
+Ġdil ated
+Ġdil utions
+Ġdil aceration
+Ġpathological ly
+Ġrad boud
+Ġcrystal line
+Ġpolic lin
+de velop
+Ġinterpro fessional
+Ġmini ature
+Ġattr active
+Ġassist ing
+Ġpt c
+Ġlink age
+Ġirrig ating
+Ġencour agement
+Ġpack ed
+Ġpack aging
+Ġdg cts
+Ġnarrow ing
+Ġmun ich
+Ġoverlap ped
+Ġld h
+Ġemb arr
+Ġbound ing
+Ġeg d
+Ġinterm ed
+Ġdmf ss
+Ġacceler ating
+Ġacceler ates
+Ġdisag reed
+Ġorthop edics
+Ġcarry over
+Ġnation ally
+Ġphysiological ly
+Ġhemod ynamic
+Ġconstit utes
+Ġput ty
+Ġfm ud
+Ġfm ps
+Ġtri ad
+Ġmorphological ly
+Ġantic ancer
+Ġprotec ts
+Ġmul tis
+Ġscr ipt
+Ġiran ian
+Ġfas hion
+Ġrm ma
+Ġnons ense
+Ġcounterpar t
+Ġpull ed
+Ġdeterior ate
+Ġgoal s
+Ġpaediatric ian
+Ġstraight forward
+Ġspontaneous ly
+Ġsided ness
+Ġhypomineral ized
+Ġpit ches
+Ġmit otic
+Ġrig orous
+Ġpenetr ability
+Ġdp cs
+Ġdisrup t
+Ġdisrup ts
+Ġtrigg ers
+Ġnotice ably
+Ġprogramm ing
+Ġobt ur
+Ġdiscol ored
+Ġworks hops
+Ġdistress ed
+Ġconclud ing
+Ġexerc ised
+Ġworth y
+Ġworth while
+Ġpure ly
+Ġren dered
+Ġselective ly
+Ġpredis position
+Ġrom e
+Ġpy kn
+Ġexclus ive
+Ġsupr amentale
+Ġhandpi eces
+Ġaggreg ated
+Ġsud anese
+Ġunre lated
+Ġmicrog ap
+Ġconfig urations
+Ġcrystall ized
+Ġunfav ourable
+Ġtun ing
+Ġwet ting
+Ġmess ages
+Ġsuspension s
+Ġconcomitant ly
+Ġthreat s
+Ġsib ling
+Ġanonym ity
+Ġfus ing
+Ġaspir in
+Ġundes ired
+Ġmarket ing
+Ġoverex pressed
+Ġannot ated
+Ġsteroid al
+Ġmicrom orph
+Ġlav a
+Ġdele ted
+Ġtrap ez
+Ġtransition s
+Ġdelay ing
+Ġthermo formed
+Ġadvoc ate
+Ġ199 3
+Ġ199 7
+Ġlubric ant
+Ġaer obic
+anal y
+arr ay
+Ġht v
+Ġshorten ed
+Ġshorten ing
+Ġfish er
+Ġpresum ably
+Ġlogarith m
+Ġxen on
+Ġglyco lytic
+Ġmultin ucleated
+Ġencompass ed
+Ġencompass ing
+Ġtang ents
+Ġthread s
+Ġdest abil
+Ġamb iguous
+Ġswab s
+Ġsph erical
+Ġpec uli
+Ġexec ution
+Ġhair y
+Ġupd ate
+Ġexacerb ating
+Ġsial opaper
+opo ietic
+Ġpara esthesia
+Ġacidogenic ity
+Ġexceed s
+Ġodontobl astic
+Ġkinderg artens
+Ġhierarch y
+Ġnecessit ate
+Ġtail ed
+Ġmp bs
+Ġpref ect
+agl obulin
+Ġderiv ative
+sh ape
+Ġwal es
+Ġvill age
+Ġdeterg ent
+Ġdrink ers
+Ġchemok ine
+Ġrepeti tions
+Ġattenu ated
+Ġflatten ing
+Ġaw ake
+Ġdum my
+Ġdev oid
+Ġunerup ted
+Ġcolomb ia
+Ġnonc avitated
+Ġclassroom s
+Ġmicropl ates
+Ġdoub t
+Ġweakness es
+Ġamplic ons
+Ġinev itable
+Ġpir anha
+Ġwel ding
+Ġascertain ed
+Ġcontig uity
+Ġvivid ness
+Ġextrap ol
+Ġcollective ly
+Ġerythemat osus
+Ġchromos omal
+Ġorbital e
+Ġinex perienced
+Ġdab cyl
+Ġmacrol ide
+Ġmacrol ides
+Ġtab ulated
+Ġlam ivudine
+atiz ation
+Ġunw anted
+Ġweigh ed
+Ġmicrot ensile
+Ġhistor ically
+Ġtown s
+Ġchat gpt
+Ġsevent een
+Ġrelie ve
+Ġpolyphosph ates
+Ġaddic tiveness
+Ġpromp ts
+Ġtradition ally
+Ġosteoconduc tive
+Ġchromat ography
+Ġmetalloprotein ases
+Ġhook ah
+Ġaliqu ots
+Ġthaw ed
+Ġinoc ulated
+Ġmiti gate
+Ġreper toire
+Ġgarg ling
+Ġamoun ted
+Ġsimul ator
+Ġbright ness
+Ġmanip ulation
+Ġzo om
+Ġpulver ized
+Ġslic er
+Ġdisclos ure
+Ġsoph isticated
+Ġdan ish
+Ġdol phin
+Ġdeion ized
+Ġtriglycer ides
+Ġintercon nected
+Ġintro duce
+Ġkine tics
+Ġarith metic
+Ġinvis ible
+Ġverb ally
+Ġchemot actic
+Ġotolaryng ology
+Ġorthopa edic
+Ġstereolith ography
+Ġnicotin ell
+Ġprostagland in
+Ġimperfec ta
+Ġtac rolimus
+Ġpon tic
+Ġfv l
+Ġhur dle
+Ġgamm a
+Ġresh ap
+Ġimagen et
+Ġprist ine
+Ġseropos itivity
+Ġpolyv inyl
+Ġimmunode fici
+Ġimmunoglob ulin
+Ġantibiof ilm
+Ġbiomechan ics
+Ġphosphor us
+Ġbenefici aries
+Ġdimeth acrylate
+Ġinnov ative
+Ġneurom uscular
+Ġinfras tructure
+yren e
+repres ent
+Ġsro h
+Ġsich uan
+Ġsanti ago
+Ġwren ch
+Ġances try
+Ġanne aling
+Ġmise q
+Ġlister ine
+Ġnore pinephrine
+Ġnst a
+Ġnause a
+osarc oma
+Ġvio let
+Ġperine ural
+Ġbeij ing
+Ġchee ks
+Ġdepro te
+Ġdegran ulation
+Ġshann on
+Ġleath ery
+Ġkyr bws
+Ġundecal cified
+Ġmanoeu v
+Ġbutterm ilk
+Ġmicrocr acks
+Ġpostmen opausal
+Ġconfidenti ality
+Ġosteoin duc
+Ġurogen ital
+Ġctnn b
+Ġboole an
+Ġstillbirth s
+Ġbrewarr ina
+Ġsubspinal e
+Ġdebrief ing
+Ġthermoco up
+Ġpykn osis
+0 1
+4 00
+4 70
+5 4
+7 6
+7 8
+8 58
+a gn
+b ed
+b ound
+c ity
+d md
+d ney
+e ther
+e lec
+f in
+f our
+f ically
+f ux
+g al
+g azi
+h n
+h ar
+i ologists
+j iang
+l as
+l ays
+l ining
+l ider
+l osan
+n de
+o tr
+o ise
+o lymer
+p et
+p athic
+q l
+r id
+r ian
+r ym
+r hex
+s en
+s ome
+s ian
+s field
+t c
+t ar
+t ures
+t epe
+u h
+u ation
+v ia
+w anese
+x ide
+Ġ um
+Ġt et
+Ġt ies
+Ġt ib
+Ġt rep
+Ġa ortic
+re t
+re ported
+Ġth r
+Ġth ous
+on ch
+on ema
+on omics
+Ġs io
+Ġs ax
+Ġs aturation
+Ġs yst
+Ġs vm
+ti tis
+ti cemia
+Ġo vari
+Ġo titis
+er ad
+er ations
+Ġc et
+Ġc ie
+Ġc asc
+Ġc ns
+Ġc atch
+Ġc moh
+Ġp ent
+Ġp od
+Ġp tr
+Ġp ins
+Ġp amph
+Ġw t
+Ġw ech
+Ġw ish
+Ġw ise
+Ġw ings
+Ġin ferences
+Ġin growth
+es h
+es ter
+es ign
+Ġan astom
+Ġf ma
+Ġf dr
+Ġf dps
+Ġf di
+Ġf anta
+Ġd ft
+Ġd ms
+Ġd ict
+Ġm ur
+Ġm ts
+Ġm res
+Ġm ors
+Ġm ens
+Ġm gi
+Ġm erc
+Ġm amp
+Ġm uh
+at c
+at r
+or a
+or adi
+or rhex
+th ane
+an i
+an ous
+an ne
+an timicrobial
+Ġb ud
+Ġb ib
+Ġb ag
+Ġb wr
+Ġb ana
+is on
+as cal
+ent ory
+ic a
+ic an
+ing ent
+Ġre cl
+Ġh us
+Ġh op
+Ġh ip
+Ġh oun
+Ġh ope
+Ġh nc
+Ġh acet
+le ep
+Ġe ch
+Ġe ke
+it r
+it ary
+it one
+it ating
+Ġst roma
+ul ose
+ec ked
+Ġl ac
+Ġl un
+Ġl aus
+Ġl ind
+Ġn ur
+Ġn ad
+Ġn rs
+Ġn ij
+im on
+im ab
+im inal
+Ġg m
+Ġg am
+Ġg out
+Ġg aus
+Ġg reg
+Ġg gd
+Ġg bi
+Ġg fr
+ur yl
+ur ane
+ud ate
+et etr
+os se
+os ide
+os omal
+ce ph
+Ġfor th
+ol on
+ol linearity
+Ġas c
+Ġas t
+il um
+il oxane
+Ġcon es
+Ġcon vers
+od ile
+od ivergent
+id ged
+id va
+id rotic
+ati a
+ab c
+am er
+am uscular
+tic ill
+Ġv d
+Ġv o
+el ae
+Ġal end
+Ġal ive
+Ġal titud
+Ġper imeter
+Ġr ings
+Ġwh itish
+Ġex em
+Ġex udate
+Ġpro pri
+Ġpro seal
+Ġres pected
+Ġbe vel
+ion ic
+tr ip
+tr ials
+ot ing
+ot em
+ot ogrammetry
+Ġim er
+Ġis ra
+Ġis fa
+ir d
+oc ular
+qu in
+iz able
+Ġde pressive
+Ġinc h
+Ġme al
+Ġpre b
+Ġpre t
+Ġpre cluded
+Ġpre adjusted
+Ġpre term
+Ġpre existing
+Ġcomp act
+Ġcomp iled
+og lu
+Ġdis l
+Ġdis artic
+Ġse as
+Ġse gn
+Ġse ating
+Ġse attle
+Ġsh all
+Ġsh adow
+ap ill
+oth ing
+Ġad obe
+Ġhe ating
+Ġsign ifying
+Ġass ets
+Ġass urance
+Ġcl erical
+and a
+Ġtw enti
+op y
+op al
+op tim
+op rop
+por ary
+odon tists
+ence ph
+Ġsignific ances
+Ġap i
+ip ette
+Ġdental ly
+Ġit erative
+Ġco ugh
+ia e
+Ġle f
+Ġle ak
+Ġle mes
+Ġsur fact
+ub ated
+ub ular
+Ġtreat s
+pec ting
+pec ified
+Ġpar s
+Ġhealth ier
+st yrene
+Ġfo ti
+Ġinf ar
+Ġinf estation
+enti stry
+Ġpl i
+Ġpl ants
+ill ing
+Ġtr io
+Ġtr ails
+Ġmod ulation
+Ġmod elling
+Ġmod uli
+Ġcons erved
+Ġreg ain
+Ġreg row
+Ġreg imes
+Ġob li
+Ġacc b
+Ġacc ult
+Ġrec a
+ors ed
+Ġrel apsed
+Ġne urons
+Ġpr s
+Ġpr ams
+Ġab dul
+Ġab olished
+Ġsub pop
+Ġsub antimicrobial
+Ġsub optim
+Ġinter r
+Ġinter ior
+Ġinter ferences
+Ġinter maxillary
+Ġqu bit
+Ġun h
+Ġun n
+Ġun t
+Ġun so
+Ġun ified
+Ġun paired
+form ing
+Ġint ent
+Ġint el
+ay ama
+ist a
+Ġy east
+Ġam ine
+Ġam yg
+ens or
+Ġvari ates
+ven ue
+Ġk l
+Ġk etone
+Ġclinical trials
+Ġdet er
+lec tive
+ost atic
+Ġgen isc
+Ġchild care
+ass ment
+ass ay
+ass ium
+gn athic
+Ġfin n
+Ġstatistic ian
+Ġup load
+Ġcontrol l
+Ġar s
+Ġar ts
+Ġar med
+amin ob
+amin etetr
+Ġinv entory
+Ġmax graft
+Ġph il
+Ġph obia
+Ġover coming
+Ġbi ob
+ct g
+Ġmo is
+ograph ically
+lu oric
+Ġdec is
+Ġcr ises
+Ġcr nde
+Ġcr iminal
+Ġag itation
+Ġstr i
+cc s
+Ġproc odile
+Ġbr ay
+Ġbr onch
+Ġund iagnosed
+Ġ2 50
+Ġnon cont
+Ġdisc our
+Ġsup re
+Ġradi o
+Ġdef ensive
+Ġsp it
+Ġj oh
+Ġmin t
+Ġmin us
+ds pathic
+Ġprob ed
+Ġi ia
+Ġi plan
+Ġtrans crip
+Ġtrans palatal
+Ġtrans cribed
+Ġop ted
+Ġop tically
+Ġdi e
+Ġdi ure
+Ġdi ap
+Ġdi ary
+Ġdi aminob
+Ġcur tis
+Ġgr ip
+ak a
+Ġcharacter izations
+Ġconf id
+Ġconf ection
+Ġconf used
+Ġ3 00
+Ġcells ens
+Ġser ially
+Ġstat ure
+Ġem its
+Ġem itted
+Ġem itting
+Ġintr ales
+Ġintr amuscular
+amm aglobulin
+Ġz he
+Ġwor ry
+Ġwhere in
+Ġplan kt
+Ġdr astic
+Ġdr iving
+Ġdr ank
+Ġdr idva
+Ġend orsed
+Ġradiograph ical
+Ġca iro
+echn ology
+Ġloc us
+Ġtechn ological
+tit ution
+Ġdid actic
+hip s
+Ġfr ance
+Ġindividual ized
+Ġperiod ically
+Ġprac tis
+Ġprac tising
+Ġremo ves
+Ġany way
+Ġany where
+Ġinflu ential
+ob is
+ob ut
+Ġexpl antation
+ines cence
+Ġmuc in
+Ġsm og
+Ġins pected
+Ġrestor atives
+Ġir ccs
+Ġidenti ty
+Ġcb i
+Ġprot ected
+Ġgl fs
+Ġgl idden
+Ġpot ency
+Ġpot assium
+Ġanti gens
+Ġforce ps
+Ġdist ancing
+Ġos man
+Ġpe er
+Ġpe tia
+Ġfem ur
+Ġidentif iable
+Ġhist ogram
+Ġparen chym
+Ġeth ically
+Ġeth moid
+Ġresult ant
+Ġfl aw
+Ġfl ipping
+ful ness
+Ġstress ed
+Ġstress ors
+Ġoste oid
+Ġiniti ative
+ox ia
+Ġsl opes
+Ġang ina
+Ġhyp oh
+Ġhyp osal
+Ġhyp odivergent
+Ġver ticill
+Ġgrow s
+Ġexpos ing
+Ġperce p
+Ġsens ors
+Ġsens itis
+Ġsens ibility
+Ġsens odyn
+Ġep q
+Ġps q
+Ġps us
+Ġhard est
+Ġcontr a
+Ġcontr acted
+Ġabs or
+Ġnew cast
+Ġhand ed
+Ġhand les
+Ġfluor oph
+Ġfluor ochrom
+Ġcompl icate
+Ġpulp otomized
+Ġanalyz er
+ator ies
+Ġacid ity
+Ġref ined
+Ġref resh
+Ġhos mer
+Ġmid face
+Ġpoly ether
+Ġpoly styrene
+Ġsym pos
+Ġcategor ize
+Ġachie ves
+Ġsugges tion
+Ġsugges tive
+Ġoh c
+Ġoh e
+Ġoh i
+Ġoh bs
+Ġdevi ated
+Ġsequ elae
+Ġu ws
+Ġrespond s
+ps is
+ps ych
+Ġimmun ologic
+Ġsyn ov
+Ġpow ders
+Ġod ors
+Ġlog ical
+Ġprog lider
+Ġequ ator
+Ġ4 3
+Ġ4 4
+Ġ4 9
+Ġ6 7
+Ġprem ix
+Ġprem ise
+Ġta ught
+Ġfib re
+Ġintere sts
+Ġmembr anous
+Ġrespons iveness
+Ġaccess ory
+Ġmm se
+Ġdistal ize
+Ġexam s
+ogene tic
+vari able
+Ġintroduc tory
+Ġlinear ly
+Ġtool k
+Ġsatis fy
+Ġhyper ther
+Ġhyper lin
+Ġhyper paramet
+Ġhyper variable
+Ġwork er
+mark s
+Ġvir ucid
+Ġspl at
+az iz
+Ġspecial ised
+Ġcement al
+Ġbene ath
+Ġsk ip
+gen erative
+Ġartic ul
+Ġx t
+Ġx y
+Ġhyd ration
+Ġback side
+Ġproportion ately
+Ġsurv ived
+lor a
+pa igns
+Ġ9 000
+Ġ8 3
+Ġ8 4
+Ġoptim ism
+me gen
+Ġtub ing
+Ġsil ane
+Ġsn ack
+Ġcd na
+Ġclean er
+rop y
+Ġpen n
+Ġill um
+Ġill umination
+Ġevery day
+Ġfunctional ity
+Ġmedium s
+Ġrepe ating
+Ġreal m
+Ġorgan is
+Ġhydro lys
+Ġbro thers
+Ġnas o
+Ġultr a
+Ġsee ing
+ux imab
+Ġge ometrical
+Ġerup tive
+plas ms
+Ġmicroscop ically
+Ġirradi ations
+Ġled s
+Ġphosph ates
+Ġsem ic
+Ġfp g
+Ġiss ued
+Ġultras truct
+nt gee
+Ġfav ors
+omat osa
+Ġq ia
+Ġsb i
+Ġsb p
+Ġmass ili
+Ġbin ds
+Ġhom d
+Ġhom ologous
+Ġdys biotic
+Ġpocket ing
+Ġpass es
+Ġcop d
+Ġnan oceramic
+Ġalcohol ic
+Ġesthetic ally
+Ġadap tion
+Ġadap ting
+Ġpor cel
+Ġdown s
+Ġdown loaded
+Ġ19 75
+Ġ19 60
+Ġcran i
+Ġphen otypic
+Ġchlor oform
+Ġent ropy
+Ġpediatric ian
+Ġgerm s
+Ġgerm line
+Ġgerm icidal
+Ġpair ing
+Ġmis class
+Ġlin king
+Ġlater ally
+Ġintegr ating
+Ġintegr ates
+Ġsa fer
+Ġrecogn ise
+Ġdiss imilar
+Ġbirth day
+Ġmedi ator
+Ġcam paigns
+Ġflex ible
+Ġsuperior ly
+Ġpf m
+Ġvr l
+Ġminim izes
+Ġpil oted
+Ġrout ines
+Ġnumer ically
+ron ate
+Ġcre am
+Ġalt man
+Ġplot ting
+ula e
+oph otogrammetry
+Ġprogress ing
+Ġleuk ocyte
+Ġeti ologies
+Ġacqu iring
+Ġfacilit ators
+Ġviol ation
+Ġmc a
+16 8
+Ġobjective ly
+Ġlact ation
+Ġparalle ling
+Ġss is
+Ġlymph ocyte
+Ġstrati fying
+bal anced
+Ġsubstit ution
+Ġcentrif uge
+Ġprospective ly
+Ġrecall s
+Ġnutr ients
+Ġlat via
+Ġprefer ably
+Ġroom s
+Ġmas se
+Ġtons il
+Ġcarcin ogenic
+Ġoverl aps
+Ġcollagen ous
+Ġalb umin
+Ġsegment ations
+Ġfabric ate
+Ġaccep ting
+Ġbes ide
+Ġretain ing
+Ġmic r
+Ġmix tures
+Ġcounter st
+Ġsecre tions
+Ġsecre te
+Ġprincip ally
+Ġincom pati
+Ġker nel
+Ġcondyl ion
+Ġulcer ations
+Ġulcer ative
+Ġ200 1
+Ġ200 4
+Ġ200 6
+Ġ200 9
+Ġden ote
+Ġbs so
+Ġrp ost
+Ġdisp ensed
+Ġcs a
+Ġcs f
+Ġgraph ically
+Ġexc itation
+Ġhypothes ised
+Ġtap e
+Ġtap ping
+Ġatten tive
+de generative
+Ġisch emia
+oin ted
+oin ting
+Ġorganization al
+dom inal
+Ġattr acted
+Ġattr acting
+Ġgland ular
+Ġabsorb ing
+Ġsy dney
+Ġsy rian
+Ġkin ase
+Ġinst ability
+Ġbott les
+Ġcellular ity
+Ġsent ences
+Ġdeath s
+Ġshif ted
+Ġextre m
+Ġamel ogenesis
+Ġedge wise
+Ġsulf ide
+Ġtorque ing
+Ġcat abolic
+Ġfinanc ially
+Ġauthor ity
+Ġec osystem
+Ġextract able
+Ġscienti fically
+Ġnc m
+Ġmunicip al
+Ġfel dspathic
+Ġhar b
+Ġhol istic
+Ġperm it
+Ġperm its
+Ġperm itted
+Ġuns pecific
+Ġcorrespond ence
+Ġtransf ers
+Ġdistingu ished
+Ġhr l
+Ġhr p
+Ġhr ql
+Ġput ting
+Ġfm bs
+Ġrejec tion
+Ġosteo lysis
+Ġsweet ened
+Ġsweet eners
+Ġscar city
+Ġhomogeneous ly
+Ġlamin ar
+Ġnoti fication
+Ġdim ethyl
+Ġdim orphism
+Ġresol ving
+Ġresol utions
+Ġleg end
+eptid e
+Ġsuperv is
+Ġreinfor ces
+Ġreinfor cing
+dt ot
+Ġframewor ks
+Ġns mu
+Ġdeterior ating
+Ġequival ence
+Ġjusti fication
+Ġcorrec ting
+Ġdiscrimin ating
+Ġdiv or
+Ġdiv ide
+Ġtox ins
+Ġgn ation
+Ġpreschool ers
+Ġcorro sion
+Ġstere ophotogrammetry
+Ġautom ix
+Ġpenetr ates
+Ġmultic ollinearity
+Ġdp rs
+Ġdisrup ted
+Ġtrain ee
+Ġtrigg ering
+Ġprotrusion s
+Ġpet ech
+Ġanalog ous
+Ġ00 2
+Ġinfiltr ate
+Ġinfiltr ations
+Ġanthrop ometry
+Ġdiscol or
+Ġdigitiz ation
+Ġstimul ator
+Ġstret ch
+onym ous
+Ġconce aled
+Ġperfor ations
+Ġsep ticemia
+Ġclassify ing
+Ġmultid imensional
+Ġpig mentation
+Ġren ew
+Ġprepar ing
+Ġneuro degenerative
+Ġendoc anthion
+Ġrom ania
+Ġwors en
+Ġexer ting
+Ġtai wanese
+Ġfavour ably
+Ġzygomatic otem
+Ġarom atic
+icill in
+Ġresorb ed
+Ġaden oid
+Ġepis ode
+Ġmention ing
+Ġaggreg ate
+Ġunre acted
+Ġillness es
+Ġtoxic ological
+ze h
+Ġpv l
+Ġdut y
+Ġcrack ed
+Ġendo plasmic
+Ġphysi ology
+Ġphysi otherapy
+Ġdispers ed
+Ġla id
+Ġla uryl
+Ġrbf dp
+Ġant ec
+Ġtoler ated
+Ġperme able
+hy d
+Ġannot ations
+Ġdisturb ance
+Ġglyc oprotein
+Ġthermo plastic
+Ġcollabor ations
+Ġscratch es
+Ġpolar ity
+Ġconscious ness
+Ġbios ynthesis
+Ġ199 0
+Ġintention ally
+Ġlubric ating
+enz idine
+Ġcouns eling
+Ġstir red
+Ġelectro de
+Ġdupl icated
+Ġunemploy ment
+Ġbring ing
+Ġantigen ic
+Ġreplic ates
+Ġuncontroll able
+Ġoccasion al
+Ġencompass es
+Ġtgn c
+Ġtang ent
+Ġlib eral
+Ġcompens ation
+Ġtrib es
+Ġstereomicro scopic
+Ġmillimet re
+Ġsynergistic ally
+dal a
+Ġwithdr awn
+Ġproce eding
+Ġmicros urgical
+Ġremn ant
+Ġexacerb ate
+Ġsun t
+Ġretic ular
+Ġnit r
+Ġnit ric
+Ġvic tim
+Ġmeticul ously
+Ġoverd ose
+Ġhistomorph ometrical
+Ġheads ets
+Ġsupernat ants
+Ġculti vation
+Ġdd wor
+Ġbif id
+Ġasep tically
+iagnos is
+Ġtrabec ulae
+Ġindustrial ized
+Ġstack ed
+Ġimag inary
+Ġtrache al
+Ġkary orrhex
+yd ro
+Ġtight ening
+Ġpip e
+Ġgenotoxic ity
+Ġretest ing
+Ġseminar s
+Ġattenu ation
+Ġinher ited
+Ġconcurrent ly
+Ġrelig ion
+Ġkill ed
+Ġkill ing
+Ġsof ter
+Ġbran ch
+Ġbran ching
+Ġju ven
+Ġinstal lation
+Ġfluctu ations
+Ġveget ables
+Ġmicronucle us
+Ġef p
+Ġcontig uous
+Ġvivid ly
+Ġperp etr
+Ġdisapp ointing
+Ġembr y
+Ġvirul ent
+Ġsubmuc ous
+Ġspectrom eter
+Ġstic ky
+Ġreass ess
+Ġelu tion
+Ġelu ted
+Ġhistopath ology
+Ġimmunore activity
+Ġmidwif e
+92 9
+Ġace tic
+Ġsas ayama
+Ġtouch ing
+atiz ed
+Ġves icular
+Ġbiot echnology
+Ġcri tic
+Ġcri tically
+Ġtransduc er
+Ġhistor ical
+Ġpolys omn
+Ġsteril ized
+Ġevol ve
+Ġcamp us
+Ġpreclud ing
+Ġtwin light
+Ġleuc ite
+Ġune ven
+Ġoutper formed
+Ġimped e
+Ġmultil ink
+Ġsuit ability
+Ġdiges tion
+Ġdiges tive
+Ġhypert ensive
+Ġraj esh
+Ġowners hip
+Ġrefrig er
+Ġpyram id
+Ġpyram idal
+Ġtsal d
+Ġtsal dtot
+Ġeosinophil ic
+Ġproceed s
+Ġautonom ous
+Ġautonom ously
+Ġanton i
+Ġhered itary
+Ġvig orous
+Ġvibr ating
+Ġhepar in
+Ġaber rant
+Ġdecalc ified
+Ġspons orship
+Ġjo ined
+Ġhyal ur
+Ġiq r
+Ġmalay a
+Ġprofess ors
+Ġprecip itate
+Ġslee ves
+Ġphosphory lation
+Ġmisd iagnosis
+Ġdehyd ration
+Ġanaerob es
+Ġkuwa iti
+Ġobstac les
+Ġfasc ia
+Ġexcep tions
+Ġmah alan
+Ġscaff old
+Ġunav ail
+Ġdetach ment
+Ġcorners t
+Ġdesquam ative
+Ġtranscript ase
+Ġconfer ring
+Ġremind ers
+Ġpathophys iological
+Ġsuff ix
+Ġautops y
+Ġbook let
+Ġdysreg ulation
+Ġdenom inator
+Ġasteris k
+Ġsor ted
+Ġsad dle
+Ġdhe a
+Ġreti red
+Ġpert urb
+Ġrit uximab
+Ġdisg ust
+Ġhemost asis
+Ġcoag ulation
+Ġparv imonas
+Ġcontem porary
+Ġtric losan
+Ġtransill umination
+Ġelong ation
+Ġprednis one
+ometr ically
+Ġhypothal amus
+Ġhydrof luoric
+Ġannex in
+Ġtorsion al
+Ġinhom ogeneous
+Ġconcres cence
+Ġharv esting
+Ġrhabdomy osarcoma
+Ġvlogg ers
+Ġvertebr ae
+Ġethylenedi aminetetr
+Ġelabor ated
+Ġpreprocess ing
+Ġepigene tic
+Ġau tis
+Ġcub ic
+Ġpend ulum
+Ġpier re
+Ġantr al
+Ġbam ako
+Ġrl cs
+Ġresembl ing
+Ġdisreg arded
+ferenti ally
+Ġprescrip tions
+Ġtrip le
+Ġtrimm ing
+Ġconsor tium
+Ġintercus pation
+Ġunequ al
+Ġunidenti fied
+Ġintu itive
+Ġkerm an
+Ġkang fux
+Ġradiop aque
+Ġmicrop ipette
+Ġmicroet cher
+Ġremed ies
+Ġmucoc iliary
+Ġbacteroid etes
+otherap eutic
+Ġverruc ous
+Ġwilli ams
+Ġcondens ation
+Ġqalp ntgee
+Ġintermed ia
+Ġmicromorph ology
+Ġtrapez oidal
+analy zer
+Ġhtv c
+Ġpeculi arities
+Ġdeprote inized
+Ġtrep onema
+Ġsyst olic
+Ġovari an
+Ġcet yl
+Ġcmoh k
+Ġpamph let
+Ġwech at
+Ġhoun sfield
+Ġhacet tepe
+Ġlaus anne
+Ġnij megen
+Ġgaus sian
+Ġgreg ory
+osse ous
+Ġalend ronate
+Ġaltitud e
+Ġpropri etary
+Ġisra el
+Ġisfa han
+Ġsegn et
+enceph al
+Ġlemes how
+Ġtrio xide
+Ġobli que
+Ġaccult uration
+Ġsuboptim al
+Ġunso und
+Ġamyg dala
+Ġgenisc a
+Ġbiob ank
+Ġdiaminob enzidine
+Ġconfection ary
+Ġintrales ional
+ammaglobulin emia
+Ġzhe jiang
+Ġplankt onic
+Ġosman gazi
+Ġparenchym a
+Ġhyposal ivation
+Ġverticill ium
+Ġsensodyn e
+Ġnewcast le
+Ġfluorochrom e
+Ġsynov ial
+Ġhyperlin ks
+Ġvirucid al
+Ġultrastruct ural
+Ġmassili ense
+Ġporcel ain
+Ġzygomaticotem poral
+Ġkaryorrhex is
+Ġmahalan obis
+Ġethylenediaminetetr aacetic
+Ġkangfux in
+, "
+0 3
+0 9
+2 1
+4 4
+8 8
+a ve
+a ag
+b el
+b ell
+b les
+b pa
+c or
+c ant
+c ore
+c pre
+d c
+d u
+d est
+d etected
+e g
+e on
+f ast
+f lora
+g is
+g ha
+g ov
+h ul
+i atic
+j d
+k eless
+k gl
+l im
+l uc
+l ished
+l eness
+l urane
+m as
+m ar
+m and
+n i
+n p
+n est
+o ot
+o ag
+p o
+p en
+p ic
+p ig
+p ensive
+p ring
+p tivity
+p aper
+p ointed
+r q
+r ated
+r ins
+s cc
+s ky
+t le
+t ct
+t art
+t oxic
+t gg
+t otal
+u ated
+u itable
+v it
+v ibacter
+w al
+w ord
+w gt
+x ill
+x ceph
+y te
+y der
+y xceph
+Ġ ub
+Ġ velop
+Ġt ent
+Ġt ree
+Ġt ack
+Ġt art
+in b
+in ten
+in osa
+in atus
+Ġa ur
+Ġa rose
+Ġa rous
+Ġa abc
+Ġa venue
+re vibacter
+Ġth omm
+on ates
+Ġs id
+Ġs ant
+Ġs ir
+Ġs end
+Ġs ass
+Ġs ene
+Ġs ri
+Ġs sc
+Ġs roc
+Ġs fa
+Ġs acr
+ti form
+Ġo le
+Ġo ven
+Ġo asis
+Ġo tt
+en tic
+en ia
+en itor
+al though
+er os
+er adi
+er ating
+er ned
+Ġc w
+Ġc ip
+Ġc gi
+Ġc els
+Ġp in
+Ġp ed
+Ġp us
+Ġp ere
+Ġp ge
+Ġp ater
+Ġp ss
+Ġp ick
+Ġp pe
+Ġp ma
+Ġp tm
+Ġp ads
+Ġw on
+Ġw st
+Ġw ang
+Ġw rapped
+Ġw gc
+Ġin puts
+es cence
+Ġan c
+Ġan h
+Ġan hu
+Ġan ionic
+Ġf id
+Ġf its
+Ġf ax
+Ġf uk
+Ġf gg
+Ġf oster
+Ġf erment
+Ġf entan
+Ġf kgl
+Ġd ere
+Ġd ow
+Ġd ip
+Ġd ub
+Ġd end
+Ġd bs
+Ġd row
+Ġd inucle
+Ġd obut
+Ġd jd
+Ġm ere
+Ġm oc
+Ġm cr
+Ġm yl
+Ġm ilit
+Ġm tes
+at en
+at uring
+at ched
+or i
+or ance
+or ne
+or oot
+th on
+th us
+an ine
+an ks
+Ġb w
+Ġb x
+Ġb er
+Ġb ab
+Ġb are
+Ġb rom
+Ġb end
+Ġb ang
+Ġb ax
+Ġb old
+Ġb ank
+Ġb ern
+is ol
+is ability
+tion ately
+as i
+as ure
+ent ed
+ic y
+ic ing
+ic ide
+ic les
+ic its
+ro d
+ro fl
+Ġre feren
+Ġre ex
+Ġre vascular
+Ġre aff
+Ġto d
+Ġto ky
+Ġh it
+Ġh ors
+Ġh ok
+Ġh inge
+le g
+Ġe ap
+Ġe igen
+Ġe fa
+Ġe ucl
+it o
+it as
+it ter
+it ers
+it ations
+us ting
+us si
+Ġst ore
+Ġst ents
+Ġst rap
+Ġst av
+Ġst ayed
+Ġst yles
+Ġst uff
+ere mia
+ul f
+ul ant
+ul cular
+ac a
+ac g
+ac oustic
+ac ami
+ec s
+ec tions
+ec ond
+Ġl is
+Ġl ud
+Ġl ati
+Ġl ach
+Ġl oci
+Ġl ra
+Ġl ank
+Ġl ussi
+om agic
+Ġn i
+Ġn atal
+Ġn nt
+Ġn rt
+im il
+im plant
+im otor
+im ura
+Ġg g
+Ġg y
+Ġg ree
+Ġg ome
+Ġg all
+Ġg ale
+ur ia
+ig ley
+et ti
+os h
+os es
+os tal
+os ities
+Ġwas te
+if entan
+ol s
+ol uble
+Ġas per
+Ġas par
+Ġas yl
+Ġas leep
+il ine
+il ian
+Ġcon g
+Ġcon formed
+Ġcon gl
+od s
+od ium
+od emic
+id om
+id ad
+id ium
+id ov
+id inium
+Ġon yxceph
+ts son
+am ara
+tic ola
+Ġv ls
+Ġv oids
+el le
+ter a
+ter ity
+Ġal iph
+Ġal ara
+Ġper in
+Ġr w
+Ġr im
+Ġr ush
+Ġr ick
+Ġr pe
+Ġr cs
+Ġr ights
+Ġr rs
+Ġwh is
+Ġwh ate
+Ġpro ff
+Ġpro max
+Ġres emb
+Ġbe es
+ion e
+uc k
+Ġcom mented
+ot ong
+ot ens
+ot rophic
+Ġim w
+Ġim mo
+Ġis l
+Ġis ot
+Ġis lands
+ut ory
+ir c
+ir y
+oc c
+oc ard
+oc onstr
+oc ultural
+qu al
+qu er
+qu ence
+qu antit
+Ġch est
+Ġde ploy
+Ġde pressed
+ore z
+ore cept
+igh ter
+Ġinc ap
+um s
+pl icated
+Ġat las
+Ġpre formed
+Ġpre ferentially
+ys ed
+Ġcomp e
+Ġcomp lying
+iv able
+Ġdis hes
+Ġse eding
+Ġse vered
+Ġse psis
+Ġsh a
+Ġsh ed
+Ġsh ush
+Ġsh ades
+ap ine
+ap tan
+Ġad ds
+Ġad hs
+feren tial
+Ġbet nes
+Ġhe ins
+Ġhe man
+Ġass er
+Ġass ured
+Ġass ists
+Ġass uring
+Ġass imil
+Ġcl as
+Ġcl ient
+Ġcl oned
+Ġcl oning
+and o
+and ina
+por ting
+por osity
+we es
+we ar
+we ighted
+em ar
+em ide
+em br
+em akers
+ers on
+Ġsc ant
+Ġsc andina
+Ġperi opaper
+Ġit erations
+und ii
+Ġco a
+Ġco ur
+Ġco ast
+Ġco ex
+Ġind ul
+Ġind oor
+ub lished
+se a
+Ġcan n
+Ġpar amed
+Ġpos ted
+st rength
+Ġinf eri
+Ġinf odemic
+per t
+Ġha w
+Ġha wth
+ich ia
+Ġpres e
+Ġpl ung
+ell er
+Ġall ogenic
+Ġperiodon tists
+ch i
+ug inosa
+ill ed
+ill ar
+ill over
+ill aries
+Ġro se
+Ġtr ust
+Ġtr ays
+Ġtr acks
+Ġtr sk
+Ġmod ular
+ach i
+ach es
+ach ial
+Ġcons pic
+Ġreg isters
+Ġob sc
+Ġno xi
+Ġrec on
+Ġrel aps
+Ġne vir
+Ġcar unc
+Ġcar isol
+Ġab st
+Ġab usive
+Ġab dominal
+fac eted
+Ġsub sc
+Ġinter cellular
+Ġinter vie
+Ġinter bracket
+Ġqu ant
+Ġqu alities
+Ġqu iet
+Ġqu igley
+Ġun l
+Ġun trained
+Ġun balanced
+Ġint ubated
+Ġy ol
+Ġy ang
+Ġy ields
+ens ory
+ard o
+ard itis
+Ġassoci ate
+Ġassoci ates
+Ġk im
+Ġk cl
+Ġk ath
+Ġk och
+ple ts
+Ġwe ather
+ast a
+pro p
+pro duc
+ost ar
+ire ction
+Ġen graft
+yp t
+Ġchild birth
+ph thal
+ph enol
+Ġout growth
+Ġout lines
+Ġout lining
+Ġsuc ce
+Ġup hold
+ond rosis
+ide an
+ose quence
+Ġcor ah
+Ġdes min
+acter ium
+Ġso ce
+valu es
+Ġph usion
+Ġph ag
+Ġevalu ator
+Ġover wh
+Ġover represent
+Ġnum eric
+Ġfound ed
+Ġbi ologic
+Ġbi ode
+ct c
+Ġmo uld
+Ġmo vable
+ograph s
+Ġdec e
+Ġcr aw
+Ġag ammaglobulinemia
+Ġwhen ever
+Ġstr iation
+Ġstr angers
+Ġ1 50
+Ġbr itt
+Ġbr idges
+Ġbr du
+Ġbr achial
+Ġlower case
+ep id
+ep tive
+ag m
+ag le
+ag onal
+ag asta
+ath y
+ath etic
+Ġmaxill o
+Ġcompar ably
+Ġnon con
+Ġnon linear
+ingiv ally
+Ġdisc erned
+Ġsup pose
+Ġclass ifies
+Ġorth o
+Ġdef enses
+Ġdef icits
+Ġsp in
+Ġsp ong
+Ġsp ans
+Ġsp ending
+Ġsp urt
+Ġsp acer
+Ġsp iro
+Ġj ab
+Ġj acc
+Ġbut tress
+Ġed j
+Ġed ition
+Ġed itor
+Ġmicro control
+Ġmicro flora
+Ġmicro implant
+Ġcomm ens
+Ġtyp ing
+te ine
+Ġfive fold
+Ġeffect or
+Ġpop s
+Ġmaterial ise
+Ġbec n
+Ġi ip
+ivid ual
+Ġtrans c
+Ġop n
+Ġop tic
+Ġop scc
+Ġwell ness
+Ġgr d
+Ġgr ant
+ak i
+Ġdep iction
+Ġdep apill
+Ġsal e
+Ġunder develop
+Ġcharacter s
+Ġimp eding
+Ġpost ures
+Ġcro atia
+Ġser ous
+Ġser ology
+Ġvis ibility
+Ġbl and
+Ġbl ister
+Ġbl asted
+Ġbl unt
+Ġsin tering
+Ġol t
+Ġintr uded
+Ġ0 7
+Ġ0 8
+Ġ0 9
+Ġz ah
+Ġz eros
+Ġz idov
+Ġtotal ing
+Ġsix teen
+Ġer oded
+Ġsecond hand
+Ġcondition al
+Ġsoft ening
+Ġdr ains
+Ġend odontist
+Ġend oscopic
+Ġend orez
+Ġend osequence
+Ġloc ator
+Ġel icit
+Ġel dest
+Ġmulti tude
+Ġmulti faceted
+fer ase
+Ġrem emb
+Ġrem eas
+Ġrem ifentan
+ie ties
+Ġsome how
+Ġincis ive
+Ġcle ary
+Ġinflu x
+ob ium
+ob revibacter
+Ġmuc ins
+ha e
+Ġdistrib uting
+Ġins ec
+Ġins pect
+Ġins oluble
+Ġconduc tivity
+Ġbefore hand
+Ġear s
+gi osis
+Ġir ish
+Ġinstr on
+etic ally
+Ġoc clus
+Ġsmo keless
+Ġinfec tive
+Ġrece ptivity
+Ġprot on
+Ġbeha ve
+Ġgl o
+Ġpath osis
+Ġcommon est
+Ġoper ational
+Ġspecific ation
+Ġdist obuccal
+Ġunivers itas
+Ġunivers idad
+Ġos x
+Ġoccur rences
+Ġav iv
+Ġav ascular
+of lurane
+of agasta
+Ġmechan istic
+Ġmechan otherapy
+Ġmechan orecept
+Ġpal e
+Ġpal p
+yl obacter
+Ġthir teen
+Ġhist ories
+Ġtm a
+Ġes tr
+Ġes cal
+Ġes ophageal
+Ġfl ip
+Ġdistribution al
+Ġpubl ish
+Ġoste oph
+Ġoste odent
+Ġdimension ally
+Ġdimension ality
+Ġprof ici
+Ġda hl
+Ġevid ently
+Ġsl ing
+Ġang ulations
+Ġmaj ors
+Ġhyp oxia
+Ġhyp hae
+Ġfe ared
+Ġver on
+Ġver hul
+ogen in
+Ġ5 3
+Ġep inephrine
+Ġsol d
+Ġhard s
+Ġsoci ocultural
+Ġred d
+Ġred ness
+Ġcontr arily
+Ġpotential s
+ocol itis
+Ġnorm ando
+Ġtherap ist
+Ġtherap ists
+Ġnew tons
+ins titution
+Ġvalid ating
+Ġcompl ies
+Ġcompl icating
+Ġpulp otomies
+Ġsingle t
+Ġcap ped
+Ġcap sa
+Ġcap illaries
+Ġprov oking
+Ġprov ocation
+Ġprov oke
+Ġalign s
+Ġday light
+Ġref ix
+Ġref lux
+Ġestim ations
+Ġdm em
+more over
+hol m
+irm ed
+Ġpoly p
+Ġpoly ethyl
+Ġpoly gonal
+Ġsu ited
+Ġsu icide
+Ġsym b
+Ġcategor izing
+ou fl
+pe ople
+Ġlif t
+onal d
+Ġreli abilities
+vent ful
+Ġtum s
+Ġdevi ate
+Ġu oc
+Ġu ae
+Ġaut ocl
+Ġorder ing
+Ġret ino
+Ġlay people
+Ġdig enic
+Ġdig luc
+Ġresist ances
+Ġcarr ies
+Ġvers atile
+Ġsw s
+Ġcult urally
+Ġod onto
+Ġmultiple x
+Ġflow s
+Ġprog enitor
+Ġauth entic
+Ġpractic ally
+Ġ6 8
+Ġadm ixed
+Ġnormal ization
+Ġta u
+cle ft
+Ġfib ron
+Ġfib ril
+Ġdirect or
+Ġdirect ors
+Ġrespons ive
+Ġaccess ories
+Ġfree ly
+Ġmm ps
+Ġmm pa
+Ġgo v
+Ġgel atin
+Ġct v
+Ġprec a
+Ġclear ing
+Ġintroduc es
+Ġdom inance
+Ġbo y
+Ġbo oking
+Ġhal t
+Ġhal ogen
+Ġappear ing
+Ġappear ances
+Ġdeep ening
+Ġhypoth etically
+Ġhyper g
+Ġhyper pig
+Ġhyper inten
+ink led
+Ġcycl er
+ned y
+Ġconstr ictions
+Ġnecess itated
+oma xill
+Ġchr is
+roph osphate
+Ġspl ine
+Ġshap ley
+Ġcontrast ing
+Ġmorph ologic
+Ġpsych otropic
+Ġpress ing
+Ġmut ants
+Ġmut agen
+ros emide
+Ġrough ened
+Ġsk ew
+Ġpur s
+Ġpur se
+Ġartic ulation
+Ġartic aine
+tention ally
+Ġx p
+scop ically
+Ġhyd rate
+Ġchem oradi
+Ġchem ilum
+Ġchem otherapeutic
+Ġapproxim ated
+Ġpol ium
+cep tive
+Ġsepar ates
+Ġconcentr ate
+Ġconcentr ating
+Ġwall ed
+Ġregular ity
+Ġregular ization
+Ġdoc king
+Ġtra jec
+Ġpolymer ic
+Ġpanor ama
+Ġoptim ally
+Ġwa ke
+Ġwa ived
+Ġattrib ution
+Ġdigital ized
+Ġms p
+Ġsubs ite
+Ġsubs ided
+me ga
+ocy tosis
+Ġtop ographic
+Ġexclusion s
+Ġtub ular
+Ġtub erc
+Ġtub ulin
+Ġmus lim
+Ġsn yder
+Ġcd e
+Ġcoll apse
+eric ity
+Ġbar c
+Ġvisual izing
+Ġecon omy
+Ġalong side
+orb ent
+Ġcod ification
+Ġten se
+Ġten ets
+Ġmagn ifications
+Ġtransl oc
+Ġreal izing
+Ġorgan isation
+Ġdetect ors
+Ġfit ness
+Ġic cs
+obl astic
+Ġemerg ent
+Ġmanual s
+Ġbur ns
+Ġrepl en
+Ġtemper ing
+Ġge omagic
+Ġenc aps
+Ġmy ogenin
+Ġerup ting
+grad ation
+Ġmr c
+Ġmr s
+Ġmill ilit
+Ġstain ability
+Ġepithelial ization
+Ġsem ester
+Ġscreening s
+Ġinstit ut
+Ġlig aments
+Ġhem im
+Ġhem ocyt
+Ġmac ao
+Ġpapill omatous
+Ġadvant aged
+Ġmedic ines
+omat osis
+Ġinterpre tability
+Ġtraum atized
+Ġmass es
+Ġmass ive
+Ġpass ively
+Ġcop e
+Ġcop ious
+Ġher ze
+Ġpm pr
+Ġnan of
+Ġadap ter
+Ġsection ing
+Ġcandid osis
+Ġpor tions
+Ġpor osities
+Ġassign ing
+Ġur g
+Ġder otation
+Ġchlor amph
+Ġblock ers
+Ġblock age
+Ġpeak ed
+Ġstre aming
+ili aries
+Ġalter s
+Ġmis con
+Ġlin er
+Ġlater o
+Ġnucle ation
+Ġnucle oside
+oh ex
+Ġcompreh ension
+Ġinteraction al
+Ġmedi ating
+Ġnex tera
+Ġcam oufl
+Ġpf h
+Ġpf ms
+Ġpf de
+Ġwr inkled
+Ġanch ors
+Ġanch oring
+Ġinterview er
+Ġinterview ing
+Ġinterview ers
+Ġaccount ability
+Ġcre a
+Ġexplan ted
+Ġenti ties
+Ġsar pe
+Ġodont ocl
+Ġreconstr uctive
+Ġabund ances
+Ġcolle ges
+Ġoffic ers
+Ġincorpor ates
+the tical
+Ġextern ally
+Ġfal con
+Ġcard i
+Ġarr ive
+Ġrespir ators
+Ġsubstanti ate
+Ġann ounced
+Ġwound s
+Ġirregular ly
+Ġbal tic
+Ġnear by
+Ġconver t
+Ġlymph oid
+Ġprop r
+Ġdeb ond
+Ġdeb atable
+Ġtransm embr
+Ġrev is
+Ġrev olution
+Ġste adily
+Ġfacult ative
+Ġsummar ize
+Ġsubm ission
+Ġsod a
+Ġinequ ities
+Ġcovari ation
+Ġcovari ables
+10 1
+10 5
+Ġedent ate
+Ġcc g
+Ġcc w
+Ġcarcin omatosa
+Ġexpand ers
+Ġreproduc ed
+Ġequal s
+rs f
+Ġrs a
+Ġabnorm ally
+Ġtext bo
+Ġsubg ingivally
+Ġdecid ing
+Ġsegment ing
+zym e
+Ġcys teine
+Ġtnf rsf
+Ġvas oconstr
+bo ard
+Ġthin ning
+Ġthin nest
+Ġmap ks
+cha etes
+Ġ202 3
+Ġker at
+Ġbio activated
+Ġulcer ated
+Ġcoordin ated
+cet ti
+Ġsurround s
+Ġ200 8
+Ġindent er
+Ġden mark
+Ġden oted
+Ġden ticola
+Ġrp ds
+Ġcusp id
+Ġspread er
+Ġmembers hip
+Ġbis phenol
+Ġord ers
+Ġexc iting
+Ġagg l
+Ġspe akers
+Ġdil acer
+Ġemo tionally
+Ġprosthetic ally
+Ġpsor iatic
+Ġah rq
+Ġcav acami
+astom as
+Ġlock er
+Ġattr act
+Ġmacro economic
+Ġmacro scopically
+Ġharm ony
+Ġthor ac
+Ġretrie ve
+Ġretrie ving
+Ġtransform er
+Ġtransform ations
+Ġsulf onate
+Ġconc aten
+Ġucl a
+Ġappe aling
+Ġsplit ting
+Ġswe at
+Ġswe ets
+Ġben gha
+Ġurban ization
+Ġqualitative ly
+Ġconv inc
+Ġrt dc
+Ġcontain ers
+Ġauthor itative
+Ġwar rant
+Ġrepa iring
+Ġspectr al
+Ġelect roc
+sin ess
+Ġec cles
+Ġserious ly
+Ġphotograph er
+Ġphotograph ed
+Ġattain ing
+Ġmoti vated
+Ġactiv ators
+Ġphoto acoustic
+Ġscienti sts
+Ġnc bi
+Ġfif teen
+Ġuns pecified
+Ġuns uitable
+Ġgranul omatosis
+Ġtransf usion
+Ġprofil ometry
+rogen ase
+Ġobstr ucted
+Ġpseud o
+Ġpay ing
+Ġpay ments
+Ġexpect ation
+Ġquar ant
+Ġamelobl astomas
+Ġter tile
+Ġantic aries
+Ġantic oag
+Ġscar ring
+Ġfourth s
+Ġoccup ied
+Ġnanopartic le
+Ġglaz ed
+Ġple omorph
+Ġport ug
+Ġangi otens
+Ġadip ose
+Ġmethan ogen
+Ġmethan obrevibacter
+Ġnons yn
+Ġnons ignificant
+Ġimbal ances
+Ġkh an
+Ġsimpl icity
+Ġgluc onate
+Ġmt ls
+Ġbad ge
+Ġdiscrimin ative
+Ġoxygen ation
+Ġpharm acy
+Ġmoist ening
+Ġdiagn odent
+Ġhypomineral izations
+Ġnorth w
+Ġbul b
+Ġchrom atic
+Ġpathogenic ity
+Ġpersist ing
+Ġautom ate
+Ġpenetr ated
+Ġpenetr ating
+Ġtension s
+Ġmultic lass
+mm ol
+Ġdp ig
+Ġdisrup ting
+Ġunp ublished
+Ġmetagen ome
+Ġpromin ence
+Ġvalu ed
+Ġgram s
+ker atosis
+Ġintraoperative ly
+Ġexh aus
+Ġgovernment al
+Ġsenior ity
+Ġpig ment
+Ġren ewed
+Ġrich ness
+Ġendoc rine
+Ġendoc arditis
+Ġrefr ain
+Ġrefr act
+Ġpy thon
+Ġpy rophosphate
+Ġwors ens
+Ġexer ts
+Ġchew able
+Ġshar ply
+Ġsensor imotor
+Ġment ally
+Ġvsc s
+Ġprelimin arily
+Ġdistor ted
+Ġsemi quantit
+Ġaden ine
+Ġaden oma
+Ġsupr ac
+Ġoroph arynx
+Ġtruth s
+Ġunre li
+Ġmalform ed
+Ġimmig rant
+Ġosteop rogen
+Ġmesh mix
+Ġsustain ing
+Ġadministr ated
+Ġregul ator
+Ġjour ney
+Ġconfig ural
+Ġanticip atory
+Ġanthropometric s
+Ġtun el
+Ġventi l
+Ġcontamin ants
+Ġmeaningful ly
+Ġinaccur acy
+Ġant ofagasta
+Ġanonym ously
+Ġtoler ant
+Ġaspir ates
+Ġindustr y
+Ġindustr ially
+Ġinters ected
+Ġinters urface
+Ġprosth odontist
+Ġexception ally
+Ġhemat opoietic
+Ġts gh
+Ġglyc os
+Ġterti les
+Ġcorrobor ates
+Ġdele tion
+Ġpoin ting
+Ġsuppress ing
+Ġconflic ts
+Ġintraven ously
+Ġcollabor ate
+Ġcollabor ating
+Ġcorticoster oid
+Ġbeauti ful
+Ġsenti strength
+Ġoil s
+Ġfren um
+att ach
+Ġneu rop
+Ġaer uginosa
+Ġhapp ens
+Ġroll s
+Ġstir ring
+Ġnanos truct
+Ġenter ocolitis
+Ġign orance
+Ġaux iliaries
+Ġnb h
+Ġpresum ptive
+Ġrect us
+Ġgeneraliz able
+Ġsynch ondrosis
+Ġxen ografts
+Ġintim ately
+Ġmaf rs
+Ġcrop ping
+Ġtag s
+Ġsph ericity
+Ġfu rosemide
+Ġfer mentation
+Ġproce eded
+Ġadh ering
+Ġmicros omia
+Ġdissol ving
+Ġexacerb ation
+Ġexacerb ated
+Ġsial oprotein
+Ġpum a
+Ġhind ered
+Ġnit rogen
+Ġorific es
+Ġprocl ined
+opo lys
+opo lymer
+Ġrequest ing
+Ġguarant eed
+Ġodontobl ast
+Ġlys ed
+Ġgf b
+Ġcoinc idence
+Ġcoinc ides
+Ġcoinc ident
+Ġneo plasms
+Ġsubc ult
+Ġfirm ly
+Ġfraction al
+Ġfamiliar ity
+Ġworkflow s
+azol ium
+Ġmarking s
+Ġdocument ing
+Ġcada vers
+Ġmacrodes ign
+Ġacknowled ging
+Ġmbl s
+Ġbac cetti
+Ġlic ens
+Ġfort unately
+Ġexfoli ation
+Ġimag ine
+Ġheatm aps
+80 6
+onduc tor
+Ġopt g
+Ġdro plets
+Ġstv c
+Ġscl erotic
+Ġtrack ing
+Ġdiscontin uation
+Ġloose ly
+Ġlabor atories
+Ġniger ian
+26 4
+Ġsan itation
+Ġdt c
+Ġdum mer
+Ġdress ings
+Ġperic ard
+Ġreluct ant
+Ġenrich ment
+Ġju icy
+Ġcommit ment
+Ġdoub led
+Ġfluctu ation
+Ġbiofunctional ization
+Ġafflu ence
+Ġprovisional ized
+Ġprovisional ization
+Ġoss c
+Ġwel ded
+Ġbus iness
+Ġei ken
+trans plant
+trans ferase
+Ġcomput ations
+Ġphyl um
+Ġtaq man
+Ġultrason ically
+Ġafford ability
+Ġsubmuc osal
+Ġtanz anian
+yth ia
+Ġtil ting
+Ġstic ks
+enic ol
+Ġinex pensive
+ano ic
+Ġhon est
+Ġerb b
+Ġflush ed
+Ġverte bral
+Ġimmunore active
+Ġhyperch rom
+Ġcarboxyl ic
+Ġmigr atory
+Ġaggrav ated
+Ġaggrav ate
+Ġtel eradi
+Ġstock holm
+Ġnom inal
+Ġnom ogram
+Ġgather ing
+Ġneph rotic
+Ġunw illing
+Ġevol ving
+Ġcamp ylobacter
+Ġdynam ometer
+Ġvortex ed
+Ġcred ibility
+Ġatp ase
+Ġsevent y
+Ġinterp ol
+Ġune ventful
+Ġoutper forms
+Ġze al
+Ġhandicap ping
+Ġcaps id
+Ġcaps ule
+Ġpolyphosph ate
+Ġcontribut ors
+Ġoverload ing
+Ġmetalloprotein ase
+Ġvapor ization
+Ġneighbour ing
+Ġneighbour hood
+Ġhb p
+Ġlum en
+Ġresor ptions
+Ġresor ptive
+Ġhepar inized
+Ġtriang ular
+Ġconflu ence
+Ġmultif unctional
+Ġiraq is
+Ġpolyol s
+Ġelev ator
+Ġslee ve
+Ġphosphory lated
+Ġdehyd rogenase
+Ġanaerob ically
+Ġdwell ings
+Ġkuwa it
+Ġobstac le
+46 8
+onucle ar
+Ġsort ase
+Ġcens ored
+Ġfc n
+Ġdog s
+Ġmich a
+Ġbub bles
+Ġbites trip
+Ġlob ene
+Ġhaemat oxylin
+Ġunin tentionally
+Ġamp icillin
+Ġtranspl ants
+Ġtranspl anted
+Ġglomer ular
+Ġhydrochlor ic
+Ġhydrochlor ide
+Ġmicrol iter
+Ġmicrol iters
+Ġconstitu ent
+Ġconstitu ents
+Ġrhyth m
+Ġpharmaceutical s
+Ġmoistur izer
+Ġcontradic ts
+Ġinactiv ate
+Ġdisappear ance
+Ġdispropor tionately
+Ġrhamnol ipid
+Ġrhamnol ipids
+Ġut m
+Ġspor ad
+Ġanim ation
+Ġdot ted
+Ġderm at
+Ġreevalu ation
+Ġhim self
+Ġvw cpre
+Ġexoc anthion
+Ġpropos al
+Ġatom s
+Ġseiz ures
+Ġadver tise
+Ġsurpass es
+Ġconsolid ated
+Ġunid imensional
+Ġken nedy
+Ġjia otong
+Ġminip ig
+Ġunderp in
+partic ip
+Ġflo ating
+Ġsegreg ation
+Ġbisphosph onates
+Ġamelior ate
+Ġargu ment
+Ġretrocl ination
+Ġsphen o
+Ġlncr nas
+Ġamphoter icin
+Ġmycobi ome
+fam il
+iqu it
+pyr idinium
+Ġthuring ia
+Ġsig moid
+Ġcts k
+Ġanesthes iologists
+Ġrech ecked
+Ġhots tart
+Ġell ip
+Ġfors ythia
+Ġconvention ally
+Ġalarm ing
+Ġdeple tion
+Ġmex ican
+Ġallopl asts
+Ġpole i
+Ġsuppl ies
+Ġintras ulcular
+Ġerg onomic
+Ġmultipl ication
+Ġmultilay er
+Ġsett led
+Ġpalis ading
+Ġcohere nce
+Ġxanth an
+meth ods
+Ġpreponder ance
+Ġmyco tic
+Ġhousekee per
+Ġhomo zyg
+Ġoffs pring
+Ġbreastf ed
+Ġsulph uric
+Ġmcn emar
+Ġdebilit ating
+Ġbioinform atics
+Ġpoliclin ic
+Ġembarr assed
+Ġprefect ure
+Ġdoubt ful
+Ġreshap ed
+Ġmanoeuv re
+Ġosteoinduc tive
+Ġthermocoup le
+elec tric
+rym al
+Ġthous and
+erad ish
+Ġcasc ade
+Ġmur ine
+Ġmors el
+Ġmens tr
+Ġmerc aptan
+Ġbib li
+Ġrecl ining
+Ġech o
+Ġlac un
+Ġnur ser
+Ġnad ir
+Ġgam ander
+Ġexem pl
+Ġpreb ent
+Ġdisartic ulation
+Ġseas onal
+Ġsurfact ants
+Ġinfar ction
+Ġregrow th
+Ġabdul aziz
+Ġinterr adicular
+Ġcontroll able
+Ġdecis ive
+Ġnoncont act
+Ġsupre me
+Ġtranscrip tional
+Ġdiure tics
+Ġfluoroph ores
+Ġsympos ium
+Ġhyperther mia
+Ġsemic onductor
+Ġmisclass ification
+Ġdivor ced
+Ġpetech iae
+Ġrenew al
+Ġadenoid itis
+hyd ration
+Ġnitr ide
+Ġbifid obacterium
+ydro xy
+Ġjuven ile
+Ġpolysomn ographic
+Ġrefriger ator
+Ġhyalur onic
+Ġautis m
+Ġcetyl pyridinium
+gov ina
+mand u
+vit amin
+Ġvelop h
+Ġtart u
+Ġthomm en
+Ġsass ari
+Ġsacr ific
+Ġott awa
+Ġcip rofl
+Ġcels ius
+Ġpater nal
+Ġpick ed
+Ġwgc na
+Ġanhu i
+Ġfuk uoka
+Ġferment able
+Ġfentan yl
+Ġdub lin
+Ġdbs np
+Ġdrow siness
+Ġdinucle otide
+Ġdobut amine
+Ġmilit ary
+Ġbare ly
+Ġbrom ide
+Ġrevascular ization
+Ġtoky o
+Ġhors eradish
+Ġeap d
+Ġeucl idean
+Ġstav udine
+Ġlach rymal
+Ġlank a
+Ġgree k
+Ġaspar tate
+Ġasyl um
+Ġcongl omer
+Ġaliph atic
+Ġwhate ver
+Ġproff it
+Ġresemb les
+Ġimmo b
+Ġshush tar
+Ġbetnes ol
+Ġheins g
+Ġheman giosis
+Ġscandina vian
+Ġcoex ist
+Ġinferi us
+Ġhawth orne
+Ġplung er
+Ġtrsk f
+Ġconspic uous
+Ġnoxi ous
+Ġrelaps es
+Ġnevir apine
+Ġcarisol v
+Ġintervie wees
+Ġkath mandu
+Ġweather ing
+Ġengraft ment
+Ġoverwh el
+Ġbiode gradation
+Ġcraw ford
+Ġbritt leness
+Ġspiro chaetes
+Ġjacc ard
+Ġmicrocontrol ler
+Ġzidov udine
+Ġrememb ered
+Ġremeas ured
+Ġremifentan il
+Ġmechanorecept ors
+Ġosteodent in
+Ġdahl berg
+Ġverhul st
+Ġcapsa icin
+Ġpolyethyl ene
+Ġautocl aved
+Ġretino ic
+Ġdigluc onate
+Ġfibron ectin
+Ġhyperpig mentation
+Ġhyperinten se
+omaxill ofacial
+Ġchemoradi otherapy
+Ġchemilum inescence
+Ġtuberc ul
+Ġmillilit ers
+Ġhemocyt ometer
+Ġherze govina
+Ġchloramph enicol
+Ġcamoufl age
+Ġtransmembr ane
+Ġtextbo oks
+Ġbengha zi
+Ġangiotens in
+Ġsemiquantit ative
+Ġmeshmix er
+Ġciprofl oxacin
+0 2
+0 6
+0 8
+0 50
+1 15
+3 1
+3 3
+3 5
+4 95
+5 92
+7 00
+9 6
+9 15
+? "
+a ut
+a ult
+a quer
+b ot
+b est
+b its
+b rew
+b ott
+b urg
+b ada
+b da
+c m
+c ip
+c ss
+d ex
+d ental
+d ah
+e al
+f ar
+f it
+f ur
+f ull
+f ibr
+f eedback
+f etamine
+f unctional
+g m
+g u
+g ar
+g ation
+g un
+g ated
+g ulation
+h g
+h il
+h ir
+h ouse
+i ess
+i ors
+j a
+j un
+j ah
+k r
+k in
+k ise
+k etone
+k umar
+k tsson
+k elle
+l on
+l if
+l ity
+l of
+l odent
+l oxacin
+m ineral
+m itted
+n um
+n ary
+n ase
+n ace
+o e
+o ac
+o lec
+o vation
+o active
+o lytic
+o epithelial
+p us
+p el
+p ad
+p ore
+p athetic
+r ib
+r ight
+r ont
+s is
+s ing
+s cribed
+t om
+t ail
+v in
+v ents
+v ital
+w ar
+w ig
+w ered
+y i
+y ama
+z m
+z p
+z ing
+z el
+z ade
+Ġt y
+Ġt us
+Ġt am
+Ġt and
+Ġt ures
+Ġt iter
+Ġt estim
+Ġt ps
+Ġt bs
+Ġt roph
+Ġt read
+Ġt de
+Ġt iring
+Ġt zp
+in an
+in ent
+in ting
+in ct
+in ates
+in ization
+in formation
+Ġa y
+Ġa th
+Ġa us
+Ġa tr
+Ġa vid
+Ġa cellular
+re en
+re ds
+re ktsson
+Ġth i
+on i
+on in
+on od
+on ials
+Ġs ab
+Ġs age
+Ġs ight
+Ġs yp
+Ġs ak
+ti tion
+ti tive
+ti ans
+Ġo ad
+Ġo est
+Ġo int
+Ġo ught
+Ġo lymp
+Ġo phthal
+Ġo mega
+en i
+en n
+en able
+en oid
+en osis
+al al
+al tered
+er r
+er us
+er ont
+Ġc ac
+Ġc olog
+Ġc ared
+ed e
+ed es
+ed ent
+ed ral
+ed dah
+Ġp ore
+Ġp em
+Ġp cc
+Ġp ages
+Ġp co
+Ġp ink
+Ġp cs
+Ġp edic
+Ġp bst
+Ġp lymp
+Ġw s
+Ġw ore
+Ġw ist
+Ġw rap
+Ġw art
+Ġw ished
+Ġw atch
+Ġw inb
+Ġin ac
+Ġin ad
+Ġin val
+Ġin so
+Ġin valu
+Ġin vention
+Ġin ward
+Ġin ert
+Ġin activity
+Ġin lays
+Ġin ferential
+es e
+es ophageal
+Ġan amn
+Ġf ight
+Ġf ag
+Ġf dp
+Ġd q
+Ġd op
+Ġd ust
+Ġd ying
+Ġd iph
+Ġd yes
+Ġd ermal
+Ġm v
+Ġm ond
+Ġm atic
+Ġm ics
+Ġm ening
+Ġm ule
+Ġm els
+Ġm hc
+at ne
+or ient
+th el
+th ree
+an ic
+an im
+an cerous
+an chi
+Ġand es
+Ġand rogen
+Ġb ent
+Ġb ip
+Ġb act
+Ġb ell
+Ġb low
+Ġb isc
+Ġb ah
+Ġb acill
+Ġb oli
+Ġb amp
+Ġb attle
+Ġb ullous
+Ġb cip
+is ser
+is ites
+as ible
+ent uated
+ic c
+ic ul
+ic king
+ic tor
+ic ochemical
+ing ive
+ing ke
+ar n
+ar aldehyde
+Ġre ade
+Ġre ward
+Ġre ps
+Ġre app
+Ġre wards
+Ġre kn
+Ġre bound
+Ġre hydration
+Ġre orient
+Ġto cant
+Ġh its
+Ġh of
+Ġh ung
+Ġh ci
+Ġh urt
+Ġh inder
+le ading
+Ġe b
+Ġe ub
+Ġe uk
+Ġe ager
+it z
+it ory
+it ability
+it our
+us es
+Ġst ew
+Ġst ake
+Ġst aged
+Ġst ories
+Ġst enosis
+ere ll
+ere bral
+ul u
+ul sion
+ul ates
+ul onod
+ac cha
+ec d
+ec k
+ec y
+ec are
+ec tive
+ec ological
+ec onomics
+Ġl id
+Ġl und
+Ġl ose
+Ġl ag
+Ġl ane
+Ġl ux
+Ġl ights
+Ġl atin
+Ġl ci
+Ġl umina
+om ies
+om olar
+om onic
+om eration
+Ġn x
+Ġn ti
+Ġn oc
+Ġn ish
+Ġn yl
+Ġn ice
+Ġn ened
+Ġn othing
+Ġn anda
+im er
+im etic
+Ġg os
+Ġg ad
+Ġg ip
+Ġg est
+Ġg one
+Ġg ases
+Ġg cc
+Ġg ust
+Ġg ung
+Ġg ames
+Ġg arb
+Ġg ini
+Ġg sea
+Ġg eront
+Ġg ingive
+ly cemia
+ur u
+ur ich
+ur man
+ur nal
+ig ent
+ig oid
+et o
+et able
+et ers
+os i
+os oph
+os urgery
+os accharides
+ce in
+ce ment
+if acial
+Ġfor ums
+ol er
+ol ateral
+ol itical
+Ġas a
+Ġas ide
+Ġas cribed
+il le
+il im
+il ot
+il and
+il ia
+Ġcon ges
+Ġcon ferences
+Ġcon ometrically
+od en
+od ec
+od ak
+od entistry
+id ene
+id yl
+id ays
+id rosis
+Ġon s
+ati vity
+ati lity
+Ġor f
+Ġor n
+Ġor bit
+un i
+am ped
+am fetamine
+Ġv erm
+Ġv acc
+Ġv ials
+Ġv bmt
+Ġv enham
+Ġv icious
+Ġv inyl
+Ġv oting
+el or
+el is
+el ly
+ter one
+Ġal oe
+Ġper iv
+Ġper lodent
+Ġr ip
+Ġr go
+Ġr fe
+Ġr nas
+Ġr nase
+Ġwh i
+Ġex ons
+Ġex ak
+Ġpro ges
+Ġpro ving
+Ġpro position
+Ġpro drom
+Ġpro poses
+Ġpro gnathic
+Ġres tr
+Ġres ting
+Ġres ized
+Ġres izing
+Ġres erve
+Ġres embled
+Ġbe ating
+tr on
+tr an
+tr itis
+ot ted
+ot gun
+Ġim itate
+Ġis ced
+Ġis oprop
+ad ione
+ut oy
+ut down
+ver t
+ver sion
+Ġus d
+Ġus eless
+oc in
+oc ys
+oc cus
+oc ortic
+qu ick
+qu ilibrium
+qu oise
+iz uoka
+Ġch im
+Ġch ap
+Ġde ft
+Ġde press
+Ġde als
+Ġde oxy
+ain t
+um a
+pl er
+pl ate
+pl int
+pl ained
+pl asty
+Ġme i
+Ġby pass
+Ġby produc
+Ġat op
+Ġac r
+Ġac ted
+Ġac ta
+Ġac oustic
+ys cale
+ys eal
+Ġcomp utation
+og reen
+Ġse q
+Ġse leg
+Ġsh in
+Ġsh aker
+Ġsh utdown
+Ġsh izuoka
+ap ers
+ap ascal
+oth ermal
+are r
+feren t
+Ġhe x
+Ġhe ar
+Ġhe mi
+Ġhe pati
+Ġhe aring
+Ġhe brew
+Ġass ure
+Ġass emb
+Ġcl oth
+Ġcl ues
+Ġcl ots
+Ġcl icking
+rom eter
+and oned
+Ġare ep
+Ġtw ins
+Ġtw itter
+Ġma z
+Ġma iled
+op ause
+op io
+op enia
+op olitical
+odon t
+we igh
+em ics
+em entia
+Ġsc ent
+Ġsc ass
+Ġtwo fold
+Ġap ert
+Ġco at
+Ġco hes
+Ġind ist
+Ġle ather
+Ġle thal
+Ġle ica
+Ġsur vi
+orm ous
+Ġsize able
+ub ba
+Ġnot ation
+ary otes
+est ine
+est abl
+se e
+Ġcan adi
+Ġpar aker
+Ġpos ed
+Ġpos es
+Ġpos ing
+st rom
+st ep
+ee zing
+Ġinf ested
+per cent
+Ġha us
+ari an
+Ġpl s
+Ġpl asty
+Ġall o
+ong k
+Ġperiodon tic
+ase b
+ill a
+ill ion
+Ġro is
+Ġro ad
+Ġro tor
+Ġtr acts
+Ġmod ulated
+Ġmod ulates
+ach ie
+cl ines
+cl onal
+cl osed
+Ġob e
+Ġacc red
+Ġacc entuated
+ges ic
+Ġno ur
+Ġno hes
+Ġno va
+Ġno bel
+Ġsam i
+Ġrec olon
+Ġrel u
+Ġne isser
+Ġcar ds
+Ġab c
+Ġab l
+Ġab us
+Ġab andoned
+Ġclin dam
+ight ened
+Ġsub com
+Ġinter position
+Ġinter fered
+Ġinter acting
+Ġinter stage
+Ġthere of
+Ġthere for
+Ġdat es
+Ġdat ing
+Ġqu asi
+Ġun il
+Ġun ans
+Ġun pro
+Ġun fe
+Ġun load
+Ġun loaded
+Ġun no
+Ġun filled
+Ġun weighted
+Ġun altered
+Ġint oler
+ay ing
+Ġy ap
+Ġy osh
+Ġam az
+Ġam enable
+ens itis
+ard i
+ard ation
+ard ized
+ven tional
+ven ience
+Ġk m
+Ġk et
+Ġk el
+Ġk ir
+Ġk mo
+Ġk not
+Ġk odak
+Ġval ve
+olog ized
+Ġwe in
+ans en
+atis m
+pro lif
+Ġpresent ly
+ost at
+Ġen qu
+Ġen ormous
+Ġhad s
+Ġfol ic
+rol ateral
+rol ins
+rol ina
+Ġgen io
+Ġgen itour
+Ġpartic ulate
+Ġage usia
+Ġassess able
+Ġtim er
+Ġtim ings
+Ġtim etable
+Ġperform s
+ph ot
+Ġout puts
+Ġout weigh
+Ġsuc c
+gn etic
+Ġspec ulation
+Ġspec ifying
+Ġcor ds
+Ġmeth ohex
+Ġdes k
+Ġdes cent
+Ġdes kt
+Ġdes ensitis
+Ġso y
+Ġar k
+Ġar gue
+amin ated
+amin ase
+amin ogly
+ile ps
+Ġinv ade
+Ġinv iting
+Ġinv ulner
+Ġinv aded
+Ġmed cal
+Ġmed ially
+Ġmax d
+Ġmax ilim
+Ġph aryng
+Ġover lying
+Ġover filled
+Ġover hang
+Ġbi ogen
+Ġbi odent
+Ġbi oseal
+Ġbi ologized
+Ġcell plus
+Ġcol onic
+Ġcol linearity
+lu tition
+Ġtime points
+Ġdec ent
+Ġdec imal
+Ġdec oron
+Ġcr anium
+Ġcr imes
+Ġcr ypt
+Ġag b
+adi ol
+Ġstr aw
+Ġstr ingent
+Ġdise quilibrium
+Ġbr idged
+Ġund ec
+Ġund etermined
+Ġund etected
+Ġdia gonal
+ag as
+Ġman ne
+Ġman ik
+Ġman agers
+Ġnon static
+ric ular
+Ġdisc ard
+Ġdisc ord
+Ġgener ator
+Ġdef ence
+Ġdef ines
+Ġdef ault
+Ġsp ar
+Ġsp illover
+Ġj unctional
+Ġj uris
+Ġj iang
+Ġj inan
+Ġj alal
+Ġj eddah
+Ġfur nace
+Ġcare t
+Ġmicro invasive
+Ġmicro partic
+Ġmicro array
+Ġmicro porosity
+Ġcomm and
+oun cing
+Ġhy gro
+na i
+Ġmand all
+Ġprob abil
+Ġbec lin
+Ġi oc
+Ġmal position
+que faction
+Ġform ations
+Ġform ulating
+Ġop ens
+Ġop tional
+Ġop pose
+Ġop acity
+Ġop aquer
+Ġdi en
+Ġdi etic
+Ġdi ets
+Ġdi urnal
+uth an
+Ġcur ry
+Ġcur tail
+Ġgr ain
+Ġgr ace
+Ġgr iess
+fic ially
+Ġli quefaction
+Ġsal ary
+Ġunder to
+Ġcharacter isation
+Ġimp uted
+Ġimp eded
+tor ies
+Ġpost age
+Ġconf ine
+Ġconf using
+Ġconf ront
+Ġprim ing
+Ġser b
+Ġser ver
+Ġser ving
+Ġrelated ness
+Ġstat utory
+Ġvis ibly
+Ġmon o
+Ġmon obl
+Ġmon ochrom
+Ġmon etary
+Ġbl t
+Ġbl ades
+Ġbl adder
+Ġbl anks
+Ġem a
+Ġem ilia
+Ġintr on
+Ġ0 75
+vers ibly
+Ġz h
+Ġz ip
+Ġz ulu
+Ġz urich
+Ġsaliv ation
+Ġer ics
+Ġmain stream
+Ġinvestig ative
+Ġquestion ing
+Ġless ening
+Ġsoft en
+Ġdr af
+Ġdr ives
+Ġdr ift
+Ġend uring
+Ġend odontists
+Ġca is
+Ġca rolina
+Ġcharacteristic ally
+Ġinfl ation
+Ġloc king
+arg eted
+Ġel usive
+ie th
+Ġsome one
+Ġfr anchi
+Ġcent red
+Ġincis ed
+ption ist
+Ġterm inated
+Ġcle ared
+Ġcle aved
+Ġcle arer
+Ġinflu enza
+ob ullous
+Ġid a
+Ġexpl o
+Ġexpl ants
+Ġgeneral ised
+Ġgeneral isability
+Ġsm r
+ateg ories
+Ġins ure
+Ġins ult
+Ġins ults
+Ġdesign ation
+Ġimm ense
+Ġsch iff
+Ġdo or
+Ġscal pel
+Ġii ib
+Ġprocess or
+Ġcy ano
+Ġrece ives
+Ġrece ptive
+Ġrece ptionist
+Ġneg ate
+Ġneg oti
+Ġsit af
+Ġprot otypes
+Ġrequ isite
+Ġmouth ful
+Ġmouth rin
+inal is
+Ġpot enti
+Ġpot osi
+Ġpath ogn
+Ġoper ate
+Ġoper ates
+Ġspecific s
+Ġanti hy
+Ġanti oxid
+Ġunivers iti
+Ġos tia
+Ġpe king
+Ġstruct urally
+Ġstrength ens
+of ol
+yl ene
+Ġfem oral
+Ġidentif iers
+io id
+Ġlo ops
+Ġlo hs
+Ġgu ess
+Ġes thetical
+Ġes kise
+Ġfl ash
+over sion
+Ġoste otomized
+Ġiniti ates
+Ġiniti ator
+Ġiniti atives
+Ġfail s
+Ġcaus ation
+Ġprof use
+ox amer
+Ġintra osseous
+Ġintra famil
+Ġpul s
+Ġsl b
+Ġsl p
+Ġsl ur
+Ġsl ab
+Ġsl ider
+Ġsl abs
+Ġang ulated
+Ġhyp ot
+Ġhyp erelastic
+Ġlead ers
+cess ible
+Ġcomb at
+Ġver a
+Ġmat tress
+ri tic
+ri ans
+Ġanaly te
+Ġphys icochemical
+Ġep och
+Ġep ileps
+av ail
+Ġconsist encies
+Ġhard ening
+Ġsoci ological
+Ġproduc tive
+Ġproduc tivity
+Ġred irec
+Ġrepresent atives
+Ġcontr ac
+Ġcontr act
+Ġcontr actions
+Ġwater line
+Ġpart ners
+Ġliter atures
+Ġfluor oh
+sc al
+sc ore
+sc atter
+Ġcompl ained
+Ġcompl iers
+Ġcompl icates
+Ġanalyz es
+Ġprov isions
+Ġalign ments
+Ġcross l
+Ġcross ing
+Ġacid ification
+Ġacid uric
+Ġref us
+Ġhum erus
+Ġmid facial
+Ġmid lines
+Ġpers ists
+Ġwid ening
+Ġwid ened
+Ġpoly g
+Ġpoly cr
+Ġpoly acryl
+Ġpoly clonal
+Ġsu kumar
+Ġsym biotic
+Ġsym pathetic
+Ġeven ing
+Ġpa ve
+Ġext ubation
+Ġext ensor
+pe tiform
+Ġlab i
+Ġlab our
+Ġlab eller
+Ġpap ulonod
+Ġmicrob e
+omm un
+Ġsequ ela
+Ġwhe el
+Ġaut ografts
+Ġhel per
+Ġhel ix
+Ġsinus oidal
+Ġret reat
+Ġret ested
+Ġret ardation
+Ġhab ib
+Ġlight ly
+Ġlight weight
+Ġlight fast
+Ġfract ographic
+Ġdentin o
+Ġdentin ogenesis
+vir atne
+Ġimmun ocyt
+Ġperman ently
+Ġperman ova
+Ġrecomm ending
+Ġmen u
+Ġmen adione
+Ġmen opause
+Ġeff lux
+Ġapproach ed
+Ġapproach ing
+Ġsw ell
+Ġsyn th
+Ġsyn onymous
+Ġhuman ization
+Ġdeg lutition
+ind ividual
+Ġprom ises
+omy cin
+Ġintern ally
+Ġcontin ents
+Ġcontin ual
+Ġnormal ize
+Ġnormal isation
+Ġta iz
+Ġfib res
+Ġdifferenti ally
+ih am
+Ġcoh en
+Ġfear ful
+Ġprote ases
+Ġeffic acies
+Ġprec urs
+Ġprec ancerous
+Ġrot ates
+Ġhal ve
+Ġhal ting
+Ġhal ide
+Ġhal imeter
+Ġsatis fying
+Ġhyper plastic
+Ġwork load
+Ġcp q
+Ġ7 4
+Ġ7 00
+Ġelec tive
+Ġconstr ains
+Ġcari ogenesis
+Ġcontact able
+Ġbiom olec
+Ġbiom imetic
+roph izing
+Ġunders ampling
+Ġunders erved
+Ġspl icing
+Ġdel t
+Ġdel amination
+Ġdel aire
+Ġinduc tive
+Ġmorph ogenesis
+az zi
+Ġpsych ology
+Ġpress urized
+ros ine
+Ġrough er
+Ġpur ify
+Ġpur su
+Ġnine ties
+Ġreflec tivity
+Ġsumm ation
+Ġfil aments
+Ġmaxilla e
+Ġutil ising
+ov sky
+Ġx ception
+Ġlip opolys
+Ġconnec t
+Ġchem omechanical
+Ġapproxim ations
+Ġconsum er
+Ġback scatter
+Ġproportion ally
+bl adder
+Ġpol oxamer
+Ġview point
+Ġepithel ioid
+Ġshort age
+Ġpower point
+Ġunderstand able
+Ġwa fer
+Ġseem ingly
+Ġattrib ute
+Ġphot on
+Ġphot ographic
+Ġphot opolymer
+Ġphot othermal
+Ġdigital ization
+Ġms ls
+Ġbre akage
+Ġtop ically
+Ġtop fa
+Ġtop ographical
+Ġrecur red
+Ġrecur rences
+Ġarti fact
+otyp ed
+hold ers
+Ġsn mp
+Ġcd b
+Ġcoll aps
+Ġcoll apsed
+Ġcoll oidal
+com p
+Ġplate aus
+Ġpen g
+Ġpen ins
+Ġbar zeh
+Ġbar thel
+Ġconsent ing
+Ġprotein uria
+Ġill icit
+Ġevery one
+Ġprep ubertal
+Ġincub ate
+Ġstrateg ic
+orb ic
+Ġten ding
+Ġtransl ating
+Ġtransl atory
+Ġtransl ator
+Ġdepartment al
+Ġpneum atization
+Ġreal ize
+Ġorgan ised
+Ġorgan izations
+pre vious
+drom ic
+Ġapex ification
+Ġread mitted
+Ġmild ly
+Ġheter otrophic
+Ġbur n
+Ġbur ning
+Ġbur dens
+Ġsyndrom al
+Ġful fil
+Ġdam ping
+Ġrepl icated
+Ġrepl aces
+Ġge opolitical
+Ġopen bite
+Ġmy od
+Ġmy ocard
+Ġmy oepithelial
+Ġerup tions
+Ġcut ter
+plas ma
+Ġmr nas
+Ġirradi ate
+Ġirradi ating
+Ġinvasive ly
+air s
+Ġexist ent
+Ġsem iland
+Ġanatom ies
+Ġanatom age
+Ġinstit utes
+Ġhem ifacial
+Ġregen erated
+Ġpand emics
+roc yte
+Ġpapill itis
+Ġdebr ided
+Ġmedic aid
+Ġinterpre table
+Ġq i
+Ġq ias
+Ġve ter
+Ġlate x
+Ġquanti fiable
+Ġmar sh
+Ġhom emakers
+Ġhom ecare
+Ġmach ines
+Ġmach ining
+Ġcand ies
+Ġadequ acy
+Ġher bst
+Ġher petiform
+Ġtur quoise
+Ġadap ters
+Ġpor tr
+Ġdown wards
+Ġassign ments
+Ġ19 6
+cp ost
+Ġder ks
+Ġder angement
+Ġenrol ling
+Ġeng ines
+Ġent rap
+Ġent rapped
+Ġdl m
+Ġgerm inal
+Ġvirt ue
+Ġrc u
+Ġmis ch
+Ġmis leading
+Ġlater ality
+Ġnucle otid
+Ġsa ud
+Ġrecogn ised
+Ġrecogn izable
+Ġglass es
+oh y
+Ġretr ained
+Ġcompreh ens
+Ġdecl are
+Ġiv s
+Ġaff airs
+Ġcarb amide
+Ġmedi ates
+Ġeuro cat
+Ġcam pan
+for ce
+Ġorigin ating
+Ġpf oa
+Ġpf ua
+Ġwr ite
+Ġdemineral ize
+Ġprognos es
+Ġfore arm
+Ġfore ground
+Ġfore going
+Ġepid ermal
+gg a
+gg t
+Ġpp m
+Ġnumer ator
+Ġmonom eric
+Ġalloc ating
+Ġkey word
+Ġaesthetic ally
+Ġeti opath
+Ġeti ologic
+Ġpromo ter
+Ġ12 0
+Ġ12 4
+Ġviol ations
+Ġcolon ize
+Ġcolon izers
+Ġperson ally
+Ġindepend ency
+Ġarr iving
+Ġmetastasis ing
+Ġmc as
+olith s
+Ġga ug
+Ġshe kelle
+Ġshe iham
+Ġprin ters
+Ġorthodon tia
+ymph ony
+Ġsept ate
+Ġlact ams
+put able
+Ġlymph ad
+Ġprop elled
+Ġprop ofol
+Ġqual ify
+Ġqual ifications
+Ġameric ans
+Ġapproval s
+Ġtransm it
+Ġip ac
+Ġsd f
+Ġinj ured
+Ġprojec ting
+ococ cal
+Ġpool s
+Ġscrew ed
+Ġopening s
+Ġsubstit uted
+Ġbeg ging
+Ġrepro duce
+Ġrecall ing
+Ġblind ly
+Ġinequ ity
+Ġnutr ient
+Ġinferior ity
+Ġcall ing
+Ġexperiment ation
+Ġtherapeutic s
+Ġcc d
+Ġcv s
+Ġhere after
+Ġdiffer ing
+Ġcarcin ogenesis
+Ġeros ions
+Ġgold en
+Ġgold enh
+Ġcollagen ases
+Ġalb rektsson
+Ġcognitive ly
+Ġtext ual
+Ġtext uring
+Ġtom es
+Ġtom ograms
+Ġabras ives
+Ġfabric ating
+Ġremineral ize
+Ġremineral ise
+Ġcircum scribed
+Ġtherm omechanical
+Ġig m
+Ġretain s
+Ġdeli vers
+Ġdegrad ed
+Ġvas oactive
+Ġthin king
+Ġmap ped
+Ġdrop ping
+Ġincom pet
+Ġsut uring
+Ġana esthetic
+Ġana emia
+Ġstatic ally
+dl ers
+Ġposts urgical
+Ġjud ging
+Ġcoordin ating
+Ġnh s
+Ġwire frame
+Ġexclud es
+Ġdisp ase
+Ġteam work
+Ġgraph ical
+Ġgraph pad
+Ġgre yscale
+Ġamino transferase
+Ġsilic o
+Ġls d
+Ġboard s
+inf ection
+Ġpolic ym
+rup tion
+Ġuc i
+Ġuc sc
+Ġsound ing
+Ġcav itations
+lect omy
+Ġcarbon yl
+Ġassist ants
+Ġmacro vascular
+Ġsy rup
+Ġsy rians
+Ġirrig ate
+Ġexcessive ly
+Ġpredom inated
+Ġpredom inate
+Ġretur ning
+Ġretur ns
+Ġmad rid
+Ġvs mp
+Ġadhere s
+Ġimpair ing
+Ġbreat he
+Ġpreser ves
+Ġhistopathological ly
+Ġkeratin ization
+Ġom itted
+Ġom itting
+Ġom bada
+Ġrein ser
+Ġvascular ization
+Ġnarrow ed
+Ġlockdown s
+Ġconc urs
+Ġcurv atures
+Ġdichotom ously
+Ġperpendicular ly
+Ġimmunohist ological
+Ġpu ros
+Ġmel d
+Ġmel t
+Ġbcl p
+Ġupr ighter
+Ġextra orally
+Ġsmooth ened
+Ġinstitutional ized
+Ġben j
+Ġ14 4
+Ġborder lines
+Ġaccompan y
+ae i
+Ġcompound ed
+press ants
+Ġauthor ized
+Ġaustr ia
+Ġwar ts
+Ġwar time
+Ġwhit ened
+Ġcham fer
+Ġdetermin ations
+Ġpdl cs
+Ġwave one
+Ġwave forms
+Ġion ic
+Ġovere ruption
+Ġcath eter
+Ġfast est
+Ġfast ai
+Ġstabil ised
+Ġstabil izing
+Ġdisag rees
+Ġupreg ulate
+Ġmoti ves
+au er
+Ġpolymorph onuclear
+Ġtetr agonal
+Ġtetr azolium
+Ġhar assment
+Ġhol idays
+Ġgas tritis
+Ġperm ut
+Ġpercenti les
+Ġquad r
+Ġmyop ic
+ah l
+ah edral
+Ġcit ations
+Ġground s
+Ġow ed
+Ġhr v
+Ġconstit uting
+Ġconstit utive
+Ġobstr uctions
+Ġouts et
+bor n
+bor hood
+Ġsen escence
+Ġstop ping
+Ġsubstr uct
+Ġeryth romycin
+Ġter at
+Ġstom ach
+Ġvar imax
+Ġ18 1
+Ġoccup ations
+Ġprotec ting
+Ġing a
+Ġscr ut
+Ġscr ip
+Ġscr atching
+Ġcontrovers ies
+Ġround s
+Ġmorb id
+Ġpronounced ly
+Ġdim eric
+Ġleg ion
+Ġmethan ol
+eptid es
+Ġirre versibly
+Ġsuperv ise
+onas al
+app iness
+Ġuniform ity
+Ġcortic otomy
+Ġfulfill ing
+tg tc
+Ġkh at
+Ġdeterior ates
+Ġsimpl est
+Ġsimpl ify
+Ġspr ayed
+Ġgluc ocortic
+Ġequival ents
+Ġexpress ers
+can y
+Ġauc s
+Ġanth ro
+Ġanter o
+Ġunderestim ating
+Ġdiscrimin atory
+Ġtox in
+cell ulose
+Ġmatch es
+Ġbitewing s
+Ġmit utoy
+Ġdisinf ecting
+Ġ15 7
+Ġpenetr ance
+Ġliquid s
+Ġdc nn
+rose al
+Ġever ted
+Ġunp olymer
+Ġencod ed
+Ġmf i
+Ġmotor cy
+Ġtough ening
+Ġdisil icates
+Ġkind ly
+Ġformer ly
+Ġzyg oma
+Ġimmunos orbent
+Ġmelan omas
+Ġure mic
+Ġib ge
+Ġhu ang
+acryl ates
+Ġgradi ents
+Ġmillim etric
+Ġtetracy clines
+Ġplatform s
+74 2
+bi ased
+Ġdos ages
+Ġconce ption
+Ġconce ived
+Ġconce ivable
+Ġperfor ated
+Ġexerc ises
+Ġdiscl ose
+Ġyellow ish
+Ġspan ning
+Ġspan ned
+Ġhygien ic
+Ġhemis ections
+Ġembed ding
+Ġud esign
+Ġpig mented
+Ġclock s
+Ġneuro psych
+Ġneuro feedback
+Ġcariogenic ity
+Ġimmunosup pressed
+Ġrom agn
+Ġhund reds
+Ġshar jah
+Ġflav or
+Ġchron odentistry
+Ġbreak s
+Ġtan n
+Ġtan zo
+Ġtan aka
+Ġrb t
+Ġresorb ing
+Ġdistor otation
+Ġaden osine
+Ġregister ing
+Ġspot ted
+Ġfrag ile
+Ġaggreg ates
+95 6
+Ġomd urman
+Ġcel ik
+Ġdeal t
+Ġunre paired
+Ġdecom pens
+Ġmesh ing
+Ġallevi ated
+Ġbm ms
+Ġinvag inatus
+Ġcrack ing
+Ġdistinguish es
+Ġanticip ate
+fr action
+Ġtun is
+Ġfix ing
+Ġmess aging
+Ġla un
+Ġventi lated
+Ġcontamin ations
+Ġcontour s
+Ġhypersens itive
+Ġfus obacteria
+Ġded uc
+Ġtoler ate
+Ġinters ti
+Ġblast n
+Ġblast x
+Ġhemat ologic
+Ġpharmac ists
+Ġts ads
+Ġts ingke
+Ġdimin ishing
+Ġconve y
+Ġconve yed
+Ġka rolins
+Ġdisturb ed
+Ġdisturb ing
+Ġmicrom o
+Ġglyc ol
+Ġinn ovation
+Ġlav age
+Ġdele ting
+iph il
+Ġenvelop ed
+Ġsuppress or
+Ġsynerg ism
+Ġthermo forming
+Ġsenti ments
+Ġvap ors
+Ġneigh borhood
+Ġwax ing
+Ġlubric ants
+Ġsonic fill
+Ġht css
+Ġgross ly
+Ġroll ing
+Ġunco operative
+oste en
+Ġcalip ers
+Ġcylind ers
+Ġcapital s
+Ġdupl ication
+Ġdutch cleft
+Ġsand paper
+Ġpic rust
+Ġpic ogreen
+Ġmart ins
+Ġnb t
+Ġbacteri ostatic
+Ġimmunological ly
+Ġskull s
+Ġrepeat able
+Ġheterozyg ote
+Ġtang ency
+Ġbath room
+Ġlll i
+udd in
+Ġonc ogene
+Ġvent ed
+Ġvent rolateral
+Ġcompens ations
+Ġcompens atory
+Ġsubtr acted
+Ġunex plained
+Ġdiver gent
+Ġpathf inder
+Ġsharp ness
+Ġtu ft
+Ġfer rans
+Ġexec ute
+Ġmeg apascal
+Ġinterrup tion
+Ġupd ates
+Ġencoun ters
+Ġcolumn ar
+Ġgastro esophageal
+Ġsun light
+Ġsial ometry
+Ġcatal ase
+Ġhind ers
+Ġvic inity
+Ġrab bits
+Ġcloud s
+Ġcoop erate
+Ġuncom plicated
+Ġfibrin ogen
+Ġunsatis fied
+14 6
+Ġaap d
+Ġculti vated
+Ġdd wr
+Ġbed s
+Ġlys ol
+Ġlys ate
+Ġincon venience
+Ġdispar ate
+Ġarres ts
+Ġarres ting
+Ġcerti fic
+Ġhyperl ink
+Ġnecessit ating
+Ġcdc m
+Ġintermedi ary
+Ġaeti ologies
+Ġindustrial ised
+Ġrectang les
+Ġvacu olated
+Ġtb st
+Ġbac rep
+Ġaccid ental
+Ġinterfere s
+Ġsoon er
+Ġarte fact
+Ġiod ide
+Ġexcav ator
+Ġmotiv ating
+Ġscarce ly
+Ġpiez osurgery
+Ġpip ed
+Ġpip etting
+Ġwal d
+Ġlr b
+Ġhaem ost
+Ġdownreg ulation
+Ġempir ically
+Ġpermission s
+Ġsandbl asted
+Ġaver aging
+Ġdum mar
+imb ili
+Ġdev ised
+Ġinfra occlusion
+Ġku opio
+Ġbran ches
+Ġmang osteen
+Ġmicrostruct ural
+Ġemer ges
+Ġdoub ts
+Ġprotozo a
+Ġguard ian
+Ġfluctu ates
+Ġpurch ase
+Ġhydrophobic ity
+Ġdimer ization
+Ġmulticent re
+Ġantagon ists
+Ġbenchmark s
+Ġtell s
+Ġthal idom
+Ġpir d
+Ġascertain ment
+Ġalve oli
+Ġperp et
+Ġcomment ers
+Ġindones ian
+Ġidi omatic
+Ġarchae al
+Ġafford able
+Ġsubmuc osa
+Ġcatast rophizing
+Ġstic k
+Ġsore ness
+Ġpes a
+Ġreass urance
+osc opy
+Ġresc ued
+Ġprerequ isites
+Ġinfrequ ently
+Ġnepal ese
+Ġquin tile
+Ġsecure ly
+Ġcalvar ia
+Ġdiscre tion
+Ġnegl igence
+Ġglycer in
+Ġglycer ophosphate
+Ġjudg ments
+Ġbiosurfact ants
+Ġbifur c
+Ġaggrav ation
+Ġaz ithromycin
+Ġson ography
+Ġanesthetic s
+Ġmio h
+Ġba uru
+Ġtouch ed
+Ġeye lets
+Ġlam bda
+Ġves icul
+Ġrug a
+Ġhapl otypes
+Ġweigh ing
+Ġinvest ment
+Ġbiot in
+Ġmanager ials
+Ġjord anian
+Ġminipl ate
+Ġtransduc tion
+Ġethyl ene
+Ġpolys iloxane
+Ġeston ians
+Ġundersc ore
+Ġsteril izer
+Ġprevail ing
+Ġcollaborative ly
+Ġost ectomy
+Ġcred ible
+Ġmist akes
+Ġek g
+Ġchen nai
+Ġchat bot
+Ġatyp ia
+Ġpreclud es
+Ġcovers l
+Ġparas it
+Ġinterp olated
+Ġimped ance
+Ġerad ication
+Ġerad icated
+Ġnecro tising
+Ġaddic tive
+Ġcontribut or
+Ġcontribut ory
+Ġhypert rophy
+Ġraj a
+Ġtradition s
+Ġnarr atives
+Ġosteoconduc tion
+Ġorthopantom ogram
+Ġorthopantom ography
+Ġbicusp ids
+Ġrefrig eration
+Ġdiminish es
+Ġoblig ations
+Ġvapor izer
+Ġaerosol s
+Ġanton ovsky
+Ġmpi i
+there fore
+Ġreper cussion
+Ġhered ity
+Ġgarg le
+Ġdex terity
+Ġtriang le
+Ġamoun ting
+Ġkar achi
+Ġweaken ed
+luor ide
+Ġdecalc ification
+Ġbrist le
+Ġbrist ol
+Ġspons ored
+Ġjo ining
+Ġlimb ic
+Ġconflu ent
+Ġmultif ocal
+Ġglut amine
+Ġglut araldehyde
+Ġprofess or
+Ġcontraind ication
+Ġcontraind ications
+Ġpatch y
+Ġmisd iagnosed
+Ġmobil ized
+Ġmobil izing
+Ġdisclos ures
+Ġunrealistic ally
+onucle ic
+Ġinqu iry
+Ġfc ns
+Ġduc ts
+Ġduc tal
+Ġbub ble
+Ġlob ulated
+Ġexcep tional
+Ġscrap ed
+Ġscaff olds
+Ġunav oid
+Ġphr ases
+Ġdiscover ies
+Ġpostp oning
+Ġpostp ubertal
+Ġolig osaccharides
+Ġappreci ation
+Ġglomer ul
+Ġpathophys i
+Ġautops ies
+Ġhomogen ized
+Ġelectromy ograph
+Ġterrit ory
+Ġterrit ories
+Ġdisinfect ants
+Ġcontradic ting
+Ġectod erm
+Ġectod ermal
+Ġsynchron ization
+Ġsubcutaneous ly
+Ġinactiv ating
+Ġasteris ks
+Ġaccommod ation
+Ġaccommod ate
+rans ky
+Ġut most
+Ġspor ts
+Ġmer its
+Ġbill ion
+Ġnond ysplasia
+Ġnond ementia
+Ġconca ve
+Ġvw cpost
+Ġpropos als
+Ġsev oflurane
+Ġsev ille
+Ġseiz ure
+Ġadver tising
+Ġhep ato
+Ġjia o
+Ġminip rep
+Ġgrand io
+Ġendotox in
+Ġendotox ins
+Ġdelim it
+Ġdelim ited
+Ġaugment ations
+Ġmisinterpre tation
+Ġbisphosph onate
+Ġharmon ious
+Ġtaxon omy
+Ġpiezo electric
+Ġretrocl ined
+Ġlingu oversion
+Ġsphen oid
+Ġaffirmative ly
+Ġlncr na
+Ġamphoter ic
+Ġmycobi omes
+Ġsap i
+Ġstit ches
+Ġciv il
+Ġplex iform
+Ġdeline ate
+Ġbund le
+Ġvag ue
+Ġvag inalis
+Ġalert ness
+Ġexagg erated
+Ġexagg erate
+ogly c
+Ġlept in
+Ġlept otr
+Ġtryp tic
+Ġinterl ocking
+Ġinterrelations hips
+Ġunres tor
+Ġenfor ced
+gnath ia
+gnath ism
+Ġunderm ining
+Ġspind le
+Ġspind led
+Ġmicroc irc
+Ġblur red
+Ġcleans ing
+Ġcapac ities
+Ġrefine ment
+Ġimmuno assay
+Ġprioritiz e
+Ġevap or
+Ġphosphol ipid
+Ġphosphol ipids
+Ġmcd onald
+Ġhemodynamic s
+Ġobtur ating
+Ġdestabil izing
+Ġexecution ers
+Ġextrapol ation
+Ġextrapol ate
+Ġpolyvinyl idene
+Ġimmunodefici ent
+Ġimmunodefici ency
+54 8
+Ġtib ia
+Ġthr ive
+Ġsax ony
+Ġanastom osed
+Ġmuh imbili
+itr ile
+Ġlun ch
+Ġlind i
+imon ious
+Ġasc orbic
+Ġconvers ations
+Ġvd o
+Ġdisl od
+Ġtwenti eth
+opal atal
+Ġlef se
+Ġpars imonious
+Ġsubpop ulation
+Ġunh appiness
+Ġunn amed
+Ġunt argeted
+Ġfinn mark
+Ġphil osoph
+Ġstri king
+Ġbronch ial
+Ġdiap roseal
+Ġconfid ently
+Ġpractis es
+Ġhypoh idrotic
+Ġpercep tron
+Ġsensitis ers
+Ġabsor bs
+Ġtoolk its
+Ġhyperparamet ers
+Ġarticul are
+Ġsnack ing
+Ġillum inant
+Ġorganis ations
+Ġhydrolys ates
+Ġqia quick
+Ġcrani omaxillofacial
+Ġmicr ons
+Ġcounterst ain
+Ġincompati bility
+Ġharb oring
+Ġsupervis or
+Ġdiscolor ations
+Ġperpetr ator
+Ġcritic ised
+Ġtsald ant
+Ġcornerst ones
+Ġintuitive ly
+Ġub iquit
+Ġaur icular
+Ġsid ew
+Ġsene viratne
+Ġssc ecs
+Ġole fin
+Ġpin pointed
+Ġpma q
+Ġmcr a
+Ġbank ur
+rod ysplasia
+Ġreferen ced
+Ġreex amin
+Ġreaff irmed
+Ġtod dlers
+Ġlis dex
+Ġlud wig
+Ġlati tude
+Ġgy na
+Ġgall bladder
+Ġgale azzi
+Ġcong ress
+Ġperin atal
+Ġrush ton
+Ġisl amic
+Ġincap able
+Ġcompe titive
+Ġasser tion
+Ġcour ier
+Ġparamed ian
+pert ensive
+Ġprese lection
+Ġcarunc le
+Ġabst aining
+Ġquiet ly
+Ġphag ocytosis
+Ġoverrepresent ation
+Ġortho analyzer
+Ġcommens al
+Ġblister ing
+Ġocclus ally
+Ġestr adiol
+Ġosteoph ytes
+Ġprofici ency
+Ġveron ococcus
+Ġsold iers
+Ġhards hip
+Ġsymb ols
+Ġfibril s
+Ġpreca utions
+Ġhyperg lycemia
+Ġchris tians
+Ġtrajec tories
+Ġwake fulness
+Ġreplen ished
+Ġencaps ulated
+Ġinstitut et
+Ġurg ency
+Ġmiscon ception
+Ġcardi omy
+Ġdebond ed
+Ġvasoconstr ictor
+Ġaggl omeration
+Ġdilacer ated
+Ġconcaten ated
+Ġconvinc ing
+Ġelectroc ardi
+Ġanticoag ulant
+Ġnonsyn dromic
+Ġexhaus tive
+Ġrefract ory
+Ġsuprac restal
+Ġunreli able
+Ġosteoprogen itor
+Ġventil ator
+Ġglycos aminogly
+Ġnanostruct ures
+Ġsubcult ured
+Ġlicens ing
+Ġunwilling ness
+Ġzeal and
+Ġminipig s
+Ġmenstr ual
+Ġbibli ographic
+Ġnurser ies
+Ġexempl ary
+ydroxy apatite
+Ġveloph aryngeal
+Ġsacrific ed
+Ġconglomer ate
+Ġimmob ilization
+Ġcoexist ence
+Ġtubercul osis
+fibr illar
+hil is
+mineral ized
+num ber
+rib onucleic
+zade h
+Ġtus cany
+Ġtand em
+Ġtures ky
+Ġtestim onials
+Ġtroph ozo
+Ġtread ed
+Ġsyp hilis
+Ġoest rogen
+Ġolymp ua
+Ġcolog ne
+Ġpem ph
+Ġpco a
+Ġpedic le
+Ġplymp us
+Ġwist ar
+Ġinac cessible
+Ġinval id
+Ġinso far
+Ġinvalu able
+Ġfag an
+Ġdop pler
+Ġmond ay
+Ġmening itis
+Ġbact eremia
+Ġreapp lying
+Ġtocant ins
+Ġstake holders
+erell a
+Ġnoc ic
+Ġnish imura
+Ġnyl on
+Ġnened ent
+Ġgos lon
+Ġgest ational
+Ġgarb age
+Ġgingive ct
+Ġperiv ascular
+Ġrip a
+Ġexak t
+Ġproges terone
+Ġprodrom al
+Ġdeoxy ribonucleic
+Ġbyproduc ts
+Ġatop obium
+Ġseleg iline
+Ġhepati tis
+Ġassemb ly
+Ġareep ong
+Ġindist inct
+Ġsurvi ve
+Ġcanadi ans
+Ġparaker atosis
+Ġrecolon ization
+Ġneisser ia
+Ġclindam ycin
+Ġsubcom position
+Ġunans wered
+Ġunfe asible
+Ġunload ing
+Ġunno ticed
+Ġgenio plasty
+Ġgenitour inary
+Ġmethohex ital
+Ġdeskt op
+Ġdesensitis ation
+Ġinvulner ability
+Ġmedcal c
+Ġbiogen eric
+Ġbiodent ine
+Ġdecoron ated
+Ġmanne quin
+Ġmanik in
+Ġjuris d
+Ġjalal uddin
+Ġhygro scopic
+Ġprobabil istic
+Ġdietic ian
+Ġunderto ok
+Ġmonobl ock
+Ġerics on
+Ġcyano acrylate
+Ġnegoti ating
+Ġsitaf loxacin
+Ġmouthrin se
+Ġpathogn omonic
+Ġantihy pertensive
+Ġantioxid ant
+Ġeskise hir
+Ġintrafamil ial
+Ġepileps y
+Ġfluoroh ydroxyapatite
+Ġpolyacryl amide
+Ġpapulonod ular
+Ġlightfast ness
+Ġmyocard ial
+Ġsemiland marks
+Ġqias ymphony
+Ġmarsh field
+Ġnucleotid es
+Ġcampan ia
+Ġgoldenh ar
+Ġvsmp ost
+Ġmitutoy o
+Ġromagn a
+Ġcelik oglu
+Ġkarolins ka
+Ġthalidom ide
+Ġvesicul obullous
+Ġleptotr ichia
+Ġmicrocirc ulation
+Ġlisdex amfetamine
+Ġglycosaminogly can
+0 12
+0 85
+1 000
+1 70
+1 74
+1 78
+2 7
+2 76
+3 6
+3 00
+3 18
+3 38
+4 2
+4 20
+5 5
+5 90
+5 96
+6 6
+7 1
+7 2
+7 60
+8 00
+9 8
+9 30
+a a
+a ac
+a act
+b f
+b es
+b ing
+b ar
+b ul
+b ec
+b et
+b ow
+b and
+b ase
+b led
+b ones
+b ilities
+b den
+b ird
+c am
+c ap
+c act
+c ens
+c ome
+c ons
+c umin
+c arb
+d g
+d or
+d ar
+d ig
+d if
+d el
+d iv
+d em
+d erm
+d iss
+d ays
+d isc
+d rew
+d oor
+d dp
+e b
+e j
+e le
+e ared
+e av
+e ets
+e lect
+e ira
+f b
+f i
+f at
+f ig
+f ive
+f ound
+f pe
+f ather
+f ilms
+g b
+g in
+g ic
+g ac
+g ill
+g ating
+g ium
+g etr
+g was
+g ata
+g ional
+h d
+h o
+h t
+h al
+h ing
+h us
+h am
+h ain
+h aus
+h anes
+h ok
+h adow
+i tic
+i ative
+i ke
+i vers
+i ently
+i ometric
+i atric
+i ella
+i inf
+i osity
+j f
+j o
+j an
+j ets
+j unction
+j uan
+k b
+k c
+k m
+k v
+k w
+k an
+k it
+k ul
+k ins
+k ron
+k illed
+l h
+l r
+l en
+l os
+l ab
+l ate
+l ice
+l uded
+l undii
+m t
+m el
+m ised
+m pre
+m ologic
+m ale
+m ara
+m uch
+n y
+n z
+n il
+n ity
+n ew
+n ever
+n ier
+n ocyt
+n ius
+n getr
+o z
+o on
+o il
+o oc
+o ich
+o ven
+o yl
+o ising
+p c
+p y
+p in
+p ow
+p act
+p ss
+p ediatric
+r is
+r as
+r ac
+r ig
+r ations
+r ay
+r itol
+s r
+s an
+s ur
+s um
+s aw
+s ame
+s ki
+s imilar
+s econd
+t ur
+t tr
+t and
+t op
+t ations
+t est
+t ured
+t ubular
+u f
+u v
+u z
+u en
+u ent
+u ing
+u el
+u ances
+u ardo
+u oden
+v ol
+v ess
+v ating
+v oked
+v uls
+w is
+w ere
+w id
+w ich
+w ater
+w atch
+w ah
+w teen
+x ing
+x ual
+y er
+y ush
+y ang
+z in
+z ig
+z ia
+z one
+z inc
+z ah
+z hou
+Ġ :
+Ġ ia
+Ġ ug
+Ġ ics
+Ġ ibr
+Ġt on
+Ġt ig
+Ġt rom
+Ġt ia
+Ġt ug
+Ġt all
+Ġt ech
+Ġt ms
+Ġt ian
+Ġt ired
+Ġt ung
+Ġt ilt
+Ġt astes
+Ġt abled
+Ġt ale
+Ġt ensor
+in en
+in us
+in ce
+in ted
+in able
+in ak
+in ery
+in ogen
+in itis
+in tegr
+in stru
+Ġa o
+Ġa ro
+Ġa ar
+Ġa vers
+Ġa ics
+Ġa xi
+Ġa uro
+Ġa udi
+re tion
+re ment
+re ate
+re ach
+re led
+re can
+re place
+re yi
+re zinc
+Ġth am
+Ġth rus
+on a
+on an
+on it
+on os
+on able
+on ents
+on ca
+on tia
+on azole
+on avir
+on ias
+on ni
+on iphil
+Ġthe ob
+Ġthe sis
+Ġs pt
+Ġs ons
+Ġs ang
+Ġs orb
+Ġs ake
+Ġs elling
+Ġs ights
+Ġs osa
+Ġs ards
+Ġs accha
+ti x
+ti ed
+ti ter
+ti ge
+ti te
+ti ll
+ti fied
+ti ble
+ti ka
+Ġo ac
+Ġo ts
+Ġo cl
+Ġo mi
+Ġo kc
+Ġo zone
+en k
+en er
+en ac
+en yl
+en net
+en berg
+en opathy
+en zyme
+al f
+al ore
+al ized
+al ex
+al ian
+al most
+al kon
+al ongk
+er as
+er ied
+er ving
+er ately
+er he
+Ġc ic
+Ġc ation
+Ġc res
+Ġc tr
+Ġc able
+Ġc ue
+Ġc ased
+Ġc ex
+Ġc itation
+Ġc enes
+ed ge
+ed entistry
+Ġp b
+Ġp n
+Ġp as
+Ġp up
+Ġp all
+Ġp enc
+Ġp bm
+Ġp ept
+Ġp omer
+Ġp ini
+Ġp ascal
+Ġw ro
+Ġw orm
+Ġw ag
+Ġw ood
+Ġw inding
+Ġw att
+Ġw oven
+Ġw edge
+Ġin el
+Ġin ven
+Ġin gest
+Ġin the
+es c
+es o
+es ed
+es tern
+es lundii
+Ġan er
+Ġan is
+Ġan os
+Ġan tim
+Ġan ov
+Ġan orec
+Ġan za
+Ġan ecd
+Ġf is
+Ġf os
+Ġf ab
+Ġf up
+Ġf led
+Ġf ibular
+Ġf atal
+Ġf ang
+Ġf allen
+Ġf cs
+Ġf dl
+Ġf use
+Ġf hc
+Ġf ern
+Ġf ests
+Ġf aint
+Ġf dg
+Ġf fpe
+Ġd it
+Ġd un
+Ġd ated
+Ġd ad
+Ġd ess
+Ġd ir
+Ġd ign
+Ġd ers
+Ġd ull
+Ġd ak
+Ġd aw
+Ġd ta
+Ġd aps
+Ġd rew
+Ġd iction
+Ġd ella
+Ġd kk
+Ġd osing
+Ġd angers
+Ġd odec
+Ġd alex
+Ġm n
+Ġm ant
+Ġm ies
+Ġm ers
+Ġm ary
+Ġm cl
+Ġm ans
+Ġm ile
+Ġm amm
+Ġm erg
+Ġm itosis
+Ġm vm
+Ġm plus
+Ġm ieth
+at ine
+at ally
+at cc
+at ural
+at ri
+at gg
+or n
+or re
+or ig
+or ding
+or tal
+or se
+or st
+or ates
+or tical
+or onal
+or rees
+or ously
+or pore
+th m
+th opathy
+an tic
+an king
+an xi
+an osine
+Ġand ro
+Ġb ing
+Ġb um
+Ġb ure
+Ġb ug
+Ġb ass
+Ġb ile
+Ġb lu
+Ġb erg
+Ġb uro
+Ġb ca
+Ġb iliary
+Ġb outs
+Ġb atter
+Ġb ivariable
+is k
+is ure
+is ens
+is ons
+is pers
+as a
+as m
+as o
+as y
+as se
+as ures
+as ions
+as ks
+as hi
+as odium
+as plint
+as onable
+ent ric
+ic ed
+ic ter
+ic ted
+ic ell
+ic yl
+ic itis
+ic ron
+ic acies
+ic ola
+ing ing
+ing ually
+ro ad
+ro gram
+ro de
+ro oted
+ro lytic
+ro viral
+ro bacter
+ro toxic
+ro gated
+ro kin
+ro uel
+ar p
+ar u
+ar um
+ar ma
+ar pal
+ar cation
+ar adicular
+ar tial
+Ġre ver
+Ġre ap
+Ġre te
+Ġre int
+Ġre acted
+Ġre acts
+Ġre use
+Ġre acting
+Ġre arr
+Ġre abs
+Ġre amer
+Ġre institution
+Ġre attach
+Ġre establ
+Ġto w
+Ġto ken
+Ġto hok
+Ġh i
+Ġh k
+Ġh v
+Ġh w
+Ġh ed
+Ġh es
+Ġh ir
+Ġh are
+Ġh ose
+Ġh int
+Ġh ither
+Ġh ang
+Ġh fa
+Ġh mm
+Ġh idal
+Ġh ata
+Ġh la
+Ġh ubba
+le b
+le ys
+le te
+le bs
+Ġe ich
+Ġe ug
+Ġe asing
+Ġe gf
+Ġe eg
+Ġe agle
+Ġe uthan
+it age
+it ates
+it ron
+us sion
+us ual
+Ġst t
+Ġst orm
+Ġst ub
+Ġst ool
+Ġst ays
+Ġst ably
+Ġst oring
+Ġst air
+Ġst ones
+Ġst abilities
+Ġst eep
+Ġst agn
+Ġst amped
+Ġst oich
+ul ing
+ul ature
+ul itis
+ul ator
+ul ou
+ul gen
+ul ista
+ul alongk
+ac s
+ac le
+ac ia
+ac ase
+ac ency
+ac ute
+ac avir
+ac arpal
+ec tic
+ec ology
+ec ostal
+Ġl k
+Ġl ent
+Ġl ia
+Ġl ately
+Ġl ute
+Ġl air
+Ġl fs
+Ġl aryngeal
+Ġl obe
+om ore
+om ater
+om idine
+om avirus
+Ġn ol
+Ġn ap
+Ġn op
+Ġn em
+Ġn vid
+Ġn ult
+Ġn br
+Ġn ord
+Ġn omen
+Ġn ps
+Ġn atives
+Ġn ested
+Ġn ails
+Ġn ik
+Ġn ests
+Ġn aked
+Ġn la
+Ġn ucl
+Ġn amara
+Ġn uances
+im et
+im od
+im pl
+im olar
+im ene
+im etry
+im ethyl
+im ilarities
+Ġg ar
+Ġg ate
+Ġg em
+Ġg orm
+Ġg ill
+Ġg ear
+Ġg lu
+Ġg ag
+Ġg ds
+Ġg ob
+Ġg omes
+Ġg gg
+Ġg ca
+Ġg nas
+Ġg tg
+Ġg era
+Ġg han
+Ġg aming
+Ġg erald
+Ġg azi
+Ġg sr
+Ġg imene
+ly tes
+ly tically
+ly zer
+ly bden
+ur ate
+ur bs
+ur ances
+ur ring
+ur ious
+ur tosis
+ur cation
+ur pr
+ig itation
+ig uing
+Ġwi pe
+Ġwith drew
+ud a
+ud en
+et ts
+et res
+et tle
+et omidine
+os um
+os omes
+os oid
+os itol
+ce le
+if ting
+if urcation
+Ġfor going
+ol t
+ol lective
+ol ingually
+Ġas yn
+Ġas rs
+Ġas tra
+Ġas mt
+il or
+il ament
+Ġcon gr
+Ġcon clus
+Ġcon forms
+Ġcon gestion
+od ing
+od il
+od erm
+od rop
+od ermal
+od uoden
+id one
+id ental
+id emia
+id ae
+id oprop
+ow ed
+ow ered
+Ġon ward
+Ġon ye
+Ġon wards
+Ġon lays
+ment al
+Ġor m
+Ġor pt
+ab in
+ab el
+ab ite
+ab ama
+ab uccal
+un as
+un it
+un ion
+un ting
+un eration
+Ġstud io
+am ant
+am ad
+am yl
+am ycin
+am iliar
+am idoprop
+tic k
+Ġv u
+Ġv if
+Ġv oc
+Ġv og
+Ġv ist
+Ġv anc
+Ġv asc
+Ġv isting
+Ġv hn
+res cens
+el ity
+el ong
+el ps
+el ier
+el ters
+el inak
+ter oidal
+up l
+up t
+up es
+Ġal k
+Ġal er
+Ġal ber
+Ġal ta
+Ġal inity
+Ġal anine
+Ġal abama
+Ġper th
+Ġper it
+Ġper vious
+Ġper inucle
+Ġper iles
+Ġper itone
+Ġr q
+Ġr v
+Ġr iv
+Ġr io
+Ġr af
+Ġr pre
+Ġr icap
+Ġwh l
+Ġwh ites
+Ġex it
+Ġex ome
+Ġex ecutive
+Ġex tir
+Ġex pecting
+Ġpro ping
+Ġpro posing
+Ġpro gnathism
+Ġres um
+Ġres ili
+Ġres trained
+Ġres emble
+Ġres pecting
+Ġres ettle
+Ġbe e
+Ġbe ad
+Ġbe verage
+Ġbe agle
+Ġbe wteen
+ion ts
+uc ting
+uc hs
+tr ate
+tr ap
+tr ich
+tr ace
+tr ache
+tr abec
+tr iglycer
+ot ated
+ot ap
+ot te
+Ġim aged
+Ġim posing
+Ġim iqu
+Ġim itating
+Ġim porting
+Ġis g
+Ġis tit
+Ġis tan
+Ġis thm
+ad ual
+ut o
+ut om
+ess ment
+ess ential
+ver a
+ver al
+ver di
+Ġus b
+oc us
+oc co
+oc ae
+oc utaneous
+oc aine
+qu ing
+qu eness
+Ġch ol
+Ġch emic
+Ġch agas
+Ġch ulalongk
+Ġde activation
+Ġde phosph
+Ġde grade
+Ġde qual
+ore gional
+ain ment
+Ġinc ong
+pl ot
+pl ess
+pl ane
+ure thane
+Ġat a
+Ġat omic
+Ġat ubular
+Ġpre con
+Ġpre tes
+Ġpre occ
+Ġpre transplant
+Ġac b
+Ġac p
+Ġac anth
+ys es
+ys ma
+ys plas
+ys ema
+Ġcomp o
+Ġcomp ost
+Ġcomp utes
+Ġgroup ings
+ific ance
+iv ocal
+og el
+ib ulum
+Ġdis tr
+Ġdis oc
+Ġdis ks
+Ġdis position
+Ġdis organ
+Ġdis ulf
+Ġdis putable
+Ġdis junction
+Ġdis integr
+Ġse a
+Ġse es
+Ġse fs
+Ġse pha
+Ġsh en
+Ġsh ore
+Ġsh ip
+Ġsh ine
+Ġsh out
+Ġsh elf
+Ġsh aw
+Ġsh aken
+Ġsh ield
+Ġsh ank
+Ġsh aded
+Ġsh bg
+Ġsh ielding
+Ġsh yama
+Ġsh anxi
+Ġsh elters
+ap a
+ap rep
+ap rezinc
+Ġdif luoride
+Ġad vers
+Ġad ma
+Ġad ela
+Ġpati ence
+Ġdent ation
+Ġdent ogingival
+Ġdent oskeletal
+Ġbet aine
+Ġhe ater
+Ġsign ified
+Ġsign ify
+Ġass esed
+Ġcl on
+Ġcl ad
+Ġcl ue
+Ġcl aus
+Ġcl ade
+Ġcl ips
+Ġcl arith
+Ġcl ocking
+Ġcl othing
+rom ine
+and ro
+and ible
+and ez
+Ġare ca
+Ġtw elf
+Ġtw isting
+Ġtw eets
+ff man
+Ġma al
+op er
+op ed
+op tic
+op md
+op eptide
+op ilot
+op apers
+por ts
+por ter
+por ous
+odon tal
+we alth
+ers ten
+ers son
+Ġsc rol
+Ġsc all
+Ġsc iss
+Ġsc ou
+Ġperi impl
+Ġap q
+Ġap ic
+Ġap ico
+ip ol
+ip zig
+ip artial
+Ġdental s
+und ant
+und ibulum
+Ġco in
+Ġco ach
+Ġco fact
+Ġind ocy
+Ġle an
+Ġle ite
+Ġle aching
+Ġle wis
+Ġle isure
+Ġle ipzig
+Ġsur in
+Ġsur mised
+ub jec
+act ants
+act ures
+se ven
+se lec
+se lective
+se xual
+se veral
+Ġcan ce
+Ġpar ag
+Ġpar acase
+ine a
+ine oplastic
+Ġpos itron
+val ence
+val late
+vi x
+st en
+st ar
+st ated
+st aff
+Ġfo etal
+Ġfo aming
+Ġinf ers
+Ġinf undibulum
+ull ary
+ich ofacial
+enti st
+enti veness
+enti tude
+ren z
+Ġcont oured
+Ġcont ingent
+ari um
+ari ably
+ari ogenic
+Ġpres et
+Ġpres tige
+Ġpl ough
+Ġpl atin
+Ġpl iers
+Ġpl entitude
+ell i
+Ġall en
+Ġall otted
+ch e
+ch ron
+end able
+end ers
+end all
+ug g
+ug s
+ug ular
+ill er
+Ġro e
+Ġro w
+Ġro th
+Ġro str
+Ġro ss
+Ġro utes
+Ġro set
+Ġtr in
+Ġtr ig
+Ġtr ies
+Ġtr aces
+Ġtr usting
+Ġtr illion
+Ġtr ifurcation
+Ġtr ilor
+ach er
+Ġcons ens
+Ġcons angu
+Ġreg ress
+cl in
+cl ature
+Ġacc ustom
+ative ly
+Ġno ises
+Ġno vice
+Ġthree fold
+Ġrec k
+Ġrec ons
+Ġrec edes
+Ġrec reate
+Ġrec tified
+Ġincl usive
+Ġrel oc
+Ġrel ine
+Ġpr n
+Ġpr ab
+Ġpr ices
+Ġpr dx
+Ġpr ato
+Ġpr oroot
+Ġpr agm
+Ġpr ahl
+Ġcar re
+Ġcar los
+Ġcar rouel
+Ġtooth less
+Ġtooth wear
+ive ira
+Ġab used
+Ġab bott
+Ġab fraction
+Ġab orig
+Ġab road
+Ġab acavir
+Ġclin var
+Ġaf rs
+Ġaf ferent
+Ġrepor ters
+Ġsub nas
+Ġsub anal
+Ġsub lux
+Ġsub epid
+Ġsub acute
+Ġsub urbs
+Ġsub unit
+Ġinter acted
+Ġinter cor
+Ġinter individual
+Ġinter tubular
+Ġinter trabec
+Ġafter ward
+Ġafter no
+Ġqu int
+Ġqu art
+Ġqu oted
+Ġqu eries
+Ġqu itting
+Ġqu eried
+Ġun im
+Ġun iz
+Ġun iv
+Ġun per
+Ġun con
+Ġun ins
+Ġun wor
+Ġun pre
+Ġun plan
+Ġun iaxial
+Ġun esp
+Ġun stand
+Ġun inter
+Ġun bound
+Ġun qual
+Ġun attach
+Ġun anim
+Ġun biased
+Ġun usual
+Ġint end
+Ġint estine
+ay gis
+ist em
+ist ance
+Ġy r
+Ġy in
+Ġy rs
+Ġam c
+Ġam m
+Ġam in
+Ġam ple
+Ġam ber
+Ġam put
+Ġam mon
+Ġam ira
+Ġam star
+ens ins
+ens pan
+Ġvari ably
+Ġassoci ating
+Ġk b
+Ġk re
+Ġk al
+Ġk ick
+Ġk pa
+Ġk oh
+Ġk ota
+Ġk obe
+Ġk ato
+Ġk umar
+Ġk oil
+Ġk yush
+Ġk lebs
+Ġk urtosis
+Ġk endall
+Ġk aygis
+Ġval ley
+Ġval leys
+iti m
+iti ts
+iti ators
+Ġwe i
+Ġwe erhe
+atis fied
+pro t
+lec ting
+Ġen r
+Ġen erg
+Ġen vision
+Ġen closed
+Ġfol i
+Ġfol lic
+Ġfol ded
+rol idone
+Ġgen omes
+Ġgen icular
+Ġgen ban
+Ġgen omics
+Ġmay an
+Ġpo uring
+ome in
+ome atal
+ome gal
+Ġassess or
+Ġtim eline
+ph or
+ph ys
+ph ones
+Ġout reach
+ugh ter
+ugh ters
+ass im
+ass ays
+gn er
+Ġspec ulative
+erm oid
+erm ann
+Ġfin er
+Ġup ch
+Ġup wards
+Ġup stream
+Ġcor ner
+Ġcor pus
+Ġmeth ane
+Ġmeth acrylates
+str and
+all a
+Ġso x
+Ġso aking
+Ġso hi
+Ġar d
+Ġar as
+amin i
+amin ar
+Ġinv ivo
+Ġinv ariably
+Ġmed er
+Ġmed iter
+Ġmed ipol
+Ġmed ullary
+enc our
+Ġph q
+Ġph ones
+Ġph obi
+Ġph elps
+Ġph ocae
+Ġevalu able
+Ġevalu ative
+Ġover he
+Ġover treatment
+Ġover jets
+Ġover stated
+ke ys
+mo unt
+Ġbi oc
+Ġbi otype
+Ġbi oroot
+Ġcell ulose
+Ġcell ulitis
+ct cc
+ct tg
+Ġmo ves
+Ġmo vie
+Ġmo orrees
+Ġmo lybden
+Ġparticip ates
+Ġcol ab
+Ġcol itis
+Ġcol umb
+ber t
+ues e
+Ġdenti um
+Ġtime atr
+Ġdec iph
+Ġdec ortic
+Ġdec oded
+Ġcr d
+Ġcr s
+Ġcr iti
+Ġcr ibr
+Ġsec oster
+Ġsec luded
+Ġag encour
+adi um
+Ġcal f
+Ġcal cein
+Ġwho qol
+ior otated
+Ġaccor ds
+Ġperiodonti ts
+Ġstr ipping
+Ġstr icter
+Ġstr ugg
+ex traction
+Ġ1 000
+Ġ1 10
+tain ment
+Ġimpl icate
+Ġimpl icit
+Ġsim on
+Ġbr ier
+Ġbr acing
+ystem s
+Ġund eni
+ep am
+Ġnumber of
+Ġexamin es
+Ġexamin ator
+ag y
+ag ia
+ag ct
+ag asc
+ag tt
+Ġman ages
+Ġman ning
+Ġman ova
+Ġman ches
+Ġman pow
+Ġ2 95
+ath in
+Ġcompar ator
+Ġcompar asions
+Ġnon h
+Ġnon adj
+Ġnon toxic
+Ġnon institution
+Ġnon particip
+Ġnon mineralized
+Ġnon fat
+Ġnon instru
+Ġnon union
+Ġnon selective
+pos ons
+Ġdisc arding
+Ġdisc oid
+Ġdisc ordance
+Ġsup position
+Ġorth ox
+pt ual
+pt otic
+Ġradi od
+Ġradi ant
+Ġradi ometer
+Ġdef icit
+Ġdef ensins
+Ġsp a
+Ġsp ines
+Ġsp inal
+Ġsp astic
+Ġsp aced
+Ġsp itting
+Ġsp arc
+Ġsp inous
+Ġsp ike
+Ġsp oon
+Ġsp asm
+Ġsp urious
+Ġj r
+Ġj mp
+Ġj da
+Ġj elly
+Ġj ugular
+Ġed it
+Ġed ible
+Ġed ited
+Ġed ged
+Ġed emat
+Ġed uardo
+Ġfur nish
+Ġcare rs
+istic s
+Ġmicro d
+Ġmicro fr
+Ġmicro phot
+Ġmicro comp
+Ġmicro elect
+Ġmicro vess
+Ġcomm encing
+Ġcomm itted
+Ġcomm endable
+Ġdem ography
+Ġdem arcation
+Ġmater nity
+oun cement
+Ġmin as
+Ġmin ing
+Ġmin ors
+Ġmin nes
+Ġtyp odont
+Ġgingiv ally
+Ġsubjec ting
+Ġextr usive
+Ġappro ve
+Ġappro ving
+Ġmand ates
+Ġcalc ic
+Ġchar ges
+Ġchar ging
+Ġi er
+Ġmal align
+Ġmal asse
+Ġtrans it
+Ġtrans ference
+Ġtrans itivity
+Ġtrans posed
+Ġtrans aminase
+Ġtrans iently
+Ġtrans porter
+Ġtrans sexual
+Ġtrans posons
+ten tional
+Ġform ally
+ological ly
+Ġdi j
+Ġdi pl
+Ġdi amine
+Ġdi acet
+uth ors
+Ġcur b
+Ġcur cumin
+Ġdevelop ers
+ace ous
+Ġgr iff
+ons cious
+ak ary
+ak ening
+Ġli u
+Ġsal icyl
+Ġunder ne
+Ġunder growth
+Ġunder filled
+Ġunder achie
+Ġlim a
+ough s
+Ġimp ar
+Ġimp ose
+Ġimp actions
+Ġimp uls
+Ġimp rac
+tor ch
+Ġpost code
+Ġpost biotic
+Ġpost extraction
+Ġprim ed
+Ġprim es
+Ġpain ted
+Ġser val
+Ġser oma
+Ġmet re
+Ġmet ers
+Ġmet aph
+Ġmet acarpal
+Ġmon os
+Ġmon ob
+Ġmon of
+Ġmon ophosphate
+Ġbl end
+Ġbl aming
+Ġbl isters
+Ġem ails
+Ġfre undii
+Ġol r
+Ġol s
+Ġol iver
+Ġol sen
+Ġol iveira
+Ġintr ins
+Ġintr ude
+Ġintr aper
+Ġintr icacies
+Ġintr iguing
+amm as
+Ġneed les
+Ġ0 16
+Ġ0 12
+Ġ0 18
+Ġfrequ entist
+Ġstand point
+Ġz i
+Ġz p
+Ġz ops
+Ġz uan
+Ġz hu
+Ġz hou
+Ġz hang
+Ġwor ried
+Ġwor ris
+Ġwhere ver
+Ġer ik
+Ġer verdi
+Ġmain z
+Ġinvestig ational
+ss on
+Ġquestion aire
+Ġless en
+ll ables
+Ġsoft max
+Ġplan ar
+Ġplan ners
+ores istance
+Ġdr ained
+Ġdr aft
+Ġdr ifting
+Ġend es
+Ġend ure
+Ġend ang
+Ġend osseous
+Ġend eav
+Ġend orse
+Ġend opilot
+Ġinform s
+Ġinform al
+Ġinform ational
+Ġradiograph ies
+Ġca val
+Ġresearch ed
+Ġresearch ing
+Ġsug ared
+ym ethyl
+Ġinfl icted
+Ġce a
+Ġce f
+Ġstandard izing
+Ġloc ked
+Ġloc oregional
+Ġdid anosine
+Ġaffec tion
+Ġel ders
+Ġel nil
+Ġobtain s
+Ġobtain able
+Ġmulti organ
+Ġmulti bracket
+Ġmulti vitamin
+Ġmulti rooted
+fer ior
+Ġselec ts
+Ġselec tivity
+Ġrem uneration
+gr ip
+gr ath
+Ġfr ightened
+Ġfr aying
+Ġcriter ium
+ving s
+ord ed
+ord ant
+our a
+our se
+Ġpred ig
+Ġany one
+Ġany how
+Ġany thing
+Ġeduc ator
+Ġadj acency
+Ġindex ed
+Ġexpl ant
+Ġmuc us
+Ġmuc oderm
+Ġexperi ential
+Ġflu x
+Ġflu ent
+Ġflu ence
+Ġflu ores
+ha h
+ha ving
+Ġdistrib ute
+Ġsm op
+Ġsm gi
+Ġsm ith
+Ġsm eared
+Ġins ulator
+Ġins urances
+Ġconduc ed
+Ġconduc tion
+Ġconduc tive
+Ġconduc tor
+Ġimm pact
+Ġimm ortal
+Ġknowledge able
+gi ans
+Ġir ct
+Ġsch ul
+Ġsch ema
+Ġline age
+Ġoc clud
+Ġcb ss
+Ġinfec ting
+Ġneg ativity
+Ġneg lecting
+Ġprot ons
+Ġprot otyping
+Ġbeha ved
+Ġbeha ves
+Ġuni queness
+Ġsamples w
+Ġmouth rins
+Ġgl ue
+Ġgl mm
+Ġgl enoid
+Ġpath ologists
+Ġcommon wealth
+Ġspecific ations
+Ġanti de
+Ġanti ret
+Ġanti plate
+Ġcer vix
+Ġdist omolar
+Ġupper most
+Ġos ap
+Ġos tial
+Ġos aka
+Ġpe a
+Ġpe b
+Ġpe g
+Ġpe el
+Ġpe eling
+Ġpe opl
+Ġpe aking
+Ġpe eso
+Ġav d
+Ġcollec ts
+of iles
+Ġfac ets
+Ġpal ates
+Ġpal mas
+yl s
+yl ase
+Ġhist one
+io ceptive
+00 1
+til ity
+Ġparen chymal
+Ġeth ic
+Ġlo ts
+Ġlo ess
+Ġlo osing
+Ġlo upes
+Ġgu inea
+Ġes ter
+Ġes ri
+Ġfl ight
+Ġfl ared
+Ġfl ag
+Ġfl ood
+Ġfl our
+Ġfl akes
+Ġfl anking
+ick ness
+ick man
+Ġdiscussion s
+Ġarch ived
+Ġstress ing
+Ġdemonstr ation
+Ġdemonstr ative
+Ġoste itis
+Ġoste otome
+Ġatt entiveness
+ox ymethyl
+Ġintra vascular
+Ġintra vital
+Ġintra fibrillar
+Ġvi rolog
+Ġda ej
+Ġda ughters
+Ġevid ences
+Ġsl ap
+Ġsl imm
+Ġsl ime
+Ġang led
+Ġang elier
+Ġschool ers
+Ġmaj ored
+Ġpoint less
+Ġfe es
+Ġfe els
+Ġfe kon
+Ġfe aturing
+Ġfe ulgen
+Ġver nier
+Ġperce ptual
+Ġsens ed
+Ġsens ible
+Ġmat ters
+Ġmat su
+Ġmat lab
+Ġmat rig
+oid osis
+Ġep ic
+Ġep oxide
+Ġep oseal
+Ġep iinf
+Ġep istem
+Ġsol dered
+Ġsol vents
+Ġadhes in
+Ġadhes iveness
+ne il
+ne ys
+Ġconsist ence
+Ġred irection
+Ġwater y
+Ġmem orial
+sequ ently
+con sequently
+Ġnew tom
+Ġliter ate
+Ġliter ally
+man y
+ral e
+Ġhand grip
+Ġsing h
+Ġsing ular
+Ġmor k
+Ġmor gan
+Ġmor occo
+cept or
+sc o
+Ġvalid ations
+Ġcompl aining
+Ġcap nocyt
+Ġthick est
+Ġthick ened
+Ġimpact ing
+Ġprov inc
+Ġmoder ated
+Ġmoder ating
+Ġacid ophilus
+Ġref ute
+Ġref ining
+Ġhos ts
+Ġhos ted
+Ġrele ases
+Ġhum oral
+Ġhum ming
+Ġsoc ransky
+Ġhospital izations
+Ġwid owed
+Ġpoly urethane
+Ġsu fficiency
+Ġach ing
+Ġpa hel
+Ġpa ulista
+ou rous
+pe g
+Ġlab io
+Ġlab rale
+Ġoh io
+Ġlif elong
+Ġcrown ed
+Ġmicrob acterium
+vent ed
+Ġtum ourous
+Ġdevi ating
+omm a
+Ġu it
+Ġu icc
+Ġu rokin
+Ġaut oflu
+Ġaut osomal
+Ġhel ices
+Ġorder ly
+Ġret reated
+Ġret inal
+Ġlight ening
+Ġlight wal
+Ġsuper position
+Ġsuper oin
+Ġsuper ius
+Ġsuper infection
+Ġcephal ostat
+Ġmucos itits
+Ġfam ous
+Ġlas ts
+erg lass
+vir als
+vir idae
+Ġlay out
+Ġdig ora
+Ġimmun ization
+Ġimmun otherapy
+Ġimmun izations
+Ġimmun omod
+Ġbel gian
+Ġbel gium
+Ġtem gesic
+Ġperman gan
+Ġmen tions
+Ġmen gh
+Ġeff avi
+Ġul na
+Ġresist ing
+Ġresist ome
+Ġattach ing
+Ġsocial izing
+Ġsw in
+Ġsw ift
+Ġsyn ops
+Ġsyn ergy
+Ġseal apex
+af ung
+af raid
+Ġirr itating
+Ġpat ent
+Ġexp on
+Ġexp ands
+Ġexp ense
+Ġexp atri
+enced irect
+Ġ20 3
+Ġsti ffer
+Ġsti gm
+Ġdispl acing
+Ġod or
+Ġflow ers
+Ġoscc s
+ind ex
+Ġair tig
+Ġair scal
+Ġtimes pan
+Ġsocio economics
+Ġequ ated
+Ġequ ity
+Ġequ imolar
+Ġequ ivocal
+Ġmes o
+Ġmes hes
+Ġmes iorotated
+Ġ4 00
+Ġest adual
+Ġax il
+Ġax ially
+Ġprem ises
+Ġfib r
+Ġfib ula
+Ġfib romy
+Ġfib erglass
+Ġdifferenti ates
+Ġlocal ize
+Ġdirect orate
+Ġfocus sing
+Ġabo hab
+Ġfree form
+Ġdistal ized
+Ġdistal isation
+Ġpolym icrobial
+Ġpolym ethyl
+Ġfew est
+ang ular
+ang ulation
+ang kul
+Ġprior ities
+Ġadhesive ly
+Ġclos ures
+Ġprote obacteria
+Ġprote oglyc
+Ġprec ede
+Ġintroduc tions
+Ġrot ten
+Ġrot terdam
+Ġpros pect
+Ġdom inates
+Ġdom hain
+Ġbo k
+Ġbo om
+ival ent
+Ġhal o
+Ġhal ted
+Ġhal ves
+Ġdeep en
+Ġhypoth yroid
+Ġsatis fies
+Ġhyper inflammatory
+Ġhyper keratosis
+Ġhyper prolif
+Ġhyper triglycer
+Ġwork st
+wor ks
+Ġcp r
+Ġresid ency
+Ġresid ences
+reg ulation
+reg ions
+Ġconstr ained
+Ġcari ostatic
+Ġchr ist
+Ġbiom onit
+roph obia
+Ġcommun icated
+Ġcommun icating
+Ġcommun icable
+Ġvir gin
+Ġvir onos
+Ġspl atter
+Ġspl inted
+Ġhead l
+Ġhead aches
+Ġhead films
+Ġdel ve
+Ġdel icate
+Ġdel hi
+Ġmorph ogenetic
+Ġmark ov
+etr ically
+az ine
+az vin
+Ġclinic opath
+Ġpsych opathological
+Ġpsych ologist
+Ġpsych ophys
+Ġans ys
+Ġml n
+Ġcement obl
+Ġskeletal ly
+Ġmut an
+Ġmut ational
+Ġmut ually
+ros pinal
+Ġbleeding s
+Ġrough ening
+Ġpublic ity
+Ġpublic ize
+Ġpur ple
+Ġlogistic s
+gen ase
+Ġsumm aries
+Ġadv ising
+Ġadv ancing
+Ġartic ulating
+Ġland is
+Ġutil ises
+Ġdescrip tors
+Ġx eon
+Ġconnec tors
+Ġconnec tivity
+Ġvisit ors
+Ġchem istry
+Ġchem oresistance
+Ġapproxim ating
+Ġapproxim ates
+Ġback ing
+Ġback bone
+Ġback bones
+Ġproportion ed
+Ġnetwor king
+Ġpol der
+Ġpol aprezinc
+Ġchec ks
+Ġregular ize
+lor ic
+Ġ8 11
+Ġinser tions
+Ġsitu ated
+Ġoptim ised
+Ġoptim izes
+Ġoptim izer
+Ġwa king
+Ġwa iver
+Ġwa gner
+Ġbor oughs
+Ġphot ography
+Ġphot ochemical
+Ġphot oin
+Ġms v
+Ġms x
+Ġms bi
+Ġsubs ides
+Ġsubs ites
+Ġsubs iding
+Ġsubs ampling
+Ġinstruc tor
+me tical
+ru le
+line arities
+Ġassum es
+Ġarti ficially
+Ġtub er
+Ġtub ings
+Ġtub ule
+Ġsil k
+Ġsil ence
+Ġsil vers
+Ġsil va
+tid a
+tid ine
+Ġmus ic
+Ġsn hg
+Ġacro derm
+Ġclean ness
+Ġclean ings
+com b
+Ġtit led
+Ġtit rated
+rop o
+rop enic
+Ġrecru iter
+Ġpen sion
+Ġbar reled
+Ġmucosa e
+Ġprotein ase
+Ġsleep y
+Ġeas iest
+Ġconsequ ential
+Ġmale ic
+Ġvisual izes
+Ġemploy er
+Ġfunctional ized
+Ġfunctional ities
+orb able
+ect odermal
+ony ms
+Ġcod iagnos
+Ġten th
+Ġmagn et
+Ġmagn ificance
+Ġpneum onias
+Ġreal ism
+Ġhydro lytic
+Ġhydro carb
+Ġalg ometer
+ax es
+Ġmineral ising
+ls kron
+Ġic w
+Ġic es
+Ġobjec ted
+ung s
+obl ast
+Ġread ers
+Ġzir kon
+Ġpneumonia e
+Ġmild er
+Ġheter ogenic
+ucle ar
+Ġultr ap
+Ġultr athin
+Ġbur r
+Ġbur ied
+Ġbur rs
+Ġsee kers
+Ġsee berg
+Ġparti tioned
+Ġdam p
+Ġdam pen
+Ġrepl ied
+Ġrepl anted
+Ġhs ps
+Ġhs pa
+Ġge ography
+Ġge ometr
+Ġge ographically
+Ġenc ode
+Ġopen ness
+Ġopen gwas
+Ġmy el
+Ġerup ts
+Ġcut out
+Ġcut mix
+grad ed
+Ġhor us
+Ġev oked
+Ġev andro
+Ġmicroscop es
+Ġmill ions
+Ġphosph orous
+Ġphosph opeptide
+Ġbenef ited
+Ġsem ia
+Ġsem ipartial
+pati ent
+Ġfp ds
+Ġinstrument ations
+Ġlig ase
+Ġlig ands
+Ġmac ules
+Ġregen erate
+Ġsci encedirect
+Ġexplain able
+Ġexplain ability
+Ġcomposition ally
+Ġpapill oma
+Ġpapill omavirus
+nt p
+nt on
+Ġfav oured
+uk i
+Ġq c
+Ġq iac
+Ġq ray
+Ġq assim
+Ġq azvin
+Ġve t
+Ġve au
+agen er
+agen ous
+Ġmar ria
+Ġmar mara
+Ġmar wah
+Ġmass ively
+Ġbin ocular
+Ġhom olog
+Ġdys m
+Ġdys plastic
+Ġdys keratosis
+Ġmesial isation
+Ġdescriptive ly
+Ġpass ages
+Ġmach inery
+Ġra vera
+Ġintrusion s
+Ġcheck point
+Ġcop enh
+Ġcop olymer
+Ġher itability
+Ġcho ke
+Ġadjust ability
+Ġpm p
+Ġtur b
+Ġtur in
+Ġnan oseal
+Ġnan omater
+Ġnan odrop
+Ġnan ogel
+Ġadap ts
+Ġcandid al
+Ġcandid ate
+Ġdown grade
+Ġ19 50
+Ġ19 86
+Ġur ge
+Ġur ges
+Ġur ging
+Ġphen otyping
+Ġtransfer rin
+thes ia
+opath ies
+opath ogen
+Ġent ail
+Ġgerm ans
+Ġachieve ments
+Ġstre am
+Ġrc us
+Ġmis rec
+Ġmis fit
+Ġmis information
+Ġcirc uit
+Ġintegr in
+Ġsa har
+Ġrecogn ising
+Ġrecogn izes
+Ġasym ptotic
+Ġdiss imilarities
+Ġretr actions
+Ġdecl ines
+Ġfibro vascular
+Ġna eslundii
+Ġaccum ulating
+Ġaccum ulative
+Ġcarb oxymethyl
+Ġeuro ba
+Ġeuro transplant
+Ġcam eras
+Ġflex ofiles
+Ġnod al
+Ġnod atum
+Ġram i
+Ġram p
+Ġram ifications
+for ation
+Ġcomputer s
+Ġwr ists
+Ġke ys
+Ġke gg
+Ġmanif ests
+Ġdemineral izing
+Ġminim ization
+Ġglob e
+Ġpil omat
+Ġfore gone
+Ġnone x
+Ġreciproc ation
+Ġther most
+Ġther abite
+Ġmetabol ize
+Ġmetabol ite
+els k
+Ġaccount able
+Ġds p
+Ġalloc ate
+Ġhis ti
+Ġhis tidine
+Ġrun t
+oph osph
+oph aga
+Ġvitamin s
+opl ates
+Ġpromo tional
+Ġ12 1
+Ġ12 5
+Ġ12 8
+Ġfacilit ator
+ochem ically
+down regulation
+the y
+Ġabr idged
+Ġabr upt
+Ġarr ange
+Ġrespir ation
+Ġsubstanti ated
+li ya
+Ġann ouncement
+Ġmc grath
+Ġmc neil
+Ġenhance ments
+Ġsuscepti bilities
+Ġbal kan
+Ġattend ances
+Ġfalse ly
+Ġlymph atic
+Ġrap idity
+Ġprop ia
+Ġprop idium
+Ġprop onents
+Ġdeb ated
+Ġstrati fy
+Ġcentr ally
+Ġip ex
+Ġmig rant
+Ġrev ol
+Ġrev ise
+Ġrev man
+Ġstem ming
+Ġunderw ood
+Ġsubstit utions
+Ġsubstit uting
+ced ented
+Ġbeg un
+Ġemph ysema
+Ġsummar ises
+Ġsubm it
+Ġsubm erged
+Ġsubm icron
+Ġemp tied
+Ġswed es
+Ġinferior ly
+Ġcalibr a
+Ġcalibr ators
+Ġcall ip
+Ġlat encies
+aryn go
+Ġparallel ism
+Ġcc nd
+Ġmas king
+Ġreaction ary
+Ġrestric ts
+Ġweak ens
+Ġactin obacteria
+Ġpurpose ly
+Ġpurpose ful
+Ġcentrifug ing
+Ġown er
+Ġown ed
+Ġhere by
+Ġreproduc tive
+Ġdiscrep ant
+Ġdepend ant
+Ġdepend ents
+Ġdepend ency
+Ġcollagen olytic
+Ġinterd igitation
+ino in
+Ġtom ograph
+Ġtom ographic
+Ġcerv ically
+Ġabras iveness
+Ġabras ivity
+Ġaccep ts
+Ġremineral ising
+Ġcircum vallate
+wh en
+wh ich
+Ġhome work
+Ġtonsill itis
+Ġmic afung
+Ġmix er
+Ġsecre t
+Ġconst ants
+Ġ16 08
+Ġcontinu um
+Ġwrit ers
+Ġker as
+Ġker atosis
+Ġgly ca
+Ġbio eth
+Ġbio assay
+Ġbio analyzer
+Ġbio avail
+Ġjud ges
+Ġcoordin ator
+Ġcoordin ators
+Ġnh ird
+Ġwire less
+Ġcoating s
+Ġsurround ings
+Ġindent ed
+Ġindirect ness
+Ġplastic ization
+Ġtor ino
+Ġtor onto
+Ġtor quing
+Ġden g
+Ġden oting
+Ġden aturing
+Ġden oising
+Ġdisp utes
+Ġcs hc
+Ġcusp al
+Ġgraph ite
+Ġgraph ics
+Ġperf used
+Ġligament ous
+Ġide as
+Ġgre ene
+Ġgre enspan
+Ġord u
+Ġord inance
+Ġagg rec
+Ġagg recan
+Ġspe eding
+Ġspe aker
+Ġtap ed
+Ġox ides
+Ġdil igence
+etric s
+Ġyour self
+Ġkap a
+Ġdiscom for
+15 0
+Ġincrement ally
+Ġcrystal lin
+Ġjoint ly
+Ġincomplete ly
+rup ted
+Ġah med
+Ġgc oc
+Ġras h
+Ġbeam s
+Ġdigit ations
+Ġhg pp
+lect ual
+Ġcarbon aceous
+dom ain
+abil ization
+Ġattr action
+Ġintrac erebral
+Ġmacro regions
+Ġprophyl axes
+Ġsy llables
+Ġmeet ings
+Ġirrig ator
+Ġdb p
+Ġdb ar
+Ġvide otap
+Ġalle lic
+Ġforeign ers
+Ġaid ing
+Ġinjec ting
+Ġinjec table
+Ġmad agasc
+Ġharm ed
+Ġharm less
+Ġvs mpre
+Ġkn g
+Ġkn hanes
+Ġkn orst
+Ġtransverse ly
+Ġencour ages
+pr inting
+Ġpack s
+Ġinh aling
+Ġfresh men
+Ġdg zm
+Ġcomprom ises
+Ġlithuan ians
+Ġkeratin izing
+Ġkeratin isation
+Ġom is
+Ġvascular ity
+Ġrare r
+Ġrare faction
+Ġtransform ative
+Ġestablish es
+Ġsulf on
+Ġsulf oxide
+hard t
+Ġconc ordant
+ips es
+Ġabsolute ly
+Ġdichotom ize
+Ġdichotom isation
+Ġimmunohist ochemically
+Ġpu zz
+Ġpu tida
+Ġmel ted
+unct ure
+Ġappe tite
+Ġsmooth ly
+Ġxyl ol
+Ġxyl ene
+Ġxyl azine
+fill ings
+Ġccc d
+Ġcustom ize
+Ġcustom ised
+Ġben zo
+Ġvestib ule
+Ġcolour s
+Ġconv ince
+Ġperiodont opathic
+Ġpron ouncing
+Ġscreen er
+Ġauthor ization
+Ġauthor ised
+Ġcommercial ized
+cy cl
+Ġwar p
+Ġwar ning
+Ġwar rants
+Ġwar burg
+Ġwar saw
+Ġkee ps
+Ġdetermin ability
+Ġdmf r
+Ġelect roma
+Ġec d
+Ġec ori
+Ġdiagram s
+Ġfram ed
+Ġwave form
+Ġphotograph ers
+Ġmaster y
+Ġanaer obe
+Ġcath olic
+Ġhif i
+Ġclar ification
+Ġupreg ulating
+Ġadjunc ts
+Ġsouth eas
+Ġapplic ator
+Ġpolymorph ic
+Ġaustral ians
+Ġtetr a
+Ġtetr ahedral
+Ġtetr asodium
+Ġather oma
+Ġhar ness
+Ġhol m
+Ġhol t
+Ġhol st
+Ġperm uted
+Ġperm selec
+Ġuns up
+Ġuns killed
+Ġuns urpr
+Ġgranul ocytes
+12 0
+ah im
+Ġcit rate
+Ġcit robacter
+oscl erosis
+Ġground water
+Ġgovern ate
+Ġgovern ments
+Ġgovern orates
+rane an
+Ġslow ing
+Ġow ens
+Ġcoch ran
+Ġdap i
+Ġmom bell
+Ġlist ening
+Ġlist wise
+ards hip
+Ġtax es
+Ġhydroxy ethyl
+Ġhydroxy vitamin
+Ġouts tand
+Ġpseud onym
+70 3
+70 9
+Ġrejec ting
+Ġstop per
+Ġstop watch
+Ġtri age
+Ġquar tiles
+Ġcoron ectomy
+Ġsector al
+Ġ13 4
+Ġsafe gu
+Ġprincipal s
+Ġeryth rocyte
+Ġeryth ropo
+Ġter nary
+Ġscar s
+Ġfourth ly
+Ġoccup y
+med ia
+med etomidine
+Ġcere sa
+Ġft as
+Ġnig rescens
+Ġstudent es
+Ġscr atched
+Ġcontrovers ially
+Ġnoti fied
+Ġkore ans
+Ġmoun t
+Ġvolunte ered
+Ġport o
+Ġfas ted
+Ġdim ers
+Ġdim med
+Ġdim ples
+Ġadip ogenic
+Ġadip ok
+Ġleg acy
+Ġleg itim
+Ġmethan ogenesis
+gd u
+Ġnm m
+Ġnm t
+Ġnm ct
+Ġnons mo
+Ġnons teroidal
+23 3
+hr agm
+Ġpull ing
+Ġmature d
+Ġns a
+Ġns aid
+Ġcool ant
+Ġkh omein
+Ġoverc omes
+Ġdecont aminated
+Ġsimpl istic
+Ġsimpl ification
+Ġequival ently
+Ġrepair s
+Ġpush ed
+Ġfund ed
+Ġbad ersten
+Ġjusti ce
+Ġjusti fies
+Ġjusti fiable
+Ġcorrec tional
+Ġmesi olingual
+Ġoxygen ator
+imm un
+cell i
+Ġmethodological ly
+Ġmoist ened
+Ġverify ing
+Ġswit ching
+Ġswit ched
+Ġempow ered
+ocompati bility
+Ġpit x
+Ġmit osoid
+Ġbul im
+Ġbul lying
+Ġstere otypes
+Ġcompet e
+Ġ15 2
+Ġradiological ly
+Ġpersist ently
+Ġautom ation
+Ġautom ating
+Ġtele ph
+Ġpenetr ations
+era j
+Ġng s
+Ġnp ddp
+Ġdisrup tive
+Ġdisrup tions
+Ġplat ysma
+Ġencod ers
+Ġmf cs
+Ġmotor ic
+Ġbic onca
+Ġanalog s
+Ġanalog y
+Ġroc king
+Ġunf old
+Ġunf amiliar
+Ġmann itol
+Ġmelan in
+Ġmelan oac
+Ġcurriculum s
+Ġprogramm ed
+Ġure thane
+Ġband ing
+Ġband wid
+Ġhu jo
+Ġdiscol oured
+Ġsched ules
+Ġdigitiz ations
+Ġattemp ting
+Ġpel vis
+Ġexerc ising
+Ġafric ans
+Ġinten tions
+Ġarg in
+Ġarg ues
+Ġmultid irectional
+Ġhemis ected
+Ġthermocycl er
+Ġdetrim ent
+Ġpig ments
+Ġgp fs
+Ġclock ed
+Ġneuro sc
+Ġneuro trans
+Ġ24 0
+Ġ24 6
+Ġendoc rin
+Ġpredis posed
+Ġpredis poses
+Ġantifungal s
+Ġrefr action
+Ġrefr ained
+Ġdefinitive ly
+Ġneutral ize
+Ġpy torch
+Ġball istic
+Ġchew ers
+Ġshar q
+Ġshar ma
+Ġsurpr ise
+Ġflav in
+Ġflav us
+Ġfavour s
+Ġosseointegr ated
+Ġmirr oring
+Ġdark ened
+Ġnd a
+Ġrhe in
+umin ate
+Ġextrac orpore
+Ġfrag mentation
+Ġfifth s
+04 6
+Ġcu ff
+Ġine fficient
+Ġunre asonable
+Ġarm y
+Ġdecom posed
+oxy genase
+Ġhypo zin
+Ġhypo trich
+Ġmesh work
+Ġsustain able
+Ġsustain ability
+Ġsustain ably
+Ġadministr ator
+Ġadministr ators
+Ġbonfer onni
+otid yl
+Ġbod ied
+Ġkid neys
+Ġwealth ier
+Ġnorthern most
+Ġcrystall oid
+Ġdistinguish able
+Ġanticip ation
+Ġhundred th
+38 8
+fr ames
+Ġmess eng
+Ġbss ro
+Ġhm b
+Ġcontamin ating
+Ġcontour ing
+Ġ25 4
+Ġfront omaxillary
+Ġfront onasal
+Ġappra ised
+Ġincorrect ly
+Ġant ineoplastic
+Ġfus es
+Ġded uctive
+Ġded upl
+Ġnac l
+osin ate
+Ġaspir ated
+Ġaspir ate
+Ġperme ant
+Ġperme abilization
+Ġiso amyl
+Ġneut ropenic
+Ġmandib ula
+Ġblast ing
+Ġelectric ity
+Ġhemat ological
+Ġproblematic ally
+Ġtemporal is
+Ġoxid ation
+Ġoxid ase
+Ġsyring es
+Ġchronological ly
+20 358
+Ġts b
+Ġacet one
+Ġacet yl
+Ġparaf unctions
+Ġka unas
+Ġmasseter ic
+Ġmicrom eter
+Ġmicrom etres
+Ġglyc ine
+Ġglyc idyl
+Ġcorrobor ating
+Ġpancre as
+Ġpancre atitis
+Ġbil ayer
+Ġbil aminar
+Ġho oked
+Ġho ffman
+leuk oplakia
+Ġrub bed
+Ġdele tions
+Ġtrap door
+Ġobl igation
+Ġarrow head
+Ġvisc ous
+Ġretro gnathic
+Ġthermo elastic
+Ġaggress iveness
+ran i
+wa ve
+Ġrep elling
+Ġbios ystems
+Ġdiast ase
+Ġ01 4
+Ġsmart phone
+Ġsmart phones
+Ġsynthes ize
+Ġsynthes ised
+Ġadvoc ates
+Ġ199 6
+ophil ic
+Ġarray c
+Ġarray l
+Ġcasp ases
+Ġimposs ibility
+Ġamalgam ation
+Ġamalgam ate
+han i
+Ġhapp y
+Ġhapp ening
+Ġroll er
+Ġsubd iagnos
+Ġinterleuk ins
+Ġsou za
+Ġretrom ta
+Ġenter ococcus
+Ġenter opathic
+Ġenter tainment
+Ġelectro static
+Ġelectro encephal
+Ġelectro lytes
+Ġpic os
+Ġpic king
+Ġfro st
+Ġreag ents
+yst one
+Ġpresum e
+Ġsubcl ass
+Ġintell igent
+Ġmaxim ally
+Ġmaxim ise
+Ġmaxim ilian
+Ġbacteri ocin
+Ġreplic ating
+Ġoverestim ate
+Ġcereb rospinal
+Ġfinger printing
+Ġrheum atic
+ij i
+ij m
+Ġtgn ss
+Ġtang ible
+Ġtang ential
+Ġdest ination
+Ġonc ological
+Ġonc ogenesis
+Ġbeh alf
+Ġcompens ated
+Ġmaf b
+Ġcancell ation
+Ġcancell ations
+Ġsubtr act
+Ġsubtr active
+Ġamb ient
+Ġamb ivalent
+Ġagar wal
+Ġdiver sion
+Ġdiver ging
+Ġdepr iving
+Ġswab bed
+Ġcutoff s
+Ġporphy rins
+ethyl d
+Ġmillimet res
+Ġsharp en
+Ġrehabilit ated
+Ġtag ged
+Ġfu zz
+Ġfu jian
+Ġfer rule
+Ġmpa h
+anth oma
+Ġche ap
+Ġmeg a
+Ġmeg akary
+Ġadh d
+Ġhair line
+Ġrox olid
+Ġtrac ers
+Ġinterrup t
+Ġovers hadow
+Ġ26 2
+Ġ26 4
+Ġcentur ies
+Ġdissol ve
+Ġplasm inogen
+Ġhydrophilic ity
+mod erate
+Ġsial opapers
+Ġcatal og
+Ġcatal ysed
+Ġpun ch
+Ġpum ice
+Ġhap tic
+Ġgh pss
+opo ulou
+Ġunm atched
+Ġuncom promised
+Ġoverd ispers
+Ġhistomorph ometry
+Ġrefuge e
+Ġmicron utr
+Ġinhab ited
+Ġfundament ally
+Ġpunct ate
+Ġfanc oni
+Ġlys ates
+Ġlys osomal
+Ġrational ized
+Ġcoinc ide
+Ġcoinc idental
+Ġsubc ategories
+rolog y
+Ġsmoker lyzer
+Ġ79 0
+Ġpsychometric s
+Ġknock out
+Ġpleasant ness
+Ġoutbreak s
+19 0
+60 3
+60 5
+Ġexfoli ate
+Ġimag ining
+Ġimag inable
+Ġpref ers
+Ġclot ting
+Ġkary orrh
+Ġ17 8
+Ġspir ito
+Ġhomeost atic
+Ġexcav ators
+Ġmotiv ate
+Ġmotiv ates
+Ġhemisphere s
+Ġpiez oceramic
+sh otgun
+Ġtight ly
+Ġaa of
+Ġpip ette
+Ġwal k
+Ġdic lof
+Ġdro ol
+Ġdens ennet
+Ġhall marks
+Ġlr p
+Ġexon eration
+Ġshr na
+Ġclen ch
+Ġfores ee
+Ġhaem in
+Ġtrack er
+Ġdiscontin ue
+Ġlabor ious
+Ġrepeti tion
+Ġnasoph arynx
+Ġfavor ably
+Ġhomogenous ly
+Ġherpes viridae
+Ġentr ainment
+Ġmisalign ed
+Ġdirectional ity
+Ġattenu ating
+Ġattenu ates
+Ġdisadvantage ous
+Ġdiffuse ly
+Ġplei otropic
+Ġmartens ite
+Ġunexpected ly
+Ġaw akening
+Ġaw liya
+Ġov ary
+Ġov sen
+Ġpth lh
+Ġdress ed
+Ġgent amycin
+Ġperic arp
+Ġdev ising
+Ġfourteen th
+Ġnonc oll
+Ġnonc arious
+Ġnonc ommun
+Ġju ice
+Ġju ices
+Ġmicrostruct ures
+Ġmicrostruct ured
+Ġtransg enders
+Ġappend icitis
+Ġfluctu ating
+Ġattack ed
+Ġ57 8
+Ġsolub ilization
+Ġhumid ification
+Ġpsychi atr
+Ġevolution ary
+Ġadapt ations
+Ġaffirm ed
+Ġaffirm ing
+Ġsarc oidosis
+Ġsarc osinate
+Ġspray ing
+Ġantagon istic
+Ġmicronucle ated
+Ġreservoir s
+Ġarbitr arily
+Ġtell i
+Ġaud itory
+Ġwel come
+Ġanx a
+Ġanx ieties
+Ġdyn asplint
+Ġbow el
+Ġchond ro
+Ġchond rodysplasia
+Ġinfusion s
+Ġintens ification
+Ġintens ify
+Ġkil ograms
+agg c
+Ġmicroenvironment al
+Ġembr ace
+Ġembr asure
+Ġ55 5
+ocyt openia
+hu a
+Ġcoc ci
+Ġcoc amidoprop
+Ġpist acia
+Ġank le
+Ġbord ered
+Ġbatch es
+Ġreass ign
+Ġelu ate
+odynamic s
+Ġadren o
+Ġprescrib e
+Ġobst etrics
+Ġarc tic
+Ġarc gis
+Ġsput um
+Ġsput tered
+Ġlozen ge
+Ġflush ing
+Ġauton omy
+Ġimmunore actants
+Ġpolish er
+Ġphotosensitiz ers
+Ġdissem inated
+Ġdissem inate
+Ġcarboxyl ase
+Ġpropag ated
+Ġglycer ol
+Ġglycer ine
+Ġglycer aldehyde
+bacter ium
+Ġtab ulation
+Ġtel edentistry
+Ġaz ad
+Ġaz har
+Ġson ication
+Ġsel en
+Ġinver sion
+Ġdh cs
+Ġhous ed
+Ġnom inally
+Ġgather ings
+Ġperioste al
+Ġplant arum
+Ġneph rotoxic
+Ġinvest ments
+Ġmicrot ube
+Ġtransduc ers
+Ġformul ary
+Ġ34 3
+Ġsla ughter
+Ġsteril ization
+Ġevol ved
+Ġsaving s
+Ġcrevic es
+Ġboxpl ot
+Ġspreadshe ets
+Ġaccompl ish
+Ġmitochond ria
+Ġneurolog ic
+Ġoverdent ures
+Ġreimburse ments
+Ġvortex ing
+Ġunnecess arily
+Ġtc ga
+Ġcred it
+Ġmist aken
+Ġmist reatment
+Ġmist aking
+Ġchen gdu
+Ġpreclud e
+Ġshah id
+Ġheavi er
+Ġleuc ine
+Ġleuc ocyte
+Ġparas ite
+Ġparas itosis
+peri odontal
+class ified
+class ifications
+Ġrelie ved
+Ġrelie ving
+Ġintense ly
+Ġamph etamine
+Ġnumb ness
+Ġours elves
+Ġsparse ly
+Ġze it
+Ġze idi
+Ġerad icating
+Ġranking s
+Ġmultil abel
+Ġremember ing
+Ġinsp ired
+Ġdistinc tions
+Ġpromp ted
+Ġpromp ting
+Ġeconom ically
+Ġinterpret ations
+Ġveh icles
+Ġvegf a
+Ġraj aei
+Ġdsd na
+Ġreinstru mented
+Ġorthopantom ograph
+Ġrefrig erated
+Ġsudden ly
+Ġoblig ated
+Ġoblig ate
+Ġoblig atory
+Ġdestro ys
+Ġaliqu ot
+Ġaliqu oted
+Ġneighbour s
+Ġabbrevi ation
+Ġmiti gation
+Ġbh aru
+Ġreform at
+Ġreform ulated
+acchar ide
+Ġlos es
+Ġlum p
+Ġnich es
+Ġgt q
+Ġvan ishing
+Ġvig orously
+Ġvibr ational
+Ġrup tured
+Ġdex amethasone
+Ġdex tran
+Ġdex medetomidine
+Ġcompuls ive
+Ġseat s
+Ġaber ration
+Ġaber rations
+Ġquinol one
+Ġkar ary
+Ġkar lskron
+Ġsimul ant
+Ġbrist les
+Ġmanip ulating
+Ġhyal inization
+Ġimprec ision
+Ġ03 7
+Ġzo e
+Ġelab orate
+Ġglut am
+Ġpulver ization
+Ġslic ing
+Ġcontraind icated
+Ġsymph yseal
+Ġelev ate
+Ġelev ating
+Ġhemorrh agic
+Ġoverlo oking
+Ġerythro leukoplakia
+Ġuncover ing
+Ġosteoper foration
+Ġkaryo lytic
+Ġthromb in
+Ġthromb osis
+Ġthromb ocytopenia
+Ġmathematic ally
+46 1
+pers on
+sm ile
+vis it
+vis its
+Ġsort ases
+Ġsoph omore
+Ġcens oring
+Ġwit ness
+Ġinqu ired
+Ġinqu iring
+Ġdol ichofacial
+Ġduc reyi
+Ġdog an
+Ġmich elinak
+Ġnr cc
+Ġdeion ised
+Ġscrap ing
+Ġfoil s
+Ġhaemat opoietic
+Ġtriglycer ide
+Ġintercon nec
+Ġunin tentional
+Ġamp ure
+Ġkine tic
+Ġdetach ed
+Ġdesquam ated
+Ġarith metical
+Ġinvis ibility
+Ġphr ase
+Ġphr asing
+Ġcry o
+Ġcry ogenic
+Ġcry otherapy
+Ġolig odontia
+Ġremind ed
+Ġappreci ated
+Ġsuff ers
+Ġchemot axis
+Ġburst one
+Ġhomogen ization
+Ġdysreg ulated
+Ġdenom ination
+Ġelectromy ographic
+Ġelectromy ography
+Ġorthopa edics
+Ġterrit orial
+Ġconjug ation
+Ġconjug ated
+Ġconjug ative
+Ġrhyth ms
+Ġrhyth mic
+Ġmoistur izing
+Ġmoistur izers
+Ġdisinfect ant
+Ġnicotin amide
+Ġectod ysplas
+Ġcounsel ed
+Ġsynchron ize
+Ġsynchron ous
+Ġprostagland ins
+Ġunaware ness
+Ġdisappear s
+Ġimperfec tions
+Ġdispropor tionally
+hang elsk
+Ġtear s
+Ġsor ting
+Ġpad ua
+Ġanim ations
+Ġdhe eraj
+Ġmer it
+Ġbill ions
+Ġreti rement
+Ġreevalu ated
+Ġconform ity
+Ġconca vity
+Ġconca vities
+Ġpert inent
+Ġrit onavir
+Ġexoc rine
+Ġdisg usting
+Ġhep at
+Ġhep atic
+Ġhemost atic
+Ġparv ula
+Ġtrim med
+Ġconsolid ation
+Ġunid irectional
+Ġmoh amm
+Ġtransill uminate
+Ġgrand father
+Ġunderp owered
+Ġ000 1
+Ġelong ated
+Ġprednis olone
+Ġfaces can
+Ġsegreg ating
+Ġhypothal amic
+Ġtravel s
+Ġhydrof loric
+Ġaugment in
+Ġmisinterpre ted
+Ġmisinterpre tations
+Ġharmon isation
+Ġinhom ogeneity
+Ġamelior ated
+Ġconcres cent
+Ġbenz ene
+Ġbenz alkon
+Ġrhabdomy oblastic
+Ġargu ably
+Ġvlogg er
+Ġlingu istic
+Ġvertebr a
+Ġethylenedi amine
+Ġpreprocess ed
+Ġepigene tics
+bu ffer
+bu ilt
+fam ily
+iet in
+pyr rolidone
+Ġtar trate
+Ġthuring ian
+Ġstit ching
+Ġcts b
+Ġplex ig
+Ġdial ysed
+Ġdeline ated
+Ġrech arge
+Ġham per
+Ġhots p
+Ġell ipses
+Ġll od
+Ġfors us
+Ġdeple ted
+Ġmex ico
+ibacter ium
+Ġhein rich
+Ġposter o
+stud ents
+Ġallopl ast
+Ġtryp sin
+Ġinterl abial
+Ġinterrelations hip
+Ġenfor ce
+Ġenjoy ed
+Ġphantom s
+Ġbioceramic s
+Ġsuppl anted
+Ġje op
+Ġje jun
+Ġmicroc occus
+Ġcommission er
+Ġblur ry
+Ġerg onomics
+Ġmultilay ered
+Ġcleans ed
+Ġmuco epid
+Ġdisto angulation
+Ġpalis ade
+Ġguang xi
+Ġguang hua
+Ġcapac itance
+Ġcohere nt
+Ġprioritiz ed
+Ġdelib eration
+Ġdelib erately
+Ġpreponder ant
+Ġprolong ing
+Ġmyco plasma
+Ġevap oration
+Ġhousekee ping
+Ġbreastf eed
+Ġmcn amara
+Ġbioinform atic
+Ġperfluor ooc
+Ġpoliclin ico
+develop ment
+Ġembarr assment
+Ġmultis urface
+Ġmultis ensory
+Ġmultis lice
+Ġobtur ate
+Ġdestabil ization
+Ġexecution er
+Ġreshap ing
+Ġpolyvinyl pyrrolidone
+Ġmanoeuv res
+Ġosteoinduc tion
+Ġthermocoup les
+dmd patient
+ret inoin
+Ġthr ush
+Ġcatch ment
+Ġpent ecostal
+esign er
+Ġanastom osis
+Ġdict ated
+Ġdict ate
+atc gt
+Ġbud s
+Ġbag s
+Ġhus band
+Ġhop ed
+Ġhop eless
+Ġhope fully
+imon ian
+Ġforth coming
+Ġconvers ation
+Ġvo i
+Ġpret esting
+Ġtwenti es
+opal atine
+Ġiterative ly
+Ġcough ing
+Ġleak ages
+Ġsubpop ulations
+Ġunn atural
+Ġintel lectual
+Ġdeter rent
+Ġfinn gen
+Ġphil ip
+Ġstri ker
+Ġdiscour age
+Ġdiscour aging
+Ġjoh n
+Ġdiap hragm
+Ġconfid ential
+Ġworry ing
+Ġpractis ed
+Ġflaw less
+Ġhypoh idrosis
+Ġsensitis ation
+Ġrefresh er
+Ġrefresh ed
+Ġtoolk it
+Ġhyperparamet er
+Ġillum inated
+Ġorganis ational
+Ġhydrolys ate
+Ġdissimilar ity
+Ġtonsil s
+Ġcarcinogenic ity
+Ġcounterst ained
+Ġincompati ble
+Ġextrem ity
+Ġextrem ities
+Ġharb ors
+Ġsupervis ors
+Ġantec edents
+Ġantec edent
+Ġvictim ization
+Ġperpetr ators
+Ġembry onal
+Ġreassess ed
+Ġreassess ment
+Ġpyramid obacter
+Ġunavail able
+Ġunavail ability
+Ġcornerst one
+Ġperturb ed
+Ġisrael i
+encephal y
+88 8
+aag ag
+cor rect
+tct ag
+Ġtent ative
+Ġtack le
+Ġarous al
+Ġarous als
+Ġsant os
+Ġsir na
+Ġsir nas
+Ġped erson
+Ġpere s
+Ġwon kw
+Ġanc ient
+Ġanc illary
+Ġanh idrotic
+Ġfid ucial
+Ġfid elity
+Ġdere gulation
+Ġdend ritic
+Ġdend rogram
+Ġmere ly
+Ġmyl ohy
+Ġbab y
+Ġbab ies
+Ġbern ardo
+Ġeigen values
+Ġstrap s
+acg tgtc
+Ġgome z
+Ġasper gill
+Ġrick ets
+Ġrick etts
+Ġwhis kers
+Ġwhis ker
+Ġisot onic
+Ġisot retinoin
+Ġdeploy ed
+Ġdeploy ment
+Ġsha vings
+Ġshed s
+Ġshed ding
+Ġassimil ation
+Ġclas p
+Ġclas ps
+Ġclient ele
+Ġcoa uthors
+Ġindul ged
+Ġindul gence
+Ġcann ulation
+Ġhaw ley
+Ġobsc ured
+Ġrecon f
+Ġsubsc ale
+Ġsubsc ales
+Ġunl ock
+Ġyol o
+Ġyol ov
+irection ally
+Ġsucce ed
+Ġsucce eded
+Ġdece ased
+Ġdece mentation
+Ġnoncon ventional
+Ġspong i
+Ġspong y
+Ġjab al
+Ġjab our
+Ġgrant ing
+Ġdepapill ation
+Ġdepapill ated
+Ġunderdevelop ed
+Ġunderdevelop ment
+Ġzah ngetr
+Ġzah rani
+Ġinsec ts
+Ġinsec urity
+Ġglo ved
+Ġglo ves
+Ġescal ated
+Ġescal ating
+Ġredd y
+Ġredd ish
+Ġpolyp eptide
+Ġauthentic ated
+Ġctv ox
+Ġmutagen ic
+Ġskew ness
+Ġpurs ue
+Ġbarc odes
+Ġbarc oded
+Ġtransloc ated
+Ġhemim andibular
+Ġhemim andible
+Ġnanof ill
+Ġodontocl astic
+Ġodontocl asts
+Ġpropr ieties
+Ġpropr ioceptive
+Ġrevis ited
+Ġrevolution ized
+Ġkerat otic
+Ġkerat ocys
+Ġthorac ic
+Ġquarant ine
+Ġpleomorph ic
+Ġpleomorph ism
+Ġportug al
+Ġportug uese
+Ġnorthw est
+Ġnorthw estern
+Ġchromatic ity
+Ġneurop eptides
+Ġpericard ium
+Ġhyperchrom atism
+Ġteleradi ography
+Ġteleradi ographs
+Ġinterpol ation
+Ġneighbourhood s
+Ġmicha elis
+Ġsporad ic
+Ġsporad ically
+Ġdermat ological
+Ġadvertise ments
+Ġunderpin ning
+particip ants
+Ġellip se
+Ġhomozyg ous
+Ġhomozyg ote
+Ġlacun ar
+Ġlacun ae
+Ġoverwhel ming
+fur ther
+Ġty rosine
+Ġtam ba
+Ġay tan
+Ġatr ial
+Ġsab ur
+Ġsak uma
+Ġoint ment
+Ġophthal mologic
+enn ial
+Ġcac l
+Ġpbst g
+Ġws l
+Ġwrap ping
+Ġwinb ugs
+Ġinad vert
+Ġanamn esis
+Ġdq a
+Ġmv bf
+Ġmels en
+Ġbip olar
+Ġbisc uits
+Ġbah ri
+Ġbacill i
+Ġhof mann
+Ġeb sco
+Ġeub acterium
+Ġeuk aryotes
+itz ender
+Ġstew ardship
+ecy cline
+Ġlid ocaine
+Ġgust atory
+eto oth
+Ġconges tive
+Ġvacc ine
+Ġrestr ains
+Ġisoprop anol
+Ġchim era
+Ġchap ters
+Ġdepress ors
+Ġbypass ing
+Ġshutdown s
+Ġmaz zeh
+Ġapert ure
+Ġcohes ion
+percent age
+Ġhaus dor
+Ġobe id
+Ġaccred ited
+Ġnour ishment
+Ġnobel replace
+Ġabl ating
+Ġabus ers
+Ġunil aterally
+Ġunpro voked
+Ġintoler ance
+Ġkm no
+Ġkir celli
+Ġwein berg
+Ġenqu ired
+Ġsucc ession
+Ġark hangelsk
+Ġpharyng itis
+Ġcrypt ococcal
+Ġundec ided
+Ġspar ser
+Ġjiang su
+Ġcaret akers
+Ġmicropartic les
+Ġgrace y
+Ġserb ian
+Ġmonochrom atic
+Ġdraf ted
+Ġexplo ited
+Ġsmr rs
+Ġpotenti ating
+Ġpuls atility
+Ġslur ry
+Ġhypot ension
+Ġepoch s
+Ġredirec ting
+Ġcontrac ep
+Ġcrossl ink
+Ġrefus al
+Ġpolyg ons
+Ġpolycr ystalline
+Ġhabib zadeh
+Ġimmunocyt ochemistry
+Ġsynth ase
+Ġprecurs or
+Ġdelt oid
+Ġpursu ing
+Ġlipopolys accharides
+Ġwafer less
+Ġcollaps ibility
+Ġpenins ula
+Ġqi aprep
+Ġveter ans
+Ġportr ay
+Ġ196 4
+Ġentrap ment
+Ġcomprehens iveness
+Ġetiopath ogenesis
+Ġgaug es
+Ġlymphad enopathy
+Ġincompet ent
+Ġpolicym akers
+Ġreinser ted
+Ġbenj amini
+Ġpermut ational
+Ġquadr atic
+Ġsubstruct ures
+Ġterat ogenic
+Ġinga alp
+Ġscrut inized
+Ġscrip ts
+Ġmorbid ities
+Ġglucocortic oids
+Ġunpolymer ised
+Ġmotorcy cle
+Ġneuropsych iatric
+Ġtann erella
+Ġtunis ian
+Ġlaun ched
+Ġdeduc ed
+Ġintersti tial
+Ġmegapascal s
+Ġcertific ate
+Ġhaemost ats
+Ġperpet uate
+Ġbifurc ates
+Ġcoversl ip
+Ġparasit ology
+Ġraja ee
+Ġrepercussion s
+Ġunavoid able
+Ġglomerul osclerosis
+Ġpathophysi ology
+Ġhepato cellular
+Ġsapi enza
+Ġunrestor able
+Ġevapor ator
+Ġdislod ge
+Ġphilosoph y
+Ġubiquit ous
+Ġsidew ays
+Ġgyna ecological
+Ġcardiomy opathy
+Ġelectrocardi ogram
+Ġexhaustive ly
+Ġtrophozo ites
+Ġpemph igoid
+Ġnocic eptive
+Ġgingivect omy
+Ġjurisd ictions
+012 6
+bes ides
+cons istent
+disc ussion
+new c
+pediatric ians
+san jan
+vol tage
+zah n
+Ġug anda
+Ġibr ahim
+Ġton etti
+Ġtig ecycline
+Ġtrom s
+Ġtung sten
+Ġtensor flow
+Ġaar hus
+Ġavers ive
+Ġaxi ostar
+Ġauro cc
+Ġaudi ence
+Ġtham aseb
+Ġthrus ting
+oniphil us
+Ġtheob romine
+Ġsang on
+Ġsorb itol
+Ġcation ic
+Ġcased esigner
+Ġcenes thopathy
+Ġpup il
+Ġpall iative
+Ġpenc il
+Ġpept oniphilus
+Ġwro ught
+Ġworm s
+Ġwag staff
+Ġinel igible
+Ġinven tions
+Ġanis otropic
+Ġanov as
+Ġanorec tic
+Ġfdl c
+Ġfern andez
+Ġfests itzender
+Ġdit ched
+Ġdun n
+Ġdir t
+Ġdign ity
+Ġders imonian
+Ġdull ed
+Ġdak j
+Ġdaps one
+Ġdodec yl
+Ġmant el
+Ġmies cher
+Ġmans oura
+Ġmamm alian
+Ġmieth ke
+Ġandro gens
+Ġbure au
+Ġbug base
+Ġblu etooth
+Ġberg en
+Ġburo ta
+Ġbatter y
+Ġreap plied
+Ġreint ubation
+Ġreabs orption
+Ġreattach ment
+Ġtohok u
+Ġhare i
+Ġhither to
+Ġhang s
+Ġhidal go
+Ġeich ner
+Ġeug enol
+Ġeuthan ized
+Ġstair case
+Ġstagn ation
+Ġstoich iometric
+Ġlute us
+Ġlair d
+Ġnvid ia
+Ġnult y
+Ġnbr m
+Ġnord ic
+Ġnomen clature
+Ġnucl isens
+Ġgorm an
+Ġgnas hing
+Ġgera is
+Ġghan a
+Ġgerald o
+Ġgimene z
+Ġasyn chron
+Ġasmt l
+Ġconclus ively
+oduoden ectomy
+Ġonye aso
+Ġvoc ational
+Ġvasc ulature
+Ġalta ir
+Ġperinucle ar
+Ġperiles ional
+Ġriv as
+Ġraf sanjan
+Ġextir pation
+Ġresili ence
+Ġresettle ment
+trache al
+Ġimiqu imod
+Ġistit uto
+Ġistan bul
+Ġchemic o
+Ġchulalongk orn
+Ġdephosph ory
+Ġdequal inium
+Ġprecon dition
+Ġpretes ted
+Ġpreocc up
+Ġacanth osis
+Ġcompost ela
+Ġdisulf ide
+Ġsepha rose
+Ġshout ing
+Ġadvers ities
+Ġadela ide
+Ġclarith romycin
+Ġtwelf th
+Ġscrol ling
+Ġscall oped
+Ġsciss ors
+Ġscou trace
+Ġperiimpl antitis
+Ġcofact ors
+Ġindocy anine
+Ġparacase i
+Ġplough ing
+Ġplatin um
+Ġrostr al
+Ġroset te
+Ġregress ed
+Ġaccustom ed
+Ġpragm atic
+Ġaborig inal
+Ġsubnas ale
+Ġsubanal ysis
+Ġsublux ation
+Ġsubepid ermal
+Ġintercor relations
+Ġintertrabec ular
+Ġafterno on
+Ġquart z
+Ġunins ured
+Ġunwor n
+Ġunpre cedented
+Ġunplan ned
+Ġunstand ardized
+Ġuninter rupted
+Ġunqual ified
+Ġunattach ed
+Ġamput ation
+Ġammon ium
+Ġkyush u
+Ġklebs iella
+Ġkaygis iz
+Ġweerhe ijm
+Ġfollic le
+Ġgenban k
+Ġmediter ranean
+Ġphobi as
+Ġphocae icola
+Ġoverhe ating
+Ġmolybden um
+Ġcolumb ia
+Ġtimeatr isk
+Ġdeciph er
+Ġdecortic ation
+Ġcribr iform
+Ġsecoster oid
+Ġagencour t
+Ġundeni ably
+Ġnumberof newc
+Ġmanches ter
+Ġmanpow er
+Ġnonadj acent
+Ġnoninstitution alized
+Ġnoninstru mented
+Ġspastic ity
+Ġedemat ous
+Ġmicrofr actures
+Ġmicroelect rode
+Ġmicrovess el
+Ġminnes ota
+Ġmalasse zia
+Ġdiacet ate
+Ġgriff ith
+Ġsalicyl ate
+Ġunderne ath
+Ġunderachie ving
+Ġimprac tical
+Ġpostbiotic s
+Ġmonob ond
+Ġmonof ilament
+Ġintrins ically
+Ġintraper itone
+Ġzuan ba
+Ġworris ome
+Ġmouthrins es
+Ġantide pressants
+Ġantiret roviral
+Ġpeopl es
+Ġdaej eon
+Ġslimm er
+Ġangelier i
+Ġfekon ja
+Ġmatrig el
+Ġepiinf o
+Ġcapnocyt ophaga
+Ġprovinc ial
+Ġhumming bird
+Ġurokin ase
+Ġautoflu orescent
+Ġlightwal ker
+Ġsuperoin ferior
+Ġimmunomod ulatory
+Ġpermangan ate
+Ġmengh ini
+Ġeffavi renz
+Ġsynops is
+Ġexpatri ates
+Ġstigm atis
+Ġairtig ht
+Ġairscal er
+Ġfibromy algia
+Ġabohab ib
+Ġproteoglyc ans
+Ġhypothyroid ism
+Ġhyperprolif eration
+Ġhypertriglycer idemia
+Ġbiomonit oring
+Ġvironos tika
+Ġpsychophys iological
+Ġcementobl asts
+Ġphotoin itiators
+Ġacroderm atitis
+Ġcodiagnos tix
+Ġzirkon zahn
+Ġseeberg er
+Ġgeometr ies
+Ġqiac ube
+Ġmarria ges
+Ġcopenh agen
+Ġnanomater ials
+Ġmisrec orded
+Ġsahar an
+Ġcarboxymethyl cellulose
+Ġeuroba rometer
+Ġmicafung in
+Ġglyca emic
+Ġbioeth ics
+Ġbioavail ability
+Ġcshc n
+Ġaggrec ans
+Ġcrystallin ity
+Ġmadagasc ar
+Ġdgzm k
+Ġelectroma gnetic
+Ġsoutheas tern
+Ġpermselec tivity
+Ġunsurpr ising
+Ġmombell i
+Ġoutstand ing
+Ġbiconca ve
+Ġmelanoac anthoma
+Ġbandwid th
+Ġhujo el
+Ġneurotrans m
+Ġextracorpore al
+Ġhypotrich osis
+Ġmesseng er
+20358 0
+Ġsubdiagnos es
+Ġenteropathic a
+Ġfuzz y
+Ġoverdispers ion
+Ġkaryorrh ectic
+Ġdiclof enac
+Ġovsen ik
+Ġnoncoll agenous
+Ġnoncommun icable
+Ġpsychiatr ist
+Ġcocamidoprop yl
+Ġkarlskron a
+Ġmichelinak is
+Ġectodysplas in
+Ġdisgusting ness
+Ġbenzalkon ium
+Ġmucoepid ermoid
+Ġperfluorooc t
+Ġwonkw ang
+Ġmylohy oid
+Ġaspergill us
+Ġzahngetr agener
+Ġkeratocys ts
+Ġinadvert ently
+Ġhausdor ff
+Ġasynchron ism
+" ;
+" ?
+, ,
+, ;
+0 15
+0 11
+0 14
+0 80
+0 25
+0 86
+0 99
+1 7
+1 89
+1 47
+2 16
+2 15
+2 13
+2 12
+2 18
+2 14
+2 90
+2 100
+2 85
+3 75
+3 60
+3 45
+3 500
+3 40
+3 42
+4 3
+4 8
+4 9
+4 18
+4 38
+4 32
+4 40
+4 24
+5 2
+5 000
+5 50
+5 74
+5 79
+5 99
+6 2
+6 50
+6 23
+6 20
+6 14
+6 19
+6 60
+6 80
+6 25
+6 30
+7 70
+7 23
+7 80
+7 26
+7 600
+8 16
+8 10
+8 12
+8 70
+8 81
+8 76
+8 27
+8 42
+8 72
+9 00
+9 60
+9 46
+9 31
+9 71
+9 48
+? ",
+a er
+a at
+a im
+a ud
+a un
+a am
+a uc
+a ip
+a vid
+a ery
+a ural
+a verage
+a ise
+a ires
+a ros
+a uter
+a he
+a era
+a udal
+a pless
+a rophobia
+b c
+b h
+b n
+b in
+b on
+b as
+b ro
+b om
+b ut
+b ies
+b able
+b ach
+b all
+b ss
+b ox
+b ne
+b ang
+b ody
+b bl
+b mi
+b ella
+b umin
+b enz
+b idden
+b iguous
+b agy
+c d
+c k
+c n
+c v
+c z
+c is
+c ar
+c ur
+c ad
+c ut
+c ub
+c end
+c ally
+c ay
+c all
+c ct
+c iss
+c onstr
+c anti
+c ogn
+c ken
+c restal
+c ica
+c oses
+c ostal
+c idyl
+c ommun
+c ollective
+c agct
+d f
+d w
+d y
+d z
+d ac
+d et
+d ated
+d ia
+d ong
+d ans
+d les
+d na
+d omen
+d ri
+d ma
+d uring
+d ynamic
+d ened
+d ler
+d irect
+d ca
+d isciplinary
+d irec
+d eep
+d isability
+d imethyl
+e a
+e an
+e ological
+e br
+e vic
+e ier
+e faction
+e ye
+e bi
+e tium
+e ij
+e zi
+e vo
+e elis
+e bert
+e bacterium
+f c
+f h
+f el
+f ir
+f ical
+f ap
+f em
+f ia
+f ine
+f ari
+f ting
+f all
+f ile
+f lu
+f ak
+f its
+f idence
+f av
+f ins
+f ism
+f itt
+f asc
+f cs
+f ighting
+f ilt
+f ident
+f requ
+f inally
+f orest
+f lective
+f omycin
+f luoride
+g y
+g er
+g it
+g ment
+g ot
+g ant
+g ut
+g rom
+g ers
+g age
+g ell
+g ene
+g man
+g ets
+g reg
+g ling
+g he
+g tt
+g ingival
+g ae
+g lass
+g ulatory
+g ctg
+g ativity
+g tgtc
+g ctcc
+g hani
+h m
+h ed
+h or
+h le
+h ot
+h ad
+h igh
+h um
+h og
+h ary
+h ine
+h ist
+h ens
+h ak
+h ort
+h art
+h oid
+h man
+h ism
+h ensive
+h ner
+h ina
+h ole
+h ydr
+h inol
+h att
+h ime
+h ift
+h tar
+h ubba
+h hal
+h uda
+i ut
+i enti
+i ase
+i ens
+i ace
+i itis
+i oma
+i rop
+i ography
+i atives
+i ogl
+i olabial
+i ologist
+i eller
+j c
+j i
+j n
+j in
+j ab
+j ad
+j ust
+j ith
+j acent
+j eni
+j evic
+k g
+k j
+k o
+k x
+k as
+k et
+k ine
+k ill
+k str
+k all
+k ines
+k ier
+k ind
+k ok
+k ert
+k rus
+k han
+k no
+k eep
+k eted
+k oseal
+k aryotes
+k auer
+k ransky
+k fb
+k hah
+l k
+l n
+l le
+l ot
+l ut
+l og
+l ia
+l ative
+l oss
+l ord
+l io
+l isted
+l az
+l agen
+l icate
+l icular
+l isation
+l ighting
+l ades
+l actic
+l ospor
+l ady
+l ipidemia
+l aq
+l bert
+m c
+m l
+m r
+m w
+m at
+m om
+m et
+m ol
+m ut
+m ies
+m ap
+m op
+m em
+m st
+m ild
+m ans
+m ile
+m icro
+m ail
+m ined
+m int
+m acy
+m atic
+m ium
+m ified
+m other
+m ri
+m itis
+m ma
+m pa
+m orb
+m ask
+m itus
+m dsc
+m mp
+m osaic
+m etal
+m poral
+m acg
+m eters
+m strom
+m bow
+m acher
+n m
+n on
+n en
+n an
+n ge
+n ut
+n ical
+n oc
+n ine
+n ist
+n our
+n ick
+n oid
+n ma
+n iotic
+n eling
+n ino
+n itus
+n umer
+n atally
+n uclear
+o es
+o ic
+o ar
+o ly
+o ab
+o uc
+o qu
+o op
+o vel
+o amin
+o vic
+o ins
+o ining
+o ai
+o tics
+o immune
+o plasm
+o ara
+o trans
+o zyme
+o economics
+o plasma
+o enzyme
+o cele
+o oxygenase
+p g
+p m
+p ti
+p as
+p om
+p ts
+p ain
+p pl
+p able
+p ine
+p ost
+p ds
+p ace
+p ines
+p etic
+p aren
+p ool
+p ful
+p ator
+p ping
+p ocl
+p ina
+p itus
+p ole
+p dt
+p tics
+p uscular
+p ubertal
+p illover
+p ilot
+p uni
+p apers
+q c
+q s
+q er
+r c
+r x
+r ion
+r ad
+r ies
+r ain
+r and
+r ull
+r ct
+r ag
+r ak
+r action
+r int
+r aw
+r ically
+r itt
+r uous
+r ontal
+r amine
+r atch
+r ange
+r ams
+r atable
+r mined
+s al
+s es
+s ar
+s ec
+s ter
+s up
+s ity
+s ors
+s ied
+s ix
+s amin
+s ag
+s ins
+s thetic
+s ung
+s olution
+s ters
+s angu
+s chool
+s how
+s urgical
+s her
+s avir
+s uch
+s uccessful
+s ka
+s essive
+s leep
+s iloxane
+s uda
+s ubjec
+s atisfied
+s thesia
+s pillover
+t p
+t at
+t ud
+t ol
+t ase
+t eeth
+t cc
+t ages
+t led
+t ene
+t ten
+t echn
+t ob
+t aw
+t ographic
+t etr
+t own
+t ection
+t uk
+t gf
+t ella
+t aper
+t rophic
+t ata
+t zi
+t ats
+t inen
+t rophobia
+t fap
+u i
+u o
+u os
+u ine
+u ke
+u ating
+u ade
+u til
+u ising
+u rolog
+u zz
+u fficiency
+u elle
+u quer
+u lectomy
+u mental
+u iller
+v d
+v s
+v y
+v on
+v an
+v ac
+v ad
+v ies
+v ate
+v oth
+v und
+v amin
+v ail
+v ability
+v ism
+v ival
+v isions
+v estib
+v sky
+v anic
+w b
+w k
+w o
+w er
+w ad
+w ip
+w est
+w ari
+w end
+w ser
+w ould
+w ak
+w ood
+w he
+w can
+w ares
+w ij
+w elled
+w elve
+w abs
+w elly
+x l
+x s
+x ies
+x ia
+x ine
+x ication
+x ner
+x erost
+x tg
+y k
+y z
+y as
+y ro
+y ear
+y mo
+y ric
+y ness
+y co
+y to
+y cle
+y go
+y roc
+y back
+y ema
+y ria
+y att
+y lectomy
+y ttr
+y tten
+z al
+z ed
+z an
+z ur
+z if
+z ol
+z ated
+z ers
+z ari
+z led
+z yn
+z he
+z ale
+z han
+z aws
+z array
+z epam
+z ko
+z yk
+Ġ ull
+Ġ ental
+Ġ ict
+Ġ umb
+Ġt d
+Ġt x
+Ġt ec
+Ġt id
+Ġt uc
+Ġt ir
+Ġt ph
+Ġt aus
+Ġt esti
+Ġt pt
+Ġt amm
+Ġt ick
+Ġt onic
+Ġt ne
+Ġt edi
+Ġt ires
+Ġt reg
+Ġt pa
+Ġt elling
+Ġt cs
+Ġt abol
+Ġt ads
+Ġt asting
+Ġt akers
+Ġt iff
+Ġt ntp
+in y
+in er
+in ic
+in ig
+in ib
+in op
+in val
+in ition
+in ell
+in ch
+in iti
+in ide
+in clusion
+in atory
+in ities
+in ately
+in ised
+in ished
+in erg
+in ators
+in ction
+in tention
+in isation
+in omatous
+in ii
+in avir
+in opathy
+in ositol
+Ġa in
+Ġa as
+Ġa it
+Ġa qu
+Ġa vi
+Ġa ok
+Ġa head
+Ġa wa
+Ġa att
+Ġa ky
+Ġa unt
+Ġa leg
+Ġa kin
+Ġa acgtgtc
+Ġa jith
+re a
+re b
+re r
+re y
+re as
+re um
+re ased
+re gn
+re te
+re ogen
+re yg
+re tentive
+re porting
+re ports
+re valence
+Ġth igh
+Ġth ia
+Ġth ong
+Ġth ric
+Ġth ym
+Ġth ie
+Ġth urs
+Ġth rust
+Ġth iaz
+Ġth war
+Ġth ammas
+on j
+on en
+on et
+on id
+on ut
+on ality
+on ium
+on yl
+on itis
+on oid
+on atal
+on ically
+on iasis
+on key
+on tium
+on otic
+on nected
+on za
+on anoic
+on version
+on itrile
+on vuls
+on bach
+Ġthe at
+Ġthe or
+Ġthe ft
+Ġthe si
+Ġthe ses
+Ġs g
+Ġs j
+Ġs q
+Ġs x
+Ġs om
+Ġs ip
+Ġs ell
+Ġs ong
+Ġs ill
+Ġs ple
+Ġs pro
+Ġs olar
+Ġs ures
+Ġs ke
+Ġs its
+Ġs oss
+Ġs arg
+Ġs ledge
+Ġs ade
+Ġs anc
+Ġs ains
+Ġs ier
+Ġs ays
+Ġs ending
+Ġs ider
+Ġs ender
+Ġs aph
+Ġs agl
+Ġs ift
+Ġs anta
+Ġs omn
+Ġs orbent
+Ġs gar
+Ġs vert
+Ġs ongk
+Ġs vy
+ti ly
+ti ps
+ti go
+ti bility
+ti fication
+ti gate
+ti omeatal
+ti bacterium
+ti fical
+ti vism
+Ġo en
+Ġo ed
+Ġo is
+Ġo ud
+Ġo ce
+Ġo ment
+Ġo ch
+Ġo ug
+Ġo so
+Ġo tis
+Ġo ds
+Ġo tor
+Ġo ily
+Ġo ks
+Ġo clusal
+Ġo kr
+Ġo ecd
+en o
+en u
+en en
+en ot
+en ib
+en tive
+en ich
+en ch
+en ets
+en idine
+en iable
+en cher
+en otypic
+en kr
+en juan
+al a
+al z
+al en
+al ted
+al act
+al ition
+al ance
+al so
+al king
+al ene
+al ization
+al ane
+al ty
+al arm
+al cohol
+al ibration
+al ways
+al ysis
+al usia
+al nutrition
+al aj
+al ypt
+al gesic
+al bumin
+al vanic
+er k
+er an
+er ig
+er ati
+er ology
+er ational
+er red
+er vation
+er ogenic
+er nec
+er ogram
+er ra
+er tia
+er jian
+er board
+er hensive
+er wood
+er tification
+Ġc ed
+Ġc ul
+Ġc im
+Ġc ati
+Ġc ib
+Ġc age
+Ġc ary
+Ġc vi
+Ġc ull
+Ġc enti
+Ġc ay
+Ġc yp
+Ġc ures
+Ġc ct
+Ġc ages
+Ġc ak
+Ġc ust
+Ġc ps
+Ġc cp
+Ġc ili
+Ġc akes
+Ġc ze
+Ġc eng
+Ġc atia
+Ġc abin
+ed s
+ed le
+ed ation
+ed uc
+ed ence
+ed ication
+ed ler
+ed odontists
+Ġp im
+Ġp ly
+Ġp uc
+Ġp ine
+Ġp ich
+Ġp ens
+Ġp ile
+Ġp ace
+Ġp ms
+Ġp br
+Ġp unc
+Ġp ust
+Ġp av
+Ġp cp
+Ġp itted
+Ġp bi
+Ġp iment
+Ġp antom
+Ġp asted
+Ġp aves
+Ġp ctc
+Ġw k
+Ġw in
+Ġw an
+Ġw ic
+Ġw ol
+Ġw are
+Ġw op
+Ġw age
+Ġw ong
+Ġw ins
+Ġw ets
+Ġw isc
+Ġw inter
+Ġw aters
+Ġw onder
+Ġw ander
+Ġw person
+Ġw bc
+Ġw enjuan
+Ġw ernec
+Ġin at
+Ġin gr
+Ġin ns
+Ġin wards
+Ġin bre
+Ġin opress
+Ġin anim
+Ġin icell
+Ġin ositol
+Ġin built
+Ġin iatives
+Ġin ertia
+es tic
+es tr
+es em
+es cent
+es hip
+es cal
+es co
+es tration
+es min
+Ġan tis
+Ġan ym
+Ġan aphyl
+Ġan abolic
+Ġan eg
+Ġan war
+Ġan encephaly
+Ġf om
+Ġf ess
+Ġf are
+Ġf ay
+Ġf ared
+Ġf ire
+Ġf ond
+Ġf les
+Ġf ages
+Ġf ade
+Ġf sts
+Ġf ps
+Ġf ont
+Ġf fe
+Ġf ishing
+Ġf tm
+Ġf ighting
+Ġf ellow
+Ġf hi
+Ġf ascial
+Ġf iro
+Ġf eces
+Ġf xa
+Ġf umar
+Ġf uchs
+Ġf iji
+Ġf esem
+Ġd x
+Ġd in
+Ġd ar
+Ġd ies
+Ġd ib
+Ġd ell
+Ġd ong
+Ġd ome
+Ġd ass
+Ġd ile
+Ġd te
+Ġd ds
+Ġd ough
+Ġd ines
+Ġd elf
+Ġd aren
+Ġd read
+Ġd de
+Ġd pi
+Ġd nas
+Ġd hs
+Ġd ipping
+Ġd zz
+Ġd icalcium
+Ġd ako
+Ġd ammas
+Ġd ntp
+Ġm k
+Ġm z
+Ġm ing
+Ġm ab
+Ġm up
+Ġm ot
+Ġm um
+Ġm ari
+Ġm ong
+Ġm ug
+Ġm ct
+Ġm esti
+Ġm ack
+Ġm te
+Ġm tor
+Ġm ll
+Ġm oss
+Ġm ort
+Ġm eral
+Ġm itis
+Ġm isc
+Ġm uk
+Ġm ission
+Ġm ams
+Ġm ocking
+Ġm ogh
+at y
+at ti
+at th
+at le
+at ul
+at un
+at ell
+at rol
+at ct
+at ered
+at tem
+at tain
+at te
+at ox
+at to
+at ov
+at ry
+at tg
+at acc
+at ada
+at urity
+at cat
+at rans
+at urations
+or is
+or ize
+or ations
+or ans
+or ting
+or ized
+or ological
+or ough
+or ily
+or af
+or anes
+or row
+or lin
+or rec
+th a
+th s
+th en
+th at
+th ro
+th ion
+th rom
+th em
+th est
+th one
+th ose
+th ym
+th mia
+th ora
+th enia
+th ritol
+th ickness
+an in
+an ent
+an ing
+an ly
+an ate
+an ial
+an ide
+an gth
+an ization
+an terior
+an gi
+an yl
+an imal
+an ins
+an ella
+an ians
+an ik
+an idium
+an illa
+an zhou
+an uclear
+Ġand ersson
+Ġand ean
+Ġand reas
+Ġand alusia
+Ġb n
+Ġb ion
+Ġb ore
+Ġb ull
+Ġb ach
+Ġb ans
+Ġb cc
+Ġb ak
+Ġb ish
+Ġb ough
+Ġb gi
+Ġb ros
+Ġb ae
+Ġb ama
+Ġb omb
+Ġb wa
+Ġb han
+Ġb dx
+Ġb udd
+Ġb aker
+Ġb ogg
+Ġb inge
+Ġb ird
+Ġb irc
+Ġb km
+Ġb arium
+is n
+is en
+is er
+is ce
+is el
+is trib
+is eness
+is econd
+is lative
+is oara
+as or
+as om
+as ter
+as tr
+as ad
+as ia
+as tal
+as ized
+as hes
+as ured
+as ters
+as omal
+as pha
+as urable
+as aj
+as thenia
+ent ation
+ent ritt
+ent erology
+ic on
+ic uc
+ic ke
+ic acy
+ic ator
+ic ides
+ic ules
+ic iting
+ic ella
+ic ellular
+ic atively
+ing er
+ing ed
+ing osine
+ing aki
+ro e
+ro in
+ro le
+ro sion
+ro cent
+ro sed
+ro va
+ro ids
+ro scopic
+ro scope
+ro aches
+ro best
+ro version
+ro gating
+ro test
+ro benz
+ro tene
+ar al
+ar at
+ar or
+ar us
+ar im
+ar ity
+ar ate
+ar ach
+ar ater
+ar te
+ar cin
+ar ns
+ar ina
+ar son
+ar affin
+ar zi
+ar ani
+ar fism
+Ġre y
+Ġre up
+Ġre ut
+Ġre fere
+Ġre op
+Ġre vel
+Ġre its
+Ġre though
+Ġre lying
+Ġre pre
+Ġre organ
+Ġre bal
+Ġre hard
+Ġre amed
+Ġre introduc
+Ġre introduction
+Ġre versal
+Ġre forms
+Ġre using
+Ġre activated
+Ġre analy
+Ġre venue
+Ġre weighted
+Ġre infection
+Ġre bec
+Ġre nton
+Ġre classified
+Ġre built
+Ġre zif
+Ġto e
+Ġto t
+Ġto es
+Ġto ul
+Ġto ly
+Ġto ur
+Ġto ile
+Ġto ms
+Ġto ss
+Ġto sc
+Ġto ffee
+Ġto la
+Ġto lbert
+Ġh ud
+Ġh ts
+Ġh un
+Ġh ers
+Ġh ull
+Ġh ue
+Ġh ill
+Ġh ans
+Ġh ass
+Ġh ide
+Ġh mo
+Ġh ack
+Ġh ood
+Ġh ob
+Ġh omet
+Ġh ics
+Ġh omic
+Ġh och
+Ġh oh
+Ġh ca
+Ġh igg
+Ġh ilt
+Ġh mp
+Ġh iding
+Ġh itting
+Ġh att
+Ġh amp
+Ġh ams
+Ġh unt
+Ġh eners
+Ġh ilum
+Ġh eck
+Ġh ansen
+Ġh ermann
+Ġh ickman
+Ġh ench
+le es
+le ment
+le tic
+le ted
+le ver
+le igh
+le ther
+le wa
+le ash
+le aved
+le thal
+le ander
+le idom
+le welly
+le arns
+Ġe un
+Ġe uc
+Ġe ys
+Ġe ber
+Ġe jec
+Ġe ust
+Ġe af
+Ġe bmt
+Ġe ik
+Ġe hu
+Ġe iff
+Ġe uv
+it in
+it ant
+it ous
+it ee
+it ors
+it onal
+it rix
+it ters
+it ra
+it ope
+it ories
+it onin
+it arian
+it rea
+it robenz
+us ins
+us iveness
+us awa
+us ceptive
+us uke
+ation ary
+ation ality
+Ġst d
+Ġst z
+Ġst ent
+Ġst ur
+Ġst ati
+Ġst ab
+Ġst um
+Ġst rom
+Ġst ee
+Ġst ance
+Ġst atis
+Ġst ood
+Ġst aw
+Ġst yl
+Ġst arch
+Ġst och
+Ġst acks
+Ġst amp
+Ġst agg
+Ġst oll
+Ġst uates
+Ġst rapped
+Ġst yrene
+Ġst uck
+Ġst ahl
+Ġst adium
+Ġst omma
+Ġst alking
+Ġst ationary
+ere ther
+ere br
+ere ogeneity
+ere nce
+ere bell
+ere sthesia
+ul is
+ul ent
+ul os
+ul ding
+ul se
+ul ants
+ul pt
+ul ins
+ul man
+ul gg
+ul ograms
+ul opathy
+ul ana
+ul gar
+ul anic
+ul omegal
+ac i
+ac id
+ac ile
+ac ct
+ac ities
+ac ode
+ac att
+ac agg
+ac alc
+ac gt
+ac aine
+ac itating
+ac ctg
+ac uated
+ac aca
+ac gga
+ac agtt
+ve a
+ve y
+ve ments
+ve ct
+ve itis
+ve fl
+ec ity
+ec ess
+ec ke
+ec aps
+ec otomy
+ec tious
+ec osystem
+ec anoic
+ec ourse
+Ġl v
+Ġl il
+Ġl uc
+Ġl iz
+Ġl ore
+Ġl op
+Ġl end
+Ġl ug
+Ġl ied
+Ġl iti
+Ġl uted
+Ġl ang
+Ġl inc
+Ġl ighted
+Ġl anes
+Ġl ca
+Ġl umb
+Ġl au
+Ġl ively
+Ġl ange
+Ġl actic
+Ġl ai
+Ġl umin
+Ġl enet
+Ġl arynx
+Ġl aryng
+Ġl ira
+Ġl mu
+Ġl uck
+Ġl ighter
+Ġl enn
+Ġl apa
+Ġl alla
+Ġl aryngo
+Ġl onza
+Ġl anzhou
+Ġl arson
+Ġl lewelly
+om i
+om s
+om ad
+om ers
+om ach
+om ass
+om ized
+om ian
+om inal
+om gro
+om eric
+om ography
+om ogenous
+om otor
+om edic
+om edics
+om pet
+om acs
+om strand
+om ouc
+om oniasis
+Ġn k
+Ġn n
+Ġn ul
+Ġn id
+Ġn ip
+Ġn ance
+Ġn ag
+Ġn ets
+Ġn irm
+Ġn ih
+Ġn az
+Ġn air
+Ġn ops
+Ġn emat
+Ġn emen
+Ġn chs
+Ġn alc
+Ġn lr
+Ġn lk
+Ġn enets
+im at
+im it
+im id
+im ate
+im ary
+im atic
+im ately
+im ental
+im ony
+im ara
+im edes
+im etrically
+Ġg is
+Ġg ur
+Ġg and
+Ġg ase
+Ġg yp
+Ġg ak
+Ġg br
+Ġg ha
+Ġg ics
+Ġg ilm
+Ġg ets
+Ġg pa
+Ġg iver
+Ġg athers
+Ġg tex
+Ġg ams
+Ġg arc
+Ġg soft
+Ġg arth
+Ġg gt
+Ġg izan
+Ġg alp
+Ġg ogg
+Ġg emt
+Ġg avage
+Ġg sk
+Ġg assed
+Ġg estation
+Ġg illing
+Ġg ecs
+Ġg arn
+Ġg dna
+Ġg inig
+Ġg alvanic
+Ġg atto
+ly l
+ly tics
+ly cidyl
+ur n
+ur y
+ur in
+ur ip
+ur sion
+ur ved
+ur ist
+ur ization
+ur ational
+ur ities
+ur ably
+ur ino
+ur oradi
+ur vey
+ig y
+ig an
+ig us
+ig ating
+ig ms
+ig ently
+ig ibility
+ig ung
+ig rants
+ig ara
+ig rams
+ig erence
+Ġwi en
+Ġwi red
+Ġwi fe
+Ġwi ped
+Ġwi pes
+Ġwith st
+Ġwith hol
+ud ent
+ud os
+ud all
+ud ication
+ud io
+ud arzi
+et z
+et ment
+et les
+et ect
+et abol
+et tes
+et een
+et ano
+et gee
+et uses
+os it
+os il
+os ted
+os ion
+os pl
+os ome
+os itive
+os yn
+os yl
+os itis
+os pital
+os omatic
+os ra
+os ci
+os etting
+os ample
+os trip
+os pore
+os pas
+os arcin
+ce ived
+ce mented
+ce gen
+Ġwas hes
+Ġwas for
+Ġwas filt
+if e
+if i
+if al
+if lu
+if fer
+if ference
+if fs
+if ert
+if ei
+if eng
+if ferenti
+if lora
+Ġfor a
+Ġfor k
+Ġfor amin
+Ġfor gone
+Ġfor get
+Ġfor bidden
+Ġfor got
+ol f
+ol ent
+ol am
+ol um
+ol ved
+ol ian
+ol ta
+ol uted
+ol ism
+ol ishing
+ol ense
+ol opl
+ol isation
+ol au
+ol actic
+ol anton
+Ġas ex
+Ġas ians
+Ġas ah
+Ġas crib
+Ġas ton
+Ġas ai
+Ġas phy
+Ġas accha
+Ġas vs
+Ġas xl
+il on
+il er
+il ent
+il un
+il ant
+il ical
+il ate
+il ution
+il ane
+il ator
+il ty
+il ink
+il arily
+il ton
+il tering
+il nius
+Ġcon qu
+Ġcon val
+Ġcon ner
+Ġcon formation
+Ġcon clusive
+Ġcon index
+od al
+od ied
+od ds
+od ities
+od ox
+od ental
+od ih
+od els
+od ialysis
+od ians
+od iver
+od yst
+od ulatory
+od iaz
+id u
+id en
+id ol
+id el
+id ia
+id ist
+id ans
+id ered
+id onic
+id ou
+id az
+id adian
+id dens
+id gman
+id igung
+ow a
+ow ard
+ow ski
+Ġon o
+Ġon ych
+Ġon lay
+ment able
+ati f
+ati m
+ati es
+ati tic
+ati um
+ati ens
+ati fied
+ati fying
+ts total
+ts uki
+ts aun
+Ġor fs
+Ġor ino
+Ġor tiz
+Ġor chi
+Ġor top
+Ġor icell
+Ġor lady
+Ġor tob
+ab e
+ab adi
+ab etic
+ab ella
+ab ras
+ab owski
+un en
+un ic
+un ate
+un ba
+un oglu
+Ġstud i
+am as
+am ong
+am ities
+am ps
+am ping
+am ides
+am eric
+am aged
+am ella
+am ura
+am ora
+am bled
+am biguous
+am anik
+am abe
+tic ut
+tic ism
+tic eship
+Ġv ial
+Ġv and
+Ġv se
+Ġv ied
+Ġv olog
+Ġv ak
+Ġv ie
+Ġv gi
+Ġv oid
+Ġv to
+Ġv inc
+Ġv oy
+Ġv bm
+Ġv omer
+Ġv ime
+Ġv ocation
+Ġv gm
+Ġv yas
+Ġv ulgar
+Ġv ilnius
+res orbable
+res thesia
+res tha
+el ed
+el es
+el ion
+el and
+el ocol
+el man
+el ung
+el let
+el oad
+el ometry
+el ker
+el kv
+el sson
+el nick
+el igibility
+ter al
+ter ia
+ter ix
+ter ols
+ter inen
+up id
+up ilar
+up illary
+up uncture
+Ġal ow
+Ġal are
+Ġal ia
+Ġal ph
+Ġal ha
+Ġal dr
+Ġal ask
+Ġal iment
+Ġal sa
+Ġal oud
+Ġal sh
+Ġal dehy
+Ġal moh
+Ġal har
+Ġal car
+Ġal huda
+Ġal qer
+Ġal zhe
+Ġper ch
+Ġper ple
+Ġper fer
+Ġper uan
+Ġper acetic
+Ġper mount
+Ġr x
+Ġr ud
+Ġr if
+Ġr id
+Ġr uc
+Ġr ain
+Ġr ist
+Ġr ond
+Ġr ized
+Ġr uth
+Ġr br
+Ġr hes
+Ġr ne
+Ġr itt
+Ġr ayed
+Ġr dr
+Ġr umination
+Ġr stud
+Ġr onald
+Ġr agas
+Ġr gb
+Ġr uling
+Ġr ungs
+Ġr uos
+Ġr icuc
+Ġr arity
+Ġr ationality
+Ġwh ine
+Ġwh ipl
+Ġwh eezing
+Ġwh alen
+Ġex e
+Ġex port
+Ġex pects
+Ġex iting
+Ġex oph
+Ġex changed
+Ġex porting
+Ġex ostar
+Ġex oenzyme
+Ġex sangu
+ge an
+ge ber
+ge ym
+ge me
+ge mia
+Ġpro qu
+Ġpro form
+Ġpro hib
+Ġpro ps
+Ġpro line
+Ġpro plan
+Ġpro dig
+Ġpro karyotes
+Ġpro xies
+Ġres ver
+Ġres ort
+Ġres uture
+Ġres az
+Ġres ists
+Ġres izes
+Ġres pects
+Ġres urg
+Ġres ampling
+Ġres truct
+Ġres erved
+Ġres ample
+Ġres erves
+Ġres ecting
+Ġres ective
+Ġres erving
+Ġbe er
+Ġbe ech
+Ġbe ak
+Ġbe he
+Ġbe gg
+Ġbe aut
+Ġbe zm
+Ġbe aty
+Ġbe etles
+ion ine
+ion ix
+ion izing
+ion ibacterium
+uc ch
+uc onazole
+uc cally
+uc eno
+Ġthat the
+Ġcom a
+Ġcom is
+Ġcom itee
+tr up
+tr ad
+tr ical
+tr um
+tr ics
+tr acted
+tr imethyl
+ot as
+ot ate
+ot ally
+ot ons
+ot ency
+ot ool
+ot land
+ot eness
+ot als
+ot onin
+ot ocin
+ot trup
+Ġim b
+Ġim am
+Ġim por
+Ġim ip
+Ġim ark
+Ġim position
+Ġim press
+Ġim pressed
+Ġim ani
+Ġim idaz
+Ġis por
+Ġis of
+Ġis omet
+Ġis hib
+Ġis omal
+Ġis opro
+Ġis oflurane
+Ġis aac
+Ġis mail
+Ġis rct
+Ġis tat
+ant e
+ant an
+ant ly
+ant ou
+ad d
+ad u
+ad an
+ad ent
+ad ine
+ad dition
+ad ental
+ad ri
+ad den
+ad dam
+ad ata
+ad iaz
+ad zadeh
+ad asa
+ut a
+ut or
+ut ter
+ut ogenic
+ut omatic
+ut ense
+ut arate
+ess en
+ess es
+ess enz
+ir i
+ir ation
+ir ub
+ir ates
+ir yn
+ir ane
+ir cle
+ir ling
+ir anta
+ir sag
+ir angth
+ir abadi
+ver te
+ver bal
+Ġus able
+Ġus earch
+Ġus ui
+oc ent
+oc op
+oc ers
+oc ue
+oc ay
+oc ating
+oc ru
+oc yst
+oc rit
+oc uria
+oc onazole
+oc orre
+oc oronal
+oc onversion
+oc erebell
+qu i
+qu ant
+qu ia
+qu ality
+qu asi
+qu ennial
+iz el
+iz ant
+iz obium
+iz zled
+Ġch s
+Ġch ter
+Ġch ib
+Ġch ores
+Ġch ocol
+Ġch erv
+Ġch ees
+Ġch aper
+Ġch imes
+Ġch alo
+Ġch sy
+Ġch ao
+Ġch illed
+Ġch km
+Ġch aud
+Ġch lord
+Ġch zhan
+Ġch orological
+Ġch isel
+Ġch elion
+ies er
+ies is
+ate eb
+ate mporal
+Ġde ub
+Ġde ox
+Ġde uter
+Ġde uts
+Ġde identi
+Ġde acet
+Ġde activated
+Ġde otte
+Ġde escal
+ore tic
+ore ll
+ore nce
+ore activity
+ore fraction
+ore opmd
+ore flective
+ain es
+ain ab
+ain ted
+Ġinc ur
+Ġinc ogn
+Ġinc urable
+Ġinc arn
+Ġinc urring
+Ġinc entive
+ign e
+ign ac
+um i
+um es
+um ping
+um ped
+um arin
+um ann
+um dar
+um onen
+pl on
+pl ated
+pl ication
+pl aced
+pl atin
+pl aces
+pl aque
+pl icable
+Ġgro pus
+Ġme f
+Ġme k
+Ġme ib
+Ġme ij
+Ġme yer
+Ġby stand
+ure n
+ure ment
+Ġat e
+Ġat ec
+Ġat act
+Ġat rop
+Ġat opy
+Ġat mega
+Ġat atct
+Ġat elocol
+Ġpre cr
+Ġpre cal
+Ġpre co
+Ġpre fr
+Ġpre max
+Ġpre odont
+Ġpre hist
+Ġac s
+Ġac ar
+Ġac ms
+Ġac yl
+Ġac pa
+Ġac ron
+Ġac ker
+Ġac umin
+Ġac etal
+Ġac ini
+Ġac rid
+Ġac aact
+Ġac arophobia
+Ġac upuncture
+ys er
+ys ide
+ys can
+ys terols
+Ġcomp ass
+Ġcomp ose
+Ġcomp ile
+Ġcomp te
+Ġcomp acted
+Ġcomp elling
+Ġcomp omer
+Ġcomp acting
+Ġcomp elled
+Ġcomp erhensive
+iv ated
+iv ir
+iv ary
+iv ile
+iv ash
+og ain
+og um
+og ingiv
+og old
+og alact
+ib is
+ib ur
+ib ers
+ib urg
+Ġdis able
+Ġdis per
+Ġdis ple
+Ġdis ten
+Ġdis pose
+Ġdis appro
+Ġdis odium
+Ġdis fig
+Ġdis till
+Ġdis fav
+Ġdis asters
+Ġse ed
+Ġse ize
+Ġse ymo
+Ġse erig
+Ġse ulgg
+Ġse vefl
+Ġse ifert
+ial y
+ial is
+ial em
+ial ist
+Ġsh p
+Ġsh s
+Ġsh as
+Ġsh am
+Ġsh and
+Ġsh op
+Ġsh ee
+Ġsh ell
+Ġsh erm
+Ġsh ack
+Ġsh ark
+Ġsh ih
+Ġsh ame
+Ġsh rin
+Ġsh ields
+Ġsh imm
+Ġsh ofer
+Ġsh iro
+Ġsh uff
+Ġsh ams
+Ġsh aved
+Ġsh ading
+Ġsh otgun
+Ġsh oes
+Ġsh yness
+Ġsh erwood
+Ġsh ingaki
+Ġsh ulman
+Ġsh restha
+Ġsh antou
+Ġsh ivash
+ap on
+ap an
+ap tic
+ap ore
+ap ort
+ap ically
+ap ped
+ap illary
+ap point
+ap tability
+ap oly
+ap rint
+ap ositive
+Ġdif ft
+Ġdif etti
+oth rom
+oth ane
+oth iaz
+are lia
+Ġad am
+Ġad ition
+Ġad rs
+Ġad amant
+feren ts
+Ġdent aid
+Ġdent omaxillofacial
+Ġdent urist
+Ġdent aport
+Ġbet aines
+Ġbet apositive
+Ġhe ine
+Ġhe be
+Ġhe pes
+Ġhe yd
+Ġhe arten
+Ġhe ista
+Ġhe athy
+Ġhe idel
+Ġass ayed
+Ġass ert
+Ġass emble
+Ġass embl
+Ġass iut
+Ġass osci
+Ġcl s
+Ġcl op
+Ġcl ip
+Ġcl ay
+Ġcl ox
+Ġcl av
+Ġcl si
+Ġcl amp
+Ġcl amped
+Ġcl erk
+Ġcl imate
+Ġcl amping
+Ġcl umping
+rom e
+rom ic
+reat oduodenectomy
+and e
+and ed
+and ard
+Ġare al
+Ġare nas
+Ġtw ee
+Ġtw ist
+Ġtw isted
+Ġtw inc
+Ġtw eed
+Ġtw een
+Ġtw osample
+ff ens
+ff ord
+ff co
+ff aj
+ff icacy
+Ġma e
+Ġma gg
+Ġma ker
+Ġma ze
+Ġma fr
+Ġma ulana
+op ack
+op ne
+op ros
+op old
+op ography
+op rec
+op orous
+op erated
+op revalence
+por ation
+por ated
+por ulating
+we is
+we ges
+em s
+em le
+em per
+em ade
+em inal
+em onic
+em sa
+em ori
+em kit
+em ethyld
+ers ons
+ers onal
+ers tructure
+ers core
+ers tats
+Ġsc b
+Ġsc ip
+Ġsc ree
+Ġsc out
+Ġsc ene
+Ġsc our
+Ġsc ha
+Ġsc anc
+Ġsc abs
+Ġsc ulpt
+Ġsc otland
+Ġsignific atively
+Ġsignific anly
+Ġperi opath
+Ġperi opro
+Ġperi ocular
+Ġperi apically
+Ġap om
+Ġap olar
+Ġap ice
+Ġap osens
+Ġap di
+Ġap arat
+Ġap atitic
+ip ated
+ip red
+ip pa
+ip itation
+ip emia
+ip uncture
+Ġdental care
+Ġit k
+Ġit ch
+Ġit erm
+Ġit eration
+und i
+und ed
+und ancy
+Ġco vi
+Ġco ined
+Ġco ins
+Ġco ok
+Ġco erc
+Ġco inf
+Ġco ales
+Ġco ats
+Ġco existing
+Ġco occ
+Ġco enzyme
+Ġco bbl
+Ġco alition
+Ġco orlin
+Ġco astal
+Ġco usins
+Ġco omass
+Ġco umarin
+Ġind ents
+Ġind uration
+Ġind eterm
+Ġind uv
+Ġind raw
+Ġind welled
+Ġind ifference
+ia vi
+ia gn
+ia ged
+Ġle o
+Ġle ver
+Ġle one
+Ġle verage
+Ġle ung
+Ġle va
+Ġle ita
+Ġle aves
+Ġle bon
+Ġle pping
+Ġle voth
+Ġle iden
+Ġle opold
+Ġsur mount
+Ġsur rey
+ding e
+ub les
+ub ital
+ub eral
+ub ator
+tal w
+Ġnot ting
+Ġtreat able
+ary otic
+ary lether
+est a
+est one
+est ep
+est ones
+est udio
+est amps
+est otals
+act or
+act ant
+act ored
+pec trum
+pec ialist
+se as
+se vere
+se ier
+Ġcan all
+Ġcan thion
+Ġpar ity
+Ġpar ath
+Ġpar ties
+Ġpar ks
+Ġpar ama
+Ġpar acr
+Ġpar alysis
+Ġhealth ily
+ine ous
+ine hart
+Ġpos its
+Ġpos ology
+Ġpos ters
+val ue
+vi ar
+vi ate
+vi oral
+ition s
+ition ally
+st l
+st on
+st ain
+st op
+st ay
+st atistic
+st anes
+st atus
+st abs
+st atter
+Ġfo ul
+Ġfo resh
+Ġfo ams
+Ġfo vea
+Ġfo etuses
+Ġinf ancy
+Ġinf used
+Ġinf initi
+vel ed
+vel le
+ull age
+per form
+per itone
+per imental
+Ġha y
+Ġha ens
+Ġha avi
+Ġha ematological
+Ġha hn
+Ġha ffaj
+ich ung
+ich mann
+enti es
+ren cy
+ren nma
+ren ticeship
+Ġcont ec
+Ġcont ure
+Ġcont ag
+ari ed
+Ġpres so
+Ġpres yn
+Ġpres erv
+Ġpres ervative
+Ġpres urgical
+Ġpres troke
+Ġpres urgery
+Ġpres pecified
+Ġpres urvey
+Ġpl ating
+Ġpl icated
+Ġpl orer
+Ġpl acode
+Ġpl urip
+ue h
+ell s
+ell en
+ell ent
+ell ated
+ell um
+ell ors
+ell osis
+Ġall ied
+Ġall usion
+Ġall iance
+Ġall dl
+Ġall ogenous
+Ġall uding
+Ġall oplastic
+ong elli
+Ġperiodon tically
+Ġfull est
+ch o
+ch ures
+ch ke
+ch ak
+ch land
+ch aft
+ch oric
+ch arged
+ch berg
+ch ez
+ch ison
+ch ecked
+ch wer
+ch rome
+end ence
+end odontic
+Ġwhich bu
+ug i
+ug ness
+ill i
+ill ation
+ill eri
+ill iant
+ill oliths
+ill imet
+Ġro os
+Ġro od
+Ġro up
+Ġro vers
+Ġro usp
+Ġro cha
+Ġro udi
+Ġro ws
+Ġro che
+Ġro uiller
+Ġro ugness
+Ġtr an
+Ġtr ag
+Ġtr ade
+Ġtr ick
+Ġtr ains
+Ġtr ih
+Ġtr aps
+Ġtr iaz
+Ġtr ieth
+Ġtr pc
+Ġtr iaged
+ear th
+Ġmore no
+Ġmod y
+Ġmod ifier
+Ġmod ares
+Ġmod elled
+Ġmod ulatory
+ach ed
+ach ian
+ach idonic
+Ġcons ole
+Ġcons ola
+Ġcons erving
+Ġcons ervation
+Ġreg ist
+Ġreg laz
+cl s
+cl ub
+cl one
+cl ish
+cl air
+cl ave
+Ġob j
+Ġob so
+Ġob sessive
+Ġob weges
+Ġob viate
+Ġacc ession
+Ġacc ru
+Ġacc used
+Ġacc ented
+Ġacc retion
+Ġacc utom
+Ġthan k
+Ġno un
+Ġno vic
+Ġno hs
+Ġno body
+Ġno vamin
+Ġanalys er
+Ġsam sung
+oci ation
+oci ties
+Ġrec reated
+Ġrec ateg
+Ġrec ont
+Ġrec umb
+Ġrec ker
+Ġrec ycl
+Ġrec oded
+Ġrec ede
+Ġrec ourse
+Ġrec alibration
+Ġrec ertification
+Ġrec esses
+Ġincl ines
+Ġrel ay
+Ġrel vas
+Ġrel atable
+Ġne xy
+Ġne bn
+Ġne pom
+Ġne onatal
+Ġne uroradi
+Ġpr p
+Ġpr ide
+Ġpr ints
+Ġpr onged
+Ġpr isons
+Ġpr aise
+Ġpr asad
+Ġpr udent
+Ġpr amanik
+Ġcar lin
+Ġcar tographic
+Ġcar inii
+Ġtooth aches
+Ġab u
+Ġab et
+Ġab ated
+Ġab ate
+Ġab led
+Ġab ik
+Ġab aq
+Ġab using
+Ġab del
+Ġab domen
+Ġab udall
+Ġaf ferents
+ight ening
+ces fully
+duc tion
+fac estotals
+Ġsub ple
+Ġsub ord
+Ġsub ging
+Ġsub urb
+Ġsub fl
+Ġsub forms
+Ġsub cellular
+Ġsub field
+Ġsub famil
+Ġsub rogated
+Ġsub domain
+Ġsub family
+Ġsub jacent
+Ġsub nuclear
+Ġsub them
+Ġsub arach
+Ġinter ph
+Ġinter ms
+Ġinter ne
+Ġinter cal
+Ġinter arch
+Ġinter gen
+Ġinter go
+Ġinter activity
+Ġinter cepts
+Ġinter class
+Ġinter tw
+Ġinter change
+Ġinter ceptive
+Ġinter fur
+Ġinter fibrillar
+Ġinter rogated
+Ġinter oper
+Ġinter costal
+Ġinter rogating
+Ġinter leaved
+Ġinter verte
+Ġinter appoint
+Ġqu ater
+Ġqu otes
+Ġqu eas
+Ġqu encher
+Ġqu iryn
+Ġun str
+Ġun ite
+Ġun int
+Ġun ord
+Ġun man
+Ġun resp
+Ġun mark
+Ġun etr
+Ġun me
+Ġun iting
+Ġun esthetic
+Ġun aff
+Ġun ra
+Ġun stead
+Ġun used
+Ġun time
+Ġun obser
+Ġun struct
+Ġun trans
+Ġun hel
+Ġun itek
+Ġun interpre
+Ġun bu
+Ġun oise
+Ġun ison
+Ġun establ
+Ġun closed
+Ġun antic
+Ġun classified
+Ġun just
+Ġun vac
+Ġun esco
+Ġun attain
+Ġun icellular
+Ġun leash
+Ġun cemented
+Ġun ambiguous
+Ġun earth
+Ġeffec ted
+Ġeffec tivity
+low er
+form er
+form ations
+form ative
+Ġint ension
+Ġint akes
+Ġint uss
+Ġint welve
+ay an
+ay ment
+ay ashi
+Ġlow ers
+ist ak
+ist ae
+ist opathy
+Ġy d
+Ġy h
+Ġy un
+Ġy ass
+Ġy uan
+Ġy amam
+Ġy ttr
+Ġy uen
+Ġy usuke
+Ġy amabe
+Ġam id
+Ġam ines
+Ġam ended
+Ġam ps
+Ġam arant
+Ġam assed
+Ġam itr
+Ġam ylase
+Ġam niotic
+Ġam aral
+Ġam irabadi
+ens i
+ens en
+ens ible
+ater istics
+one ment
+one ous
+one gativity
+one urolog
+one edle
+ard d
+ard ize
+ard iac
+Ġmeas urably
+Ġvari o
+Ġk ul
+Ġk ven
+Ġk ual
+Ġk ob
+Ġk ines
+Ġk aw
+Ġk ne
+Ġk ih
+Ġk ont
+Ġk az
+Ġk ivo
+Ġk uro
+Ġk abil
+Ġk wan
+Ġk ids
+Ġk urt
+Ġk avy
+Ġk sa
+Ġk sh
+Ġk la
+Ġk ats
+Ġk ungs
+Ġk cis
+Ġk dca
+Ġk ratch
+Ġk atada
+Ġk asaj
+Ġk omi
+Ġk utter
+Ġk ocuria
+Ġk ieser
+Ġk ateeb
+Ġk arelia
+Ġk ullage
+Ġk rennma
+ple ted
+ple ct
+Ġval o
+Ġval es
+Ġval ide
+Ġval enc
+Ġval ves
+Ġval iable
+Ġval div
+iti ous
+iti ves
+iti vities
+iti ba
+Ġwe xner
+Ġwe apon
+ans as
+ans ive
+ans son
+ans aker
+ans hah
+ast in
+ast ating
+ast atic
+ast oid
+ast onec
+Ġlevel ed
+Ġlevel ling
+Ġlevel ler
+pro fessional
+pro fit
+so uni
+Ġdet in
+lec ules
+lec oxib
+lec yst
+ost atistic
+ost osis
+ost omat
+Ġen act
+Ġen low
+Ġen cr
+Ġen ucle
+Ġen umer
+Ġen igm
+Ġen thus
+Ġen oyl
+Ġen clave
+Ġhad laq
+Ġfol ding
+Ġfol der
+Ġfol licular
+Ġfact o
+Ġfact ures
+Ġfact ored
+ting en
+rol s
+Ġgen ic
+Ġgen ew
+Ġgen ital
+Ġgen amic
+Ġgen esis
+Ġgen ova
+Ġgen code
+Ġgen otypic
+Ġgen otyped
+Ġgen uine
+Ġgen estudio
+yp ted
+yp ox
+yp rep
+Ġpartic pation
+Ġpartic ularities
+Ġtheir s
+Ġmay er
+Ġpo ur
+Ġpo und
+Ġpo ison
+ome ther
+ome thane
+Ġchild smile
+Ġassess ors
+Ġassess essment
+Ġtim isoara
+Ġtim estamps
+ph i
+ph arm
+ph alan
+ph erson
+ph arma
+ph agia
+Ġdur a
+Ġdur um
+Ġout lying
+Ġout let
+Ġout going
+Ġout dated
+ugh ing
+ugh out
+Ġsuc cesfully
+ass en
+ass es
+ass essment
+Ġsurfac er
+Ġspec ular
+Ġspec ks
+Ġspec ulations
+erm ack
+Ġfin ial
+Ġfin ds
+Ġstatistic a
+Ġstatistic ians
+olar ct
+olar ization
+Ġup to
+Ġup most
+Ġup set
+Ġup arse
+Ġup grade
+Ġup held
+Ġup graded
+Ġup keep
+ond rodysplasia
+Ġcor d
+Ġcor yn
+Ġcor ros
+Ġcor oll
+Ġcor rid
+Ġcor bella
+Ġcor puscular
+Ġcor tella
+Ġcor poration
+Ġmeth y
+Ġmeth icillin
+Ġmeth ionine
+str ate
+Ġdes mo
+Ġdes orption
+Ġdes ires
+Ġdes erve
+Ġdes aturation
+Ġdes icc
+Ġdes cend
+Ġdes alted
+Ġdes aturations
+acter istics
+Ġso il
+Ġso res
+Ġso up
+Ġso oth
+Ġso br
+Ġso fa
+Ġso hn
+Ġso kransky
+ix ture
+Ġcontrol ed
+Ġar ric
+Ġar cs
+Ġar be
+Ġar ias
+Ġar ora
+Ġar jun
+Ġar iji
+Ġar bagy
+Ġar isen
+Ġar rosion
+Ġar idia
+Ġar achidonic
+amin es
+amin ating
+Ġtest able
+Ġtest ori
+Ġris en
+Ġris es
+Ġinv ite
+Ġinv itation
+Ġinv ested
+Ġinv ades
+Ġinv ading
+Ġmed ved
+Ġmed io
+Ġmed rx
+Ġmed ilink
+Ġshowed that
+enc k
+enc ers
+Ġph are
+Ġph ix
+Ġph ds
+Ġph asc
+Ġph asic
+Ġph arma
+Ġph leb
+Ġmethod ologic
+Ġrisk y
+Ġover t
+Ġover ly
+Ġover pres
+Ġover con
+Ġover gro
+Ġover com
+Ġover time
+Ġover pass
+Ġover taken
+Ġover flow
+Ġover rated
+Ġover hydration
+Ġover see
+Ġover fillings
+Ġover development
+Ġover seas
+Ġnum py
+ke ystone
+ke ypox
+Ġfound ations
+Ġfound ational
+mo ud
+mo bility
+pres ive
+pres so
+Ġbi otypes
+Ġbi ochemistry
+Ġbi ostar
+Ġbi optic
+Ġbi odynamics
+Ġbi olum
+Ġbi ostatistic
+Ġcell titer
+ct ta
+ct gc
+ct atcgt
+ct tcc
+Ġmo tive
+Ġmo ose
+Ġmo ons
+Ġmo tility
+Ġmo ebi
+Ġmo vies
+Ġmo zan
+Ġmo leander
+Ġmo ulding
+Ġmo urino
+Ġmo irangth
+Ġparticip atory
+Ġcol ic
+Ġcol ds
+Ġcol oring
+Ġcol de
+Ġcol linearities
+ber y
+ber ates
+ber to
+iss ity
+iss ance
+iss ibility
+lu ter
+lu oron
+Ġtime frames
+Ġdec ays
+Ġdec oration
+Ġdec ellular
+Ġdec iles
+Ġdec eptive
+Ġdec edent
+Ġdec ennial
+Ġboth r
+Ġboth ered
+Ġobser ves
+Ġcr a
+Ġcr ater
+Ġcr ush
+Ġcr ust
+Ġcr ick
+Ġcr af
+Ġcr imin
+Ġcr ime
+Ġcr ash
+Ġcr ista
+Ġcr onbach
+Ġcr atered
+Ġcr ashes
+Ġcr ippa
+Ġcr istae
+Ġsec t
+Ġsec ular
+Ġroot ward
+Ġag encies
+Ġag itated
+Ġag tgg
+Ġag ilent
+adi er
+adi ation
+adi ene
+Ġcal oric
+Ġcal cemic
+Ġcal zol
+Ġcal amities
+ech ing
+ech oic
+ech enich
+Ġfour fold
+tem a
+tem eier
+ite x
+Ġperiodonti al
+Ġstr aining
+Ġstr iving
+Ġstr ands
+Ġstr uble
+Ġstr ange
+Ġstr anger
+Ġstr aws
+Ġstr iae
+Ġstr uck
+Ġstr atov
+Ġstr anded
+ex ct
+ex posing
+cc cat
+cc aag
+cc aact
+cc cagct
+cc acagtt
+Ġindic a
+Ġ1 13
+vid opo
+Ġproc ured
+Ġproc era
+Ġproc alc
+Ġproc urement
+les ion
+Ġimpl acement
+Ġimpl ode
+Ġimpl icating
+Ġimpl oding
+Ġsim ark
+Ġsim ps
+Ġsim ilarily
+Ġbr ion
+Ġbr ass
+Ġbr ust
+Ġbr av
+Ġbr ains
+Ġbr ings
+Ġbr amant
+Ġbr uising
+Ġbr inell
+Ġbr atth
+Ġbr idgman
+Ġbr illiant
+Ġund eb
+Ġund eniable
+Ġund etect
+Ġund ifferenti
+Ġund amaged
+ep tor
+ep ines
+ep sen
+Ġnumber ing
+Ġdia zepam
+Ġexamin ators
+odontic s
+ag t
+ag ation
+ag ion
+ag ue
+ag ens
+ag ulation
+ag ination
+ag tgg
+ag ggt
+ag tctag
+ag reb
+Ġfir ings
+Ġman ia
+Ġman ometric
+Ġman ged
+Ġman eu
+Ġman hatt
+Ġman kind
+Ġman zal
+ack ing
+Ġ2 10
+Ġ2 13
+Ġ2 23
+ath ized
+Ġmaxill ar
+Ġnon cr
+Ġnon fer
+Ġnon red
+Ġnon operative
+Ġnon resp
+Ġnon com
+Ġnon oral
+Ġnon vascular
+Ġnon norm
+Ġnon inf
+Ġnon med
+Ġnon organic
+Ġnon viral
+Ġnon ionic
+Ġnon vital
+Ġnon biased
+Ġnon essential
+Ġnon porous
+Ġnon linearities
+Ġnon cycl
+Ġnon metal
+Ġnon nen
+Ġnon pain
+Ġnon rand
+Ġnon alcohol
+Ġnon resorbable
+Ġnon ionizing
+Ġnon verbal
+Ġnon operated
+Ġnon stop
+Ġnon profit
+ric ulomegal
+Ġsurg ed
+pos ively
+pos itories
+Ġdisc ounts
+Ġdisc onnected
+Ġsup ress
+Ġsup plying
+Ġsup erstructure
+Ġsup positories
+Ġgener gy
+Ġfirst born
+Ġappl iable
+Ġclass ed
+Ġorth ophosph
+Ġorth odox
+pt een
+Ġradi opro
+Ġradi obacter
+Ġradi osensitiz
+Ġdef ies
+Ġdef ences
+Ġdef ending
+Ġdef lected
+Ġdef rag
+Ġdef erred
+Ġsp b
+Ġsp am
+Ġsp ores
+Ġsp ark
+Ġsp ouse
+Ġsp ok
+Ġsp aring
+Ġsp onge
+Ġsp oke
+Ġsp atul
+Ġsp icules
+ult urally
+ult urable
+Ġdiagnos able
+Ġj ar
+Ġj ul
+Ġj ig
+Ġj am
+Ġj ak
+Ġj ane
+Ġj itt
+Ġj ang
+Ġj oy
+Ġj ung
+Ġj ones
+Ġj ok
+Ġj cp
+Ġj uan
+Ġj acks
+Ġj ames
+Ġj ails
+Ġj oa
+Ġj eremia
+Ġj ansen
+Ġj enk
+Ġj peg
+Ġj pg
+Ġj inger
+Ġj ansaker
+Ġj epsen
+Ġbut t
+Ġbut ani
+Ġed o
+Ġed its
+Ġed man
+Ġed ax
+Ġed ef
+Ġed ardd
+Ġfur in
+Ġfur unc
+Ġfur haus
+Ġfur usawa
+Ġsample array
+trib utory
+Ġcare ers
+Ġcare taking
+king e
+Ġmicro dr
+Ġmicro jet
+Ġmicro ca
+Ġmicro cy
+Ġmicro flex
+Ġmicro hy
+Ġmicro arr
+Ġmicro abs
+Ġmicro phthal
+Ġmicro ecological
+Ġmicro gnathia
+Ġmicro titer
+Ġmicro ecology
+Ġmicro porous
+Ġmicro aer
+Ġmicro retentive
+Ġmicro tips
+Ġmicro ecosystem
+Ġmicro abras
+Ġcomm ences
+Ġcomm enced
+Ġcomm ands
+Ġcomm uting
+Ġcomm odities
+Ġdem ethyl
+Ġdem aros
+Ġdem erjian
+led o
+led ent
+oun i
+Ġmin k
+Ġmin p
+Ġmin ia
+Ġmin ds
+Ġmin ty
+Ġmin ibr
+Ġmin ced
+Ġmin isce
+Ġmin olta
+cr aft
+cr anial
+cr istopathy
+te ilun
+Ġinto xication
+Ġhy oid
+Ġques ts
+Ġgingiv ial
+port ant
+Ġsubjec tiveness
+Ġsubjec tivism
+Ġextr ude
+Ġextr uding
+Ġextr aradicular
+Ġextr abuccal
+na round
+na issance
+Ġappro vement
+Ġappro ves
+Ġappro imately
+Ġmand ated
+Ġmand ate
+Ġpatient ly
+Ġmaterial istic
+Ġcalc ific
+Ġcalc ite
+Ġcalc ifying
+Ġprob st
+Ġprob atory
+Ġprob ands
+Ġchar ted
+Ġchar ged
+Ġchar ateristics
+Ġbec ker
+Ġi it
+Ġi ked
+Ġi was
+Ġi hu
+Ġi kb
+Ġi owa
+Ġmal ic
+Ġmal ar
+Ġmal tit
+Ġmal ocl
+Ġmal treatment
+Ġmal adj
+Ġmal function
+Ġmal ho
+Ġmal development
+Ġmal mstrom
+Ġmal nour
+Ġmal olactic
+Ġtrans oral
+Ġtrans duce
+Ġtrans itory
+Ġtrans disciplinary
+Ġtrans cranial
+ten ite
+ten ax
+Ġform a
+Ġform ers
+Ġform yl
+Ġform az
+Ġform alities
+Ġoutc oming
+Ġoutc ompet
+Ġop d
+Ġop ts
+Ġop ting
+Ġop io
+Ġop pressed
+Ġop acities
+Ġdi aries
+Ġdi odes
+Ġdi arr
+Ġdi hyd
+Ġdi hydr
+Ġcur l
+Ġcur ro
+Ġcur vi
+Ġcur ving
+Ġcur ious
+Ġcur iosity
+Ġcur rency
+Ġcur itiba
+Ġdevelop er
+ace a
+Ġgr p
+Ġgr ants
+Ġgr its
+Ġgr amm
+Ġgr av
+Ġgr ains
+Ġgr ind
+Ġgr inder
+Ġgr oning
+Ġgr ytten
+Ġgr acile
+Ġgr atifying
+Ġgr abowski
+ons in
+ons ive
+ak s
+ak ata
+ak ani
+ak iri
+fic ations
+ish ita
+ish nan
+Ġdep araffin
+Ġdep olarization
+itive ly
+Ġcorre x
+Ġli ability
+Ġreduc er
+Ġreduc tase
+Ġsal ud
+Ġsal ter
+Ġsal ute
+Ġsal ame
+Ġsal ient
+Ġsal mon
+Ġsal esp
+Ġsal imetric
+Ġsal aam
+Ġsal utogenic
+Ġsal aried
+Ġunder ized
+Ġunder treatment
+Ġunder pr
+Ġunder represent
+Ġunder lining
+Ġunder reported
+Ġunder wear
+Ġunder fillings
+Ġunder cut
+Ġcharacter ise
+Ġlim eira
+Ġlim ongelli
+Ġimp art
+Ġimp ute
+Ġimp inge
+Ġimp inging
+Ġimp regn
+Ġimp inged
+Ġimp urities
+Ġimp atiens
+tor al
+tor is
+Ġpost ulation
+Ġpost ulate
+Ġpost ulating
+Ġpost part
+Ġpost graduates
+Ġpost traumatic
+Ġpost test
+Ġpost cur
+Ġpost natally
+Ġpost endodontic
+Ġcro en
+Ġcro uz
+Ġimplant able
+Ġconf ers
+Ġconf ines
+Ġconf ron
+Ġconf use
+int endence
+Ġprim ates
+Ġprim itive
+Ġprim acaine
+Ġdetec ts
+Ġdetec tions
+Ġ3 16
+Ġ3 23
+Ġ3 38
+Ġ3 75
+Ġ3 11
+Ġknow able
+cer al
+cer ning
+Ġpain ting
+Ġpain kill
+Ġser ine
+Ġser af
+Ġser ologic
+Ġser pina
+Ġser otonin
+Ġser oconversion
+Ġser oprevalence
+Ġser onegativity
+Ġrelated ly
+Ġstat ue
+Ġmet res
+Ġmet acy
+Ġmet rical
+Ġmet atrans
+Ġmet adata
+Ġmet apoly
+Ġvis otool
+Ġvis ceral
+Ġmon ir
+Ġmon se
+Ġmon oph
+Ġmon ochlor
+Ġmon key
+Ġmon obe
+Ġmon oxid
+Ġmon ocycline
+Ġmon onuclear
+Ġmon keys
+Ġmon umental
+Ġmon roe
+Ġmon keypox
+Ġbl oc
+Ġbl ended
+Ġbl ots
+Ġbl au
+Ġbl amed
+Ġbl unting
+Ġbl omma
+Ġbl omstrand
+Ġem ographic
+Ġem bl
+Ġem ax
+Ġem ble
+Ġem press
+Ġem ittance
+Ġem mel
+Ġem anate
+Ġem irates
+ulti vable
+Ġfre y
+Ġfre uden
+Ġfre mitus
+Ġfre tibacterium
+Ġfre iburg
+Ġcomple ments
+Ġsin k
+Ġsin ter
+Ġsin ha
+Ġsin clair
+Ġol tra
+Ġol cay
+Ġol omouc
+Ġintr ons
+Ġintr icate
+Ġintr atum
+Ġintr uding
+Ġintr aind
+Ġintr aradicular
+Ġintr abuccal
+Ġintr anuclear
+Ġintr arater
+Ġintr usiveness
+its geme
+its chak
+amm ed
+amm ery
+amm onium
+Ġneed iness
+Ġ0 000
+Ġ0 25
+Ġ0 85
+Ġ0 78
+vers ing
+br ide
+br itt
+br uck
+acy tic
+Ġz echn
+Ġz ha
+Ġz anc
+Ġz af
+Ġz ame
+Ġz ole
+Ġz ale
+Ġz ij
+Ġz ik
+Ġz no
+Ġz wr
+Ġz inb
+Ġz enot
+Ġz aror
+Ġz unba
+Ġz amora
+Ġz ucch
+Ġz ainab
+Ġz agreb
+ature d
+Ġet a
+Ġet tema
+terior ly
+Ġwhere fore
+Ġer asing
+Ġer len
+Ġer iogl
+Ġer zur
+Ġer reyg
+Ġer itrea
+Ġmain stay
+Ġsecond arily
+Ġcondition ers
+Ġcondition ally
+ss i
+ss en
+atic al
+atic ally
+atic ians
+Ġquestion ary
+Ġquestion aires
+Ġsoft ens
+Ġsoft ness
+Ġsoft wares
+tim ulation
+Ġplan ed
+Ġplan et
+Ġplan um
+Ġplan imetric
+Ġplan imetrically
+ores i
+ores een
+ores cein
+Ġdr ip
+Ġdr aining
+Ġdr ks
+Ġdr iver
+Ġdr ivers
+Ġdr smile
+Ġend ometric
+Ġend emic
+Ġend oph
+Ġend orph
+Ġend omicro
+Ġend osc
+Ġend note
+Ġend onasal
+Ġend oscopy
+Ġend opathogen
+Ġend omotor
+ian ia
+Ġinform ations
+Ġinform ally
+Ġinform atization
+Ġinform aticians
+Ġits x
+Ġca e
+Ġca o
+Ġca res
+Ġca ha
+Ġca uter
+Ġca fs
+Ġca ught
+Ġca rotene
+Ġca viar
+ym ptomatic
+ym onkey
+ym odels
+Ġinfl atun
+Ġce ase
+Ġce ased
+Ġce ases
+Ġce be
+Ġce fr
+Ġce lecoxib
+Ġstandard izations
+Ġran ova
+Ġloc o
+Ġloc ulation
+oss al
+Ġfollowing s
+arg ing
+arg inine
+Ġtechn ics
+Ġtechn icians
+Ġtechn etium
+tit ors
+Ġaffec tive
+Ġel ite
+Ġel uting
+Ġel apse
+Ġel bow
+Ġel taw
+Ġel iciting
+Ġel ionix
+Ġel astin
+Ġmulti ply
+Ġmulti plan
+Ġmulti step
+Ġmulti media
+Ġmulti morb
+Ġmulti professional
+fer roni
+Ġrem ake
+Ġrem des
+Ġrem oteness
+ie h
+ie u
+Ġinflamm ations
+Ġinflamm aging
+Ġinflamm atories
+Ġinflamm osome
+vic s
+vic le
+vic ular
+Ġsampl ings
+Ġsome where
+Ġimpro bable
+Ġfr anc
+Ġfr ances
+Ġfr ustr
+Ġfr cs
+Ġfr yback
+Ġfr izzled
+Ġcent roid
+Ġcent roids
+Ġindividual ised
+Ġsever ities
+ord able
+our ing
+our ce
+our ced
+Ġposs ession
+Ġlong bott
+Ġpred ication
+Ġpred ecess
+Ġincis o
+Ġremo ver
+Ġany cub
+ark ed
+Ġadj unction
+Ġadj oining
+Ġadj udication
+amic in
+Ġcorrel ative
+Ġcorrel ating
+Ġterm ed
+Ġterm inate
+Ġcle ave
+Ġcle fting
+ning ton
+Ġinflu encers
+Ġbas ion
+Ġbas que
+Ġbas ilar
+Ġbas elines
+Ġbas ophil
+Ġbas cd
+ob a
+ob es
+ob arb
+ob uccally
+par able
+par isons
+Ġid p
+Ġid s
+Ġid ent
+Ġexpl icable
+Ġexpl oding
+Ġexpl orations
+Ġexpl osion
+Ġgeneral ist
+Ġgeneral ise
+Ġgeneral ising
+Ġlesions core
+Ġaccur acies
+Ġmuc or
+Ġmuc opolys
+Ġmuc ogingiv
+Ġflu ted
+ha ve
+ha vioral
+Ġdistrib utes
+Ġdistrib utor
+Ġsm ad
+Ġsm elling
+Ġsm iled
+Ġsm orkers
+uct ors
+Ġins ist
+Ġins pite
+Ġins pects
+Ġins ulating
+Ġins tig
+Ġins tigate
+Ġdesign ate
+Ġdesign ations
+Ġconduc ing
+Ġconduc ts
+Ġapp reh
+Ġapp ointed
+Ġapp renticeship
+Ġparamet rically
+Ġimm erged
+Ġimm anent
+Ġknowledge ability
+Ġear n
+gi oma
+Ġir m
+Ġsch ell
+Ġsch ra
+Ġsch war
+Ġsch iller
+Ġsch loss
+Ġsch nut
+Ġsch wend
+Ġsch imid
+Ġsch luter
+Ġdo a
+Ġdo f
+Ġdo uch
+Ġscal ar
+Ġinstr uctors
+Ġthen were
+Ġidenti ties
+Ġidenti fications
+Ġprocess ors
+Ġoc p
+Ġoc cluded
+Ġoc clusive
+Ġoc ulograms
+onstr ated
+Ġcb t
+anc kx
+anc erscore
+Ġbacter iological
+Ġsmo kes
+Ġinfec t
+Ġinfec tivity
+Ġcy bers
+Ġcy nical
+Ġcy anide
+Ġrece ivers
+Ġneg ating
+Ġprot amine
+Ġprot uber
+Ġrand all
+Ġrandom ise
+Ġrandom izing
+Ġrandom izations
+ste in
+Ġrate itschak
+aren al
+Ġmouth fe
+Ġmouth pi
+Ġgl m
+Ġgl oor
+Ġgl ider
+Ġgl ickman
+Ġgl ioma
+Ġgl iddens
+Ġgl abella
+Ġpot ently
+Ġpredic able
+Ġfill s
+Ġpath s
+Ġpath osystem
+ration ality
+Ġcommon ality
+Ġcommon alities
+Ġoper on
+Ġoper atory
+Ġspecific ities
+Ġif u
+Ġif ference
+yn ucle
+yn thes
+yn oph
+Ġanti di
+Ġanti psych
+Ġanti prolif
+Ġanti virals
+Ġanti throm
+Ġcer con
+Ġcer agl
+Ġdist olingual
+Ġdist obuccally
+Ġunivers ita
+clud e
+Ġos more
+Ġos lo
+Ġos aki
+Ġos tiomeatal
+Ġos terix
+Ġfactor ability
+Ġrepres sors
+Ġoccur r
+Ġoccur ance
+Ġpe tit
+Ġpe valence
+Ġposition er
+Ġstruct uring
+ust ment
+Ġav ulsion
+Ġcollec tions
+Ġcollec tor
+Ġgend ered
+of ect
+of unction
+of rontal
+Ġmechan otrans
+ith i
+Ġfac s
+Ġfac eted
+Ġfac scal
+Ġfac ilate
+Ġpal m
+Ġpal ind
+Ġpal estine
+Ġpal sied
+aw i
+aw fully
+yl ine
+yl oid
+yl phosph
+yl meth
+Ġthir st
+Ġthir ties
+Ġyears and
+Ġfem ap
+Ġfem urs
+Ġfem oris
+omet abolic
+Ġhist ocytes
+Ġhist ograms
+Ġhist ogenetic
+Ġhist ocompatibility
+Ġhist oplasma
+io tical
+io va
+io vision
+00 3
+00 6
+00 7
+00 9
+00 400
+00 872
+Ġparen theses
+Ġparen teral
+Ġeth idium
+Ġlo x
+Ġlo an
+Ġlo ud
+Ġlo osen
+Ġlo oks
+Ġlo hman
+Ġlo vd
+Ġcancer ous
+Ġcancer ization
+Ġgu ilt
+Ġgu yatt
+Ġgu anidium
+Ġgu imara
+Ġgu ilty
+Ġes co
+Ġes ters
+Ġes rs
+Ġes cher
+Ġfl are
+Ġfl ame
+Ġfl orescent
+Ġfl anks
+Ġfl asks
+Ġfl apless
+Ġfl uconazole
+Ġfl orence
+ick s
+Ġarch iving
+Ġarch eological
+Ġarch imedes
+Ġnec ros
+Ġnec toric
+Ġnec issity
+ock a
+Ġstress ogenic
+Ġoste ons
+Ġoste ointegr
+Ġoste ogenetic
+Ġoste omeatal
+Ġoste omacs
+Ġoste odyst
+Ġatt in
+Ġatt ga
+Ġiniti ators
+Ġdimension less
+ount able
+Ġcaus ally
+Ġprof itability
+ox in
+ox il
+ox ically
+Ġbrush er
+Ġbrush ers
+Ġintra vent
+Ġintra uter
+Ġpul pless
+Ġvi i
+Ġvi rous
+Ġvi rometer
+Ġda q
+Ġda vis
+Ġda eg
+Ġda iry
+Ġda unting
+Ġda vidopo
+Ġsl c
+Ġsl r
+Ġsl id
+Ġsl ated
+Ġsl ip
+Ġsl ang
+Ġsl active
+Ġsl itting
+Ġsl ash
+Ġsl oter
+Ġsl ums
+Ġsl umped
+Ġang er
+Ġang ell
+Ġschool work
+Ġhyp ophosphate
+Ġhyp hal
+Ġhyp hens
+Ġhyp eresthesia
+Ġhyp oreflective
+Ġhyp opne
+Ġhyp ofunction
+Ġperformance previous
+Ġmajor ities
+cess ed
+cess es
+cess ing
+Ġcomb ating
+Ġcomb ionts
+Ġcomb inatory
+Ġcase i
+Ġcase ating
+Ġfe et
+Ġver acity
+Ġver tex
+Ġver gata
+Ġver tigo
+Ġver ocay
+Ġexpos ition
+Ġperce ives
+Ġperce ivable
+Ġsens es
+Ġsens ing
+Ġsens itivities
+Ġmat os
+Ġmat ures
+Ġmat te
+Ġmat ru
+Ġmat the
+Ġmat tsson
+Ġmat suda
+Ġmat urational
+ane a
+Ġvit ally
+Ġvit tek
+Ġvit apan
+ogen y
+ogen es
+ri ad
+ri age
+ta u
+ise ly
+Ġanaly is
+Ġanaly tes
+Ġ5 70
+Ġ5 50
+Ġ5 74
+Ġ5 14
+Ġ5 30
+ety angkul
+Ġvol itional
+Ġvol tages
+Ġphys ico
+Ġep on
+Ġep iph
+Ġep imer
+Ġep itope
+Ġep ulis
+Ġep iflu
+Ġsol o
+Ġsol utes
+Ġsol icit
+Ġsol icited
+av olt
+onic ity
+Ġadhes ions
+Ġps k
+Ġps ipred
+Ġhard y
+Ġhard en
+Ġproduc er
+Ġproduc ers
+Ġred ress
+Ġred ox
+Ġred acted
+Ġred irect
+Ġred undant
+Ġred istrib
+Ġred undancy
+Ġrepresent ations
+Ġcontr actile
+Ġcontr acting
+Ġwater lines
+Ġmem arian
+Ġmem orize
+Ġsurve ymonkey
+Ġabs ciss
+Ġnorm oxic
+Ġnorm oxia
+Ġnorm odiver
+sequ ential
+con cluded
+con vuls
+con cerning
+Ġchange over
+ound ecanoic
+Ġnew man
+Ġnew bor
+Ġnew born
+ins chaft
+Ġliter al
+ral ised
+Ġfluor ine
+Ġfluor ochemical
+Ġfluor ometry
+Ġfluor ometer
+Ġfluor osed
+Ġfluor chrome
+ks an
+Ġsing apore
+Ġmor in
+Ġmor row
+Ġmor gell
+Ġmor adzadeh
+Ġmor ishita
+sc s
+sc an
+sc ov
+sc ale
+sc aling
+Ġvalid ates
+Ġcompl iment
+Ġcompl utense
+Ġpulp o
+Ġlength y
+Ġlength ened
+Ġlength ways
+Ġbias ing
+Ġcap b
+Ġthick ens
+Ġthick eners
+Ġthick ener
+Ġrecord ers
+Ġimpact on
+cal cemia
+Ġprov oked
+Ġmoder ator
+Ġbeing s
+Ġyoung sters
+Ġcross lin
+Ġcross checked
+Ġacid ified
+Ġacid ov
+Ġday care
+Ġday lighting
+Ġref ired
+Ġref use
+Ġref iring
+Ġref using
+Ġref works
+Ġref iltering
+Ġref actored
+Ġhos kins
+Ġhos hina
+co ating
+co vsky
+Ġceph ems
+Ġestim ators
+Ġload cell
+Ġhum eral
+Ġhum ane
+Ġdm a
+Ġdm d
+Ġdm so
+Ġdiab ru
+Ġmid i
+Ġmid gest
+Ġmid orb
+Ġmid day
+Ġmid points
+Ġmid crestal
+hol z
+irm ing
+Ġpers ian
+Ġpers uade
+Ġhospital ised
+Ġbiof unctions
+Ġwid en
+Ġwid est
+Ġpoly gen
+Ġpoly hex
+Ġpoly eth
+Ġpoly lines
+Ġpoly amide
+Ġpoly vidone
+Ġpoly ester
+Ġpoly prop
+Ġpoly tom
+Ġpoly wave
+Ġpoly but
+Ġpoly dimethyl
+Ġpoly lactic
+Ġpoly techn
+Ġpoly arylether
+Ġpoly choric
+Ġpoly pharm
+Ġservic emen
+Ġsu icidal
+Ġeven ed
+Ġach ili
+Ġach ondrodysplasia
+Ġcategor ise
+Ġcategor isation
+Ġpa x
+Ġpa ys
+Ġpa ved
+Ġpa rotic
+Ġpa epe
+Ġpa olon
+Ġpa rod
+Ġpa jn
+Ġpa edodontists
+Ġpa olanton
+Ġpa resthesia
+Ġpa etyangkul
+Ġdiagnostic ally
+Ġext ant
+Ġext ubated
+Ġext inction
+Ġext roversion
+Ġgood s
+Ġachie vability
+ou ver
+ou fia
+ou jeni
+Ġlab ile
+Ġlab ially
+Ġoh b
+Ġoh tsuki
+Ġlif ts
+Ġlif ted
+Ġlif ting
+Ġlif ecy
+Ġlif ecourse
+Ġbuc ci
+Ġbuc hner
+Ġeight eeth
+Ġpap ain
+Ġpap ular
+Ġpap yr
+Ġpap ua
+Ġpap anic
+Ġreli ant
+Ġreli ance
+Ġmicrob ially
+Ġmicrob alance
+Ġresin ous
+Ġtum efaction
+Ġsequ els
+Ġsequ estration
+Ġwhe els
+Ġvarious ly
+xi as
+Ġscre eching
+Ġu i
+Ġu w
+Ġu tr
+Ġu iv
+Ġu fl
+Ġu isn
+Ġu veitis
+Ġerr ant
+Ġerr oneous
+Ġwill mann
+Ġaut och
+Ġaut onomic
+Ġaut oph
+Ġaut ograft
+Ġaut opolymer
+Ġaut ocorre
+Ġaut orefraction
+ps ka
+Ġret ina
+Ġret arded
+Ġret ests
+Ġret inopathy
+Ġhab er
+Ġlight en
+Ġlight ning
+Ġlight cycl
+Ġsuper oxide
+Ġsuper iors
+Ġsuper ficially
+Ġsuper fi
+Ġsuper family
+Ġsuper aural
+Ġsuper fine
+Ġsuper charged
+Ġsuper intendence
+Ġcephal ography
+Ġreduced ebr
+Ġfract ography
+Ġlas so
+Ġalveolar is
+Ġcountr yside
+anti al
+anti aca
+aken ed
+vir us
+Ġlay down
+Ġlay pers
+Ġtraining s
+Ġdig e
+Ġdig imatic
+Ġdig lycidyl
+Ġdig oxin
+Ġimmun ogenic
+Ġimmun oph
+Ġimmun osen
+Ġimmun opathological
+Ġimmun ochemistry
+Ġimmun ologists
+Ġimmun ogold
+Ġbel ly
+Ġbel ts
+Ġbel ated
+Ġbel arus
+Ġrecomm edation
+Ġmen g
+Ġmen opausal
+Ġmen oufia
+Ġul m
+Ġul teriorly
+Ġseg uro
+Ġseg elnick
+Ġseg former
+Ġsymptom less
+Ġbuccal e
+Ġvers e
+Ġvers ican
+Ġvers atility
+Ġsocial ize
+Ġsocial ization
+Ġsw an
+Ġsw ay
+Ġsw ish
+Ġsw ord
+Ġsw aps
+Ġsw irling
+Ġsw inehart
+Ġsyn thetized
+Ġsyn onyms
+Ġpd a
+Ġpd hs
+Ġpow ers
+Ġthem e
+Ġthem atic
+Ġcult urable
+af a
+af e
+af ield
+af old
+Ġirr itants
+Ġirr itations
+Ġpat el
+Ġpat ching
+Ġpat ters
+Ġpat ni
+Ġpat ented
+Ġpat rols
+Ġexp ired
+Ġexp iration
+Ġexp ansive
+Ġaffected subjec
+Ġdeg li
+Ġdeg idi
+Ġdeg reased
+ogn omy
+Ġsuccess ors
+Ġsuccess ively
+Ġ20 45
+Ġsti ppl
+Ġdispl aces
+Ġod i
+Ġod orous
+Ġod hl
+Ġod ynoph
+to oth
+to fore
+to omb
+to uch
+ople gic
+Ġinitial ized
+Ġinitial izing
+Ġsum c
+Ġsum s
+Ġsum ac
+ind ered
+ind eed
+ind entation
+Ġlog an
+Ġnet osis
+Ġnet tle
+Ġadd itonal
+Ġadd itives
+Ġallow ance
+Ġprofession ally
+way hi
+Ġprom ised
+Ġequ itable
+Ġequ ilibr
+Ġequ idist
+Ġwear s
+omy ces
+omy tes
+omy coses
+Ġmes ang
+Ġmes ofacial
+Ġmes oph
+Ġmes oporous
+Ġ4 000
+Ġ4 04
+Ġ4 20
+Ġ4 47
+Ġpractic ality
+Ġintern asal
+Ġ6 20
+Ġ6 60
+Ġ6 83
+Ġfoc ally
+Ġmarg ination
+Ġmarg olis
+Ġest udos
+Ġax in
+Ġax illa
+Ġax haus
+Ġax elsson
+Ġax yprep
+Ġax iovision
+Ġprem ixed
+Ġprem edication
+Ġprem aturity
+Ġprem adasa
+Ġadm it
+Ġadm ira
+Ġadm ixture
+Ġcontin ent
+Ġcontin ually
+Ġsystematic s
+Ġsystematic al
+Ġnormal ities
+Ġnormal ised
+Ġnormal izing
+Ġnormal ising
+Ġprofessional ism
+Ġta urate
+Ġta hani
+Ġta hm
+Ġta acatt
+Ġta ichung
+Ġfib ered
+Ġfib roma
+Ġintere set
+Ġlocal izing
+Ġlocal izations
+Ġstrong yloid
+Ġespec ialy
+Ġfree zers
+Ġmm hg
+ih iro
+ih ilator
+Ġgo iter
+Ġgo zel
+Ġgo udarzi
+Ġgo etz
+Ġgo iania
+Ġlife times
+iel le
+ang ent
+ang ing
+Ġantib iotical
+Ġgel man
+Ġprogram ing
+Ġagree ing
+Ġagree able
+Ġexperimental group
+Ġclos et
+vari ous
+Ġct an
+Ġct ab
+Ġprote omic
+Ġprote omics
+Ġprote olytic
+Ġprote asomal
+Ġte o
+Ġte at
+Ġte ens
+Ġte ichmann
+Ġprec arious
+Ġprec erebral
+Ġprec edence
+Ġprec urved
+ero virus
+Ġlinear ized
+Ġrot ate
+Ġpros thetical
+Ġpros kauer
+Ġfinal ized
+Ġfinal ization
+Ġfinal izing
+Ġele gant
+Ġdom s
+Ġdom inate
+Ġbo il
+Ġbo ots
+Ġbo oster
+Ġbo oked
+Ġbo ley
+Ġbo oks
+Ġbo iled
+Ġbo iling
+Ġbo osted
+Ġbo geym
+Ġbo ferroni
+ival is
+Ġpan as
+Ġpan outs
+Ġpan cher
+Ġpan phot
+fact orily
+Ġhal le
+Ġhal ved
+Ġhal othane
+Ġtool bar
+Ġdeep ithelial
+Ġsatis factorily
+Ġstep ano
+Ġhyper active
+Ġhyper activation
+Ġhyper cellular
+Ġhyper mes
+Ġhyper mineralized
+Ġhyper cap
+Ġhyper plane
+Ġhyper algesic
+Ġhyper mobility
+Ġhyper calcemia
+inc ter
+Ġreason ing
+Ġreason abl
+ink le
+Ġwork up
+Ġwork and
+Ġwork group
+Ġwork day
+Ġwork force
+Ġwork days
+Ġwork places
+Ġcp us
+Ġcp ap
+Ġble ed
+Ġble ached
+Ġble kinge
+Ġ7 10
+Ġ7 53
+Ġ7 22
+Ġ7 46
+abl ly
+Ġresid es
+Ġaffect ation
+Ġcycl in
+Ġcycl ophosph
+Ġcycl ooxygenase
+reg or
+reg ular
+reg istr
+Ġelec ted
+Ġelec tir
+Ġelec toral
+Ġact ors
+Ġconstr ue
+Ġconstr aining
+Ġnecess ities
+oma uro
+ogenic ity
+ont on
+ont ocl
+Ġbiom ineral
+Ġbiom odulatory
+Ġbiom echenich
+roph oretic
+Ġcommun ality
+Ġcommun icates
+Ġvir idans
+Ġunders ide
+Ġlayer ing
+ych lor
+ych osocial
+arch ae
+Ġtong ren
+Ġtong ues
+Ġtong ji
+Ġspl its
+Ġspl ice
+Ġspl inting
+Ġpock ed
+och eck
+Ġhead ed
+Ġhead ing
+Ġhead rest
+Ġhead light
+Ġhead board
+Ġcontrast ingly
+Ġdel ated
+Ġdel ves
+Ġdel mop
+Ġdel phi
+Ġecc entric
+Ġinduc ible
+Ġmorph ometry
+Ġauthors hip
+etr a
+etr ies
+etr ix
+own s
+az e
+az ione
+Ġsus pects
+Ġsus pecting
+Ġclinic gpt
+oy ed
+oy ance
+Ġpsych otic
+Ġpsych ometrically
+Ġpsych osomatic
+Ġpsych oneurolog
+Ġenh ancer
+Ġzero ed
+Ġsr y
+Ġsr pska
+Ġml in
+Ġml ps
+Ġcement oid
+Ġmut tuk
+Ġmut uelle
+ros ensory
+ros timulation
+Ġrough ed
+Ġsk ieller
+Ġsk yroc
+Ġsk ottrup
+Ġsk yscan
+Ġdivid er
+Ġdivid es
+Ġstate wide
+Ġpur posed
+Ġpur ged
+Ġpur ported
+Ġpur ports
+Ġpur ulent
+Ġpur posively
+Ġnine fold
+Ġreflec tions
+Ġreflec tor
+Ġsumm ative
+Ġstim ulations
+Ġfil ing
+Ġfil ament
+Ġfil iform
+Ġfil iation
+Ġcolor ation
+Ġcolor ant
+Ġcolor ants
+Ġcolor imeter
+Ġcolor imetry
+Ġadmin strate
+Ġadv ises
+Ġsour ced
+Ġsour cing
+Ġartic o
+Ġartic ulated
+Ġutil izations
+ov ascular
+ov olt
+Ġil s
+Ġx q
+Ġx u
+Ġx in
+Ġx ing
+Ġx un
+Ġx age
+Ġx yle
+Ġx cp
+Ġx iang
+Ġx ho
+Ġx erogenic
+Ġlip oma
+Ġlip ogenesis
+Ġlip osarcoma
+Ġlip osomal
+Ġlip pert
+Ġlip oxygenase
+Ġlip ophilic
+Ġlip ofect
+Ġconnec ticut
+osph onate
+osph aera
+Ġhyd rated
+Ġchem ibis
+Ġnor a
+Ġnor the
+Ġnor rh
+Ġnor wich
+Ġsubst andard
+Ġback ed
+Ġback wards
+Ġback prop
+Ġback step
+Ġback log
+Ġgene jet
+Ġgene pharma
+Ġproportion ate
+bl ing
+bl ue
+bl ood
+bl otted
+Ġpol ice
+Ġpol ling
+Ġpol imer
+Ġpol astr
+Ġpregn ancies
+Ġgrad ation
+Ġgrad able
+Ġgrad ers
+cep tions
+Ġinvas iveness
+Ġinvas ivity
+Ġview points
+Ġchronic ity
+Ġcond ense
+Ġcond ylectomy
+Ġcond oms
+Ġhp mc
+Ġconcentr ically
+Ġepithel ia
+Ġepithel ization
+read ing
+read ability
+Ġregular ized
+Ġmicrobi otas
+lor odih
+Ġshort listed
+Ġtoothbrush er
+Ġtoothbrush ed
+Ġ9 10
+Ġ9 15
+Ġ9 18
+Ġ9 73
+Ġunderstand ably
+Ġunderstand ings
+cin ated
+cin ate
+Ġsqu eezing
+Ġsqu alane
+Ġtra ebert
+Ġtra etment
+Ġtra fford
+Ġtra versing
+Ġcalcul i
+Ġcalcul ators
+Ġpolymer ised
+Ġpolymer izes
+Ġpolymer isation
+Ġ8 000
+Ġ8 10
+Ġ8 89
+Ġ8 56
+Ġ8 60
+Ġlear ner
+Ġlear nt
+Ġsitu ational
+Ġoptim e
+Ġoptim ise
+Ġwa al
+Ġwa it
+Ġwa ited
+Ġwa als
+Ġwa hl
+Ġwa hn
+Ġwa had
+Ġbor uta
+Ġbor oujeni
+imin odi
+Ġattrib uting
+Ġphot ometer
+Ġphot omedic
+Ġphot ocop
+ext ct
+Ġrelevant ly
+Ġms m
+Ġms r
+Ġms ws
+Ġbre f
+Ġbre ach
+Ġbre eding
+Ġbre au
+Ġbre vis
+Ġbre vund
+Ġbre asor
+Ġsubs ide
+Ġsubs umes
+Ġsubgroup ed
+Ġinstruc tive
+me asure
+me yer
+me asures
+me aning
+Ġrecor der
+ru ity
+ru vate
+ocy anins
+ocy ante
+Ġaccord ed
+Ġens embled
+Ġens embl
+Ġtop ological
+Ġtop ographically
+Ġrecur ring
+Ġnational e
+Ġnational s
+Ġobes ogenic
+Ġtub ert
+Ġsil ences
+Ġsil enced
+Ġsil oxane
+Ġsil oranes
+Ġsil anization
+Ġmus savir
+Ġmus illi
+otyp ical
+Ġsn ap
+Ġsn ail
+Ġsn ored
+Ġsn odent
+Ġsn eezing
+Ġsn orting
+Ġsn odds
+Ġsn ellen
+Ġcd nas
+Ġcd kn
+Ġcd fc
+Ġcd mem
+Ġcd rc
+Ġcoll ation
+Ġcoll age
+Ġcoll ateral
+Ġcoll ins
+Ġcoll prot
+Ġcoll agens
+Ġappropri ates
+Ġclean up
+Ġclean ers
+com as
+com parative
+com parisons
+Ġtit ration
+Ġtit ratable
+rop ores
+rop athy
+Ġster cher
+Ġster noc
+Ġtoothp icks
+eric a
+Ġcir au
+Ġcir cinate
+Ġrecru its
+Ġpen ding
+Ġpen light
+Ġpen alty
+Ġpen nington
+Ġbar on
+Ġbar ts
+Ġbar cel
+Ġbar ata
+Ġbar code
+Ġbar rel
+Ġbar bed
+not ably
+aps ular
+Ġprotein uric
+Ġcarious ly
+Ġill ino
+Ġmaintain ers
+Ġ201 70
+rix oma
+Ġeas iness
+Ġprep uberal
+uter ized
+Ġvisual isation
+Ġemploy ability
+Ġfunctional s
+Ġfunctional ize
+Ġfunctional ization
+Ġlingual ized
+Ġlingual ization
+Ġincub ating
+Ġreporting s
+Ġavoid s
+Ġcod ers
+Ġcod ings
+Ġten uous
+Ġten acity
+Ġten nis
+Ġexpected ly
+Ġprol apse
+Ġmagn um
+Ġmagn ified
+Ġmagn ets
+Ġmagn ifying
+Ġmagn eto
+Ġpneum onic
+Ġpneum ophil
+Ġpneum ocys
+Ġreal ization
+Ġreal izes
+Ġorgan ise
+Ġorgan ising
+Ġorgan izes
+Ġorgan ole
+Ġdirection ally
+Ġhydro lytically
+Ġhydro dynamic
+Ġalg ahe
+ax ceph
+pre p
+Ġmineral ize
+Ġmineral izing
+Ġic p
+Ġic r
+Ġic at
+Ġic eland
+Ġobjec tivity
+Ġbro ers
+Ġbro ach
+Ġbro der
+Ġbro ward
+Ġbro ok
+Ġbro oks
+Ġbro ws
+Ġbro wser
+Ġbro chures
+Ġnas opalatine
+Ġnas iolabial
+Ġread able
+Ġread iness
+Ġgenetic ist
+Ġzir cad
+Ġheter ologous
+Ġheter ogenetic
+Ġheter omeric
+ibr ated
+Ġultr acle
+Ġbur t
+Ġbur dened
+Ġsee ks
+Ġparti tion
+Ġtrials non
+Ġtrials quasi
+uro us
+uro xim
+Ġtend on
+Ġdam on
+Ġdam ped
+Ġhs l
+Ġhs ueh
+Ġhs ieh
+Ġtemper ament
+Ġge ared
+Ġge force
+Ġenc ore
+Ġenc ased
+Ġenc oraf
+Ġenc roaches
+Ġmy ofacial
+Ġmy ogenesis
+Ġmy rt
+Ġmy ocutaneous
+Ġmy ths
+Ġmy asthenia
+Ġmy riad
+Ġbu i
+Ġbu y
+Ġbu zz
+plas ties
+grad ing
+Ġmr is
+Ġmr onj
+Ġmr presso
+Ġhor n
+Ġhor se
+Ġhor ns
+Ġhor ani
+Ġev ans
+Ġev ade
+Ġev oke
+Ġev acuated
+Ġev agination
+Ġirradi ates
+Ġirradi ances
+Ġmill i
+Ġmill ard
+Ġmill isecond
+Ġmill igrams
+Ġstain er
+acti vities
+Ġinterven ed
+Ġinterven ing
+Ġphosph ine
+Ġphosph oprotein
+Ġphosph osil
+Ġbenef iting
+Ġepithelial ize
+Ġepithelial ized
+Ġsem inal
+Ġsem mel
+Ġdefin able
+Ġgran ular
+Ġgran atum
+pati ents
+Ġrecip e
+Ġmalign ity
+Ġfp n
+Ġinstrument ing
+Ġexpansion s
+Ġprepared ness
+Ġlig ate
+Ġlig ations
+Ġhem ocue
+Ġtren ding
+Ġmac es
+Ġmac arth
+Ġmac book
+Ġmac romo
+Ġmac pherson
+Ġmac ropores
+Ġhouse field
+Ġregen erating
+roc occus
+roc audal
+Ġsci enza
+Ġsci kit
+Ġcov r
+Ġminisc ule
+Ġexplain er
+Ġpapill ated
+Ġdebr iding
+Ġmedic o
+Ġmedic inal
+Ġweek days
+Ġultras tructure
+Ġultras hort
+cs b
+Ġrank les
+Ġflap ping
+Ġq in
+Ġq ude
+Ġq trap
+Ġve ins
+Ġtf h
+Ġsb d
+kers son
+Ġquanti le
+Ġquanti les
+Ġquanti kine
+Ġmar c
+Ġmar sa
+Ġmar itrix
+Ġmar riage
+Ġmust afa
+Ġbin ong
+Ġbin ning
+Ġbin imet
+Ġbin ominal
+Ġhom ed
+Ġhom ing
+Ġhom eless
+Ġhom onymous
+Ġhom olateral
+Ġhom emade
+Ġculture ware
+Ġdys gran
+Ġdys functional
+Ġdys gnathia
+Ġdys phor
+Ġdys kines
+Ġdys lipidemia
+Ġdys trophic
+Ġdys thym
+Ġdys phagia
+Ġmouthwas he
+Ġpocket of
+Ġess ence
+Ġess ay
+Ġess ix
+Ġpass ers
+Ġpass arge
+Ġpass aging
+Ġpass aged
+Ġpass word
+Ġpass iflora
+Ġpass ivated
+Ġoff ended
+Ġoff line
+Ġoff ending
+Ġra i
+Ġra hhal
+Ġaccept ably
+Ġfluid ity
+Ġcheck erboard
+Ġcand y
+Ġcop ied
+Ġcop ayment
+Ġcop rococcus
+arm ed
+Ġcf x
+Ġcf us
+Ġpast es
+Ġher b
+Ġher itable
+Ġher pex
+Ġher lof
+Ġher itage
+Ġher petic
+urs ors
+urs ive
+Ġcho i
+Ġcho oses
+Ġcho lewa
+Ġcho lecyst
+Ġcorrect ness
+Ġpm d
+Ġpm ns
+Ġtur co
+Ġtur ner
+Ġtur cica
+Ġtur rion
+Ġtur naround
+Ġtur ssi
+Ġnan ning
+Ġnan ogl
+Ġnan ograms
+Ġnan omolar
+Ġnan ohy
+Ġnan oplates
+Ġalcohol s
+Ġalcohol ism
+Ġrespect fully
+Ġfield work
+Ġadap tor
+Ġweight ings
+Ġsection ally
+Ġpor k
+Ġpor opl
+Ġdown growth
+Ġdown load
+Ġdown side
+Ġdown tur
+Ġdown graded
+Ġdown town
+Ġassign s
+Ġ19 2
+Ġ19 5
+Ġ19 10
+Ġ19 74
+Ġ19 95
+Ġ19 53
+Ġ19 32
+Ġ19 45
+Ġ19 30
+Ġ19 05
+Ġur zel
+Ġur jc
+Ġur anyl
+Ġmetast astic
+Ġmetast asized
+Ġder ives
+Ġder otate
+tric ted
+tric ably
+Ġenrol lees
+Ġphen ochlor
+Ġphen olic
+Ġphen yto
+Ġphen ylmeth
+Ġphen otypical
+Ġmanufact ures
+Ġtransfer able
+Ġtransfer ase
+Ġbonding s
+Ġaltern ated
+Ġaltern ating
+Ġaltern ately
+Ġchlor in
+Ġchlor ine
+Ġchlor oamin
+Ġchlor amines
+opath ogenicity
+Ġeng er
+Ġeng ages
+Ġblock er
+Ġblock ade
+he a
+he alth
+he iro
+he althy
+tt tg
+tt ga
+tt aga
+tt atc
+tt ggt
+Ġhd ock
+Ġinternal ised
+Ġent ers
+Ġent rus
+Ġent omb
+Ġent erovirus
+Ġmil ano
+Ġmil erad
+Ġmil grom
+Ġmil estones
+Ġmil ieu
+Ġgerm a
+Ġgerm icides
+Ġinte gu
+Ġinte ger
+Ġinte grading
+Ġdiet ing
+Ġundergo es
+Ġprolif erations
+Ġprolif erating
+Ġstre ate
+Ġstre aked
+Ġstre aks
+ili ans
+Ġsugar less
+Ġcyto lysis
+Ġcyto plasms
+Ġcyto hubba
+Ġcyto lethal
+Ġmis cell
+Ġmis fits
+Ġmis wak
+Ġmis reporting
+Ġmis cegen
+Ġmis placed
+Ġmis registr
+Ġlin fen
+Ġlater otr
+Ġnucle ase
+Ġnucle oli
+Ġbrux er
+Ġbrux ane
+Ġcirc uits
+Ġintegr ative
+Ġintegr ins
+Ġsa e
+Ġsa o
+Ġsa atch
+Ġsa quin
+Ġsa ifi
+Ġhence for
+abol ize
+Ġdiss ect
+Ġdiss ecting
+Ġdiss ociation
+Ġcad mium
+Ġretr ain
+Ġretr acting
+Ġcompreh end
+Ġcompreh ending
+Ġinteraction ist
+Ġiv a
+Ġiv y
+Ġaff lic
+Ġaff ording
+Ġaff inities
+Ġbirth ing
+Ġbirth year
+Ġna ip
+Ġna oh
+Ġna ples
+Ġna ito
+Ġna eij
+Ġna idu
+Ġna vicular
+Ġcarb onic
+Ġcarb olic
+Ġcyt ology
+Ġcyt ometer
+Ġcyt opathic
+Ġcyt osc
+Ġcyt osol
+Ġcyt oskeletal
+Ġcyt omegal
+Ġcyt ocompatibility
+Ġ" ,
+Ġ" .
+Ġ" ?
+Ġeuro pa
+Ġeuro cleft
+Ġeuro fins
+Ġeuro clone
+Ġplay er
+Ġplay ful
+Ġnex p
+ishing ly
+Ġcam phor
+Ġcam illeri
+Ġflex ing
+Ġflex ure
+Ġflex ibly
+Ġflex comp
+Ġnod ular
+Ġram seier
+Ġmake up
+for ces
+for having
+Ġcomputer ised
+Ġart ocar
+Ġpf es
+Ġpf au
+Ġpf apa
+Ġpf kfb
+Ġpf wb
+Ġpf alz
+Ġvr am
+Ġvr anckx
+Ġke en
+Ġke uls
+Ġke ystone
+Ġke bang
+Ġke elung
+Ġdemineral izes
+Ġminim a
+Ġminim ising
+Ġminim ises
+Ġot odental
+Ġpil ocar
+Ġinternational e
+fs r
+Ġfore ver
+Ġfore fr
+Ġspecif ical
+Ġreciproc ity
+Ġreciproc ates
+Ġisol a
+Ġmetabol ized
+Ġmetabol ised
+ittle ment
+Ġmachine able
+ped ed
+Ġhighl ands
+Ġmode er
+gg ini
+gg tc
+gg cttg
+Ġpp b
+Ġpp ts
+Ġrest less
+Ġrest rospective
+Ġpriv ately
+Ġsubjective ly
+Ġdetailed ly
+Ġcre ams
+Ġcre pitus
+Ġds m
+Ġds lr
+icular is
+Ġray leigh
+Ġalloc ates
+Ġobserv ably
+Ġemd ogain
+Ġmarginal ized
+Ġmarginal ization
+Ġenti tle
+Ġenti tled
+Ġsar vas
+Ġsar aj
+Ġsar scov
+Ġsar comas
+Ġfar s
+Ġfar ms
+Ġfar thest
+Ġ10 5
+Ġ10 18
+Ġ10 55
+Ġtrend ed
+Ġodont ostomat
+Ġodont ontocl
+Ġeurope ans
+oph or
+oph aryn
+oph obic
+oph obia
+oph leb
+Ġreconstr uct
+Ġreconstr ucting
+Ġcolle gians
+Ġguide book
+Ġleuk emia
+Ġleuk oar
+Ġoperator ies
+opl anin
+Ġoffic er
+Ġoffic ially
+Ġmg cl
+Ġpromo tive
+Ġacqu ires
+Ġacqu aint
+Ġacqu ainted
+Ġ12 3
+Ġ12 7
+Ġ12 00
+Ġ12 80
+Ġ12 62
+Ġgrade pro
+Ġviol in
+Ġviol ated
+Ġviol ating
+Ġincorpor ations
+the iss
+Ġindepend ents
+Ġillustr a
+Ġillustr ator
+Ġchlorhexidine in
+Ġfal ter
+Ġabr ade
+Ġarr hy
+Ġsubstanti ates
+Ġsubstanti vity
+Ġcoefficient in
+Ġcost a
+Ġcost ly
+Ġmd t
+Ġann ouncing
+Ġann ihilator
+Ġann oyance
+Ġmc af
+Ġmc erebr
+Ġmc clish
+Ġmc bride
+otoxic ities
+Ġchi u
+16 3
+16 5
+Ġga a
+Ġga ik
+Ġshe han
+Ġprin ce
+Ġsuperim posable
+ble eds
+alle bne
+atin ics
+Ġgain za
+Ġsept ation
+back a
+Ġcn y
+orph ic
+Ġbal samin
+Ġlact am
+Ġwil ks
+Ġwil mes
+Ġconver ts
+Ġconver ter
+Ġconver ge
+Ġconver ging
+Ġconver ters
+Ġparalle led
+Ġparalle ls
+Ġattend s
+Ġattend ant
+Ġattend ers
+Ġanswers for
+Ġasymm etries
+Ġmanifest ing
+Ġglobal ization
+aries lesion
+Ġlymph otox
+Ġlymph oblastic
+Ġlymph openia
+Ġlymph oplasm
+Ġlymph ovascular
+Ġprop els
+Ġprop ensities
+Ġprop anol
+Ġprop ulsion
+Ġprop ylene
+Ġprop enen
+Ġprop ionibacterium
+Ġdeb t
+Ġqual trics
+Ġameric as
+Ġtransm its
+Ġtransm uted
+Ġtransm issibility
+bal ancing
+bal jevic
+Ġsd a
+Ġsd g
+Ġsaf est
+Ġsaf ran
+Ġinj ure
+Ġinj uring
+Ġmig rants
+Ġscrew ing
+Ġscrew dri
+Ġcm b
+Ġcm v
+Ġrev o
+Ġste er
+Ġste ered
+Ġste enberg
+Ġste iner
+Ġste ffens
+Ġste adier
+Ġstem ness
+Ġstem med
+Ġcogn izant
+Ġbeg ets
+Ġmicrole vel
+Ġsummar izing
+Ġsummar ising
+Ġrepro cessing
+Ġtogether ness
+Ġsubm itting
+Ġsubm enu
+Ġsubm alnutrition
+Ġsubm illimet
+Ġemp athic
+Ġemp athy
+Ġemp athetic
+Ġemp yema
+Ġemp athized
+Ġmortal ities
+Ġcapt ures
+Ġepidem ics
+Ġgut ter
+Ġgut enberg
+Ġgut taper
+10 3
+Ġcall ao
+Ġcall osum
+Ġlat ches
+Ġacute ly
+Ġtherapeutic ally
+Ġinjur ious
+tes man
+Ġcc ts
+Ġcc agggt
+Ġrestric tive
+Ġweak ly
+Ġweak est
+Ġbasic ranial
+Ġcentrifug ated
+Ġcentrifug ating
+Ġcv c
+Ġhere tofore
+Ġcarcin osis
+Ġcarcin ogens
+Ġcarcin omatous
+Ġarab ian
+Ġreproduc es
+Ġreproduc tion
+Ġcore ceptor
+Ġstomat ologists
+Ġstomat otoxicities
+Ġoverl ay
+Ġoverl aid
+Ġoverl aying
+Ġdepend able
+Ġdepend ability
+Ġdepend ences
+Ġdepend encies
+Ġpersonal ities
+Ġpersonal ised
+Ġequal ization
+erv ised
+Ġalb ino
+Ġalb uquer
+Ġalb adri
+tm anea
+Ġtext ural
+ino lytic
+Ġdu oden
+Ġdu arte
+Ġtom ogram
+Ġtom ographies
+Ġtom ographs
+Ġtom orrow
+Ġhabit at
+Ġhabit ational
+Ġhabit ually
+Ġabras ions
+Ġhour glass
+Ġrat ers
+Ġrat aj
+Ġdepos iting
+ystal lisation
+Ġampl i
+Ġampl ifying
+Ġampl itudes
+Ġ05 5
+Ġremineral ized
+Ġremineral izable
+Ġcircum ferentially
+Ġcircum ferential
+Ġcircum vents
+Ġcircum vented
+Ġcircum pubertal
+Ġtherm ally
+Ġtherm ometer
+Ġtherm odynamics
+Ġtherm osetting
+Ġbes chwer
+Ġretain ment
+Ġprotr ude
+Ġprotr acting
+Ġprotr actor
+Ġdegrad es
+Ġkit ami
+Ġtnf p
+Ġtnf aip
+Ġmic o
+Ġvas eline
+Ġvas odil
+Ġvas ospas
+Ġvas oreactivity
+Ġrd b
+Ġrd p
+Ġrob bery
+Ġrob ledo
+Ġcounter balanced
+Ġcounter produc
+Ġcounter mom
+Ġcounter vail
+Ġcounter measures
+Ġcounter balancing
+Ġdirec ting
+Ġdirec tives
+bo tic
+bo ured
+bo emb
+Ġthin ness
+Ġthin ned
+lys iloxane
+irect club
+Ġsecre tary
+Ġsecre tory
+Ġactual ized
+itation diss
+Ġincom ing
+Ġheat ers
+Ġ16 0
+Ġ16 8
+Ġ16 9
+Ġ16 38
+Ġfloss ed
+Ġcontinu ation
+Ġcontinu ity
+va art
+va uthan
+Ġana esthes
+Ġker atitis
+Ġker ato
+Ġker nels
+Ġcondyl oma
+uan ide
+Ġincid ental
+Ġposts econd
+Ġbio trans
+Ġbio abs
+Ġbio elec
+Ġbio assays
+Ġbio quant
+Ġbio archae
+Ġbio activities
+Ġbiops ychosocial
+Ġulcer osa
+Ġconcerning ly
+pal uk
+Ġou ellet
+Ġcreat ors
+Ġstaff ing
+Ġnh c
+Ġnh ok
+Ġwire frames
+Ġconcept ually
+Ġ200 2
+Ġ200 00400
+Ġwestern ized
+Ġwestern ised
+Ġhost ing
+Ġnav igating
+Ġplastic ity
+Ġplastic ize
+Ġplastic ally
+Ġplastic ized
+Ġplastic izers
+Ġtor ques
+Ġden ys
+Ġden atures
+Ġden uded
+Ġden atured
+Ġbs a
+Ġbs m
+Ġexclud er
+Ġdeform ed
+Ġdeform aties
+Ġdisp ute
+Ġdisp elling
+Ġcs r
+Ġcs bss
+Ġgraph y
+Ġgraph ing
+Ġgraph itic
+Ġperf etti
+Ġperf luoron
+Ġscoring s
+Ġosteocl asis
+Ġemphas ise
+Ġemphas ised
+Ġide ation
+Ġbis ected
+Ġnar umi
+Ġgre mbow
+Ġord ination
+Ġord inate
+Ġexc ited
+Ġexc ise
+Ġexc isions
+Ġexc ursion
+Ġexc ursive
+Ġactinomycetemcomit an
+Ġtap es
+Ġtap ers
+Ġtap ering
+Ġtap puni
+Ġtap iova
+Ġtheore tic
+Ġox ogl
+Ġox ford
+Ġox imetry
+Ġox irane
+Ġox ysterols
+Ġdil ator
+Ġdil ute
+Ġdil uting
+Ġdil igent
+Ġdil uent
+let ter
+Ġemo tion
+Ġamino ethyld
+Ġamino acid
+Ġkap p
+15 6
+15 9
+15 842
+ca att
+ca aa
+ca atcc
+ca aat
+Ġfun gemia
+Ġwash ability
+Ġwash bas
+odem us
+Ġrad ix
+Ġrad ically
+Ġrad nz
+Ġcrystal ized
+Ġcrystal eye
+Ġfeature d
+Ġelectron ics
+Ġstrept oz
+Ġstrept avid
+Ġincomple teness
+Ġpis as
+Ġatten uate
+Ġenl isted
+Ġenl ightened
+Ġenl ightening
+Ġenl arging
+Ġdestr ucted
+Ġdestr ucting
+Ġjoint point
+Ġsociodem ographics
+de fin
+rup licate
+Ġuc m
+Ġuc hime
+Ġah n
+Ġah plus
+Ġpac ific
+Ġpac emakers
+Ġanomal ous
+Ġstart led
+Ġgc df
+Ġras ines
+Ġras hes
+Ġras pator
+Ġsound ness
+Ġdeclar ing
+Ġdeclar ations
+Ġstreptococ cal
+lect rophoretic
+Ġcarbon ization
+Ġcarbon izations
+Ġintrac artilaginous
+Ġintrac ardiac
+Ġremod eled
+Ġabsorb ent
+Ġmacro scopy
+Ġmacro gl
+Ġmacro porosity
+Ġmacro scale
+Ġaffili ations
+Ġsed ative
+Ġsed extct
+Ġlink ages
+Ġaction able
+Ġkin ins
+Ġfeas ibly
+Ġirrig ations
+Ġgeriatric s
+Ġinst antly
+Ġbott led
+Ġbott len
+ecal is
+Ġdemand ed
+Ġformula e
+Ġpredom inates
+Ġpredom inately
+Ġbinary zated
+Ġsent ence
+Ġmad a
+Ġmad unic
+Ġharm onic
+Ġacce ledent
+Ġadhere ns
+Ġkn it
+Ġkn ight
+Ġkn ocking
+Ġkn oop
+Ġkn ife
+Ġdivers ities
+Ġdivers ified
+Ġdivers ification
+Ġmetal s
+ole y
+pr ise
+pr asom
+pr imary
+Ġthor ax
+Ġthor nton
+Ġpack ing
+Ġinh ale
+Ġdg as
+Ġdg pro
+Ġdg kj
+Ġdich otomy
+Ġdich lorodih
+Ġblack s
+Ġosse o
+Ġskin ner
+Ġretrie vable
+Ġom it
+Ġom ari
+Ġom ission
+Ġom fs
+Ġom fr
+Ġom nist
+Ġom pds
+Ġrein formed
+Ġrein vented
+Ġrare fied
+Ġedge file
+Ġfiber optic
+Ġsusp ensory
+Ġxerost omic
+Ġsulf o
+Ġsulf ated
+Ġsulf onic
+Ġsulf adiaz
+Ġnarrow s
+Ġinadequ acy
+Ġinadequ ately
+Ġinadequ acies
+Ġmun ster
+Ġconc ession
+Ġconc rete
+Ġconc iseness
+Ġconc isely
+Ġvene ered
+Ġspect acle
+Ġcurv um
+Ġcurv iline
+Ġrobust ly
+Ġdichotom izing
+fa ecalis
+kk o
+lin i
+Ġtactile ly
+Ġpu han
+Ġpu zzle
+Ġfa ult
+Ġfa ith
+Ġmel le
+Ġmel ink
+Ġmel amine
+Ġmel phalan
+Ġmel kersson
+ister ium
+Ġhong al
+Ġld a
+Ġforward s
+Ġforward ed
+Ġforward ly
+umb ed
+Ġupr ighted
+Ġemb odied
+Ġemb arked
+Ġsmooth ing
+Ġbroad ening
+Ġbroad cast
+Ġmacroph agic
+Ġbreath er
+Ġbreath ed
+Ġbreath ers
+Ġswe ats
+Ġcustom s
+Ġcustom ers
+Ġcustom ization
+Ġcustom arily
+ank ara
+Ġben ha
+Ġben net
+Ġvestib ules
+Ġvestib ulum
+Ġcortical is
+Ġcolour ing
+Ġ14 3
+Ġ14 5
+Ġ14 8
+Ġ14 65
+Ġelastom ers
+Ġdifferential s
+Ġcdt abc
+Ġcat s
+Ġcat ered
+Ġcat ogor
+Ġcat arina
+Ġcat abolize
+Ġpaste urization
+Ġeg k
+Ġconv oluted
+Ġrt f
+Ġrt x
+Ġcontain ment
+Ġperiodont ologically
+Ġperiodont opathogen
+Ġpron amel
+Ġinterm odal
+press ant
+Ġhypochlor ous
+Ġprovision ally
+Ġauthor itarian
+Ġeasy q
+Ġfaecal i
+Ġfaecal ibacterium
+89 5
+Ġog den
+Ġog awa
+Ġwar n
+Ġwar ren
+Ġwar ms
+Ġwar ned
+Ġwar ns
+Ġwar ped
+Ġwar angkul
+Ġwhit ley
+Ġarth roscopy
+Ġarth ritic
+Ġarth rocent
+Ġelect rostimulation
+Ġdistinct ly
+Ġdistinct ness
+Ġthorough ness
+13 5
+13 7
+13 9
+13 12
+13 99
+sin us
+sin ce
+Ġcast es
+Ġcast ing
+Ġec x
+Ġec ops
+Ġec ologies
+Ġec chym
+Ġec kert
+Ġorient ated
+Ġprev ails
+Ġprev ocheck
+Ġlet ting
+Ġphenomen ology
+Ġacceler ator
+hth alene
+Ġion t
+Ġion ized
+Ġion ization
+Ġion ian
+Ġion ically
+Ġion izes
+Ġion omers
+Ġcath eters
+Ġfast x
+Ġfast ening
+Ġfast qc
+Ġfast prep
+Ġdw arfism
+Ġhif u
+Ġstabil ies
+Ġstabil ise
+Ġstabil ising
+Ġcongen iti
+Ġresour ced
+Ġattain able
+Ġdisag greg
+Ġclar ifications
+Ġups ide
+Ġmoti f
+Ġcurric ular
+Ġactiv ion
+Ġsmear ing
+Ġdegen erated
+Ġphoto irr
+Ġphoto electric
+Ġcolonies was
+be in
+be zo
+be havioral
+net b
+Ġoffer ings
+Ġnc cls
+Ġnow here
+Ġnow zari
+Ġgover ning
+Ġgover ns
+Ġrin n
+Ġsouth ard
+Ġsouth west
+Ġ11 7
+Ġ11 8
+Ġapplic ant
+Ġarchitect ural
+Ġlabel er
+Ġmouthwashes can
+Ġtetr ameth
+Ġtetr aacetic
+Ġather othrom
+Ġfif ties
+Ġhar z
+Ġhar bor
+Ġhar sh
+Ġhar assed
+Ġhar sher
+Ġhar akiri
+Ġhar boured
+Ġhol an
+Ġhol low
+Ġhol berg
+Ġhol otox
+Ġhol opros
+Ġhol chberg
+Ġgas zyn
+Ġgas lini
+Ġperm uting
+Ġcompress es
+Ġdiff uses
+Ġdiff raction
+Ġcover ings
+Ġconservative ly
+Ġquad ri
+Ġquad hel
+Ġquad ruplicate
+Ġuns olid
+Ġuns tick
+Ġuns afe
+Ġswallow ed
+Ġcorrespond ent
+Ġgranul omatosa
+12 1
+12 5
+12 36
+Ġcit rull
+Ġground ed
+Ġintergroup s
+crib e
+Ġprofil er
+Ġprofil ed
+Ġprofil ing
+Ġequip ping
+Ġequip oise
+Ġramec group
+Ġgreen ish
+Ġgreen ery
+Ġgreen gene
+Ġgovern ates
+Ġslow s
+Ġslow ed
+Ġow ning
+Ġhr ct
+Ġlist e
+Ġlist ened
+Ġcarri ere
+Ġmeaning less
+Ġhydroxy prop
+Ġouts ourced
+Ġsubtyp ing
+Ġpseud arth
+Ġpseud ocyst
+70 8
+bor g
+bor ate
+Ġsen iors
+Ġput ties
+Ġpay or
+Ġpay ers
+Ġfm pos
+Ġfm pm
+Ġstop pers
+Ġgi essen
+Ġgi emsa
+Ġextension s
+Ġextension al
+Ġclus talw
+Ġsubstr atum
+Ġcoron oid
+Ġ13 44
+Ġdraw s
+Ġdraw ings
+Ġnanop rec
+Ġsweet ener
+Ġeryth roid
+Ġeryth rocytes
+Ġeryth rosine
+Ġeryth ritol
+Ġter a
+Ġter rain
+Ġantic ariogenic
+Ġantic onvuls
+Ġmir on
+Ġmir na
+Ġmir nas
+Ġstom fak
+omer ated
+omer isation
+Ġvar icella
+Ġscar less
+Ġ18 0
+Ġ18 3
+Ġ18 5
+Ġ18 73
+Ġoccup ies
+Ġgradu ations
+Ġcathep sins
+Ġnanopartic ulate
+med a
+Ġsi ategories
+Ġing ress
+Ġing ots
+Ġing britt
+Ġnig ro
+Ġcomfort ably
+Ġmeh ta
+Ġmeh ra
+Ġscr ambled
+Ġround ing
+Ġnoti fy
+Ġmoun tain
+Ġimmers ive
+Ġparent age
+Ġvolunte ering
+Ġenlarge ments
+50 9
+ydr ified
+ydr amine
+Ġple ase
+Ġple ural
+Ġple asing
+Ġple asure
+Ġple thora
+Ġple asurable
+Ġangi ography
+Ġangi opo
+Ġfair ness
+Ġdim ax
+Ġdim itra
+acill in
+Ġrna imax
+Ġresol utive
+Ġacryl ate
+Ġacryl ics
+Ġacryl onitrile
+Ġadip ic
+Ġadip ocytes
+Ġadip oai
+Ġcla he
+Ġcla vicle
+Ġleg islative
+Ġunknow ingly
+Ġoutput voltage
+Ġmethan obacterium
+Ġmethan osarcin
+Ġmethan osphaera
+eptid ase
+Ġsolid ification
+Ġsolid ify
+Ġsolid ifying
+Ġsolid works
+Ġsolid solution
+Ġsuperv ising
+Ġsnp p
+Ġbottom s
+Ġoct enidine
+Ġoct acalc
+ange ments
+Ġbit ter
+Ġrm b
+Ġrm mas
+Ġrm sea
+Ġuniform ed
+Ġcortic otropic
+Ġstra umann
+Ġnons urg
+Ġnons tick
+Ġnons porulating
+Ġnons pecialist
+Ġpopular izing
+Ġolk in
+Ġdoctor al
+Ġfulfill s
+Ġfulfill ment
+23 19
+23 06
+gate kee
+tg aag
+Ġoxy dans
+Ġpull out
+Ġns d
+Ġns g
+Ġns p
+Ġns w
+ogl ossal
+Ġcool er
+Ġkh en
+Ġkh osra
+Ġkh iavi
+Ġoverc ame
+Ġoverc orre
+Ġdecont aminating
+Ġsimpl ifications
+Ġsimpl ifier
+Ġsimpl ifying
+Ġspr int
+Ġspr ays
+Ġspr ang
+Ġspr ague
+Ġspr inkle
+Ġformat s
+Ġopin on
+Ġgluc onid
+Ġgluc osyl
+Ġexpress ive
+Ġexpress ivity
+Ġhydrox ychlor
+Ġrepair ability
+Ġvarnish es
+Ġpush es
+Ġpush ing
+Ġinput ting
+Ġinput voltage
+Ġanth ocyanins
+Ġanter iors
+Ġanter olateral
+Ġfund s
+Ġmt f
+Ġmt wo
+Ġbad ly
+Ġrh oa
+Ġrh initis
+Ġrh izobium
+Ġchit ra
+opro fen
+Ġuncertain ties
+Ġelucid ation
+Ġpaediatric ians
+Ġarticular is
+Ġdiscrimin ated
+Ġdiscrimin ability
+Ġstraight ening
+Ġoxygen ated
+Ġoxygen ating
+mp uan
+Ġdiv isions
+acc ording
+acc agct
+Ġlibr arian
+imm igrants
+Ġgn omad
+Ġgn atium
+Ġital ic
+Ġpreschool s
+Ġpreschool er
+ught ered
+Ġmoist ness
+Ġliqu or
+Ġapproximal s
+Ġhydrogen ogen
+Ġhydrogen otrophic
+Ġempow erstats
+Ġrpd gf
+Ġhnscc s
+edic o
+Ġpit ts
+Ġpit fall
+Ġfed erated
+Ġfed erica
+Ġfine ly
+Ġmit f
+Ġmit ogen
+Ġmit oses
+Ġmit teilun
+Ġbul ge
+Ġbul ang
+Ġbul gar
+Ġreverse ly
+Ġstere oscopic
+Ġstere otyped
+Ġrig or
+Ġchrom a
+Ġchrom oblast
+Ġcompet ing
+Ġcompet ences
+Ġcompet encies
+Ġdisinf ective
+Ġabstr acted
+Ġ15 00
+Ġ15 189
+Ġautom atization
+Ġautom atized
+Ġtele visions
+Ġmultic rystalline
+Ġclaim ing
+Ġdc m
+Ġdc fh
+Ġdp c
+Ġdp as
+Ġdp bs
+Ġdp scs
+Ġmother board
+Ġscap hoid
+Ġtrain er
+Ġtrain able
+Ġunp acking
+Ġ30 4
+Ġ30 7
+Ġ30 216
+Ġmetagen omes
+obacter iace
+Ġpalat ogenesis
+Ġpalat ogingival
+Ġpalat oglossal
+Ġencod es
+Ġscience ll
+Ġpet erson
+Ġpet ersson
+Ġpet ermann
+Ġpet role
+Ġbic ortical
+Ġbic ycle
+Ġbic inch
+Ġlc d
+Ġlc u
+Ġrms prop
+Ġanalog ies
+Ġanalog ously
+Ġneural gic
+Ġunf inished
+Ġunf unded
+Ġunf oreseen
+Ġkind lin
+Ġdetr act
+Ġdetr itus
+Ġ00 25
+Ġzyg omaxillary
+Ġinspec ting
+Ġinspec tions
+Ġgloss y
+Ġgloss odyn
+Ġtransluc ence
+Ġmelan ocyte
+Ġmelan ocytic
+Ġmelan oblastic
+Ġanthrop ological
+Ġanthrop ology
+Ġprogramm atically
+58 0
+58 4
+58 63
+58 461
+eth ical
+Ġure ase
+Ġtp n
+Ġtas ked
+Ġpict ured
+Ġdf g
+Ġband pass
+Ġband eira
+Ġhu a
+Ġhu we
+Ġhu ifeng
+Ġhu umonen
+Ġdeposition s
+Ġscen ery
+Ġforest omach
+Ġobt use
+Ġemg s
+Ġsched uler
+Ġsched uling
+Ġdistress ing
+Ġdistress ful
+Ġohs ugi
+Ġdigitiz e
+Ġdigitiz er
+Ġdigitiz ing
+Ġstimul ant
+Ġstimul atory
+Ġstret cher
+Ġanteroposterior ly
+74 40
+74 85
+bi at
+enes ulf
+Ġpel leted
+Ġpeptid ase
+Ġpeptid yl
+Ġbb c
+Ġlp xtg
+Ġconce iving
+Ġconclud es
+Ġperfor ate
+Ġperfor ator
+Ġsep ts
+Ġsep tic
+chym e
+Ġneutr on
+Ġfold ers
+Ġarg yria
+Ġreflex es
+Ġnutrition s
+Ġnutrition ist
+Ġnutrition ists
+Ġthermocycl ed
+Ġattrition ed
+Ġembed s
+zo lyl
+Ġpog o
+Ġdon achie
+Ġren ewing
+Ġren net
+Ġren ders
+Ġren unciation
+Ġren min
+Ġgp ds
+Ġvast ly
+Ġrich er
+Ġrich est
+Ġrich ard
+Ġchip ped
+Ġprepar atory
+Ġneuro ectodermal
+Ġneuro cogn
+Ġneuro ticism
+Ġneuro cristopathy
+Ġsole m
+Ġsole us
+Ġformal dehyde
+Ġremark s
+Ġremark ablly
+Ġlips itz
+Ġimmunosup pressants
+Ġimmunosup presive
+Ġimmunosup pressant
+Ġneutral ized
+Ġneutral izing
+Ġneutral izes
+18 0
+18 4
+18 00872
+18 15842
+Ġrom ano
+Ġrom pen
+Ġrom antic
+Ġrom anians
+Ġpy ati
+Ġpy ogenic
+Ġpy kno
+Ġpy robest
+Ġpy ruvate
+Ġball s
+Ġball al
+Ġball ard
+Ġball ista
+Ġexer tion
+Ġexclus ivity
+Ġflav ins
+Ġflav oured
+Ġflav onoid
+Ġchron ically
+Ġchron ometer
+Ġbreak fast
+Ġcircumst antial
+Ġincident ally
+Ġtoughness es
+Ġzygomatic ofrontal
+ai osis
+Ġxi i
+Ġxi ap
+Ġtan ks
+Ġtan ba
+Ġtan ja
+Ġtan uma
+Ġtan erella
+Ġalex a
+Ġinner vation
+Ġinner vated
+Ġinner vating
+Ġfing ern
+Ġdark ly
+Ġdark ens
+Ġdark ening
+Ġment en
+Ġment or
+Ġment um
+Ġment oplates
+Ġbon fig
+Ġhc is
+Ġnd in
+Ġnight ly
+Ġnight time
+Ġald hu
+Ġald osterone
+Ġcompression s
+Ġdistor t
+Ġaden itis
+Ġaden oids
+Ġaden omas
+Ġaden otons
+Ġcoup le
+Ġcoup les
+Ġcoup ons
+Ġregister ation
+Ġunc ured
+Ġunc onscious
+Ġunc orrec
+Ġunc ulturable
+Ġunc ultivable
+Ġunc ountable
+Ġyemen is
+Ġkrus kall
+Ġweb cam
+Ġsupr arenal
+Ġspot light
+Ġextrac ranial
+Ġextrac apsular
+Ġendothel ium
+Ġfrag ility
+Ġethanol s
+Ġethanol ic
+Ġaligned viral
+Ġaggreg ating
+04 1
+95 5863
+Ġcu esta
+Ġcel iac
+Ġine fficacy
+Ġfat ality
+Ġmb t
+Ġdeal er
+Ġtruth ful
+Ġarm itage
+Ġdecom pose
+Ġdecom posing
+Ġ23 7
+Ġpossess ing
+Ġosteop ontin
+Ġhypo albumin
+Ġhypo echoic
+Ġ50 3
+Ġ50 7
+Ġbucc opalatal
+Ġbucc olingually
+Ġmesh ed
+Ġallevi ating
+Ġallevi ates
+Ġclarify ing
+des cribed
+des cribe
+rax in
+Ġpc b
+Ġpv c
+Ġpv d
+Ġdut p
+Ġbm w
+Ġbm is
+Ġregul ators
+Ġwealth y
+Ġmicrog raph
+Ġendo tracheal
+Ġfebr ile
+Ġphysi ochemical
+Ġphysi otherap
+Ġphysi ognomy
+Ġmesio angular
+Ġmesio vestib
+Ġdispers e
+Ġcrystall ites
+Ġcrystall oids
+Ġcompartment alization
+Ġanticip ating
+38 2
+38 6
+mon th
+pir al
+Ġtun neling
+Ġwet ness
+Ġfix ated
+Ġfix ogum
+Ġmess y
+Ġla uren
+Ġla velle
+Ġla ughing
+Ġnic odemus
+Ġshallow er
+Ġ25 7
+Ġ25 56
+Ġmetall ographic
+ultim ately
+Ġappra ising
+Ġappra ises
+Ġmagnetic ally
+Ġbuild s
+Ġbuild up
+Ġincorrect ness
+Ġepidemi ologist
+Ġmeaningful ness
+accur acy
+flex ions
+Ġae gean
+Ġthreat en
+Ġthreat ens
+enh aus
+enh ydramine
+Ġcas h
+Ġcas till
+Ġcas eload
+Ġpanc reatoduodenectomy
+Ġwc ancerscore
+Ġwant ing
+Ġant elman
+Ġfus arium
+Ġded uce
+Ġded uction
+Ġtoler ates
+Ġperme ate
+Ġiso forms
+Ġindustr ielle
+Ġros ter
+Ġros ters
+Ġros entritt
+Ġinters pers
+Ġinters ecting
+Ġinters ections
+Ġinters pace
+Ġyo on
+Ġyo uden
+Ġ27 7
+Ġ29 0
+Ġ29 8
+Ġspring ing
+Ġmandib ulectomy
+Ġiot f
+Ġblast ospore
+Ġblast omyces
+Ġprosth odontists
+Ġmarket ed
+Ġbrown s
+Ġhemat o
+Ġhemat oma
+Ġhemat ogenous
+Ġhemat ologist
+Ġcontextual ization
+Ġoxid ant
+Ġoxid izing
+Ġoxid izes
+Ġsedent exct
+Ġspectrophot ometrically
+Ġoverex posed
+Ġpharmac ist
+Ġpharmac otherapy
+Ġpharmac otherapeutic
+Ġpharmac oeconomics
+Ġbulk y
+Ġbulk iness
+20 5
+20 15
+20 1312
+20 2306
+Ġts d
+Ġts ad
+align ed
+Ġpear ls
+Ġannot ator
+lytic us
+eterm inator
+Ġconve ys
+Ġvl p
+Ġcoil s
+Ġparaf ilm
+Ġparaf unction
+Ġka arn
+Ġka iser
+Ġmesen chyme
+Ġrealistic ally
+Ġmicrom eters
+Ġglyc ated
+Ġglyc olic
+Ġinn ocent
+Ġbil irub
+Ġho oking
+Ġho oley
+Ġstay ing
+Ġlub art
+Ġlav igne
+ospor ium
+Ġalkal izing
+Ġalkal inized
+Ġalkal inization
+Ġrub in
+Ġrub bers
+Ġdele gated
+Ġperioperative ly
+iph enyl
+Ġtrap ped
+Ġtrap ezi
+Ġ28 83
+Ġedm onton
+Ġverbal ized
+Ġverbal izing
+Ġsymm etrically
+Ġretro gnathia
+Ġretro gnathism
+Ġretro virals
+Ġretro fitt
+Ġretro peritone
+Ġsynerg ize
+Ġthermo plasm
+Ġharves ts
+Ġmoment um
+Ġmoment ously
+Ġjournal ism
+ken ya
+ran oside
+wa ite
+Ġtg aa
+Ġtg caaa
+Ġpolar isation
+Ġwarm ed
+Ġwarm ing
+Ġfren al
+Ġfren ula
+Ġfren cken
+Ġdn ase
+att ggt
+att ccaag
+Ġrep uls
+Ġrep olished
+Ġrep ulsion
+Ġrep olishing
+Ġrep ellent
+Ġhet reogen
+Ġhet ereogeneity
+Ġproxim ate
+Ġneu rosensory
+Ġquick er
+Ġquick est
+Ġquick mark
+Ġbios pin
+Ġbios pectrum
+Ġbios ource
+Ġbios ynthes
+Ġdiast olic
+Ġliver pool
+Ġcomplement ing
+Ġsmart peg
+Ġfeed forward
+Ġsynthes izes
+Ġadvoc ating
+Ġadvoc acy
+Ġ199 4
+Ġ199 8
+Ġ199 9
+Ġhdp c
+Ġarray er
+Ġarray le
+Ġamalgam s
+Ġamalgam ated
+sa an
+Ġaer obes
+Ġaer ogenes
+ata ac
+Ġbay rak
+Ġbay onet
+Ġnf atc
+Ġnf kb
+Ġri otte
+Ġgross man
+stand ard
+Ġinfr abony
+Ġinfr adental
+Ġinfr atemporal
+Ġroll ers
+Ġsubd ue
+Ġsubd ural
+Ġsubd ued
+Ġunco oper
+Ġmethyl ation
+Ġmethyl meth
+Ġmethyl cellulose
+Ġmethyl iminodi
+Ġmoi ety
+Ġmanage ments
+Ġmind ful
+Ġmind fulness
+Ġmalays ians
+Ġcouns ellors
+Ġdiscuss es
+Ġretrom andibular
+Ġstir rer
+Ġicc mst
+Ġnanos ized
+Ġenter prise
+Ġenter obacteriace
+Ġelectro porated
+Ġelectro convuls
+Ġelectro blotted
+Ġ; .
+Ġign ores
+Ġign oring
+Ġsand ifier
+Ġsand wich
+Ġsand papers
+Ġpic n
+Ġfish bein
+Ġmart in
+Ġmart ande
+Ġling ling
+Ġnb ar
+Ġnin eteen
+Ġreson ant
+Ġreson ates
+Ġpresum ption
+Ġsubcl oned
+Ġsubcl oning
+Ġintell igently
+Ġyes avage
+phosph ate
+Ġmaxim a
+Ġmaxim ization
+Ġmaxim izing
+Ġmaxim izes
+Ġmaxim ilians
+Ġjc m
+Ġtransp ire
+Ġtransp ired
+Ġtransp eptidase
+Ġerk oform
+Ġantigen icity
+Ġ60 5
+Ġnorwe gians
+Ġreplic a
+Ġreplic ability
+Ġenroll ments
+Ġcolleag ue
+Ġetiological ly
+Ġexcision al
+Ġcereb ellum
+Ġpixel wise
+Ġmimic ry
+Ġrheum atism
+Ġpancreatic oduodenectomy
+her d
+ij a
+Ġice box
+Ġtin y
+Ġtin idazole
+Ġtin ius
+Ġtin nius
+Ġtin nitus
+Ġtang entially
+Ġtang su
+Ġsic ca
+Ġsic ilian
+Ġpg k
+Ġfs rs
+Ġdest oring
+Ġbid irectionally
+Ġbath s
+Ġbath ed
+Ġbath ing
+Ġstaphyl ococcal
+Ġlib ya
+Ġlib erati
+Ġlll s
+Ġonc ogenic
+Ġonc ologic
+Ġonc oprotein
+Ġonc ologist
+Ġonc oproteins
+Ġonc opathogenicity
+Ġvent ana
+Ġvent ricular
+Ġvent anilla
+Ġvent riculomegal
+Ġvent rocaudal
+Ġvac ation
+Ġvac pre
+Ġvac post
+Ġexten uating
+Ġimper vious
+Ġtrib al
+Ġtrib st
+Ġtrib ometer
+Ġunex perienced
+Ġunex tracted
+Ġamb itious
+Ġdiscern ment
+Ġdiscern ible
+Ġdiver ge
+Ġdiver ting
+Ġelis as
+Ġswab bing
+Ġhyperd ontia
+Ġheterogeneous ly
+Ġporphy rym
+Ġquarter ly
+Ġsharp ening
+Ġsharp ened
+Ġrehabilit ations
+32 8
+79 0
+79 4
+Ġtu ition
+Ġtu fts
+Ġtu keys
+Ġtag ging
+Ġsph ingosine
+Ġsph incter
+Ġpec toris
+Ġfu el
+Ġfer rit
+Ġruss el
+Ġexec uting
+truct ures
+Ġche onan
+Ġmeg aspha
+Ġmeg avolt
+Ġshear n
+Ġpositi vo
+Ġhair s
+Ġsubl imit
+Ġinterrup ts
+Ġovers ight
+Ġ26 7
+Ġmicros ilver
+Ġmicros phere
+Ġmicros atell
+Ġ31 9
+Ġadju van
+Ġfitting s
+Ġdissol ves
+Ġgastro prot
+Ġgastro enterology
+Ġsun y
+Ġsun ny
+Ġsial oliths
+Ġsial ocele
+Ġsial ostrip
+Ġcatal ysis
+Ġcatal yses
+Ġcatal yz
+Ġpun itive
+Ġpun ica
+Ġpum ping
+Ġpum icing
+Ġpum iced
+Ġpum paluk
+arc zyk
+Ġretic ence
+Ġhap map
+Ġhind i
+Ġnit ro
+Ġnit inol
+Ġnit rate
+Ġnit rous
+Ġnose bleeds
+Ġgh osh
+Ġgh ensi
+ames e
+Ġvic tor
+Ġvic enza
+Ġvic arious
+Ġalumin ates
+Ġalumin ium
+Ġprocl aim
+Ġapne as
+Ġcoop er
+Ġcoop erating
+Ġrelax ed
+Ġunm istak
+Ġuncom pleted
+Ġuncom parable
+Ġunfort unate
+Ġhistomorph ology
+Ġguarant ees
+Ġfibrin ous
+Ġhdl were
+Ġconceptual ize
+Ġconceptual ized
+Ġconceptual ization
+Ġinhab itable
+Ġarterial ized
+Ġconcur red
+Ġconcur rence
+Ġbench mar
+Ġbench top
+Ġunsatis fying
+Ġrheumat ologic
+Ġhierarch al
+14 3
+14 9
+14 57
+56 2
+56 3
+56 4
+56 8
+56 00
+Ġvel ar
+Ġvel ocities
+Ġti wari
+Ġsaw ed
+Ġsaw ing
+Ġculti vating
+Ġcensus es
+Ġpunct ual
+Ġfoss ae
+Ġfanc d
+Ġbed time
+Ġlys er
+Ġlys osomes
+Ġlys ozyme
+Ġgf c
+Ġgf x
+Ġasep sis
+Ġva ud
+Ġva ults
+uch ers
+Ġincon sequential
+Ġacycl ic
+ipt yline
+Ġcoinc ided
+Ġcantile vers
+Ġneo plasia
+Ġneo formations
+Ġsubc ortical
+Ġsubc ollective
+Ġsubc onscious
+rolog ie
+Ġceras mat
+Ġfamiliar izing
+Ġ62 2
+Ġ62 5
+Ġ62 7
+Ġhyperl ipemia
+Ġ79 1
+Ġdocument ations
+Ġadaptive ly
+Ġreinforce ments
+Ġacknowled gment
+Ġvacu olar
+Ġvacu olisation
+19 1
+19 7
+19 86
+Ġtail or
+Ġtail oured
+Ġpter igoid
+Ġmp d
+Ġbac itr
+Ġbig dy
+Ġbig uanide
+Ġexfoli ates
+Ġimag ers
+Ġimag ery
+Ġimag ines
+Ġfov s
+Ġplaus ability
+Ġplaus ibility
+Ġtrache otomy
+Ġsuperelastic ity
+Ġiod oform
+Ġiod ophor
+Ġcros stabs
+Ġ37 3
+Ġ37 8
+Ġtermin us
+Ġtermin ating
+Ġtermin ator
+Ġ94 9
+Ġoptimistic ally
+Ġderiv ation
+Ġderiv ates
+Ġmcf adden
+cript ome
+Ġexcav ated
+Ġexcav ating
+Ġmotiv ations
+Ġhazard ous
+Ġrepublic a
+Ġcholesterol s
+22 00
+22 285
+sh ell
+Ġtight ened
+Ġaa o
+onduc tivity
+erup ted
+Ġpip eline
+Ġpip ettes
+Ġwal a
+Ġwal ter
+Ġwal king
+Ġwal pole
+Ġdic el
+Ġdro ve
+Ġdens er
+Ġbd dma
+Ġegg s
+Ġstv s
+Ġstro kes
+Ġnerv osa
+Ġgon zale
+Ġgot tsaun
+Ġgot tingen
+Ġgot tesman
+Ġvill i
+Ġvill arim
+Ġrib bing
+Ġreserv ations
+Ġscop ing
+Ġfores ight
+Ġfores een
+Ġhaem oglobin
+Ġhaem odialysis
+Ġhaem atinics
+Ġrod ent
+Ġrod ents
+Ġtrack ed
+Ġkol wij
+Ġkol omgro
+Ġarbit ration
+Ġphy ton
+Ġdiscontin uous
+Ġdiscontin uity
+Ġspear mint
+Ġknowing ly
+Ġdrink able
+Ġschematic s
+Ġschematic ally
+Ġfacem asks
+Ġslim line
+Ġ56 2
+Ġreplace ments
+Ġfavor ite
+Ġdownreg ulate
+Ġentr ained
+Ġacquire ment
+Ġopportunistic ally
+Ġinher it
+Ġelectroph erogram
+Ġplei osis
+Ġscatter plot
+Ġunexpected ness
+Ġknockdown on
+Ġpteryg opalatine
+26 6
+Ġaw ad
+Ġaw arding
+Ġaw aking
+Ġaw akened
+Ġaver sion
+Ġaver ting
+Ġthyroid itis
+Ġsan nino
+Ġsan chez
+Ġov oid
+Ġwom ac
+Ġdum mies
+level d
+Ġgent ler
+Ġgent amicin
+Ġorb icularis
+Ġperic oronal
+Ġpertain s
+Ġpertain ed
+Ġdev ise
+Ġdev ote
+Ġdev astating
+Ġindian a
+Ġrelig ated
+Ġrelig iosity
+Ġku rol
+Ġku hle
+Ġkill er
+Ġenrich ing
+Ġbran ched
+Ġmang os
+Ġmang old
+Ġmang alore
+Ġnonc ulture
+Ġnonc ariogenic
+Ġju iz
+Ġcommit ments
+Ġtransg lut
+Ġsmirn ova
+Ġinstal ling
+Ġdoub ted
+Ġ52 1
+Ġ57 7
+Ġhumid or
+Ġhumid ness
+Ġhumid ifies
+Ġswiss meda
+Ġpsychi atry
+Ġpurch ases
+Ġpurch asing
+Ġ82 1
+Ġveget ating
+Ġmulticent ric
+Ġantagon ism
+Ġwithdraw ing
+Ġwithdraw als
+Ġelectrophores ed
+environment al
+45 2
+45 9
+tons illoliths
+Ġaud its
+Ġaud ited
+Ġaud ibly
+Ġaud axceph
+Ġthal amus
+Ġsure call
+Ġpir ds
+Ġpfe iffer
+Ġwel tzi
+Ġmh z
+Ġbus an
+Ġbow l
+Ġbow s
+Ġbow ing
+Ġhan ley
+Ġhold e
+Ġhold ers
+Ġhoney comb
+Ġef netb
+Ġln ln
+Ġny on
+Ġny vad
+Ġascertain ing
+Ġcontig s
+Ġalve olopl
+Ġring git
+Ġproof ing
+Ġproof reading
+Ġcomment aries
+Ġchond rocyte
+Ġshir akata
+Ġrecomb ination
+Ġintens ifying
+Ġintens ifies
+Ġki emle
+Ġkil o
+Ġkil ogram
+Ġkil ovolt
+Ġphone tic
+Ġphyl otyped
+agg tg
+agg cat
+Ġembr aced
+Ġembr acing
+Ġembr asures
+Ġembr ittlement
+Ġperiodic ity
+Ġsmell s
+Ġarchae ological
+Ġprofound ly
+Ġestrogen ic
+Ġtaq tm
+Ġtaq ii
+Ġ95 1
+Ġpowerful ly
+Ġsubsid y
+Ġsubsid izing
+ocyt ose
+ocyt opathies
+Ġexceeding ly
+Ġultrason ography
+Ġengine ers
+Ġengine ered
+Ġafford ed
+Ġsubmuc ositis
+aryng ologic
+Ġirrele vance
+Ġguarantee ing
+Ġtil es
+inter media
+Ġcoc a
+Ġcoc oyl
+Ġcoc onut
+Ġpist ons
+Ġinex plicable
+Ġinex tricably
+Ġank ara
+Ġfung iform
+Ġbatch elor
+Ġrer un
+Ġreass ured
+Ġreass uring
+oll ate
+Ġont ogeny
+Ġfoot point
+Ġfoot board
+Ġprescrib es
+Ġobst etrix
+Ġquin quennial
+Ġarc uate
+Ġagric ultural
+Ġdiscre et
+Ġsput tering
+Ġfried y
+Ġbasel ined
+Ġpulpect omies
+Ġverte idigung
+Ġimmunore gulatory
+Ġ76 92
+Ġcyclospor in
+Ġ86 8
+Ġplateau ed
+Ġdissip ate
+Ġdissip ater
+Ġdissip ating
+Ġdissip ates
+Ġcarboxyl ation
+Ġpropag ating
+Ġmigr ate
+Ġsuspic ions
+Ġecological ly
+Ġjustify ing
+Ġneurolemm omas
+Ġineffec tiveness
+Ġobliter ated
+Ġobliter ate
+Ġobliter ations
+Ġaggrav ates
+25 1
+25 4
+25 7
+200 8
+30 3
+30 6
+73 1236
+92 4
+gt ctg
+gt ctc
+gt acgga
+pens ating
+zi oglu
+Ġtre ble
+Ġtre acher
+Ġtre lle
+Ġtab s
+Ġtab ular
+Ġtel esc
+Ġaz ide
+Ġson ographic
+Ġson ically
+Ġson ographically
+Ġsas souni
+Ġcot angent
+Ġpiv oxil
+Ġfh p
+ann in
+ann es
+Ġeye let
+Ġeye wear
+Ġstock s
+Ġstock aligned
+Ġlam as
+Ġlam ella
+Ġlad en
+Ġlad der
+Ġnom ograms
+Ġven ue
+Ġven ipuncture
+Ġves ion
+Ġves icles
+Ġves terinen
+romy ces
+Ġlex ical
+Ġlex icon
+Ġhapl oins
+Ġtris phosphate
+Ġneph ritis
+Ġneph rology
+Ġneph elometry
+Ġneph ropathy
+Ġneph rologie
+Ġunw ished
+Ġweigh s
+Ġinvest ing
+Ġoverf it
+Ġbiot ech
+Ġbiot ene
+Ġbiot inyl
+Ġsupposed ly
+Ġmicrot ome
+Ġmicrot omography
+Ġmicrot opography
+Ġtransduc ing
+Ġ35 98
+Ġthroat s
+Ġsla ughtered
+Ġpolys pecific
+Ġpolys accharides
+Ġpolys accharide
+Ġuz unoglu
+Ġinterns hip
+Ġteen age
+Ġprosper ous
+Ġundersc oring
+Ġmorphometric s
+Ġsteril izable
+Ġcamp bell
+Ġcamp oresi
+Ġdeficient primary
+Ġaccompl ishment
+Ġneurolog ist
+ocarcin oma
+67 2
+ga acgtgtc
+gl cn
+ptic ism
+with in
+Ġtc f
+Ġtro ugh
+Ġtro pe
+Ġtro ubles
+Ġtess ini
+Ġtess elation
+Ġthrom boemb
+Ġsick le
+Ġsick ness
+Ġost ecotomy
+Ġost ensible
+Ġcred ited
+Ġrevers es
+Ġek uni
+Ġek strand
+Ġek bom
+Ġchen g
+Ġatp ases
+Ġseman tics
+Ġshock wave
+Ġshah idi
+Ġscler osed
+Ġscler oses
+Ġleuc ocytes
+Ġparas ites
+Ġparas anguinis
+Ġparas itic
+Ġparad igms
+Ġparad oxically
+peri operative
+char acteristics
+Ġinterp apill
+Ġinterp apillary
+Ġinterp ersonal
+Ġune asy
+Ġamph iphil
+Ġks el
+Ġoutper forming
+Ġstrip ped
+Ġedar add
+Ġiat rosed
+Ġimped es
+Ġimped iment
+Ġmonoc entric
+Ġmonocl inic
+Ġemail ing
+Ġintragroup s
+Ġze iss
+Ġze ggini
+Ġerad icate
+Ġerad icator
+Ġmultil ateral
+Ġmultil ocular
+Ġmultil ocus
+Ġiris i
+Ġantise psis
+Ġantise ptics
+Ġsuit ably
+Ġuv p
+Ġimmunocom pet
+Ġaddic tions
+Ġ61 7
+Ġhypert onic
+Ġhypert elor
+Ġactu ated
+Ġeconom ies
+Ġvegf r
+Ġssb ss
+Ġosteoconduc tivity
+Ġorthopantom ograms
+Ġorthopantom ographs
+Ġcoronavirus es
+Ġchromat ograph
+Ġchromat ographic
+Ġchromat ogram
+Ġchromat ograms
+Ġadenocarcin omas
+Ġuncommon ly
+Ġaceton itrile
+Ġeosinophil s
+Ġoblig ed
+Ġvapor izers
+Ġaerosol ized
+Ġsubdiv isions
+Ġdestro y
+Ġimperf ect
+Ġimperf ection
+Ġtracheost oma
+Ġadrenal ine
+Ġpakistan i
+oul os
+tw ice
+Ġthaw ing
+Ġsat ellate
+Ġcg cct
+Ġcow herd
+Ġinoc ulation
+Ġinoc ulate
+Ġinoc ulum
+Ġanton io
+Ġmiti gating
+thal mitis
+Ġbh alaj
+Ġbh atti
+Ġbms cs
+Ġreform ations
+Ġhb d
+Ġhered ia
+ulo ou
+Ġlu o
+Ġlu hs
+Ġlum ens
+Ġlum ps
+Ġlum eng
+Ġlaws one
+Ġgt fb
+Ġgt caatt
+Ġvig ilant
+Ġvibr ations
+Ġvibr atory
+Ġresor ted
+Ġdispro ved
+Ġallerg ies
+Ġallerg ological
+Ġtriang ulation
+Ġtriang les
+Ġaccident ally
+Ġkar ia
+Ġkar aca
+Ġweare r
+Ġdecalc ifications
+Ġsimul ates
+Ġbrist led
+Ġmanip ulations
+Ġspons oring
+Ġjo ves
+Ġhyal ine
+Ġhyal inised
+Ġlimb us
+Ġconflu ency
+Ġconflu ences
+Ġ32 74
+Ġ03 6
+Ġzo onotic
+Ġmultif arious
+Ġmultif ocus
+Ġmucoperi ostal
+Ġiraq i
+Ġglut amic
+Ġprofess ed
+Ġpulver ize
+Ġslic ed
+Ġ58 4
+Ġcontraind icating
+Ġautogenous ly
+Ġprecip itated
+Ġprecip itates
+Ġprecip itous
+Ġprecip itationdiss
+Ġelev ations
+ochrom es
+Ġmuscul ature
+Ġmuscul ocutaneous
+Ġmyc n
+Ġmyc obacteria
+Ġmisd iagn
+Ġnaive ty
+Ġcytological ly
+Ġforens ics
+Ġvasopress or
+Ġdwell ers
+Ġegypti ans
+Ġrhamn osus
+Ġmobil ised
+Ġmobil isation
+Ġmobil igy
+Ġscholars hip
+Ġanxio lytics
+Ġankyl os
+Ġankyl osed
+Ġthromb ocytes
+Ġthromb ocyte
+Ġthromb ophleb
+05 2
+05 4
+05 5
+40 9
+cat gc
+cat ctg
+da ily
+evalu ation
+ias m
+onucle otide
+Ġsis cho
+Ġoval e
+Ġcens or
+Ġcens orship
+Ġinqu ire
+Ġfasc in
+Ġfasc icles
+Ġfasc iitis
+Ġdor ay
+Ġdor ri
+Ġdan ion
+Ġdan ks
+Ġmich eelis
+Ġmich igan
+attr actant
+Ġbg m
+Ġbub bling
+Ġstad tmanea
+Ġlob bezo
+Ġnr p
+Ġnr ti
+ela ar
+Ġbear s
+Ġbear ings
+adow ed
+Ġprepro sthetic
+Ġmah arani
+Ġmah idol
+Ġmah moud
+Ġscrap e
+Ġscrap er
+Ġindis putable
+Ġpark ar
+Ġhaemat oma
+Ġhaemat ocrit
+Ġtrich omoniasis
+Ġtripl ed
+Ġinterim plant
+Ġinterfer on
+Ġunin formed
+Ġunin formative
+Ġintro version
+Ġintro flexions
+Ġyag uo
+Ġamp ule
+Ġdesquam ation
+Ġphr ased
+Ġcry ostat
+Ġdiscover ing
+Ġjun ta
+Ġdemarc ating
+Ġtranscript omics
+Ġpostp oned
+Ġpostp onement
+Ġconfer red
+Ġ33 6
+Ġolig o
+Ġolig omerisation
+Ġolig onucleotide
+Ġappreci ate
+Ġappreci ative
+Ġappreci ably
+Ġmouths for
+Ġglomer ulus
+Ġverb atim
+Ġepig lot
+Ġsuff ice
+Ġprompt ly
+Ġ45 1
+Ġfibroc artilaginous
+Ġbook lets
+Ġ78 8
+Ġchemo attractant
+Ġ92 1
+Ġ98 2
+Ġultravi olent
+Ġhomogen ised
+Ġhomogen izing
+Ġhomogen isation
+Ġdysreg ulating
+Ġcytoplasm atic
+Ġmediast initis
+Ġotolaryng ological
+Ġotolaryng ologist
+Ġleuka emic
+Ġdenom inators
+Ġintermitt ently
+Ġelectromy ograms
+Ġframes hift
+Ġconjug ate
+Ġconjug ates
+Ġstereolith ographic
+Ġstereolith ographically
+Ġcontradic ted
+Ġacknowledge ment
+Ġsynchron ized
+Ġlecture r
+Ġlecture rs
+Ġinactiv ates
+Ġdisappear ing
+Ġdistinctive ly
+Ġdispropor tions
+Ġdispropor tional
+Ġaccommod ated
+Ġaccommod ations
+24 1
+24 2
+24 3
+85 5
+aj o
+aj t
+sk og
+sk tra
+Ġtac tility
+Ġtear ing
+Ġsad ness
+Ġcis platin
+Ġpon tifical
+Ġanim ate
+Ġfv r
+Ġderm is
+Ġderm oid
+Ġderm aut
+Ġmer ge
+Ġmer ignac
+Ġbill s
+Ġreevalu ate
+Ġhur dles
+Ġnond estr
+Ġgamm aglobulin
+Ġconform ing
+Ġconform ance
+Ġconform ational
+Ġexoc ad
+Ġresh ape
+oco agulation
+Ġsev enties
+Ġcoag ulant
+Ġcoag ulopathy
+Ġcontem plate
+Ġcontem plated
+Ġplain ly
+Ġplug in
+Ġplug gers
+Ġtrim gal
+Ġconsolid ate
+Ġprist ina
+Ġunid irectionally
+Ġken yan
+Ġken ya
+Ġken ny
+Ġmoh amed
+Ġmoh amad
+aga aac
+aga atgg
+aga aagag
+aga aggcat
+Ġsupra erupted
+Ġspend s
+Ġmicrovascular ity
+Ġgrand mother
+Ġgrand paren
+Ġgray ish
+Ġunderp ins
+Ġseropos itive
+Ġ06 6
+Ġendotox emia
+Ġflo at
+Ġflo ors
+Ġflo qs
+Ġnews paper
+Ġnews letter
+Ġpolyv itex
+Ġscreens hot
+Ġimmunode pression
+Ġimmunoglob ulins
+Ġsegreg ated
+Ġ47 2
+Ġantibiof im
+Ġbiomechan ically
+Ġdelim itation
+Ġpsycho active
+Ġtravel ing
+Ġtravel led
+Ġ89 00
+Ġbenefici ary
+Ġannex ed
+Ġdestructive ly
+Ġharmon ize
+Ġharmon ization
+Ġamelior ates
+Ġbenz yl
+Ġbenz odiaz
+Ġbenz othiaz
+Ġcosmetic ally
+Ġharv est
+Ġharv ard
+Ġtaxon omies
+Ġdimeth acrylates
+Ġargu ments
+Ġinnov ations
+Ġneurom otor
+Ġinfras tructures
+Ġlingu opalatal
+Ġlingu ovel
+Ġelabor ative
+Ġelabor ates
+Ġskeleton ised
+65 1
+99 8
+99 9
+pop ulation
+Ġtar iffs
+Ġtar biat
+Ġatraumatic ally
+Ġsig le
+Ġsig ma
+Ġstit ch
+eng aged
+Ġcup s
+Ġciv ilization
+Ġciv ilian
+Ġciv atte
+Ġcub es
+Ġpend ant
+Ġpier ce
+Ġplex us
+Ġantr um
+Ġanesthes izing
+Ġanesthes iologist
+Ġfi ocru
+Ġfi orell
+Ġdial ister
+Ġdial yser
+Ġdeline ating
+Ġbam h
+Ġbund les
+Ġbund ling
+Ġbund esmin
+Ġham idi
+Ġham burg
+Ġham ilton
+Ġham adan
+Ġhcl o
+Ġll amas
+Ġalarm ingly
+Ġrl c
+Ġresembl ance
+Ġdisreg ards
+Ġadvent urous
+iaz epam
+Ġposter otr
+Ġposter olateral
+stud y
+stud ies
+stud ied
+arious sur
+Ġprescrip tive
+Ġtrip od
+Ġtryp an
+Ġtrimm er
+Ġconsor tia
+Ġinterl acing
+Ġintercus pal
+Ġunres trained
+Ġunres olved
+Ġunres tricted
+Ġunequ ally
+Ġunidenti fiable
+Ġintu ition
+Ġkerm anshah
+Ġenfor cement
+Ġenjoy ment
+Ġenjoy able
+Ġunderm ine
+Ġunderm ined
+Ġunderm ines
+Ġradiop acity
+Ġje ffco
+Ġje annin
+Ġmicroc olon
+Ġmicrop ores
+Ġmicroet ching
+Ġtransposition s
+Ġgrid lines
+Ġblur ring
+Ġintras inus
+Ġintras ubjec
+Ġmultipl icity
+Ġmultipl icatively
+Ġremed y
+Ġsett ling
+Ġsett lement
+Ġcleans able
+Ġmuco cele
+Ġmucoc utaneous
+Ġbacteroid es
+Ġguang zhou
+Ġguang dong
+Ġverruc iform
+Ġcapac itates
+Ġrefine ments
+Ġwilli am
+Ġimmuno inflammatory
+Ġimmuno assays
+Ġresistor here
+Ġseventh ly
+Ġprioritiz ing
+Ġdelib erate
+Ġdelib erating
+Ġxanth one
+Ġxanth oma
+Ġcondens er
+Ġ93 4
+Ġ93 5
+Ġ93 9
+Ġ99 6
+Ġevap orate
+Ġqalp etgee
+Ġhomo lytically
+Ġpassage way
+Ġporous ites
+Ġsulph ate
+Ġsulph onic
+Ġmcm aster
+Ġdebilit ation
+Ġdebilit ated
+Ġcognition s
+Ġperfluor inated
+Ġperfluor ohex
+Ġperfluor odec
+Ġperfluor oundecanoic
+Ġgrey ish
+Ġintermed ium
+Ġtriad ent
+Ġfashion ed
+Ġfashion ing
+Ġobtur ator
+Ġmicromorph ological
+Ġtrapez oids
+Ġdestabil izes
+Ġpeculi ar
+Ġprefect ures
+Ġprefect ural
+Ġtowns hips
+Ġhookah s
+Ġarithmetic ally
+represent ative
+Ġdeprote inisation
+54 1
+76 4
+76 8
+78 8
+78 290
+fin ite
+some times
+Ġum c
+Ġum emori
+Ġum berto
+Ġum pteen
+Ġtet rology
+Ġtib ias
+Ġtib ialis
+ret inol
+Ġthous ands
+Ġsax lin
+Ġsax ton
+Ġcasc ades
+Ġcatch es
+Ġpent aery
+Ġpent obarb
+Ġpent raxin
+Ġpod ocytes
+Ġpod ocyte
+Ġpod osomes
+Ġpod oplanin
+Ġpod ocytopathies
+Ġwish es
+Ġdict ates
+Ġmur mans
+Ġmors els
+Ġmens uration
+Ġmerc ury
+Ġmuh amed
+Ġmuh ammed
+atc acg
+atr ization
+Ġbud gets
+Ġbib upillary
+Ġbag ging
+Ġbag hd
+Ġrecl inging
+Ġhus m
+Ġhop craft
+Ġech ocard
+Ġlac zko
+Ġlun ar
+Ġlun ate
+Ġlind he
+Ġlind auer
+Ġnur bs
+Ġnad u
+Ġgm fcs
+Ġgam bet
+Ġasc ites
+Ġasc omytes
+Ġvo ice
+Ġvo iced
+Ġvo uchers
+Ġexem pt
+quin one
+Ġpreb end
+Ġpret est
+Ġpret ended
+Ġpret tau
+Ġcompact ness
+Ġdisl ocation
+Ġdisl ocating
+Ġdisartic ulating
+Ġseas onality
+Ġshadow ing
+opy ranoside
+Ġleak y
+Ġsurfact ant
+Ġpars imony
+Ġpars ifal
+Ġinfar ct
+Ġabdul jab
+Ġinterr ater
+Ġunh indered
+Ġunh armed
+Ġunt oward
+Ġunt apped
+Ġdeter red
+Ġupload ing
+Ġcontroll ability
+Ġars enic
+Ġdecis ively
+Ġbronch oscopic
+Ġbronch odil
+Ġnoncont aminated
+Ġdiscour aged
+Ġsupre macy
+Ġradio active
+Ġradio immun
+Ġjoh ansen
+Ġjoh ansson
+Ġjoh annes
+Ġtranscrip ts
+Ġdie lectrophoretic
+Ġdiure tic
+Ġgrip ing
+Ġintramuscular ly
+Ġdrastic ally
+Ġtechnological ly
+obut yric
+Ġpeer less
+Ġethmoid ectomy
+Ġpercep tible
+Ġpercep tibility
+Ġabsor ber
+Ġabsor pti
+Ġhanded ness
+Ġfluoroph ore
+Ġpolyether ketone
+Ġsympos ia
+Ġohc ps
+psych ological
+Ġequator ial
+Ġ43 4
+Ġhyperther mic
+Ġarticul ators
+Ġarticul ography
+Ġxt index
+Ġsemic ircle
+Ġqia gen
+Ġqia amp
+Ġdowns ized
+Ġcrani osyn
+Ġcrani opharyn
+Ġmisclass ifications
+Ġtonsil lectomy
+Ġalbumin emia
+Ġmicr orough
+Ġmicr oneedle
+Ġattentive ly
+Ġextrem um
+Ġecosystem s
+Ġhrp z
+Ġdimethyl arginine
+Ġdivor ce
+Ġpetech ial
+Ġdiscolor ant
+Ġdiscolor ants
+Ġstretch able
+Ġadenoid ectomy
+Ġantec ubital
+Ġproceeding s
+Ġnitr ite
+ydro flu
+Ġjuven iles
+Ġdisappointing ly
+Ġembry ological
+Ġembry onic
+Ġembry ologically
+Ġcritic ize
+Ġcritic ized
+Ġpolysomn ography
+Ġcampus es
+Ġuneven ness
+Ġrefriger ant
+Ġhyalur onan
+Ġunavail ing
+Ġperturb ing
+Ġperturb ation
+Ġperturb ations
+Ġautis tic
+Ġcetyl trimethyl
+encephal ography
+Ġoblique ly
+03 5
+03 9
+09 1
+09 3
+44 1
+44 2
+ave a
+bel ow
+cant e
+po lysiloxane
+tct gga
+tgg acctg
+tgg gtacgga
+Ġub th
+Ġtack led
+Ġtack ling
+Ġaur antiaca
+Ġsid estep
+Ġsant ec
+Ġsant omauro
+Ġsend s
+Ġsene gal
+Ġole ophobic
+Ġpin heiro
+Ġped uzz
+Ġped odontics
+Ġpus teria
+Ġpere ira
+Ġpere mpuan
+Ġpma ip
+Ġanh idrosis
+Ġanh ydrified
+Ġdere rmined
+Ġdere plication
+Ġdip ped
+Ġdip ole
+Ġdip eptide
+Ġdip osit
+Ġmyl ar
+Ġmyl opoulou
+Ġber ge
+Ġber nal
+Ġber ry
+Ġber vian
+Ġbang alore
+Ġbang kok
+Ġbang lades
+Ġbang sar
+Ġbern ier
+Ġreferen cing
+Ġreex amine
+Ġreaff irming
+Ġtod dler
+Ġhit achi
+Ġeigen vect
+Ġeigen value
+Ġstuff ed
+ulf onyl
+aca aggc
+Ġlis inop
+Ġlud er
+Ġlati tud
+Ġni enk
+Ġnatal i
+Ġgg plot
+Ġgg cccagct
+Ġgy hd
+Ġgall i
+Ġasper ity
+Ġasper ities
+Ġcong olense
+Ġperin atally
+Ġisl am
+occ um
+Ġincap acitating
+Ġcompe titors
+Ġasser ted
+Ġassimil ated
+Ġassimil ates
+Ġclient eles
+Ġscant y
+Ġscant ly
+Ġcour ant
+Ġcann ula
+Ġcann abin
+Ġparamed ical
+Ġhaw ally
+Ġhaw kins
+Ġprese lected
+Ġobsc ure
+Ġobsc uration
+Ġrecon nected
+Ġrecon naissance
+Ġcarunc ula
+Ġabst inent
+Ġunl ocking
+Ġunl awfully
+Ġkim wip
+Ġkoch er
+Ġphag ocytose
+ctc cttcc
+Ġmould s
+Ġmould ed
+Ġnoncon forming
+Ġnoncon tributory
+Ġspin osum
+Ġspin ocerebell
+Ġbuttress es
+Ġcommens urate
+Ġtransc restal
+Ġtransc utaneous
+Ġtransc ultural
+Ġtransc ulturally
+Ġsale h
+Ġ09 1
+Ġinflux es
+Ġocclus o
+Ġpalp ate
+Ġpalp able
+Ġpalp ating
+Ġpalp atory
+Ġestr ada
+Ġflip ped
+Ġosteoph yte
+Ġprofici ent
+Ġveron a
+Ġ53 7
+Ġ53 9
+Ġhards hips
+Ġpolyp oid
+Ġpolyp eptides
+Ġsymb ionts
+Ġodonto lyticus
+Ġmultiplex ing
+Ġauthentic ity
+Ġ68 72
+Ġgelatin ous
+Ġpreca ution
+Ġclearing house
+Ġbooking s
+Ġhyperg ammaglobulinemia
+Ġmutagen esis
+Ġmutagen icity
+Ġskew s
+Ġpurs ued
+Ġpurs uit
+Ġtrajec tory
+Ġtransloc ate
+Ġtransloc ating
+Ġreplen ishing
+Ġencaps ulation
+Ġcopious ly
+Ġnanof illed
+Ġnanof ibers
+Ġurg ently
+Ġmiscon ceptions
+Ġpfh xs
+Ġcardi ometabolic
+Ġrevis it
+Ġrevis its
+Ġrevolution ize
+Ġvasoconstr iction
+Ġaggl omerated
+Ġdilacer ations
+Ġattract ant
+Ġattract ants
+Ġthorac oscopic
+Ġthorac oab
+Ġconcaten ating
+Ġconvinc ed
+Ġwarrant ing
+Ġelectroc auter
+Ġtransfusion s
+Ġquarant ined
+Ġquarant ines
+Ġanticoag ulants
+Ġnonsyn onymous
+Ġnonsignificant ly
+Ġexhaus tion
+Ġrefract ometer
+Ġsuprac utaneous
+Ġunreli ability
+Ġosteoprogen itors
+Ġventil atory
+Ġglycos ylphosph
+Ġneurop athic
+Ġneurop athy
+Ġnanostruct ured
+Ġcoincident ally
+Ġsubcult uring
+Ġlicens ure
+Ġpericard ial
+Ġreluctant ly
+Ġbusiness es
+Ġeiken ella
+Ġeiken alla
+Ġhonest y
+Ġhyperchrom atic
+Ġhyperchrom asia
+Ġinterpol ate
+Ġinterpol ations
+Ġzeal ous
+Ġmicha ud
+Ġmicha el
+Ġdermat an
+Ġdermat ology
+Ġadvertise ment
+Ġunderpin ned
+iquit ination
+Ġellip tic
+Ġellip tical
+Ġmenstr uation
+Ġbibli ographies
+Ġecho es
+Ġnurser y
+Ġexempl ified
+Ġveloph aryngo
+Ġsacrific ing
+Ġdublin iens
+Ġconglomer ates
+Ġimmob ilon
+Ġconspicuous ly
+Ġoverwhel m
+Ġoverwhel med
+Ġtubercul ous
+31 7
+aut oimmune
+kr ishnan
+oac ids
+sing le
+Ġty csb
+Ġtam il
+Ġtps dig
+Ġtps util
+Ġath ens
+Ġath lete
+Ġath letic
+Ġaus roc
+Ġaus terity
+Ġaus tenite
+Ġavid in
+Ġthi oglyc
+Ġthi ogalact
+Ġthi ocyante
+onin ic
+Ġsab a
+Ġsak ki
+Ġoint ments
+Ġophthal mic
+err correct
+Ġcac o
+Ġws ls
+Ġwrap per
+Ġwart y
+Ġwatch ful
+Ġwinb urn
+Ġinad aptability
+Ġinward ly
+Ġanamn estic
+Ġdq ms
+Ġdiph enyl
+Ġdiph osphonate
+Ġdiph enhydramine
+Ġmels on
+Ġbip upilar
+Ġbell ini
+Ġbell igerence
+Ġblow n
+Ġblow ing
+Ġbisc upid
+Ġbah asa
+Ġbacill us
+Ġrebound ed
+Ġreorient ed
+Ġhung ate
+Ġhung ary
+Ġeb d
+Ġeub acterial
+Ġeuk aryotic
+Ġeager ness
+Ġstew art
+Ġlund skog
+Ġlag ocka
+Ġlux ated
+Ġlux ate
+Ġlux aprint
+Ġnice ly
+Ġgcc gctcc
+Ġgcc atcat
+Ġgcc atcacg
+Ġgust ave
+Ġgeront ological
+Ġgeront ology
+Ġgeront ologists
+Ġconges ted
+Ġons ite
+Ġons ets
+Ġverm ette
+Ġverm aire
+Ġverm illion
+Ġvacc ination
+Ġvinyl polysiloxane
+Ġrestr aining
+Ġisoprop yl
+Ġchim eric
+Ġchap ter
+Ġdepress or
+Ġmei osis
+Ġacr p
+Ġacr ies
+Ġacr onyms
+Ġcomputation ally
+Ġshin y
+Ġhex agonal
+Ġhex ahedral
+Ġcloth es
+Ġmaz umdar
+Ġcohes iveness
+Ġhaus en
+Ġallo immun
+Ġobe idi
+Ġaccred itation
+Ġnour ished
+Ġsami ee
+Ġabus er
+Ġunil ocular
+Ġunpro cessed
+Ġintoler ant
+Ġyosh pe
+Ġyosh imura
+Ġyosh ihiro
+Ġamaz on
+Ġamaz ing
+Ġamaz onia
+Ġket ac
+Ġket oconazole
+Ġket oprofen
+Ġkel es
+Ġkel oid
+Ġkel antan
+Ġkir zioglu
+Ġwein stein
+Ġenqu iring
+Ġoutweigh s
+Ġoutweigh ed
+Ġsucc umbed
+Ġark ansas
+Ġmaxd ball
+Ġpharyng oscopy
+Ġoverhang s
+Ġoverhang ing
+Ġdecent ralised
+Ġcrypt ochromes
+Ġundec ane
+Ġdiscord ant
+Ġspar sity
+Ġmicropartic le
+Ġmalposition ed
+Ġconfine ment
+Ġconfront ation
+Ġconfront ational
+Ġserb ia
+Ġmonochrom ator
+Ġzh ong
+Ġzh ifei
+Ġzh ermack
+Ġzip per
+Ġdraf ting
+Ġexplo iting
+Ġsmr r
+Ġschiff ner
+Ġreceptive ly
+Ġpotenti ality
+Ġguess ing
+Ġpuls atile
+Ġslp m
+Ġslur ries
+Ġhypot onicity
+Ġleaders hip
+avail able
+Ġredirec ted
+Ġcontrac eptive
+Ġcontract ually
+Ġpartners hip
+score thickness
+Ġrefus als
+Ġpolyg raph
+Ġpolycr ystal
+Ġlabi olingual
+Ġlabi opalatal
+Ġlabi olingually
+Ġretreat ing
+Ġretreat ments
+Ġretreat ability
+Ġimmunocyt ochemical
+Ġswell ings
+Ġsynth ograft
+individual s
+Ġprecurs ors
+Ġworkload s
+Ġbiomolec ular
+Ġbiomolec ules
+Ġbiomolec ule
+Ġdelt as
+Ġpursu ant
+Ġlipopolys accharide
+Ġphotopolymer ized
+Ġcollaps ing
+Ġpenins ular
+Ġburn out
+Ġqi u
+Ġveter an
+Ġportr ayed
+Ġcomprehens ibility
+gga agg
+Ġetiopath ology
+Ġ124 3
+Ġgaug ing
+Ġlymphad enoid
+Ġincompet ence
+Ġpolicym aking
+Ġsyrup s
+Ġreinser tion
+Ġmelt down
+Ġbenj afield
+Ġpermut ations
+Ġquadr at
+Ġsubstruct ure
+Ġterat ogens
+Ġinga as
+Ġscrut iny
+Ġscrip ted
+Ġlegion ella
+Ġlegion ellosis
+Ġglucocortic oid
+Ġanthro plus
+Ġunpolymer ized
+Ġmotorcy cles
+Ġneuropsych ological
+Ġtann ins
+Ġdecompens ation
+Ġdecompens ated
+Ġdecompens ate
+Ġtunis ia
+Ġlaun ch
+Ġdeduc tible
+Ġintersti tium
+Ġmicromo tion
+Ġmicromo tions
+Ġmicromo vements
+Ġcertific ates
+Ġartefact ual
+Ġartefact ural
+Ġhaemost asis
+Ġperpet ually
+Ġbifurc ations
+Ġcoversl ips
+Ġparasit ophobia
+Ġunavoid ably
+Ġglomerul opathies
+Ġpathophysi ologic
+Ġsapi ens
+Ġtryptic ase
+Ġunrestor ability
+Ġevapor ated
+Ġdislod ged
+Ġphilosoph ies
+Ġubiquit ination
+Ġsidew ay
+Ġreexamin ed
+Ġreexamin ing
+Ġreexamin ations
+Ġgyna ecology
+Ġperinatal y
+Ġcardiomy ocyte
+Ġelectrocardi ography
+Ġtrophozo ite
+Ġpemph igus
+Ġnocic eptor
+Ġgingivect omies
+Ġsubcomposition s
+Ġsubcomposition al
+Ġjurisd iction
+170 5
+170 7485
+36 2
+420 1707485
+66 6
+bec ause
+bet a
+bled ygo
+cap ene
+cact tct
+cact aggtg
+dif ference
+dif ferent
+del iler
+div ant
+dem and
+dem onstrated
+diss atisfied
+gac agtt
+gac acagg
+juan a
+oz ide
+sur vival
+sum c
+second ly
+tur key
+uf ier
+uf statter
+Ġia j
+Ġtall ied
+Ġtian amp
+Ġtian jin
+Ġtale bi
+Ġtale ghani
+Ġaro use
+Ġaro used
+Ġsaccha rolytic
+Ġsaccha romyces
+Ġots u
+Ġots uki
+Ġcic lospor
+Ġcic atrization
+Ġcres ts
+Ġcres cent
+Ġctr l
+Ġcex p
+Ġcex tran
+Ġpb sts
+Ġpomer ania
+Ġpomer anian
+Ġpascal s
+Ġwood s
+Ġwood side
+Ġwinding s
+Ġingest ing
+esc ulin
+Ġaner obic
+Ġaner opack
+Ġanos im
+Ġanos mia
+Ġantim yco
+Ġantim etabol
+Ġanecd otal
+Ġanecd otally
+Ġfis cal
+Ġfos ters
+Ġfos fomycin
+Ġfab i
+Ġfab k
+Ġfled gling
+Ġdess ication
+Ġdess ert
+Ġdaw son
+Ġdaw ley
+Ġdiction ary
+Ġdiction aries
+Ġdalex tra
+Ġmn emonic
+Ġmers in
+Ġmary land
+Ġmile tic
+Ġmerg er
+Ġmerg ing
+atcc ggtc
+atgg acct
+Ġbum ping
+Ġbum pers
+Ġbile esculin
+Ġrever berates
+Ġrearr anging
+Ġrearr angements
+Ġreestabl ishing
+Ġreestabl ishment
+Ġtow ed
+Ġtow els
+Ġhed strom
+Ġhed ghe
+Ġhes itation
+Ġhes itant
+Ġhir ai
+Ġhir aki
+Ġhose y
+Ġhose in
+Ġegf r
+Ġstub born
+Ġsteep est
+Ġlent ulo
+Ġlent ulos
+Ġlia oning
+Ġlia ison
+Ġnol an
+Ġnol temeier
+Ġnap dh
+Ġnap hthalene
+Ġnem o
+Ġnem covsky
+Ġnik on
+Ġnik olic
+Ġgar net
+Ġgar vin
+Ġgem ma
+Ġgem inatus
+Ġgill ison
+Ġglu ed
+Ġglu ing
+Ġgob let
+Ġgob bledygo
+Ġggg ccaact
+Ġggg tttg
+Ġgca agtctag
+Ġgca agaaagag
+Ġgtg tctgga
+Ġgtg tgggtacgga
+Ġcongr uous
+Ġcongr uent
+Ġorm ocer
+Ġorm ocers
+Ġvog ue
+Ġvog ues
+Ġvist as
+Ġvist adent
+Ġvanc omycin
+Ġvanc ouver
+Ġalk yl
+Ġalk oxy
+Ġaler ts
+Ġaler ted
+Ġalber o
+Ġalber ti
+Ġperth ometer
+Ġperth omether
+Ġperit ubular
+Ġperit onitis
+Ġpervious ness
+Ġperitone al
+Ġperitone um
+Ġresum es
+Ġresum ption
+trap ping
+Ġisthm us
+Ġisthm uses
+utom ated
+Ġchol inerg
+Ġchol angi
+Ġincong ruous
+Ġincong ruity
+Ġata xias
+Ġdistr act
+Ġdistr actions
+Ġdisoc cluded
+Ġdisoc clude
+Ġdisorgan ized
+Ġdisorgan ization
+Ġdisintegr ation
+Ġdisintegr ated
+Ġshen yang
+Ġship ped
+Ġshield ed
+Ġclon ally
+Ġclon idine
+Ġclad ogram
+Ġclad osporium
+Ġclaus ii
+Ġclaus trophobia
+Ġapic ectomy
+Ġapic ocoronal
+Ġlean er
+Ġsurin ame
+Ġsurin amese
+Ġcance led
+Ġcance ling
+Ġparag raph
+Ġparag raphs
+Ġroe koseal
+Ġroe leveld
+Ġroth ia
+Ġross i
+Ġross ini
+Ġtrin itrobenz
+Ġtrin idadian
+Ġtrig one
+Ġtrig eminal
+Ġconsens ual
+Ġconsens ually
+Ġconsangu inity
+Ġconsangu ineous
+clin ically
+clin icians
+Ġreck oned
+Ġrecons titution
+Ġrecons idered
+Ġreloc ated
+Ġreloc ates
+Ġprab hu
+Ġprab hak
+Ġcarre ra
+Ġcarre ras
+Ġquint essential
+Ġquint essenz
+Ġunim portant
+Ġunim peded
+Ġunper formed
+Ġunper ceived
+Ġuncon ventional
+Ġuncon fident
+Ġunanim ous
+Ġunanim ously
+Ġamm ari
+Ġamm onia
+Ġamin omethane
+Ġamin obutyric
+Ġkre vers
+Ġkre uter
+Ġkal ra
+Ġkal etra
+Ġkoh ar
+Ġkoil ocytes
+Ġkoil ocytosis
+Ġenerg ies
+Ġenerg ised
+Ġenvision ed
+Ġfoli ated
+Ġfoli ate
+phys ical
+phys iological
+Ġard uous
+Ġard akani
+Ġbioc ides
+Ġbioc onductivity
+ctcc gaacgtgtc
+cttg ttatc
+Ġcolab oratory
+Ġcriti que
+Ġcriti ques
+Ġstrugg le
+Ġstrugg les
+Ġimplicit ly
+Ġsimon is
+Ġ295 23
+Ġ295 22
+Ġnonh omogenous
+Ġnonh ospital
+Ġnonparticip ation
+Ġnonparticip ating
+Ġorthox scan
+Ġradiod ensity
+Ġradiod ensities
+Ġedit orial
+Ġedit mask
+Ġmicrod ontia
+Ġmicrod ilution
+Ġmicrophot ograph
+Ġmicrocomp uted
+Ġmicrocomp uterized
+Ġmalalign ment
+Ġmalalign ments
+Ġtranssexual s
+Ġdij kstr
+Ġdij sktra
+Ġdipl oma
+Ġdipl omatic
+Ġimpar ts
+Ġimpar ting
+Ġimpuls es
+Ġimpuls ivity
+Ġprimes can
+Ġprimes cript
+Ġmetaph yseal
+Ġmetaph yses
+Ġmetacarpal s
+Ġmonos odium
+Ġmonos ymptomatic
+Ġblend s
+Ġoliver ia
+Ġerik sson
+Ġerik ssen
+Ġendang ered
+Ġendang ering
+Ġendeav or
+Ġendeav ors
+Ġendorse ment
+Ġcaval lo
+Ġcaval cante
+Ġcef uroxim
+Ġcef capene
+Ġpredig est
+Ġpredig ested
+Ġflux es
+Ġfluores ce
+Ġfluores ced
+Ġsmith ii
+Ġimmortal ized
+Ġimmortal ization
+Ġschul z
+Ġschul theiss
+Ġocclud e
+Ġocclud ing
+Ġsamplesw opmd
+Ġantiplate let
+Ġantiplate lets
+yls ilane
+yls ulfonyl
+Ġflag s
+Ġflag ellated
+Ġflood ed
+Ġflood ing
+Ġvirolog ic
+Ġvirolog ical
+Ġpointless ly
+Ġmatsu yama
+Ġepic utaneous
+Ġepic occum
+Ġepistem ological
+Ġepistem ology
+Ġswift ly
+Ġexpon ential
+Ġexpon entially
+Ġmeso americ
+Ġfibr illation
+Ġfibr inolytic
+Ġworkst ation
+Ġworkst ations
+Ġchrist ou
+Ġchrist ensen
+Ġvirgin ia
+Ġheadl ights
+Ġheadl amp
+Ġclinicopath iological
+Ġclinicopath ologic
+Ġmutan best
+comb ined
+Ġpension er
+Ġpension ers
+Ġhydrocarb on
+Ġhydrocarb ons
+Ġultrap ure
+Ġultrap ulse
+Ġdamp ening
+Ġdamp ened
+Ġmyel oid
+Ġmyel oma
+Ġsemia utomatic
+Ġsemia utomated
+Ġqray pen
+Ġqray cam
+Ġvet ted
+Ġvet ting
+Ġhomolog ue
+Ġhomolog ues
+Ġdysm orphism
+Ġdysm orphic
+Ġcopolymer ize
+Ġcopolymer ization
+Ġturb ine
+Ġturb inate
+Ġstream lined
+Ġramp ant
+Ġkeys plint
+Ġpilomat rical
+Ġpilomat rixoma
+Ġnonex traction
+Ġnonex perimental
+Ġthermost at
+Ġthermost atic
+Ġhisti ocytes
+Ġhisti ocytic
+Ġrevol ve
+Ġrevol utions
+Ġcallip er
+Ġcallip ers
+Ġaggrecan ases
+Ġdiscomfor ts
+Ġdiscomfor ting
+Ġrash id
+Ġvideotap ed
+Ġvideotap es
+Ġsulfon ated
+Ġsulfon amides
+Ġpuzz led
+Ġpuzz ling
+Ġbenzo ic
+Ġbenzo ate
+Ġharness ing
+Ġunsup ported
+Ġunsup ervised
+120 58461
+Ġpseudonym ized
+Ġpseudonym ised
+Ġsafegu ard
+Ġsafegu arding
+Ġerythropo ietin
+Ġerythropo iesis
+Ġadipok ine
+Ġadipok ines
+Ġlegitim ate
+Ġlegitim ise
+Ġnonsmo kers
+Ġnonsmo ker
+Ġnsa oh
+Ġnsa ids
+Ġbulim ic
+Ġbulim ia
+Ġteleph onic
+Ġteleph onically
+Ġunfold ed
+Ġunfamiliar ity
+Ġargin ase
+Ġdetriment ally
+Ġneurosc ience
+Ġneurosc ienti
+Ġendocrin ological
+Ġendocrin ology
+Ġrhein land
+Ġhypozin cemic
+Ġhypozin cemia
+otidyl inositol
+Ġdedupl ication
+Ġdedupl icated
+Ġarrayc force
+Ġarrayc fsr
+Ġarrayl the
+Ġarrayl wcan
+Ġelectrostatic ally
+Ġelectroencephal ography
+Ġelectroencephal ograms
+Ġsubclass ifications
+Ġsubtractive ly
+Ġmegakary ocytes
+Ġmegakary ocyte
+Ġovershadow ing
+Ġmicronutr ient
+Ġmicronutr ients
+Ġforesee ing
+Ġforesee able
+Ġchondro ectodermal
+Ġchondro itin
+aggc ac
+Ġreassign ed
+Ġreassign ing
+Ġadreno ceptor
+Ġselen ium
+Ġselen omonas
+Ġnephrotoxic ity
+Ġ343 7
+Ġslaughter house
+Ġmistaken ly
+classifications total
+Ġzeit geber
+Ġzeit ouni
+Ġreformat ting
+Ġlump ur
+Ġglutam ate
+Ġglutam ax
+Ġwitness ed
+Ġinterconnec tion
+Ġinterconnec tions
+Ġhepat ology
+Ġhepat ospl
+Ġmohamm ad
+Ġmohamm adi
+Ġplexig lass
+Ġplexig las
+Ġrecharge able
+Ġhotsp ot
+Ġhotsp ots
+Ġpostero anterior
+Ġtrypsin ized
+Ġjeop ardized
+Ġjeop ardize
+Ġjejun um
+Ġjejun ectomy
+atcgt ggaagg
+Ġphilip pines
+Ġjohn ston
+aagag catctg
+tctag cacttct
+Ġreconf irm
+Ġreconf irmed
+Ġunlock ed
+Ġspongi ose
+Ġspongi osa
+further more
+Ġsabur ral
+Ġsabur reum
+Ġmonochromatic ity
+Ġcontracep tion
+Ġcontracep tives
+Ġdislodge ment
+Ġpupil s
+Ġdephosphory lation
+Ġdephosphory lated
+Ġpreoccup ation
+Ġpreoccup ied
+Ġaboriginal s
+Ġtimeatrisk forhaving
+Ġnumberofnewc aries
+Ġnumberofnewc arioussur
+Ġintraperitone al
+Ġintraperitone ally
+Ġstigmatis ing
+Ġstigmatis ation
+Ġneurotransm itter
+Ġneurotransm itters
+Ġperfluorooct ane
+Ġperfluorooct anoic
+212 78290
+214 0
+375 6
+49 3
+auc ine
+bro ok
+cv mi
+cz ak
+constr uct
+canti lever
+commun ity
+det ails
+dia gram
+direct ors
+direc ted
+fel t
+fir st
+fem ale
+fasc in
+frequ ently
+gtt cttgttatc
+gingival is
+gae y
+gctg ttga
+gtgtc gctgttga
+hor izontal
+high er
+hum an
+hinol aryngologic
+irop oulos
+kas emkit
+ket ones
+krus kal
+khah et
+met astatic
+mut ans
+micro soft
+mdsc oreopmd
+macg regor
+numer ous
+oqu ine
+pocl adium
+rad ar
+sal ivary
+sec retion
+sup ply
+show ed
+successful ly
+tetr azolium
+tata a
+whe ther
+xerost omia
+yro xine
+yttr ium
+zaws ka
+zarray n
+Ġull ah
+Ġumb ilical
+Ġtec co
+Ġtid ymodels
+Ġtuc ker
+Ġtir ana
+Ġtaus che
+Ġtesti fied
+Ġtpt p
+Ġtamm ami
+Ġtick ling
+Ġtedi ous
+Ġtires ome
+Ġtabol li
+Ġait chison
+Ġaqu a
+Ġavi ation
+Ġaok i
+Ġawa ited
+Ġaatt ctccgaacgtgtc
+Ġaky ol
+Ġaleg re
+Ġaacgtgtc agtgg
+Ġajith krishnan
+Ġthia zolyl
+Ġthong prasom
+Ġthric e
+Ġthym idine
+Ġthie le
+Ġthurs day
+Ġthiaz ide
+Ġthwar ted
+Ġthammas at
+Ġtheat re
+Ġtheor ised
+Ġthesi as
+Ġsom atization
+Ġsip py
+Ġsill ness
+Ġsple en
+Ġspro uting
+Ġsures mile
+Ġske pticism
+Ġsarg eran
+Ġsade k
+Ġsanc tis
+Ġsier ra
+Ġsider idou
+Ġsaph o
+Ġsagl am
+Ġsomn omedics
+Ġsgar amella
+Ġsongk la
+Ġoen ning
+Ġoed ema
+Ġoud erra
+Ġoce ania
+Ġoment um
+Ġoch oa
+Ġoug radar
+Ġotor hinolaryngologic
+Ġoks ayan
+Ġokr ug
+enkr att
+alarm ing
+alypt ol
+Ġced ex
+Ġcul pable
+Ġcim baljevic
+Ġcib ei
+Ġcull in
+Ġcenti meters
+Ġcay etano
+Ġcyp rus
+Ġcct ttaga
+Ġcak ur
+Ġcust odians
+Ġcili ated
+Ġcze izel
+Ġceng iz
+Ġcabin et
+educ ation
+Ġpim ozide
+Ġpich ler
+Ġpms f
+Ġpbr n
+Ġpunc tiform
+Ġpust ules
+Ġpav oni
+Ġpiment a
+Ġpantom ography
+Ġwan ed
+Ġwol ford
+Ġware house
+Ġwop mdscoreopmd
+Ġwins auer
+Ġwets elaar
+Ġwisc onsin
+Ġwaters hed
+Ġwperson nel
+Ġwenjuan xing
+Ġwernec k
+Ġinat tention
+Ġingr ained
+Ġinns bruck
+Ġinbre eding
+Ġinopress ors
+Ġinanim ate
+Ġantis ense
+Ġanym ore
+Ġanaphyl atox
+Ġaneg undi
+Ġfom ites
+Ġfay oum
+Ġfire fighting
+Ġfond azione
+Ġfles ch
+Ġfiro uz
+Ġfumar ic
+Ġfuchs ine
+Ġdib iase
+Ġdong yang
+Ġdile mma
+Ġdines h
+Ġdelf tia
+Ġdaren deliler
+Ġdammas chke
+Ġming le
+Ġmup pa
+Ġmot allebne
+Ġmum mified
+Ġmari juana
+Ġmong olian
+Ġmesti zo
+Ġmack erel
+Ġmort gage
+Ġmisc roscope
+Ġmuk htar
+Ġmission s
+Ġmams l
+Ġmogh addam
+atle astonec
+attem pts
+atacc gtctc
+thro ughout
+Ġandreas en
+Ġbion ics
+Ġbull ae
+Ġbach elor
+Ġbans al
+Ġbcc p
+Ġbish ara
+Ġbough t
+Ġbgi i
+Ġbros h
+Ġbomb ail
+Ġbudd hism
+Ġbogg ess
+Ġbkm r
+rotest osterone
+Ġreup take
+Ġreut roin
+Ġrefere ed
+Ġreop ened
+Ġrevel ation
+Ġreits ma
+Ġrethough t
+Ġrepre paration
+Ġreorgan ization
+Ġrebal ance
+Ġrehard ening
+Ġreintroduc ed
+Ġreanaly zed
+Ġrezif low
+Ġtoul ouse
+Ġtoly pocladium
+Ġtour ism
+Ġtoile t
+Ġtoss ed
+Ġtosc ano
+Ġtola rova
+Ġhud dinge
+Ġhts cs
+Ġhun an
+Ġhers elf
+Ġhill s
+Ġhass elkv
+Ġhack le
+Ġhob bies
+Ġhomet owns
+Ġhomic ide
+Ġhoch berg
+Ġhoh mann
+Ġhigg ins
+Ġhilt unen
+Ġhatt ab
+Ġhamp ered
+Ġhams ters
+leidom astoid
+Ġeun uchs
+Ġeuc alyptol
+Ġeys enck
+Ġeber hardt
+Ġejec ted
+Ġeust achian
+Ġeik anella
+Ġeiff el
+Ġeuv olemia
+Ġstur divant
+Ġstab holz
+Ġstum p
+Ġstrom al
+Ġstee per
+Ġstatis tily
+Ġstaw arczyk
+Ġstyl us
+Ġstoch astic
+Ġstagg ering
+erether ketone
+acaca acaaggc
+Ġlil acs
+Ġluc ky
+Ġliz ards
+Ġlore nz
+Ġlop inavir
+Ġlug o
+Ġliti gation
+Ġlinc omycin
+Ġlumb ar
+Ġlau vauthan
+Ġlumin ance
+Ġlaryng oscopy
+Ġluck ily
+Ġlenn on
+Ġlapa roscopic
+Ġlaryngo tracheal
+Ġllewelly n
+Ġnid dm
+Ġnip ples
+Ġnag elker
+Ġnirm ala
+Ġnaz ari
+Ġnemat ode
+Ġnemen yi
+Ġnalc aci
+Ġnlr p
+Ġgur zawska
+Ġgand olf
+Ġgase ous
+Ġgyp sum
+Ġgak uen
+Ġgha fari
+Ġgilm ore
+Ġgarc ia
+Ġgarth waite
+Ġggt ggcttg
+Ġgizan i
+Ġgalp ore
+Ġgogg les
+Ġgemt c
+Ġgilling ham
+Ġgarn ered
+Ġginig ivalis
+Ġwithst ood
+Ġwithhol ding
+Ġwasfilt ered
+Ġforamin al
+Ġforget fulness
+Ġforgot ten
+Ġasex ual
+Ġasah i
+Ġascrib ing
+Ġaston ishingly
+Ġasphy xia
+Ġasaccha rolytic
+Ġconqu ering
+Ġconval escent
+Ġconner t
+Ġonych o
+tstotal person
+Ġorino quia
+Ġorchi ectomy
+Ġortop edico
+Ġortob ajt
+Ġvse arch
+Ġvied oc
+Ġvolog da
+Ġvak if
+Ġvie ira
+Ġvinc kier
+Ġvoy age
+Ġvime o
+Ġvulgar is
+Ġalia ga
+Ġalph afold
+Ġalha ija
+Ġaldr ich
+Ġalask an
+Ġaliment ation
+Ġalsh ammery
+Ġaldehy des
+Ġalmoh amad
+Ġalhar bi
+Ġalcar az
+Ġalhuda ithi
+Ġalqer ban
+Ġalzhe imer
+Ġperple xing
+Ġperfer red
+Ġperuan a
+Ġrain forest
+Ġrist ow
+Ġrond ells
+Ġrhes us
+Ġrne asy
+Ġritt ler
+Ġrdr p
+Ġrstud io
+Ġronald o
+Ġruos po
+Ġricuc ci
+Ġwhine y
+Ġwhipl ash
+Ġexoph ytic
+Ġexsangu ination
+Ġproqu est
+Ġproform ae
+Ġprohib itively
+Ġprodig y
+Ġresver atrol
+Ġresuture d
+Ġresaz urin
+Ġresurg ence
+Ġrestruct uring
+Ġbeech er
+Ġbehe ira
+Ġbeaut y
+Ġbezm ialem
+trad itionally
+Ġimpor ving
+Ġimip ramine
+Ġimpress ively
+Ġimidaz oles
+Ġisof ield
+Ġishib ashi
+Ġisomal t
+Ġisopro stanes
+Ġisaac son
+Ġisrct n
+addition ally
+irsag ar
+Ġchib a
+Ġchocol ates
+Ġcherv in
+Ġchees e
+Ġchaper ones
+Ġchalo os
+Ġchaud hary
+Ġchlord emethyld
+Ġdeub iquitination
+Ġdeox ynucle
+Ġdeuter ium
+Ġdeuts chland
+Ġdeidenti fied
+Ġdeacet ylase
+Ġdeescal ating
+Ġincogn ito
+Ġincarn ate
+Ġmeib omian
+Ġbystand er
+Ġatact ctatcgt
+Ġatrop ine
+Ġatatct attggt
+Ġatelocol lagen
+Ġprecr ystallisation
+Ġprecal ibrated
+Ġpreco ated
+Ġprefr ontal
+Ġpremax illa
+Ġpreodont oblast
+Ġprehist oric
+Ġacron ym
+Ġacumin atum
+Ġacetal dehyde
+Ġacrid inium
+Ġacaact ttggt
+ivile ged
+Ġdisper tion
+Ġdisple asing
+Ġdisten ding
+Ġdisappro ve
+Ġdisfig uration
+Ġdistill ation
+Ġdisfav or
+Ġseymo ur
+Ġseulgg ie
+Ġsevefl urane
+Ġshand ong
+Ġshee hab
+Ġshell hardt
+Ġsherm an
+Ġshack les
+Ġshark ia
+Ġshrin king
+Ġshimm ering
+Ġshiro ta
+Ġshuff led
+Ġshivash ankara
+Ġdifft est
+Ġadamant inomatous
+Ġhebe i
+Ġheyd ecke
+Ġhearten ed
+Ġheista ro
+Ġheidel berg
+Ġassembl ing
+Ġassosci ates
+Ġclop per
+Ġclip ped
+Ġclox acillin
+Ġclav ulanic
+Ġtwee zer
+Ġtwinc ubator
+Ġtwosample mr
+Ġmagg ots
+Ġmaze ii
+oprec ipitation
+Ġscip y
+Ġscour ge
+Ġscha edler
+Ġscanc o
+Ġsculpt able
+Ġperiopath ogens
+Ġperiopro be
+Ġaposens or
+Ġitch y
+Ġcoerc ive
+Ġcoinf ected
+Ġcoales cent
+Ġcoocc urring
+Ġcobbl estone
+Ġcoorlin ates
+Ġcoomass ie
+Ġindeterm inate
+Ġinduv ial
+Ġindraw ati
+Ġleva i
+Ġleita o
+Ġlevoth yroxine
+Ġleopold o
+Ġnotting ham
+Ġcanall ed
+Ġparath yroid
+Ġparama gnetic
+Ġparacr ine
+statistic al
+Ġforesh adowed
+perform ance
+Ġhaens zel
+Ġhaavi kko
+Ġhahn enkratt
+Ġhaffaj ee
+Ġcontag ious
+Ġpresyn aptic
+Ġpreserv atives
+Ġplurip otency
+Ġalldl ms
+Ġwhichbu ild
+Ġrousp o
+Ġtrag us
+Ġtrick y
+Ġtrih ydroxy
+Ġtriaz olam
+Ġtrieth ylene
+Ġconsola ro
+Ġregist ro
+Ġreglaz ing
+Ġobso lete
+Ġobweges er
+Ġaccru ed
+Ġnovic es
+Ġnohs a
+Ġrecateg orized
+Ġrecont ouring
+Ġrecumb ent
+Ġrecycl ing
+Ġnexy gen
+Ġnebn ext
+Ġnepom uceno
+Ġneuroradi ology
+Ġabik o
+Ġabaq us
+Ġabdel aziz
+Ġabudall atif
+facestotals urface
+Ġsubple ural
+Ġsubord inate
+Ġsubging inval
+Ġsubfl avea
+Ġsubfamil ies
+Ġsubthem es
+Ġsubarach noid
+Ġinterph ase
+Ġinterne urons
+Ġintercal ated
+Ġintergen erational
+Ġintergo up
+Ġintertw ined
+Ġinterchange ably
+Ġinterfur cal
+Ġinteroper ability
+Ġinterverte bral
+Ġinterappoint ment
+Ġquater nary
+Ġqueas iness
+Ġquiryn en
+Ġunstr atified
+Ġunint ended
+Ġunord ered
+Ġunman ly
+Ġunresp onsive
+Ġunmark ed
+Ġunme asured
+Ġunaff ordable
+Ġunra vel
+Ġunstead y
+Ġuntime ly
+Ġunobser ved
+Ġunstruct ured
+Ġuntrans formed
+Ġunhel pful
+Ġuninterpre table
+Ġunbu ffered
+Ġunestabl ished
+Ġunantic ipated
+Ġunvac cinated
+Ġunattain able
+Ġunleash ed
+Ġintuss usceptive
+Ġyass aei
+Ġyamam ura
+Ġyttr ia
+Ġamarant e
+Ġamitr iptyline
+Ġkual a
+Ġkob ayashi
+Ġkaw amura
+Ġkne ecaps
+Ġkih on
+Ġkont tinen
+Ġkaz az
+Ġkivo vics
+Ġkuro da
+Ġkavy a
+Ġksh irsagar
+Ġkla assen
+Ġkungs backa
+Ġkratch man
+Ġkrennma ir
+plect in
+Ġvalenc ia
+Ġvaldiv ia
+Ġencr ypted
+Ġenucle ation
+Ġenumer ated
+Ġenigm atic
+Ġenthus iasm
+Ġgenew iz
+Ġgenamic s
+olarct obacterium
+Ġcoryn ebacterium
+Ġcorros ive
+Ġcoroll ary
+Ġcorrid ors
+Ġdesmo plastic
+Ġdesicc ator
+Ġdescend ants
+Ġsobr inus
+Ġarric o
+Ġarbe itsgeme
+Ġarrosion s
+Ġmedrx iv
+Ġphasc olarctobacterium
+Ġphleb oliths
+Ġoverpres cribed
+Ġovercon fidence
+Ġovergro wn
+Ġovercom pensating
+Ġbiolum inescence
+Ġbiostatistic s
+ctta attg
+ctgc ctccttcc
+Ġmoons hine
+Ġmoebi us
+Ġmozan y
+Ġmoirangth em
+Ġcolde a
+Ġdecellular ized
+Ġdeceptive ly
+Ġcrush ed
+Ġcrick ets
+Ġcraf ted
+Ġcrimin ality
+Ġagtgg gtgtcgctgttga
+Ġcalzol ari
+Ġstratov an
+cccat ctc
+ccacagtt tc
+Ġ113 1
+Ġprocalc itonin
+Ġsimps on
+Ġbrust ad
+Ġbrav o
+Ġbramant e
+Ġbratth all
+Ġundeb ated
+Ġundetect able
+Ġundifferenti ated
+Ġmaneu ver
+Ġmanhatt an
+Ġmanzal awi
+Ġ213 8
+Ġnoncr itical
+Ġnonfer mentable
+Ġnonred undant
+Ġnonresp onse
+Ġnoncom plicated
+Ġnonvascular ized
+Ġnonnorm ally
+Ġnoninf ectious
+Ġnonmed ical
+Ġnoncycl oplegic
+Ġnonnen macher
+Ġnonpain ful
+Ġnonrand omized
+Ġnonalcohol ic
+Ġsupress es
+Ġorthophosph oric
+Ġradiopro tection
+Ġradiosensitiz er
+Ġdefrag mentation
+Ġspok en
+Ġspatul as
+Ġjak oba
+Ġjane iro
+Ġjitt ered
+Ġjoy ce
+Ġjung le
+Ġjok ovic
+Ġjcp ds
+Ġjacks on
+Ġjeremia h
+Ġjenk is
+Ġedef inition
+Ġfurunc u
+Ġfurhaus er
+Ġmicrodr ill
+Ġmicroca vities
+Ġmicrocy tic
+Ġmicrohy brid
+Ġmicroarr ays
+Ġmicroabs cesses
+Ġmicrophthal mia
+Ġmicroaer ophilic
+Ġmicroabras ion
+Ġdemethyl ase
+Ġdemaros i
+Ġminibr ush
+Ġminisce w
+Ġiked a
+Ġiwas aki
+Ġikb kg
+Ġmaltit ol
+Ġmalocl usion
+Ġmaladj ustment
+Ġmalho tra
+Ġmalnour ished
+Ġformaz an
+Ġoutcompet e
+Ġopio ids
+Ġdiarr hea
+Ġdihyd rotestosterone
+Ġdihydr ate
+Ġgramm atical
+Ġgrav is
+Ġgrind ed
+Ġgroning en
+Ġdeparaffin ization
+Ġsalame h
+Ġsalesp ersons
+Ġsalimetric s
+Ġunderpr ivileged
+Ġunderrepresent ed
+Ġimpinge ment
+Ġimpregn ated
+Ġpostpart um
+Ġpostcur ricular
+Ġcrouz on
+Ġconfron ting
+Ġpainkill ers
+Ġseraf im
+Ġmetacy c
+Ġmetatrans criptome
+Ġmetapoly zyme
+Ġmonoph ase
+Ġmonochlor inated
+Ġmonobe veled
+Ġblau tia
+Ġembl oyed
+Ġemble matic
+Ġemmel mann
+Ġfreuden mann
+Ġfreiburg er
+Ġintratum oral
+Ġintraind ividual
+Ġ0000 1
+Ġzechn er
+Ġzha o
+Ġzanc ajo
+Ġzaf iropoulos
+Ġzame er
+Ġzole til
+Ġzale plon
+Ġzij nge
+Ġzik avirus
+Ġzenot ec
+Ġzucch elli
+Ġerlen meyer
+Ġeriogl aucine
+Ġerzur um
+Ġerreyg ers
+Ġendoph thalmitis
+Ġendorph ins
+Ġendomicro scopy
+Ġendosc opes
+Ġcauter ization
+Ġinflatun s
+Ġcefr adine
+Ġeltaw il
+Ġmultiplan ar
+Ġmultimorb idity
+Ġremdes ivir
+Ġfranc a
+Ġfrances hi
+Ġfrustr ated
+Ġlongbott om
+Ġpredecess or
+Ġanycub ic
+Ġbasophil s
+Ġmucopolys accharides
+Ġmucogingiv itis
+Ġsmiled irectclub
+Ġinstig ates
+Ġappreh ension
+Ġschra ufstatter
+Ġschwar zer
+Ġschnut enhaus
+Ġschwend icke
+Ġschimid lin
+Ġdouch ing
+Ġcybers ickness
+Ġprotuber ance
+Ġmouthfe el
+Ġmouthpi ece
+Ġpathosystem s
+Ġantidi abetic
+Ġantipsych otics
+Ġantiprolif erative
+Ġantithrom bin
+Ġceragl aze
+Ġuniversita ire
+Ġosmore gulation
+Ġavulsion s
+Ġmechanotrans duction
+Ġfacscal ibur
+Ġpalind romic
+Ġguimara es
+Ġesco ufier
+Ġescher ichia
+Ġnecros iss
+Ġosteointegr ation
+Ġosteodyst rophy
+Ġattga acacaacaaggc
+Ġintravent ricular
+Ġintrauter ine
+Ġdaeg u
+Ġdavidopo uloou
+Ġsloter vaart
+Ġhypophosphate mia
+Ġhypopne a
+Ġmatru h
+Ġmatthe us
+Ġ570 5
+Ġepiph aryngeal
+Ġepimer ase
+Ġepiflu orescence
+Ġredistrib uted
+Ġabsciss a
+Ġnormodiver gence
+Ġnewbor ns
+Ġmorgell ons
+Ġcompliment ary
+Ġcrosslin king
+Ġacidov orans
+Ġhoskins on
+Ġdiabru x
+Ġmidgest ation
+Ġmidorb ital
+Ġpolygen ic
+Ġpolyhex inide
+Ġpolyeth eretherketone
+Ġpolyprop ylene
+Ġpolytom ous
+Ġpolybut adiene
+Ġpolydimethyl siloxane
+Ġpolytechn ic
+Ġpolyarylether ketones
+Ġpolypharm acy
+Ġachili as
+Ġpaepe gaey
+Ġpaolon i
+Ġparod ontium
+Ġpajn igara
+Ġpaolanton io
+Ġlifecy cle
+Ġpapyr acea
+Ġpapanic olau
+Ġufl c
+Ġautoch thone
+Ġautoph agy
+Ġautopolymer ized
+Ġautocorre lated
+Ġlightcycl er
+Ġreducedebr is
+Ġlaypers ons
+Ġimmunoph enotypic
+Ġimmunosen escence
+Ġaffectedsubjec tstotalperson
+Ġstippl ed
+Ġodhl ers
+Ġodynoph agia
+toomb ak
+Ġequilibr ated
+Ġequidist ant
+Ġmesang ial
+Ġmesoph aryngeal
+Ġ420 21278290
+Ġaxhaus en
+Ġtahm aseb
+Ġtaacatt agaaac
+Ġintereset ed
+Ġstrongyloid es
+Ġexperimentalgroup s
+Ġprecarious ness
+Ġboots trapping
+Ġbogeym an
+Ġpanouts opoulou
+Ġpancher z
+Ġpanphot ocoagulation
+Ġdeepithelial ization
+Ġstepano vic
+Ġhypercellular ity
+Ġhypermes h
+Ġhypercap nia
+Ġreasonabl eness
+Ġcyclophosph amide
+Ġelectir c
+Ġbiomineral ization
+Ġbiomechenich al
+Ġdelmop inol
+Ġpsychotic ism
+Ġpsychoneurolog ical
+Ġmuttuk adu
+Ġskyroc keted
+Ġxyle tol
+Ġxiang ya
+Ġlipofect amine
+Ġnorthe ast
+Ġnorrh em
+Ġbackprop agation
+Ġbackstep ping
+Ġpolastr i
+Ġ860 2
+Ġwahl strom
+Ġwahad ni
+Ġphotomedic ine
+Ġphotocop ies
+Ġbrevund imonas
+measure ments
+meaning ful
+Ġmussavir a
+Ġcollprot ect
+Ġsternoc leidomastoid
+Ġcirau qui
+Ġbarcel ona
+Ġillino is
+Ġ20170 1
+Ġtennis on
+Ġmagneto encephalography
+Ġpneumophil a
+Ġpneumocys tis
+Ġorganole ptic
+Ġalgahe fi
+Ġbrows able
+Ġultracle an
+Ġencoraf enib
+Ġmyrt le
+Ġbuzz ing
+Ġmillisecond s
+Ġphosphosil icate
+Ġsemmel weis
+Ġmacarth ur
+Ġmacromo lecules
+Ġqude imat
+Ġbinimet inib
+Ġdysgran ular
+Ġdysphor ia
+Ġdyskines ia
+Ġdysthym ia
+Ġherlof son
+Ġcholecyst ectomy
+Ġturrion i
+Ġnanogl asses
+Ġnanohy brid
+Ġporopl is
+Ġdowntur ns
+Ġphenochlor oform
+Ġphenyto in
+Ġphenylmeth ylsulfonyl
+Ġchloroamin oacids
+Ġentrus ted
+Ġintegu mental
+Ġmiscell aneous
+Ġmiscegen ation
+Ġmisregistr ations
+Ġlaterotr usion
+Ġsaatch i
+Ġsaquin avir
+Ġhencefor th
+Ġafflic ted
+Ġbirthyear s
+Ġnaeij e
+Ġcytosc ape
+Ġcytomegal ovirus
+Ġcamphor quinone
+Ġartocar pin
+Ġkebang saan
+Ġpilocar pine
+Ġforefr ont
+Ġsaraj evo
+Ġodontostomat ological
+Ġodontontocl asts
+Ġleukoar aiosis
+Ġacquaint ance
+Ġarrhy thmia
+Ġmcerebr um
+Ġgaik wad
+Ġbalsamin a
+Ġlymphotox ins
+Ġlymphoplasm acytic
+Ġpropenen itrile
+Ġsafran in
+Ġscrewdri ver
+Ġsteenberg he
+Ġsubmillimet re
+Ġguttaper cha
+Ġccagggt atggacct
+Ġalbuquer que
+Ġduoden um
+Ġrataj czak
+Ġbeschwer den
+Ġkitami ense
+Ġvasodil ation
+Ġvasospas ms
+Ġcounterproduc tive
+Ġcountermom ent
+Ġcountervail ing
+Ġanaesthes iologists
+Ġpostsecond ary
+Ġbiotrans formation
+Ġbioabs orbable
+Ġbioelec trical
+Ġbioarchae ological
+Ġ20000400 63
+Ġperfluoron onanoic
+Ġgrembow ski
+Ġtapiova ara
+Ġoxogl utarate
+Ġaminoethyld iphenyl
+caatcc cttaattg
+Ġwashbas in
+Ġradnz ic
+Ġstreptoz otocin
+Ġstreptavid in
+defin itions
+Ġgcdf p
+Ġraspator ium
+Ġmacrogl obulin
+Ġbottlen eck
+Ġdichlorodih ydroflu
+Ġomnist at
+Ġsulfadiaz ine
+Ġcurviline ar
+Ġbennet t
+Ġcatogor ized
+Ġwarangkul kasemkit
+Ġarthrocent esis
+Ġecchym osis
+Ġdisaggreg ated
+Ġphotoirr adiation
+Ġtetrameth ylsilane
+Ġatherothrom botic
+Ġholotox in
+Ġholopros encephaly
+Ġgaszyn ska
+Ġquadhel ix
+Ġunstick iness
+Ġcitrull inated
+Ġhydroxyprop yl
+Ġpseudarth rosis
+Ġnanoprec ursors
+Ġanticonvuls ant
+Ġangiopo ietin
+Ġmethanosarcin a
+Ġoctacalc ium
+Ġnonsurg ically
+gatekee per
+tgaag atccggtc
+Ġkhosra vi
+Ġovercorre ction
+Ġglucosyl transferase
+Ġhydroxychlor oquine
+accagct catgc
+Ġpitfall s
+Ġmitteilun gen
+Ġbulgar ia
+Ġchromoblast omycoses
+Ġpetrole um
+Ġbicinch oninic
+Ġglossodyn ia
+enesulf onic
+Ġrenmin bi
+Ġneurocogn itive
+Ġpykno tic
+Ġfingern ail
+Ġbonfig lio
+Ġaldhu wayhi
+Ġadenotons illar
+Ġunconscious ly
+Ġuncorrec ted
+Ġhypoalbumin emia
+Ġphysiotherap ists
+Ġmesiovestib ular
+Ġcastill o
+Ġinterspers ed
+201312 1815842
+202306 12058461
+Ġkaarn iranta
+Ġbilirub in
+Ġtrapezi us
+Ġretrofitt able
+Ġretroperitone um
+Ġthermoplasm ata
+Ġtgaa aagagcatctg
+Ġtgcaaa agaaggcat
+Ġrepuls ive
+Ġhetreogen ecity
+Ġbiosynthes ized
+Ġbayrak dar
+Ġnfkb ia
+Ġinfradental e
+Ġuncooper ativeness
+Ġmethylmeth acrylate
+Ġmethyliminodi acetic
+Ġiccmst m
+Ġenterobacteriace ae
+Ġelectroconvuls ive
+Ġnineteen th
+Ġtangsu ksan
+Ġventriculomegal y
+Ġporphyrym ona
+Ġferrit in
+Ġmegaspha era
+Ġmicrosphere s
+Ġmicrosatell ite
+Ġadjuvan tive
+Ġgastroprot ective
+Ġsunny brook
+Ġcatalyz es
+Ġproclaim ed
+Ġunmistak able
+Ġbenchmar king
+1457 7
+Ġbacitr acin
+Ġbigdy eterminator
+22285 70
+Ġgonzale z
+Ġgottsaun er
+Ġkolwij ck
+Ġkolomgro v
+Ġkuhle felt
+Ġtransglut aminase
+Ġweltzi en
+Ġalveolopl asty
+Ġtrelle borg
+Ġtelesc opic
+Ġhaploins ufficiency
+Ġbiotinyl ated
+Ġ3598 4
+glcn ac
+Ġtroubles ome
+Ġthromboemb olism
+Ġinterpapill ae
+Ġamphiphil ic
+Ġiatrosed ative
+Ġimmunocompet ent
+Ġhypertelor ism
+Ġcgcct accagctcatgc
+Ġbhalaj i
+Ġgtcaatt ctgcctccttcc
+Ġprecipitationdiss olution
+Ġmisdiagn ose
+Ġthrombophleb itis
+Ġlobbezo o
+Ġepiglot tis
+Ġnondestr uctive
+Ġtrimgal ore
+Ġmohamad khahet
+agaatgg gata
+Ġgrandparen ts
+Ġfloqs wabs
+Ġbenzodiaz epines
+Ġbenzothiaz ole
+Ġlinguovel ar
+Ġfiocru z
+Ġfiorell i
+Ġbundesmin isterium
+Ġhamidi ye
+Ġposterotr agion
+Ġjeffco at
+Ġmicrocolon ies
+Ġintrasubjec t
+Ġperfluorohex ane
+Ġperfluorodec anoic
+Ġpentaery thritol
+Ġpentobarb ital
+Ġmurmans k
+Ġbaghd ady
+Ġechocard iography
+Ġgambet ta
+Ġabduljab bar
+Ġbronchodil ators
+Ġradioimmun oprecipitation
+Ġabsorpti ometry
+Ġpolyetherketone ketone
+Ġcraniosyn ostosis
+Ġcraniopharyn gioma
+Ġmicrorough ness
+Ġcetyltrimethyl ammonium
+Ġsidestep s
+Ġoleophobic ity
+Ġpeduzz i
+Ġbanglades h
+Ġeigenvect ors
+Ġlisinop ril
+Ġlatitud es
+Ġnienk emper
+Ġggcccagct tctagcacttct
+Ġcannabin oids
+Ġkimwip es
+Ġspinocerebell ar
+Ġthoracoab dominal
+Ġelectrocauter y
+Ġglycosylphosph otidylinositol
+Ġvelopharyngo plasties
+Ġdubliniens is
+Ġthioglyc ollate
+Ġthiogalact opyranoside
+Ġdiphenyl tetrazolium
+Ġgccgctcc gacacagg
+Ġgccatcat gttcttgttatc
+Ġgccatcacg ccacagtttc
+Ġalloimmun ization
+4201707485 4
+gacagtt caaat
+Ġciclospor in
+Ġantimyco tic
+Ġantimetabol ites
+Ġhedghe hog
+Ġlentulos piral
+Ġgobbledygo ok
+Ġgggccaact gacagttcaaat
+Ġgggtttg caatcccttaattg
+Ġgcaagtctag ataccgtctc
+Ġgtgtctgga agaatgggata
+Ġgtgtgggtacgga aggcac
+Ġcholinerg ic
+Ġcholangi ocarcinoma
+Ġtrinitrobenz enesulfonic
+Ġprabhak ar
+Ġnonhospital ized
+Ġdijkstr a
+Ġcefuroxim e
+Ġmesoameric an
+Ġneuroscienti fic
+Ġarraylwcan cer
+Ġhepatospl enic
+Ġtimeatriskforhaving atleastonec
+Ġnumberofnewcarioussur facestotalsurface
+Ġaattctccgaacgtgtc acgt
+Ġaacgtgtcagtgg tggacctg
+Ġcctttaga ac
+Ġanaphylatox ins
+Ġmotallebne jad
+Ġhasselkv ist
+Ġlauvauthan on
+Ġnagelker ke
+Ġggtggcttg cactaggtg
+Ġchlordemethyld iazepam
+Ġdeoxynucle otidyl
+Ġatactctatcgt cccatctc
+Ġatatctattggt attccaag
+Ġacaactttggt atcgtggaagg
+Ġarbeitsgeme inschaft
+Ġagtgggtgtcgctgttga agt
+Ġtaacattagaaac ctg
+Ġphenylmethylsulfonyl fluoride
+Ġccagggtatggacct gtctg
+Ġaminoethyldiphenyl borate
+Ġdichlorodihydroflu orescein
+Ġtgaaaagagcatctg tgaagatccggtc
+Ġtgcaaaagaaggcat gg
+Ġcgcctaccagctcatgc ataac
+Ġgtcaattctgcctccttcc acc
+Ġgccgctccgacacagg tataa
+Ġgccatcatgttcttgttatc g
+Ġgcaagtctagataccgtctc g
+Ġtimeatriskforhavingatleastonec arieslesion