diff --git "a/merges.txt" "b/merges.txt"
--- "a/merges.txt"
+++ "b/merges.txt"
@@ -5,33956 +5,49736 @@ i n
 r e
 Ġt h
 o n
-Ġth e
+a t
 Ġ s
-t i
-Ġ o
+Ġth e
 e n
-a l
+Ġ o
 e r
 Ġ c
-e d
 Ġ p
+e d
 Ġ w
+a l
 Ġ in
-e s
 Ġa n
+i t
+e s
 Ġo f
 Ġ f
+i c
+i on
+o r
 Ġ d
+i s
 Ġ m
-a t
-o r
-t h
-a n
 Ġan d
 Ġ b
-i s
-ti on
-a s
 en t
-i c
-in g
+a s
+a n
 r o
 a r
+in g
 Ġ re
-Ġt o
+c t
 Ġ h
 l e
 Ġ e
-i t
+Ġt o
+v e
+at ion
 u s
-a tion
+u l
+Ġ n
 Ġs t
+o m
 e re
-u l
-a c
-v e
-e c
+u r
 Ġ l
-o m
-Ġ n
+e t
+it h
+l y
+o s
 i m
+Ġw ith
 Ġ g
-l y
-u r
 i g
-Ġw i
-Ġwi th
-u d
-e t
-o s
+i d
+t h
+at i
 c e
-Ġw as
-i f
-Ġf or
 o l
+i f
 Ġa s
-i l
+Ġw as
+u d
+Ġf or
 Ġc on
-o d
-i d
-o w
+u n
+i l
+r a
 Ġ on
-m ent
-a ti
+o w
+e l
+ent s
+u t
 Ġw ere
-t s
-Ġo r
 a b
-u n
-Ġst ud
-a m
-ti c
-Ġ v
 re s
-e l
-t er
-u p
-Ġa l
-t ed
-Ġp er
-Ġ r
-Ġw h
-Ġe x
-g e
-Ġp ro
-Ġre s
+Ġ v
+c h
 Ġb e
-i on
+e ct
+Ġp ati
+Ġp ro
 at ed
-u c
+u p
+t er
+o d
+Ġe x
+an t
+o t
+Ġst ud
+Ġ r
+i v
+e m
+it y
+Ġa l
+ic al
 Ġth at
+Ġw h
+a g
 Ġc om
-t r
-o t
-Ġ im
+is t
 Ġ is
-an t
-it y
-a d
-u t
-es s
+u m
+Ġpati ents
+a m
+Ġre s
+at e
 i r
-v er
-Ġ us
-ic al
+Ġo r
 o c
-q u
-i z
-Ġc h
-i es
-at e
+o p
+y s
 Ġd e
-o re
-Ġstud y
-a in
+i ve
+es t
+or t
+m ent
 ig h
 Ġin c
-ig n
-u m
-p l
-Ġg ro
-Ġm e
-ab le
+Ġ us
+i z
 Ġb y
+v er
+Ġc h
+Ġ im
 u re
-ent s
+i es
+i b
+q u
+o re
 Ġa t
-Ġp re
-Ġa c
-y s
+es s
 Ġcom p
-Ġgro up
-if ic
-i v
-o g
-i b
-Ġd is
 Ġs e
 i al
-Ġs h
-f ere
-a p
-Ġth is
-Ġd if
-o th
-a re
+o g
+a ct
+Ġstud y
 Ġa d
-fere n
-Ġp ati
-Ġd ent
-Ġb et
-Ġh e
-Ġs ign
-Ġas s
-Ġc l
+ul t
+a d
+Ġp re
+Ġp er
+s t
+Ġs u
+ab le
+Ġg ro
 ro m
-re at
-an d
-Ġa re
-Ġt w
+Ġs h
+ig n
+if ic
+a in
+i p
+Ġ le
+Ġgro up
 f f
-Ġm a
-o p
-p or
-Ġdif feren
-od on
-w e
-e m
+a re
+Ġth is
+Ġas s
+s e
+in e
+Ġa c
+a y
 er s
-Ġs c
-en ce
-Ġtw o
-Ġbet we
-Ġbetwe en
-Ġsign ific
-Ġper i
-Ġor al
-a ge
-Ġf rom
-Ġa p
-i p
-Ġdent al
-Ġ it
-Ġsignific ant
+a c
+Ġt w
 un d
+Ġa re
+Ġd is
 Ġc o
-iz e
-th er
+Ġf rom
+p ort
+res s
 Ġin d
-i a
-Ġpati ents
-Ġ le
-Ġs ur
-ation s
-d ing
+Ġtw o
+as e
+Ġs ign
+el l
+Ġn ot
+Ġw e
+if f
+p l
+Ġcon t
 or m
-Ġhe al
-o us
+ere n
+Ġd iff
+Ġb et
+Ġc l
 Ġon e
-Ġs ize
-Ġt able
-u b
-t al
-Ġn ot
-Ġt reat
-ar y
-es t
-Ġh igh
-ti ve
-ac t
-p ec
-s e
-re e
-Ġc an
-Ġp ar
-Ġtreat ment
-Ġheal th
-in e
-Ġres ul
-Ġp os
-v al
-v i
-i tion
-s t
-Ġf o
-e e
-Ġin f
-an ce
 ve l
-ul l
+Ġh e
+th er
+ar t
+en ce
+ation s
+ct ion
+Ġt re
+p e
+os t
+en d
+Ġm e
+i a
+p t
+o us
+Ġ it
+Ġn e
+Ġh igh
+Ġan al
+ar d
+Ġsign ific
+g e
+w e
+ag e
+Ġs c
 p er
+Ġd i
+Ġin f
+p h
+u c
+iz e
+Ġsignific ant
+we en
+Ġbet ween
+Ġin t
+Ġdiff eren
 Ġh a
+it ion
+ar y
+Ġs ize
+Ġf o
+ati ve
+Ġt able
+ff ect
 ic h
+Ġa f
+an d
 Ġsh ow
-en ti
-Ġan al
-re n
-Ġcon t
-ar i
-ff ec
-Ġp res
-Ġp l
-Ġstud ies
-u e
-el l
-Ġal l
-s ion
-on g
-Ġperi odon
-Ġf ull
-as e
-c h
-en d
+en s
+as ed
+as t
+Ġa p
+v i
+Ġanal ys
+re e
+Ġf ul
+Ġres ult
+Ġs ur
+Ġa b
 Ġwh ich
+l ud
+Ġ k
+Ġful l
+or s
+Ġal l
+Ġe v
 u g
-il l
-Ġ ro
-Ġt r
-e ar
-Ġm ore
-Ġm od
-al ly
-ac h
-Ġcon s
-Ġre g
-c l
+Ġc an
 Ġo b
-Ġac c
-Ġth an
-ati ve
-g es
-Ġn o
-Ġth ree
-Ġanal ys
+ar i
+Ġaf ter
+Ġtre at
+igh t
+an ce
+Ġt r
+on g
+Ġre l
+Ġm et
+Ġp l
 Ġha ve
-ul d
-Ġs am
-Ġus ed
 oc i
-Ġre c
-Ġinc l
-or s
-Ġus ing
-Ġre l
-Ġn e
-Ġp r
-Ġc ar
-Ġto oth
-i ve
-ee th
-Ġt eeth
-Ġresul ts
-as ed
-Ġa b
-Ġcl in
-Ġa f
-igh t
-Ġre por
-c es
-d uc
-f ac
-Ġs ub
+Ġre g
+u e
+d ing
+Ġle vel
+Ġc ell
+Ġe ffect
 Ġin ter
-Ġaf ter
-Ġthe re
-Ġd at
-Ġ qu
-Ġ un
-Ġe ffec
+os e
+Ġstud ies
 l ow
-f orm
-v ed
-Ġin t
-a y
-Ġl ow
-is t
-Ġ y
+ion s
+Ġre c
+Ġp res
+Ġ un
+Ġd at
+Ġp art
+ul d
+Ġcon s
+Ġm ore
+Ġth an
+Ġanalys is
+Ġinc re
+Ġsu b
+Ġtreat ment
+Ġth ree
+il l
+Ġm ed
+a ch
 Ġa m
-en s
-at er
-i ed
-on e
-ar d
-Ġme as
-Ġv ari
-Ġincl ud
-v en
 ul ar
-Ġass oci
-Ġ k
-Ġanalys is
-p le
-il d
-Ġv al
-i ti
 ol og
-Ġgroup s
-Ġw e
 an s
-as t
-Ġle vel
-ati s
-r ap
+Ġinc lud
+Ġthe re
+Ġass oci
+Ġre port
+Ġac c
 p ro
-Ġclin ical
+Ġp h
+or y
+at h
+Ġhe al
+o th
+ro l
+Ġcl in
+Ġ qu
+Ġus ing
+v ed
+Ġm od
+Ġr is
+Ġo ur
+a p
+Ġresult s
 s o
-Ġd et
-Ġpres ent
-le c
-os t
-Ġdat a
-are d
-i re
-Ġ en
+d u
+Ġus ed
+Ġo ut
+Ġn o
+Ġris k
+Ġf ol
+Ġl ow
 Ġh ad
-d ition
+Ġheal th
+i ed
+Ġdat a
+Ġt im
+Ġp os
+Ġex p
+en c
+Ġ y
 Ġal so
-Ġo ther
-il ity
-Ġf ol
-Ġf act
-Ġinc re
-Ġrepor ted
-t ing
-ro l
+e ar
+ress ion
 Ġg en
-y p
-Ġpar tic
-Ġthe ir
-u al
-Ġma y
-Ġp o
-Ġfol low
+re n
+al u
+Ġa ct
 om e
-Ġa ge
-Ġch ild
-Ġass ess
-Ġt im
-Ġper form
-p h
-Ġd ur
-tion s
-Ġo ut
-ug h
-e w
-Ġs uc
-Ġcar ies
-us ion
-as s
-Ġmod el
-g n
-Ġsur fac
-Ġs pec
-er m
-Ġf in
-atis tic
-Ġst atistic
-ol ar
-Ġ up
-on d
+are d
+Ġst at
+al l
+Ġan t
+Ġfol low
+Ġf act
+ra ct
+Ġs am
 id e
-os e
+Ġres p
+Ġb l
+Ġm ay
+f orm
+ic s
+Ġclin ical
+d ition
+Ġd ur
+Ġthe se
+er m
+u al
+on e
+il ity
+a k
+Ġa r
+Ġd et
+Ġh y
+t e
+Ġo ther
+Ġt est
+Ġv ari
+ug h
+c l
+Ġpart ic
+a us
+Ġthe ir
 Ġc or
-Ġmeas ure
-f t
-Ġme th
-ment s
-s tr
-al l
-Ġd es
-an ts
-Ġhigh er
-s er
-ac ter
-Ġdifferen t
-Ġe ach
+os is
+Ġ ro
+Ġc ol
+Ġme as
+Ġp r
 Ġbe en
-Ġthe se
-Ġh ow
+Ġdis e
+Ġcont rol
+Ġtim e
+u b
 Ġh as
-Ġs o
+as es
+pe c
+ul ation
+Ġgroup s
+Ġhigh er
+Ġp o
 Ġcomp ared
-i x
-Ġcont rol
-Ġa r
+Ġc r
+it al
+c r
 o ut
-am in
-u res
-Ġt est
-Ġim age
-Ġr is
+Ġ en
+Ġex t
+Ġf in
+Ġ up
+y m
+Ġh ow
+act er
+Ġwh o
+Ġreport ed
+Ġd es
+ag n
+Ġpati ent
 i le
+Ġdifferen t
+is s
+Ġ und
+Ġa g
+r ic
+Ġper form
 Ġin v
-Ġm ed
-Ġma x
-rap h
-Ġshow ed
-Ġperiodon tal
-val u
-en c
-Ġp h
-Ġmeth od
-Ġe valu
-Ġris k
+o od
+al ity
+p le
+at er
+ys t
+ant s
+Ġpres ent
+e w
+at es
+s er
+Ġsignificant ly
+t al
+in ed
+Ġs er
+i x
+e ver
 Ġo ver
-as es
-Ġn um
-k e
-Ġfo und
-m o
-p res
-Ġb i
-Ġc ell
-c t
-Ġm o
+Ġt e
+Ġcell s
+Ġdur ing
+le ct
+Ġass ess
+c c
 Ġpartic ip
-ti s
-Ġc ol
-b er
-e ver
-a us
-u es
-is s
-og raph
-l u
+Ġmet h
+ic e
+Ġund er
+Ġc are
+Ġassoci ated
+c es
+Ġm an
+Ġfo ur
+as s
+j ect
+Ġs up
+Ġ 1
+Ġshow ed
+Ġus e
+Ġa ge
+Ġ ra
+Ġfo und
+at ing
+on d
 Ġhow ever
-Ġd enti
-Ġsignificant ly
-Ġtim e
-Ġd ec
+Ġlevel s
+st r
+Ġact iv
+v ent
+Ġdi agn
+a il
+Ġb ut
+Ġim age
+b er
 ere d
-Ġb oth
-Ġchild ren
-Ġob ser
-Ġo ur
-Ġc r
-or y
-Ġs ec
-j ec
-Ġro ot
-Ġa g
-ad i
-Ġc al
-ec h
-Ġwh o
-Ġb one
-vi ous
-at ing
-Ġfo ur
-t em
+us ion
+er y
+c re
+Ġmeas ure
 iz ed
-Ġb ased
-i or
-Ġwh en
-it e
+an g
+os p
+Ġs pec
+vi ous
+i re
+c er
+Ġtr ans
+Ġn on
 f ore
-Ġacc or
-Ġperiodon ti
-Ġst r
-e x
-c c
-Ġdur ing
+ro s
+e p
+Ġb ased
+c ent
+Ġsur g
+osp ital
+Ġmod el
+Ġob ser
+in t
+Ġn um
+Ġw or
+Ġb i
+Ġs yst
+Ġdise ase
+Ġde p
+Ġper i
+Ġinf l
+Ġpre vious
+Ġh ospital
+Ġb oth
+Ġsu ch
+Ġmeth od
+Ġcom m
+u res
+t ain
+og ra
 Ġind ic
+Ġe ach
+at ory
+Ġ j
 o uld
-Ġ 1
-ul ation
-v id
-Ġch an
-Ġam ong
-Ġpro c
-Ġm ost
-Ġdis e
-l es
-Ġsuc h
-t ain
-Ġpre vious
-ic ro
-at es
-Ġim pl
-Ġs im
-Ġb r
-ys tem
-Ġlow er
-Ġs ystem
-Ġperiodonti tis
-Ġ und
+Ġs p
 Ġon ly
-Ġsurfac e
-e p
-gn os
-Ġnum ber
-Ġus e
-Ġme an
-es ti
-Ġd ia
-Ġco uld
-Ġex amin
-ib le
-odon tic
-Ġdifferen ces
-a g
-Ġf ir
-Ġm an
-ac k
+Ġm ost
 Ġ 2
-at h
-Ġmax ill
-Ġdifferen ce
-a il
-Ġcomp ar
-Ġn on
-r ic
-ab ility
-n ess
-it er
-Ġsur g
-p os
-ing iv
-Ġdis c
-Ġaccor ding
-Ġs up
-Ġgen er
-Ġfir st
-Ġap pl
-Ġcl ass
-a ges
+ect ion
+a ce
+Ġst r
+t ed
+Ġpro c
+it ive
+Ġout c
+Ġ end
+un ction
+Ġacc or
+Ġd ist
+Ġch ar
+Ġe m
+Ġf ir
+Ġfact ors
+Ġs im
+Ġd em
+Ġbe c
+Ġwh en
 Ġex per
-Ġor th
-Ġassoci ated
-p t
-Ġinclud ed
-Ġr adi
+l es
+k e
+id ent
+Ġv al
+Ġev alu
+aus e
+Ġfir st
+Ġco uld
+Ġam ong
 Ġde f
-Ġad dition
-Ġs p
-ul t
-Ġdia gnos
-Ġ j
-Ġb ut
-Ġ ed
-Ġperform ed
-Ġf ur
-Ġsam ple
-tr ib
-Ġc are
-is tic
-k ing
-Ġval ues
-Ġm icro
-v ity
-Ġcom m
-Ġde m
-l ed
-Ġm ater
-Ġcons id
-o un
-Ġm in
-c r
-Ġt yp
-Ġres p
-u tion
-Ġparticip ants
-t e
-ion s
-Ġint o
-Ġfact ors
-ain ing
-Ġd ue
-Ġh y
-Ġy ear
-Ġfur ther
-Ġqu es
-Ġg ingiv
-por t
-Ġsub jec
+d er
+Ġp ost
+ect ive
+v al
+Ġs o
+ent al
+et h
+Ġsyst em
+ard i
+Ġs m
 Ġf ive
-Ġex tr
-d s
+Ġchar acter
+r ation
+Ġincre ased
+olog ical
+Ġperi od
 n a
-Ġeffec t
-en e
-Ġap pro
-Ġm and
+Ġad dition
+id ence
+Ġt y
+l ic
+Ġt ra
+it er
+ur s
 Ġp op
-Ġpati ent
-Ġpre val
-Ġmater ial
-Ġcal c
-Ġpro b
-Ġch ar
-Ġb ec
-Ġt iss
+un t
+Ġperform ed
+uc ed
+i or
+Ġinclud ed
+Ġre m
+Ġpro v
+ogra ph
+Ġthe y
+if ied
 Ġth ose
-Ġ i
-iv id
-Ġm al
-qu e
-Ġtr ans
-Ġobser ved
-t en
-Ġfor m
+Ġm a
+Ġstat ist
+Ġf ur
+Ġap pro
+Ġw ell
+m ents
+Ġnum ber
+in al
+Ġlow er
+Ġfur ther
+Ġaccor ding
 vel op
-g th
-cl usion
-olog ical
-Ġm olar
-Ġout c
-Ġo p
-c ent
-Ġd i
-in ed
-u th
+Ġy ear
+ur ren
+m s
+Ġpre d
+Ġrel ated
 ic i
-Ġc ur
-Ġw ell
+f t
+Ġd r
+Ġparticip ants
+Ġad m
+Ġbl ood
 Ġde velop
-Ġfin ding
-ac e
-Ġg r
-Ġwh ile
-n ow
-on s
-a k
-Ġl es
-f ic
-aus e
-ac tion
-is h
-Ġde p
-i tive
+ical ly
+al ly
+ce pt
+ib le
+Ġbec ause
+r i
+Ġcons id
 Ġcor re
-Ġl i
-er y
-Ġre duc
-Ġthe y
-enc y
-Ġs al
-Ġund er
-Ġchar acter
-Ġl im
-d er
-o ugh
-tion al
-Ġim p
-Ġpreval ence
-m s
-t or
-Ġpos t
-Ġc ro
-Ġlim it
-Ġimpl ant
-Ġorth odontic
-al ity
-Ġcon f
-in t
-res s
-Ġlevel s
-Ġpr im
-Ġdet ec
-Ġ 3
-Ġk now
-c er
-Ġcell s
-Ġp ain
-il ar
-Ġs er
-Ġrel ated
-Ġst at
-Ġdise ase
-Ġsim ilar
-Ġm et
-Ġv is
+Ġg l
+Ġm ult
+ab ility
+Ġc al
+Ġpro g
+it ies
+Ġd ue
+o x
+g est
+Ġb as
+Ġex am
 Ġm on
-Ġb l
-Ġe m
-ul ti
-iz ation
-Ġf re
-Ġmaxill ary
-Ġstat us
-Ġcomp le
-Ġs in
-re ated
-Ġcan al
-Ġstatistic ally
-Ġo l
-Ġbec ause
-Ġin tr
-it s
-am m
-Ġne ed
-ab les
-Ġpop ulation
-Ġ 0
-ver s
-b r
-o od
-ac y
 Ġsc ore
-Ġfre qu
-Ġst and
-Ġ z
-ib ular
+at ic
+Ġr ate
+Ġcharacter ist
+is h
+o ugh
+Ġfin ding
 Ġto tal
-Ġs ix
-at ure
-Ġe t
-at ory
-ter ior
-it al
-Ġw or
-Ġwh ere
-Ġsal iv
-Ġ er
-Ġassoci ation
-Ġm ain
-Ġsec ond
-Ġcon dition
-Ġinv esti
-Ġinvesti g
-s s
-am et
-Ġf ig
-ati c
-Ġques tion
-Ġl ess
-Ġsh ould
-l l
-Ġso ft
-Ġincre ased
-ti m
-Ġpl an
-o res
-Ġmethod s
-Ġd r
-Ġ end
-i an
-Ġinf orm
-Ġtiss ue
-Ġit s
-Ġradi ograph
-i um
-Ġc a
-Ġcharacter istic
-ear ch
-Ġres earch
-Ġs ug
-y m
-pec tive
-Ġinf l
-Ġc e
-Ġfinding s
-Ġstand ard
-Ġr an
-ech n
-Ġeffec ts
-Ġvari ables
+y t
+Ġgen er
+Ġcon f
+o b
+Ġdis c
+iv id
+Ġthe ra
+Ġ ident
+al e
+Ġcomp ar
+Ġl i
+Ġint o
+ion al
+Ġim pro
+Ġme an
+il d
+Ġim p
+on s
+Ġsu g
+e x
+enc y
+it e
+in es
+Ġd id
+Ġre f
+op er
+ib ut
+Ġobser ved
+r ibut
+Ġf unction
+pt om
+Ġc ar
+ic t
+Ġwor k
+Ġpop ulation
+Ġc ardi
+h ib
+Ġk n
+c ular
+Ġs ym
+iz ation
+Ġcharacterist ics
+or d
+an c
+Ġdifferen ce
+Ġde cre
+Ġm in
+il ar
+Ġf ig
+us t
+Ġp ar
+Ġ est
+Ġne ed
+Ġ i
+ent ial
+Ġ ed
+Ġshow n
+in ation
+Ġsug gest
+Ġeffect s
+orm al
 Ġinclud ing
-Ġind ivid
-olog y
-un c
-Ġl oc
-os s
-Ġfollow ing
-ar g
-us h
+Ġdifferen ces
+am m
+vi ew
+Ġl im
+l ed
+r on
+Ġwh ile
+i um
+y n
+Ġsub ject
+a v
 Ġdet erm
-Ġt echn
-Ġsubjec ts
-ti t
-Ġchan ges
-Ġd id
-Ġa ffec
-Ġe l
-Ġob tain
-Ġm ulti
-res sion
-f er
-h ip
-Ġse lec
-Ġre m
-ul ated
-i e
-Ġthere fore
-Ġtyp e
-Ġwith out
-Ġinfl amm
-v ic
-Ġsam pl
+Ġf l
+Ġsim ilar
+du ct
+og en
+Ġs ix
+y l
+Ġat t
+Ġpos itive
+Ġexp ression
+Ġsym ptom
+oper ative
+Ġse c
+o k
+Ġc ases
+Ġcorre l
+Ġcal c
 Ġs ome
-Ġim pro
-Ġshow n
-g r
-Ġf r
-Ġab out
-Ġcr iter
-Ġc ent
-v ing
-Ġindivid ual
-Ġsam e
-Ġare a
+em ent
+Ġre d
+Ġv alu
+ar g
+Ġm ain
+o id
+Ġactiv ity
+ear ch
+Ġph ys
+Ġres earch
+Ġp e
+ab et
+Ġinf orm
+n ess
+Ġhy per
+Ġcon cent
+Ġsurg ery
+Ġp ath
 Ġim port
+Ġwith out
+Ġ if
+du ction
+Ġim m
+ac k
+Ġpr im
+it is
 Ġse ver
-or d
-Ġperi od
-pres sion
-or t
-ent ly
-vi ew
-Ġproc ed
-o ur
-Ġs et
-Ġpos s
-Ġl ong
-Ġpr ac
-Ġmand ibular
-Ġpos itive
-Ġpre d
-Ġcharacteristic s
-Ġinc is
-p tion
-Ġre mo
-Ġprim ary
-Ġan y
+Ġ 0
+o res
+Ġtre ated
+it ed
+Ġcomp le
+Ġe t
+Ġthera p
+c op
+om en
+Ġfor m
+Ġst and
+ce iv
+Ġsec ond
+Ġdi abet
+ul ated
+Ġp ain
 ar k
-Ġed uc
-Ġad j
-Ġind ex
-Ġassess ment
-Ġdes cr
-am ic
-Ġcorre l
-Ġt erm
-Ġc le
-Ġcriter ia
-Ġcompar is
-n ing
-Ġco un
-Ġinf lu
-Ġb as
-Ġg reat
-Ġc ases
-o b
-p ar
-Ġac ti
-Ġ id
-Ġex pl
-Ġgener al
-Ġles ions
-Ġacc ur
-Ġstatistic al
-in es
-Ġm uc
-Ġexper i
-im en
-Ġf lu
-h a
-Ġmed ical
-Ġdis trib
-Ġs m
-Ġim ages
+Ġm ic
+Ġc ent
 ate g
+ect ed
+at ure
+a ys
+Ġl ong
+u ct
+Ġvalu es
+Ġpred ict
+el ine
+Ġit s
+ab les
+om es
+i an
+Ġqu est
+Ġinfl amm
+Ġh ist
+Ġext ract
+Ġor al
+Ġcan cer
+Ġt erm
+Ġdes cr
+te in
+Ġp ot
 Ġo cc
-tic al
-uc t
-Ġgingiv al
-Ġin s
-ar t
-Ġres tor
-Ġdes ign
-led ge
-Ġcon duc
-Ġap p
-iv ed
-Ġconsid ered
-Ġsurg ical
-Ġpar amet
-Ġbe fore
-Ġim m
-ren t
+ent ly
 ation al
-Ġknow ledge
+Ġe l
+Ġsam ple
+an ge
+Ġfinding s
+olog y
+ivid ual
+Ġg ra
+Ġin s
+Ġl iv
+Ġpro b
+d s
+Ġind ividual
+Ġant i
+o und
 Ġincre ase
-Ġe ar
-g i
-Ġ ir
-Ġsc h
-Ġd o
-Ġsc al
-Ġi i
-Ġin str
-w are
-Ġl ine
-Ġthe n
-th ough
-e tic
-Ġt es
-Ġid enti
-Ġproc ess
-Ġo c
-Ġal though
-ad e
+Ġkn ow
+Ġstand ard
+Ġfollow ing
 on str
-Ġc b
-an c
-Ġb acter
-ter n
-Ġs mo
-Ġl oss
-Ġinf ec
-Ġpl a
-Ġquestion na
-Ġc y
-Ġre ce
-enti al
-Ġne g
-Ġdisc us
+Ġd o
+re d
+Ġt iss
+Ġn urs
+Ġin hib
+ol ic
+Ġcl ass
+o ther
+p s
+im al
+ut e
+Ġm ort
+Ġch ang
+ro ugh
+Ġsh ould
+Ġ 3
+ter n
+urren t
+Ġcr iter
+Ġmort ality
+Ġo l
+r al
+iv al
+Ġt um
+a f
+am et
+tain ed
+re qu
+Ġty pe
+Ġbe fore
+Ġwh ere
+Ġch ild
+lect ed
+Ġwith in
+Ġpos s
+Ġw omen
 Ġli ke
-Ġt reated
-om es
-Ġsc ores
+an e
+os ed
+it s
+Ġmed ical
+Ġvari ables
+Ġan y
+o v
+Ġinv est
+us s
+o ur
+Ġv is
+Ġth rough
+Ġa v
+Ġdiagn osis
+Ġbas eline
+Ġassoci ation
+on t
+cl usion
+Ġmed ic
+r y
+u id
+Ġ es
+Ġf requ
+Ġp s
+Ġtherap y
+Ġinvest ig
+i e
+Ġoutc omes
+Ġhy p
+th ough
+Ġre p
+Ġab out
+et y
+as cular
+Ġproc ed
+Ġf e
+Ġspec ific
+i ly
+t ing
+Ġal though
+Ġinter vent
+Ġexper i
+Ġthere fore
+Ġcriter ia
+d i
+Ġex pl
+Ġsymptom s
+Ġreg ard
+Ġ ic
+is m
+v en
+Ġpro t
+Ġd ay
 Ġqu ality
-w n
-Ġrel ations
+Ġpre val
+Ġn ormal
+Ġint ra
+Ġpot ential
+Ġprov id
+Ġdem onstr
+Ġpro tein
+ag es
+Ġl oc
+Ġdisc uss
+Ġcon dition
+Ġp ress
+Ġimport ant
+Ġd ental
+Ġpo int
+Ġe ar
+Ġe p
+Ġl ess
+Ġre qu
+Ġsam pl
+Ġmethod s
+o ver
+Ġser um
+Ġre ceiv
+Ġre t
+ific ation
+t ion
+Ġprim ary
+Ġsubject s
+Ġchang es
+er g
+Ġdr ug
+end ent
+Ġle ad
+oc k
 Ġinform ation
-ar ding
-el f
-iti es
-Ġobtain ed
-Ġs it
-ain ed
-Ġmeasure ments
-Ġpro t
-Ġrelations hip
-Ġdec re
-ech an
+Ġad j
+Ġper s
+h ip
+Ġc urrent
+Ġp ub
+od y
+Ġdescr ib
+Ġsup port
+ve re
+iv en
+Ġp ract
+Ġs et
+un g
+Ġcons ist
+Ġsc ores
+t s
+Ġsur v
+f ul
+Ġconsid ered
+Ġap pl
+Ġtr ial
+Ġthe n
+Ġcomm on
+v ing
+Ġne g
+Ġg re
+ens ion
+Ġo p
+en e
 Ġre view
-ur al
-Ġwith in
-Ġbe ha
-Ġun i
-Ġsampl es
-Ġreg arding
-Ġpro vid
-Ġm ight
-Ġbeha vi
-Ġre qu
-Ġr and
-Ġcb ct
-i ly
-Ġrand om
-ff ici
-st e
-ve ment
-ic ation
-Ġr ate
-are n
-Ġw ould
-Ġmo uth
-Ġg l
-if ied
+Ġpress ure
+Ġa ffect
+Ġim pl
+Ġimpro ve
+Ġcon duct
+Ġstat us
 Ġmeasure d
-in al
-Ġp ot
-Ġpred ic
-Ġf ill
-Ġtechn i
-h es
-re d
-Ġp ath
-r ation
-Ġcur rent
-Ġcomm on
-Ġth ro
-Ġo per
-Ġspec ific
-Ġ if
-Ġexamin ation
-Ġmaterial s
-y n
-Ġp ub
-Ġan ti
-Ġc er
-Ġfor ce
-ire d
-Ġassess ed
-Ġdis t
-Ġup per
-Ġuni vers
-Ġpres ence
-cl ud
-Ġo s
-Ġthro ugh
-Ġd ire
-ess ion
+Ġgener al
+ac y
+ch an
+l ish
+Ġc ase
+Ġdiabet es
+le v
+Ġcom b
+Ġpreval ence
+Ġm o
+Ġm y
+c is
+ch n
+ar ge
+Ġin it
+ak e
+Ġimm un
 ate ly
-Ġconduc ted
-Ġstud ents
-Ġfact or
-Ġre pres
-Ġmodel s
-Ġneg ative
-Ġocc ur
-Ġp e
-ific ation
-ren gth
-Ġimport ant
-Ġpos ition
-Ġstr uct
-us t
-Ġa v
-Ġst rength
-am el
-Ġcol lec
-Ġpla que
-v ere
-Ġg end
-Ġsurg ery
-o f
-Ġm echan
-oth er
-i th
-er ative
-Ġf ac
-Ġposs ible
-Ġgreat er
-Ġp al
-Ġreg ression
-al ed
-Ġth us
-o ol
-Ġs elf
-a w
-y l
-Ġth ir
-Ġevalu ated
-Ġyear s
-Ġf em
-om et
-Ġidenti f
-Ġh ist
-i o
-Ġre ve
+Ġl if
+Ġval ue
+Ġind ex
+e k
+Ġ z
+ire d
 0 0
-ti l
-Ġp aren
-Ġen amel
+Ġco unt
+Ġw ill
+Ġliv er
+Ġoutc ome
+qu e
+Ġb one
+Ġcompar is
+n al
+g th
+Ġsam e
+Ġquest ion
+Ġl ine
+Ġs in
+Ġadm in
+Ġm ight
+ial ly
+Ġs ens
+Ġco h
+Ġar ter
+Ġcomp lic
+ain ing
+Ġf ail
+Ġinv ol
+on ary
+Ġtiss ue
+Ġse vere
+Ġte chn
 Ġe th
-om en
-ven tion
-Ġoutc omes
-Ġt m
-Ġl o
-Ġcan cer
-Ġevalu ation
-Ġg u
-Ġval ue
-Ġcomparis on
-Ġst age
-Ġresul t
-Ġ es
-Ġf l
-ic k
-Ġdiscus sion
-Ġf unc
-Ġar ch
-o ver
-Ġper cent
-Ġmon th
-imen sion
-Ġcondition s
-Ġdistrib ution
-Ġn ec
-Ġpub l
-f ul
-oc k
-ti es
-Ġst ress
-Ġfem al
-Ġparamet ers
-Ġdem onstr
-Ġo ste
-Ġat t
-Ġsin ce
-Ġin iti
-Ġd imension
-Ġdevelop ment
-oun t
-it ed
-Ġover all
-Ġf ail
+Ġfact or
+Ġo per
+Ġy o
+Ġproc ess
+eth er
+Ġo x
+Ġma j
+Ġant ib
+Ġme chan
+Ġv ol
+el f
+Ġman ag
+Ġmaj or
+Ġstatist ical
+Ġneg ative
+u th
+iss ion
+Ġadmin ist
 Ġc aus
+Ġw ould
+Ġob tained
 Ġpro f
-o x
-Ġbr ush
-Ġintr a
-Ġextr action
-s ts
-Ġp ul
+Ġpar amet
+om y
+Ġwe ight
+Ġpres ence
+Ġun iv
+Ġreg ression
+Ġe ff
+Ġdiscuss ion
+n ing
+Ġm al
+Ġh em
+Ġcoh ort
+ron ic
+Ġind ep
+ur al
+Ġassess ment
+en ing
+ra in
+ective ly
+Ġd el
+Ġmic ro
+e c
+om a
+Ġs yn
+Ġchild ren
+p ar
+ver se
+if y
+Ġest im
+Ġind uced
+Ġex c
+th es
+Ġsm all
+Ġf em
+Ġsampl es
+et ic
+Ġr ati
+Ġconduct ed
+Ġf ib
+y z
+and om
+m a
+Ġrel ations
+Ġdef ined
+Ġf ra
+Ġr andom
+Ġresp on
+op h
+Ġl es
+Ġne w
+Ġd ose
+iv ity
+Ġthe m
+ograph ic
+Ġv ent
+Ġ er
+Ġc yt
+Ġab s
+Ġinc idence
+Ġac id
+Ġc d
+t en
+Ġrelations hip
+Ġdescrib ed
+Ġrespon se
+Ġed uc
+h a
+Ġg uid
+Ġst ress
+Ġbe ing
+Ġover all
+m ed
+g en
+ain ed
+Ġ 5
+Ġinfl u
+Ġanal yz
+Ġth us
+Ġdes ign
+ic es
+Ġyear s
+y ch
+Ġc ult
+Ġrep res
+Ġanalys es
+Ġ ir
+Ġr ates
+Ġhe art
+et er
+Ġsurv ival
+ut ion
+n e
+Ġma x
+Ġmon th
+Ġdevelop ment
+Ġimp act
+or b
+Ġident ified
+Ġg ast
+Ġposs ible
+Ġconf ir
+Ġc a
+Ġp a
+in k
+in ing
+os cop
+Ġsever al
+Ġwe ek
+Ġdemonstr ated
+c le
+Ġra di
+Ġsurg ical
+eren ce
+Ġinflamm atory
+Ġassess ed
+Ġhyper t
+Ġdi re
+ve al
+Ġi i
+g an
+Ġre veal
+Ġpre vent
+ost ic
+Ġc ir
+Ġcorrel ation
+Ġb ody
 Ġv i
-ater al
-Ġquestionna ire
-Ġd a
-Ġe vid
-Ġres pective
-Ġdef ec
-Ġeduc ation
-Ġs l
-er al
-Ġcomp os
-Ġoutc ome
-Ġappl ied
+Ġear ly
+Ġdist ribut
+Ġin st
+om m
+in u
+ros s
 Ġan g
-Ġse vere
-Ġdiagnos is
-Ġsch ool
-Ġma j
-Ġpresent ed
-im al
-Ġh yp
-Ġle ad
-Ġmolar s
-Ġdescr ib
-Ġpo int
-Ġgend er
-en gth
-Ġperform ance
-Ġmaj or
-c ess
+Ġr at
+Ġlim it
+Ġm em
+o unt
+Ġresp ectively
+act ion
 Ġc ateg
-id ence
-ic s
-Ġcom b
-Ġc ase
-Ġf e
-ment ation
-cl us
-Ġsurfac es
-Ġaccur acy
-Ġv er
-Ġgro w
-Ġex pos
-h ib
-ent al
-Ġper ce
-Ġs ens
-Ġw omen
-Ġm at
-ver age
-Ġdenti sts
-an e
-Ġconsid er
-Ġhy gi
-as tic
-Ġv it
-el ine
+Ġpresent ed
+os s
+Ġm ark
+h ol
+Ġred uced
+Ġpost operative
+Ġse ven
+ol ar
+Ġ il
+Ġpo ly
+Ġch ronic
+Ġrec ord
+Ġro le
+o f
+Ġc ur
+Ġtum or
+Ġco v
+Ġl ab
+Ġev idence
+Ġval id
+Ġs elf
+Ġsc ale
+Ġdecre ased
+Ġh um
+Ġcomparis on
+Ġs ol
+Ġper cent
+ch em
+Ġc le
+ot ic
+Ġle ft
+Ġs k
+Ġne c
+Ġsin ce
+le ction
 Ġcalc ulated
-Ġsm all
-og en
-r i
-t a
-is e
-Ġanal y
-in ts
-on ding
-iti s
-Ġreve aled
-Ġ 5
-et y
-Ġv ol
-Ġph ys
-o id
-u ted
-Ġe p
+Ġc ost
+Ġconsid er
+Ġlif e
+Ġparamet ers
+ip le
 Ġdise ases
-u ally
-Ġs ol
-Ġcon clusion
-a v
-on ic
-Ġan terior
-Ġad hes
-ix ed
-Ġcorrel ation
-Ġthir d
-Ġp s
-n e
-Ġcons ist
-v ant
-Ġh ard
-Ġad ul
-Ġs oci
-Ġpro duc
-Ġinv ol
-Ġre d
-Ġex pression
-Ġrepres ent
-end ent
-Ġcon tr
-Ġit em
-Ġexper im
-Ġpot ential
-Ġw ater
-Ġcon cent
-Ġear ly
-is ed
-oc ol
-Ġme m
-Ġsur ve
-Ġab s
-Ġfrequ ency
-k ed
-Ġn orm
-op erative
+ic ation
+ens ive
+Ġf am
+Ġd ys
+Ġac ute
+ad e
+Ġps ych
+Ġc t
+Ġintervent ion
+Ġstatist ically
+Ġte eth
+Ġse x
+Ġav ail
+ro ph
+Ġinf ection
+Ġrel ative
+Ġconcent ration
+em s
+Ġpro m
+Ġev en
+Ġle ast
+v es
+at or
+Ġin j
+Ġrec omm
+Ġare a
 se qu
-c on
-Ġpar t
-Ġchan ge
-ish ed
-Ġinflu ence
-Ġunivers ity
-clud ed
-o und
-Ġthe rap
-Ġbas eline
-Ġprot ocol
-is ion
-Ġne w
-Ġinstr u
-Ġhygi ene
-in s
-Ġl iter
-Ġsaliv ary
-m an
-es is
-r al
-om ic
-feren ce
-Ġh and
-il m
-Ġprob le
+Ġrecomm end
+Ġf ac
+Ġvol um
+pt ion
+Ġl arge
+Ġb m
+Ġfail ure
+t y
+u ction
+Ġcardi ac
+Ġres t
+Ġe ight
+Ġexper im
+Ġquestion na
+lish ed
+o ve
+Ġcon clusion
+Ġgl uc
+ist s
+Ġm l
+Ġlike ly
+g ro
+Ġad v
+Ġpr ior
+Ġre duction
+Ġde ath
+Ġprevious ly
+Ġto oth
+Ġch ange
+Ġinhib it
+p ective
+Ġc ap
+Ġhist ory
+b r
+Ġappro ach
+Ġcomplic ations
+Ġcondition s
+Ġsc re
+Ġevalu ated
+r h
+Ġh el
+Ġpro port
+Ġad d
+u es
+Ġmanag ement
+Ġphys ical
+Ġnurs es
+arg et
+f er
+Ġrati o
 Ġindividual s
-Ġflu or
-k s
-v es
-in ation
-ain s
-Ġsever al
+Ġt ak
+ib ility
+Ġregard ing
+Ġad ult
+Ġser v
+Ġeffect ive
+Ġreceiv ed
+Ġt arget
+d e
+t ic
+o int
+Ġsur f
+Ġe c
+Ġs it
+p es
+ress ed
+u ro
+ed ing
+Ġag ain
+og n
+Ġm ater
+Ġres ist
+om et
+Ġinj ur
+it ivity
 Ġs ing
-Ġm or
-et s
-ce pt
-s c
-Ġval id
-Ġcom pl
-Ġbet ter
-Ġhealth y
-ograph ic
-Ġpul p
-Ġre as
-Ġanaly z
-u ce
-is m
-Ġl ength
-Ġbi as
-Ġexperi ence
-Ġevid ence
-clus al
-Ġsing le
-en ing
-Ġselec ted
-Ġc ap
-Ġth ick
-at al
-Ġr ati
-Ġle ast
-Ġrec ord
-Ġimp act
-c al
-g ro
-Ġpro v
-Ġmod er
-Ġoc clusal
-Ġap ical
-Ġreduc tion
-Ġal ign
-w ard
-at or
-Ġbe ing
-Ġy oun
-Ġyoun g
-Ġcro ss
+ens ity
+Ġsur ve
+Ġconcent r
+w ay
+Ġreveal ed
+Ġhe p
+ari ate
+led ge
+ent ion
+c s
+l i
 Ġdur ation
-ed ing
-Ġac id
-ial ly
-Ġd ay
-Ġre f
-Ġh os
-esti m
-Ġgrow th
+Ġb el
+Ġman y
+Ġwh ether
 c o
-Ġce ph
-ffici ent
-Ġrespective ly
-Ġadul ts
-Ġreg ion
-Ġ estim
-im um
-Ġproced ures
-Ġlo ad
-Ġre le
-Ġh um
-Ġd m
-Ġinflamm atory
+as ing
+Ġrepres ent
+Ġre as
+Ġcont inu
+Ġ 4
+lud ed
+Ġm ice
+Ġfollow ed
+Ġor gan
+Ġdire ct
+Ġf low
+Ġm us
+Ġmult iple
+Ġbe ha
+Ġs us
+ff ici
+ra m
+Ġindep endent
+Ġs af
+Ġbet ter
+Ġev ents
+Ġd ent
+Ġl oss
+ar m
+ple ment
+Ġknow ledge
+Ġbeha vi
+Ġf at
+Ġ q
+Ġb acter
+Ġdeterm ined
+ter ior
+Ġm at
+Ġsing le
+Ġe qu
+Ġgre ater
+Ġgro w
+Ġuniv ers
+ver age
+Ġmet ab
+Ġan other
+Ġl ip
+Ġ ent
+is ed
+Ġg iven
+Ġp at
+Ġ ur
+Ġb ene
+ul in
+Ġis ol
+Ġevalu ation
+Ġp ul
+Ġl iter
+Ġbene f
+ograph y
+Ġcomm un
+Ġa ut
+w are
+Ġe lect
+Ġindic ated
+Ġ2 0
+Ġs l
+Ġsm ok
+Ġavail able
+Ġpro l
+ith er
+em ia
 m ore
-Ġdi ab
-omet ric
-Ġs oc
-Ġm id
-Ġdif fic
-h ol
-Ġeffec tive
-ir m
-ew ing
-p ital
-Ġse x
-ve olar
-Ġper s
-Ġsc an
-Ġshow s
-Ġpo or
-Ġhos pital
-Ġtr ial
-Ġbi of
-Ġwi d
-end ed
-Ġpo ly
-Ġser vic
-Ġs u
-Ġs ym
-Ġe ven
-Ġac h
-Ġind ep
-Ġfurther more
-Ġsaliv a
+du ce
+op le
+Ġpro p
+Ġproced ure
+Ġvolum e
+Ġb r
+Ġtechn i
+Ġth ir
+Ġst age
+Ġa ch
+g n
+Ġic u
+Ġrat s
+Ġol der
+Ġstr uct
+ic k
+Ġvari ous
+Ġimpl ant
 Ġcateg or
-Ġp a
-ut e
-Ġdiagnos tic
-Ġex t
-Ġm ade
-ar ge
-Ġg ood
-Ġach ie
-Ġrel ative
-Ġsug ges
-Ġpercent age
-ut ure
-o u
-p e
-Ġl ab
-Ġsoft ware
-Ġacti vity
-Ġsit es
-Ġo h
-Ġl if
-Ġprac ti
-Ġanalys es
-Ġevalu ate
-Ġliter ature
-on al
-Ġb uc
-Ġe ight
-im ens
-Ġcro wn
-Ġdemonstr ated
-ed i
-Ġp ap
-Ġrel i
-Ġmicro b
-Ġan other
-Ġfollow ed
-Ġm iss
-ac ted
-Ġres in
-pt om
-Ġdescrib ed
-v ent
-Ġt um
-Ġde vi
-Ġs ide
-om m
-Ġindic ated
-ace ment
-Ġconf irm
-Ġse qu
-Ġwh e
-Ġmeas ures
-Ġvari ous
-Ġrecord ed
-x i
-Ġt ip
-Ġsc re
-Ġ u
-Ġr ates
-Ġpo ints
-Ġspec imens
-Ġresp ond
-Ġer r
-Ġwi ll
-Ġhigh est
-Ġa ut
-Ġh el
-Ġsin us
-Ġsurve y
-v ation
-p s
-Ġsmo king
-Ġor der
-Ġbr ack
-Ġinflamm ation
-Ġlike ly
-Ġpro per
-Ġman y
-Ġgu id
-Ġre t
-Ġh ab
-Ġl ight
-Ġsup er
-Ġceph al
-ure d
-Ġreduc ed
-Ġmuc os
-Ġre ference
-Ġfr act
-Ġwhe ther
-et es
-Ġf am
-Ġha ving
-Ġl as
-Ġdent in
-Ġprevious ly
-Ġav ail
-er g
-ic e
-Ġterm s
-Ġal veolar
-Ġcoun tr
-an ti
-Ġam ount
-ak en
-Ġca vity
-Ġtechni que
-Ġcomple te
-v ir
-Ġl ay
-Ġtr aining
-Ġdetec tion
-Ġd ig
-th etic
-Ġpos terior
-Ġimm un
-Ġdiab etes
-Ġb el
-fac ial
-Ġmoder ate
 Ġt em
-en ces
-Ġper man
-ical ly
-Ġro le
-Ġrec omm
-Ġm en
-Ġe ff
-Ġappro ach
-Ġ ul
-ic ations
-Ġmore over
-gr am
-it t
-Ġres ist
-Ġch ewing
-m a
-Ġse g
-Ġdenti st
-Ġj aw
-Ġmet a
-Ġsym ptom
-Ġcar r
-Ġatt ach
-Ġbuc cal
-Ġmiss ing
-on se
-Ġy ou
-Ġvol um
-Ġcomp on
-Ġresp onse
-Ġdiffic ult
-Ġperman ent
+oc ol
+c in
+Ġr ight
+Ġs al
 Ġv ers
-Ġdep th
-Ġsoc ial
-Ġs w
-Ġs yn
-Ġp d
-Ġp ow
-Ġse al
-Ġse ven
-Ġinter vention
-Ġlimit ed
-b s
-Ġthe m
-Ġc ult
-Ġb ond
-ore d
-a f
-Ġir r
-i ther
-Ġa verage
-Ġp at
-ac ed
-Ġex p
-os is
-Ġradiograph s
-Ġaffec ted
-Ġhum an
-Ġde g
-og n
-Ġsuc cess
-enc ed
-Ġ2 0
-Ġs ti
-ol es
-Ġcon ven
-ver se
-Ġdis pl
-Ġmo vement
-Ġan xi
-Ġl arge
-Ġde vic
-Ġo d
-Ġdenti tion
-Ġmulti ple
-Ġfail ure
-Ġthick ness
-t o
-Ġf low
-Ġproced ure
-Ġrece ived
-Ġtherap y
-Ġdef ined
-Ġend odontic
-Ġtes ted
+Ġan es
+l d
+a ir
+Ġgen e
 Ġl ack
-op le
-Ġaddition al
-Ġiniti al
-Ġbrush ing
-i er
-Ġos cc
+in s
+Ġmodel s
+Ġc y
+er t
+Ġpl ace
+enc es
+Ġfurther more
+Ġpe ople
+Ġof f
+Ġconcentr ations
+Ġprog n
+Ġmed ian
+Ġs ch
+Ġo pt
 Ġs um
-Ġg iv
-Ġpro por
-Ġinter val
-Ġmeasure ment
-in d
+Ġl o
+Ġprot ocol
+Ġpract ice
 Ġl og
-ment ed
-iti vity
-Ġdist ance
-is ted
-Ġn et
-Ġad d
-Ġall ow
-Ġadj us
-Ġprof ession
-Ġa ir
-Ġv ery
-Ġtim es
-Ġlimit ations
-Ġscal e
-Ġpe ople
-Ġsoci o
-w ay
-Ġpro g
-Ġpro m
-a ys
-Ġe qu
-Ġdetec ted
+oc ial
+ater al
+ol es
+ist ic
+Ġh and
+end er
+Ġan imal
+or ing
+Ġmod er
+Ġf oc
+Ġanalyz ed
+or ph
+Ġocc ur
+Ġext ra
+Ġsh ort
+enc ed
+Ġhypert ension
+Ġgluc ose
+Ġin str
+b s
+os ure
+Ġacc ur
+Ġsup er
+w ard
+ro p
+anc y
+Ġp an
+Ġcor onary
+urren ce
 Ġsever ity
-Ġmechan ical
-Ġanxi ety
-Ġw ear
-Ġre fer
-om y
-Ġappl ication
-Ġa uth
-Ġm es
-as ing
-Ġlas er
-Ġ 4
-Ġform ation
-Ġprac tic
-Ġmonth s
-Ġinter n
+im ens
+Ġcol lected
+Ġch em
+Ġnurs ing
+i at
+Ġpre gn
+Ġhum an
+Ġqu ant
+Ġpo or
+Ġdistribut ion
 ag ing
-Ġtes ts
-g an
+on al
+Ġrec ent
+Ġ ve
+Ġmet a
+Ġcont r
+Ġeduc ation
+Ġsens itivity
+Ġm en
+Ġde g
 Ġ 6
-Ġs ite
-Ġf oc
-Ġm arg
-Ġplan e
-Ġ est
-Ġa x
-at ors
-Ġr ight
-Ġpre m
-Ġad m
-Ġcont in
-Ġsystem atic
-Ġran ge
-Ġdefec ts
-Ġitem s
-Ġnorm al
-Ġprofession al
-Ġt a
-Ġt aken
-Ġreg ard
-Ġavail able
-c le
-Ġf ib
-Ġdifferen ti
-Ġint ere
-Ġles ion
-Ġmem br
-Ġpracti ce
-Ġconven tional
-tr ation
+Ġ ill
+Ġm m
+Ġdecre ase
+is e
+Ġd a
+Ġdiff ic
+Ġh er
+ot y
+Ġexperi ence
+Ġaddition al
+Ġf ree
+Ġv ery
+Ġach ie
+Ġquestionna ire
+ere st
+Ġresp ons
+ov ascular
+d l
+Ġpub lic
+Ġmeasure ments
+Ġpos ition
+Ġliter ature
+Ġdiffic ult
+Ġcult ure
+Ġass ay
+Ġ ut
+orb id
+Ġsu cc
+Ġagain st
+Ġv it
+Ġso ft
+Ġo st
+Ġm ass
+im um
+ow n
+Ġfam ily
+op t
+es is
+Ġg ender
+Ġbl ock
+Ġstr ateg
+or al
+Ġsurf ace
+Ġob es
+Ġb re
+Ġap p
+Ġcont ribut
+Ġcol on
+Ġcomple te
+Ġk e
+Ġsucc ess
+Ġad h
+Ġg ood
+Ġf ract
+Ġl ym
+Ġunivers ity
+en gth
+Ġst im
+ur se
+Ġmore over
+gro up
+Ġcomp on
+Ġc er
+Ġad verse
+Ġset ting
+Ġles ions
+Ġinc ub
+Ġpl as
+ect ions
+Ġadm ission
+Ġor der
+Ġa verage
+Ġadminist ration
+Ġfrequ ency
+Ġinc l
+Ġs oci
+Ġdiagn ostic
+Ġlym ph
+ce l
+Ġse lected
+Ġprov ide
+oc yt
+anc ed
+Ġro ot
+Ġinjur y
+Ġe lev
+Ġmult iv
+Ġcov id
+Ġexam ination
+Ġost e
 Ġloc al
-er ation
-pec t
-Ġrec ent
-str y
+Ġprob le
+Ġcardi ovascular
+Ġm r
+Ġr ange
+Ġincre asing
+in d
+x i
+ain s
+c a
+it ud
+Ġe ither
+Ġm id
+Ġhealth y
+Ġsecond ary
+Ġident ify
+Ġlim ited
+Ġs ocial
+Ġdep ression
+os es
+Ġtest s
+Ġfoc us
+Ġbi as
+Ġproport ion
+Ġeff ic
+Ġpartic ular
+ual ly
+Ġdevelop ed
+Ġdi et
+Ġs at
+Ġsuggest ed
+Ġlab or
+Ġobser v
+Ġtra ining
+c i
+Ġn ine
+Ġinflamm ation
+om ic
+Ġsub group
+Ġall ow
+Ġinit ial
+Ġtim es
+Ġab ove
 Ġstr ong
-Ġincis or
-Ġincis ors
-Ġdire ct
+Ġc re
+are n
 Ġes pec
-Ġprov ide
-or ption
-ro duc
-Ġdem ographic
-Ġresp ons
 Ġespec ially
-Ġol d
-Ġwhere as
-Ġfluor ide
-Ġfoc us
-Ġacc ess
-Ġab o
-Ġmal es
-par ation
-Ġang le
-Ġle ft
-Ġvari able
-Ġinvestig ated
-Ġbacter ia
-Ġidentif ied
-Ġexpos ure
-Ġf ree
-Ġm m
-Ġl ateral
-Ġdis tal
-Ġdenti stry
-Ġdeterm ined
-Ġfemal es
-i h
-Ġg o
-Ġradiograph ic
-Ġimpro ve
-Ġpoly m
-s ed
-Ġare as
-Ġco h
-Ġincl usion
-Ġimpl ants
-Ġset ting
-em ic
-Ġcomple x
-Ġlif e
-i el
-Ġf ew
-Ġor ig
-oc clusion
+Ġd ays
+Ġcontrol s
+el ines
+Ġconsist ent
+Ġen h
+Ġmater ial
+on tal
+Ġpat tern
+Ġprof ess
+Ġa uth
+ar ch
+Ġem erg
+Ġexc luded
+Ġest ab
+Ġthir d
+Ġ 7
+Ġsurve y
+ard ial
+Ġgrow th
+Ġknow n
 Ġprovid ed
-Ġcollec ted
-Ġpal atal
-an g
-Ġex am
-ens ity
-Ġag ain
-Ġanti b
-res p
-Ġclass ification
-Ġinfec tion
-ens ive
-Ġmal occlusion
-Ġf ear
-Ġg el
-od y
-ay ed
-Ġcor resp
-Ġmax imum
-Ġrati o
-c tion
-Ġpro gram
-Ġpr ior
-Ġques tions
+Ġb le
+ut ure
+Ġbm i
+Ġguid elines
+Ġins ulin
+os ph
+ore d
+Ġof ten
+Ġdeterm ine
+Ġpercent age
+Ġcir c
+Ġmy oc
+Ġs w
+Ġcontr ast
+Ġevalu ate
+ur n
 Ġrequ ired
-Ġindep endent
-Ġvolum e
-Ġf ixed
-og ene
-Ġag ree
-Ġadhes ive
-Ġexperim ental
-u ous
-Ġcon trib
-ib ility
-Ġcl os
-Ġco vid
-Ġtreatment s
-Ġtm d
-Ġver tical
-Ġproble ms
-v ari
-Ġc t
-Ġf uture
-Ġpro te
-Ġeff ic
-Ġresist ance
-Ġpat tern
-Ġt e
-Ġpre c
-Ġbl ood
-Ġcle ar
-Ġhist ory
-Ġconsist ent
-Ġanalyz ed
-Ġcarr ied
-Ġbacter ial
-er o
-Ġl arg
-Ġrestor ations
-q ol
-fic ial
-tit ud
-Ġremo val
-Ġparen ts
-Ġa im
-Ġtyp es
-Ġbehavi or
-Ġint roduc
-Ġmand ible
-Ġline ar
-Ġred uce
-Ġbiof ilm
+Ġun t
+a x
+Ġl ength
+r ies
+Ġeffic acy
 ab ly
-Ġro t
-Ġdeterm ine
-Ġselec tion
-Ġpro s
-Ġfin al
-Ġsymptom s
-an ces
-Ġe le
-Ġex cluded
-Ġat titud
-g est
-p ing
-Ġd om
-Ġb o
-ro und
-iv al
-Ġag ed
-Ġsti ll
-Ġeffic acy
-Ġp an
-vir on
-f act
-Ġh al
-Ġad oles
-Ġappro x
-Ġii i
-Ġhab its
-Ġgiv en
+Ġint erest
+Ġst ill
+Ġo s
+Ġha ving
+Ġshow s
+ic ity
+Ġre duce
+op ath
+Ġmeas ures
+Ġ ult
+g o
+um ent
+Ġmeasure ment
+Ġtrial s
+y ro
+Ġproced ures
+Ġmon it
+Ġdiagn osed
+id es
+Ġinter val
+Ġd m
+Ġcle ar
+Ġpro s
+b ers
+Ġw ater
+Ġwhere as
+Ġarter y
+Ġap opt
+at ors
+Ġgen es
+i el
+ix ed
+us ted
+Ġexp osure
+Ġstud ents
+Ġp ur
+at in
+Ġconfir med
+other ap
+Ġcons um
+Ġm uc
+Ġsum m
+Ġresist ance
+em ic
+Ġresp ond
+b o
+Ġas p
+thes ia
+Ġan xi
+Ġdem ographic
+Ġappl ied
+Ġmoder ate
+Ġph ase
+Ġde c
+Ġperform ance
+Ġc am
+Ġterm s
+Ġit ems
+Ġincl usion
+Ġdrug s
+Ġc ut
+is ms
+Ġdet ected
+Ġap pe
+Ġinst it
+Ġend oscop
+Ġh f
+Ġm ut
+Ġyo u
+Ġs ide
+ffici ent
+Ġa im
+h y
+Ġh b
+c are
+g es
+w n
+r u
+as is
+Ġse qu
+it ative
+ane ous
+is f
+Ġphys ici
+Ġrecord ed
+Ġre nal
+Ġinflu ence
+Ġre lev
+Ġpl ate
+an n
+Ġact ive
+Ġ u
+Ġhigh est
+g f
+Ġm ade
+le t
+er ation
+Ġfig ure
+Ġfl u
+Ġble eding
+Ġunder st
+er o
+Ġplas ma
+r as
+Ġcar ies
+al es
+otherap y
+Ġcontinu ous
+rom e
+p ri
+Ġhel p
+Ġinvol ved
+Ġpoint s
+am ic
+Ġcon c
+Ġf ew
+er al
+Ġsign al
+Ġl ast
+Ġcomb ination
+Ġcol l
+Ġrel i
+a ff
+Ġsmok ing
+ros is
+Ġhealth care
+x im
+o y
+Ġw a
+s et
+ir atory
+Ġcomp ound
+est inal
 Ġto ol
-Ġapp ear
-Ġservic es
-i res
-Ġde ep
-Ġhe ight
-Ġhyp oth
-Ġs atis
-Ġst ep
-Ġhy per
-Ġsens itivity
-Ġpractic es
-t y
-in c
-Ġreas on
-in k
-Ġof ten
-Ġme ans
-Ġe ither
-is c
-ac tions
-Ġinc ome
-Ġheal ing
-ren ce
-Ġwor k
-Ġfunc tion
-Ġintere st
-w or
-Ġc p
-Ġb le
-Ġcont aining
-Ġsug gest
-Ġstruct ure
-Ġvit ro
-Ġsugges ted
-Ġprem olar
-Ġ 7
+Ġdet ail
+Ġinclud e
+Ġacc ess
+Ġst ren
+Ġsyn d
+ogen e
+am in
+Ġinter view
+Ġin ject
+Ġd am
+ros cop
+Ġt ub
+yro id
+Ġstren gth
+Ġprom ot
+ver s
+Ġyo ung
+Ġgast ric
+Ġinv as
+v ir
+Ġph en
+m e
+Ġanxi ety
+i ated
+Ġm ir
+cr ip
+Ġp ow
+Ġscre ening
+Ġs le
+l ast
+or k
+Ġserv ices
+Ġty pes
 ul ations
-ab l
-Ġres id
-Ġaffec t
-Ġcy cl
-Ġdecre ased
-n ed
-re g
-as is
-Ġe lec
-Ġac t
-Ġcons tr
-ke le
-Ġcer amic
-Ġnec ess
-gro up
-Ġc ari
-om a
-Ġch r
-ap ical
-Ġpl aced
-Ġda ily
-ogen ic
-on t
-at ric
-Ġperi apical
-Ġcont act
-Ġbi om
-m ark
-ro ph
-Ġpre vent
-Ġpre paration
-Ġen viron
-Ġcomm un
-Ġpost operative
-Ġcent ral
-Ġsol ution
-Ġabo ve
-o int
-Ġv ir
-Ġund ers
-Ġlay er
-y ch
-ar ch
-Ġdm ft
-Ġcephal ometric
-in eral
-or ing
+Ġex er
+Ġc s
+Ġadult s
+ord ers
+Ġmonth s
+Ġsaf ety
 Ġsub sequ
-Ġproper ties
-Ġfam ily
-n ec
-Ġt ong
-Ġs pl
-Ġp ock
-Ġst ages
-oc h
-Ġinc idence
-Ġsh ap
+Ġimprove ment
+Ġprog ram
+Ġsub st
+Ġprofess ional
+op s
+Ġol d
+it ation
+Ġexp ressed
+Ġa ir
 Ġcaus ed
-kele tal
-as c
-Ġhe ad
-pec ted
-Ġph ase
-Ġdevelop ed
-Ġcontr ast
-Ġd el
-Ġe cc
-Ġind uc
-Ġexamin ed
-pos ed
-Ġsup por
-Ġmor ph
-Ġauth ors
-e ed
-g ed
-ver y
-qu es
+Ġvent ric
+Ġg o
+ort ic
+Ġs ection
+d om
+Ġadj usted
+Ġcon cer
+Ġde v
+Ġda ily
+Ġlog istic
+Ġtest ed
+Ġreg ion
+uc ing
+i ot
+i ous
+Ġmyoc ardial
+Ġperiod ontal
+Ġam ount
+Ġc ross
+i ation
+Ġim aging
+Ġor th
+Ġmus cle
+ve ment
+Ġdef in
+Ġvent il
+Ġare as
+Ġlabor atory
+Ġm ental
+Ġdis orders
+Ġab n
+Ġimpro ved
+ress ive
+Ġhy d
+Ġf uture
+Ġv ir
 Ġab ility
-Ġcompos ite
-Ġadoles c
-Ġm ark
-et r
-ow n
-Ġpartic ular
-Ġtiss ues
-a z
-Ġs us
-Ġst ability
-Ġclin ic
-Ġspec ial
-Ġphys ical
-Ġdevi ation
-g ing
-o y
+Ġdep endent
+Ġrem o
+Ġre ad
+iat ric
+in ary
+Ġint ro
+i ent
+r ied
+Ġcomple x
+Ġhyp oth
+Ġsk in
+Ġcount ries
+Ġe ver
+Ġadj ust
+f unction
+Ġor ig
+Ġse en
 Ġneed ed
-Ġps ych
-Ġest abl
-Ġtong ue
-e qu
-Ġin hib
-Ġen h
-Ġcoh ort
-Ġw ee
+o ol
+Ġ ib
+Ġtak en
+Ġ 8
+Ġl ung
+Ġcr it
+Ġlimit ations
 Ġz ero
-Ġcountr ies
-Ġs r
-Ġan s
-Ġm l
-Ġpres s
-Ġdet ail
-Ġsystem ic
-Ġce ment
-Ġs keletal
-Ġm ut
-ro s
-Ġmembr ane
-Ġble eding
-Ġb ene
-Ġro ugh
-Ġser um
-r qol
-is ts
-Ġpubl ic
-Ġmajor ity
-n er
-Ġs k
-Ġd ivid
-Ġst ate
-ur ing
-Ġtest ing
-Ġagree ment
-Ġp ur
-Ġst aining
-Ġn ine
-Ġres orption
-Ġincre asing
-Ġol der
-Ġlog istic
-Ġadjus ted
-Ġcorresp onding
-Ġunders t
-g en
-et er
-id es
-ast e
-Ġfac ial
-Ġref lec
-Ġsum m
-Ġs tim
-Ġf il
-iv ing
-Ġcol or
-Ġenviron ment
-Ġdat as
+Ġdat ab
+Ġdes p
+Ġm ale
+Ġres id
+in a
+vir on
+ce m
+Ġfunction al
+il t
+Ġdesp ite
+Ġc m
+Ġm ac
+cis e
+Ġse par
+end ing
+Ġnec ess
+re g
+Ġcon st
+Ġv ia
+Ġsat isf
+Ġc v
+ure d
+Ġm ot
 Ġcomb ined
-Ġadm in
-f ied
-Ġl ast
-Ġad v
-Ġrepor t
-Ġso ur
+Ġ 9
+Ġr ang
+Ġst art
+pri ate
+Ġst ro
+ox id
+Ġaffect ed
+Ġunderst and
+Ġh eter
+Ġim ages
+Ġdys function
+Ġactiv ities
+cel l
+Ġup per
+od ont
+Ġdet ection
+Ġal co
+Ġpro per
+Ġpub lished
+Ġreport s
+n s
+Ġv as
 Ġar tic
-Ġmaxill a
-Ġtechni ques
-Ġtum or
-Ġadolesc ents
-Ġl and
-Ġex hib
-Ġconcent ration
-Ġu til
-b ers
-o v
-Ġ il
-Ġm ih
-ing s
-ten tion
-Ġdescr ip
-Ġdecre ase
-Ġ x
-Ġl ip
-Ġcon nec
-Ġpre ven
-Ġfill ed
-sc op
-Ġans w
-Ġpreven tive
-os ph
-Ġsignific ance
-Ġsup port
-Ġhy d
-Ġvis it
-Ġremo ved
-Ġan at
-le x
-Ġch em
-Ġvari ation
-anc ed
-ith el
-Ġapprox im
-Ġland mark
-Ġn or
-Ġcons um
-Ġsub st
-Ġcor onal
-Ġfrequ ently
-Ġidentif y
-Ġdevic e
-Ġa ware
-ing ual
-age ment
-io tic
-Ġrespond ents
-Ġb ack
-Ġgen e
-Ġsec tional
-Ġfemal e
-Ġpropor tion
-Ġnet wor
-Ġlarg er
-b l
-Ġp ol
-Ġb ody
-Ġpre gn
-Ġgr ad
-Ġw ay
-Ġreli ability
-ce p
-Ġfor ces
-Ġdep art
-Ġrem aining
-Ġdeg ree
-Ġpress ure
+Ġfem ale
+Ġunder w
 Ġth ough
-iz ing
-Ġse en
-Ġse par
-Ġinv as
-Ġvi ew
-Ġfract ure
-Ġchr onic
-Ġb est
-Ġcon d
-am e
-Ġgingiv a
-Ġgingiv itis
-tion ed
-Ġh p
-Ġconcent r
-Ġsur v
-Ġep ithel
-o ts
-p ri
-re ad
-Ġw all
-Ġch ec
-Ġreg ular
-Ġindic ate
-ath er
-Ġvis its
-Ġmicrob i
-l or
-p a
-Ġd oc
-Ġim aging
+Ġst rain
+Ġreg ist
+Ġn ational
+an k
+cis ion
+n er
+an ces
+Ġunderw ent
+Ġd om
+ill ary
+el ial
+at al
+Ġac ross
+Ġmedic ation
 pl oy
-Ġsh ort
-Ġtooth br
-Ġrestor ation
-Ġdo es
-Ġabs ence
-Ġdivid ed
-Ġtoothbr ush
-Ġ 9
-as ts
-Ġto ward
-Ġcon cer
-og r
-Ġoh rqol
-Ġpow er
-Ġunderst and
-c in
-Ġs qu
-Ġtr a
-pos ition
-Ġcalc ul
-Ġpolym er
+Ġcent er
+Ġelev ated
+Ġfra ction
+Ġ20 1
+Ġp aren
+em i
+Ġinvestig ated
+Ġen viron
+Ġextract s
+e g
+Ġgra de
+Ġactiv ation
+Ġestim ated
+Ġo d
+Ġtechni que
+ly ing
+Ġph osph
+Ġd ivid
+Ġpro duct
+Ġfin al
+ocyt es
+Ġref er
+ter ol
+Ġt n
+o chem
+is ion
+Ġm and
+Ġrelev ant
+Ġd na
+Ġc p
+ro b
+Ġre cept
+Ġc ogn
+Ġsynd rome
+Ġref erence
+Ġexam ined
+uc le
+Ġret ros
+re ad
 iel d
-Ġpan or
-Ġ 8
-Ġin ser
-Ġle ar
-Ġresul ting
-Ġsit u
-Ġrelative ly
-Ġconfirm ed
-m i
-Ġfin ally
-Ġop tim
-i ance
-Ġw a
+Ġcorrel ated
+Ġs ite
+ul ate
 at ures
-Ġb or
-im in
-Ġse em
-Ġfollow s
-Ġat trib
-Ġcomp are
-Ġph ot
-Ġindic ating
-Ġpanor amic
-Ġfo od
-Ġshow ing
-ex t
-Ġhel p
-Ġoper ative
-Ġrele vant
-Ġdig ital
-Ġm s
-Ġsurv ival
-Ġb re
-Ġrec ession
-Ġne ver
-Ġsub s
-Ġsub group
-Ġinstr uc
-m e
-Ġrec or
-Ġcollec tion
-Ġachie ved
-r u
-Ġs le
+Ġv er
+Ġb ar
+Ġvi ew
 Ġp cr
-oc y
-Ġse arch
-Ġaccor d
-Ġman agement
-Ġel astic
-Ġax is
-l ine
-Ġ ens
-Ġto p
-ly ing
-Ġrec ur
-Ġcompar ing
-Ġbrack et
+Ġm ak
+Ġag ed
+Ġappro xim
+Ġreas on
+r ial
+end ed
+m onary
+Ġcomm it
+res p
+Ġpl ac
+Ġtem per
+Ġtra um
+Ġs a
+w ays
+Ġmedic ine
+Ġmuc os
+ing s
+Ġdet ect
+Ġobes ity
+o urs
+Ġmultiv ariate
+Ġpan cre
+Ġsoft ware
+Ġst ep
+Ġanes thesia
+Ġen rol
+Ġph arm
+Ġsup p
+ay ed
+Ġlip id
+x t
+ro und
+er ic
+Ġvari able
+Ġv ascular
+Ġcol lection
+Ġh ome
+Ġth rom
+Ġpregn ancy
+Ġb ack
+Ġstro ke
+Ġresp iratory
+Ġunder go
+Ġquest ions
+Ġclass ification
+Ġw ide
+Ġcan n
+Ġlong er
+Ġn or
+r s
+Ġag re
+Ġpath way
+Ġcent ral
+Ġdeg ree
+Ġdep art
+Ġfin ally
+Ġox id
+Ġa k
+Ġsle ep
+Ġw ay
+oid s
+Ġw all
+Ġpl a
+Ġintervent ions
+d m
+f usion
+Ġre ach
+Ġabn ormal
+Ġshow ing
+Ġth ick
+it ted
 on omic
-Ġn ational
-Ġinclud e
-Ġknow n
-Ġconsider ing
-Ġcategor ies
-Ġinduc ed
-ul es
-Ġex clusion
-Ġass um
+l ation
+Ġc ad
+Ġcont ent
+Ġim plement
+k ed
+u ch
+Ġsol ution
+Ġform ation
+Ġre al
+Ġapopt osis
+o le
+Ġc od
 ous e
-Ġar ti
-Ġelec tr
-Ġob es
-fac tion
-Ġsp ace
-Ġdimension al
-Ġprog ression
-asc ular
-Ġt ub
-on ia
-Ġs il
-ti d
-Ġm us
-it ud
-ot yp
-Ġmed ian
-Ġlong er
-hol d
-Ġaccord ance
-Ġa round
-Ġs n
-Ġc d
-us tr
-Ġg um
-Ġac ro
-Ġcol l
-Ġappro pri
-Ġimport ance
-Ġcle an
-Ġagain st
-Ġapproxim ately
-c om
-Ġt it
-ro p
-Ġst er
-Ġpl ate
-Ġpl acement
-Ġtooth p
-Ġexamin er
-Ġaddition ally
-Ġextr acted
-Ġprom ot
-l d
-er ic
-Ġc ir
-is ms
-Ġex pres
-Ġrec ru
+Ġmo le
+Ġexperim ental
+Ġre act
+ath er
+Ġsignific ance
+Ġever y
+Ġmajor ity
+Ġexperi enced
+y gen
+iven ess
+Ġprol if
+Ġse arch
+ul ating
+Ġab dom
+os ition
+Ġn et
+Ġut il
+Ġcor resp
+Ġa x
+Ġcost s
+Ġenviron ment
+Ġdis ch
+Ġrecommend ed
 all en
-enc ing
-Ġclass ified
-Ġstruct ures
-Ġdimension s
-Ġrecomm ended
-Ġnecess ary
-Ġp en
-Ġb ar
-ic t
-Ġcons ent
-Ġprob ing
-ici ans
-Ġinvol ved
-Ġmucos a
-n ot
-Ġre ach
+Ġmem br
+r it
+Ġk g
+z ym
+Ġpre operative
+Ġdam age
+Ġbi ops
+Ġtreat ments
+e qu
+cl us
+Ġh s
+Ġappro priate
+Ġex ist
+Ġhe ad
+Ġan terior
+pe ut
+d en
+Ġauth ors
+om p
+Ġd er
+Ġappe ar
+Ġfac il
+Ġcontrol led
+Ġb u
+ab il
+Ġult ras
+Ġer r
+Ġd own
 Ġch allen
-ap s
-Ġwid e
-Ġattach ment
-Ġod ds
-Ġprote in
-Ġcari ous
-Ġsle ep
-Ġ ill
-on tal
-al ities
-Ġex ce
-ch ing
-Ġno ted
-Ġun til
-Ġmain tain
-Ġcent er
-yn amic
-Ġ20 1
-r ix
-Ġe as
-Ġe very
-Ġn at
-Ġcon sequ
-Ġpre p
-Ġmal e
-Ġperce ived
-u ter
-Ġim pression
-Ġpre vention
-Ġstatistic s
-Ġsystem s
-Ġdiagnos ed
-Ġcomm itt
-Ġvis ual
-Ġem ploy
-Ġrandom ly
-Ġfunc tional
-Ġcommitt ee
-b ial
-d le
-x imal
-Ġe con
-Ġl ingual
-Ġal ong
-Ġinc ub
+s s
+in c
+Ġalco hol
+Ġm iss
+Ġb ra
+Ġne uro
+Ġst aff
+Ġp d
+Ġspec ial
+Ġdiabet ic
+Ġfo od
+Ġinhib ition
+Ġprog ression
+Ġrelative ly
+Ġabdom inal
+Ġpoly m
+Ġse lection
 Ġmed ium
-Ġstr ateg
-icro bial
-Ġdesign ed
-anc y
-Ġmat rix
-Ġacro ss
-or b
-an tit
-ec t
-el ess
-Ġex cept
-Ġrepor ting
-Ġmain ly
-Ġav oid
-Ġerr or
-Ġhal f
-on y
-Ġc od
-or al
-Ġre pe
-Ġag ing
-tim icrobial
-m ost
-Ġt en
-Ġp ne
-Ġex pected
-Ġpro l
-Ġma gn
-ist ered
-Ġcompar able
-Ġtrans l
-Ġbehavi ors
-Ġda ys
-Ġdefec t
-Ġdepart ment
-Ġpne um
-Ġre al
-ec onomic
-Ġor gan
-Ġac tive
-Ġimpro vement
-Ġdire ction
-Ġhyd ro
-in ing
-is tration
-Ġal g
-Ġqu antit
-Ġdetec t
-Ġcanal s
-Ġcomparis ons
-g o
-Ġf it
-Ġf ile
-is ing
-ig ation
-Ġco e
-Ġreg ions
-Ġexamin ations
-Ġexperi enced
-Ġimm edi
-Ġtm j
-Ġcontin uous
-Ġrespons es
-Ġrough ness
-a x
-p re
-p ite
-Ġan timicrobial
-iv o
-form ation
-Ġmin eral
-Ġconf ound
-Ġmulti vari
-Ġcle ft
-Ġfill ing
-edi atric
-Ġcompon ent
-d rom
-l s
-Ġ ic
-fere d
-Ġap ex
-Ġob jec
-Ġdes pite
-Ġimpro ved
-Ġexpl ained
-Ġeth ics
-Ġsocio economic
-ogene ity
-Ġb ro
-Ġn as
-un g
-iz es
-Ġhigh ly
-ob l
-Ġwid th
-a ke
-Ġv ivo
-and s
-Ġem erg
-Ġsequ ence
-Ġvers ion
-Ġdatas et
-th eless
-Ġre ad
-Ġim ple
-Ġresul ted
-Ġgen etic
-Ġman ual
-Ġz ir
-Ġmid dle
-Ġlear ning
-Ġpneum onia
-Ġd na
-Ġm ild
-Ġh eter
-if y
-ib r
-Ġappro ved
-Ġarti ficial
-Ġnat ural
-f ort
-l ess
-u tions
-Ġpro posed
-uc le
-Ġyoung er
-Ġul tr
-Ġhypoth esis
-b ility
-or ith
+Ġline ar
+Ġmetab ol
+Ġac cept
+Ġem ploy
+Ġ iv
+Ġarter ial
+Ġn od
+Ġhospital s
+Ġl v
+g ment
+Ġst aining
+Ġh c
+Ġincub ated
+Ġo c
+Ġm it
+Ġaddition ally
+Ġl ink
+ogen ic
+Ġapproxim ately
+Ġtest ing
+Ġfl uid
+Ġp p
+Ġaccur acy
+ect s
+Ġb rain
+un ct
+Ġindic ate
+Ġperiod ont
+or ation
 Ġb ur
-Ġh iv
-Ġse e
-Ġpar ti
-Ġmod ified
-Ġdat ab
-Ġincre ases
-Ġpredic t
-Ġtrial s
-Ġsyn drom
-Ġalg orith
-Ġzir con
-u ro
-y le
-Ġf ul
-Ġassoci ations
-Ġsecond ary
-Ġoccur red
-Ġpubl ished
-Ġprofessional s
-Ġappropri ate
-n s
-Ġt end
-re w
-Ġd am
-Ġd ynamic
-Ġre pl
-Ġh s
-Ġaccur ate
-Ġmuc h
-Ġspecific ity
-Ġpal ate
-Ġcomb ination
-Ġtem per
-Ġconcentr ations
-o facial
-r ing
-u x
-Ġg e
-uc tion
-igh ted
-Ġen c
-Ġop en
-Ġinvestig ate
-Ġcer tain
-Ġbrack ets
+Ġcogn itive
+Ġm orph
+Ġab le
+Ġindic ating
+Ġcar ried
+Ġal one
+Ġtemper ature
+f s
+peut ic
+i res
+Ġestab lished
+Ġso ur
+Ġdivid ed
+Ġwork ing
+Ġh al
+Ġcom orbid
+Ġresult ing
 Ġconsum ption
-i pl
-v ated
-Ġm y
-Ġm ixed
-Ġch ines
-Ġer up
-Ġcommon ly
-Ġinstru ments
-Ġsatis faction
-Ġchines e
-Ġc ut
-Ġb u
-ec tion
-ut es
-pl as
-ven ess
-Ġindic ates
-Ġmon it
-gr ad
-Ġload ing
-Ġd one
-Ġm r
-Ġh or
-Ġe v
-Ġclinical ly
-Ġmicro scop
-Ġirr adi
-Ġsr ta
-Ġinvas ive
-Ġecon omic
-a ir
-x y
-Ġm ill
-Ġst ain
-ac ti
-Ġl ed
-Ġinter ven
-Ġvari ations
-Ġph osph
-Ġdep endent
-Ġcompon ents
-Ġzircon ia
-Ġex ist
-Ġsign s
-Ġint ake
-Ġsl ight
-Ġcompl ications
-Ġreas ons
-Ġexam ple
-Ġshap e
-Ġestabl ished
-Ġbene f
-Ġepithel ial
-an es
-Ġcon cluded
-Ġal most
-Ġse m
-Ġappl ian
-Ġdef in
-Ġgr an
-Ġlimit ation
-Ġorig inal
-Ġanat om
-Ġapplian ces
+Ġd il
+Ġlo ad
+Ġb est
+Ġsit u
+Ġcyt ok
+Ġpers on
+Ġtre n
+Ġcur ve
+Ġen zym
+Ġdo es
+Ġpow er
+Ġn er
+Ġappl ication
+Ġabs ence
+Ġproble ms
+oles terol
+Ġsystem atic
+Ġheter ogene
+Ġcon vent
+Ġon set
+Ġrec ru
+Ġcont aining
+Ġtiss ues
+Ġrandom ized
+Ġ ig
+Ġde vi
+Ġch olesterol
+Ġmat ch
+Ġt a
+Ġcan al
+Ġb il
+e f
+Ġto p
+ne y
+Ġunt il
+Ġhyd ro
+Ġprogn osis
+Ġd ensity
+Ġm s
+Ġfe atures
+Ġpre par
+Ġre pl
+Ġref lect
+Ġex hib
+str uct
+Ġventric ular
+Ġox ygen
+Ġreport ing
+Ġep id
+Ġle ar
+i ate
+Ġg ly
+Ġpro duction
+Ġen g
+Ġadd ed
+Ġdis pl
+Ġra d
+Ġcommit te
+iv ed
+Ġdis s
+Ġst ate
+Ġhep at
+Ġanimal s
+Ġto ward
+Ġ ess
+Ġappro ved
 p ati
-w as
-ol d
-Ġas ked
-Ġrec ip
-Ġlow est
+on ding
+b p
+Ġm olar
+ip h
+Ġmet ast
+Ġdel iv
+Ġsp ect
+Ġre v
+Ġre pe
+Ġme ans
+Ġro ut
+hol d
+Ġke y
+oty pe
+Ġemerg ency
+Ġco urse
+Ġf ast
+Ġacc ount
+ut ed
+Ġpul monary
+is ing
+Ġconfir m
+olog ic
+Ġles ion
+ul es
+Ġ enc
+Ġcommun ity
+l ine
+Ġreceiv ing
+Ġcons ent
+Ġconvent ional
+Ġne u
+Ġg ing
+ul a
+u le
+Ġmax imum
+Ġmechan ism
+c al
+arg er
+Ġel der
 Ġmal ign
-Ġconf idence
-Ġscre ening
-n ic
-Ġf p
-an sion
-iz ontal
-Ġcl ose
-00 0
-Ġeth nic
-Ġperce ption
-Ġinstru ment
-Ġexp ansion
-Ġdifferenti ation
-Ġintroduc tion
-Ġattrib uted
-Ġprep ared
-n al
-Ġrepor ts
-Ġcontrol s
-Ġcontrol led
-Ġdi amet
+Ġexam ple
+Ġl arger
+ff er
+Ġe as
+Ġang i
+Ġstud ied
+a z
+l ing
 Ġwor ld
-Ġins tit
-Ġarch w
-Ġexpos ed
-Ġbel ie
-Ġlandmark s
-Ġhor izontal
-Ġl ig
+Ġem b
+Ġsystem ic
+Ġc ath
+Ġclass ified
+Ġadminist ered
+Ġav oid
+Ġst ay
+Ġmetab olic
+Ġextra ction
+Ġis chem
+Ġmain ly
+Ġvers us
+Ġde cl
+Ġbacter ial
+Ġcompon ents
+Ġev ent
+Ġvis ual
+res t
+Ġh ip
+Ġoccur red
 Ġis s
-oc l
-Ġhe m
-Ġsc ans
-Ġsu fficient
-l ing
-Ġt ren
-Ġt arg
-Ġm ac
-Ġh ouse
-ur ation
-pec ts
-vi ties
-Ġreg en
-Ġsmall er
-Ġmen tioned
-Ġinterval s
-Ġmarg in
-Ġp and
-ro c
-Ġsc i
-Ġco v
-Ġindic es
-Ġmin isc
-fic ation
-Ġexpl ain
-Ġcompos ition
-Ġdifficult y
-Ġmorph ology
-Ġaware ness
-Ġd ensity
-Ġdis ord
-Ġap op
-Ġrel ation
-Ġli k
-Ġcomple ted
-Ġstandard ized
-Ġrestor ative
-Ġpap ill
-Ġrecomm end
-Ġminisc rew
-i ent
-an ium
-Ġde br
-Ġad vant
-Ġcont ent
-ell ing
-Ġmed ic
-Ġgener ally
-Ġintra oral
-Ġfe atures
-Ġwee k
-Ġultr as
-c s
-n t
-t reated
-Ġf av
-om at
-il ateral
-Ġpl ace
-Ġinter pre
-Ġdr y
-Ġran k
-Ġfl ap
-Ġpand emic
-b ite
-c are
-f e
-u k
-Ġ q
-Ġ ve
-Ġt f
-Ġs b
-Ġr ather
-ag en
-Ġproble m
-Ġattitud es
-Ġtra um
-k ers
-Ġf ilm
-Ġl ate
-el ines
-Ġqu anti
-Ġpop ulations
-ten sion
-Ġalign ers
-Ġtit anium
-Ġexpres sed
+Ġex cept
+e e
+oc y
+Ġte am
+ur ing
+c ut
+Ġincre ases
+Ġdefin ition
+Ġcommitte e
+ogen esis
+h e
+Ġthera peutic
+Ġex clusion
+Ġdatab ase
+Ġretros pective
+Ġcon sequ
+Ġse pt
+Ġre le
+le x
+Ġint eg
+Ġd ig
+Ġint ake
+or der
+Ġsus p
+um in
+Ġsup plement
+Ġfract ure
+Ġinter p
+Ġlead ing
+Ġh r
+Ġb o
+Ġcont act
+Ġs qu
+Ġocc urrence
+Ġsch ool
+Ġfrequ ently
+Ġinf ections
+Ġm ild
+Ġe ch
+ess el
+Ġwh at
+qu es
+Ġexer cise
 en ed
-Ġm ar
-Ġm ass
-Ġm ust
-Ġb in
-Ġh om
-Ġscan ning
-Ġguid elines
-Ġseg mentation
-Ġcult ure
-Ġdispl acement
-Ġadd ress
-Ġantib iotic
+Ġpl an
+Ġm agn
+Ġfollow s
+Ġelder ly
+Ġnecess ary
+Ġcompar ing
+Ġvis it
+Ġin ser
+p ing
+Ġreas ons
+Ġperiodont itis
+Ġexp ected
+Ġii i
+Ġpl ot
+Ġcompound s
+Ġk id
+Ġgast ro
+Ġneed s
+Ġc op
+us h
+od ies
+Ġimmun e
+Ġl a
+Ġro om
+over y
+w ork
+p id
+Ġconsider ing
+c k
+Ġess ential
+odont ic
+Ġm t
+Ġdi amet
 on es
-Ġd ys
-it tal
-il it
-Ġv ia
-ag ittal
+Ġc b
+Ġn ucle
+Ġto x
+Ġpre p
+Ġ x
+Ġmonit oring
+Ġbel ie
+Ġdepart ment
+Ġrequ ire
+Ġs n
+r ated
+il es
+Ġtn f
+ines e
+Ġob ject
+s c
+Ġg u
+Ġprolif eration
+Ġch inese
+Ġpla que
+Ġd one
+Ġimp air
+Ġinter n
+Ġnot ed
+Ġass um
+u k
+ochem ical
+Ġd oc
+Ġcomp are
+Ġprotein s
+Ġgl ob
+in ant
+Ġsit es
+Ġthrom b
+Ġg r
+Ġbi om
+Ġsystem s
+Ġpe ak
+iz ing
+Ġl ight
+Ġrout ine
+Ġl ateral
+Ġsl ight
+ro w
+Ġmechan ical
+Ġr ather
+Ġpredict ive
+Ġsuccess ful
+Ġd iv
+Ġconf idence
+ro t
+Ġmechan isms
+yn amic
+Ġimport ance
+Ġ ul
+Ġpos terior
+Ġ ens
+Ġrec urrence
+Ġf ill
+Ġhigh ly
+ib ular
+Ġm ap
+Ġcaus es
+Ġm i
+Ġp c
+Ġprevent ion
+Ġinvas ive
+ici ency
 Ġinform ed
-Ġloc ation
-Ġeduc ational
-Ġmouth was
-Ġmes ial
-Ġbiom ark
-Ġpock et
-Ġdescrip tive
-ogr am
-Ġtoothp aste
-l and
-Ġ ess
-ti veness
-Ġp ass
-Ġof f
-Ġm ach
-or age
-Ġr a
-Ġac cept
-Ġad ult
-Ġintr usion
-Ġwor king
-Ġloc ated
-Ġflu id
-Ġreli able
-Ġappear ance
-Ġchec k
-Ġtoward s
-Ġanatom ical
-Ġc and
-Ġc op
-ar m
-ol ution
-Ġad equ
-Ġcan not
-Ġnum bers
-Ġdec ayed
-Ġplan ning
-Ġel ig
-Ġbehavi our
-Ġvalid ity
-in a
-Ġc f
-Ġp ast
-Ġf usion
-is sion
-Ġh er
-ur s
-Ġch o
-Ġgen es
-Ġcorre ct
-Ġol p
-Ġadj ust
-Ġfil es
+Ġcategor ies
+Ġpro d
+Ġsh e
+Ġmark ers
+Ġhal f
+Ġdescr ip
+Ġv essel
+ric t
+Ġparticular ly
+Ġextract ed
+Ġatt ribut
+Ġhep atic
+Ġinf ar
+p a
+Ġweek s
+o ch
+Ġvit ro
+ter s
+Ġsuggest ing
+p oint
+Ġth yroid
+Ġtrans fer
+Ġp al
+l or
+Ġag ents
+Ġcl ose
+Ġm ar
+t ies
+Ġm es
+Ġch ec
+Ġj oint
+Ġphysici ans
+ir th
+Ġcompar able
+Ġinject ion
+Ġoper ative
+b al
+Ġm d
+Ġl dl
+Ġal b
+ceiv ed
+Ġpros pective
+Ġbacter ia
+Ġimm ed
+Ġch o
+Ġprogn ostic
+Ġplac ed
+ati f
+cin oma
+en se
+an ol
+Ġstrateg y
+g ing
+Ġde cision
+Ġad equ
+Ġclinical ly
+Ġpop ulations
+Ġal t
+o h
+Ġstrateg ies
+Ġpharm ac
+Ġl ay
+Ġne ver
+Ġventil ation
+Ġop en
+Ġl act
+Ġclin ic
+Ġsatisf action
+Ġfib rosis
+Ġit em
+l ess
+th ers
+Ġisol ated
+Ġm uch
+and s
+Ġred ucing
+Ġf it
+Ġadv anced
+Ġanti oxid
+es tern
+Ġassoci ations
+Ġod ds
+iv es
+Ġtraum a
+Ġo thers
+enc ing
+Ġper ceived
+Ġstr atif
 Ġbre ast
-a ft
-o k
-u tr
-Ġp m
-ac ent
-om atic
-Ġhealth care
-Ġcur ve
-Ġneed s
-Ġsampl ing
-Ġscal ing
-Ġeth ical
-co hol
-Ġmicrob ial
-Ġartic les
-Ġheter ogeneity
-Ġt ur
-it ing
-Ġn an
-Ġas pects
-Ġal cohol
-Ġwh at
-Ġres pect
-ap y
-Ġspec ies
-Ġinfec tions
-Ġes thetic
-Ġdoc u
-Ġobes ity
-Ġinterven tions
-Ġtarg et
-Ġs agittal
-Ġf ield
-or atory
-Ġad ap
-Ġtr ained
-Ġwe ight
-Ġsec tion
-Ġdr ug
-Ġrepresent ative
-Ġair way
-Ġresid ual
+Ġco un
+Ġdisch arge
+Ġt c
+Ġan n
+Ġm ention
+Ġrec ogn
+Ġmicro b
+i ological
+Ġinvestig ate
+Ġrespons es
+Ġst er
+Ġresult ed
+Ġsc an
+Ġcommon ly
+el ess
+Ġli k
+Ġc e
+Ġheterogene ity
+Ġcy cl
+pl ant
+Ġrec overy
 Ġpsych ological
-Ġcand id
-d r
-g ue
-er ior
-Ġp or
-Ġan imal
-Ġd own
-it es
-Ġinc or
-Ġass ign
-Ġun treated
-Ġmo ve
-ograph y
-Ġ1 9
-Ġadj acent
-Ġsubsequ ent
-ov a
-Ġrepe ated
-Ġdisord ers
-c p
-c ence
-Ġ ,
-Ġ ur
-Ġco verage
-Ġcr an
-Ġmet ast
-Ġdr ill
-Ġrandom ized
-Ġvers us
-Ġnever theless
-u fact
-Ġd er
-th ers
-tr ic
-ir th
-Ġad verse
-Ġeffec tiveness
-Ġen rol
-Ġph en
-Ġman ufact
-Ġappl iance
-Ġcalc ium
-Ġtrans fer
-ane ous
-Ġhard ness
-Ġfocus ed
-Ġsour ce
-Ġa ug
-Ġf ati
-th es
-Ġb onding
-res t
-Ġal tern
-Ġch lor
-op ath
-Ġpr inc
-Ġab le
-Ġen g
-Ġobser vation
-Ġbl ock
-Ġinvestig ation
-Ġinfec ted
-Ġexhib ited
-Ġens ure
-Ġquantit ative
-Ġfati gue
-h e
-t t
-Ġh d
-ul ate
-el ing
-ib ration
-Ġspec imen
-Ġrequ ire
-Ġpe ak
-Ġrati os
-Ġpap er
-Ġrefer ral
-Ġintern al
-Ġhp v
-l ier
-Ġ ent
-Ġp ediatric
-Ġd l
-Ġm il
-Ġg erm
-Ġstud ied
-Ġus ually
-Ġint e
-Ġdi et
-Ġunder go
-Ġfrequ ent
-Ġapp oint
-Ġpa ir
-Ġachie ve
-Ġrecor ds
-Ġtemper ature
-c ers
-m d
-w ise
-Ġcr p
+Ġachie ved
+Ġinter nal
+Ġaccor d
+m an
+Ġagre ement
+Ġres our
+Ġcrit ical
+Ġa ction
+ap s
+Ġd imens
+Ġstruct ure
+Ġtr ig
+Ġeth ics
+Ġel ig
+Ġh om
+Ġexpl ained
+Ġinterp re
+Ġmr na
+Ġem ot
+Ġindep end
+Ġdist al
+Ġb ro
+Ġquant itative
+ere b
+Ġr s
+Ġun it
+Ġtra dition
+Ġserv ice
+th etic
+Ġa ortic
+Ġfem ales
+Ġvers ion
+Ġnet work
+Ġw estern
 Ġwho le
-Ġprob ability
-Ġoccur rence
-Ġext ent
-Ġcommun ity
-Ġvir t
-Ġprol if
-Ġmalign ant
-Ġpapill a
-Ġess ential
-b m
-Ġo thers
+Ġn ut
+Ġsoci o
+Ġbenef it
+Ġqu al
+Ġundergo ing
+Ġsuggest s
+Ġa round
+w h
+Ġkid ney
+Ġint ensity
+Ġeffect iveness
+Ġend oth
+Ġplace bo
+Ġind uction
+Ġsign s
+Ġinstit ut
+Ġtum ors
 er c
-Ġst re
-il i
-id ed
-Ġal ter
-Ġr c
-iv es
-Ġcons isted
-Ġparticip ate
-Ġreduc ing
-Ġimp acted
-Ġsug ar
-Ġcy to
-Ġestim ated
-ros pective
-Ġrecur rence
-h ere
-i ological
-p tions
-Ġan ova
-Ġm is
-Ġl in
-Ġl ater
-Ġn ucle
-Ġal one
-Ġsur ge
-Ġbr ux
-Ġmaxill ofacial
-Ġsup ple
-Ġsubjec t
-ak age
-Ġret rospective
-Ġbel ow
-Ġcir c
-Ġemploy ed
-Ġinte gr
-Ġs a
-ro ke
-Ġh ence
-Ġg ir
-ab ol
-Ġrec ogn
-Ġmed ia
-Ġquestionna ires
-Ġgl ass
-o h
-p ose
+as k
+Ġe uro
+Ġintro duction
+ub ation
+on ia
+Ġac et
+r ing
+i otic
+Ġd l
+Ġp ast
+Ġvalid ity
+Ġco e
+Ġal tern
+Ġn orm
+ocy te
+Ġaccord ance
+p or
+Ġob tain
+Ġd oses
+Ġprepar ation
+ot ox
+Ġc as
+Ġc av
+Ġrec ently
+Ġmak ing
+Ġl ist
+cr ib
+Ġdoc ument
+Ġrecept or
+Ġcap ac
+Ġanal ges
+l er
+er ior
+Ġlear ning
+Ġdiamet er
+Ġinter action
+Ġd ate
+an es
+omet ric
+Ġdev ice
+Ġconf ound
+Ġsal iv
+Ġsyst olic
+Ġh cc
+im in
+s h
+Ġmal es
+pati ent
+Ġuse ful
+in ding
+Ġb p
+Ġcath eter
+Ġg a
+Ġb al
+Ġrespond ents
+Ġcann ot
+Ġth res
+am e
+Ġdeliv ery
+Ġac qu
+Ġs od
+Ġad en
+Ġcont ex
+Ġus ually
+Ġhem at
+Ġal le
+Ġmembr ane
+Ġam eric
+00 0
+unct ure
+Ġfrequ ent
+Ġmem bers
+m ost
+Ġra pid
+Ġf ixed
+Ġder ived
+Ġpl ay
+Ġ "
+os ing
+Ġcorresp onding
+Ġ ,
+Ġbur den
+Ġoper ation
+Ġp ort
+ic ial
+Ġm ig
+Ġreli ability
+Ġcer tain
+c ence
+Ġl at
+Ġcon n
+Ġh ours
+Ġv ac
+Ġcorre ct
+i er
+Ġvis its
+Ġint estinal
+Ġan a
+Ġan at
+Ġsignal ing
+Ġthick ness
+Ġultras ound
+Ġproper ties
+Ġres ection
+Ġhe ight
+Ġre action
+Ġspecific ity
+Ġse cre
+Ġper iph
+Ġartic les
+Ġw ound
+Ġreg ions
+Ġgen etic
+r ition
+Ġc ereb
+Ġag g
+Ġsimilar ly
+Ġtrans plant
+Ġindic ates
+Ġal ong
+Ġdist ance
+Ġtechni ques
+Ġgener ally
+Ġmax illary
+Ġad a
+Ġc ort
+Ġmedic ations
+ne um
+op l
+Ġn at
+Ġv en
+Ġmaterial s
+Ġmiss ing
+crip tion
+Ġk it
+Ġuniv ariate
+Ġtak ing
+Ġendoscop ic
+Ġas ked
+Ġo v
+Ġpur p
+Ġbiops y
+Ġa ware
+Ġt end
+Ġwork ers
+Ġeuro pe
+Ġdirect ly
+Ġbiom ark
+l o
+itud e
+og l
+Ġbar ri
+Ġsubsequ ent
+Ġreg ular
+Ġfe el
+am ine
+Ġb irth
+Ġco x
+Ġenrol led
+Ġsk ill
+Ġne ut
+Ġl ater
+Ġvit amin
+Ġcompon ent
+Ġcapac ity
+Ġtren d
+Ġm c
+Ġext ent
+Ġp neum
+Ġdevelop ing
+im ic
+erg y
+f ort
+ro gen
+p ical
+Ġ ip
+Ġh is
+Ġrem ained
+or i
+Ġm arg
+Ġbel ow
+Ġadh es
+Ġorth odontic
+Ġse ps
+Ġoxid ative
+d le
+Ġa ther
+Ġm ake
+oc ardi
+Ġinc ome
+Ġad ip
+Ġp and
+Ġgre at
+Ġch ina
+Ġisol ates
+Ġrepe ated
+ar ing
+Ġm ixed
 re h
-en ding
-Ġf ace
-Ġas ym
-Ġdis s
-Ġpl us
-Ġab ut
+thes is
+s a
+ag en
+oscop y
+im en
+i ology
+Ġsumm ar
+Ġill ness
+Ġm g
 enc ies
-Ġsp eed
-Ġnec k
-Ġprec ision
-Ġc ad
-Ġre tr
+ist ry
+Ġsus cept
+Ġchem otherapy
+Ġflu or
+y le
+Ġindepend ently
+Ġpredict ors
+Ġinterest ing
+in ations
+f a
+Ġinter act
+Ġmic roscop
+th m
+Ġf av
+Ġprof ile
+Ġident ification
+Ġantib ody
+ic ted
+Ġdi ast
+Ġch rom
+Ġcontex t
+Ġear li
+Ġperiph eral
+Ġpl ant
+Ġh orm
+Ġr ank
+Ġdevi ation
+Ġf all
+Ġon ce
+Ġtradition al
+h ood
+Ġal most
+Ġinf ilt
+Ġrem aining
+Ġwas h
+Ġseps is
+Ġprep ared
+rol og
+Ġhospital ization
+Ġliv ing
+Ġant ic
+it ing
+Ġrem ains
+Ġunderstand ing
+Ġpand emic
+et s
+Ġbehavi or
 Ġcomp reh
-ific ations
-Ġinter action
-Ġmeas uring
+iot ics
+Ġantioxid ant
+Ġpers ist
+Ġf ield
+Ġn urse
+Ġmid dle
+Ġpre c
+Ġmention ed
+ub le
+Ġspec imens
+Ġass ist
+cell ular
+Ġse gment
+Ġj ust
+Ġst able
+cl er
+Ġech ocardi
+Ġfract ures
+Ġmole cular
+Ġmod ified
+Ġh dl
+Ġprol ong
+Ġcol le
 Ġbi ological
-Ġdec l
-Ġextr actions
-Ġfib ro
-Ġcycl ic
-Ġunderstand ing
-Ġmultivari ate
-i ous
-v ascular
-Ġ iv
-Ġa ff
-es thetic
-Ġb irth
-Ġn a
-ition al
-Ġacc um
-Ġcar b
-Ġmed i
-Ġcy t
-ox ic
-Ġservic e
-Ġtem por
-Ġadd ed
-Ġattitud e
-Ġsqu are
-Ġdiamet er
-Ġ "
-Ġb ase
-Ġe uro
-Ġcomp r
-reat ment
-Ġpl ay
-Ġne x
-amin ation
-ish ing
-Ġear lier
-Ġproduc tion
-Ġdom ain
-Ġtraum a
-u le
-Ġc am
-Ġf lex
-is tr
-Ġn od
-Ġr am
-Ġpro ximal
-Ġma ke
-Ġgener ated
-Ġinflu enced
-Ġproduc ed
-Ġsitu ation
-Ġfp m
-f or
-ur se
-Ġcomp uter
-Ġdent ine
-Ġun it
-Ġar t
-ingiv al
-ores cence
-Ġsuper ior
-Ġorig in
-w ays
-Ġp f
-Ġw r
-Ġan ch
-Ġst able
-Ġv r
-Ġinf il
-enti ally
-Ġk e
-Ġman if
-Ġdem ineral
-Ġmin im
-Ġgl ob
-gro und
-Ġmus cle
-Ġrecru ited
-Ġful ly
-Ġprolif eration
-Ġo t
-Ġp il
-ur ance
-Ġwh ite
-Ġpro gnos
-ys is
-and ibular
-Ġro ots
-Ġschool s
-Ġintern ational
-Ġclos ure
-Ġparticular ly
-Ġnetwor k
-Ġgir ls
-c us
-f s
-Ġf ore
-Ġd ose
-ic ate
-Ġn one
-id ine
-Ġsh or
-Ġcan ine
-Ġro ut
-Ġspec if
-Ġparticip ant
-Ġmin imum
-Ġprovid ing
-Ġep id
-etr y
-Ġinstruc tions
-Ġrecip roc
-Ġadequ ate
-Ġth res
-Ġthe r
-Ġis ol
-Ġint ensity
-Ġmet abol
-Ġsmo kers
-itt le
-Ġrefer red
-Ġspl int
-Ġback ground
-Ġev ents
-Ġmach ine
-Ġspecif ically
-b y
+Ġser ies
+Ġper cept
+Ġmand ibular
+Ġdesign ed
+Ġrecord s
+Ġn as
+Ġep ith
+Ġheal ing
+Ġl ed
+Ġnum bers
+p ut
+it t
+Ġunder lying
+l ight
+Ġac up
+Ġspec ies
 p ed
-Ġb mi
-Ġst ated
-el s
-Ġhigh l
-Ġmod e
-Ġinter view
-ag ed
-Ġdevelop ing
-Ġalign er
-Ġmucos al
-Ġsuccess ful
-Ġdirect ly
-Ġbo ys
-Ġpremolar s
-Ġincub ated
-Ġcompreh ensive
-g g
-Ġo hip
-Ġp p
-ul us
-Ġres t
-Ġcont ext
-Ġpl as
-Ġacc ount
-Ġpr iv
-Ġnum er
-Ġsubjec tive
-Ġmon om
-Ġlead ing
-Ġext ensive
-Ġlab oratory
-Ġguid ed
-Ġsubsequ ently
-Ġdetail ed
-Ġdatab ase
-plas ia
-Ġmedic ine
-Ġmil k
-a ment
-h ex
-r on
-Ġa ges
-Ġc re
-Ġd s
-ic ular
-ro tid
-Ġr ay
-uc ted
-Ġall oc
-Ġobser v
-Ġmin or
-Ġem d
-unc tion
-Ġrem ains
-Ġexpl an
-Ġprovid es
-Ġmarg inal
-Ġsuppor ted
-Ġpregn ant
-otyp e
-Ġirradi ation
-Ġ enti
-Ġs ar
-en se
-Ġf ar
-ro w
-il ities
-Ġon ce
-Ġal t
-ess ions
-Ġat tention
-Ġsign al
-Ġvari ance
+Ġimpair ment
+Ġyoung er
+Ġcir rh
+s w
+Ġhist ological
+Ġpath ways
+Ġpotential ly
+Ġm ob
+Ġinfar ction
+Ġse lect
+ce ive
+Ġrel ation
+Ġcomple ted
+Ġar ch
+Ġm ust
+Ġorig inal
+Ġinvol vement
+Ġantib odies
+Ġsection al
+Ġintern ational
+Ġm orbid
+a e
+Ġar th
+Ġs pe
+Ġcy cle
+Ġto g
+Ġadm itted
+Ġinstr ument
+g i
+Ġfor ce
+Ġbas is
+Ġtog ether
+Ġloc ation
+Ġdiff er
+Ġexperim ents
+Ġlow est
+Ġprop osed
+Ġglob al
+Ġg erm
+Ġdis order
+em pt
+Ġtoward s
+ro c
+os ter
+Ġp ed
+Ġmain tain
+ul atory
+Ġt g
+Ġcon cept
+os cler
+Ġexp osed
+Ġobserv ation
+Ġass ign
+r ate
+ect omy
+r ine
+Ġproduct s
+in f
+Ġf ace
+Ġada pt
+Ġner ve
+Ġal ter
+Ġpo ol
+ace ment
+Ġsuper ior
+Ġpattern s
 Ġ1 0
-Ġran ging
-Ġcorrel ated
-Ġrece iving
-Ġpredic tion
-other apy
-Ġproduc ts
-Ġsk ill
-Ġslight ly
-Ġtren d
-Ġrout ine
-Ġc reated
-Ġm oth
-Ġh is
-Ġr ural
-Ġpl ot
-Ġsim ple
-Ġperiod s
-Ġlong itud
-Ġod ont
-Ġcontrib ute
-Ġparti al
-Ġeuro pe
-or gan
-Ġst roke
-ul a
-ac ts
-Ġr un
-op h
-Ġrec onstr
-Ġab und
-Ġcol le
-Ġli th
-Ġins urance
-Ġir reg
-Ġrepres ents
-Ġgu ide
-Ġdevi ations
-Ġcountr y
-Ġprog ress
-Ġadmin istration
-Ġdam age
-Ġaccept able
-Ġke y
-Ġpil ot
-Ġmoth ers
-a ff
-Ġs izes
-Ġb ite
-as k
-Ġre tention
-Ġl ines
-Ġpre operative
-Ġad op
-Ġle uk
+Ġchec k
+l u
+Ġfin d
+Ġra re
+Ġrele ase
+Ġt b
+Ġopt imal
+Ġintra operative
+Ġdiet ary
+uc es
+Ġn f
 ari ly
-ch ed
-Ġran ged
-Ġoper ator
-Ġvit amin
-Ġcategor ized
-Ġsugges ts
+Ġvari ation
+Ġendoth elial
+Ġcontribut e
+Ġm ri
+ct al
+it es
+Ġn it
+em a
+Ġpancre atic
+Ġst ent
+Ġinterval s
+Ġantib iotic
+ip l
+Ġcomparis ons
+Ġsur ge
 Ġsumm ary
-Ġseem s
-Ġnex t
-b a
-o pl
-Ġa esthetic
-Ġof fic
-Ġm g
-is ation
-Ġe ti
-Ġpro mo
-Ġac qu
-Ġtr ad
-Ġdec ision
-Ġ1 2
-Ġform ed
-Ġgr ade
-Ġfac ilit
-Ġparen ting
-Ġvi ol
-Ġimmun e
-Ġsetting s
-och em
-Ġpromot e
-Ġerup tion
-Ġincor por
-d own
-th e
-th esis
-it able
-ac tive
-Ġl ittle
-Ġex tern
-Ġus ers
-Ġtw ice
-Ġcol on
-Ġparamet er
-Ġreview s
-Ġhist ological
-Ġperce ptions
-Ġpers on
-Ġindep end
-Ġdom ains
-Ġinterest ing
-Ġinhib it
-Ġwide ly
-Ġill ustr
-Ġbiomark ers
-Ġchlor hex
-Ġcyto k
-Ġchlorhex idine
-e u
-i asis
-t ation
-Ġs ul
-Ġf al
-Ġl iving
-igh ts
-og ens
-Ġhe art
-Ġass ay
-Ġreg istered
-Ġcar d
-Ġab r
-fac e
-Ġar r
-Ġindic ators
-Ġresp ir
-Ġcro w
-Ġcaus es
-Ġvalid ation
-Ġrele ase
-Ġseal er
-Ġsubst anti
-Ġpregn ancy
-Ġstrateg y
-Ġcoe fficient
-Ġimmedi ately
-Ġultras onic
-Ġmove ments
-Ġmetast asis
-Ġvirt ual
-Ġpriv ate
-l i
-l er
-re p
-Ġc ost
+Ġpre m
+Ġsh ock
+ogl ob
+Ġad oles
+Ġmo uth
+Ġcon struct
+Ġm el
+Ġparticip ant
+Ġearli er
+i ary
+Ġremo val
+r itis
+Ġprovid es
+Ġcytok ines
+Ġfacil it
+Ġlead s
+Ġresp ect
+iz es
+Ġ1 9
+Ġpers onal
+Ġn af
+Ġhem od
+it us
+Ġair way
+rob ial
+opl as
+Ġimpl ants
+ol d
+Ġam pl
+u ary
+Ġax is
+Ġs ess
 Ġp i
-Ġm d
-ge ther
-Ġy et
-Ġassess ing
-ici an
-Ġpock ets
-Ġalgorith m
-Ġassign ed
-Ġgerm an
-Ġan n
-Ġm c
-ol ith
-ot oxic
-Ġch i
-op s
-Ġsec tions
-ath ic
-Ġpreval ent
-Ġcent ers
-Ġfail ed
-ogen esis
-Ġfract ures
-erg y
-Ġrot ation
+Ġhigh light
+Ġsetting s
+Ġpredict or
+Ġro t
 Ġenh ance
-Ġchem ical
-Ġcond yle
-Ġbar ri
-1 6
-Ġt n
-Ġs uture
-Ġw ound
-Ġg a
-Ġsh e
-Ġpres ents
-Ġpr in
-Ġorth odon
-Ġresearch ers
-ym ph
-Ġel imin
-Ġestim ate
-Ġsuper im
-com it
-Ġmonit oring
-Ġabut ment
-Ġfibro bl
-Ġlongitud inal
-Ġextern al
-b le
-n el
-al le
-er ing
-at in
-Ġg ain
-os en
-Ġex cess
-Ġse pt
-Ġgr af
-Ġdevic es
-Ġprogram s
-Ġaim ed
-Ġsus cep
-Ġinser tion
-Ġobjec tive
-Ġirreg ular
-Ġsuscep ti
-b ack
-Ġc n
-or ph
-Ġb al
-Ġl act
-Ġn ear
-Ġwi l
-Ġcon ver
-Ġpar alle
-Ġrec ently
-olog ic
-Ġwe ighted
-Ġevalu ating
-Ġmost ly
-Ġcalc ulation
-Ġsimilar ly
-Ġdistrib uted
-Ġatt end
-Ġvi ability
-Ġaut o
-Ġansw ers
-Ġnetwor ks
-Ġarchw ire
-urs es
-Ġenrol led
-Ġlin ked
-Ġasym m
-Ġmanif est
-Ġglob al
-Ġfal se
-i tical
-p ut
-Ġs s
-ar ies
-Ġl ymph
-et ration
-Ġr ap
-Ġpro p
-Ġch osen
-Ġde b
-Ġqu al
-Ġam eric
-Ġmo lec
-Ġstr ati
-Ġappro val
-Ġtrans m
-Ġgr aft
-Ġcent r
-Ġpot entially
-Ġsuggest ing
-Ġpen etration
-Ġconfound ing
-Ġrespir atory
-b al
-Ġ ip
-Ġs d
-Ġs af
-er ve
-Ġin j
-Ġm ig
-Ġpro jec
-ot omy
-oc oc
-ub le
-Ġtr ue
-Ġpo ol
-Ġpain ful
-Ġfig ure
-Ġremo ve
-Ġbas is
-Ġcrown s
-Ġscre w
-Ġcomplete ly
-Ġhyper tension
-eu tic
-Ġcrow ding
-g f
-in ant
-Ġc m
-Ġc ause
-Ġre v
+ary n
+Ġes oph
+Ġadequ ate
+Ġeth ical
+Ġvalid ated
+Ġadh erence
+Ġm ix
+ph yl
+Ġclin ici
+Ġins u
+Ġch i
+Ġremo ved
+or ption
+Ġl um
+Ġdep th
+Ġsubst ant
+ch e
+Ġs ed
+Ġatt empt
+Ġgra ft
+Ġslight ly
+Ġstandard ized
+Ġwide ly
+om as
+if ically
+Ġpro x
+Ġproble m
+o un
+Ġwe ak
+ur ation
+Ġinc is
+Ġp olic
+Ġather oscler
+re ated
+Ġl ines
+Ġdetail ed
+Ġdiast olic
+Ġp t
+Ġt ake
+Ġb ow
+el i
+hy d
+Ġp ap
+Ġexhib ited
+Ġlimit ation
+Ġenh anced
+Ġk in
+Ġparticip ate
+Ġdifferent iation
+Ġerr or
+Ġrecommend ations
+Ġpredict ion
+Ġplate let
 Ġst e
-Ġst ar
+int estinal
+Ġt m
+op ro
+Ġcons ult
+1 2
+Ġpres crib
+r in
+Ġr t
+Ġinvestig ation
+Ġmin imum
+read y
+ri ef
+iv o
+Ġal ready
+or rh
+Ġp ass
+ke le
+Ġp ci
+Ġexpl ain
+ap se
+Ġr na
+kele tal
+Ġprot ective
+Ġan sw
+Ġe le
+Ġdep end
+Ġnaf ld
+Ġpr inc
+Ġsampl ing
+p r
+Ġfast ing
+Ġstatist ics
+Ġmark ed
+Ġstrain s
+Ġprovid ing
+Ġo il
+Ġw id
+Ġaltern ative
+Ġse ems
+Ġbenef its
+Ġant imic
+Ġmetabol ism
+Ġne xt
+Ġacc um
+Ġc all
+Ġmark er
 Ġst em
-iv ari
-Ġma king
-Ġclin icians
-Ġun cle
-Ġop ening
-Ġunder w
-Ġacti vation
-Ġprotocol s
-Ġsubs tit
-Ġsyndrom e
-Ġtrad itional
-Ġcentr if
-Ġuncle ar
-c ed
-Ġc ogn
-us p
-Ġl ps
+Ġeduc ational
+Ġreg ulation
+Ġantimic robial
+Ġspec ifically
+t ure
+Ġres ol
+Ġj ob
+Ġcompreh ensive
+Ġbow el
+Ġv s
+Ġcv d
+Ġgastro intestinal
+Ġak i
+Ġachie ve
+Ġv ivo
+Ġcalc ium
+Ġsaf e
+Ġtub e
+Ġfocus ed
+Ġsh if
+Ġs ections
+Ġ ide
+k n
+Ġg el
+Ġsubsequ ently
+Ġcirc um
+Ġresearch ers
+Ġstim ulation
+Ġcurrent ly
+Ġging ival
+ive ly
+Ġrad ical
+Ġp en
+re at
+p ath
+Ġj ap
+Ġprob ability
+Ġadv ant
+Ġne ar
+ag ed
+2 0
+Ġd ra
+Ġman if
+Ġhb a
+l ip
+of il
+Ġrati os
+ur g
+Ġre ceive
+c ers
+Ġg e
+Ġcol or
+Ġh ere
+Ġa ff
 ig en
-Ġv ary
-Ġbe g
-Ġgener ation
-Ġmicro le
-Ġem ph
-Ġrem ained
-Ġcorrel ations
-Ġrelationship s
-Ġfac ult
-Ġprof ile
-oid s
-Ġpros pective
-Ġreflec t
-Ġsumm ar
-Ġhouse hold
-Ġelig ible
-Ġcran io
-Ġaltern ative
-Ġaccum ulation
-r y
-Ġre pro
-Ġto gether
-Ġn iti
-ab ric
-ial ysis
-Ġpar ts
-Ġcons ult
-Ġrec all
-Ġclin ics
-Ġsub m
-Ġassess ments
-Ġsuc king
-Ġbr az
-Ġcompar ative
-Ġtrans formation
+ari able
+os ite
+Ġep is
+Ġinf usion
+Ġch est
+Ġmanif est
+Ġmucos a
+Ġmed iated
+Ġcomorbid ities
+ar s
+Ġ uc
+Ġestim ate
+Ġcr p
+Ġaut o
+Ġec onomic
+Ġens ure
+Ġsubgroup s
+Ġl ate
+Ġantib iotics
+Ġar m
+a ired
+Ġcar cinoma
+Ġp et
+Ġfam il
+Ġpath ological
+Ġs pl
+Ġthres hold
+Ġrepresent ative
+opath y
+Ġlink ed
+Ġme et
+Ġen ergy
+Ġameric an
+Ġsc i
+b l
+Ġend point
+Ġphysici an
+us e
+ati ves
+al s
+Ġp v
+Ġo h
+Ġde ep
+or ter
+id al
+Ġst ages
+Ġn ature
+Ġwh ite
+Ġbl ot
+Ġc and
+is ation
+w s
+ph al
+Ġs d
+Ġdr ink
+Ġat rial
+Ġpolym orph
+ell ing
+Ġsour ce
+Ġh t
+Ġup on
+g s
+Ġt ract
+Ġflu ores
+b y
+Ġd im
+g iv
+Ġt en
+Ġobes e
+Ġcomp li
+Ġkn ee
+Ġcommun ication
+Ġcomp et
+Ġcare giv
+Ġindic ators
 Ġbl ind
-Ġem p
-Ġplan ned
-Ġaffec ting
-Ġel der
-Ġoc clusion
-Ġmechan ism
-Ġmor tal
-Ġvalid ated
-Ġcap t
-Ġtum our
-Ġsw ed
-Ġintroduc ed
-Ġmut ans
-Ġoptim al
-Ġexist ing
-Ġdefin ition
-Ġepid em
-Ġunderw ent
-Ġmicrole akage
-Ġcranio facial
-Ġbraz il
-Ġs od
-Ġs ides
-Ġin equ
-Ġe ffici
-Ġn utr
-Ġg ut
-ter s
-Ġwh ose
-uc ial
-Ġco vari
-Ġinf erior
-Ġpartic les
-Ġcal ibr
-Ġpredic ted
-Ġpath way
-Ġoste obl
-Ġaut omatic
-Ġpattern s
-Ġtf ap
-Ġflex ural
-Ġshor ter
-Ġmortal ity
-1 0
-Ġa i
-er t
-Ġc all
-ic tion
-Ġl at
-Ġpre fer
-Ġac ute
-ary n
-ell a
-Ġro om
-Ġfin d
-Ġed ent
-Ġunder lying
-Ġscore d
-Ġtechn ology
-Ġcoun t
-Ġscal er
-Ġinvol ving
-Ġexperim ent
-Ġtherap eutic
-Ġsu itable
-Ġtip ping
-Ġta king
-Ġprec ise
-Ġadv anced
-Ġder ived
-Ġbrux ism
-Ġenti re
-Ġparalle l
-Ġinj ur
-r a
-t es
-Ġc c
-Ġm as
-or ation
-Ġre action
-Ġres tric
-Ġwe ak
-Ġcr ucial
-Ġdef ici
-ak ia
-Ġbas ic
-Ġunivers al
-Ġthrough out
-Ġiniti ally
+Ġbi o
+ogra m
+Ġepis od
+Ġh ence
+Ġcl us
+Ġst re
+Ġqual itative
+m ission
+Ġdescrip t
+Ġvi ability
+Ġnut rition
+am el
+Ġb rief
+Ġsu fficient
+Ġmin im
+f erence
+Ġval ve
+id ine
+Ġprofessional s
+Ġb inding
+k a
+l and
+Ġf et
+Ġint ensive
+Ġfem oral
 Ġcateg ory
-Ġattach ed
-ang u
-Ġact in
-Ġwee ks
-Ġpur pose
-Ġcalcul us
-Ġclean ing
-Ġreciproc ating
-Ġcentrif ug
-Ġfacult y
-o or
-Ġt ons
-Ġo wn
-Ġc v
-Ġh ere
-id ity
-Ġcomp uted
-Ġdif fer
-Ġcar cin
-Ġun its
-Ġen ergy
-Ġar ab
-Ġer os
-Ġins u
-Ġidenti fication
-Ġexp and
-ogn athic
-Ġele ment
-Ġmicrobi ome
-Ġmouthwas h
-Ġrepro duc
-n orm
-Ġc ore
-Ġb ilateral
-Ġe vent
-Ġst omat
-Ġg old
-Ġal read
-Ġch x
-Ġco urse
-Ġcan ines
-Ġthere by
-ens ile
-Ġover l
-Ġdisc rep
-Ġbec ome
-Ġdep end
-Ġaffec ts
-Ġcoun ts
-Ġparen tal
-Ġphys icians
-Ġadhes ion
-Ġpers onal
-Ġequ al
-ros is
-Ġcoll agen
-Ġthres hold
-Ġalread y
-p an
-r s
-y ag
-er v
-Ġal b
-Ġr s
-ot t
-Ġch ina
-Ġab norm
-Ġinter d
-olog ies
-ten ance
-Ġimp action
-Ġmain tenance
-Ġacti vities
-Ġexpl ore
-Ġrepresent ed
-Ġfluor id
-Ġbor ne
-Ġsubgroup s
-Ġmr na
-Ġinstit ution
-Ġaug mentation
-ivari ate
-Ġcogn itive
-d uce
-t m
-y g
-Ġt ext
-in o
-Ġd u
-Ġto m
-Ġcon e
-Ġco ord
-Ġpl ates
-Ġsub g
-iti z
-Ġparticip ating
-Ġdec id
-Ġradi ation
-Ġcer v
-Ġinstru mentation
-Ġhab it
-Ġcephal ogram
-Ġseg ment
-Ġviol ence
-Ġcard io
-Ġabr as
-Ġedent ul
-f y
-s tim
-u ary
-z ym
-Ġc ys
-Ġf abric
-Ġh our
-Ġas pect
-Ġr at
-ut ing
-Ġde pos
-Ġac cep
-ys tal
-ee k
-Ġcont ained
-cl ine
-Ġam pl
-Ġmicro organ
-Ġol ds
-Ġ0 5
-Ġrem ineral
-Ġcompl ain
-Ġanalyz e
-Ġsour ces
-Ġster ile
-Ġreach ed
-Ġconsequ ently
-Ġregen eration
-Ġdocu mented
-Ġcirc um
-Ġcyt otoxic
-Ġther m
-ochem ical
-Ġindepend ently
-Ġsept a
-Ġrap id
-w h
-Ġ ig
-Ġw nt
-Ġb es
-Ġre tain
-Ġh ome
-Ġe ating
-Ġr ated
-Ġco ated
-Ġpr f
-Ġph ases
-Ġuse ful
-Ġform s
-Ġcorre ction
-Ġbl ue
-Ġca rotid
-Ġposs ib
-Ġpath ology
-Ġcurrent ly
-Ġul cers
-to tic
-Ġrespons ible
-Ġdel i
-Ġsubst ance
-Ġtoothbrush ing
-Ġapop totic
-Ġelder ly
+Ġpositive ly
+Ġeth n
+Ġt urn
+Ġp m
+Ġparen ts
+Ġexc ess
+Ġf d
+Ġneu rolog
+g in
+Ġbi ofil
+Ġr ct
+iv ation
+Ġresist ant
+Ġorgan ization
+Ġinhibit ory
+Ġasp ects
+Ġk ore
+Ġpl us
+ast ic
+Ġs il
+th eless
+ic ations
+Ġar t
+Ġcand id
+Ġexperi ences
+Ġloc ated
+Ġnat ural
+Ġdig ital
+tern al
+Ġrepres ents
+Ġl ig
+Ġr h
+Ġde x
+Ġcar b
+Ġwa ve
+Ġnever theless
+Ġexist ing
+Ġorig in
+c ed
+u ce
+it u
+Ġimplement ation
+oc ation
+Ġcirrh osis
+Ġd en
+Ġattribut ed
+Ġsp ace
+er v
+Ġst ability
+Ġskill s
+Ġelig ible
+ra d
+Ġcomp r
+Ġto ler
+Ġal ign
+Ġlay er
+Ġc yst
+ur ance
+Ġh ouse
+ac es
+Ġvalid ation
+oglob in
+Ġinterview s
+b e
+Ġatt ention
+Ġle uk
+Ġn one
+Ġexpl an
+Ġresour ces
+Ġus ers
+Ġext re
+Ġischem ic
+Ġposs ibility
+Ġent ire
+Ġpred icted
+Ġang le
+Ġen amel
+Ġestab lish
+Ġmac roph
+Ġha em
+Ġin h
+Ġcyt otox
+ys is
+Ġplace ment
+Ġimp aired
+Ġdo ct
+Ġimpro ving
+Ġsin us
+Ġsupport ed
+age al
+un e
+Ġemot ional
+r up
+y ing
+g t
+Ġcoll agen
+Ġgerm an
+l s
+Ġb en
+Ġassess ing
+ur b
+Ġvari ance
+Ġcent r
 Ġsod ium
-Ġtons ill
-Ġcerv ical
-Ġcardio vascular
-d en
-Ġb ox
-ac ity
-Ġpro tr
-ot om
-Ġde grad
-Ġtreat ing
-Ġinter face
-Ġk it
-Ġobser ver
-Ġmin imal
-Ġimp a
-Ġet ching
-Ġset up
-Ġfam il
-Ġutil ized
-Ġantibiotic s
-Ġcandid a
-opl akia
-Ġtn f
-d m
-Ġt ensile
-Ġd ate
-Ġm ic
-Ġm ix
-ac ing
-om al
-Ġv as
-Ġr d
-Ġro b
-Ġcr itical
-Ġsp ss
-Ġcomm erc
-Ġprob e
 Ġprob ably
-Ġcoun ter
-ste ad
-Ġgl ands
-Ġdire c
-Ġfl oor
+lo ad
+i ately
+Ġm is
 Ġestim ates
-Ġirr igation
-Ġfew er
-Ġphosph ate
-Ġrecommend ations
-opath ological
-Ġplas ma
-Ġcalibr ated
-Ġsubg ingival
-Ġdecid uous
-Ġimpa ired
-b o
-j et
-r yl
-Ġth in
-Ġw es
-Ġin stead
-Ġf sc
-Ġm ap
-Ġm ental
-ly s
-Ġv ital
-Ġr ins
-ire ct
-Ġen zym
-Ġsec re
-Ġvis ible
-Ġos a
-Ġlead s
-Ġdispl ayed
-Ġadjus ting
-Ġclos ed
-Ġact ual
-Ġmark ed
-Ġdetail s
-Ġcoll ab
-Ġprinc ip
-Ġanch orage
-Ġinfil tration
-Ġcolle ge
-Ġleuk oplakia
-Ġfibrobl asts
-Ġmig ration
-Ġfsc n
-in ding
-al low
-er i
-Ġd rop
-it us
-it ation
-Ġcon st
-Ġinc om
-Ġhe at
-ch a
-ist ent
-ens us
-Ġ1 6
-Ġorth ognathic
-Ġfl oss
-Ġpracti tion
-Ġsequ ences
-Ġapproach es
-Ġsw elling
-Ġ20 2
-Ġcontin u
-Ġregard less
-Ġcycl es
-Ġcov ered
-Ġdrug s
-Ġwr it
-Ġactin omy
-v a
-Ġs ut
-Ġan a
-or able
-ic ated
-Ġst atic
-Ġn ull
-Ġind igen
-Ġcont amination
-Ġanalys ed
-Ġincl ination
-Ġk er
-Ġover jet
-Ġj ust
-Ġcharacter ized
-br id
-ie f
-Ġrequ ires
-Ġpredic tive
-Ġerr ors
-Ġstrong ly
-Ġexam ine
-Ġceramic s
-Ġcond yl
+Ġsqu are
+ly cem
+Ġg c
+n el
+Ġoper ating
+th e
+Ġp ac
+Ġcur ves
+Ġimmed iately
+Ġinclud es
+Ġrandom ly
+Ġpract ices
+Ġun its
+Ġobserv ational
+Ġth or
+Ġtherap ies
+w ise
+am p
+Ġsitu ation
+Ġh ab
+l r
+Ġrespons ible
+Ġy et
+Ġhy gi
+Ġst en
+olog ists
+Ġmed ia
+Ġaccur ate
+on ic
+Ġprox imal
+ly cer
+Ġsmall er
+Ġind uce
+b c
+ens us
+Ġam i
+Ġhypoth esis
+Ġint ubation
+Ġnec k
+Ġser ious
+Ġp el
+Ġadd ress
+Ġcer v
+Ġstat es
+Ġexpl ore
+Ġprovid ers
+Ġstratif ied
+Ġo wn
+Ġprocess es
+Ġh p
+Ġg i
+Ġadjust ment
+Ġas c
+Ġfat ig
+Ġocc up
+b b
+Ġmo vement
+Ġresid ual
+ve olar
+Ġsal ine
+Ġph ot
+Ġenzym e
+Ġmatch ed
+ven ous
+ann ed
+o ly
+Ġtrans l
+k ing
+g a
+Ġsim ple
+Ġw ar
+Ġpl ates
+Ġpre fer
+Ġacup uncture
+Ġobject ive
+Ġexp ect
+Ġcharacter ized
+Ġh ard
+Ġcompli ance
+Ġc ause
+Ġro c
+Ġex act
 Ġiss ues
-Ġminiscrew s
-istr y
-Ġdegrad ation
-Ġindigen ous
-d l
-u an
-in ary
-Ġp ds
-Ġw ind
-Ġst ored
-Ġl angu
-Ġg ly
-oc om
-Ġinc id
-em ia
-Ġpos ts
-ch ild
-Ġvari ed
-Ġbi o
-Ġbi ops
-tis ts
-Ġj ud
-Ġstandard s
-Ġoccur s
-Ġschool child
-Ġinvol vement
+Ġw rit
+Ġdem ent
+Ġur inary
+opro tein
+Ġsh a
+Ġreli able
+Ġj an
+Ġchem ical
+Ġemploy ed
+Ġcav ity
+Ġdocument ed
 Ġul cer
-Ġpow ered
-Ġta ke
-Ġrot ary
-Ġenh anced
-Ġconcer ning
-ung al
-Ġundergo ing
-Ġodont ogenic
-Ġeffici ency
-Ġgut ta
-Ġcoord in
-Ġaccep ted
-Ġmicroorgan isms
-Ġbes ides
-Ġconst ant
-Ġwrit ten
-Ġwind ow
-c et
-p al
-u ate
-Ġo u
-Ġc reat
-es thes
-Ġst aff
-Ġl ost
-Ġn h
-Ġwi re
-Ġcon cept
-Ġco ating
-Ġsur round
-Ġ2 00
-Ġhy brid
-Ġposs ibility
-Ġprocess es
-Ġrandom ization
-Ġoper ation
-Ġconsist ency
-Ġcap acity
-Ġlay ers
-Ġclear ly
-Ġbenef its
-Ġasymm etry
-Ġameric an
-Ġinsu fficient
-Ġfamil ies
-Ġwes tern
-Ġschoolchild ren
-Ġp eek
+Ġc um
+Ġpredict ing
+Ġmalign ant
+Ġexam ine
+Ġintra venous
+Ġsoci ety
+Ġt it
+Ġinhibit or
+Ġgen otype
+Ġrefer red
+Ġd on
+Ġpro ject
+Ġpregn ant
+Ġreg ional
+Ġcorrel ations
+Ġsurv iv
+Ġprod uced
+Ġpneum onia
+Ġresid ents
+Ġfatig ue
+Ġprolong ed
+Ġcell ular
+e a
+Ġb ed
+Ġradi ograph
+Ġl as
+Ġcerv ical
+Ġinflu enced
+Ġcomp osition
+Ġf il
+y g
+Ġ1 2
+ra ms
+Ġdis cr
+Ġrisk s
+Ġl ps
+im e
+Ġmult i
 Ġm ell
-is al
-Ġh orm
-Ġh ost
-ul ating
-Ġn av
-Ġpro duce
-Ġac ad
-Ġass isted
-Ġind ent
-Ġind irect
-Ġpl astic
-Ġup on
-Ġdiagnos es
-Ġz inc
-Ġmechan isms
-Ġfunc tions
-Ġvol un
-Ġalign ment
-Ġseg ments
-Ġax ial
-Ġansw er
-Ġsepar ately
-Ġic d
-Ġadvant age
-Ġsurge on
-Ġstrati fied
+Ġgra du
+Ġha z
+Ġop i
+Ġh iv
+ul ative
+Ġmeas uring
+Ġinvol ving
+Ġpublic ation
+t a
+Ġinf ected
+Ġexp ress
+Ġf r
+Ġal g
+Ġperiod s
+Ġful ly
+itud inal
+Ġrang ing
+Ġbenef icial
+Ġcent ers
+n as
+Ġem ph
+Ġexperim ent
 Ġmell itus
-m ic
-Ġt or
-re es
-Ġth ink
-Ġs bs
-Ġd en
-Ġb s
-ac es
-Ġl isted
-Ġr p
-Ġex act
-Ġex clud
-Ġde form
-Ġdis p
-Ġmod ulus
-Ġcal ibration
-Ġindic ator
-Ġchan ged
-cr ip
-Ġsal ine
-Ġser ies
-Ġdr ied
-Ġrece ive
-Ġstress es
-Ġte am
-fact ory
-Ġinhib ition
-Ġelectr onic
-Ġmagn ification
-fe eding
-Ġbreast feeding
-Ġdiet ary
-Ġcompr ised
+s ide
+en ia
+eren t
+Ġib d
+Ġabs orb
+Ġex ternal
+Ġinhibit ors
+on in
+Ġbu ffer
+Ġro s
+Ġcomplic ation
+id ed
+Ġdo uble
+Ġp ol
+se cut
+Ġrep air
+Ġsens itive
+Ġrecru ited
+Ġmin or
+Ġpurp ose
+Ġpool ed
+Ġtrans f
+Ġinser tion
 Ġeurope an
-Ġtonsill olith
-Ġnav igation
-b ac
-f ric
-p end
-Ġc s
-Ġc usp
-Ġto bac
-Ġn erve
-Ġg raph
-ab ony
-Ġal ways
-Ġper f
-Ġsc oring
-ill ary
-Ġdenti fric
-Ġag ents
-Ġsp read
+Ġsh orter
+Ġpl ane
+Ġconsist ed
+Ġcon secut
+Ġm ouse
+Ġa a
+Ġquestionna ires
+Ġhaz ard
+Ġmorbid ity
+p ase
+Ġc at
+Ġaim ed
+och ond
+Ġcb ct
+Ġdement ia
 Ġmater nal
-ll ent
-Ġinflu encing
-Ġdiscus sed
-Ġpath ogens
-Ġoste ocl
-Ġadhes ives
-Ġmem bers
-Ġlab ial
-Ġtip s
-Ġallow ed
-ogene ous
-Ġadmin istered
-Ġexce llent
-Ġstrateg ies
-Ġimple mented
-Ġlig ament
-Ġadjust ment
-Ġalter ations
-Ġabund ance
-Ġcn n
-Ġdeb onding
-Ġemph as
-Ġpossib ly
-Ġtobac co
-i ans
-Ġ ide
-ti ous
-Ġc rest
-Ġm astic
-Ġm ta
-Ġb is
-Ġh oc
-it ted
-Ġn ar
-Ġg re
+Ġthrough out
+Ġm p
+as h
+as ia
+id s
+Ġpart ial
+Ġpromot e
+Ġf lex
+Ġevalu ating
+Ġlong itudinal
+Ġcomp ut
+Ġdetail s
+Ġse em
+gro und
+Ġhygi ene
+Ġequ al
+Ġinstitut ional
+el ing
+Ġre pro
+Ġmat r
+Ġrec onstr
+crip t
+1 0
+ra ction
+Ġnum er
+Ġjan uary
+Ġst ained
+Ġmm p
+Ġmut ations
+um ents
+Ġcho ice
+Ġn m
+Ġdimens ions
+atin ine
+ic ular
+t ake
+Ġv ar
+Ġpresent ation
+Ġinhib ited
+Ġunt reated
+oty pes
+Ġana es
+Ġalg or
+Ġill ust
+Ġback ground
+Ġcre atinine
+Ġalgor ith
+ir ing
+Ġvac c
+Ġper f
+Ġfat ty
 Ġg et
-ol uc
-od ies
-Ġor d
-Ġwh y
-Ġex c
-Ġinc ons
-Ġdent ures
-por ted
-em comit
-Ġmod alities
-Ġag g
-Ġradi oluc
-Ġsp e
-Ġorthodontic s
-Ġprim er
-Ġdetec ting
-Ġintr abony
-Ġplan es
+um ab
+Ġallow ed
+Ġtw ice
+Ġ2 00
+Ġconcer ning
+str uction
+Ġabnormal ities
+Ġr ural
+Ġtrans port
+Ġc k
+Ġun c
+Ġrest or
+Ġve in
+Ġch lor
+Ġreview ed
+Ġtr i
+Ġcharacterist ic
+Ġgener ated
+Ġur ine
+Ġatt ach
+Ġbre ath
+Ġassign ed
+Ġinf erior
+Ġman ner
+Ġdemonstr ate
+Ġmig ration
+Ġ ure
+ul l
+Ġpred om
+Ġv ital
+Ġt ip
+Ġout patient
+Ġparticip ation
+Ġle g
+ic ated
+Ġv ary
+Ġag ent
+anc ies
+Ġcoe fficient
+Ġc c
+it able
+Ġg er
+Ġbec ome
+Ġcereb ral
+Ġext ensive
+Ġinstr uction
+omet ry
+Ġped iatric
+im es
+Ġalb umin
+Ġrem ission
+Ġib s
+Ġform ula
+Ġbehavi ors
+ill ed
+Ġdistribut ed
+Ġmut ation
+Ġsequ ence
+v ascular
+Ġcol lect
+Ġstrong ly
+Ġn ow
+ro g
+Ġinc or
+Ġinfilt ration
+Ġculture d
+Ġe g
+oc oc
+Ġcount ry
+Ġt ert
+Ġinterpre t
+Ġsummar ized
+in ct
+Ġmultiv ariable
+Ġincub ation
+it one
+Ġsc oring
+Ġposs ib
+Ġprinc ip
+Ġapproach es
+om al
+Ġmolar s
+Ġne ur
+Ġhist opath
+Ġmain tained
+Ġv ert
+Ġexc lud
+c ents
+Ġmetast asis
+Ġcentr if
+Ġtum our
+Ġent er
+e ed
+Ġal veolar
+Ġd p
+Ġinit iation
+im m
+Ġtox icity
+Ġbiomark ers
+v ant
+Ġmucos al
+Ġdire ction
+itt le
+Ġno vel
+Ġdel ayed
+y e
+Ġrelationship s
+Ġaut om
 Ġlif est
-Ġsequ encing
-Ġcult ured
-Ġcomplex ity
-Ġhypoth es
-Ġsr p
-Ġbene ficial
-Ġinser ted
-Ġassum ed
-Ġtub e
-Ġdebr is
-Ġskill s
-Ġeti ology
-Ġactinomy cet
-Ġcondyl ar
-Ġactinomycet emcomit
-k now
-t osis
-Ġt ap
-Ġthe ore
-Ġo x
-Ġd il
-le t
-Ġe mo
-et ric
-am ine
-Ġdent ure
-Ġha art
-Ġy our
-Ġam ino
-Ġk ap
-Ġdisc om
-Ġinvestig ations
-Ġpath ological
-Ġreve al
-Ġdistal ization
-Ġprote ins
-Ġpros thetic
-Ġsepar ate
-Ġsil ic
-itud e
-Ġexplan ation
-Ġbeg in
-Ġtom ography
-Ġactinomycetemcomit ans
-1 5
-c a
-d ps
-f fered
-o ad
-v able
-Ġf un
-Ġl s
-Ġn ature
-Ġwas h
-od em
-Ġper cha
-Ġr ad
-Ġincre ment
-Ġover bite
-Ġcr ystal
-Ġsim ulated
-Ġimpro ving
-Ġacti vated
-Ġflu orescence
-Ġpercent ages
-Ġpubl ication
-Ġfe ature
-Ġmat uration
-Ġeffective ly
-Ġcult ural
-Ġbo ard
-Ġmark ers
-Ġstim ulation
-Ġelectr on
-Ġimmedi ate
-Ġemerg ency
-Ġbenef it
-Ġstre pt
-Ġsubstanti al
-lys is
-Ġincom ple
-s ink
-in f
-Ġp is
-or ts
-us e
-ec ted
-if ier
-ati te
-Ġpro ved
-Ġres idence
-Ġres olution
-Ġat ten
-enti a
-Ġacc om
-Ġwe bs
-Ġen l
-Ġdes tr
-Ġj oint
-oun ts
-Ġdep ending
-Ġdr in
-Ġconsider ation
-Ġps or
-ne y
-Ġsoci odem
-Ġcompl iance
-Ġscan ned
-Ġhospital s
-Ġhel sink
-Ġpd t
-Ġseal ing
-Ġele vated
-Ġenvironment al
-Ġpol ic
-Ġeas ily
-Ġcho ice
-Ġmanufact ure
-Ġpool ed
-Ġste el
-Ġprefer red
-esthes ia
-Ġdiscom fort
-Ġincomple te
-Ġhelsink i
-d e
-n ish
-r up
-w ide
-Ġ uc
-Ġa h
-ed ed
-Ġp ac
-Ġan omal
-at ch
-ro tic
-Ġst art
-om andibular
-Ġn ame
-Ġg c
-ati ves
-res h
-Ġr as
-Ġbe am
-Ġis ch
-em a
-Ġob vious
+Ġn h
+ov a
+Ġdis cre
+Ġactiv ated
+Ġcum ulative
+Ġaware ness
+Ġcons ensus
+Ġt ask
+Ġmeth yl
+Ġadoles cents
+Ġcov ari
 Ġvari ability
-acter ial
-Ġso und
-Ġcontrol ling
-Ġmo bility
-Ġsim ult
-Ġcur ves
-Ġvis ited
-ulti es
-Ġradiograph y
-Ġca v
+Ġbas ic
+Ġclear ly
+Ġso uth
+ut es
+Ġsecre tion
+Ġreach ed
+Ġmit ochond
+i o
+Ġclinici ans
+Ġg ap
+Ġfail ed
+Ġinteresting ly
+q ol
+Ġbr ush
+Ġl ittle
+Ġsten osis
+Ġst ated
+Ġindic es
+Ġabs ol
+Ġap ical
+Ġinjur ies
+Ġn a
+Ġcomp uted
+Ġabsol ute
+os en
+Ġmatr ix
+Ġro b
+we ight
+Ġs keletal
+Ġins urance
+d h
+Ġmorph ology
+Ġwrit ten
+Ġh ar
+Ġbi ochemical
+Ġstruct ures
+Ġvir us
+r m
+Ġsuscept ibility
+Ġprog rams
+Ġdat as
+r ant
+s is
+rot id
+Ġto m
+et ics
+ph a
+Ġa ust
+Ġgu ide
+Ġepid emi
+Ġch d
+Ġun cle
+Ġf ar
+op e
+Ġasp ir
+Ġsu ffer
+Ġrecru it
+Ġpr iv
+Ġbal ance
+Ġc ro
+Ġven ous
+Ġam b
+Ġw ard
+roph il
+Ġint r
+r um
+Ġas ym
+Ġadjust ing
+Ġcomp l
+Ġuncle ar
+Ġsyn thesis
+Ġfra il
+Ġar r
+Ġoc clus
+Ġdescript ive
+Ġs ul
+Ġhyp ox
+Ġte ach
+Ġnot e
+Ġcr uc
+Ġam in
+Ġregard less
+Ġres in
+in ess
+as ter
+Ġg p
+Ġl ang
+Ġpro st
+Ġcategor ical
+Ġaf ric
+Ġir an
+Ġpsych iatric
+r ich
+Ġfra m
+Ġb ase
+Ġre h
+Ġdef iciency
+Ġregist ered
+Ġrest ric
+Ġinvas ion
+ic le
+Ġwor se
+Ġconcer n
+Ġexam inations
+Ġret urn
+Ġinteract ions
+Ġsept ic
+Ġaccum ulation
+Ġcentrif ug
+Ġsp ont
+Ġdisc ont
+5 3
+m ark
+ire ct
+Ġrev ision
+at itis
+Ġb es
+Ġn ame
+m ia
+Ġch osen
+Ġdep ending
+Ġauth or
+Ġspont aneous
+Ġgl ut
+m ic
+Ġatheroscler osis
+Ġendoscop y
+i ents
+Ġsu ic
+Ġgener ation
+h d
+act ive
+Ġcl a
+Ġepith elial
+Ġmost ly
+Ġd uct
+ill in
+Ġcal ib
+Ġdis p
+Ġn an
+Ġrec urrent
+Ġsp inal
+Ġper man
+Ġf ile
+Ġpract ition
+n p
+or able
+Ġreg ulated
+of ol
+Ġd erm
+Ġdiagn oses
+Ġtrans form
+Ġoste op
+Ġneurolog ical
+Ġregist ry
+Ġte le
+ox ide
+Ġtool s
+Ġs s
+Ġup take
+Ġcalc ulation
+Ġd s
 Ġdeterm ination
-Ġsol utions
-Ġdig it
-Ġdescrip tion
-Ġchallen ging
-Ġiss ue
-Ġadvant ages
-Ġappoint ment
-Ġdecl ar
-Ġcytok ines
-Ġorthodon tists
-Ġconsult ation
-Ġstrept ococ
-Ġsociodem ographic
-Ġsimult aneous
-o in
+Ġsour ces
+Ġcomp osite
+Ġvessel s
+Ġsaliv a
+last s
+Ġpers ons
+Ġb urn
+Ġf ix
+Ġfol d
+Ġconc luded
+p art
+Ġanalys ed
+Ġphosph ory
+Ġrepresent ed
+Ġtechn ology
+Ġm ill
+Ġtreat ing
+Ġher bal
+id emia
+Ġphys iological
+ent an
+Ġc ement
+Ġdist ress
+Ġbo ard
+ag ulation
+Ġinit ially
+Ġs em
+Ġrel apse
+Ġtra ined
+Ġsex ual
+r t
+roph y
+Ġdem ograph
+Ġ id
+Ġhemod ynamic
+Ġse e
+Ġcategor ized
+Ġconfound ing
+Ġaffect ing
+Ġab lation
+Ġsurf aces
+Ġf ear
+Ġpe pt
+Ġthere by
+cut aneous
+Ġbehavi our
+f act
+Ġac s
+Ġbarri ers
+ra y
+Ġtarget s
+Ġcas pase
+g ed
+Ġstandard s
+Ġmin imal
+en u
+Ġnec rosis
+Ġmain ten
+Ġhem orrh
+Ġlifest yle
+Ġmainten ance
+Ġtrans fusion
+Ġrefer ral
+Ġatt enu
+Ġob vious
+Ġsm o
+Ġcr c
+Ġind irect
+Ġs f
+Ġocc urs
+Ġeff ort
+Ġrang ed
+Ġsub sc
+Ġconsecut ive
+Ġf ore
+Ġb uc
+Ġl ap
+Ġdev ices
+Ġbet a
+Ġfunction s
+Ġec g
+Ġre verse
+Ġpur ch
+Ġprescrib ed
+Ġh u
+Ġp ack
+Ġdispl ayed
+Ġp bs
+Ġprop ofol
+Ġad op
+Ġact ual
+ad der
+Ġmod e
+e ad
+Ġind eed
+Ġy ield
+Ġcohort s
+Ġanat om
+Ġop port
+Ġdom ains
+Ġcolle ag
+Ġfacil ities
+Ġbro ad
+ish ed
+Ġischem ia
+1 6
+Ġpresent ing
+Ġradi ation
+Ġopport un
+Ġpercept ion
+Ġperman ent
+Ġd os
+Ġd c
+Ġcr an
+Ġpa per
+Ġpossib ly
+Ġlang u
+Ġrequ iring
+Ġdi ed
+Ġca rotid
+ut ions
 Ġc i
-ent y
-Ġh g
-id ge
-Ġreg istration
-Ġinter pro
-Ġun li
-ast om
-lec t
-Ġcol d
-Ġmin i
-Ġop tions
+Ġanalyz e
+Ġdis ability
+m et
+er ative
+Ġcruc ial
+Ġdep ressive
+Ġneut rophil
+Ġgly c
+Ġlact ate
+b le
+Ġdemograph ics
+c us
+Ġprotocol s
+Ġbe gin
+Ġec m
+Ġopt im
+Ġmole c
+Ġdiscont inu
+Ġl ar
+g er
+Ġhepat itis
+Ġg over
+oh ist
+ore ctal
+Ġse al
+Ġpan el
+y c
+om it
+Ġequ ip
+Ġal ways
+olog ies
+Ġsusp ected
+Ġplan ning
+Ġst rict
+ch ing
+Ġdent ists
+Ġtr ue
+Ġa ug
+Ġwh om
+Ġbiofil m
+Ġe a
+Ġstim ul
+Ġth ink
+Ġa er
+d ed
+Ġg as
+i i
+Ġpul p
 Ġimplant ation
-Ġloc k
-Ġdeterm ining
-Ġapp lying
-Ġcy cle
-Ġoper ating
-Ġmat ched
-Ġexperim ents
-Ġantib acterial
-Ġconstr iction
-Ġorgan ization
-Ġethnic ity
-Ġtur n
-Ġcarb on
-Ġmetabol ic
-Ġann ual
-Ġcarcin oma
-Ġcephalogram s
-Ġunli ke
-c ation
-d om
-g ent
-h ood
-t reatment
-Ġo ro
-Ġf erm
-Ġn urses
-ab il
-Ġpro ph
-Ġde h
-Ġde formation
-Ġat tr
-Ġass ist
-Ġne ither
-Ġclin ician
-Ġdec ay
-Ġperiodonti um
-Ġj ap
-Ġdem entia
-Ġintr ac
-Ġrem od
-ob ic
-Ġgl and
-Ġoste oc
-Ġabs orb
-Ġpa ired
-Ġwork ers
-Ġrecor ding
-Ġbelie ved
-Ġmac ro
-Ġdys plasia
-Ġaff ili
-Ġnumer ous
-Ġinteresting ly
-Ġip v
-Ġlangu age
-Ġdeclar ation
-Ġferm t
-Ġproph yl
-k t
-Ġt ask
+Ġshif t
+Ġexper t
+Ġbil ateral
+Ġr un
+Ġcomplete ly
+Ġtransplant ation
+Ġg all
+Ġr ating
+Ġmean ing
+re l
+Ġinst ead
+Ġd rop
+Ġto o
+Ġrepl acement
+Ġmed i
+Ġimmun ohist
+Ġechocardi ography
+Ġal pha
+Ġappro val
+y cin
 Ġs y
-Ġs ed
-ti le
-Ġc ity
-Ġp t
-ic es
-Ġe fficient
-Ġl ink
-om ia
-Ġg eri
-Ġme et
-Ġat tem
-Ġac tion
-Ġdent o
-Ġk in
-Ġrisk s
-pos es
-Ġdisc s
-Ġtrans port
-Ġrece pt
-Ġdecre ases
-Ġdist in
+Ġintro d
+Ġassess ments
+Ġcolleag ues
+ogen ous
+Ġo m
+Ġan ova
+Ġcle an
+Ġf er
+Ġreact ive
+Ġclus ter
+Ġcro wn
+Ġneed le
+Ġsmok ers
+olog ist
+Ġg ain
+Ġpre t
+Ġsch ed
+Ġt t
+Ġreview s
+Ġfac ial
+Ġdom ain
+Ġtra che
+Ġwash ed
+Ġacqu ired
+ud e
+Ġfor ms
+us ed
+Ġfew er
+Ġa uc
+Ġch art
+Ġpl ays
+Ġbes ides
+Ġutil ization
+Ġvert ical
+Ġtransfer red
+5 0
+Ġstart ed
+Ġrel ie
+Ġb ile
+w ide
+Ġapopt otic
+Ġhorm one
+Ġinstruction s
+Ġgover n
+Ġparamet er
+Ġir on
+Ġhypoth es
+Ġaust ral
+b an
+Ġn ar
+Ġass ays
+ery th
+Ġhem oglobin
+Ġgr an
+Ġak t
+Ġmacroph ages
+Ġdecl ine
+Ġcs f
+Ġchallen ges
+Ġsubstant ial
+ed ed
+Ġhb v
+gf r
+Ġfl av
+2 1
+pl asia
+Ġty pical
+Ġappear s
+iv ing
+Ġpolic y
+eli hood
+Ġd u
+Ġcon ver
+Ġwh ose
+Ġf und
+Ġperform ing
+Ġrem ain
+Ġscore d
 Ġfe as
-Ġirr ig
-Ġte ach
-Ġcommun ication
-Ġvir al
-ocy tes
-Ġmicroscop e
-Ġapop tosis
-Ġdebr ide
-Ġblock s
-Ġrc ts
-Ġadop ted
-Ġexcess ive
-Ġcovari ates
-Ġsut ures
-Ġpsor iasis
-Ġgeri atric
-Ġc ure
-Ġin st
-es ted
-Ġd b
-an ted
-Ġb ott
-ec al
-Ġg ap
-Ġg ive
-Ġv ide
-Ġal le
-ir ing
-Ġsign ed
-Ġanal ges
-Ġmod ality
-ach e
-Ġcons ists
-Ġinclud es
-ew or
-Ġmed ication
-Ġcell ular
-Ġaccording ly
-Ġdem and
-Ġprob iotic
-Ġform ula
-Ġop md
-Ġinvestig ating
-Ġpred om
-Ġoper ators
-omet ry
-Ġcontr ary
-Ġret ur
-Ġbin ary
-Ġfore ign
-Ġcre ate
-Ġepidem iological
-Ġdefici ency
-Ġoro facial
-Ġdebride ment
-Ġa id
-Ġs ent
-Ġin jec
-Ġm ad
+Ġch ol
+itud es
+Ġlik elihood
+Ġtrig lycer
+Ġtom ography
+Ġst om
+Ġpreval ent
+Ġwid th
+Ġm il
+Ġrequ ires
+Ġinstr uments
+Ġpro phyl
+Ġantic o
+Ġp il
+Ġcount s
+ot t
+Ġret ention
+Ġeth anol
+Ġvari ations
+Ġc ore
+Ġinsu fficient
+Ġst ored
+n at
+Ġcent re
+Ġsocio ec
+Ġreact ions
+Ġlas er
+Ġcomput er
+Ġhydro x
+Ġl t
+roscop ic
+it ary
+Ġas t
 Ġh arm
-Ġfor am
-Ġv s
-ad vant
-Ġde ath
-Ġde pression
-pl ant
-Ġac ce
-Ġdis advant
-Ġsh if
-Ġad here
-Ġno vel
-Ġk n
-Ġperform ing
-Ġparticip ation
-port un
-Ġtrans verse
-Ġop tion
-Ġop portun
-Ġdi vers
-Ġimp air
-Ġmet al
-Ġfrequ encies
-Ġremo ving
-Ġdo uble
-Ġpla ys
-Ġdist ances
+ari an
+Ġindic ator
+Ġguid ed
+Ġopt ions
+lycem ia
+Ġse ek
+ific ations
+Ġerr ors
+Ġ eryth
+Ġt p
+Ġpar al
+Ġdel ay
+Ġcrit ically
+is ter
+Ġper fusion
+Ġelect ronic
+Ġsu itable
+Ġcovari ates
+Ġesoph ageal
 Ġnegative ly
-Ġcaus al
-Ġallow s
-Ġstep s
-Ġster oids
-Ġalgorith ms
-Ġenc our
-grad uate
-Ġsignal ing
-Ġsuperim position
-Ġmanifest ations
-Ġisch emic
-Ġforam en
-a wn
-o le
-p r
-s et
-Ġth or
-Ġo a
-er ost
-Ġp ack
-Ġin h
-Ġf resh
-Ġd g
-Ġd ich
-Ġb reat
-it ative
-Ġcomp rom
-ff er
-Ġpres er
-Ġcons ensus
-Ġbl ack
-Ġmain land
-Ġincis al
-Ġear r
-Ġpredic tor
-Ġos se
-Ġhist opathological
-over y
-Ġsurve ys
-Ġdiffic ulties
-Ġpers ons
-Ġext re
-Ġsyn thesis
-Ġele ments
-eed back
-Ġsk in
-Ġchallen ge
-Ġappoint ments
-Ġretr ie
-Ġprognos is
-Ġisol ated
-Ġpp d
-Ġmonom er
-Ġalloc ation
-Ġlith uan
-Ġbarri ers
-Ġnear ly
-Ġarab ic
-Ġker atin
-Ġkap pa
-b an
-Ġo m
-Ġin ade
-Ġre in
-it ol
-Ġst orage
-ul ner
-od e
-Ġv ascular
-Ġr are
-Ġr ct
-Ġdent inal
-vel ength
-ight ing
-Ġam el
-Ġar ter
+Ġconsequ ently
+Ġanatom ical
+Ġm oth
+Ġdist urb
+Ġcl ar
+Ġp ay
+Ġj a
+Ġchang ed
+omp an
+Ġfluores cence
+Ġsurviv ors
+Ġreh abil
+ot omy
+Ġexp ans
+Ġcoll ab
+ing u
+av es
+Ġparticip ating
+Ġde cem
+Ġman ual
+Ġdecem ber
+Ġacc ompan
+Ġh or
+Ġs izes
+Ġsocioec onomic
+y thm
+Ġs r
+om er
+Ġr ated
+a i
+ult aneous
+Ġv ag
+ff ered
+Ġsim ultaneous
+Ġalle le
+ach e
+Ġrecruit ment
+rh ythm
+Ġosteop or
+Ġmoth ers
+i op
+Ġpredom inant
+em ents
+Ġdef ects
+Ġemph as
+o z
+Ġw al
+Ġsubject ive
+Ġq ol
+Ġn c
+om eter
+Ġocclus al
+Ġs low
+av en
+erg ic
+Ġhc v
+Ġpersist ent
+Ġc f
+ain e
+cer tain
+Ġsepar ately
+Ġangi ography
+Ġh our
+Ġpath ogenesis
+Ġpa ir
+Ġnucle ar
+Ġelev ation
+Ġpres cription
+Ġend omet
+d uc
+Ġdeath s
+Ġinstit ute
+Ġlap a
+Ġca pt
+Ġcaregiv ers
+Ġf ed
+Ġbm d
+Ġvir al
+Ġd op
+Ġa es
+Ġres us
+Ġinf ect
+Ġtrans cription
+Ġeffective ly
+Ġd rain
+Ġperi operative
+Ġanalges ia
+g ments
+Ġpurch ased
+Ġun kn
+Ġavail ability
+Ġvari ety
+Ġo ct
+Ġdifficult y
+li ke
+Ġidentify ing
+Ġte xt
+Ġconcer ns
+ar in
+Ġresp ective
+Ġexpans ion
+Ġsc aven
+Ġelect ro
+Ġsub m
+Ġunkn own
+Ġobserv ations
+le ts
+al ities
+Ġb d
+Ġur ban
+Ġfet al
+Ġh oc
+k al
+Ġre ag
+Ġan e
+Ġcol orectal
+Ġr he
+Ġlangu age
+Ġphen omen
+lip idemia
+Ġb all
+Ġn s
+g l
+Ġstruct ural
+Ġthough t
+Ġinteg r
+Ġexplan ation
+od en
+p ectively
+at ically
+Ġm b
+Ġabsorb ance
+Ġthe rm
+Ġwith d
+Ġlip oprotein
+Ġp yl
+Ġpart s
+Ġend oc
+Ġar rest
+Ġappe ared
+Ġp f
+Ġf t
+Ġs bp
+ac ic
+iss ions
+Ġdiscuss ed
+Ġbr an
+Ġpel v
+ur ys
+Ġprim arily
+Ġsw ed
+Ġli qu
+Ġeff iciency
+Ġad ren
+Ġenzym es
+is a
+Ġb ond
+Ġins p
+Ġrct s
+Ġo ption
+o ff
+Ġcardi omy
+Ġcod es
+3 8
+Ġun like
+Ġcytok ine
+Ġrehabil itation
+Ġcult ural
+g g
+Ġun i
+Ġenvironment al
+o on
+Ġst op
+Ġcult ures
+Ġreg imen
+Ġh d
+ent er
+Ġwh y
+Ġimmun os
 Ġindic ation
-Ġed ge
-Ġtrans form
-Ġtechn ical
-Ġstrength s
-Ġnec rosis
-Ġevid ent
-co h
-Ġfib er
-Ġappear s
-Ġsus p
-Ġestabl ish
-Ġx erost
-Ġwa velength
-Ġgum s
-Ġnas al
-Ġtend ency
-Ġve ct
-Ġpair s
-Ġobserv ational
-Ġpromo tion
-Ġacqu ired
-Ġsul f
-Ġinjur y
-Ġpractition ers
-Ġnh anes
-Ġicd as
-Ġnar row
-Ġinterpro ximal
-Ġlock down
-Ġinade qu
-h ard
-l ic
-Ġin pati
-Ġm un
-or der
-Ġb op
-it ated
-ul um
-ul ative
-ol ute
-Ġcon c
-Ġv ene
-Ġper pend
-ge al
-ot a
-Ġdis order
+Ġhyp og
+Ġradi ographic
+Ġj ud
+Ġpolym er
+Ġconc omit
+Ġprefer red
+Ġreconstr uction
+r ig
+Ġhab its
+Ġsub ty
+Ġen rich
+Ġrecept ors
+Ġpriv ate
+Ġsc ient
+ici ent
 ip s
-Ġsub t
-Ġspec t
-Ġcur v
-Ġvis ually
-Ġins ide
-ust om
-Ġcaus ing
-Ġabs olute
-Ġimmun oh
-Ġpur poses
-Ġpolymer ization
-acti le
-Ġregen erative
-Ġdemineral ization
-Ġgraf ting
-aryn geal
-Ġoverl ap
-Ġinterd ental
-Ġrob ust
-pal atal
-Ġtheore tical
+Ġconcomit ant
+r ia
+Ġcolon oscopy
+ann el
+Ġfamil ies
+Ġig g
+Ġopi oid
+Ġmix ture
+Ġbas al
+Ġsepar ate
+acter ial
+Ġps ori
+Ġprevent ive
+y pt
+Ġ rol
+Ġre vers
+ell a
+Ġem p
+Ġprog ressive
+Ġaccept able
+Ġcon j
+Ġinc ident
+Ġlist ed
+Ġacid s
+Ġqu art
+Ġt ib
+Ġt gf
+Ġbelie ve
+Ġf if
+Ġg h
+el t
+Ġsw it
+1 1
+am ed
+est ed
+Ġfour th
+Ġsha pe
+ra di
+Ġsh ap
+ade qu
+Ġcoun ter
+Ġtrans ition
+Ġprof iles
+Ġcla im
 Ġbegin ning
-Ġdestr uction
-Ġuc l
-Ġdivers ity
-Ġdich otom
-Ġxerost omia
-Ġperpend icular
-Ġimmunoh ist
-f a
-k k
-l in
-Ġt actile
-Ġp u
-Ġf a
-Ġm el
+Ġr v
+Ġclose ly
+Ġecm o
+Ġin adequ
+Ġar g
+Ġde b
+Ġob struction
+Ġdist inct
+x p
+Ġcr ude
+em b
+Ġch annel
+Ġar ds
+Ġex cell
+arg ed
+Ġu k
+oph il
+Ġtarget ed
+anes e
+Ġ ion
+Ġdecre asing
+Ġoc clusion
+Ġmatch ing
+Ġf al
+Ġdef ect
+Ġlo ok
+Ġiss ue
+Ġdescrib e
+Ġconsist ency
+ot e
+Ġout put
+Ġfrequ encies
+Ġmot or
+Ġun s
+aren t
+Ġbuc cal
+Ġweight ed
+Ġun ited
+or ding
+Ġcalc ulate
+Ġst iff
+Ġon c
+Ġl n
+Ġcan cers
+ac ent
+Ġresol ution
+Ġimprove ments
+Ġdiscre p
+Ġatt itudes
+Ġsuper nat
+om ple
+ill a
+Ġinvestig ations
+Ġnod e
+Ġalgorith m
+Ġsh am
+Ġde cis
+Ġb a
+Ġstim ulated
+ove red
+Ġvari ed
+t o
+Ġmet s
+Ġinter f
+Ġextre me
 Ġb cl
-is ter
-is ions
-Ġh ong
-it osis
-Ġst ates
-Ġl d
-Ġfor ward
-un ct
-um b
-Ġdif fered
-Ġtw enty
-ff ee
-Ġind uce
-ari ties
-Ġchild hood
-Ġup r
-esti b
-Ġj an
-Ġcare gi
-Ġextr a
-Ġextr usion
-Ġem b
-Ġca vities
-Ġfr ail
-Ġgeneral ized
-Ġapp e
+Ġexcess ive
+Ġenc our
+Ġradiograph s
+Ġfraction s
+Ġl c
+Ġsubject ed
+Ġrec ip
+r ans
+Ġ1 4
+Ġload ing
+ic illin
+Ġpl anned
+at a
+Ġnas al
+Ġsc ans
+c ul
+os in
+Ġaffect s
+Ġsess ions
+Ġallow s
+Ġassum ed
+ve red
+Ġpro duce
+Ġwe ar
+Ġrem od
+Ġutil ized
+Ġrecogn ized
+r an
+Ġon line
+Ġk a
+Ġsurge ons
+r il
+Ġh l
+Ġg ive
+el ium
+Ġexpl ored
+z il
+Ġc ortic
+Ġcomm erc
+Ġgra ph
+Ġac ad
+of l
+Ġan emia
+Ġen ough
+Ġsaliv ary
+Ġarter ies
+b ack
+oc ar
+Ġsc ales
+Ġcol um
 anc ing
-Ġsmo oth
-Ġgend ers
-Ġgrow ing
-Ġsens itive
-Ġcross bite
-Ġbiof eedback
-Ġpropor tions
-Ġregard ed
-Ġconstr ucted
-Ġprevent ing
-Ġspl it
-och lor
-Ġx yl
-Ġconnec tive
-Ġtub ules
-Ġbro ad
-Ġemerg ence
-Ġworld wide
-Ġmac roph
-Ġtransfer red
-Ġsar s
-Ġgerman y
-Ġsd b
+Ġlab el
+Ġbrief ly
+Ġcont ained
+Ġcomple ment
+ag ul
+Ġmitochond rial
+Ġa ort
+Ġf elt
+Ġdist ingu
+u ff
+Ġcaus ing
+Ġgra m
+Ġappear ance
+Ġsp read
+Ġdrink ing
+Ġs ir
+Ġfix ation
+Ġspect rum
+Ġbe y
+Ġeas ily
+Ġs om
+Ġco vered
+Ġa h
+n ight
+Ġbl ue
+Ġcontinu ed
+Ġp ut
+Ġgre en
+Ġauto imm
+is ol
+Ġn t
+Ġprem olar
+Ġpath ology
+ad es
+ar rh
+iz ations
+ri e
+Ġann ual
+Ġinfect ious
+i ence
+Ġpul se
+Ġdiv er
+Ġphosphory lation
+Ġlar gest
+l im
+Ġper oxid
+Ġexper ts
+Ġform al
+Ġparal le
+Ġrhe um
+Ġequ ival
+Ġchallen ge
+Ġcorresp ond
+Ġspec imen
+Ġmin utes
+Ġnumer ous
+Ġl ost
+Ġ0 5
+Ġ vel
+ew ork
+Ġsed ation
+Ġs ph
+ve f
+Ġinc omple
+Ġprob e
+Ġadj acent
+Ġdimens ional
+Ġrandom ization
+et ric
+Ġbra ck
+ill ation
+im ination
+Ġel isa
+clus ions
+Ġov arian
+Ġwithd ra
+Ġinter med
+Ġcon d
+Ġscre ened
+Ġalt ered
 Ġblind ed
-Ġfluorid ation
-Ġinstitution al
-Ġtor que
-Ġbreat h
-f ill
-k al
-Ġs we
-en ess
-Ġc cc
-Ġc ustom
-an k
-Ġb en
-Ġl ung
-Ġv ulner
-Ġv estib
-Ġcom orb
-Ġbet a
-Ġcl p
-op e
-Ġco ffee
-Ġinter actions
-Ġk ong
-Ġcor tical
-Ġcol our
-Ġcol ored
-Ġ1 4
-Ġsup ar
-Ġprim ers
-Ġel astom
-Ġscal es
-Ġprocess ing
-Ġinfec tious
-echan ical
-Ġarch es
-Ġnec rotic
-Ġdemonstr ate
-Ġang ular
-hol ds
-Ġseal ers
-Ġdifferenti al
-Ġsuppor ts
-Ġadv ance
-Ġthough t
-Ġbor der
-Ġrecur rent
-Ġcd t
-Ġmaintain ed
-Ġconfound ers
-Ġinterpre tation
-Ġur ban
-Ġqual itative
-Ġcomplain ts
-Ġbiops y
-Ġaccom pan
-Ġdb bm
-Ġinadequ ate
-a e
-c i
-i ver
-Ġc at
-Ġp aste
-Ġb ound
-Ġre actions
-Ġe g
-us ed
-ig g
-Ġcon v
-am ond
-Ġr t
-Ġwh om
-Ġch ains
-Ġcomp ound
-Ġcont ain
-Ġcont ains
-ong ed
-Ġperiodon t
-Ġpr on
-Ġinter m
-Ġfin anc
-pres s
-Ġstr ains
-ep t
-Ġmicro hard
-Ġsubjec ted
-Ġdi amond
-Ġprim arily
-Ġdr awn
-Ġran ges
-Ġloc ations
-Ġdecre asing
-hes ive
-Ġhyp ochlor
-Ġprov ision
-Ġscre en
-Ġauth or
-Ġmembr anes
-Ġlarg est
-Ġstate ment
-Ġdatas ets
-Ġconnec tion
-Ġhp dl
-Ġconcer n
-Ġelastic s
-Ġeas y
-Ġgran ules
-Ġlik ert
-Ġna ocl
-Ġsummar ized
-Ġreproduc ibility
-Ġstomat ology
-Ġdepos its
-Ġcommerc ial
-Ġindent ation
-Ġextre me
-Ġfa ecal
-Ġjan uary
-Ġelastom eric
-Ġmicrohard ness
-Ġhpdl cs
-8 9
-c y
-r h
-r in
-u tive
-Ġa ustr
-re ed
-Ġo g
-Ġc um
-Ġw ar
-Ġm ri
-Ġre pa
-Ġto o
-Ġon es
-Ġv ibration
-Ġwh it
+Ġane urys
+Ġsp ss
+Ġform ed
+Ġv ide
+Ġover weight
+Ġflav on
+Ġrec ording
+Ġepisod es
+Ġconst ant
+Ġuni que
+Ġpyl ori
 Ġch am
-Ġdis til
-Ġy ield
-Ġk t
-Ġk ee
-Ġspec tr
-Ġar th
-Ġmed ications
-Ġcompar t
-Ġdisc r
-Ġreduc es
-cer tain
-Ġdeterm in
-Ġpositive ly
-Ġpe kk
-Ġdescrib e
-Ġconclusion s
-Ġdm f
-Ġrespond ers
-Ġpd l
-Ġtool s
-Ġelec t
-Ġsuppor ting
-Ġmicrobi ota
-Ġsee king
-Ġfav orable
-Ġcop per
-Ġtempor omandibular
-Ġalt ered
-Ġrun ning
-Ġga ve
-Ġeros ive
-Ġabras ion
-Ġdeli very
-Ġsecre tion
-Ġcollab oration
-Ġemo tional
-Ġpac ifier
-Ġdistin ct
-Ġthor ough
-Ġucl p
-Ġhypochlor ite
-Ġcum ulative
-Ġdistil led
-1 3
-a king
-s in
-Ġs essions
-Ġc ast
-Ġf ric
-Ġd va
-Ġh ba
-Ġe c
-Ġor ient
-el ih
-Ġpre v
-Ġle t
-cl es
-Ġam ounts
-Ġk ept
-Ġdia gram
-Ġser ious
-Ġz one
-Ġrem ain
-Ġfr am
-ogen ous
-Ġmid palatal
-Ġlab eling
-Ġbond ed
-Ġhal itosis
-isc ipl
-Ġchem otherapy
-Ġchec ked
-Ġwa ve
-Ġbor n
-Ġphot ograph
-otyp es
-Ġrecru it
-Ġcod es
-Ġarchw ires
-Ġsci ences
-Ġlik elih
-Ġphen omen
-Ġsuscepti bility
-Ġswed en
-Ġmas ter
-Ġana er
-Ġsurround ing
-Ġacce ler
-Ġcurv ature
-Ġfaecal is
-iscipl inary
-Ġlikelih ood
-h th
-u ge
-Ġ ion
-Ġo vere
-Ġc ath
-Ġf ast
-Ġd w
-is es
-Ġh if
-Ġst abil
-et amine
-Ġcon gen
-Ġr ace
-Ġres our
-Ġres ins
-ign ific
-Ġat tain
-Ġdis ag
-Ġcl ar
-Ġsc c
-Ġun ited
-Ġup s
+Ġco ord
+Ġred uces
+Ġar rhythm
+Ġext ension
+Ġm or
+Ġdos age
+op last
 Ġup reg
-Ġmo ti
-Ġexamin ers
-Ġorth op
-Ġj ob
-Ġj unction
-Ġextr act
-Ġcalc ifications
-Ġtrans plant
-Ġcur ric
-Ġwor se
-Ġadj unc
-Ġacti v
-Ġexperi ences
-Ġsm ear
-Ġfail ures
-con t
-Ġret reatment
-Ġcarr y
-Ġdeg en
-Ġdifferenti ated
-Ġimprove ments
-Ġspl ints
-Ġspecial ist
-Ġidentify ing
-Ġphot o
-Ġinstruc ted
-Ġobes e
-Ġimple mentation
-Ġbur den
-Ġparti ally
+Ġdim ension
+n t
+Ġsitu ations
+Ġd ynamic
+at ch
+1 7
+Ġstart ing
+Ġdiff ered
+Ġadvant age
+Ġst emi
+Ġthem es
+Ġbey ond
+os a
+Ġco verage
+Ġe gfr
+Ġincomple te
+Ġsc en
+el ves
+Ġsymptom atic
+Ġfrail ty
+Ġsur round
+Ġmeth anol
+Ġdent in
+yroid ism
+Ġadhes ion
+oph ys
+Ġcre ated
+Ġv ul
+Ġsmo oth
+Ġdifferent ial
+Ġt ail
+Ġmult ic
+reat ment
+Ġnear ly
+Ġconsider ation
+Ġdecre ases
+Ġam l
+ax is
+Ġeng lish
+Ġexcell ent
+Ġm ach
+Ġunder g
+Ġne ither
+te b
+Ġm v
+Ġag ing
+Ġalter ations
+Ġintrod uced
+ur ia
+Ġmem ory
+Ġmd a
+om fort
+Ġprot ection
 Ġdatab ases
-Ġstain less
-Ġclose ly
-Ġsci enti
-Ġquanti fy
-Ġcolon ies
-Ġprin ted
-Ġsubstit utes
-Ġosteobl asts
-Ġdentifric e
-Ġlifest yle
-Ġgc f
-Ġvestib ular
-ignific ant
-a u
-b e
-m en
-n et
-y e
-Ġth umb
-Ġof fer
-Ġb ony
-ic ip
-ar tic
+Ġdel ir
+Ġincor por
+Ġpercent ages
+Ġestim ation
+Ġguid eline
+Ġman u
+Ġs v
+Ġover night
+Ġtox ic
+er ies
+ect in
+Ġcont in
+cl es
+abil ities
+Ġfunction ing
+Ġl vef
+ac ial
+Ġmanu fact
+r ical
+Ġover l
+Ġscen ari
+Ġret rie
+Ġfram ework
+Ġbran ch
+Ġvi ol
 Ġto ok
-it ect
-Ġn c
-Ġn ation
-Ġn ow
-Ġg over
-os ter
-if orm
-id er
-Ġv ess
-Ġr in
-feren ces
-Ġap hth
-Ġnot e
-Ġacc oun
-ive ly
-Ġvari ety
-Ġso uth
-Ġmethod ology
-Ġ1 1
-Ġappl ic
-Ġappl ications
-Ġfur cation
+Ġphosph ate
+Ġbiops ies
+Ġn ight
+Ġisol ation
+Ġbarri er
+Ġliqu id
+Ġs ense
+itone al
+o e
+Ġstiff ness
+yn am
+Ġhor iz
+Ġf m
+Ġdi ag
+Ġt ong
+Ġab st
+Ġnorm ally
+Ġfin anc
+Ġve h
+Ġsol id
+Ġaccept ed
+Ġmarg inal
+ject ion
+Ġantib acterial
+Ġcirc ulating
+eth yl
+Ġas th
+Ġimmed iate
+Ġg est
+Ġre n
+ung al
+Ġinadequ ate
+Ġmicroscop e
+Ġhistopath ological
+Ġdecis ions
+er ing
+or n
+Ġp n
+Ġfal se
+Ġext ended
+ag on
+Ġdi arrh
+Ġex ce
+Ġfib rob
+Ġpromot ing
+Ġgo al
+Ġsuccessful ly
+Ġsequ ences
+et in
+Ġtechn ical
+Ġcut off
+Ġchrom at
+ur ane
+Ġ1 5
+Ġconsist s
+Ġp b
+Ġm h
+Ġag es
+res h
+Ġl ys
 Ġcare ful
-ten tive
-Ġreview ed
-Ġprovid ers
-Ġstruct ural
-Ġarch itect
-Ġphys iological
-Ġrepresent ing
-Ġlab el
-Ġmucos itis
-Ġprom ising
-Ġpolym orph
-Ġsatis fied
-Ġutil ization
-Ġconnec ted
-Ġinvas ion
-Ġmagn itude
-Ġhem od
-Ġmar ital
-Ġmouthwas hes
-Ġram us
-Ġprognos tic
-erv ative
-Ġedentul ous
-Ġrat s
-Ġanomal ies
-Ġmun icip
-Ġappe ared
-Ġxyl itol
-Ġperiodont ology
-Ġaustr al
-Ġaphth ous
-c enti
-o vir
-p i
-p ly
-p oint
-Ġt etr
-Ġa ther
-al g
-Ġc os
-Ġf if
-Ġf el
-Ġre tentive
-Ġh ar
-Ġh ol
-Ġe coh
-ec utive
-Ġg as
-os a
-am ed
-am ph
-Ġper m
-Ġper centi
-Ġcomp ress
-Ġdis ability
-Ġdif f
-em ber
-Ġco ver
-ther n
-Ġcons ervative
-Ġqu ad
-Ġun s
-ph a
-Ġi os
-Ġop tical
-Ġplan ing
-Ġgreat est
-Ġexpl ored
-ffici ents
-Ġthir ds
-Ġbrush ed
-Ġdiab etic
-Ġavail ability
-Ġattach ments
-Ġsw allow
-Ġcorresp ond
-Ġstim ulated
-Ġgrad ually
-Ġwall s
-Ġmicrobi ological
-Ġcoe fficients
-ipl es
-Ġmy op
-Ġgran ul
-Ġprinc iples
-Ġbal ance
-Ġattend ance
-Ġcall ed
-Ġlat ter
-Ġcv mi
-Ġacad emic
-Ġtonsillolith s
-Ġmastic atory
-Ġname ly
-Ġremod eling
-Ġfinanc ial
-Ġadjunc tive
-Ġrin se
-Ġecoh is
-1 2
-a h
-l f
-n as
-in ine
-on ion
-Ġc it
-le ms
-ec e
-os ity
-os cl
-un e
-Ġgro und
-Ġdis ting
-Ġrec essions
-Ġinter group
-ograph ics
-Ġobser vers
-Ġman ner
-pos ite
-Ġradi olog
-oun ced
-cr ib
-Ġtrans f
-Ġlimit s
-Ġmet ric
-Ġinflu ences
-Ġdo xy
-of lu
-Ġprof il
-Ġcompos ed
-Ġconsider able
-Ġestim ation
-Ġwill ing
-Ġequ ip
-Ġreflec ted
-Ġvisit ing
-Ġcalcul ate
-Ġmultivari able
-Ġinterpre ted
-Ġq lf
-Ġaddress ed
-Ġreferral s
-Ġsupple ment
-Ġram ec
-Ġoffic e
-Ġoffic es
-Ġwil lems
-Ġcapt ured
-wh ile
-Ġgre en
-Ġinpati ents
-Ġdetermin ants
-Ġgover n
-Ġdisting u
-h c
-r ane
-t on
-Ġ ery
-Ġt gf
-Ġs low
-Ġo w
-Ġc och
-Ġp se
-Ġd ap
-Ġm om
-ro gen
-Ġh r
-Ġl ist
-Ġv aries
-Ġr r
-Ġres ection
-Ġind eed
-Ġnot ably
-Ġpl ots
-Ġcons tit
-Ġcons ecutive
-Ġob str
-Ġrec overy
-Ġcar ri
-ard s
-Ġag reed
-Ġsim ulate
-Ġmean ing
-Ġclass es
-Ġdem ographics
-Ġits elf
-Ġset s
-Ġins ignificant
-Ġconduc t
-anc ies
-Ġfill er
-Ġvi able
-ins ic
-Ġscan ner
-Ġdeg rees
-Ġta x
-Ġstrong er
-Ġmalocclusion s
-Ġcontrib uted
-Ġconcer ns
-Ġcalcul ating
-ocy te
-Ġtransl ation
-Ġhydro xy
-Ġbelie ve
-Ġrecogn ized
-Ġfacilit ate
-Ġmolec ular
-Ġinequ ality
-Ġou ts
-Ġwebs ites
-Ġsubt yp
-Ġeg yp
-Ġrecruit ment
-Ġpse ud
-7 0
-b or
-l ish
-v ance
+Ġbre ak
+Ġscient ific
+t t
+og ens
+Ġpres er
+Ġprop ensity
+Ġmel an
+Ġrestor ations
 Ġs en
-Ġp ut
-Ġp ay
-Ġf m
-Ġre jec
-Ġe ts
-Ġst op
-Ġg i
-il t
-ati tis
-tic ally
-Ġv dr
-Ġal pha
-Ġr idge
-Ġex pect
-Ġex tension
-Ġcl us
-Ġtr i
-Ġsub str
-Ġqu ar
-Ġcor on
-Ġsec tor
-Ġ1 3
-Ġman ually
-Ġchar t
-Ġdr aw
-Ġce j
-unc tional
-omet er
-Ġoste o
-Ġsl ice
-Ġanalyz ing
-Ġscre ened
-Ġgel s
-Ġmorph ological
-Ġepithel ium
-Ġms i
-Ġms l
-Ġassum ption
-Ġchallen ges
+ul um
+Ġcycl es
+2 2
+Ġout side
+Ġfill ed
+Ġpil ot
+Ġic d
+Ġf ron
+ify ing
+Ġhypert ensive
+Ġcap s
+Ġdefinition s
+Ġ1 6
+Ġmy el
+Ġstom ach
+Ġab und
+Ġthe ms
 Ġconsequ ences
-Ġcod ed
-Ġmicroscop y
-Ġmill er
-Ġrank l
-Ġnan op
-Ġeng lish
-Ġsurge ons
-Ġmonom ers
-Ġreconstr uction
-Ġreconstr ucted
-Ġirregular ity
-Ġsaf e
-Ġprojec t
-Ġprincip al
-Ġamel obl
-Ġswe et
-cont rol
-Ġather oscl
-Ġpercenti le
-Ġmyop ia
-oflu orescence
-Ġery th
-k es
-x illary
-y ond
-Ġt er
-Ġt ables
-Ġt cp
-Ġa kt
-Ġs fe
-al ateral
-al cin
-Ġan tic
-Ġd ialysis
-Ġm ir
-Ġst om
-om er
-om ial
-Ġv ar
-Ġbe yond
-uc id
+Ġint ention
+oster one
+Ġinterpret ation
+Ġrang es
+Ġin verse
+Ġs ar
+Ġits elf
+Ġthems elves
+hol ds
+Ġlat ter
+Ġasth ma
+ob acter
+b re
+is es
+Ġun able
+re am
+Ġdeterm ining
+am ide
+ore t
+Ġeas y
+ot s
+Ġdifficult ies
+Ġp um
+ron ch
+Ġpers pective
+1 9
+up p
+Ġball oon
+Ġnew ly
+Ġmin eral
+Ġhyp ot
+Ġparalle l
+Ġproport ional
+Ġdescrip tion
+Ġfluor ide
+am ent
+Ġcompar ative
+Ġimplement ed
+Ġsupp ress
+Ġosteopor osis
+Ġcor onal
+Ġop in
+Ġle ak
+Ġbl ack
+Ġpe ep
+un te
+Ġvol unte
+Ġcompl ain
+ic a
+Ġon es
+Ġact in
+Ġcomorbid ity
+ul ed
+Ġmo ve
+Ġpolymorph ism
+Ġbehavi oral
+or ies
+Ġdet erior
+Ġdelir ium
+Ġfinanc ial
+Ġed ema
+ococ cus
+Ġf ilt
+Ġl and
+Ġne on
+Ġhospital ized
+Ġdatas et
+br id
+Ġrest oration
+Ġdoct ors
+ge al
+Ġfav orable
+Ġclin ics
+Ġprevent ing
+Ġmand ible
+Ġfor ward
+p p
+oc al
+Ġproport ions
+Ġbra zil
+Ġp g
+Ġdu oden
+Ġc it
+ptom atic
+Ġpractition ers
+Ġw ant
+Ġ3 0
+Ġmanifest ations
+Ġr up
+Ġne ph
+Ġfo ot
+u vant
+ra g
+Ġpharmac ological
+Ġdr y
+Ġmin d
+Ġfe ed
+is p
+ent y
+Ġg ut
+Ġra bb
+ri um
+Ġpre cise
+ro us
+Ġscaven ging
+Ġcl osure
+Ġcorre ction
+Ġasym ptomatic
+Ġel imin
+Ġbrush ing
+c ess
+Ġan th
+Ġdec omp
+Ġstep s
+Ġkin ase
+Ġautoimm une
+Ġmed ial
+Ġanalges ic
+ir c
+ac in
+Ġconsider able
+Ġfacilit ate
+Ġo t
+Ġus age
+Ġanaes thesia
+Ġke ep
+Ġin patient
+Ġco ver
+Ġthe oret
+Ġop p
+Ġthromb osis
+Ġfall s
+Ġarth ritis
+lu x
+Ġty p
 Ġch ain
+ill ance
+Ġmonit or
+oph ag
+aryn geal
+Ġsequ encing
+Ġas ian
+Ġplot s
+Ġl ob
+Ġa i
+Ġresus c
+Ġa ce
+eren ces
+Ġsp ine
+Ġf ever
+Ġasp ect
+Ġjap an
+Ġsupplement ation
+Ġfill ing
+ic it
+Ġadop ted
+Ġaccording ly
+Ġhel s
+Ġapp arent
+or gan
+Ġsurve illance
+Ġres orption
+Ġob struct
+Ġspe ed
+Ġy our
+Ġcoe ffici
+Ġo vere
+Ġev ol
+Ġcoeffici ents
+at osis
+Ġcontribut ed
+Ġsul f
+Ġcont ains
 Ġsc ar
-Ġun able
-Ġun ilateral
-Ġun ivariate
-ast es
-all ing
-Ġfour th
-Ġstr ict
+Ġname ly
+Ġs emi
+Ġas a
+Ġgovern ment
+b ar
+Ġd est
+is c
+ink i
+Ġw ors
+Ġsepar ated
+Ġteach ing
+Ġhels inki
+oc l
+Ġhyper g
+Ġveh icle
+Ġin n
+Ġst abil
+Ġev ident
+Ġsuffer ing
+Ġindic ations
+ac er
+Ġhouse hold
+Ġintra cellular
+Ġging iv
+Ġrob ust
+Ġp le
+Ġintermed iate
+Ġs uture
+i as
+Ġdisc omfort
+Ġr ich
+Ġjap anese
+Ġs b
+Ġcytotox icity
+Ġselect ive
+Ġtw enty
+Ġpot ent
+Ġvis ible
+que ous
+Ġsess ion
+Ġrel ax
+Ġop ening
+Ġmalign ancy
+Ġhoriz ontal
+Ġf resh
+Ġlymph oma
+Ġins ight
+Ġnod es
+Ġbel ong
+Ġrol es
+Ġpres ents
+Ġprog ress
+Ġcar ry
+Ġch ew
+Ġsuper v
+Ġtraum atic
+Ġaccompan ied
+Ġa queous
+Ġdr ied
+Ġincis ors
+il ities
+Ġnot ably
+Ġcons erv
+Ġam p
+Ġprov en
+Ġmonit ored
+Ġatt itude
+Ġgl and
+Ġve gf
+wh ile
+entan il
+1 4
+Ġall ocation
+Ġprim ers
+ar b
+Ġguid ance
+Ġwa ist
+Ġimmunos upp
+Ġdecl ar
+w ing
+st ream
+Ġvari ants
+Ġcop ing
+Ġpsori asis
+os ide
+Ġtem por
+Ġdeg rad
+Ġmembr anes
+Ġinser ted
+Ġchallen ging
+Ġadhes ive
+Ġcircum ference
+Ġdis rup
+Ġr d
+Ġanes thetic
+Ġtong ue
+en ic
+Ġof fer
+1 3
+Ġkore a
+Ġsa id
+Ġtert iary
+Ġsurge on
 Ġ1 8
-Ġbr ief
-Ġcalc ification
+Ġnutrition al
+Ġt et
+Ġs ac
+Ġl ib
+Ġlower ing
+Ġphen otype
+in ated
+Ġconf lic
+Ġinstit ution
+Ġce phal
+Ġmolec ules
+ul s
+Ġvel oc
+Ġpl ants
+Ġb ox
+d own
+Ġpal atal
+Ġco ch
+Ġhemorrh age
+Ġor ient
 Ġcriter ion
-Ġremo vable
-Ġeduc ated
-Ġocc up
-Ġprot ec
-Ġrequ iring
-Ġang les
-Ġmat ching
-Ġcontr alateral
-Ġrele vance
-Ġcategor ical
-Ġext ended
-Ġsinus es
-Ġallow ing
-Ġfib ers
-Ġbehavior al
-Ġgrad u
-Ġincub ation
-Ġcod e
-Ġpredict ors
-Ġhom ogeneous
-Ġpm u
-Ġminim ize
-Ġlith ium
-Ġtransm ission
-Ġsaf ety
-Ġdiscrep ancy
-Ġdepend s
-Ġig f
-Ġfun gi
-Ġatten ding
-Ġdrin king
-Ġcav itated
-Ġosteoc alcin
-Ġcath ep
-Ġcoch rane
-Ġnanop artic
-m ed
-r d
-Ġs i
+Ġapp oint
+Ġsupport ing
+Ġworld wide
+Ġn om
+Ġtren ds
+r illation
+Ġhe at
+Ġta i
+Ġcompr ised
+ing ual
+Ġref lected
+Ġur g
+Ġexp and
+Ġtyp ically
+Ġe ye
+Ġn ause
+Ġdeclar ation
+Ġo a
+Ġr hy
+ial ysis
+vers ion
+im ate
+Ġremod eling
 al th
-Ġc ere
-Ġc ma
-Ġp bl
-Ġin g
-Ġan esthesia
-Ġf t
-Ġm ul
-ro vers
-ar ing
-Ġre nal
-Ġe ms
-Ġst ained
-Ġl amin
-Ġn ig
-os an
-os oc
-Ġstud ent
-el ves
-Ġal p
-Ġcom fort
-Ġme h
-Ġpre treatment
-Ġsc r
-Ġcont rovers
+Ġb ronch
+Ġinc ons
 Ġro und
-Ġno ti
-Ġk ore
-Ġpresent ing
-Ġmodel ing
-Ġmo un
-Ġag ent
-Ġsim ulation
-Ġincis ion
-Ġimm ers
-Ġir an
-aren t
-Ġgl az
+Ġequip ment
+Ġthe ory
+Ġscan ning
+Ġgerman y
+Ġovere xp
+c p
 Ġstruct ured
-Ġparen t
-Ġatt ended
-Ġang ulation
-Ġmor b
-Ġpulp otomy
-Ġsuper n
-anti tis
-Ġadm ission
-Ġfocus ing
-roph il
-Ġmut ation
-Ġexhib it
-Ġanat omy
-Ġseem ed
-Ġpromot ing
-ax is
-Ġelig ibility
-Ġbehaviour s
-Ġmedi ated
-Ġsubm andibular
-Ġdu w
-Ġvolun te
-crip tion
-Ġenl arge
-Ġpron ounced
+Ġoccup ational
+Ġpre f
+re ct
+Ġappl ic
+Ġpl at
+Ġvir t
+Ġbiomark er
 Ġphenomen on
-Ġhemod ialysis
-Ġfel t
-Ġcathep sin
-osoc ial
-5 0
-i ents
-y dr
-z er
-Ġp le
-Ġp ort
-Ġan gi
-Ġf as
-Ġf air
-Ġd im
-ac ill
-il ms
-Ġv ox
-Ġr na
-Ġres ol
-Ġac ryl
-Ġad ip
-Ġcl a
-Ġma kes
-Ġle g
-Ġcan cers
-Ġha z
-Ġun know
-Ġout put
-Ġmeth an
-Ġparticip ated
-Ġstr ain
-ep tid
-Ġdep ic
-Ġunder graduate
-Ġinvestig ator
-Ġinvestig ators
-Ġdistrib utions
-Ġdesign s
-Ġir re
+Ġaort a
+Ġg old
+Ġbreath ing
+Ġut er
+Ġprost ate
+f l
+Ġa ra
+Ġh ost
+Ġgly cem
+Ġdiss ol
+Ġnause a
+Ġperson nel
+al ing
+Ġz one
+Ġradi ological
+Ġw r
+Ġ0 0
+Ġc ab
+Ġun f
+Ġconst it
+Ġbelie ved
+Ġsurve ys
+r ane
+Ġp se
 Ġoccur ring
-til age
-Ġoste otomy
-Ġcompos ites
-Ġfe el
-Ġsol id
-Ġnorm ally
-Ġsuper v
-iel ds
-Ġpsych osocial
-Ġpol ishing
-Ġsn p
-Ġtoothp astes
-Ġimpression s
-Ġsee k
-Ġconver ted
-Ġfloss ing
-Ġincons istent
-Ġbott om
-Ġrein for
-d t
-d ed
-g d
-r itis
-t ure
-on as
-Ġthe ms
-Ġo ct
-Ġc ig
-Ġf ungal
-or ies
-an ge
-Ġb it
-ic ans
-Ġn m
-ud e
-Ġr m
-Ġpro ven
-ot or
-ad es
-ore r
-ib ull
-Ġsh are
-ap p
-ap atite
-op os
-Ġle a
-ell ular
-Ġun iform
-Ġun control
-Ġwe ibull
-Ġout pati
-Ġfin ite
-Ġcor tic
-Ġdec line
-Ġobser ve
-Ġstr a
-Ġimpl antitis
-Ġnon s
-Ġtyp ical
-ds c
-Ġpop ular
-Ġol k
-Ġbas al
-Ġaccur ately
-Ġver ified
-Ġproduc t
-Ġnew ly
-Ġhel d
-Ġpol ished
-Ġdoc tor
-Ġquantit y
-Ġnas ion
-Ġful fill
-Ġadap tation
-Ġanimal s
-Ġalloc ated
-Ġillustr ated
-Ġsuscepti ble
-Ġstar ting
-Ġalb icans
-Ġcounter par
-Ġexclud ing
-Ġide al
-Ġjap an
-Ġprophyl axis
-Ġpredom inant
-Ġcomorb id
-Ġcham ber
-Ġfram ewor
-Ġscienti fic
-men tioned
-Ġcos ts
-Ġunknow n
-Ġthems elves
-2 3
-g ate
-h r
-t g
-Ġa ided
-Ġs ella
-Ġo xy
-Ġp ull
-Ġf dsc
-Ġm ature
-th ood
-Ġb cp
-ul in
-Ġn s
-Ġg dps
-os ing
-Ġcon j
-Ġon to
-Ġon set
-ab ilities
-Ġim bal
-og l
-Ġco ol
-Ġk h
-Ġdet erior
-Ġpo orer
-Ġtim ing
-Ġover c
-Ġmo tion
-Ġdec ont
-Ġsim pl
-Ġsp r
-Ġform at
-Ġop in
-Ġgr inding
-Ġimp acts
-Ġz op
-Ġca ution
-Ġresearch er
-Ġgl uc
-ox ide
-Ġsens ation
-Ġadul thood
-Ġdm fs
-Ġbiof ilms
-Ġtum ors
-Ġguid es
-anti b
-Ġseal ants
-Ġequ ival
-Ġgo al
-Ġgo ing
-Ġfunction ing
-Ġsepar ated
-Ġsitu ations
-Ġmus cles
-Ġcir rh
-Ġexpres s
-Ġvisual ization
-Ġhydro x
-Ġantimicrobial s
-Ġimple ment
-Ġvr f
-Ġelimin ate
-Ġauto antib
-Ġrev ision
-Ġfabric ated
-Ġ202 0
-Ġcontinu ed
-Ġsimultaneous ly
-Ġvect or
-Ġrepa ir
-Ġanaer obic
-Ġcongen ital
-Ġdisag ree
-Ġow ing
-Ġstom atitis
-Ġvar nish
-Ġmorb idity
-Ġcirrh osis
-c an
-l ation
-m ia
-p ps
-r ant
-y cin
-Ġt tm
-Ġa uc
-Ġs na
-al veolar
-er ment
-er osis
-Ġp ush
-Ġp lect
-Ġw ine
-Ġin put
-Ġan th
-Ġan ter
-Ġf und
-Ġm t
-Ġb ad
-us ti
-ere stim
-ur g
-am ous
-tic ed
-Ġv on
-Ġr h
-Ġim t
-Ġus age
-Ġch it
-Ġch air
-Ġad p
-op ro
-Ġperi ph
-Ġinf ants
-ch ool
+g et
+Ġd ark
+Ġh ol
+os al
+Ġstrength s
+Ġth in
+Ġh m
+Ġle af
+ph rine
+Ġdem and
+Ġinit i
+Ġmarg in
+Ġpelv ic
+Ġincons ist
+Ġmob ility
+Ġadvant ages
+Ġcolum n
+pl ast
+Ġcr yst
+Ġp od
 Ġun certain
-Ġvari ant
-Ġmeth amph
+Ġequ ation
+ofl urane
+Ġcol d
+Ġd ich
+Ġke pt
+Ġv om
+Ġreg en
+d es
+Ġs ent
+Ġkore an
+i ans
+Ġac cel
+Ġph yt
+Ġconfound ers
+Ġe osin
+Ġpart ially
+Ġele ments
+Ġsim ulation
+Ġinhibit ing
+Ġethn ic
+en z
+if orm
+Ġa ud
+Ġ1 7
+Ġra y
+Ġadren al
+Ġs omet
+ra z
+Ġv o
+Ġdistingu ish
+cr an
+Ġet iology
+Ġmedic ines
+Ġinvestig ators
+Ġpublic ations
+go ing
+pt ic
+Ġen l
+u x
+Ġre per
+Ġn lr
+Ġvolum es
+Ġ ia
+Ġprot ect
+Ġdent istry
+Ġapp lying
+Ġelig ibility
+Ġdiag ram
+f r
+k s
+Ġt er
+Ġt sh
+or age
+p m
+Ġp ts
+Ġf a
+Ġde form
+Ġinject ed
+Ġmak es
+Ġpath ogens
+Ġsch iz
+Ġconsult ation
+Ġcol itis
+Ġatt end
+Ġdiss ection
+Ġb is
+Ġth reat
+Ġsol utions
+Ġmetast atic
+Ġcontrol ling
 Ġ1 00
-Ġund erestim
-Ġsp ont
-Ġj usti
-Ġcorre c
-vers ible
-Ġel ucid
-Ġsch ne
-Ġposition s
-Ġliter acy
-Ġpa e
-Ġpa ediatric
-Ġoh pps
-Ġequ ally
-Ġmes i
-Ġantib ody
-Ġmark er
-Ġsus pected
-Ġspecial ists
-Ġartic ular
-Ġutil izing
-Ġnor way
-Ġsqu amous
-Ġtop ical
-Ġprol onged
-Ġbu ffered
-Ġpapilla e
-Ġrest ored
-Ġobserv ations
-Ġexpand er
-Ġcys tic
-Ġcytotoxic ity
-Ġstreptococ cus
-Ġabsorb ance
-Ġdento alveolar
-Ġdiscr imin
-Ġcit ric
-Ġnanopartic les
-Ġenlarge ment
-Ġacryl ic
-Ġstra ight
-Ġoxy gen
-Ġttm c
-Ġplect in
-Ġmethamph etamine
-Ġspont aneous
-Ġschne ider
-b it
-m p
-t ors
-Ġs ided
-Ġo id
-Ġo uter
-Ġp ix
-Ġin verse
-Ġof fered
-Ġd iv
-Ġm im
-Ġb ivariate
-Ġto x
-Ġh ns
-ac c
-Ġl ive
-Ġl ibr
-om ineral
-im m
-Ġg n
-ce ll
-tr action
-ir able
-Ġse paration
-Ġad ding
-we ight
-Ġit al
-Ġpres chool
-Ġqu ite
-ens ities
-Ġpresent ation
-Ġen ough
-Ġother wise
-Ġgen otype
-ugh t
-Ġcor ro
-Ġph arm
-Ġmethod ological
-Ġmo ist
-Ġdec ember
-Ġindic ations
-Ġchan ging
-Ġdia gn
-ack s
-Ġgener ate
-Ġed a
-Ġli qu
-tor ic
-Ġser ve
-Ġcomple tion
-tim e
-Ġstandard ization
-ob acill
-Ġimm ature
-Ġdemonstr ating
-ox ib
-Ġhyp omineral
-Ġver ify
-Ġmat ch
+Ġprom ising
+Ġagg reg
+Ġoverl ap
+Ġsomet imes
+ic ate
+Ġob st
+Ġant agon
+Ġd ual
+Ġro ugh
+Ġmethod ology
+Ġcortic oster
+ac ed
+Ġcont ain
+Ġf as
+Ġmus cles
+Ġconstruct ed
+o or
+Ġconserv ative
+Ġt ur
+Ġgl ass
+Ġdiv ers
+Ġm arch
+ph one
+ocar cinoma
+Ġwithdra w
+Ġcod e
+8 0
+Ġpract ical
+ic in
+Ġstud ent
+Ġregard ed
+Ġinit iated
+Ġt ended
+Ġmarked ly
+Ġexam in
+Ġclass es
+Ġsubst ance
+Ġcentrifug ed
+Ġc uff
+Ġcomp ens
+Ġinflu encing
+Ġresour ce
+Ġc art
+Ġport al
+Ġcort ical
+Ġt s
+Ġcar ri
+Ġpro ved
+ip ation
+is ition
+Ġ1 3
+Ġgen otypes
+Ġcall ed
+g ans
+Ġendpoint s
+Ġcomp ression
+Ġcont raction
+Ġant igen
+Ġfe ature
+Ġcham ber
+Ġn r
+Ġpro te
+Ġad ding
+Ġreg ul
+Ġprim er
+Ġmagn etic
+Ġtoler ance
+Ġlim b
+Ġpath ophys
+Ġs ud
+Ġp ad
+ost asis
+uc id
+Ġfac ility
+Ġacqu isition
+Ġrot ation
+az ole
+Ġmot ion
+Ġver teb
+Ġepidemi ological
+Ġir radi
+Ġfib rillation
+Ġwill ing
+Ġgrow ing
+Ġenrol l
+Ġhypot ension
+Ġreg imens
+Ġprocess ing
+pl er
+Ġben ign
+Ġs ag
+Ġmult id
+Ġmit ral
+part um
+Ġk et
+Ġadm issions
+Ġfe eding
+Ġanal og
+Ġful f
+Ġemb ol
+Ġemb ry
+Ġethn icity
+cl in
+Ġs i
+Ġp w
+Ġesoph ag
+Ġnar row
+Ġvag inal
+Ġpr one
+Ġterm inal
+Ġdemonstr ating
+Ġcyt oplas
+Ġplat form
+Ġer k
+n ia
+Ġsci ences
+Ġobstruct ive
+Ġpancre atitis
+it tal
+one y
+Ġmorph ological
+Ġbil iary
+Ġreag ent
+Ġpse ud
+Ġide al
+thes i
+Ġsh unt
+Ġresusc itation
+Ġth a
+Ġqu ad
+Ġdevi ations
+Ġcytotox ic
+Ġcalib ration
+Ġp y
+Ġtrans cript
+ro vers
+Ġsh ared
+Ġtend ency
+Ġt rop
+pl ate
+ov ing
+Ġinterpre ted
+Ġb ound
+Ġparticip ated
+Ġ2 5
+Ġe jection
+Ġlim its
+Ġagre ed
+ne a
+Ġdra wn
+ro plast
+ar ies
+Ġconsist ently
+Ġcolle ge
+t c
+Ġris e
+Ġinst ance
+Ġrepe at
+Ġacet ate
+Ġb ul
+Ġfra gment
+Ġlik ert
+p an
+z e
+Ġcont rovers
+Ġpostoperative ly
+Ġl m
+Ġk er
+Ġsp ir
+Ġhum ans
+Ġsupp ression
+Ġt ka
+Ġrelev ance
+Ġhighlight ed
+Ġck d
+Ġs ig
+Ġcon clusions
+Ġrem ark
+Ġb order
+Ġquant ified
+Ġgradu ally
+Ġmt t
+Ġexclud ing
+Ġl ive
+Ġb on
+Ġpar as
+Ġrestric ted
+Ġt or
+Ġaccur ately
+Ġreflect s
+Ġvom iting
+cran ial
+Ġcan ad
+Ġu v
+Ġon going
+Ġreg ulatory
+ub in
+Ġcy p
+Ġequival ent
+Ġp ock
+Ġthrom bo
+Ġland mark
+Ġaneurys m
+Ġd up
+ag ement
+Ġja w
+Ġabst ract
+Ġdegrad ation
+a ve
+p oral
+Ġsurround ing
+Ġacad emic
+e es
+Ġcontribut ing
+Ġvul ner
+ch ym
+Ġr r
+Ġimpl ications
+Ġartic le
+per t
+Ġsub str
+Ġrequire ments
+Ġc ity
+Ġtrans mission
+Ġcar cin
+Ġfl ap
+Ġdispl acement
+ochem istry
+Ġs ap
+Ġem s
+Ġcont ract
+Ġne oplas
+Ġic p
+Ġdent ist
+Ġmach ine
+Ġmar row
+Ġaug ment
+al y
+Ġbl adder
+Ġatt ending
+Ġcontr ary
+Ġanes th
+Ġv a
+Ġpost partum
+Ġmal oc
+Ġmax imal
+Ġpercept ions
+Ġqu ick
+Ġvari ant
+Ġer os
+Ġcop d
+Ġf ru
+Ġel ucid
 Ġconsist ing
-Ġmoder ately
-Ġregion al
-Ġload ed
-Ġpers pective
-Ġaut ofluorescence
-Ġsw it
-Ġapprox imal
-Ġresid ents
+Ġner v
+Ġdon or
+Ġabs orption
+Ġmod ification
+r ative
+Ġinstitut ions
+Ġg d
+Ġinc ision
+Ġcomplic ated
+Ġm ood
+ad j
+Ġmean while
+Ġrepro duc
+Ġreceiv er
+Ġster ile
+Ġdrain age
+Ġag ar
+Ġpoly ps
+Ġthor acic
+oz yg
+Ġrev ascular
+Ġres on
+Ġadd ressed
+ci ous
+Ġlapa roscopic
+Ġlymph ocytes
+Ġsupernat ant
+Ġw ind
+Ġmin i
+Ġor d
+Ġconst ipation
+Ġor gans
+b i
+Ġun st
+Ġalle vi
+Ġtim ing
+Ġmetabol ites
+os ity
+Ġvacc ination
+Ġe ating
+ir ubin
+ard ia
+Ġd ia
 Ġnor th
-Ġgrad es
-Ġhydro gen
-Ġpor tion
-tt es
-Ġmis es
-Ġnod e
-Ġhighl ighted
-Ġbarri er
-Ġlact obacill
+Ġsupport s
+Ġmetast ases
+Ġd ut
+Ġse v
+Ġfeed back
+ast om
+Ġel se
+Ġc n
+iat ors
+en em
+Ġsuscept ible
+Ġattach ment
+Ġpack age
+un nel
+Ġmethod ological
 Ġvary ing
-Ġemp ow
-Ġbrazil ian
-Ġrd c
-ocom pati
-Ġcoordin ates
-Ġrp d
-Ġmanufacture r
-Ġdeh isc
-Ġimpair ment
-Ġaccompan ied
-cy cline
-Ġdoxy cycline
-Ġhydroxy apatite
-Ġbit ewing
-Ġcomorbid ities
-Ġchit osan
-Ġoid p
-Ġhns cc
-l ist
-s i
-Ġs f
-Ġs ock
-ed ic
-Ġp it
-Ġan b
-Ġf ed
-Ġf ine
-Ġf ields
-Ġm it
-Ġb ul
-Ġre verse
-Ġe toric
-Ġst ere
-ud ed
-Ġon line
-ab ial
-ter ing
-Ġr ig
-Ġr ays
-Ġch rom
-Ġcomp et
-iv ered
-Ġdis inf
-Ġsc at
-Ġab str
-Ġab use
-Ġint act
-Ġinv isal
-Ġmo b
-Ġcol ony
-Ġ1 5
-Ġmean while
-Ġexamin ing
-Ġradi ological
-Ġsimilar ity
-Ġpath ogenic
-Ġposition ed
-Ġposition ing
-Ġabs orption
-Ġcompl ication
-Ġpers ist
-Ġaut om
-Ġbel ong
-Ġtem pl
-Ġresist ant
-Ġcoh orts
-Ġte le
-Ġbiom echanical
-Ġdel ivered
-Ġmut ations
-Ġansw ered
-Ġpen etr
-Ġten sion
-Ġmicroscop ic
-Ġtren ds
-Ġcheck list
-Ġdrill s
-Ġsupple mented
-Ġpromo ted
-Ġdiscrep ancies
-Ġimmunohist ochemical
-Ġccc ds
-Ġresour ces
-Ġarchitect ure
-Ġouts ide
-Ġegyp t
-Ġatheroscl erosis
-Ġing red
-Ġmul tic
-Ġcla im
-Ġdecont amination
-Ġliqu id
-Ġetoric oxib
-Ġinvisal ign
-c ox
-m m
-s on
-y ing
-in ol
-ti st
-er a
-Ġd c
-Ġd p
-Ġm other
-ro se
-Ġe ver
-Ġn g
+Ġveloc ity
+Ġallow ing
+Ġdef ine
+Ġfib rin
+Ġger d
+Ġrheum at
+Ġdown reg
+ynam ics
+Ġdys lipidemia
+Ġventric le
+Ġcoun s
+Ġrapid ly
+Ġc in
+Ġal kal
+Ġenhance ment
+Ġcarb on
+Ġst ool
+Ġman age
+Ġamount s
+Ġsn ps
+Ġl os
+oph ren
+Ġquant ification
+Ġfo rest
+Ġstat ement
+Ġper ic
+Ġco agulation
+Ġsurg eries
+Ġrabb it
+Ġglycem ic
+Ġus ual
+Ġnormal ized
+Ġre ctal
+Ġdent ition
+Ġpen et
+Ġst a
+Ġpre lim
+Ġinvestig ating
+Ġtub es
+Ġrhy thm
+Ġsag ittal
+Ġprelim inary
+Ġinf ants
 Ġn p
-Ġr aw
-ver ages
-Ġch ile
-Ġdis rup
-em atic
-Ġsc ap
-Ġpl at
-Ġtr ain
-Ġtr igg
-Ġmod ification
-Ġno ticed
-Ġun p
-lec tion
-Ġen amic
-ew ise
-Ġinv ited
-ke y
-Ġbi ocompati
-Ġdiagnos ing
-Ġed ta
-Ġop posite
-Ġcur ing
-Ġ3 0
-Ġmet agen
-Ġlong est
-Ġadj unct
-ob acter
-Ġapp ly
-Ġpal at
-Ġoste ogenic
-Ġinvol ves
-Ġprom in
-Ġenh ancing
-Ġelastic ity
-Ġenc od
-Ġsci ence
-Ġlik ewise
-Ġcandid iasis
-Ġot us
-Ġwil cox
-Ġprotr usion
-Ġperf ect
-Ġinst ance
-Ġshif t
-Ġswallow ing
-Ġcig are
-Ġframewor k
-Ġoverc ome
-Ġwilcox on
-r us
-Ġs es
-ti a
-en sion
-Ġp et
-Ġd pa
-Ġm f
-Ġm ice
-Ġm otor
-Ġb f
-Ġb ic
-Ġto ugh
-Ġst l
-Ġl c
-Ġg aps
-ol abial
-Ġas ian
-Ġr ms
-Ġpro gr
-Ġcom e
-Ġim tm
-Ġch ance
-Ġdis il
-ap se
-Ġsign alling
-Ġap dt
-Ġanal og
-Ġro c
-Ġne ural
-Ġcar tilage
-Ġun f
-Ġk ind
-Ġval u
-Ġdet r
-Ġris e
-Ġdec isions
-Ġcr c
-Ġman n
-Ġradi otherapy
-Ġbec ame
-Ġform er
-Ġgr am
-Ġimp s
-Ġser ved
-Ġ0 0
-Ġz yg
-Ġcent re
-Ġins pec
-Ġprocess ed
-Ġgl oss
-Ġfl at
-Ġpubl ications
-Ġpart ly
-Ġprov in
-Ġimmun os
-Ġendodontic s
-Ġpropor tional
-Ġmarg ins
-Ġct g
+Ġmet al
+Ġclear ance
+in ent
+of acial
+Ġpsych os
+Ġcanal s
+Ġprincip al
+Ġburn out
+v hd
+ang ed
+Ġcre ate
+Ġvolunte ers
+o a
+Ġsub set
+Ġinteg rated
 Ġshap ed
-Ġspecial ized
-Ġreflec ts
-Ġstim ulus
-Ġdepart ments
-Ġten ax
-Ġtransl uc
-Ġmineral ization
-Ġpredict able
-Ġsyndrom ic
-Ġplace bo
-Ġquanti fied
-Ġbiomark er
-Ġcf m
-Ġur gent
-Ġpediatric ians
-Ġintegr ated
-Ġinfil tr
-Ġmd as
-Ġswed ish
-Ġabnorm al
-Ġabnorm alities
-Ġremineral ization
-Ġrins ing
-Ġdeform ities
-Ġpis a
-Ġpolic y
-Ġci om
-Ġrecept or
-Ġmel an
-Ġupr ighting
-Ġfrail ty
-Ġmacroph age
-Ġvulner able
-Ġog s
-Ġcurric ulum
-Ġprotec tive
-Ġnoti ce
-Ġduw l
-Ġcounterpar ts
-Ġanth rop
-opro te
-Ġempow erment
-Ġprogr amm
-5 8
-e th
-k er
-o ints
-r il
-r ia
-w th
-w an
-Ġ ure
-Ġ ib
-Ġt p
-Ġt as
-in ated
-ti ves
-Ġp ict
-Ġd f
-Ġd ye
-Ġm ouse
-Ġb and
-Ġb ands
-Ġh u
-ac ari
-ac ryl
-im ination
-Ġus s
-Ġus es
-Ġde position
-Ġcomp an
-em at
-Ġsc en
-Ġap position
-Ġind ia
-Ġfo rest
-ell ow
-Ġmod es
-Ġob t
-Ġint ended
-one y
-olog ous
-ast oma
-Ġspec ified
-adi an
-Ġdisc ol
-Ġgener ations
-te gr
-Ġi o
-Ġform ing
-Ġgr adi
-Ġem g
-Ġz ones
-Ġwor ks
-Ġobtain ing
-Ġimpro ves
-Ġsch ed
-Ġdist ress
-Ġintra operative
-Ġconsider ably
-Ġconsist ently
-Ġinvol ve
-Ġoh s
-Ġpap acari
-Ġdig itiz
-Ġjaw s
-Ġdispl ay
-Ġflow able
-Ġendodontic ally
-Ġcontrib ution
-Ġte gd
-Ġsatis factory
-Ġreason able
-Ġdel ayed
-Ġstim ul
-Ġtop ic
-Ġpromot es
-Ġmaintain ing
-Ġnas olabial
-Ġrepl acement
-Ġmill im
-Ġbin ding
-Ġpass ive
-Ġdrill ing
-Ġmanufact uring
-Ġent ered
-Ġstre t
-Ġincorpor ation
-Ġstar ted
-Ġinequ alities
-Ġdu o
-Ġtherm al
-Ġenzym e
-Ġjud ge
-Ġox ide
-Ġaffili ation
-Ġattem p
-Ġtetr acy
-Ġamelobl astoma
-opos terior
-Ġanter oposterior
-Ġadp j
-Ġdiagn ose
-Ġplat form
-Ġpapacari e
-Ġtegd ma
-7 4
-b i
-h i
-p ass
-on ym
-en es
-en esis
-al s
-Ġc ured
-Ġc ame
-Ġp el
-Ġp eptid
-Ġw is
-Ġd os
-Ġd up
-or ial
-an ol
-Ġb b
-le ts
-ac tic
+Ġlum bar
+Ġbec ame
+Ġeffort s
+Ġschiz ophren
+Ġdiscr imin
+ect or
+ugh t
+Ġchild hood
+Ġsupplement ed
+op aus
+iz umab
+Ġpolymorph isms
+Ġdoct or
+Ġprophyl axis
+Ġd h
+Ġcomple tion
+Ġansw er
+Ġanal yt
+Ġassist ed
+opaus al
+Ġn ic
+Ġsu ffered
+Ġang ina
+Ġlarge ly
+iel ds
+wh ere
+re es
+Ġstat in
+path y
+Ġsimultaneous ly
+Ġreper fusion
+Ġ1 1
+Ġmicrob ial
+Ġagg ressive
+roplast y
+Ġhypox ia
+Ġcoch rane
+Ġs ars
+Ġw il
+Ġha ir
+ak ing
+Ġview s
+Ġto b
+Ġle t
+Ġcort isol
+Ġe b
+Ġcontin ue
+Ġra ce
+Ġpept ide
+ur ity
+Ġa id
+ot om
+Ġconn ected
+Ġchew ing
+Ġse gments
+Ġif n
+Ġelect roph
+Ġapp end
+ar th
+Ġsci ence
+Ġinhib its
+Ġdisch arged
+Ġmagn itude
+i ra
+Ġex acer
+Ġle aves
+Ġco up
+Ġmaintain ing
+Ġexacer b
+Ġf ist
+et om
+Ġfor ces
+Ġobser ve
+Ġemb ed
+Ġga ve
+Ġrest rict
+p ass
+oc ated
+Ġgra di
+Ġrepresent ing
+Ġcomp osed
+Ġsug ar
+Ġvalu able
+Ġsus tained
+Ġcolon ic
+Ġcirc ulation
+Ġminim ize
+Ġf p
+Ġc g
+Ġfac ult
+Ġachie ving
+Ġexhib it
+Ġstratif ication
+Ġn g
+Ġam yl
+Ġt al
+Ġadj uvant
+Ġart ific
+Ġ ile
+Ġver ified
+ine phrine
+Ġent ry
+an a
+Ġir rig
+Ġm other
+end s
+itu itary
+Ġenroll ment
+etom idine
+Ġst ain
+Ġcor d
+Ġaut ophag
+hy de
+Ġig f
+oun ted
+Ġul cers
+Ġn ation
+Ġphen olic
+ipl inary
+ore r
+Ġind uces
+ther n
+Ġab use
+c y
 Ġl p
-ud i
-Ġcon ce
-Ġcon clud
-id s
-id ent
-Ġper for
-Ġex h
-Ġex ists
-Ġex erc
-Ġgroup ed
-Ġdis cl
-Ġse p
-Ġsc aps
-Ġco x
-ch ym
-Ġtr ism
-Ġmod ifications
-Ġne utr
-Ġaf ric
-Ġint en
-Ġy ellow
-Ġfol d
-Ġdes ired
-Ġar g
-Ġag enesis
-pos ing
-Ġdisc ipl
-Ġclass ify
-Ġsp an
-Ġbl inding
+Ġnerv ous
+i qu
+ic ed
+Ġrup ture
+us cular
+de hyde
+Ġp ituitary
+Ġd n
+Ġdifferent iated
+Ġover c
+Ġdemonstr ates
+Ġreg ulating
+Ġdiver se
+ul us
+Ġincre ment
+Ġsub t
+ob last
+Ġdiarrh ea
+en ol
+Ġund erest
+Ġspecial ist
+Ġrelie f
+Ġcollab oration
+Ġpum p
+om an
+il ateral
+Ġrec all
+Ġexpress ions
+o ter
+Ġpr on
+Ġra w
+Ġrem ove
+Ġref ract
+reg ular
+act ic
+Ġdeterm in
+aryn g
+Ġtask s
+Ġreson ance
+Ġdist illed
+Ġfd g
+Ġanth rop
+ens in
+Ġmar ital
+Ġmob ile
+Ġir regular
+Ġwind ow
+Ġpsychos ocial
+6 5
+Ġl s
+Ġlead ers
+Ġsequ ential
+Ġdex med
+2 5
+Ġac l
+Ġent ered
+ul y
+roph ic
+Ġplas m
+Ġdexmed etomidine
+Ġb s
+Ġext ubation
+iot a
+Ġdil uted
+Ġaccel er
+Ġpo orer
+Ġhip p
+Ġport ion
+Ġc is
+Ġin g
+Ġbil irubin
+ex p
+Ġb ott
+ill ing
+Ġtri age
+um b
+s on
+ro tic
+Ġmin ute
+Ġemploy ment
+Ġprovid er
+Ġroutine ly
+Ġcaus al
+Ġepisod e
+Ġeff icient
+Ġtarget ing
+Ġprod ucing
+Ġcab g
+Ġj our
+Ġf ish
+Ġhe aring
+Ġaim s
+ro se
+od em
+Ġd b
+em ber
+Ġhist ology
+Ġcod ing
+Ġax ial
+Ġp fs
+Ġ20 20
+Ġtr y
+Ġph ases
+Ġpredominant ly
+2 7
+Ġtem poral
+Ġextra cellular
+Ġch ance
 Ġwor th
-Ġwor ds
-Ġer a
-Ġmulti d
-Ġhygi en
-Ġpulp al
-Ġcap ping
-Ġthick ening
-Ġref lex
-Ġdepth s
-Ġlack ing
-Ġclos ing
-Ġcp i
-ocy cl
-Ġsil ver
-Ġmineral ized
-Ġrepl aced
-Ġhem is
-Ġoff ers
-Ġintegr ity
-Ġnone theless
-Ġsuccessful ly
-Ġnutr ition
-Ġevent ually
-Ġtherm ocycl
-Ġmix ture
-Ġord inal
-Ġattr ition
-Ġvide o
-Ġpreser vation
-Ġlithuan ian
-Ġemb ed
-Ġadvance ment
-Ġconv olution
-Ġupreg ulated
-crib ed
-Ġprofil es
-Ġgovern ment
-Ġsen ior
-Ġvolunte ers
-Ġvox el
-Ġoutpati ent
-Ġdetr im
-Ġinspec tion
-Ġscen ari
-Ġwis dom
-Ġtrism us
-f ungal
-h and
-l o
-n ce
-y les
-z o
-Ġ ud
-Ġthe ory
-Ġp ig
-Ġp ure
-Ġp og
-Ġf iss
-Ġd on
-Ġre n
-Ġn ative
-Ġg p
-Ġv ast
-Ġv gg
-Ġr ich
-Ġr ating
-Ġex ported
-Ġch ip
-Ġpre par
-Ġcl ock
-em en
-end it
-Ġne uro
-Ġaf ore
-Ġen a
-Ġen able
-Ġso le
-Ġdec ided
+Ġlum en
+Ġt ap
 Ġ2 4
-Ġmin utes
-Ġform al
-Ġend oc
-Ġindivid ually
-Ġselec tive
-Ġrem ark
-Ġprac tical
-Ġpred is
-Ġapp arent
-ffici ently
-Ġpath ways
-Ġanti fungal
-Ġvit ality
-Ġnorm ative
-Ġhand ling
-Ġref r
-Ġrele ased
-Ġexp endit
-ang er
-Ġcontrib uting
-Ġcari ogenic
-Ġlip s
-Ġview s
-Ġregular ly
-go ing
-acti vity
-acti vation
-anes e
-Ġdefin itive
-Ġquanti fication
-Ġcf u
-Ġtarget ed
-Ġcran ial
-Ġrequire ments
-Ġmetabol ism
-Ġincorpor ated
-Ġautomatic ally
-Ġcc u
-Ġedentul ism
-Ġfabric ation
-Ġrins ed
-Ġincid ents
-Ġhorm ones
-Ġradioluc ent
-oin tegr
-Ġfeas ibility
-Ġpack age
-Ġcomprom ised
-Ġcaregi vers
-Ġorient ation
-Ġcareful ly
-ovir us
-Ġmoun ted
-Ġfas ter
-Ġconj unction
-Ġpromin ent
-Ġdisil icate
-Ġimmunos up
-Ġneutr al
-1 8
-r ical
-t age
-t aken
-z en
-Ġ rom
-Ġt ca
-ti vity
-Ġp k
-Ġp y
-Ġw ors
-Ġm aps
-Ġb all
-Ġh und
-om icro
-ur b
-Ġas king
-Ġcon ometric
-am a
-Ġex er
-Ġex clus
-uc as
-uc tive
-ad j
-Ġch ew
-Ġsh ar
-Ġco urses
-Ġsur pr
-Ġpr ism
-fac ts
-Ġevalu ations
-Ġdec ades
-Ġbr ain
-Ġdef ine
-Ġcur ved
-ak es
-Ġca ucas
+Ġdeg rees
+Ġsupp ly
+Ġqu ite
+Ġj unction
+Ġs chem
+Ġp ig
+Ġdiff use
+Ġster oid
+Ġc cl
+Ġcomp rom
+Ġpre cision
+Ġmod alities
+Ġox ide
+Ġpa ired
+Ġrevascular ization
+am eth
+Ġpc os
+Ġb and
+Ġg al
+ive red
+Ġmanag ers
+Ġm ask
+Ġfol lic
+Ġextreme ly
+e al
+Ġneu ros
+Ġfeel ing
+Ġmicroscop y
+Ġtheoret ical
+Ġref lux
+o u
+3 4
+Ġt f
+Ġan omal
+Ġr ig
+Ġdel ivered
+Ġl ingual
+av ing
+er a
+inf l
+Ġr f
+Ġmed iators
+Ġretros pectively
+Ġmeet ing
+te en
+Ġelect ive
+Ġsoci odem
+Ġsuic ide
+Ġcont ents
+Ġmicrob iota
+Ġs we
+ak en
+ob ic
+Ġtele phone
+Ġest rogen
+Ġweek ly
 Ġcorrel ate
-Ġfill ings
-Ġfl av
-Ġcomb ining
-Ġfe eding
-Ġsens or
-Ġsoci ety
-ward s
-Ġacid s
-Ġpers istent
-Ġfract ured
-Ġequ ation
-Ġwear ing
-Ġta i
-ang ed
-Ġchr on
-Ġcement o
-Ġwall is
-Ġsqu ared
-Ġbre ak
-Ġclean ed
-Ġ201 8
-Ġtransl ated
-Ġcut ting
-Ġbu ffer
-Ġmonit or
-Ġinstit ute
-Ġfav our
-he ad
-Ġpair wise
-Ġbrux ing
+Ġfib er
+Ġrespond ers
+Ġdetect ing
+r ates
+uct ed
+Ġconj ug
+Ġtib ial
+Ġt idal
+Ġh o
+Ġj une
+Ġposs ess
+Ġus a
+Ġsignal s
+r ics
+us ions
+Ġpoly p
+Ġmr sa
+Ġsat uration
 Ġrecogn ition
-Ġtempor ary
-Ġmolec ules
-Ġcentrifug ation
-Ġhabit ual
-Ġcircum st
-Ġretain ed
-Ġcontinu ing
-Ġincid ent
-Ġdg a
-Ġosse ointegr
-Ġretrie ved
-Ġsulf ur
-Ġcompound s
-Ġwhit ney
-Ġyield ed
-Ġspectr um
-Ġarth ritis
-Ġphotograph s
-osa ic
-Ġmetric s
-Ġpseud ovirus
-Ġrejec ted
-Ġsubstr ate
-Ġmir r
-Ġgluc ose
-Ġperiph eral
-Ġtough ness
-Ġvalu able
-Ġzyg omatic
-Ġgradi ent
-Ġtetracy cline
-Ġdetrim ental
-Ġafore mentioned
-a i
-d ul
-e es
-f il
-i ers
-l imin
-Ġ ult
-Ġ xi
-Ġt an
-Ġt ended
-Ġa rom
-Ġa way
-Ġa lex
-Ġs ession
+Ġemp ir
+Ġaden ocarcinoma
+oly sis
+Ġeng agement
+clin ical
+Ġschizophren ia
+Ġtc m
+Ġexam ining
+Ġtop ic
+Ġst aging
+Ġmanag ed
+Ġcur c
+Ġaff il
+Ġprincip les
+1 5
+Ġsubst ances
+Ġregist ration
+Ġpancre as
+g c
+ardi um
+Ġhum id
+f or
+Ġde hyd
+Ġafric an
+ur ic
+op ress
+Ġhypothes ized
+Ġd ors
+im ately
+Ġg ir
+Ġreg ulate
+Ġprov in
+Ġtrig ger
+Ġser ve
+Ġblock s
+Ġs ided
+hy pert
+Ġtop ical
+Ġechocardi ographic
+Ġperf oration
+Ġan k
+Ġtra ck
+Ġcom fort
+Ġchrom os
+Ġstre pt
+Ġap ril
+Ġimportant ly
+Ġmem ber
+Ġanat omy
+Ġmil k
+Ġeth yl
+Ġwh it
+Ġper me
+Ġreason able
+Ġsociodem ographic
+Ġin oc
+Ġm om
+Ġdop pler
 Ġw ays
+Ġb inary
+ac co
+Ġcl osed
+Ġimmunohist ochemical
+Ġtrache al
+Ġunder t
+Ġcort ex
+Ġepith elium
+Ġtrans ient
+Ġmicro organ
+Ġhelp ful
+Ġseek ing
+Ġvide o
+Ġc up
 Ġin ner
-Ġin here
-Ġf ing
-Ġf enes
-Ġd ark
-Ġm ent
-Ġm osaic
-or ic
-Ġb on
-ic ill
-Ġre active
-Ġh c
-om b
-Ġn d
-Ġn ight
-Ġg pt
-ur t
-ce l
-Ġv sc
-res pective
-Ġal d
-Ġr b
-Ġr he
-Ġres orb
-ot rop
-Ġch in
-um in
-Ġpre limin
-Ġcomp ression
-Ġdis tor
-Ġse mi
-oth el
-Ġad en
-ff ering
-Ġco up
-Ġreg imen
-Ġreg ister
-Ġun c
-Ġy emen
-Ġk rus
-Ġwe b
-Ġpo iss
-Ġag p
-Ġsup r
-Ġexper ts
-Ġradi ology
-Ġsp ot
-Ġtyp ically
-Ġextr ac
-Ġbec omes
-Ġunder taken
-Ġbl ot
-Ġend othel
-Ġce mentation
-Ġfr ag
-Ġparamet ric
-Ġir respective
-Ġreview ers
-Ġmechan ics
-Ġeth anol
-Ġvit a
-Ġep is
-Ġhand pi
-gro wth
-Ġalign ed
-Ġhum ans
-Ġachie ving
-Ġmen tion
-Ġcycl ing
-Ġconstr ain
-Ġconstr uct
-Ġvir us
-Ġtoothbrush es
-Ġconsequ ence
-Ġdetect able
-Ġbro th
-Ġread s
-Ġread ing
-Ġhs v
-Ġge ometric
-Ġmar pe
-Ġpass ing
-Ġsa udi
-Ġinterview s
-Ġperson nel
-Ġtumour s
-Ġrestric ted
-Ġhour s
-Ġdirec ted
-Ġdirec tions
-Ġdisp arities
-Ġagg reg
-Ġretur n
-Ġarter y
-Ġkee p
-Ġphoto lysis
-Ġvess els
-Ġmunicip alities
-Ġfif th
-Ġimmers ed
-Ġequival ent
-Ġimt ms
-Ġlibr ary
-Ġlactobacill us
-Ġthermocycl ing
-Ġcircumst ances
-Ġinhere nt
-Ġpoiss on
-0 4
-9 5
-e per
-h s
-h aps
-n c
-o ted
-t ary
-v ine
-Ġt aste
-in ations
-re ct
-Ġs ud
-Ġs ense
-Ġo roph
-Ġo md
-en tical
-Ġc u
-Ġc el
-Ġin e
-Ġf at
-Ġm b
-as ant
-it n
-Ġn os
-tic s
-Ġper haps
-Ġus a
-Ġde al
-Ġde eper
-ys gg
-iv en
-Ġap ril
-Ġtr uth
-Ġrel apse
-Ġun re
-ph one
-Ġar m
-Ġdec om
-Ġ2 3
-ath ers
-Ġsp aces
-Ġmal form
-Ġform ulations
-Ġbl x
-tim es
-Ġdr iven
-Ġposs ess
-Ġterm inal
-Ġid entical
+Ġoste oc
+act ory
+Ġexclud e
+u ed
+Ġanalyz ing
+Ġcontribut ion
+Ġextre m
+Ġafric a
+Ġfibrob lasts
+Ġcomplain ts
+Ġcol i
+Ġinvol ves
+Ġm ds
+Ġoper ated
+Ġelect roc
+Ġopportun ity
+Ġfeas ible
+pe x
+Ġlymph ocyte
+Ġamin o
+Ġsubty pes
+Ġa w
+act ivity
+Ġradi otherapy
+Ġsw elling
+Ġhom ogene
+Ġinh al
+Ġer ad
+Ġsubst it
+Ġtai w
+Ġf ri
+Ġres il
+Ġother wise
+Ġstrong er
+op ic
+Ġhydro gen
+at s
+Ġte a
+Ġres c
+Ġsub cutaneous
+Ġproced ural
+Ġroot s
+Ġact ually
+Ġpred isp
+Ġadv ance
+Ġfacult y
+Ġimpact ed
+Ġincis or
+r ating
+Ġwork pl
+Ġform er
+Ġschool s
+Ġartific ial
+Ġa e
+pl c
+Ġanes thesi
+Ġtob acco
+Ġs es
+Ġoverexp ression
+Ġsur pr
+Ġenh ancing
+Ġar ms
+Ġgradi ent
+Ġmove ments
+Ġc ac
+Ġcandid a
+p ress
+Ġst ra
+gen ital
+Ġflavon oids
+ec al
+Ġhypert rophy
+infl amm
 Ġexperi encing
-Ġocc as
-Ġimm ig
-Ġsmo ked
-Ġprot otype
-Ġuni que
-Ġoste op
-Ġdevelopment al
-ount ered
-ox y
-ox yl
-Ġda i
-Ġhyp o
-Ġdescrib ing
-ta ke
-Ġ5 0
-Ġvol tage
-av y
-Ġnorm ality
-Ġbuc c
+Ġh g
+Ġh und
+Ġat rophy
+Ġdiscontinu ation
+Ġset s
+Ġdec ades
+Ġdom inant
+isc iplinary
+Ġdivers ity
+Ġwithdraw al
+Ġcart il
+Ġf ab
+Ġk ind
+cer al
+Ġeth iop
+Ġrecommend ation
+Ġadapt ed
 Ġpap ers
-Ġrespond er
-Ġvolum es
-af ter
-Ġrefer ring
-Ġmes h
-Ġaim s
-Ġbo vine
-Ġcp itn
-Ġconstr uction
-Ġsus tain
-Ġadmin istr
-Ġsubst ances
+1 00
+ch ol
+ure us
+ast e
+Ġtrans m
+Ġdetermin ants
+Ġintra cranial
+Ġmir na
+op enia
+Ġnon s
+Ġmonth ly
+Ġult imately
+Ġorth op
+Ġsupplement ary
+Ġsc r
+Ġmicro c
+Ġn k
+Ġdis l
+Ġillust rated
+Ġant ide
+Ġcle ft
+Ġ ice
+Ġpoor ly
+Ġoper ator
+Ġsubsc ales
+Ġcommerc ial
+Ġa ureus
+Ġscre en
+Ġmagn ification
+Ġsched uled
+Ġwal king
+Ġelse where
+Ġd ed
+Ġarth roplasty
+j i
+Ġb ov
+Ġut ility
+6 4
+r d
+Ġwe b
+Ġem pt
+Ġpress ures
+Ġcon ven
+Ġres ident
+Ġk i
+Ġen ab
+Ġventil ator
+Ġadip ose
+Ġdiscrep ancy
+Ġunderg one
+Ġh oney
+Ġel ast
+Ġexer cis
+Ġby pass
+roscop y
+Ġdiscr imination
+Ġr ib
+Ġhyperg lycemia
+Ġos cc
+Ġangi ogenesis
+Ġaustral ia
+Ġviol ence
+z en
+un ately
+Ġrele ased
+Ġsn p
+Ġantide press
+Ġoste o
+Ġin put
+Ġm f
+Ġaction s
+Ġmanufact ure
+Ġa z
+oun ced
+Ġdeterior ation
+ot rop
+iv ir
+Ġtrans verse
+Ġprov ision
+Ġpurp oses
+Ġlear n
+Ġpret reatment
+Ġgeneral ized
+ffici ency
+Ġhr qol
+Ġaspir in
+Ġrefract ory
+Ġelectroc ardi
+i ar
+Ġe cc
+Ġtr ip
+Ġpath ogenic
+Ġele ment
+Ġha pp
+Ġtm d
+ion e
+Ġl ad
+Ġcomplex ity
+Ġe ct
+Ġcons cious
+Ġresearch er
+Ġepid ural
+Ġrequire ment
+Ġam el
+Ġchec ked
+Ġneur ons
+Ġpromot ion
+Ġprogram me
+at ter
+Ġblock ers
+Ġ201 9
+Ġyield ed
+Ġfocus ing
+Ġhf d
+Ġphys i
+Ġoff ered
 Ġwa iting
-Ġtub es
-Ġbar s
-Ġill ness
-Ġenc ountered
-Ġdiamet ers
-Ġhouse holds
-omat ous
-Ġbin omial
-Ġhom ogeneity
-Ġphen otype
-Ġpeak s
-Ġnucle ar
-Ġnod es
-Ġabund ant
-Ġcytok ine
-Ġsuperim posed
-Ġcapt ure
-Ġnutr itive
-Ġrestric tions
-Ġeros ion
-Ġenzym es
-Ġmarked ly
-Ġcreat ing
-Ġosteocl ast
-Ġhypothes ized
-Ġpis f
-Ġteach ing
-Ġalle vi
-Ġclar ify
-Ġdegen eration
-Ġradiolog ist
-Ġsubtyp es
-Ġschneider ian
-Ġtox ic
-Ġabstr acts
-Ġexh aled
-Ġud ma
-Ġpog onion
-Ġsurpr ising
-Ġosseointegr ation
-Ġbon fer
-Ġkrus kal
-Ġendothel ial
-b re
-d es
-n ers
-o um
-o tid
-r ax
-t ered
-w here
-z e
-Ġ qol
-Ġt t
-er ies
-Ġp c
-Ġp v
-Ġin ability
-Ġf athers
-Ġd ut
-Ġd ense
-Ġb m
-Ġb od
-ar tile
-us ted
-ul ed
-Ġn urs
-im ent
-ur is
-et al
-os ens
-od es
-uc cal
-ot e
-qu artile
-pl es
-Ġcomp ati
-ial s
-ap er
-Ġhe avy
+Ġdest r
+Ġint est
+Ġag on
+lic ate
+f low
+Ġt lr
+urg ical
+Ġhar v
+Ġch ose
+Ġpoly ph
+at t
+ro x
+Ġan astom
+oc amp
+Ġreg ister
+Ġevalu ations
+Ġinvestig ator
+Ġd osing
+Ġde gen
+Ġdec ided
+Ġtransform ation
+Ġcurc umin
+Ġint act
+Ġmir nas
+Ġrare ly
+Ġmultic enter
+Ġmill ion
+ar ia
+Ġoff ice
+Ġper cutaneous
+Ġneut ral
+Ġampl ification
+c ox
+om b
+Ġhypoth yroidism
+Ġelect ron
+Ġos a
+Ġsh r
+Ġconsequ ence
+Ġw c
+ut in
+Ġtest osterone
+Ġpr ism
+Ġabs ent
+s in
+Ġtr ust
+Ġacc ounted
+Ġsp ent
+Ġmark et
+Ġintegr ity
+Ġman n
+Ġdepart ments
+Ġoxygen ation
+Ġhp v
+Ġm as
+Ġg s
+iv ac
+Ġpart ly
+Ġhead ache
+o form
+em at
+Ġbov ine
+d ay
+ell ow
+ins ic
+pati ents
+Ġansw ers
+Ġretrie ved
+Ġvirt ual
+Ġal p
+Ġexpect ations
+ag re
+Ġwor ds
+ok in
+Ġmat ter
+Ġposition ing
+Ġconc ord
+Ġmot ivation
+Ġsubstant ially
+Ġtriglycer ide
+Ġtriglycer ides
+Ġara b
+Ġdich otom
+Ġembed ded
+Ġmap k
+Ġg yn
+Ġgl ands
+Ġ00 1
+Ġcartil age
+n atal
+Ġde le
+Ġu a
+Ġan ch
+Ġre ct
+Ġoh r
+Ġd imin
+Ġpartic les
+Ġcyt ometry
+Ġinst ability
+Ġur ic
+an olic
+Ġra ised
+Ġb ol
+ch ed
+Ġident ical
+Ġsens it
+Ġinc id
+Ġgl omer
+Ġdissol ved
+1 8
+Ġcomb inations
+Ġcoord in
+Ġh plc
+if i
+Ġfl oor
+Ġconst itu
+Ġsupp ressed
+Ġspec ified
+Ġdm ft
+Ġobtain ing
+or ous
+Ġappl ications
+Ġrad ial
+rag m
+Ġp uncture
+Ġattenu ated
+Ġhund red
+Ġexpl or
+Ġhipp ocamp
+av y
+Ġm ace
+Ġste atosis
+Ġjour nal
+y r
+Ġk ap
+Ġconsider ably
+Ġd bp
+Ġattempt s
+Ġfeel ings
+h s
+Ġcon verse
+Ġso fa
+Ġassum ption
+Ġp on
+Ġheterogene ous
+Ġgest ational
+b d
+p cr
+Ġf f
+Ġsevere ly
+Ġneon atal
+Ġurg ent
+ivac aine
+l ist
+h olic
+Ġup d
+yl in
+ed s
+as one
+Ġcom e
+Ġsuper f
+Ġvas opress
+Ġultras on
+Ġe q
+Ġread mission
+Ġatheroscler otic
+il ization
+Ġex clus
+Ġpar a
+Ġa pex
+Ġin e
+Ġsens ory
+Ġorganization al
+Ġc x
+Ġre inf
+am ination
+Ġco ugh
+Ġsup ine
+Ġve get
+Ġhom ogen
+Ġohr qol
+Ġt l
+Ġp ure
+Ġtrans lation
+Ġobser ver
+omy cin
+Ġinflu ences
+9 0
+rom b
+Ġi od
+Ġdepend s
+Ġradical s
+Ġf usion
+Ġle ave
+Ġscre w
+Ġmethyl ation
 Ġap art
-Ġle akage
-end er
-Ġreg ul
-Ġreg istry
-Ġtooth ache
-Ġinter quartile
-ens ed
-Ġvari ants
-Ġk id
-Ġwe alth
-Ġup ward
-Ġinv ag
-Ġcol um
-Ġcr ack
-Ġman aging
-Ġj our
-Ġmicro g
-te en
-Ġmand atory
-Ġconf ig
-br al
-Ġet ch
-Ġwor d
-Ġend o
-Ġce mented
-Ġmulti fact
-Ġmuc oad
-Ġoc n
-Ġpredic ting
-red ict
-Ġiniti ated
-Ġsl ot
-Ġfe br
-Ġphys i
-Ġphys ician
+Ġgo als
+Ġw ire
+Ġmc f
+Ġcalc ification
+Ġworkpl ace
+Ġc ig
+Ġc atal
+Ġmet form
+ass ium
 Ġabs cess
-Ġcap able
-Ġconfirm ing
-Ġaut ologous
-Ġeff orts
-Ġlarge ly
-Ġmes io
-Ġpros thesis
-oma xillary
-roph ic
-Ġcommun ities
-Ġpostoperative ly
-Ġnor thern
+Ġthres holds
+Ġderm at
+Ġcareful ly
+Ġautom ated
+it ual
+Ġcomp art
+Ġsp an
+Ġpow der
+Ġmiss ed
+Ġwe an
+Ġhe x
+Ġmetform in
+Ġdm so
+c an
+Ġp k
+Ġsup ra
+Ġpromot es
+Ġcomplement ary
+Ġ ug
+Ġl d
+Ġsc ann
+Ġwork load
+Ġmy c
+Ġsud den
+o in
+ic les
+Ġpot assium
+Ġinvol ve
+Ġalign ment
+Ġquart ile
+u ous
+Ġse eded
+Ġc ure
+Ġweight s
+ert ility
+Ġpts d
+Ġsev oflurane
+Ġgroup ed
+Ġdirect ed
+Ġaden oma
+kn ow
+Ġp ict
+ac c
+Ġso le
+Ġ5 0
 Ġfood s
-Ġhelp ful
-Ġsil ness
-Ġeas ier
-Ġavoid ing
-Ġic u
-Ġsyndrom es
-Ġadap ted
-Ġdown ward
-bm t
-Ġminim ally
-ron i
-Ġprogress ive
-Ġorthodon tist
-Ġelimin ated
-Ġgraf ts
-Ġscrew s
-Ġsubstit ute
-Ġinjur ies
-Ġcentrifug ed
-Ġdisp ers
-Ġemphas ized
-Ġspe aking
-Ġcrystal l
-Ġfeas ible
-Ġharm ful
-Ġdichotom ized
-Ġextreme ly
-Ġcompart ment
-Ġattain ment
-Ġpolymorph ism
-Ġdistingu ish
-Ġantic ip
-Ġcontrovers ial
-Ġopin ion
-Ġmob ile
-Ġingred ients
-Ġunp redict
-Ġunf av
+Ġpp i
+Ġpron ounced
+Ġst orage
+ol id
+Ġ3 1
+Ġunivers al
+Ġc ari
+Ġinfar ct
 Ġanthrop ometric
-acryl ate
-Ġembed ded
-Ġhund red
-adj usted
-Ġnurs ing
-Ġmultifact orial
-Ġmucoad hesive
-3 8
-7 5
-8 1
-c ular
-d ay
-f r
-f ts
-h ow
-l oad
-m on
-o fer
-p ir
-u ed
-x ial
-Ġ ions
-Ġt un
-on ate
-Ġo i
-er n
-Ġc ities
-ed ents
-Ġw et
-Ġf ix
-Ġm ess
-Ġm arch
-Ġb ss
-Ġh m
-ul y
-ac er
-Ġl a
-Ġl ich
-Ġl tt
-Ġn ic
-il st
-Ġcon comit
-id al
-id ing
-ab led
-Ġv enti
-Ġv ick
-Ġwh ilst
-um er
-pl an
-Ġsh allow
-ers ens
-Ġsc tg
-Ġap b
-Ġap n
-ia xial
-act ing
-Ġfo a
-Ġcont amin
-Ġcont our
-Ġpl ans
-Ġtr act
-Ġreg ulations
-Ġfin ishing
-Ġcr ude
-Ġ2 5
-Ġsp ine
-Ġhy rax
-Ġmet all
-ulti m
-Ġcondition ing
-arg ed
-Ġsome times
-Ġfr ont
-Ġgreat ly
-art oum
-Ġconduc ting
-Ġapp ra
-Ġprovid er
-Ġsl s
-Ġhyp ersens
-Ġmid w
-Ġsystematic ally
-Ġlocal ized
-Ġcontrib utes
-Ġct cc
-Ġartic le
-Ġ201 9
-Ġmagn etic
-Ġtmj s
-Ġread ings
-Ġhs ct
-Ġtemper atures
-Ġerup ted
-Ġbu ild
-Ġcop ing
-Ġcf nas
-Ġincor rect
-Ġretr action
-Ġcam era
-Ġsar me
-Ġcolon ization
-Ġbal anced
-Ġdefinition s
-Ġepidem i
-Ġfluorid ated
-Ġosteocl asts
-Ġtap er
-Ġaffili ated
-Ġattem pt
-Ġsusp ension
-Ġpu fa
-Ġnation ality
-Ġapplic able
-Ġequip ment
+Ġcon genital
+Ġinf ant
+Ġmanag ing
+ameth asone
+an ium
+Ġon to
+Ġcontrovers ial
+Ġmaloc clusion
+Ġconverse ly
+Ġal d
+Ġres idence
+Ġhe avy
 Ġmeaning ful
-Ġlea ving
-Ġfulfill ed
-Ġcool ing
-Ġkh artoum
-Ġdiv ision
-acc ur
-Ġtele phone
-Ġmf c
-oprote in
-Ġprism a
-Ġrb f
-Ġbonfer roni
-Ġfebr uary
-Ġlich en
-Ġconcomit ant
-Ġvick ers
-a res
-d i
-f low
-f lex
-g one
-m ds
-t ex
-Ġ ultim
-Ġa e
-re am
-Ġth reat
-Ġs ib
-ti um
-en h
-Ġc as
-Ġp anc
-Ġp bs
-Ġw c
-Ġw ant
-Ġin accur
-Ġan t
-Ġan onym
-Ġf us
-Ġd ed
-Ġm if
-Ġm tt
-Ġb odies
-Ġto ler
-Ġl uting
-Ġn ac
-Ġg ma
-Ġwi der
-os in
-Ġas pir
-Ġon going
-Ġper me
-Ġis o
-Ġse aled
-Ġse eded
-Ġdent ofacial
-Ġbet el
-Ġsc ope
-Ġind ustr
-ous ly
-st ream
-Ġro s
-Ġne ut
-Ġinter s
-Ġy o
-Ġover weight
-Ġamong st
-Ġund es
-Ġ2 7
-Ġ2 9
-Ġsurg eries
+Ġl in
+Ġlig ament
+Ġfil ter
+Ġsurpr ising
+duct ive
+Ġcig are
+Ġpe g
+Ġautophag y
+Ġf ro
 Ġfirst ly
-Ġsp ring
-Ġmin istry
-Ġextr insic
-Ġmand ib
-Ġcalc ulations
-Ġi ot
-Ġop mds
-Ġcharacter ization
-Ġbl ast
-Ġz ro
-vic e
-Ġfr ontal
-Ġcle fts
-ob uccal
-Ġpath ogenesis
-Ġdemonstr ates
-Ġiniti ation
-Ġcontr ad
-Ġsu ffered
-Ġsu fficiently
-Ġpa rotid
-Ġlas ers
-Ġcult ures
-Ġregard s
-Ġmm p
-Ġrot ated
-Ġpros th
-Ġact ually
-roph ot
-Ġmark et
-Ġinhib ited
-Ġsubs et
-Ġassum e
-Ġelectr ic
+Ġantico agul
+ter m
+Ġind ucing
+Ġprob ing
+Ġevent ually
+Ġdis ap
+pl an
+Ġgreat est
+Ġendomet ri
+Ġsubstr ate
+in eral
+ch ron
+Ġm oral
+oc on
+ad s
+Ġbr id
+Ġcod ed
+Ġdes c
+ro vascular
+Ġbe aring
+Ġun fort
+af ter
+Ġintra oral
+Ġepid erm
+Ġac know
+Ġprom pt
+Ġper m
+Ġsh are
+Ġcent res
+Ġimpact s
+Ġapp ly
+path etic
+Ġhu ve
+Ġp as
+om ing
+Ġrel atives
+Ġant if
+m en
+Ġgener ate
+Ġclean ing
+Ġgran ul
+Ġgro und
+Ġsqu am
+Ġcaps ule
+as m
+il st
+Ġchang ing
+Ġswed ish
+a res
+Ġo wing
+ogra ms
+Ġmes h
+Ġsta phyl
+3 0
+Ġp u
+ion ed
+Ġdistribut ions
+Ġsubsc ale
+a emia
+Ġtb i
+Ġh ous
+Ġr b
+Ġneutrophil s
+Ġfif th
+Ġfist ula
+6 7
+Ġwh ilst
+oc omp
+oper ation
+Ġcm v
 Ġreach ing
-Ġexce ption
-ect in
-Ġorgan ic
-Ġbro wn
-Ġdefin ite
-Ġhem at
-Ġproblem atic
-Ġdrill ed
-Ġphen otypes
-Ġdiss atis
-Ġtempor al
-Ġpf as
-Ġhighl ight
-Ġcontext ual
-Ġnumer ical
-Ġinhibit ory
-Ġlact ofer
-Ġconver sion
-Ġreflect ance
-Ġremineral isation
-Ġrd na
-Ġprincip le
-Ġwindow s
-Ġcreat inine
-Ġincons ist
-Ġradioluc ency
-Ġspe ech
-Ġox id
-Ġwash ed
-Ġsy ring
-Ġsed ent
-Ġtransport ation
-Ġrecept ors
-Ġanalges ic
-Ġprobiotic s
-Ġadhere nce
-Ġosse ous
-Ġkeratin ized
-Ġspect rophot
-Ġbreath ing
-Ġfric tion
-Ġacceler ated
-Ġovere x
-Ġmoti vation
-Ġorthop edic
-Ġaccoun ting
-Ġaustral ia
-Ġsupplement ary
-Ġglaz e
-zer land
-Ġhaz ards
-Ġmethan ogens
-Ġirre versible
-imm une
-Ġpharm ac
-Ġswit zerland
-Ġbul k
-Ġ00 1
-Ġtas ks
-Ġconclud e
-chym al
-Ġmultid isciplinary
-Ġconvolution al
-Ġprepar ations
-Ġtai wan
-Ġchron ological
-Ġprelimin ary
-Ġextrac ellular
-Ġnic ot
-Ġlactofer rin
-2 0
-4 7
-c ious
-d am
-h y
-i i
-m ber
-m osph
-s ted
-z yg
-Ġt s
-re qu
-al ign
-Ġp ear
-Ġw est
-Ġw its
-Ġan not
-Ġd imin
-Ġd anger
-at um
-an ia
-Ġb ending
-Ġb iaxial
-Ġh rqol
-it a
-it ting
-ac r
-ve mber
-ly tic
-Ġwi res
-et erm
-Ġfor ty
-Ġcon ve
-Ġv l
-Ġcom es
-Ġis q
-Ġch ose
-Ġat mosph
-Ġac et
-Ġac know
-Ġac uris
-Ġass ays
-Ġco il
-Ġco hesive
-Ġpar af
-Ġinf ant
-Ġpl acing
-Ġno vember
-Ġk a
-raph s
-Ġmo ved
-Ġtime ly
-Ġdec edents
-Ġfir ing
-Ġexper t
-Ġdef lection
-Ġless er
-Ġdist urb
-Ġcollec t
-Ġinstru mented
-Ġlength s
-Ġacid ic
-Ġguid ance
-Ġeff ort
-Ġsymptom atic
-Ġmes en
-Ġintere sted
-Ġpolym ers
-Ġclos er
-Ġprec eding
-Ġnecess ity
-Ġstate ments
-Ġexhib iting
-Ġgrad ual
-Ġconcentr ated
-ather apy
-ogr aft
-Ġoperative ly
-Ġsearch ed
-Ġsil icate
-Ġster oid
-Ġpen icill
-Ġexce l
-Ġreal istic
-Ġactive ly
-Ġtend s
-Ġmonit ored
-Ġtf a
-Ġmass eter
-Ġmanufact ured
-Ġthres holds
-Ġsul cus
-Ġauto immune
-Ġmanifest ation
-Ġprojec tion
-Ġmic rom
-Ġgly c
-Ġexclud e
-Ġhypothes es
-Ġmeet ing
-Ġvide os
-Ġvene er
-Ġbound ary
-Ġfric tional
-Ġtransplant ation
-alg ia
-Ġrr na
-Ġter ti
-Ġbrief ly
-Ġnig dul
-Ġsupern umer
-Ġcorro bor
-Ġbiocompati bility
-Ġarom atherapy
-Ġepis odes
-Ġoroph aryngeal
-Ġmalform ations
-Ġkid ney
-81 13
-Ġpanc re
-Ġiot n
-Ġsedent ary
-Ġsupernumer ary
-3 58
-d ba
-g ence
-l ass
-l ined
-m art
-o king
-p cr
-t ability
-t te
-w ha
-x im
-Ġt akes
-en et
-Ġc k
-Ġp ie
-Ġp ips
-Ġp bmt
-Ġin n
-Ġd fs
-Ġb il
-ic it
-Ġh o
-le uk
-Ġe osin
-Ġst ay
-Ġl ub
-Ġl av
-ur ized
-os por
-ol is
-ati al
-Ġal kal
-Ġr ub
-Ġr ater
-Ġr nc
-Ġbe au
-ad a
-ad s
-Ġde le
-pl ied
-Ġgro wn
-ap h
-Ġcl r
-Ġperi operative
-Ġap atite
-ip h
-Ġcan adian
-Ġpl wha
-Ġall ogene
-ch es
-Ġtr ap
-Ġtr action
-Ġmod ule
-Ġreg ulation
-Ġob l
-Ġthere after
-Ġen velop
-Ġpo in
-Ġperform ances
-Ġdur ations
-Ġcor tex
-Ġar row
-Ġchan nel
-Ġ2 8
-Ġsup press
-Ġsp atial
-Ġed m
-Ġhy flex
-Ġtrans ition
-Ġdi ode
-Ġgr a
-Ġconf lic
-Ġvis c
-Ġneed ing
-Ġwor ked
+Ġfe cal
+Ġorth odont
+Ġopin ion
+Ġb und
+Ġex ch
+Ġqu ar
+Ġhy brid
+Ġweak ness
+Ġfib ers
+Ġnod ules
+Ġunst able
+Ġf c
+ot rans
+Ġsub s
+Ġsim pl
 Ġsecond ly
-Ġend ed
-Ġstandard ised
-Ġel se
-Ġfr ame
-Ġfr ank
-Ġcent ered
-par ative
-Ġins ight
-Ġsmo ke
-Ġloss es
-Ġprot ect
-Ġpath ologies
-Ġpub er
-Ġpub med
-Ġintra ven
+Ġintest ine
+n f
+en ess
+Ġrem if
+Ġtit anium
+Ġres ting
+Ġaccept ance
+Ġclaim s
+v a
 Ġver bal
-Ġproduc ing
-Ġmem ory
-Ġvalid ate
-Ġcompl icated
-Ġpulp itis
-Ġhospital ization
-Ġsym m
-Ġmiss ed
-Ġu k
-Ġret ro
-Ġsyn erg
-oles ter
-Ġ4 0
-Ġintern et
-Ġfree hand
-Ġexam ples
-Ġrot ational
-Ġpan el
-Ġdeep est
-asc ial
-Ġdel ay
-ov ered
-Ġoptim ize
-Ġinstruc tion
-Ġassum ing
-Ġavoid ed
-Ġpredict ability
-Ġinstit utions
-Ġq pcr
-Ġadjust ments
-Ġdocu mentation
-Ġnucle i
-oh ydr
-Ġcarb ohydr
-Ġcompr ising
-Ġther mo
-Ġaesthetic s
-Ġinhibit ors
-Ġsubstanti ally
-Ġprin ting
-ococ cus
-Ġinterd isciplinary
-Ġdeli ver
-Ġbox es
-Ġcommerc ially
-Ġcollab or
-Ġcoordin ate
-Ġhorm one
-Ġagg ress
-Ġmanufacture rs
-Ġstreptococ ci
-Ġsed ation
-Ġretur ned
-Ġinjec ted
-Ġdisadvant aged
-Ġtransform ed
-Ġoverlap ping
-Ġcustom ized
-Ġcdt b
-iver gent
-Ġhar ves
-Ġquad rant
-Ġmom ent
-Ġtax a
-Ġscr atch
-Ġkore a
+Ġvisual ization
+an th
+Ġsatisf ied
+Ġethiop ia
+Ġparen tal
+Ġantico agulation
+Ġresil ience
+Ġdep osition
+Ġconc urrent
+Ġphot ograph
+Ġleak age
+Ġact ing
+Ġgo ing
+st it
+Ġinter m
+Ġremif entanil
+Ġh am
+v as
 Ġresol ved
-Ġsuperv ision
-Ġcortic oster
-Ġpredominant ly
-Ġbelong ing
-Ġtempl ate
-Ġmetagen omic
-Ġdf dba
-Ġdigitiz ed
-Ġexclus ively
-Ġhandpi ece
-Ġjour nal
-Ġhypersens itivity
-Ġnac lo
-Ġneut rophil
-Ġyo uth
-Ġsyring e
-Ġpear son
-Ġmesen chymal
-Ġbeau ti
-Ġallogene ic
-h ab
-h op
-i ro
-k en
-r t
-r an
-r ants
-w a
-x cl
-Ġt g
-Ġs enti
-Ġo il
-al e
-Ġc xcl
-Ġp olar
-Ġw arm
-Ġan emia
-Ġf ren
-Ġd n
-at t
-Ġb t
-Ġre p
-Ġre parative
-Ġh et
-Ġl me
-Ġn amed
-ig ence
-ol i
-am p
-Ġv ap
-res tal
-Ġwh tr
-Ġex isted
-Ġpro xim
-Ġim pos
-Ġim ported
-Ġus er
-Ġus ual
-ap ex
-ap sed
-rom ycin
-em b
-em y
-est inal
-Ġinf er
-ari th
-ch art
-Ġcons cious
-Ġne u
-Ġne igh
-Ġqu ick
-Ġun adjusted
-form ed
-Ġam alg
-ard ed
-Ġwe ights
-Ġar ise
-pres sed
+Ġg f
+Ġvis ceral
+Ġer up
+Ġdefin ite
+Ġgyn ec
+Ġf iles
+im b
+Ġcontribut es
+aff in
+Ġpolic ies
+Ġka plan
+Ġtrop onin
+Ġf u
+Ġper ia
+oly tic
+Ġsuic idal
+Ġfeas ibility
+Ġw ild
+Ġg t
+Ġsp o
+Ġopt ical
+b or
+Ġt ables
+et ry
+Ġseem ed
+Ġanti hypert
+Ġtrig g
+ed ic
+Ġdispl ay
+Ġward s
+n c
+lud e
+Ġag ree
+Ġpath ogen
+Ġmax illa
+Ġcp r
+Ġver ify
+yc ardia
+Ġd w
+Ġchromat ography
+Ġloc ations
+Ġcd na
+iot ensin
+Ġspecial ized
+Ġdig est
+c yst
+Ġin equ
+or ial
+Ġunderst ood
+Ġread er
+Ġmorph ine
+Ġthor ough
+ment ioned
+ost omy
+Ġang iotensin
+ward s
+om ial
+Ġle v
+Ġmult if
+Ġimpro ves
+Ġrepl aced
+Ġunlike ly
+Ġins ide
+Ġexcept ion
+Ġwar rant
+Ġst one
+Ġqu erc
+Ġp ie
+Ġexist ence
+Ġpolymer ase
+Ġmicroorgan isms
+Ġbl a
+Ġamong st
+Ġve ct
+Ġswed en
+Ġaffil iated
+at isf
+Ġle pt
+Ġj e
+Ġprocess ed
+Ġuter ine
+Ġinv ited
+Ġref ers
+Ġreduction s
+Ġsept ember
+Ġd d
+th al
+Ġat y
+Ġend ogenous
+Ġgra des
+Ġlipid s
+Ġblot ting
+b g
+g ia
+Ġl ot
+Ġcar ing
+ir us
+Ġdia ph
+Ġunfort unately
+Ġl l
+Ġq pcr
+Ġadapt ation
+Ġinsu fficiency
+arth ritis
+inflamm atory
+ul monary
+Ġrel ig
+Ġun iform
+Ġstat ins
+ric ular
+Ġunderest im
+Ġev id
+Ġfe br
+Ġenrich ment
+Ġker atin
+at um
+Ġpal ate
+o ber
+ig m
+Ġdp ph
+Ġn ative
+Ġl h
+Ġus es
+Ġmalign ancies
+Ġrelax ation
+Ġcan ine
+Ġtr imes
+Ġpros thesis
+Ġcontinuous ly
+Ġd ialysis
+Ġind ia
+Ġfoc al
+ren ch
+Ġpr f
+Ġdifferent iate
+Ġsepar ation
+Ġsa h
+Ġlay ers
+o i
+Ġbe h
+Ġpos itivity
+cl ass
+Ġobject ives
+Ġfro zen
+Ġn ig
+Ġint ens
+Ġsusp ension
+Ġcorrect ed
+Ġdis ad
+Ġbelie fs
+Ġconn ection
+Ġvacc ine
+i abet
+Ġw t
+Ġh oma
+ot ra
+Ġclinici an
+Ġinn ov
+a u
+es are
+Ġv d
+Ġdist rict
+Ġcompet ence
+Ġcardiomy opathy
+Ġex h
+Ġme ier
+Ġlack ing
+4 5
+on ym
+Ġc ag
+Ġdisad vant
+Ġr as
+Ġdiff usion
+Ġ2 1
+Ġsol vent
+Ġbrack et
+Ġevol ution
+Ġattach ed
+Ġp ip
+Ġb iv
 Ġbi os
-Ġ2 2
-Ġsp m
-Ġdi ast
-Ġdi verse
-Ġli ver
-Ġunder gone
-Ġcomple ment
+Ġmedic inal
+Ġpa ed
+Ġdra w
+2 3
+in ence
+Ġpres um
+Ġfat al
+Ġcer amic
+al low
+or th
+cl ine
+Ġocc as
+Ġintervent ional
+k in
+Ġf ields
+ac et
+ast atin
+Ġend odontic
+Ġwork ed
+Ġgra ding
+Ġtaiw an
+yt es
+Ġpair s
+Ġapplic able
+Ġex cre
+Ġcomb ining
+Ġsus tain
+Ġtransl ated
+Ġc ast
+Ġg iving
+Ġsl ides
+il ing
+Ġdep os
+ke y
+Ġerad ication
+Ġsquam ous
+Ġb ip
+Ġj uly
+Ġprom inent
+Ġpremolar s
+Ġperia pical
+Ġexp end
+Ġhep g
+le uk
+Ġsearch ed
+Ġmod ifications
+eth eless
+Ġtub erc
+Ġc ust
+Ġposition s
+Ġrestor ative
+Ġchol ang
+Ġr ule
+Ġmon otherapy
+Ġprevent ed
+Ġregen eration
+h g
+Ġin ap
+Ġde em
+br ush
+Ġblock ed
+Ġimmunohist ochemistry
+Ġcorticoster oids
+Ġb np
+Ġk its
+Ġpock et
+Ġe y
+Ġcare er
+Ġpregn ancies
+Ġirradi ation
+Ġresc ue
+Ġantihypert ensive
+Ġb onding
+Ġcomp an
+Ġnon etheless
+Ġdep ressed
+Ġatt ack
+esare an
+Ġb ic
+Ġdr iven
 Ġ0 1
-Ġselec t
-Ġsm art
-Ġprot ection
-Ġpredic tions
-Ġdist ant
-Ġposition al
-of ascial
-Ġfac ilities
+Ġdil ution
+Ġe f
+Ġover view
+Ġequ ally
+Ġunf av
+Ġreflect ing
+Ġphyt ochemical
+et ers
+Ġcr ypt
+urs es
+Ġsubm uc
+Ġverteb ral
+ard itis
+Ġsen ior
+Ġexpend it
+j un
+Ġse iz
+Ġsyn erg
+pro t
+Ġtum ours
+Ġenc od
+Ġcheck list
+Ġexamin er
+Ġn iv
+Ġpre ference
+Ġco ated
+Ġsupport ive
+Ġacet ab
+Ġclus ters
+n o
+od il
+Ġsu a
+Ġbl inding
+az ol
+Ġundert aken
+Ġst ones
+Ġcon version
+Ġcr is
+Ġlimit ing
 Ġthir ty
-Ġpul mon
-Ġsl iding
-Ġcomb inations
-Ġfe ed
-Ġep oxy
-Ġcap itation
-Ġestim ating
-Ġpoor ly
-Ġsu ffer
-ptom atic
-Ġhel ps
-Ġret inol
+Ġhaem at
+Ġpreser ved
+adj usted
+ot ide
+Ġexplor atory
+ro f
+Ġg sh
+Ġoper ations
+Ġlabel ed
+Ġgir ls
 Ġsyn thes
-Ġpow der
-Ġdispl ace
-Ġflow chart
-Ġgiv es
-Ġgiv ing
-Ġaccess ible
-Ġantib odies
-Ġele vation
-Ġprevent ed
-az ole
-Ġcement um
-Ġadv oc
-Ġgrad ing
-Ġconcer ned
-Ġpolymer ase
-Ġwa x
-Ġsn b
-Ġeas tern
-Ġobjec t
-Ġobjec tives
-ify ing
-Ġge o
-Ġmy algia
-Ġmy ofascial
-Ġlig ature
-Ġfav ored
-Ġra ised
-Ġcheck up
-Ġcho ose
-Ġcorrect ly
-Ġ19 9
-Ġhd p
-Ġdecl ared
-Ġpf ass
-Ġdemineral ized
-Ġisol ation
-Ġhighl ights
-oph il
-Ġarr ay
-Ġprop olis
-Ġprecise ly
-Ġreproduc ible
-wh at
-Ġacad emy
-Ġperf usion
-Ġsilic on
-Ġsilic one
-Ġdigit ally
-Ġkin ds
+Ġincreasing ly
+Ġger iatric
+Ġtor que
+Ġinter d
+Ġca ution
+Ġnetwork s
+Ġspecial ists
+Ġhorm ones
+i ac
+ra du
+Ġben z
+ra ph
+Ġcap illary
+ol ip
+Ġrec ess
+Ġmod ality
+Ġser ved
+Ġtrans p
+Ġneu rom
+Ġthromb us
+Ġcapt ure
+Ġf rench
+Ġab d
+ew ise
+Ġgl i
+Ġconsider ations
+Ġliter acy
+Ġreturn ed
+Ġp olar
+Ġb t
+Ġsub c
+he alth
+Ġsuperf icial
+Ġan c
+Ġf ing
+Ġra m
+Ġperson ality
+Ġdeem ed
+t ime
+Ġcm r
+Ġhypog lycemia
+Ġscenari o
+Ġa ver
+Ġsatisf actory
+Ġure a
+e en
+Ġrandom ised
+m c
+Ġps a
+Ġw oman
+Ġlik ewise
+Ġind ust
+ont rol
+Ġtooth brush
+eli ac
+Ġclar ify
+Ġm ast
+Ġun adjusted
+ish ing
+Ġpen icillin
+Ġenrich ed
+per m
+Ġsal t
+Ġvisual ized
+Ġspl it
+Ġm aster
+Ġmot iv
+2 8
+fer ase
+Ġcyst ic
+bre ak
+Ġinconsist ent
+et al
+Ġex ec
+Ġinter leuk
+Ġmid w
+Ġpla ques
+Ġdex amethasone
+Ġs ides
+Ġe ast
+Ġen able
+Ġasc ites
+Ġperoxid ation
+r im
+Ġt el
+Ġc ate
+Ġp ic
+Ġf ungal
+Ġext r
+Ġaspir ation
+l ands
+Ġampl itude
+in ol
+Ġco urses
+Ġconf ident
+Ġvi able
+v ents
+9 9
+Ġs ds
+ox acin
+Ġoct ober
+Ġb ig
+Ġout break
+Ġquant ity
+Ġupreg ulated
+Ġnom ogram
+Ġbol us
+i h
+at us
+Ġg n
+Ġsc ope
+Ġmus cul
+Ġmyoc ardium
+Ġstep wise
+Ġing red
+Ġ2 3
+Ġso und
+Ġinflu enz
+Ġcommun ities
+Ġhome ostasis
+Ġvar ies
+oplast ic
+Ġinap pro
+g ian
+an cer
+Ġcon gest
+Ġant ipl
+Ġcar bo
+Ġprem ature
+Ġch ole
+Ġpre term
+Ġwe igh
+Ġed ge
+Ġcarbo hyd
+2 4
+Ġall ocated
+Ġgreat ly
+Ġreinf or
+ic its
+Ġm er
+Ġh ot
+Ġper itoneal
+uc as
+Ġdef icits
+Ġher bs
+Ġt ension
+Ġf unnel
+Ġall ergic
+Ġol p
+f e
+Ġch a
+Ġr m
+p ect
+os keletal
+ra p
+Ġrec overed
+Ġabn orm
+Ġturn over
+Ġamel ior
+7 0
+Ġb ands
+oph ageal
+Ġrev ised
+Ġacet yl
+6 0
+Ġa ids
+ul osis
+Ġsign ed
+Ġfav our
+Ġt ach
+Ġs on
+Ġto f
+Ġst ock
+Ġint ended
+Ġvis ited
+Ġwar f
+es ophageal
+Ġb orn
+ut ical
+Ġes d
+Ġdefin itive
+Ġamb ul
+Ġdors al
+Ġread ing
+Ġbra ch
+ar p
+Ġso ught
+h aps
+Ġn av
+Ġdiagn ose
+Ġadv ice
+Ġinteg ration
+i ance
+Ġs ick
+en g
+Ġbehavi ours
+Ġcarb ap
+Ġc us
+ign ific
+Ġster oids
 Ġopportun ities
-Ġencour aged
-Ġlithuan ia
-Ġcaregi ver
-Ġcompart ments
-Ġlet ter
-Ġaccoun ted
-Ġcompress ive
-Ġcorrespond s
-Ġgranul omatous
-Ġtransf ected
-Ġcoron ally
-Ġadmission s
-Ġpae k
-Ġdehisc ence
-Ġtransluc ency
+is on
+Ġn os
+Ġquart iles
+Ġwarf arin
+v s
+v astatin
+Ġr ins
+Ġper haps
+Ġpl astic
+Ġartic ular
+Ġconjug ated
+Ġwean ing
+Ġbiofil ms
+Ġhydrox y
+Ġdisap pe
+Ġdesc ending
+al b
+id in
+ati al
+Ġpromot ed
+ivir al
+n ers
+Ġs ut
+Ġh ct
+ra de
+ak er
+Ġmon ocl
+Ġcrown s
+Ġaustral ian
+Ġperoxid ase
+Ġquerc etin
+Ġosteo arthritis
+o qu
+er in
+or ic
+Ġm ess
+roph ot
+Ġconver ted
+Ġtime ly
+Ġi h
+Ġstim ulating
+Ġcollab or
+Ġc ert
+Ġassist ance
 Ġmelan oma
-Ġperfor ation
-Ġinten tion
-Ġdon or
-Ġcaucas ian
-otid e
-Ġappra isal
-Ġcas p
-Ġmandib les
-Ġdanger ous
-eterm ined
-Ġlub ric
-Ġharves ted
-Ġimpos s
-Ġamalg am
-Ġpulmon ary
-1 16
-g ian
-h an
-l ind
-n ia
-o ked
-s a
-Ġa er
-Ġa os
-on ectin
-Ġs onic
-en z
+Ġtrimes ter
+Ġgra ded
+Ġprom oter
+Ġemerg ed
+Ġj n
+Ġmicro vascular
+Ġteam s
+Ġemphas ized
+Ġh h
+ig ation
+Ġattribut able
+Ġregular ly
+Ġkap pa
+i asis
+ac ill
+Ġcalc ulating
+Ġmic ros
+oscop ic
+Ġspect rophot
+Ġmes ial
+ab s
+Ġadminist rative
+Ġemot ions
+Ġdestr uction
 Ġc ess
-Ġw l
-es p
-Ġm w
-at a
-at uration
-an al
-an ian
-Ġb ay
-ro gate
-ar r
-Ġh t
-Ġh app
-Ġe ast
-Ġe ct
-us ive
-Ġl ot
-om ics
-om orph
-Ġn f
-ur ally
-am pl
-Ġper oxide
-Ġr i
-um ina
-Ġgro ss
-op ic
-Ġsur rogate
-st and
-Ġinf r
-Ġro ll
-Ġtr u
-Ġanalys e
-Ġsub d
-Ġinter leuk
-Ġun co
-ost e
-Ġspec ulated
-Ġfin land
-Ġfin nish
-Ġmeth yl
-Ġso u
-Ġar p
-Ġmo i
-Ġcal ip
-tem ber
-Ġchan ces
-Ġsim ply
-Ġman age
-Ġclass ical
-Ġsp s
-Ġmin d
-Ġmal ays
-Ġtrans cription
+om pl
+ot es
+Ġsc al
+Ġprofess ion
+Ġcarri ers
+ag ic
+ell ar
+Ġblock ing
+Ġprepar ations
+Ġtherm al
+Ġlob e
+Ġf air
+Ġim bal
+Ġun ilateral
 Ġform ulation
-Ġconf ined
-int roduc
-Ġol factory
-Ġwor n
-Ġsome what
-Ġcoun s
-Ġins ulin
-Ġcy lind
-Ġrece iver
-Ġdiscus s
-Ġoper ated
-Ġes rd
-Ġsl ope
-Ġcap ability
-Ġcap ital
-Ġcap ita
-Ġmid line
-Ġsex t
-Ġext end
-Ġret rom
-Ġsti r
-Ġmes ially
-Ġcontin ue
-Ġdom inant
-Ġbiom ater
-Ġunderst ood
-Ġconnec ting
-Ġconsum ed
-Ġdoc tors
-Ġplate let
-Ġexce eded
-Ġ201 3
-Ġemploy ment
-Ġcontinuous ly
-Ġic c
-Ġhs p
-Ġcertain ly
-Ġbu ilt
-Ġbelie fs
-Ġdry ness
-Ġfluid s
-Ġnan os
-Ġhd i
-Ġent er
-ili ary
-Ġasym ptomatic
-Ġabut ments
-Ġmedi ators
-Ġshor ten
-Ġexplan atory
-Ġrev ised
-Ġosteobl ast
-Ġcentrifug al
-Ġtext ure
-Ġcys t
-Ġcomplain t
-Ġjud ged
-Ġrp m
-Ġdil uted
-Ġrad ical
-Ġassist ant
-Ġanalges ics
-Ġdemand ing
-Ġinjec tion
-Ġelect ro
-Ġthorough ly
-Ġlet ters
-Ġobstr uction
-Ġclus ter
-Ġadip onectin
-ogl ob
-Ġhydrox ide
-Ġmt bs
-urg ical
-Ġmesi obuccal
-Ġsock et
-Ġautom ated
-Ġbf b
-Ġprovin ce
-Ġib m
-Ġjudge ments
-74 116
-Ġdup l
-Ġexerc ise
-Ġsep tember
-Ġgp f
-Ġsole ly
-Ġexpendit ures
-Ġment on
-Ġresorb able
-Ġdut ch
-Ġunfav orable
-358 74116
-Ġvisc osity
-Ġelse where
-Ġaggress ive
-Ġproxim ity
-Ġhdp cs
 Ġcess ation
-ampl ing
-1 1
-5 3
-a vi
-a que
-c ine
-d x
-d ered
-f l
-i able
-k y
-l amm
-l ands
-t able
-u it
-u ff
-Ġ ;
-Ġ ign
-in ess
-Ġa que
-Ġa ux
-Ġs and
-Ġp ic
-Ġf ro
-Ġf ish
-Ġf to
-Ġm ult
-Ġm art
-Ġm oney
-ar se
-Ġre ag
-Ġre position
-Ġl ing
-om as
-Ġn b
-Ġn in
-ol ds
-Ġcon ical
-Ġcon verse
-id azole
-un ately
-ter dam
-Ġr me
-Ġres on
-ot ella
-iz ations
-ys t
-Ġdis traction
-em ploy
-Ġap ices
-ip id
-Ġpres um
-Ġpres cription
-Ġcons ort
-Ġrec t
-Ġpr one
-Ġpr ice
-Ġsub cl
-Ġun employ
-Ġint ell
-Ġy es
-Ġam mp
-Ġen ables
-Ġen com
+Ġper p
+Ġpr int
+Ġelect rical
+Ġgall bl
+ignific ant
+on om
+Ġb ax
+ul ous
+Ġv t
+Ġstat ements
+Ġover load
+Ġmoder ately
+Ġbro th
+wh at
+Ġre tained
+Ġinject ions
+Ġmicroscop ic
+met ry
+Ġmonocl onal
+h ospital
+Ġrem oving
+Ġwell s
+Ġes bl
+Ġnut ri
 Ġgen omic
-ph y
-ph osph
-Ġmax im
-Ġperiodontal ly
-ex ts
-Ġimpl ications
-Ġbr ing
-Ġlower ing
-Ġsup ine
-Ġgener a
-Ġj c
-Ġj et
-Ġj une
-Ġj oints
-Ġed x
-Ġed ema
-Ġtrans p
-Ġem t
-Ġstand ing
-Ġz ls
-Ġer k
-Ġsecond s
-Ġshould er
-Ġran ks
-Ġel imination
-Ġcoun ted
-Ġexpl oratory
-Ġgeneral iz
-Ġsm ile
-Ġsurgical ly
-Ġoc s
-Ġbacter i
-Ġrequ ested
-Ġanti gen
-Ġtm ds
-Ġdescrib es
-Ġsmall est
-Ġps g
-Ġref ers
-Ġrespond ed
-Ġimmun ological
-itt ance
-Ġsyn ch
-Ġlog arith
-Ġ6 0
-ero zyg
-Ġconstr uc
-Ġcari ogram
-Ġenviron ments
-Ġestabl ishing
-Ġsk ull
-Ġdivid ing
-Ġx en
-scop ic
-Ġnor we
-com ing
-Ġtit les
-Ġrepe at
-Ġrepl ic
-plas m
-Ġphosph oric
-Ġinstrument al
-Ġrecommend ation
-Ġultras ound
-Ġaddress ing
-Ġpass ed
-Ġra ise
-Ġesthetic s
-Ġpor cine
-Ġenrol l
-Ġalter ation
-Ġintegr ation
-Ġpf os
-Ġextensive ly
-Ġrun x
-Ġcolle ag
-Ġeti ological
-Ġfacilit ated
-Ġss i
-Ġabras ive
-Ġampl ification
-Ġprotr action
-Ġgly co
-Ġdeform ity
-Ġexc ision
-Ġfun nel
-inf lamm
-Ġdrin ks
-Ġpolic ies
-Ġjap anese
-Ġirrig ated
-Ġaid s
-Ġopportun ity
-Ġpaste urized
-Ġinterm olar
-Ġprev otella
-Ġovere stim
-Ġdw elling
-Ġaustral ian
-Ġcover ing
-Ġrr t
-Ġcere b
-Ġft cp
-Ġangi ogenesis
-Ġuncontrol l
-Ġimplement ing
-Ġautoantib ody
-Ġpix el
-Ġmim ic
-Ġencod ing
-Ġcigare ttes
-Ġure a
-Ġdiscol oration
-Ġsched uled
-Ġexer ted
-Ġflav our
-Ġfing er
-Ġrhe um
-Ġblot ting
-Ġoccas ion
-Ġadministr ative
-Ġrbf dps
-Ġprosth odontic
-Ġparaf unctional
-Ġterti ary
-Ġpancre atic
-Ġalkal ine
-aph yl
-Ġhet erozyg
-Ġdisplace ments
-Ġimposs ible
-Ġtru eness
-introduc tion
-Ġaque ous
-Ġmult in
-Ġencom pass
-inflamm atory
-h er
-i j
-i end
-l ings
-o ff
-p p
-r anted
-v as
-Ġ ice
-Ġt in
-Ġt gn
-Ġt ang
-Ġth read
-Ġs ic
-Ġp g
-Ġw ard
-Ġin tim
-Ġf s
-Ġd est
-Ġd ensities
-Ġb id
-Ġb ath
-Ġb ones
-is ition
-ic le
-ic idal
-Ġre activation
-Ġre hab
-Ġh oles
-us s
-Ġst aphyl
-ere l
-ec es
-Ġl ib
-Ġl ll
-Ġl acr
-ud d
-et ting
-Ġon c
-am s
-Ġv ent
-Ġv ac
-Ġal i
-Ġper u
-Ġr ft
-Ġex ten
-Ġbe h
-Ġbe verages
-tr ict
-Ġim per
-ut ation
-ut able
-ir ms
-Ġde em
-Ġgro o
-Ġpre ferences
-Ġcomp ens
-Ġdis ch
-Ġsh ared
-Ġad s
-Ġdent ate
-Ġma f
-Ġle ct
-Ġheal ed
-Ġcan cell
-Ġpar ish
-Ġpres cribed
-ch s
-Ġtr ib
-Ġsub tr
-Ġun ex
-Ġun stim
-form in
-Ġint ensive
-Ġam b
-Ġk ing
-ire c
-ograph ical
-Ġag ar
-Ġ2 1
-Ġdisc ern
-Ġsup ply
-Ġsp ain
-Ġed s
-Ġdi ver
-Ġdep r
-Ġcro p
-Ġconf irms
-Ġmet ron
-Ġmet formin
-Ġintr insic
-Ġce ments
-Ġtechn ologies
-Ġel is
-Ġfr iend
-ord ance
-Ġpred etermined
-ob i
-Ġexpl aining
-Ġrandom ised
-Ġpath f
-Ġsl ices
-Ġsol uble
-av ir
-Ġmoder n
-Ġsex es
-Ġlab els
-Ġproper ty
-Ġguid eline
-Ġvolum etric
-Ġsw ab
-Ġpat ency
-Ġadoles cent
-Ġhyper d
-Ġhyper plasia
-Ġpur ified
-Ġexhib its
-Ġil c
-Ġlip id
-ame th
-Ġattrib utable
-Ġens ured
-Ġsn ps
-Ġ201 0
-Ġvisual ized
-Ġcod ing
-Ġheter ogeneous
-Ġbur s
-Ġcut off
-Ġexist ence
-Ġrecip ient
-Ġinterpre ting
-Ġdry ing
-Ġadequ ately
-Ġtur key
-Ġpor phy
-Ġdl ms
-Ġvirt ually
-Ġminor ity
-Ġacqu isition
-Ġillustr ate
+Ġdr iving
+Ġclinic opath
+che al
+Ġflex ion
+en in
+Ġb er
+Ġhel d
+Ġvulner able
+Ġt un
+Ġs ple
+Ġet c
+Ġprior ity
+Ġcran i
+u ge
+Ġf aster
+Ġman ip
+Ġvalid ate
+Ġdisturb ance
+Ġlandmark s
+Ġexercis es
+radu ate
+Ġdo ub
 Ġarr ival
-Ġtransm ittance
-Ġarab ia
+Ġcentrifug ation
+Ġduoden al
+r ary
+Ġat p
+Ġthere after
+Ġca ucas
+Ġrestric tion
+Ġgallbl adder
+Ġas ia
+Ġco ol
+av age
+Ġwors ening
+ve m
+Ġmot ility
+Ġhazard s
+Ġdatas ets
+Ġbrack ets
+Ġr ing
+Ġcardi op
+Ġtm j
+Ġrepro ductive
+it ated
+Ġne ural
+lycem ic
+Ġlept in
+Ġh omes
+Ġor ally
+Ġol ig
+Ġintra per
+Ġar ray
+Ġimm ers
+Ġconcentr ated
+Ġphosph at
+Ġgingiv itis
+5 4
+Ġv ap
+Ġindividual ly
+Ġplate lets
+Ġtempor ary
+Ġperme ability
+Ġer cp
+Ġb us
+ur on
+Ġhighlight s
+Ġs port
+Ġcont amination
+Ġemerg ence
+Ġarrhythm ia
+at ation
+ar c
+ct omy
+im ent
 Ġmap ping
-Ġmastic ation
-Ġdisadvant ages
-Ġvene ering
-press ive
-Ġwar ranted
-Ġkee ping
-Ġdegen erative
-Ġlabel ed
-Ġwilling ness
-Ġquar ter
-Ġcere bral
-Ġuncontrol led
-Ġelucid ated
-Ġstere omicro
-Ġpersist ence
-obacter ium
-eth yl
-Ġobt uration
-Ġmillim et
-Ġshar p
-Ġbreak down
-Ġmirr or
-Ġyemen i
-Ġfix ation
-Ġventi lation
-Ġsib lings
-Ġundes irable
-Ġrub ber
-Ġpoin ted
-Ġconflic ting
-Ġintraven ous
-Ġsynerg istic
-Ġcorticoster oids
-Ġbeauti fil
-Ġneigh b
-Ġdiast ema
+Ġtransf ected
+o ic
+Ġb ab
+av ail
+Ġz inc
+Ġautom atic
+Ġc ra
+Ġf bs
+Ġ201 8
 Ġinterleuk in
-Ġsou thern
-Ġconverse ly
-Ġnorwe gian
-Ġcolleag ues
-Ġrehab ilit
-Ġlacr imal
-Ġdeem ed
-Ġunstim ulated
-Ġmetron idazole
-3 2
-7 9
-c ill
-d al
-l ines
-l ict
-n d
-n ight
-o ud
-p ation
-s terdam
-Ġt u
-Ġt ag
-Ġs ay
-Ġs ph
-Ġc us
-Ġc asts
-Ġc ott
-Ġp ec
-Ġf u
-Ġf er
-Ġm pa
-th y
-an th
-as one
-ic ine
-ro id
-ar ant
-Ġe at
-Ġe ase
-Ġe cl
-Ġl ists
-Ġl ives
-im e
-Ġg ast
-Ġwith dr
-if iers
-ab ec
-Ġr uss
-Ġex ec
-Ġex acer
-Ġpro ce
-tr uct
-ad icular
-Ġch e
-Ġde ad
-Ġme g
-Ġcomp action
-Ġsh ear
-Ġad h
-por al
-Ġnot ewor
-Ġcan ada
-Ġpos iti
-Ġha ir
-Ġcont acted
-ch icine
-Ġro x
-Ġtr ac
-Ġtr acing
-Ġsub l
-Ġinter rup
-Ġafter wards
-Ġam sterdam
-Ġpartic le
-ew ed
-Ġup d
-Ġup ar
-Ġup take
-Ġso ught
-Ġover s
-Ġover view
-Ġover night
-Ġcol chicine
-Ġag o
-Ġimpl anted
-ag ingival
-Ġ2 6
-Ġgener ating
-Ġsp ite
-Ġsp acing
-Ġj uly
-Ġed ges
-Ġmicro s
-Ġchar ts
-Ġop posed
-Ġgr s
-Ġconf ident
-Ġconf lict
-Ġ3 1
-Ġser ial
-Ġsug ary
-Ġloc ally
-Ġrem n
-Ġcent ur
-Ġadj u
-Ġgingival is
-Ġos cill
-Ġimportant ly
-Ġfl or
-Ġsens ory
-Ġanaly tical
-Ġwid esp
-Ġcategor ised
-Ġgood ness
-Ġsurvey ed
-Ġsuper ficial
-Ġseg mented
-Ġpractic ed
-Ġadm itted
-Ġlocal ities
-Ġprior ity
-Ġshap es
-Ġinduc ing
-Ġsuppor tive
-Ġenh ances
-Ġml si
-scop y
-Ġhyd rophil
-Ġtra its
-Ġpolymer ized
-Ġtop ography
-Ġelectr ical
-Ġfit ting
-Ġapex es
-Ġenc oun
-Ġirradi ated
-Ġgran ule
-Ġtraum atic
-Ġcf ss
-Ġaug ust
-thes es
-ili ar
-Ġsupple ments
-Ġretrospective ly
-Ġdiss ol
-Ġorigin ally
-Ġot u
-Ġbackground s
-Ġhighl ighting
-Ġplas m
-Ġincorpor ating
-Ġillustr ates
-Ġfibrobl ast
-Ġprop ensity
-Ġstomat ological
-Ġ202 1
-Ġexact ly
-Ġdentifric es
-Ġord ered
-Ġwash ing
-Ġwebs ite
-Ġprophyl actic
-Ġalle le
-Ġencour age
-Ġpu i
-Ġextra oral
-Ġmacroph ages
-Ġvulner ability
-Ġion omer
-Ġvess el
-Ġapplic ability
-Ġexpect ations
-Ġoccup ation
-Ġdepic ted
-Ġimbal ance
-Ġautoantib odies
-Ġdisagree ment
-Ġital ian
-Ġnotice able
-Ġhygien ists
+it um
+Ġup s
+ace utical
+Ġparamet ric
+Ġanalyz er
+Ġrespond ed
+Ġglut ath
+Ġreproduc ibility
+Ġp all
+Ġansw ered
 Ġscenari os
-Ġsupr agingival
-Ġcompati ble
-Ġcolum n
-Ġepidemi ology
-enh am
-Ġoxid ative
-Ġoverex pression
-Ġpharmac ological
-Ġfeed back
-Ġbay es
-Ġcalip er
-Ġcylind rical
-Ġretrom olar
-Ġfro zen
-Ġreag ent
-Ġreson ance
-Ġenroll ment
-Ġstaphyl ococcus
-erel astic
-Ġexten ding
-Ġelis a
-Ġhyperd ivergent
-ameth asone
-Ġcus ps
-Ġcott on
-Ġgast ro
-Ġexacer b
-Ġnotewor thy
-Ġwidesp read
-Ġhydrophil ic
-c ts
-f old
-f unction
-g ia
-i ac
-k ish
-m er
-m ec
-m od
-s ide
-t ate
-y es
-y cl
-in vas
+Ġaty pical
+oc aine
+Ġet i
+Ġshould er
+Ġtooth p
+Ġdil ation
+Ġdon ors
+Ġb ath
+Ġantic ip
+Ġpaed iatric
+Ġglutath ione
+3 6
+p ic
+Ġat m
+Ġdiagn osing
+Ġthem e
+m on
+or ad
+oc ortic
+Ġsm a
+Ġappro pri
+Ġdiscontinu ed
+Ġb f
+Ġun exp
+Ġn ac
+Ġdescrib ing
+Ġpa o
+Ġdys p
+Ġdys plasia
+Ġher b
+Ġmi h
+Ġcapt ured
+Ġabund ance
+Ġp ear
+Ġw nt
+ot al
+ress ions
+Ġpar affin
+Ġcoun ted
+Ġa way
+Ġcolon ization
+Ġiran ian
+Ġendoc rine
+Ġinappro priate
+Ġhyper plasia
+Ġquant ify
+Ġdisturb ances
+an al
+ol in
+ps ia
+Ġz irc
+Ġorgan isms
+Ġdetect able
+Ġconfirm ation
+Ġnit ric
+Ġsar cop
+Ġs ector
+Ġreg urg
+Ġrespons ibility
+Ġhuve cs
+Ġcust om
+c g
+Ġv anc
+Ġper in
+Ġint ub
+Ġpres cript
+Ġkn ock
+Ġconfirm ing
+lu ores
+Ġge ograph
+Ġfore ign
+Ġmor ning
+od e
+on ectin
+Ġno vem
+Ġy ellow
+Ġconsum ed
+Ġprescrib ing
+n i
+Ġin ability
+Ġre tain
+ly sis
+Ġcandid ate
+Ġultrason ography
+Ġnovem ber
+Ġse as
+Ġgrow n
+Ġsynd rom
+Ġleuk emia
+Ġstimul i
+Ġprophyl actic
+Ġb ad
+Ġsc ler
+Ġfra me
+Ġinj ured
+Ġantif ungal
+Ġex ists
+Ġmult ip
+Ġalco holic
+Ġeas ier
+Ġopp osite
+Ġneurom uscular
+Ġmus cular
+opath ic
+Ġparen chym
+Ġfron tal
+Ġcor on
+Ġthreat ening
+Ġinfluenz a
+v ular
+pl es
+ptom ycin
+oscop e
+Ġcereb rovascular
+Ġanalyt ical
+id ase
+ox y
+Ġadip onectin
+Ġelectroph ores
+Ġmom ent
+Ġconduct ing
+Ġmen str
+Ġpros pectively
+Ġwa vel
+Ġb in
+os m
+Ġmon ocytes
+Ġoxid ation
+Ġwil cox
+Ġprescript ions
+Ġwavel ength
+Ġadequ ately
+Ġopi oids
+r yl
+ut ing
+end ers
+Ġtr un
+Ġliv es
+Ġpp d
+Ġnucle us
+Ġimp ed
+Ġbl ank
+ox ylin
+Ġ4 0
+v d
+Ġl id
+Ġ2 2
+Ġ2 8
+Ġult ra
+Ġlact am
+Ġcorrect ly
+Ġcaregiv er
+Ġstra ight
+Ġfebr uary
+r ast
+om nia
+ch art
+Ġregard s
+Ġfron t
+ur ally
+Ġcl os
+Ġne igh
+Ġpop ular
+Ġsome what
+Ġpharm acy
+Ġpharmac okin
+Ġga it
+Ġincorpor ated
+Ġwhit ney
+Ġoverc ome
+Ġanomal ies
+Ġty ros
+Ġsol uble
+Ġfamil iar
+Ġnig er
+Ġf io
+Ġro ute
+Ġalter ation
+Ġrecip ients
+Ġappoint ment
+Ġdi ure
+Ġtr ic
+Ġbec omes
+Ġcam e
+Ġrevers ed
+Ġwilcox on
+Ġv c
+Ġpre hospital
+Ġnot iced
+Ġcont rain
+Ġfl at
+Ġcho ose
+Ġmacroph age
+Ġcontrain d
+Ġs oc
+Ġm un
+Ġconc lude
+Ġbu ffered
+Ġspir itual
+on ucle
+Ġres ected
+Ġdis par
+Ġpub med
+Ġcap able
+Ġsple en
+Ġhe par
+Ġvis ion
+Ġdc m
+Ġempir ical
+Ġj ak
+Ġtra vel
+Ġleaders hip
+i k
+Ġpro inflammatory
+Ġsp atial
+Ġep ile
+Ġnucle i
+Ġcircum st
+Ġalgorith ms
+Ġstop ped
+Ġorient ation
+ozyg ous
+Ġrel aps
+Ġgen ome
+Ġins omnia
+Ġsubty pe
+Ġesophag us
+Ġconstitu ents
+Ġvol unt
 Ġs un
-Ġs ial
-en in
-al ment
-Ġc atal
-Ġc iel
-Ġc restal
-Ġp un
-Ġp um
-Ġm ps
-Ġm olds
-Ġb iting
-ar c
-ar in
-Ġre tic
-Ġre ally
-Ġh ap
-Ġh sc
-Ġh ier
-Ġh ind
-Ġn it
-Ġn ose
-Ġn bm
-Ġn urse
-Ġg h
-Ġg onion
-ur ity
-os ed
-if ies
-ol ingual
-il ver
-Ġor ific
-am es
-tic ul
-Ġv ic
-el astic
-Ġal umin
-Ġr ce
-Ġr ab
-Ġr ule
-Ġpro cl
-Ġpro inflammatory
-ant ation
-ign s
-pl ace
-Ġme ticul
-Ġpre ference
-Ġgroup ing
-Ġdis tric
-Ġcl oud
-op o
-odon tia
-Ġap ne
-Ġco op
-ub ation
-se al
-Ġpar a
-Ġpres erve
-ell ed
-ch anged
-Ġtr y
-ach ing
-Ġrel ax
-Ġab ilities
-Ġun m
-Ġun com
-Ġun fort
-Ġun he
-Ġvari ances
-Ġmeth acrylate
-Ġdes irable
-Ġover d
-Ġover growth
-Ġmo ving
-Ġbr idge
-ail s
-Ġradi us
-Ġop c
-ish ment
-der g
-amm etry
-Ġet c
-Ġcondition ed
-Ġplan mec
-ores cent
-ian g
-Ġfr c
-Ġindex es
-ob ser
-Ġins ights
-Ġrequ est
-Ġpot ent
-Ġos tium
-ith romycin
-aw s
-Ġhist omorph
-Ġgu arant
-Ġconsider ations
-Ġrepresent ation
-Ġabs ent
-ral gia
-Ġthick er
-Ġacid ogenic
-Ġref used
-Ġref uge
-Ġload s
-Ġsoc ially
-Ġsu ffering
-Ġmicrob es
-Ġimmun ity
-af ts
-Ġsti ff
-Ġest onia
-Ġax es
-Ġnormal ized
-Ġfib rin
-Ġlocal ization
-Ġclear ance
-Ġpros theses
-wor ds
-Ġhead s
-Ġinhib iting
-Ġreflec ting
+it in
+Ġse vent
+Ġposition ed
+Ġprinc iple
+Ġcompart ment
+ve rest
+ch ar
+Ġr p
+Ġventil ated
+Ġenc oun
+ra v
+Ġout er
+Ġro d
+Ġcyt os
+Ġdiss em
+Ġdocument ation
+Ġepidemi ology
+r or
+Ġant iviral
+Ġdisc overed
+Ġfluores cent
+im p
+qu art
+Ġparen t
+Ġsa ud
+Ġconcept s
+Ġst ents
+pt ive
+Ġneuro t
+Ġminim ally
+Ġpac u
+Ġsym pathetic
+Ġcorrel ates
+Ġform ing
 Ġstim ulate
-Ġanat omic
-Ġback ward
-ogr ammetry
-ogr afts
-Ġlear n
-Ġhelp ed
-Ġsubs ets
-Ġens uring
-Ġarti facts
-Ġexce ed
-Ġ201 2
-Ġvisual ize
-Ġemerg ed
-Ġge ographic
-Ġmill ing
-Ġlig atures
-Ġq rt
-Ġbehaviour al
-Ġher bal
-Ġtur kish
-Ġmetast atic
-tt age
-Ġhd l
-Ġnucle otide
-Ġcad her
-Ġfore head
-Ġcomprehensive ly
-Ġds pp
-Ġodont obl
-Ġkey words
-ochem istry
-Ġinhibit or
-Ġshe et
-Ġip s
-Ġemph asis
-Ġsubm itted
-Ġampl itude
-Ġmic ron
-Ġpractition er
-Ġbiops ies
-Ġconcept ual
-Ġindirect ly
-Ġteam s
-Ġide a
-Ġlifest yles
-Ġsilic a
-Ġrad icular
-Ġenl arged
-Ġkin derg
-Ġcure ttage
-Ġinst ances
-Ġinh ab
-Ġretrie val
-Ġrare ly
-Ġarter ial
-Ġconc ur
-Ġconc ordance
-Ġben ign
-Ġben ch
-Ġcat enin
-Ġarth ralgia
-Ġoffer ing
-Ġuns atis
-Ġradiolog ists
-Ġequip ped
-Ġmom ents
-Ġtri os
-Ġsupern at
-Ġspr ings
-Ġfund ament
-Ġuncertain ty
-Ġunderestim ation
-Ġelucid ate
-Ġital y
-Ġdisinf ection
-Ġtrigg er
-Ġpalat ine
-Ġcompan y
-Ġpeptid es
-Ġconce alment
-Ġclock wise
-Ġsulfur ic
+Ġpeak s
+Ġs perm
+or a
+Ġap ache
+Ġinter quart
+Ġlocal ized
+Ġrequ est
+Ġhc m
+Ġwash ing
+Ġrough ness
+Ġinterquart ile
+3 7
+Ġex ert
+Ġr c
+Ġaf ore
+Ġab er
+Ġabund ant
+Ġexch ange
+Ġcur v
+Ġsecre t
+Ġact s
+Ġclass ical
+Ġdec ade
+crib ed
+Ġstaphyl ococcus
+es ter
+Ġd as
+Ġe at
+Ġprob np
+Ġir res
+Ġmoder n
+Ġhemat ological
+Ġmultid isciplinary
+Ġendometri osis
+Ġpharm aceutical
+Ġb odies
+Ġsqu ared
+Ġdecomp ens
+Ġirrig ation
+Ġf n
+Ġd ye
+Ġmod ule
+Ġbio active
+Ġintr insic
+Ġconcern ed
+in osa
+Ġm ening
+Ġar row
+Ġloc k
+oplast y
+Ġconcord ance
+Ġperin atal
+Ġirres pective
+Ġn ull
+Ġacc ident
+Ġant ips
+Ġln cr
+Ġabd omen
+l ined
+Ġb b
+if er
+if ies
+atin ib
+Ġload ed
+Ġamin otrans
+4 0
+Ġimp ression
+Ġthick ening
+Ġunc ontrol
+Ġs ay
+Ġg um
+Ġcomp ass
+Ġinter rup
 otrop ic
-Ġconfig uration
-Ġcrystall ization
-Ġanticip ated
-Ġunpredict ability
-Ġcontamin ated
-Ġinconsist ency
-Ġspectrophot ometer
-Ġnicot ine
-Ġconve x
-Ġka plan
-Ġsynthes ized
-Ġintell igence
-Ġcereb ro
-Ġrheum at
-Ġheterozyg ous
-Ġbeh ind
-Ġpositi ves
-Ġsubl ingual
-Ġadju vant
-Ġbayes ian
-invas ive
-Ġciel ab
-Ġhier arch
-Ġdistric ts
-Ġplanmec a
-Ġcadher in
-1 4
-5 6
-a ments
-e en
-i k
-i ence
-o zo
-p es
-p ex
-y roid
-Ġ vel
-Ġt i
-in ical
-in ate
-in ance
-Ġa ap
-Ġs aw
-ti r
-Ġc ulti
-Ġc ensus
-Ġp ell
-Ġp unct
-Ġf oss
-Ġf anc
-Ġd d
-Ġd ors
-Ġd sc
-Ġd hc
-Ġm old
-at ase
-Ġb ed
-Ġb if
-as h
-ro om
-ro wn
-ro scopy
-ar a
-ar b
-Ġto ld
-Ġh pl
-Ġl ys
-Ġg f
-Ġg ained
-ol us
-Ġas ep
-Ġv a
-Ġv pt
-Ġal iz
-Ġr ational
-ge ar
-uc h
-tr y
-tr ained
-ant om
-ad y
-ad ed
-Ġstudy ing
-Ġinc on
-Ġme ier
-Ġac tions
-Ġac ycl
-Ġdis par
-Ġbet amethasone
-rom onas
-Ġsc s
-Ġsc ds
-ip t
-Ġco inc
-ther lands
-ia gnos
-Ġcan tile
-Ġpl aces
-Ġall oy
-Ġtr abec
-Ġcons ul
-Ġincl ined
-Ġrel ies
-Ġne o
-Ġne therlands
-Ġsub c
-Ġinter facial
-Ġun changed
-so ft
-rol og
-Ġage ing
-ph ere
-Ġout bre
-Ġsuc rose
-Ġfin ished
-Ġar res
-amin er
-Ġmed ial
-Ġobser ving
-Ġstr ips
-Ġfir m
-Ġdisc arded
-Ġclass ifications
-Ġdef ining
-Ġresp onding
-Ġwell be
-Ġpost graduate
-Ġ3 6
-Ġvis co
-Ġol l
-Ġwor st
-Ġwhere by
-Ġca f
-Ġran ked
-Ġrem ote
-Ġsampl ed
-Ġfr action
-Ġsmo ker
-Ġrandom isation
-Ġcer ti
-Ġcer as
-Ġbrush es
-Ġsl ide
-Ġsl ides
-Ġver tically
-Ġmat ter
-Ġmor ning
-Ġproper ly
-Ġfam iliar
-Ġbond s
-Ġdispl aced
-Ġlack ed
-Ġ6 2
-Ġdifferenti ate
-Ġaccess ing
-Ġte a
-Ġstep wise
-Ġhyper l
-Ġwork flow
-Ġ7 9
-Ġnecess it
-Ġhead gear
-Ġmorph ologies
-az ol
-Ġpsych ometric
-Ġadv ised
-Ġconnec tions
-Ġoptim um
-Ġattrib utes
-Ġtop ics
-Ġcd c
-Ġic g
-Ġwidth s
-Ġge ometry
-Ġge ographical
-Ġmill ion
-Ġphosph atase
-Ġmar king
-Ġdys function
-Ġmach ined
-Ġdocu ment
-Ġadap tive
-Ġeng aged
-Ġsa ved
-Ġspeed s
-Ġcad a
-Ġdecl ined
-Ġna h
-Ġmedi ation
-Ġisol ates
-Ġsignal s
-organ ic
-Ġann ually
-Ġga uge
-Ġprin ter
-Ġqual ification
-Ġnutr itional
-Ġlat est
-Ġmas ked
-Ġrestric tion
-Ġexpand ed
-Ġdepos ited
-Ġampl ified
-Ġrapid ly
-Ġvolun tary
-Ġcs amin
-Ġtap ered
-Ġrad ial
-Ġah i
-Ġcarbon ate
-Ġunlike ly
-Ġmacro des
-Ġcure ttes
-Ġkn ock
-Ġfresh ly
-Ġvect ors
-Ġld c
-Ġinterm edi
-Ġspectr a
-Ġprev ents
-Ġstabil ized
-Ġactiv ating
-Ġdiff ers
-Ġobstr uctive
-Ġkore an
-Ġple asant
-Ġreinfor ce
-Ġns cl
-Ġimbal anced
-Ġhydrox yl
-Ġpix els
-Ġmim ics
-Ġmoist ure
-Ġrig id
-Ġdp bm
-Ġpict ure
-Ġstimul i
-Ġstret ching
-Ġattemp ts
-Ġafric an
-Ġendoc rown
-Ġalex net
-Ġconstrain ts
-oxyl in
-Ġhypo plasia
-Ġae ti
-Ġded icated
-Ġindustr ial
-Ġacknow led
-Ġpenicill in
-ran ial
-Ġnanos ilver
-Ġrect ang
-Ġsubcl inical
-Ġgeneraliz ability
-Ġvac u
-Ġpathf ile
-Ġporphy romonas
-Ġrehabilit ation
-Ġtrac ings
-Ġcentur y
-Ġapne a
-Ġunfort unately
-obser ver
-Ġcerebro vascular
-Ġrheumat oid
-Ġhpl c
-Ġaliz arin
-Ġoutbre ak
-Ġwellbe ing
-1 9
-6 0
-c ending
-d p
-f oli
-l ay
-m y
-n atal
-o a
-r ine
-r ich
-r ied
-t roke
-u ity
-Ġt b
-Ġt ill
-Ġt ail
-Ġa verages
-re c
-Ġs ighted
-ti g
-en amel
-Ġc itiz
-Ġp ter
-Ġin organic
-Ġf all
-Ġf used
-Ġd omes
-Ġm p
-Ġm bl
-Ġb ac
-Ġb ig
-Ġb igg
-Ġre ferences
-Ġh f
-Ġh udd
+Ġmuscul oskeletal
+Ġregurg itation
+Ġflow chart
+Ġsir t
+Ġdiaph ragm
+Ġbiv ariate
+Ġde al
+Ġk r
+Ġprovin ce
+Ġantips ych
+Ġp ace
+Ġun ch
+Ġadj unct
+Ġaug ust
+Ġchole cyst
+l a
+v o
+Ġcr t
+Ġj u
+Ġgastro enter
+Ġcounter part
+otra cheal
+Ġafore mentioned
+an ine
+Ġde ad
+Ġch e
+Ġorgan ic
+Ġd t
+Ġdis agre
+Ġmodel ing
+Ġed s
+ifi able
+Ġo verest
+Ġl r
+Ġser ial
+Ġpass ive
+Ġcat enin
+Ġpractition er
+Ġinterf ace
+Ġhyp ers
+Ġreview ers
+Ġpsych iat
+Ġemploy ees
+Ġattempt ed
+Ġleg al
+Ġonc ology
+Ġeros ion
+Ġ6 0
+Ġutil izing
+in ter
+ist an
+Ġcompr ising
+Ġantipl ate
+Ġzirc onia
 le y
-Ġe hs
-it ants
-us ia
-Ġst ack
-Ġst aging
-ac ies
-Ġl ic
-Ġl ds
-Ġn ations
-Ġn ilt
-im es
-Ġfor t
-id ges
-Ġex ert
-Ġex foli
-Ġpro st
-ot ation
-Ġim ag
-Ġch olester
-Ġpre f
-Ġpre natal
-iv eness
-Ġdis abled
-Ġse ated
-Ġad vice
-Ġcl ot
-Ġco f
-ub lic
-Ġnot able
-Ġpos itivity
-vi an
-Ġfo v
-Ġcont acts
-Ġpl aus
-Ġtr ache
-Ġreg ulated
-Ġacc id
-Ġinter fere
-Ġint ensities
-Ġk ary
-Ġgen otypes
-Ġmodel ed
-erm al
-Ġdifferent ly
-Ġso on
-Ġar te
-Ġmax imal
-Ġbi ased
-Ġbi ases
-Ġbi ochemical
-Ġperiodonti st
-Ġ1 7
-ag l
-Ġsup erelastic
-Ġsp ent
-Ġsp ir
-Ġi ac
-Ġi od
-Ġop g
-Ġpost ure
-Ġcro s
-Ġconf usion
-Ġ3 7
-Ġcomple ting
-Ġz r
-Ġsix ty
-Ġet ched
-Ġend ogenous
-Ġmulti mod
-Ġterm in
-Ġcoun ting
-Ġsch em
-Ġdo ing
-Ġscal ed
-Ġneg atives
-Ġneg lect
-Ġstrength en
-Ġmonth ly
-Ġhyp odontia
-Ġfe a
-Ġfe eling
-Ġpart ner
-Ġhospital ized
-Ġu a
-Ġlight ness
-ma xillary
-Ġold est
-Ġgo etting
-Ġwork place
-Ġble aching
-Ġresid ent
-Ġnecess arily
-ont in
-Ġbiom ass
-Ġinduc es
-Ġadolesc ence
-Ġclinic opathological
-Ġmut ant
-Ġincreasing ly
-Ġreflec tion
-Ġfil ter
-Ġlast ly
-Ġtumor ous
-scop e
-Ġview er
-Ġ9 4
-Ġoptim ized
-Ġoptim istic
-Ġassum ptions
-Ġsn uff
-Ġ201 4
-Ġprep are
-Ġorgan isms
-Ġfit ted
-Ġmalign ancy
-Ġcho osing
-Ġassign ment
-Ġder iv
-Ġaltern ate
-Ġaltern atives
-Ġeng agement
-Ġsupple mentation
-Ġsa id
-Ġrecogn ize
-Ġdiss ection
-Ġbirth s
-Ġmanif ested
-Ġdemineral isation
-Ġglob ally
-Ġray pex
-Ġmc f
-Ġenhance ment
-Ġameric a
-Ġbeg ins
-Ġsummar izes
-Ġcomparative ly
-Ġcv m
-Ġhome ost
-Ġdrop out
-Ġheat m
-Ġana esthesia
-Ġbio active
-Ġcreat es
-Ġden aturation
-crip t
-Ġexc av
-Ġdil ution
-Ġobvious ly
-Ġintrac lass
-Ġrecording s
-Ġteach ers
-Ġdg ct
-Ġtransform ing
-Ġspect roscopy
-Ġupr ight
-Ġwhit ening
-Ġstabil ization
-Ġmoti v
-Ġpolymorph isms
-Ġgas tric
-Ġcarri er
-Ġcarri ers
-Ġsubtyp e
-Ġscar ce
-Ġgradu ates
-Ġlamin a
-Ġhaz ard
-23 2
-Ġdeterior ation
-Ġjusti fied
-Ġcorrec ted
-Ġpae ks
-Ġdiscrimin ant
-Ġclaim ed
-Ġprogramm e
-Ġpict ures
-Ġcompan ies
-Ġpel let
-Ġdos age
-Ġbb pe
-Ġhemis phere
-Ġcemento enamel
-Ġfenes tration
-Ġpv p
-Ġbod enham
-75 232
-Ġmetall ic
-Ġultim ately
-Ġperme ability
-Ġdissatis faction
-Ġpie z
-Ġcarbohydr ates
-Ġsenti ment
-Ġfren ch
-Ġrep ublic
-Ġdangerous ness
-Ġunemploy ed
-Ġuncontroll ability
-Ġflavour s
-Ġcancell ous
-irec tional
-79 75232
-Ġche il
-Ġovers ampling
-Ġalumin um
-Ġrefuge es
-Ġstiff ness
-Ġfundament al
-Ġfoss a
-Ġacycl ovir
-Ġcantile ver
-Ġvisco elastic
-Ġceras mart
-Ġnah co
-Ġcitiz ens
-Ġdomes tic
-Ġbigg er
-Ġhudd art
-Ġcholester ol
-Ġmultimod al
-Ġgoetting en
-2 2
-8 0
-g et
-g ma
-l ated
-l ight
-o ys
-o ber
-o ks
-r f
-s h
-y d
-z d
-z ech
+Ġdem ands
+Ġcut aneous
+Ġbal anced
+Ġconn ective
+Ġthrombo emb
+Ġinterm itt
+d a
+p read
+Ġthir ds
+Ġdivid ing
+Ġhorm onal
+Ġacetab ular
+i j
 Ġt ight
-Ġt etric
-Ġt exts
-in ar
-in der
-Ġa a
-on duc
-ti z
-Ġo pt
-er up
-Ġc zech
-Ġp ip
-Ġw al
-Ġin acti
-Ġf ist
-Ġf ather
-Ġf zd
+Ġp iv
+ar a
+ess ary
+Ġpart ners
+Ġpol l
+Ġambul ance
+r uct
+on as
+Ġas d
+Ġlung s
+Ġmax ill
+Ġaccount ing
+Ġhepar in
+Ġn sa
+Ġlocal ization
+Ġinh erent
+Ġchannel s
+Ġglomer ular
+Ġw ides
+Ġlo op
+Ġdm em
+Ġe us
+Ġpa id
+Ġwides pread
+Ġsup pl
+Ġl aryng
+Ġcon struction
+ir ation
+ex ist
+Ġimplant ed
+Ġhemat oma
+r ations
+Ġin os
+Ġre ally
+Ġl uc
+ple ments
+Ġagg rav
+Ġank le
+Ġdisl ocation
+q i
+ic ip
+Ġn b
+el ve
+Ġat rium
+ence phal
+Ġsub clinical
+Ġgeneral iz
+Ġ20 21
+Ġun n
+Ġinv ent
+of luores
+Ġbott om
+Ġl ith
+Ġsim ulated
+i ative
+n d
+Ġgen oty
+Ġcap ital
+Ġpat ch
+Ġoste otomy
+Ġdepend ence
+Ġnr f
+Ġh bs
+Ġjn k
+Ġn ether
+Ġme al
+erv ation
+Ġuncertain ty
+Ġbip olar
 Ġd ic
-Ġd ro
-Ġd ens
-Ġd ual
-Ġd ice
-Ġd pr
-or ous
-th ma
-Ġb d
-Ġb os
-Ġb hi
-is tal
-Ġre ality
-Ġre uter
-Ġh all
-Ġh gf
-Ġe al
-Ġe gg
-us tration
-Ġst v
-Ġst ro
-ul s
-Ġl r
-Ġl igation
-om onas
-Ġn ick
-Ġn erv
-Ġg on
+Ġg m
+Ġnecess arily
+m i
+Ġg vhd
+Ġhl a
+Ġcover ing
+Ġunch anged
+r ants
+Ġph one
+Ġeosin ophil
+Ġcanad a
+Ġconscious ness
+Ġcompass ion
+2 9
+y te
+id og
+Ġep ic
+Ġdown stream
+Ġdil ated
+Ġendomet rial
 Ġg ot
-Ġg ently
-ur ated
-ur face
-os al
-ce mic
-Ġas thma
-il ibr
-od ent
-od istal
-ati le
+ch a
+Ġra c
+Ġindex es
+Ġsw allow
+Ġbo ys
+entan yl
+Ġaugment ation
+Ġquick ly
+Ġt ens
+Ġg dm
+Ġdist ant
+ian ces
+Ġharv ested
+Ġtuberc ulosis
+Ġan onym
+Ġar b
+Ġhs p
+Ġexcre tion
+Ġin act
+Ġd ox
+Ġpersist ence
+Ġbrazil ian
+Ġosteoc last
+Ġun re
+Ġconsult ations
+Ġpon v
+azol am
+Ġatt ended
+ocyt ic
+Ġpp v
+Ġexh aus
+Ġelectrophores is
+Ġic us
+Ġtechn ologies
+Ġtransport ation
+Ġenl arg
+in ate
+Ġth ings
+Ġm amm
 Ġv ill
-Ġv iment
-Ġr ib
-Ġex on
-Ġpro pose
-Ġres erv
-Ġres net
-Ġbe aring
-ot al
-oc ity
-Ġch ief
-Ġat cc
-Ġac ts
-og ingival
-Ġsh r
-Ġsh ang
-ap pro
-Ġcl en
-Ġsc l
-Ġsc op
-ip ping
-Ġfo res
-Ġha em
-Ġro d
-Ġro i
-Ġtr ack
-Ġtr aced
-Ġrel ating
-Ġinter act
-Ġinter can
-Ġun a
-Ġk ol
-olog ist
-so ver
-Ġdet erg
-Ġgen otoxic
-str uct
-Ġar ms
-Ġar bit
-Ġph y
-adi ly
-Ġnon invasive
-pos able
-Ġdisc ontin
-Ġgener ational
-Ġsp ear
-Ġj ama
-Ġmicro soft
-Ġi oss
-Ġi hc
-Ġtrans ient
-Ġop aque
-Ġimplant ology
-Ġknow ing
-Ġmon olith
-vers al
-Ġdr ink
-Ġstandard ize
-Ġel apsed
-Ġproced ural
-Ġexpl oring
-Ġflu orescent
-ha i
-Ġir on
-Ġsch olar
-Ġsch ematic
-Ġscal ers
-Ġsit ting
-Ġreview ing
-Ġoper ations
-Ġcer am
-Ġfac em
-Ġlo ose
-Ġsl im
-clus ive
-Ġ5 6
-Ġps i
-Ġexpression s
-Ġhum idity
-Ġsex ual
-Ġscan ners
-Ġpa id
-Ġdiagnostic s
-Ġlab or
-Ġconfirm ation
-Ġconfirm atory
-Ġsequ ential
-Ġret est
-erg ed
-Ġpd gf
-Ġirr itation
-Ġexp ensive
-Ġdispl ays
-Ġequ ations
-Ġlife time
-Ġprior i
-Ġclos est
-Ġrot ations
-etr ical
-Ġmut ated
-Ġsk ewed
-Ġlast ing
-Ġutil ised
-Ġchem ok
-Ġconsum ing
-cep ts
-Ġshort est
-Ġconsequ ent
-Ġincub ator
-Ġrepe ti
-Ġorgan ized
-Ġbro ken
-Ġnas oph
-Ġread ability
-Ġbur sts
-Ġrepl ace
-Ġopen ed
-Ġmill ed
-Ġsem inar
-Ġfav or
-Ġhom ogenous
-Ġaccept ance
-Ġher pes
-Ġnan o
-Ġdown reg
-Ġaug mented
-opath ic
-Ġent r
-Ġmis align
-Ġcre ation
-Ġhis pan
-Ġadop ting
-Ġacqu ire
-Ġfacilit ates
-Ġhistological ly
-Ġindepend ence
-Ġarr ived
-Ġpi ece
-Ġelimin ating
-Ġmolec ule
-Ġste ady
-Ġemp ir
-Ġosteobl astic
-Ġcys ts
-Ġcircum ference
-Ġdirec tional
-Ġposts troke
-Ġsurround ed
-Ġ200 7
-Ġhorm onal
-Ġadvantage ous
-Ġemphas ize
-Ġget ting
-Ġcrystal s
-Ġatten u
-de hy
-Ġdeh ydr
-Ġassist ance
-Ġintrac ranial
-Ġpt v
-Ġirrig ants
-Ġdisadvant age
-Ġopportun istic
-Ġinh er
-Ġvascular ized
-Ġrobust ness
-Ġelect roph
-Ġperm ission
-Ġdiff use
-Ġtransf ection
-Ġconsecutive ly
-Ġoccup ational
-Ġnig er
-Ġple i
-Ġangi ogenic
-Ġreinfor ced
-Ġoct ober
-Ġmesi odistal
-Ġhypomineral ised
-Ġdehisc ences
-Ġsock ets
-Ġscat ter
-Ġcigare tte
-Ġgloss itis
-Ġflat ten
-Ġworks hop
-Ġattemp ted
-Ġremark able
-Ġimmunosup pressive
-Ġdistor tion
-Ġcoup led
-Ġdecom position
-Ġallevi ate
-Ġinvag inated
-Ġphysi ologic
-load ed
-Ġmess age
-Ġmidw ives
-Ġlichen oid
-Ġatmosph ere
-Ġck d
-Ġneutrophil s
-Ġcheckup s
-Ġcasp ase
-oglob in
-Ġaux iliary
-Ġsand bl
-Ġmart ens
-Ġlogarith mic
-Ġglyco lysis
-Ġprosthodontic s
-Ġmultin omial
-Ġunex pected
-Ġcrop ped
-Ġstereomicro scope
-Ġrox ithromycin
-Ġrab bit
-Ġunm et
-Ġinhab itants
-Ġconcur rent
-Ġvel ocity
-Ġknock down
-Ġpter yg
-Ġcros sover
-Ġreuter i
-Ġviment in
-Ġshang hai
-Ġintercan ine
-Ġmonolith ic
-Ġhispan ic
-Ġdehydr ated
-" ,
-2 6
-2 23
-9 18
-a is
-b g
-g bo
-n o
-o ir
-u ts
-v ar
-w s
-y an
-z z
-Ġ ys
-Ġt al
-Ġa w
-Ġa ver
-Ġth yroid
-on ge
-Ġs an
-Ġs omat
-Ġo v
-en viron
-Ġp th
-Ġp ess
-Ġw ent
-Ġw om
-Ġw ards
-Ġin appro
-es ts
-Ġan ten
-Ġof d
-Ġf tir
-Ġd t
-Ġd um
-Ġd ress
-Ġm i
-at us
-ro ot
-Ġre ly
-Ġto day
-Ġh ri
-le vel
-Ġe z
-Ġe yes
-Ġst one
-Ġst ai
-ul ts
-ul atory
-Ġl ies
-Ġl ived
-Ġl dl
-om nia
-im b
-Ġg ent
-ud ine
-Ġcon cepts
-Ġor b
-Ġper ic
-Ġper tain
-Ġcom ments
-tr ations
-ot es
-ut aneous
-ir n
-ver ty
-oc er
-oc ation
-oc king
-Ġde v
-ain age
-og or
-Ġdis trict
-Ġdis posable
-Ġhe ights
-Ġma kers
-Ġsc ais
-Ġind ian
-Ġinf ra
-Ġcont ents
-Ġro les
-Ġro oted
-Ġtr ay
-Ġreg ime
-Ġanalys ing
-Ġrel ig
-Ġrel uct
-Ġsub traction
-Ġun erup
-Ġk u
-Ġk ill
-Ġlevel ing
-ost aining
-Ġen rich
-Ġmay be
-Ġpo verty
-Ġso f
-Ġcol omb
-ber g
-Ġsec tioned
-Ġfour teen
-Ġindic ative
-Ġbr an
-ag on
-ag er
-Ġman g
-Ġcompar ability
-Ġnon c
-Ġdisc overed
-Ġclass room
-Ġj u
-Ġmicro pl
-Ġmicro struct
-Ġcomm it
-Ġmin ute
-Ġcalc ified
-Ġprob es
-Ġprob able
-Ġi root
-Ġtrans g
-Ġtrans versal
-Ġdep ended
-Ġlimit ing
-int estinal
-Ġem er
-Ġfre ed
-Ġtotal ly
-Ġfig s
-Ġdr ainage
-Ġradiograph ically
-Ġinfl amed
-par amet
-Ġsm irn
+pl astic
+Ġdep icted
+Ġthromb ocyt
+Ġfilt ered
+Ġelimin ate
+h i
+Ġcon duction
+Ġv ict
+Ġbl ast
+Ġrest ored
+Ġmarg ins
+d f
+p us
+Ġl y
+Ġr bc
 uct u
-Ġins tal
-Ġins omnia
-Ġapp end
-Ġdo ub
-Ġbacter icidal
-Ġpla ques
-Ġcy lin
-Ġprot ozo
-Ġfac ed
-Ġgu ard
+Ġradi o
+Ġtet ra
+Ġscann er
+Ġnether lands
+e in
+on omy
+Ġtr iple
+ric tion
+Ġdecl ined
+Ġcommerc ially
+Ġanesth et
 Ġfl uctu
-Ġatt ack
-Ġperce ive
-Ġ5 2
-Ġ5 7
-Ġsol ub
-Ġhard ly
-Ġmem ber
-Ġfluor osis
-Ġcap illary
-Ġcap abilities
-cal e
-Ġhum id
-Ġdm p
-Ġbiof unctional
-ou ts
-vir al
-Ġimmun ostaining
-Ġsw iss
-Ġseal ant
-Ġadd itive
-Ġ4 8
-Ġcontin ues
-Ġrespons ibility
-Ġgo ogl
-iel ding
-Ġreason ably
-Ġresid ential
-roph obic
-Ġhead ache
-Ġpsych i
-Ġpur ch
-Ġpur ification
-Ġadv ances
-Ġx gbo
-Ġhyd rophobic
-pri ate
-Ġ8 2
-Ġlear ned
-Ġms a
-ocy tic
-Ġsn oring
-Ġappropri ately
-Ġclean lin
-Ġtit le
-Ġplate lets
-Ġnat urally
-Ġapex dal
-Ġbro ther
-Ġev olution
-Ġgran ulation
-Ġbelie f
-Ġhem oglobin
-Ġve get
-Ġmar ried
-Ġcho ices
-Ġpm j
-Ġtarget ing
-Ġadap t
-Ġpor ion
-Ġrepeated ly
-Ġrequire ment
-Ġrc f
-Ġsugar s
-Ġdiss olution
-Ġaff lu
-Ġaff irm
-Ġcompr ises
-Ġnod ule
-Ġsuperior ity
-Ġanch or
-Ġrest ore
-Ġsar c
-Ġroutine ly
-aff in
-Ġcn ns
-Ġqual ified
-Ġstrati fication
-Ġstar ts
-Ġeffici ently
-aryn x
-Ġcc n
-Ġweak ness
-Ġdefici encies
-Ġalb anian
-Ġampl ic
-Ġretain er
-otom ies
-Ġsetup s
-Ġmix ing
-ocom ial
-Ġemphas izes
-Ġreveal s
-Ġreveal ing
-Ġanomal y
-Ġintrac anal
-Ġkn ew
-Ġsuperimposition s
-Ġimmunohist ochemistry
-Ġemb ase
-Ġccc s
-Ġbound aries
-Ġprovision al
-Ġcurric ula
-Ġquantify ing
-Ġmunicip ality
-Ġdiff usion
-Ġdistingu ishing
-Ġstop ped
-Ġclus ters
-Ġdraw back
-Ġgradu ation
-Ġlamin ate
-Ġcomfort able
-Ġfair ly
-Ġdim er
-Ġleg al
-ange ment
-Ġlea ve
-Ġsimpl ified
-Ġspr ay
-Ġfed eral
-Ġmultic ent
-Ġnp v
-Ġpel lets
-Ġdos es
-Ġafric a
-Ġdiscipl ining
-Ġspan ish
-Ġscenari o
-Ġremark ably
-Ġpredis posing
-Ġfenes trations
-Ġine v
-Ġnos ocomial
-Ġbucc olingual
-osens ory
-Ġmicrog raphs
-Ġant agon
-Ġfus obacterium
-Ġlav ender
-Ġquick ly
-Ġect opic
-Ġdupl icate
-ipid emia
-Ġconstruc ts
-Ġwithdr aw
-Ġremn ants
-Ġgastro intestinal
-Ġpun ishment
-Ġgh ost
-Ġorific e
-Ġmicron ucle
-Ġbench mark
-Ġunsatis factory
-Ġconvex ity
-Ġpunct ure
-Ġfanc a
-Ġcerti fied
-Ġintermedi ate
-Ġaeti ology
-Ġrectang ular
-Ġplaus ible
-Ġspir al
-Ġhomeost asis
-Ġegg er
-Ġnick el
-Ġnerv ous
-Ġgon ial
-ilibr ium
-Ġreserv oir
-Ġscop us
-Ġarbit r
-Ġphy tate
-Ġspear man
-Ġfacem ask
-dehy de
-Ġelectroph ores
-223 918
-Ġsomat osensory
-environ ment
-Ġinappro priate
-Ġanten atal
-Ġcylin der
-Ġgoogl enet
-Ġxgbo ost
-Ġcleanlin ess
-223918 5
-4 5
-f urt
-i ation
-m etic
-m ogor
-o tic
-p oints
-t ons
-u tious
-y r
-Ġt ell
-Ġt ds
-Ġa ic
-Ġa ud
-Ġth al
-Ġs ure
-Ġs ds
-Ġs dr
-ti se
-Ġo ss
-al ing
-Ġp ir
-Ġp fe
-Ġw el
-Ġw ds
-Ġw elf
-Ġan x
-Ġf ta
-Ġd ied
-Ġd yn
-Ġm h
-or f
-Ġb p
-Ġb us
-Ġb ow
-ar ten
-Ġre act
-Ġre versible
-Ġh an
-Ġh old
-Ġh oney
-Ġe f
-Ġe i
-Ġe ba
-it an
-Ġl n
-Ġl onge
-om od
-Ġn y
-Ġn ut
-Ġg ic
-os ening
-ce ption
-ol ated
-ol itan
-Ġas ia
-Ġas certain
-Ġcon tig
-id enti
-id den
-Ġor s
-Ġv ivid
-Ġv ice
-el ve
-Ġal ve
-Ġper p
-Ġper ir
-Ġr ing
-Ġpro ve
-Ġpro of
-Ġcom ment
-tr a
-tr ans
-ant on
-ir r
-oc ar
+Ġcalc ulations
+5 7
+al ian
+or ated
+Ġd ram
+ad en
+Ġprob able
+Ġmanag er
+Ġpul s
+Ġpw v
+Ġf entanyl
+Ġcon v
+Ġsup plements
+n ish
+Ġf re
+Ġm ur
+Ġst ake
+Ġcephal ometric
+Ġatm osph
+t te
+Ġg se
+Ġsur rog
+Ġdifferent ially
+Ġlook ing
+Ġinsight s
+Ġsaud i
+Ġl dh
+Ġimp oss
+Ġrespons iveness
+Ġure ter
+Ġantiplate let
+Ġmt or
+Ġauto ant
+c ing
+Ġdo ing
+Ġmolec ule
+Ġexclus ively
+Ġg ad
+il um
+ast ric
+Ġil iac
+Ġnan op
+Ġrestrict ions
+Ġamyl oid
+ost atic
+ia z
+Ġy og
+Ġcircum f
+Ġvect or
+at uration
+Ġg ent
+Ġhepat o
+roc ytes
+Ġfet us
+Ġpear son
+Ġs lic
+ug inosa
+ffici ently
+Ġavoid ing
+Ġmar ried
+Ġprec ip
+Ġpathophys iology
+Ġcytoplas m
+s p
+Ġstatist ic
+Ġlif et
+Ġimplement ing
+Ġvanc omycin
 Ġch ond
-Ġat rophic
-Ġcomp ut
-Ġdis app
-Ġsh ir
-Ġcl ones
-em ble
-Ġind ones
-ub e
-pec ific
-Ġcan cel
-Ġpar affin
-st able
-st atic
-Ġinf usion
-Ġpl ayed
-Ġperiodon tics
-Ġreg ulate
-Ġacc ounts
-Ġrec omb
-Ġrel ate
-fac es
-Ġinter faces
-Ġun stable
-Ġint ens
-Ġint ubation
-Ġy a
-ater ally
-Ġk i
-Ġk il
-ast ing
-Ġincre ments
-Ġcor poral
-Ġph one
-Ġph yl
-Ġcr is
-ex is
-ag g
-pt y
-Ġmicro environment
-Ġextr ap
-Ġpreval ences
-Ġdi oxide
-Ġdevelop s
-ak ers
-Ġdep ict
-Ġpost ulated
-Ġpost treatment
-cer ous
-Ġmet rop
-Ġem br
-Ġem pty
-Ġfig ures
-Ġca utious
-Ġresearch es
-Ġmulti level
-Ġselec ting
-gr ade
-Ġperiod ic
-ob ase
-Ġid i
-Ġmuc ous
-Ġsm d
-Ġsm ell
-Ġdesign ing
-Ġdesign ated
-Ġfill apex
-yn thesis
-Ġcollec tive
-Ġhist ologic
-Ġlo e
-Ġlo oking
-Ġlo osening
-Ġfl aps
-Ġarch ae
-Ġoste ogenesis
-Ġoste ocytes
-Ġoste ocyte
-Ġprof ound
-Ġpul sed
-Ġ5 5
-Ġ5 9
-oid al
-Ġep pend
-Ġtherap ies
-Ġhand s
-Ġpulp s
-Ġyoung est
-Ġload ings
-Ġmid azol
-Ġlas ted
-Ġdig ested
-Ġbel onged
-Ġpow dered
-Ġconven ience
-Ġest rogen
-Ġprem ature
-Ġta q
-Ġdistal ly
-ink age
-Ġ7 5
-Ġresid ue
-roph y
-Ġvir ul
-Ġshap ing
-Ġstim ulating
-Ġadmin ister
-Ġsepar ator
-Ġ9 5
-Ġpower ful
-Ġphot ogrammetry
-Ġsubs id
-ocy t
-Ġsearch ing
-Ġexce eding
-ect omy
-Ġtransl ations
-Ġread er
-Ġtend er
-Ġdam aging
-Ġrepl antation
-Ġcertain ty
-plas mic
-Ġirradi ance
-Ġtarg ets
-Ġdisord ered
-Ġultras on
-Ġdys bi
-ogram s
-Ġcop ies
-Ġadverse ly
-Ġeng age
-Ġeng ine
-Ġent ry
-Ġlin ks
-Ġnucle us
-Ġnucle atum
-Ġiv obase
-Ġaff ord
-Ġflex ibility
-Ġanch ored
-Ġpp v
-Ġskill ed
-Ġplot ted
-Ġpreoperative ly
-Ġadop tion
-Ġarr anged
-Ġpi eces
-Ġmd p
-Ġlymph ocytes
-Ġrev isions
-Ġsubm uc
-Ġemp tive
-aryn g
-Ġpersonal ized
-Ġretain ers
+Ġtw elve
+Ġfem ur
+Ġeas tern
+Ġsept al
+Ġs el
+ly ca
+Ġr if
+ac char
+Ġmax im
+Ġcur ric
+Ġg ained
+ab an
+Ġpain ful
+Ġrank l
+Ġmet all
+Ġref lex
+Ġorgan izations
+Ġadoles cent
+Ġcond yle
+Ġo hip
+Ġcl op
+Ġtr ied
+Ġhospital izations
+Ġend otracheal
+ount ered
+Ġanat omic
+Ġfru it
+Ġle aving
+Ġdis cl
+ens itivity
+Ġref lection
+Ġscre ws
+Ġemerg ing
 Ġenzym atic
-Ġgly cemic
-Ġulcer ation
-Ġcs i
-Ġcav itation
-Ġintrac ellular
-Ġremod elling
-Ġirrig ant
-Ġadhere nt
-Ġimpair ments
-Ġcomprom ise
+Ġenc ountered
+Ġoil s
+Ġbeh ind
+Ġg enders
+Ġcont rad
+Ġcons ort
 Ġspect rom
-Ġcomorb idity
-Ġaccompan ying
-Ġcat ast
-Ġauthor ities
-Ġdiscr imination
-Ġattain ed
-Ġtransplant ations
-Ġcarry ing
-Ġnc op
-Ġfif ty
-Ġhr k
-Ġconstit uted
-Ġconstit ute
-Ġcarri age
-Ġeryth emat
-Ġstrict ly
-Ġgradu ated
-Ġglaz ing
-Ġport able
-Ġdepic ts
-Ġirre le
-Ġcortic o
-Ġhypomineral ization
-Ġrig idity
-Ġchrom os
-Ġtempl ates
-Ġpenetr ate
-Ġmultic ore
-Ġprovin ces
-Ġpeptid e
-Ġfiss ures
-Ġrom exis
-Ġfavour able
-Ġtan z
-Ġsud an
-Ġdeal ing
-Ġimmig ration
-Ġbucc ally
-Ġsustain ed
-osens itiz
-Ġtun nel
-Ġinaccur ate
-Ġtoler ance
-Ġhemat oxylin
-Ġannot ation
-Ġinn ate
-Ġarrow s
-Ġfrank furt
-Ġpuber ty
-Ġdeliver ing
-Ġpolar ization
-Ġcomplement ary
-Ġadvoc ated
-Ġsext ants
-Ġling ually
-Ġtgn cs
-Ġfs r
-Ġlib yan
-Ġsubtr acting
-Ġking dom
-avir us
-Ġmillimet ers
-Ġtu key
-Ġadh ered
-Ġinterrup ted
-Ġprocl ination
-Ġmeticul ous
-Ġcoop eration
-Ġrelax ation
-Ġguarant ee
-Ġsupernat ant
-Ġva ult
-Ġincon clusive
-Ġhyperl ipidemia
-Ġcada ver
-Ġmacrodes igns
-Ġaccid ents
-Ġarte facts
-Ġtermin ology
-Ġhall and
-Ġshr inkage
-Ġclen ching
-Ġkol mogor
-Ġnasoph aryngeal
-Ġmisalign ment
-Ġys m
-Ġwom an
-Ġez bite
-Ġorb ital
-ocer amic
-Ġfreed om
-Ġsmirn ov
-Ġelectrophores is
-Ġwelf are
-Ġlonge vity
-Ġperir adicular
-Ġmetrop olitan
-Ġeppend orf
-Ġmidazol am
-Ġdysbi osis
-Ġkolmogor ov
-2 000
-9 0
-a rest
-c ode
-d ens
-e em
-e ast
-h u
-h el
-h ou
-j ing
-r ust
-s he
-u its
-y th
-y ad
-y tes
-Ġt il
-in i
-in ter
-in ity
-in ous
-in ized
-on ella
-Ġs tic
-Ġs ore
-Ġs ized
-Ġo mic
-en ic
-al c
-al dehyde
-Ġc oc
-Ġc ied
-Ġc chs
-Ġc anton
-Ġp es
-Ġp ist
-Ġin ex
-Ġan k
-Ġof ficial
-Ġf st
+Ġampl ified
+Ġwid er
+p en
+Ġin gest
+ot in
+Ġab i
+Ġinstr ucted
+Ġneur onal
+Ġcorrespond s
+Ġempt ying
+Ġc ef
+am ental
+Ġint ent
+Ġunfav orable
+c or
+Ġdesign s
+Ġhs ct
+Ġaddress ing
+Ġrating s
+Ġpall iative
+l ated
+it ting
+Ġcon form
+ful ness
+Ġgap dh
+Ġaer uginosa
+Ġaminotrans ferase
+idog rel
+Ġab ilities
+Ġimmun o
+Ġpsych ometric
+Ġq tc
+Ġdil atation
+Ġste ad
+Ġdisrup tion
+alb umin
+Ġclop idogrel
+h ep
+Ġdist ances
+Ġs sc
+ere s
+Ġinter fer
+Ġcas c
+Ġchlor ide
+Ġsched ule
+Ġsarcop enia
+Ġr ation
+Ġsystem atically
+yt ic
+Ġhyper lipidemia
+Ġimpl icated
+of ib
+Ġlast ing
+Ġmac ro
+Ġnorm ality
+Ġp in
+Ġappl iance
+Ġphen otypes
+igen ous
+Ġcouns eling
+Ġwarrant ed
+Ġp ep
 Ġf ung
-Ġf etal
-Ġd ab
-Ġd ss
-Ġm re
-Ġm erged
-or ate
-an o
-Ġb ord
-Ġb az
-Ġb atch
-is ite
-ic f
-ic ap
-ar th
-Ġre r
-Ġre ass
-Ġh on
-Ġh ole
-le mm
-Ġe lu
-us cular
-ac ial
-Ġl ying
-om ing
-ur able
-ur fact
-os c
-ol l
-ol ic
-ol one
-od i
-od ynamic
-Ġon t
-Ġor ange
-am n
-am atic
-Ġr idges
-ge usia
-Ġres c
+Ġres er
+Ġchar ge
+Ġtra its
+Ġless er
+Ġfri ends
+pect ives
+Ġpan or
+Ġgeograph ical
+Ġw bc
+Ġso on
+Ġrem ote
+Ġcre ating
+Ġcran ial
+Ġimmunosupp ressive
+Ġlifet ime
+Ġw aves
+Ġm ature
+Ġat tain
+ict ion
+Ġpers pectives
+rit in
+Ġhepat ocytes
+Ġdiscrep ancies
+Ġind igenous
+Ġab ut
+Ġameric a
+Ġarrhythm ias
+Ġn d
+Ġl amin
+Ġmin istry
+Ġfail ures
+Ġprolif erative
+Ġpref erences
+es ium
+ic ans
+Ġcont ra
+ob lasts
+Ġoff ers
+Ġconn ect
+Ġdut ch
+Ġcircumst ances
+a vi
 Ġbe gan
-oc al
-iz er
-ore c
-Ġpre requ
-iv ation
-Ġdis ap
-Ġsh se
-Ġsh aring
-Ġad ren
-and ria
-Ġtw elve
-Ġco unc
-Ġtable t
-Ġfo ot
-Ġinf requ
-Ġpres crib
-Ġall ograft
-ch er
-ill ance
-ill onella
-Ġmod ules
-Ġob st
-Ġno ise
-Ġne pal
-Ġne arest
-Ġinter ference
-Ġqu in
-Ġun ple
-form s
-Ġy ielding
-Ġdur ability
-Ġout lined
-str u
-Ġar c
-Ġar ising
-Ġmethod ologies
-Ġevalu ates
-Ġsec ure
-Ġsec tors
-Ġag ric
-Ġag gr
-Ġcal var
-Ġstr ata
-Ġimpl icated
-Ġsim ulating
-Ġbr af
-ag ers
-Ġman aged
-Ġmaxill omandibular
-ric es
-Ġdisc re
-Ġdisc overy
-Ġsp ut
-ult ure
-Ġj n
-Ġextr uded
-Ġcharacter ised
-Ġstat a
-Ġvis ion
-Ġneed le
-Ġer b
-Ġdr ive
-Ġdr amatic
-Ġdeterm inant
-Ġfr ied
-Ġbas el
-ob e
-Ġexpl icit
-Ġmuc ogingival
-Ġrestor able
-Ġir f
-Ġcb cts
-Ġneg l
-Ġgl ide
-Ġpath ogen
-Ġpath ologic
-Ġstrength ening
-Ġcollec ting
-Ġmechan ically
-Ġregression s
-Ġhist opath
-Ġlo zen
-Ġfl ush
-Ġfl aring
-Ġiniti ate
-ox id
-Ġpul pect
-Ġvi ewing
-Ġcomb ines
-Ġver te
-Ġsens itiz
-Ġmat rices
-Ġsol ve
-Ġsoci etal
-Ġmem ories
-Ġsurve illance
-Ġnorm s
-Ġpart y
-Ġapical ly
-pe ared
-Ġlab elled
-Ġtip ped
-Ġaut on
-Ġimmun ore
-Ġanxi ous
-Ġthickness es
-Ġlack s
-Ġ6 3
-Ġ6 5
-Ġ6 6
-Ġest eem
-Ġaccess ed
-Ġaccess ibility
-ero tic
-Ġrot ating
-Ġele ven
-Ġhyper ch
-Ġ7 1
-Ġ7 6
-Ġcycl ospor
-Ġprevent able
-Ġspecial izing
-Ġinhib its
-Ġpol and
-Ġpol ish
-Ġgrad ed
-Ġview ed
-Ġ9 0
-Ġ8 6
-Ġphot os
-Ġphot osensitiz
-line ar
-otyp ing
-Ġplate au
+Ġfib rous
+Ġmd r
+Ġtransform ed
+Ġp or
+int s
+Ġend ed
+Ġtak es
+Ġmagn esium
+Ġmitochond ria
+Ġcurv ature
+Ġsc op
+Ġcons olid
+Ġpros thetic
+Ġinterview ed
+Ġobvious ly
+Ġabstract s
+Ġre imb
+Ġst rom
+Ġcris is
+Ġp ak
+Ġl b
+Ġcont ral
+Ġcl ients
+Ġrheumat oid
+k y
+ome chan
+Ġactive ly
+Ġintern et
+Ġt ax
+cept ion
+Ġavoid ed
+Ġcirrh otic
+op os
+Ġcogn ition
+Ġunexp ected
+Ġatt ract
+Ġcyst s
+Ġc ited
+Ġstand ing
+Ġder iv
+Ġprec eding
+Ġnit rogen
+Ġremark able
+Ġcontral ateral
+ore p
+pt ions
+Ġsc c
+Ġk h
+ex in
+Ġappl iances
+Ġcolon y
+Ġpal p
+Ġnas h
+Ġfer ritin
+Ġcarry ing
+Ġunn ec
+Ġh es
+Ġus er
+Ġbr ux
+Ġmm hg
+Ġanesthesi ologists
+w a
+Ġval vular
+Ġcent ered
+Ġpoint ed
+ma x
+Ġjoint s
+Ġkeep ing
+Ġt ro
+Ġmanufacture r
+Ġb ud
+ur ated
+Ġun a
+Ġactiv ate
+Ġel imination
+Ġmicro plate
+Ġfilt ration
+Ġt ac
+Ġg on
+Ġdes ired
+Ġsyn chron
+Ġgluc ocortic
+Ġvac u
+Ġst ere
+Ġpl ans
+Ġbrach ial
+y les
+Ġinter c
+ath y
+Ġapp ra
+Ġestablish ing
+Ġabnorm ality
+p ol
+Ġpre natal
+Ġev ap
+Ġel astic
+Ġsegment ation
+Ġacknow led
+Ġautoant ib
+u an
+re ci
+Ġper oxide
+Ġinter stit
+Ġnon in
+Ġeff usion
+Ġod ont
+Ġanalges ics
+Ġpret reated
+Ġfund amental
+Ġamp k
+Ġenlarg ement
+hep atic
+Ġpanor amic
+on ate
+ak es
+Ġtra it
+Ġnor thern
+Ġconcept ual
+Ġmanifest ation
+Ġuncontrol led
+5 6
+Ġmat uration
+Ġmicrob iological
+Ġtoler ated
+Ġpict ure
+Ġe lic
+Ġform at
+Ġins ignificant
+Ġisol ate
+Ġhepato cellular
+p in
+Ġm ent
+Ġv ast
+Ġtr im
+Ġcharacter ization
 Ġ201 7
-Ġbu ffering
-Ġfp ms
-Ġethnic ities
-Ġhorizontal ly
-Ġmac rol
-Ġve illonella
-Ġmar row
-Ġaddress es
-Ġdys geusia
-Ġcop ings
-Ġpm bg
-Ġpm icf
-Ġnan jing
-Ġchlor ide
-Ġent ering
-Ġsa os
-Ġdiss em
-Ġdiss ip
-Ġbiological ly
-Ġfibro us
-Ġcarb oxyl
-Ġcyt ometry
-Ġcomputer ized
-cus sion
-Ġexplan ations
-Ġenti ty
-Ġfar si
-Ġprogress ively
-Ġadop t
-Ġmg j
-Ġabr aded
-Ġelimin ates
-Ġattend ees
-Ġasymm etric
-Ġlymph ocytic
-Ġprop ag
-Ġtransm itted
-Ġmig r
-Ġsummar ised
-ra id
-ystal line
-Ġig g
-Ġthin ner
-Ġgly cer
-Ġjud g
-Ġbs p
-Ġosteocl astic
-Ġturn over
-Ġmacro scopic
-Ġpt u
-Ġkin ematic
-Ġteach er
-Ġanalges ia
-Ġmad s
-Ġkn ee
-Ġom ds
-Ġsusp ic
-Ġestablish ment
-Ġdichotom ous
-Ġbroad er
-13 04
-Ġec ological
-Ġacceler ate
-Ġresour ce
-Ġupreg ulation
-Ġjob s
-oster one
-12 47
-Ġsupplement al
-Ġslow ly
-Ġhr b
-Ġeryth ema
-alth y
-Ġimmers ion
-Ġfeel ings
-Ġnons urgical
-Ġjusti fy
-Ġinverse ly
-Ġlive ware
-Ġpit ch
-Ġcompet ency
-Ġscat tered
-Ġdiscl osing
-Ġhemis ection
-Ġpig s
-Ġfiss ure
-Ġren der
-Ġneuro lemm
-Ġformal in
-Ġwors ened
-Ġalex andria
-otrop y
-Ġcoup ling
-Ġfrag ment
-Ġfrag ments
-Ġconstrain t
-Ġvirus es
-Ġine ffec
-Ġimmig rants
+Ġhemat oxylin
+Ġinvent ory
+Ġimposs ible
+m ing
+Ġw est
+om at
+Ġ2 9
+Ġcann ulation
+Ġuseful ness
+Ġn orep
+Ġimmun ity
+Ġdiamet ers
+Ġmel d
+Ġexpert ise
+Ġsy ring
 Ġregul ates
-Ġoi irr
-Ġmidw if
-Ġaspir ation
-Ġdimin ished
-Ġdisturb ances
-Ġobl iter
-Ġbios urfact
-Ġht cs
-Ġri yad
-Ġinfr ared
-Ġbiomater ials
-Ġreposition ing
-Ġreplic as
-Ġbid irectional
-Ġdisch arge
-Ġlect ures
-Ġtrib ochemical
-Ġpec king
-Ġoscill ation
-Ġdissol ved
-Ġretic ulum
-Ġkinderg arten
-Ġpell icle
-Ġbif ur
-Ġtrabec ular
-Ġacknowled ged
-Ġvacu um
-Ġlic ensed
-Ġheatm ap
-Ġfist ula
-Ġdic om
-Ġentr ance
-Ġempir ical
-Ġplei otropy
-Ġsandbl asting
-Ġappend ix
-Ġsolub ility
-Ġarbitr ary
-Ġshir az
-Ġrecomb inant
-Ġirrele vant
-Ġomic ron
-Ġcied e
-Ġdisap peared
-Ġcounc il
-Ġunple asant
-Ġaggr av
-Ġsensitiz ation
-Ġkinematic s
-1304 1247
-Ġriyad h
-2 5
-2 00
-3 0
-7 3
-8 04
-9 2
-a q
-b acter
-e i
-f ies
-g t
-k i
-p rom
-p tive
-p ens
-t arily
-v ered
-z i
-Ġt re
-Ġt ab
-Ġt el
-Ġt ie
-Ġt rees
-in ally
-Ġa z
-Ġa ce
-Ġthe ories
-Ġs on
-Ġs as
-Ġs el
-ti oh
-er ated
-er ical
-er ate
-Ġc ot
-Ġp iv
-Ġp age
-Ġw tioh
-Ġin ver
-Ġan esthetic
-Ġf h
-Ġf oci
-Ġd h
-Ġm end
-Ġm ast
-Ġm ss
-Ġm io
-Ġm sc
-Ġm ask
-at ers
-or on
-or rh
-th ing
-an n
-Ġb a
-as ic
-Ġre adily
-Ġre imb
-Ġto uch
-Ġh ot
-Ġh ous
-Ġe ye
-it or
-it ance
-ation ally
-Ġst ock
-ul i
-Ġl am
-Ġl ad
-Ġl ysis
-Ġl odi
-Ġn om
-Ġn cel
-Ġn yst
-Ġn ames
-im ax
-Ġg ather
-ig ible
-Ġwith stand
-os ol
-id is
-ati z
-un tary
-am am
-Ġv en
-Ġv es
-Ġv ort
-el ian
-ter m
-Ġr ug
-Ġpro xy
-uc d
-Ġcom ing
-ir a
-Ġinc enti
-um ination
-pl astic
-Ġme als
-Ġpre treated
-Ġac ting
-og le
-og onal
-ib ilities
-Ġhe ated
-Ġcl sa
-rom y
-ence ment
-Ġperi oste
-Ġoral is
-Ġap c
-Ġap e
-Ġco res
-Ġle x
-st age
-Ġha pl
-ari o
-Ġpl ant
-Ġpl ier
-Ġall ografts
-Ġro ds
-Ġtr is
-Ġmod ulate
-Ġreg imens
-Ġreg ulating
-Ġne ph
-Ġinter inc
-Ġinter active
-Ġqu it
-Ġun w
-Ġun nec
-Ġlow ered
-ens es
-Ġk its
-Ġwe igh
-Ġspec ulate
-erm idis
-Ġdes ire
-Ġris ing
-Ġinv est
-Ġmed it
-Ġmed line
-Ġph aryngeal
-Ġover f
-Ġfound ation
-Ġbi ot
-Ġmo od
-tis ing
-Ġdec ade
-Ġcr i
-Ġag a
-ite k
-Ġbr and
-Ġsystem ically
-Ġman ager
-Ġsup posed
-Ġsup plied
-Ġorth ogonal
-Ġradi ologic
-Ġj ord
-Ġj oin
-Ġmicro t
-Ġcomm encement
-Ġmin ipl
-Ġyear ly
-Ġchar ge
-Ġbec oming
-Ġi e
-Ġtrans duc
-Ġform ul
-ici ous
-Ġgr it
-Ġgr ays
-Ġreduc tions
-Ġunder lined
-Ġimp ly
-Ġ3 4
-Ġ3 5
-Ġintr usive
-Ġplan us
-ores t
-Ġend s
-Ġmulti plied
-Ġfr actions
-Ġfr uit
-Ġcorrel ates
-Ġgeneral ization
-Ġmedical ly
-Ġsm h
-Ġthro at
-Ġunivers ally
-Ġos f
-Ġfac ility
-Ġpal pation
-Ġhist or
-Ġeth yl
-Ġlo ok
-Ġcaus ality
-Ġsl a
-Ġver ification
-Ġanaly tic
-itis h
-Ġproduc es
-Ġinvol untary
-Ġcontr action
-Ġitem ized
-Ġalign ing
-Ġpoly s
-Ġoh l
-ptom ycin
-Ġu z
-Ġvers a
-Ġsyn thetic
-Ġpd c
-Ġequ ilibrium
-Ġ4 6
-Ġintern s
-Ġintern ationally
-Ġest on
-Ġfib rosis
-Ġstrong est
-Ġrespons ibilities
-Ġdistal izing
-Ġgo es
-Ġgo ogle
-Ġte en
-Ġaim ing
-Ġintroduc ing
-Ġpros per
-Ġ7 3
-Ġresid ing
-Ġunders c
-och ond
-Ġmorph ometric
-Ġpress ures
-Ġfil tered
-Ġtumor igen
-Ġdescrip tions
-Ġapproxim ate
-Ġpol itical
-Ġcond ensed
-Ġconcentr ates
-Ġinser t
-Ġphot obi
-Ġms is
-Ġmus cular
-Ġsn acks
-Ġster il
-Ġrecru iting
-Ġconsent ed
-Ġreal ized
-Ġmineral isation
-Ġobjec tions
-fort able
-Ġtend encies
-Ġerup t
-Ġev ol
-Ġgran ted
-Ġve in
-Ġra ising
-Ġpm ta
-Ġnan ocom
-Ġmil an
+Ġcytoplas mic
+Ġsole ly
+Ġcarbap enem
+ul ence
+Ġn ail
+ol s
+Ġant id
+Ġsm ear
+Ġhelp ed
+Ġure th
+c il
+Ġsex es
+Ġcam era
+Ġht n
+m d
+it ect
+il ding
+Ġall erg
+Ġactiv ating
+Ġexam ples
+Ġasc ending
+rel ated
+Ġacl f
+Ġcan ines
+Ġd ens
+Ġh ier
+all ing
+Ġsp ot
+Ġpercent ile
+Ġintermitt ent
+Ġnorep inephrine
+ic ing
+Ġgast ritis
+Ġwal k
+t on
+Ġpar ad
+Ġed ent
+Ġdescrib es
+Ġconsum ing
+Ġ201 5
+l ig
+Ġ2 7
+Ġestim ating
+Ġalb icans
+Ġcari ous
+Ġn rs
+Ġmm se
+Ġcandid ates
+Ġhydrox yl
+Ġb if
+us pid
+Ġmult im
+Ġfig ures
+Ġfulf illed
+Ġhier arch
+x a
+Ġe ase
+Ġde ple
+ment ed
+ha i
+Ġendoth elium
 Ġstre ptomycin
-Ġsa ving
-Ġbase ment
-Ġcam p
-Ġwr ist
-Ġminim ized
-Ġminim izing
-Ġepid ermidis
-Ġcre vic
-Ġfacilit ating
-Ġperson ality
-Ġarr angement
-Ġmc at
-Ġtn m
-Ġbal ancing
-Ġlact ate
-Ġcapt uring
-Ġweak er
-Ġdefici ent
-Ġelement ary
-Ġcircum maxillary
-Ġbox pl
-Ġprotr uded
-Ġdrop ped
-Ġdrop outs
-Ġ202 2
-Ġlangu ages
-Ġindent ations
-Ġvolun tarily
-Ġdeform ations
-Ġcs bs
-Ġgraph s
-Ġspread ing
-Ġspread she
-Ġaccom pl
-Ġpt g
-Ġefficient net
-Ġbott le
-Ġpredom inance
-Ġcomprom ising
-Ġpreser ved
-Ġpreser ving
-lic ates
-Ġsmooth ed
-Ġborder line
-Ġcontain er
-Ġprev ail
-Ġclar ity
-Ġactiv ate
-Ġarchitect ures
-Ġhol ds
-Ġcompress ing
-Ġdiabetic s
-Ġcorrespond ed
-Ġtax onomic
-Ġgi ant
+Ġmaxill ofacial
+Ġreimb urs
+g ar
+Ġis o
+oid al
+Ġappoint ments
+Ġcounterpart s
+v ity
+Ġdis inf
+Ġadmin ister
+Ġdent ure
+Ġoccup ation
+Ġsig ma
+n am
+is al
+act in
+Ġco ff
+Ġhand s
+Ġstre t
+Ġexpendit ure
+e ast
+Ġ ub
+Ġliv ed
+Ġsens ation
+Ġcp p
+Ġens uring
+Ġfav or
+Ġaggreg ation
+Ġmun icip
+b urg
+ab olic
+Ġsc atter
+Ġcardi ology
+Ġtop ics
+Ġimbal ance
+Ġc ip
+Ġindirect ly
+Ġelucid ate
+Ġniger ia
+or acic
+Ġg ps
+Ġdef icit
+Ġsuper oxide
+Ġformal in
 Ġopin ions
+h am
+Ġw arm
+an z
+Ġim t
+Ġper ip
+Ġrel ating
+Ġsm ad
+Ġgraft ing
+Ġstimul us
+Ġsubm itted
+Ġincrement al
+Ġhomogene ous
+r ific
+Ġrepresent ation
+Ġwilling ness
+f old
+Ġc ns
+Ġan ter
+Ġq rs
+Ġmand atory
+Ġfa ecal
+Ġfing er
+Ġlid ocaine
+Ġ uro
+in ity
+Ġp ca
+Ġe u
+Ġr id
+Ġch x
+Ġet t
+Ġhyp o
+Ġcoll ateral
+Ġpneumonia e
+Ġket amine
+m es
+Ġl ysis
+Ġcatheter ization
+Ġaden omas
+bre vi
+n ut
+Ġv ig
+ers onal
+Ġover t
+Ġdep r
+Ġdef icient
+Ġ201 6
+ira ble
+Ġevid enced
+Ġey es
+Ġas k
+od ynamic
+ach ing
+Ġcath eters
+Ġdiv ision
+Ġchemical s
+Ġcalib rated
+Ġcoff ee
+Ġd ro
+om od
+Ġcor rob
+Ġhel ps
+Ġsusp ic
+Ġaud it
+orth y
+Ġingred ients
+Ġthrombocyt openia
+Ġf ine
+Ġsub d
+Ġ2 6
+Ġvisit ing
+Ġbed s
+e u
+Ġc row
+eth ing
+Ġextensive ly
+Ġsom ething
+Ġbranch es
+Ġatmosph ere
+Ġg aps
+rom ycin
+olog ous
+Ġnot ice
+Ġnor way
+Ġtra ject
+uct ive
+Ġcur ative
+Ġsac rific
+Ġclinicopath ological
+Ġnanop art
+a a
+Ġstrong est
+Ġig a
+Ġlat ent
+Ġlat est
+Ġneut rop
+Ġamb ulatory
+Ġglyc os
+os omal
+Ġal i
+Ġpl aus
+Ġman ually
+Ġsuggest ive
+Ġapp reci
+Ġbu ilding
+Ġenl arged
+Ġcigare tte
+w i
+Ġb v
+Ġh v
+Ġun ion
+ang l
+Ġfra gments
+Ġdiss atisf
+��spect ra
+Ġeb v
+el s
+Ġpa w
+ca pe
+Ġvas odil
+Ġunnec essary
+ic ine
+Ġm u
+r id
+t able
+Ġh if
+il ib
+Ġint ense
+Ġpe er
+Ġcirc ulatory
+Ġaccess ible
+Ġmt a
+Ġconflic ting
+Ġsubmuc osal
+c ation
+Ġsec urity
+Ġrefer ring
+Ġhouse holds
+Ġlib rary
+Ġs ib
+Ġwe bs
+e ch
+ress ing
+Ġident ity
+Ġcycl in
+rect omy
+Ġphosphat ase
+ent eric
+Ġch air
+Ġantic ancer
+Ġdysp nea
+it ol
+Ġr pm
+ob ser
+Ġhyper uric
+Ġdec id
+Ġlast ly
+Ġtransf ection
+Ġded icated
+fe eding
+rast ruct
+Ġb ite
+Ġab brevi
+Ġconf ig
+Ġdam aged
+Ġpreoperative ly
+Ġassum ing
+Ġmicrob i
 Ġfund ing
-urg ery
-Ġrh il
-Ġunderestim ated
-cell ular
-Ġfed eration
-Ġmit ochond
-Ġcompet ence
-Ġchile ans
-Ġdisrup tion
-Ġbiocompati ble
-Ġbic arb
-Ġtransluc ent
-Ġinfiltr ated
-Ġmillim eter
-Ġstret ched
-Ġdup licates
-Ġhygien ist
-Ġimmunosup pression
-Ġzygomatic omaxillary
-Ġsurprising ly
-Ġregul atory
-Ġdispers ion
-Ġdispers ive
-how ever
-Ġwet tability
-Ġinters ection
-Ġ29 3
-Ġcontrad ict
-Ġdefinite ly
-47 6
-Ġacet ate
-Ġmicrom echanical
-Ġbil aterally
-Ġenvelop e
-Ġpuber tal
-Ġcollabor ative
-Ġjournal s
-emb led
-Ġinfer red
-Ġneu rolog
-Ġunco ated
-Ġmalays ia
-Ġfish ery
-Ġtransp arent
-Ġxen ograft
-Ġoverestim ated
-Ġperu vian
-Ġgroo ves
-Ġdiver gence
-Ġdepr ived
-Ġuncom fortable
-Ġunhe althy
-Ġoverd ent
-Ġips ilateral
-Ġhierarch ical
-Ġasep tic
-Ġneo plasm
-Ġarres ted
-Ġiod ine
-Ġpiez on
-Ġcitizens hip
-Ġstro be
-Ġfores try
-Ġdownreg ulated
-Ġtransg ender
-Ġemer ge
-Ġprotozo an
-Ġpsychi atric
-Ġdyn am
-Ġmh di
-omod ulation
-Ġny ucd
-ocar cin
-Ġcris is
-Ġsubsid ized
-Ġfung us
-Ġont ario
-Ġagric ulture
-Ġjn k
-Ġpulpect omy
-Ġcyclospor ine
-Ġsuspic ion
-Ġneurolemm oma
-Ġineffec tive
-prom ised
-Ġmend elian
-Ġreimb urse
-Ġnyst atin
-Ġvort ex
-Ġincenti ves
-Ġinterinc isal
-Ġunnec ess
-Ġgrays cale
-Ġtumorigen esis
-Ġphotobi omodulation
-Ġnanocom posite
-Ġbicarb onate
-5 00
-6 7
-b iotic
-b irth
-c ing
-c ium
-d h
-f en
-f ield
-g a
-g l
-g raphs
-i ant
-j ian
-k n
-o ti
-p tic
-p lying
-r it
-r am
-r ystalline
-v ision
-w ith
-y ed
-Ġt c
-Ġt ro
-Ġt ess
-in yl
-Ġth rom
-on ed
-on ing
-Ġs ick
-Ġs orption
-ti al
-ti les
-Ġo st
+Ġantagon ist
+Ġbund le
+Ġsurrog ate
+p ly
+Ġs an
+Ġf gf
+ul ator
+ati ble
+Ġeduc ated
+Ġestablish ment
+Ġbehaviour al
+Ġ ions
 Ġc red
-ed ical
-Ġp ak
-Ġp its
-Ġp amam
-Ġf ever
-Ġf bs
-Ġm ist
-Ġm itek
-at ching
-or tic
-or ally
-th is
-Ġb ases
-Ġb ind
-Ġb iph
-as il
-ic ating
-ro up
-ro red
-ar til
-Ġre vers
-Ġto wn
-Ġh uge
-Ġe k
-Ġe hr
-Ġl ens
-Ġl ining
-Ġn ail
-Ġn ights
-ly cer
-ig lycer
-ud ing
-os keletal
-ce mia
-ol id
-il ed
-id a
-ab s
-am ing
-am ide
-am ount
-am cin
-res ults
-Ġal umina
-Ġr bl
-ot ome
-ical cium
-iz an
-Ġch en
-Ġch at
-Ġch ips
-ain d
-Ġinc ip
-Ġat p
-Ġat yp
-Ġpre clud
-Ġpre trained
-og h
-Ġdis k
-Ġdis abilities
-Ġse man
-Ġse vent
-ial it
-Ġsh ock
-Ġsh ah
-Ġhe avi
-Ġcl one
-Ġtw in
-op ress
-op aper
-Ġsc ler
-Ġco vers
-Ġco arse
-Ġle uc
-Ġle fort
-Ġtable ts
-Ġnot es
-Ġpar as
-Ġpar ad
-Ġpar amount
-ine ph
-ee p
-per i
-Ġall ergy
-ch ar
-Ġtr ied
+Ġfor ty
+Ġfor ced
+Ġcon ce
+crip ts
+Ġeng age
+Ġassum e
+Ġlat ency
+Ġwant ed
+Ġmicroc irc
+Ġcardiop ulmonary
+t in
+Ġinsp iratory
+Ġanticoagul ant
+m cs
+Ġex cision
+Ġreg ulations
+Ġrec omb
+Ġhist ologic
+Ġavoid ance
+Ġbon y
+Ġtoothp aste
+c ap
+e per
+al id
+and ibular
+Ġexp iratory
+Ġgl p
+Ġdent ine
+Ġbar s
+vas ive
+l in
+re f
+Ġepid emic
+Ġleuk ocyte
+Ġgh ana
+Ġgingiv a
+Ġsynerg istic
+Ġpl ayed
+Ġphys iology
+Ġnec rotic
+Ġquar ter
+Ġd an
+Ġcom es
+Ġser ot
+Ġindic ative
+ok ines
+Ġarter i
+Ġschem e
+Ġp dl
+Ġh ope
+ps y
+Ġret ro
+Ġobst etric
+Ġsuspic ion
+Ġt k
+Ġpath ologic
+Ġcap ability
+Ġfas c
+Ġdimin ished
+w ord
+Ġc eliac
+ac s
+Ġco agul
+Ġinter ference
+ogen etic
+Ġexpl oring
+Ġincl ination
+Ġshif ts
+Ġencour age
+Ġe uth
+ot ics
+pe f
+Ġsim ply
+Ġrep et
+Ġir re
+Ġwall s
+Ġsept um
+Ġh all
+ce phal
+Ġad l
+ang er
+Ġhand ling
+Ġmass ive
+Ġsyndrom es
+g d
+ion ally
+Ġpl r
+ass ay
+Ġexpl oration
+Ġblock ade
+Ġultras onic
+Ġcardiomy ocytes
+Ġfibrin ogen
+Ġinterstit ial
+Ġt v
+Ġc esarean
+Ġbreast feeding
+Ġbd nf
+Ġch ron
+Ġtre e
+Ġhyp n
+Ġq t
+Ġincub ator
+Ġpay ment
+Ġreag ents
+Ġjud ged
+Ġpolyph enol
+o ac
+w v
+Ġt i
+Ġs as
+Ġcryst all
+Ġfab ric
+Ġgro ss
+Ġstat ic
+Ġhist or
+Ġequ ations
+Ġmd d
+Ġdl b
+Ġge ographic
+b irth
+at ology
+is ions
+Ġsit ting
+Ġmass age
+rogen ic
+Ġcaucas ian
+op oi
+vent ricular
+ok ed
+Ġprot r
+Ġconfir ms
+Ġech o
+raz ole
+a h
+ar ity
+Ġmod ulation
+Ġpar amed
+Ġtransl ocation
+Ġchlor oform
+Ġduoden um
+w ash
+Ġc ard
+Ġpur ified
+Ġaccount s
+Ġyog a
+t ics
+Ġm imic
+Ġg amm
+un ted
+Ġprob es
+omp ass
+Ġenc ompass
+Ġupreg ulation
+Ġpenet ration
+Ġcon ve
+Ġsu ction
+Ġsu fficiently
+Ġsh arp
+Ġadjust ments
+Ġprec urs
+erent ial
+Ġsar c
+Ġmenstr ual
+Ġ rom
+ati z
+Ġbi omechan
+Ġpost men
+Ġmit ig
+Ġhistopath ology
+Ġfp g
+Ġ201 4
+Ġann exin
+Ġstress ful
+Ġread m
+Ġequip ped
+4 4
+Ġst z
+Ġr i
+am en
+Ġbi ologic
+Ġborder line
+Ġfru its
+Ġchromos ome
+oc rine
+Ġbr ing
+Ġcall s
+ull ary
+obacter ia
+Ġc ct
+Ġp cs
+Ġh ind
+iv a
+Ġoff ic
+Ġreact ivity
+Ġinstrument ation
+Ġpap illary
+Ġanesth etics
+Ġcoup led
+Ġje jun
+Ġinf ormal
+agn osed
+Ġang les
+Ġembol ism
+p c
+Ġf ertility
+Ġsu c
+Ġspec ulated
+rop athy
+Ġcp b
+Ġselect ing
+Ġdegen eration
+Ġlock down
+6 8
+c ar
+ys te
+Ġnot able
+Ġbu ild
+Ġfluid s
+Ġdim er
+Ġsil ver
+Ġn in
+Ġve ins
+Ġaff ord
+Ġsynthes ized
+nut rition
+Ġe eg
+ul ates
+Ġsign alling
+Ġharm ful
+ol er
+Ġk ill
+Ġcs a
+Ġla w
+aryn x
+Ġflex ible
+Ġextrem ity
+Ġhypers ensitivity
+ic idal
+end icular
+Ġimmun ost
+Ġide a
+Ġhab it
+Ġaa a
+Ġinverse ly
+pan ic
+Ġsut ures
+Ġperp endicular
+u z
+Ġb up
+Ġco operation
+ath yroid
+Ġmon ocyte
+Ġret in
+Ġsl ope
+Ġblock er
+Ġip s
+Ġcontrad ict
+h ow
+Ġnot ew
+Ġed ta
+Ġmorbid ities
+Ġattenu ation
+in der
+im a
+Ġant en
+ineral ization
+Ġpostmen opausal
+Ġl ute
+Ġdiff ers
+Ġun p
+Ġ7 5
+Ġos se
+Ġtranscript ional
+Ġelectrocardi ogram
+Ġp ct
+Ġb or
+Ġob t
+Ġpres ervation
+Ġcolon ies
+ilum ines
+Ġnotew orthy
+Ġt ann
+Ġp ent
+Ġl on
+Ġic c
+Ġq l
+Ġassum ptions
+Ġnumer ical
+Ġremark ably
+Ġincid ences
+im s
+Ġhyp other
+Ġhf pef
+Ġacup oint
+Ġnation wide
 Ġmod est
-Ġmod ulating
-cl ass
-Ġno tion
-Ġrec overed
-Ġrel ie
-Ġab bre
-Ġaf raid
-Ġinter p
-Ġinter cept
-Ġqu id
-Ġqu ery
-Ġun e
-Ġun et
-Ġint ense
-ay er
-ist an
-ist ing
-Ġam ph
-Ġk g
-Ġk s
-olog ists
-Ġgen ome
-Ġpo orest
-Ġout per
-Ġout li
-Ġspec ially
-Ġtest osterone
-Ġnum b
-Ġbi k
-Ġbi ology
-Ġcol a
-Ġcol i
-Ġcol gate
-Ġcol orec
-Ġdec ide
-Ġour s
-Ġcr aters
-Ġag ency
-Ġstr ip
-ex aminer
-ag inous
-ag roup
-Ġ2 000
-Ġnon can
-Ġgener ates
-Ġclass ic
-Ġclass ifier
-Ġsp p
-Ġsp arse
-Ġed ar
-Ġdem ands
-Ġconsid ers
-te k
-Ġprob and
-Ġprob abilities
-Ġi at
-Ġi an
-ten ess
-Ġform ulated
-ak er
-ak ed
-Ġli e
-Ġsal es
-Ġcharacter ize
-Ġimp ed
-Ġimp lying
-Ġdetec tor
-Ġmet er
-Ġmon oc
-Ġmon ocl
-Ġem ail
-Ġintr agroup
-br asil
-Ġz e
-Ġer ad
-atic s
-Ġquestion able
-Ġless ons
-Ġsoft ened
-Ġran king
-unc tions
-Ġmulti l
-Ġrem ember
-Ġfr ialit
-Ġcent res
-Ġincis ions
-Ġeduc ating
-Ġins p
-Ġir is
-Ġrece ipt
-Ġprot aper
-Ġpredic ts
-Ġanti se
-Ġanti viral
-Ġdist inc
-Ġpe ers
-omet rical
-Ġnec ro
-Ġoste otomies
-Ġiniti ating
-Ġintra examiner
-Ġdefec tive
-eral d
-Ġsevere ly
-Ġschool ing
-Ġexpos ures
-ta king
-Ġ5 4
-Ġvol atile
-Ġsol ved
-Ġhard ware
-Ġhand icap
-Ġcap s
-Ġcross head
-Ġpoly phosph
-Ġsu it
-Ġeight y
-Ġreli ably
-omm on
-Ġsequ enced
-Ġu v
-Ġsinus itis
-Ġcephal ospor
-Ġdig es
-Ġimmun ocom
-Ġconven ient
-Ġadd ic
-Ġair bor
-Ġprom p
-Ġ4 1
-Ġ6 1
-Ġ6 4
-Ġfree ze
-Ġorig ins
-Ġcontrib ut
-Ġcontrib utions
-Ġct bs
-Ġte hr
-Ġbo ost
-Ġhyper t
-Ġcp c
-Ġ7 2
-Ġact u
-Ġcontact ing
-Ġbiom edical
-Ġcommun ications
-Ġabove mentioned
-Ġdel usion
-Ġspecial ty
-Ġsumm ed
-Ġsumm ing
-Ġfil ms
-osph ate
-Ġchem ically
-ithel ial
-Ġcond yles
-Ġchec king
-Ġphot omicro
-Ġphot odynamic
-Ġens emble
-Ġgum my
-not e
-Ġ201 5
-Ġecon om
-Ġfit c
-Ġconfound er
-Ġemerg ing
-Ġrepl icate
-Ġinterven tional
-Ġcomposition al
-Ġmedic aments
-Ġfav oring
-Ġinterpre t
-Ġve h
-Ġve gf
-Ġsb brasil
-Ġmesial ization
-Ġra j
-Ġpm um
-Ġpor osity
-Ġquantitative ly
-Ġrecogn izing
-Ġretr usion
-Ġram al
-Ġpf na
-Ġdemineral ised
-Ġinterview ed
-Ġplas ter
-Ġnumer acy
-Ġds d
-Ġminor ities
-oph ys
-Ġleuk ocytes
-Ġtrad ition
-Ġincorpor ate
-Ġillustr ating
-Ġsul ci
-Ġcondyle on
-Ġgraf ted
-Ġconver gence
-Ġss b
-Ġrap d
-Ġconsult ants
-Ġentire ly
-Ġown ers
-Ġhere in
-Ġexpand ing
-Ġoverl oad
-fy ing
-Ġpossib ilities
-bo ok
-Ġsecre ted
-Ġsut ural
-Ġ200 5
-Ġden otes
-Ġgraph ene
-Ġemphas izing
-Ġnar r
-Ġexc ised
-Ġradioluc encies
-Ġtheore tically
-Ġemo tions
-Ġpac ifiers
-Ġosteoc onduc
-Ġalle les
-Ġshif ts
-Ġrein stru
-Ġvene ers
-Ġsubt le
-Ġec ology
-Ġfast ing
-Ġorthop antom
-Ġperm utation
-Ġquad as
-Ġslow er
+Ġen velop
+Ġrequ ested
+Ġdevelopment al
+Ġphen oty
+Ġvas cul
+Ġexist ed
+ofluores cence
+Ġn v
+ell ed
+Ġcl imate
+Ġne o
+Ġint oler
+Ġall ergy
+Ġtem plate
+Ġsuper imp
 Ġexpect ancy
-Ġtri amcin
-Ġsubstr ates
-Ġquar ters
-Ġcoron avirus
-Ġmir rored
-Ġcontrovers y
-Ġdepic ting
-Ġpull s
-Ġdeterior ated
-Ġchrom at
-Ġbic usp
-Ġanalog ue
-Ġprogramm es
-emat ological
-Ġstimul ates
-Ġarg inine
-Ġarg ued
-Ġdiscipl ines
-Ġrating s
-Ġrefr ig
-Ġrefr active
-Ġexpendit ure
-Ġpy ram
-Ġwors ening
-Ġaden ocarcin
-Ġunc ommon
-Ġsud den
-Ġfat ty
-Ġosteoclast ogenesis
-Ġtoxic ity
-Ġbod ily
-Ġinvag ination
-Ġunpredict able
-fr ame
-Ġmetall oprotein
-Ġultim ate
-Ġdissatis fied
-Ġts al
-Ġdimin ish
-Ġatmosph eric
-Ġacet on
-Ġcorrobor ated
-Ġho ok
-Ġeosin ophil
-Ġobl ig
-Ġenvelop es
-Ġfrank fort
-Ġvap or
-Ġaer osol
-Ġsubd iv
-Ġbiomater ial
-Ġradical s
-Ġpic o
-Ġnin th
-Ġnin ety
-Ġmaxim ize
-Ġrepeat ability
-Ġdest ro
-Ġali qu
-Ġimper f
-Ġads orption
-Ġads orb
-Ġneighb our
-Ġneighb oring
-Ġruss ia
-Ġproce ed
+Ġnh s
+Ġemp ow
+Ġbelong ing
+p al
+y a
+Ġ encephal
+Ġr ater
+Ġall o
+Ġsurg ically
+Ġglob ally
+Ġdigest ive
+h ex
+am ycin
+Ġcm h
+Ġantioxid ants
+Ġgest ation
+Ġconflic t
+Ġprism a
+Ġd f
+Ġn ad
+ere ctomy
+Ġha pl
+int ro
+Ġi e
+Ġs ort
+Ġl am
+Ġem pathy
+Ġuniv ariable
+Ġinterest ed
+Ġswit ch
+in ance
+Ġne oplastic
+yl ar
+Ġproduct ivity
+Ġillness es
+Ġautom atically
+Ġr ip
+Ġr rt
+Ġcardi ogenic
+al dehyde
+Ġn st
+Ġsh ear
+and a
+Ġdep ict
+Ġunderg raduate
+Ġsv r
 Ġupd ated
-Ġflor ida
-Ġplasm ids
-Ġhistomorph ometric
-Ġdispar ity
-Ġtrache ost
-Ġgent le
-Ġpertain ing
-Ġreluct ance
-Ġafflu ent
-Ġsarc oma
-Ġmulticent er
-Ġaic r
-Ġindones ia
-Ġidi opathic
-Ġadminister ing
-Ġcatast rophic
-Ġbord ers
-Ġadren al
-Ġfried man
-Ġlozen ges
-Ġauton om
-Ġphotosensitiz er
-Ġrender ing
-804 476
-Ġcot inine
-Ġpiv otal
-Ġoverf itting
-Ġaga rose
-Ġuz b
-Ġcontradict ory
+iabet ic
+r is
+Ġas certain
+Ġde eper
+Ġcontact ed
+Ġce ft
+Ġasc orb
+Ġfr ance
+yste ine
+s acchar
+Ġg gt
+Ġmin is
+oph osph
+Ġspe aking
+Ġoh ca
+Ġrecording s
+Ġpr ice
+Ġconst ra
+Ġner ves
+Ġana er
+Ġoriginal ly
+Ġexpand ed
 Ġpak istan
-Ġbiph asic
-artil aginous
-Ġincip ient
-ineph rine
-Ġabbre vi
-Ġoutli ers
-Ġcolorec tal
-Ġnoncan cerous
-Ġcephalospor ins
-Ġairbor ne
-Ġtehr an
-Ġphotomicro graphs
-Ġtriamcin olone
-804476 9
-, .
-a ved
-b ites
-c ul
-d ec
-e z
-e tical
-g ans
-i us
-n n
-o ul
-o ub
-q hi
-r ial
-t w
-t ude
-u a
-v izan
-w r
-w ell
-x a
-y tic
-Ġt qhi
-in is
-Ġa es
-Ġa ure
-re l
-Ġth ail
-Ġth aw
-Ġs at
-al o
-al p
-al istic
-er ved
-Ġc g
-Ġc ow
-ed ics
-Ġp oles
-Ġw u
-Ġin oc
-Ġin ference
-Ġin activation
-Ġin lay
-Ġan ton
-Ġf ell
-Ġf alling
-Ġd uct
-Ġd ash
-Ġm iti
-Ġm ath
-Ġm ism
-Ġm pi
-at osis
-or otation
-th al
-th ere
-Ġb h
-Ġb ms
-Ġre per
-Ġre form
-Ġh b
-Ġh ered
-it ally
-ul o
-ul arities
-ac char
-Ġl u
-Ġl os
-Ġl um
-Ġl af
-Ġl amp
-Ġl aws
-Ġn est
-Ġn ich
-im eter
-Ġg t
-Ġg w
-Ġg tr
-Ġg arg
-ly mer
-ig m
-Ġwith e
-et ed
-Ġas k
-il ing
-il iter
-il arities
-Ġcon ference
-od ed
-od or
-Ġon coh
-ati veness
-Ġor gans
-am ple
-Ġv an
-Ġv ig
-Ġv ibr
-el ation
-Ġal to
-Ġper cussion
-Ġr up
-Ġr aces
-Ġr acial
-Ġres or
-Ġres usp
-ion al
-uc tions
-uc cess
-ot ox
-Ġis otropic
-ad ing
-ad ays
-Ġus ability
-Ġch eek
-ies t
-Ġde x
-ain e
-Ġat rophy
-Ġac uity
-Ġcomp ares
-Ġcomp uls
-og g
-ib ly
-Ġdis pro
-Ġse at
-Ġsh ade
-Ġhe par
-Ġhe ma
-op eri
-em t
-Ġap par
-ip ei
-Ġnot md
-pec tives
-Ġpos tal
-Ġall erg
-ch ange
-Ġtr unc
-Ġtr iang
-Ġtr icalcium
-Ġmod ifying
-Ġreg istr
-cl ock
-Ġacc ident
-Ġthan ks
-ges tion
-Ġrel ief
-Ġtooth dec
-Ġab i
-Ġab er
-Ġqu inol
-Ġint estinal
-Ġy out
-Ġy ogh
-Ġam oun
-Ġk ar
-Ġwe are
-Ġwe aken
+h ou
+Ġt ace
+Ġoste ogenic
+Ġtrip licate
+Ġoverest im
+Ġal ive
+ad ex
+Ġimpl ies
+be ing
+Ġanten atal
+w ire
+at ine
+Ġbe am
+Ġep inephrine
+Ġconven ience
+Ġantidepress ant
+Ġinf er
+Ġz ones
+Ġlymph atic
+Ġnecess ity
+itone um
+Ġh old
+Ġst yle
+Ġstudy ing
+Ġdef ining
+ps ych
+xim ab
+Ġveget ables
+Ġc im
+th etics
+av irus
+Ġimm ob
+Ġdys pe
+Ġlabor ator
+Ġ9 0
+Ġfit c
+Ġintraper itoneal
+Ġp age
+Ġag o
+Ġ3 3
+Ġmal form
+Ġd ynamics
+Ġe e
+ch lor
+Ġen ables
+Ġover d
+Ġdiscuss ions
+Ġmal ays
+be cular
+Ġeg ypt
+Ġthink ing
+Ġdownreg ulated
+Ġalkal ine
+Ġagon ist
+Ġanastom osis
+Ġs av
+Ġin r
+Ġmut ant
+Ġplot ted
+Ġbed side
+Ġsom atic
+Ġaf p
+Ġdeterm inant
+Ġ201 3
+Ġperic ardial
+Ġth ym
+Ġinc ont
+Ġph il
 Ġpresent ations
-lec ted
-Ġen abl
-Ġen abled
-Ġreported ly
-Ġout line
-ass emia
-Ġar rest
-mo id
-lu x
-lu or
-Ġdenti tions
-Ġtime point
-Ġdec alc
-Ġcr acks
-Ġsec ured
-Ġimpl ied
-Ġsim ul
-Ġbr ight
-Ġbr ist
-Ġbr ands
-Ġund oub
-ep ithelial
-Ġman ip
-Ġnon paramet
-Ġgener ic
-Ġappl ies
-Ġclass ifiers
-Ġexper tise
-Ġradi ance
-Ġsp ons
-Ġj o
-Ġcare er
-te es
-Ġhy al
-Ġprob ase
-Ġi q
-Ġmal i
-Ġmal ay
-Ġmal odor
-Ġtrans well
-Ġwell s
-Ġsal vizan
-Ġunder weight
-Ġunder take
-Ġunder taking
-Ġlim b
-Ġimp rec
-Ġconf lu
-Ġ3 2
-Ġ3 9
-Ġser ves
-Ġbl ade
-Ġbl ank
-Ġcomple teness
-Ġ0 3
-Ġz o
-Ġend point
-Ġel ab
-Ġmulti f
-Ġmulti plying
-Ġrem ission
-Ġsome thing
-gr aft
-Ġfr uits
-Ġcoun ties
-par t
-Ġexpl ains
-Ġexpl oration
-Ġmuc operi
-Ġflu ency
-Ġsm hr
-Ġir aq
-Ġoc ular
-ffici ency
-Ġgl ut
-Ġunivers ities
-Ġstrength ened
-Ġlo op
-imension al
-Ġstress ful
-Ġprof ess
-Ġintra observer
-Ġpul ver
-Ġsl ic
-Ġ5 1
-Ġ5 8
-Ġ5 00
-Ġthird ly
-Ġcontr aind
-Ġcompl iant
-Ġcross bites
-Ġrele asing
-Ġmid point
-Ġpers pectives
-Ġpoly ol
-Ġsym ph
-Ġeven ly
-Ġlab elling
-Ġmiss ense
-Ġwhe y
-Ġaut ogenous
-Ġaut orotation
-Ġguid ing
-Ġcult uring
-Ġpat ch
-Ġpat ches
-Ġexp ose
-Ġta ipei
-Ġdifferenti ating
-Ġgo at
-Ġtmd dx
-Ġprote ase
-Ġte fl
-Ġprec ip
-Ġpros pects
-Ġele v
-Ġpan ic
-Ġhypoth etical
-wor k
-Ġ7 0
-Ġ7 7
-och rom
-Ġshap iro
-Ġinduc tion
-Ġcorresponding ly
-Ġfil tek
-Ġutil ity
-Ġx ive
-Ġansw ering
-Ġgrad uate
-Ġshort com
-Ġtra it
-Ġ8 7
-Ġinser ts
-Ġinser ting
-Ġsle e
-ocy cline
-Ġsearch es
-Ġens ures
-Ġmus cul
-itud es
-Ġill umina
-Ġemploy ee
-Ġtmj oa
-Ġread y
-Ġgenetic s
-Ġgenetic ally
-Ġdam aged
-Ġmy c
-Ġbu ff
-Ġmill iliter
-Ġphosph ory
-Ġlig ated
-Ġhem orrh
-Ġmargin ally
-roc ytes
-Ġrecommend s
-Ġhom ology
-Ġess entially
-Ġaccept ability
-Ġcf na
-Ġtur ned
-Ġtransfer ring
-opath y
-Ġdl p
-Ġmis d
-Ġnucle ic
-Ġcirc ular
-Ġcirc ulation
-Ġcirc ulating
-Ġcirc adian
-Ġintegr al
-Ġna ive
-Ġcarb ide
-Ġcyt ological
-Ġorigin ated
-Ġwr ong
-Ġfore ns
-Ġisol ate
-Ġsimple x
-Ġprogress es
-opl astic
-16 9
-Ġsept um
-Ġlact ating
-Ġss bs
-Ġprop ria
-Ġcovari ate
-Ġcovari ance
-angu inis
-Ġelement al
-Ġstomat ognathic
-Ġoverl o
-Ġdepend ence
-Ġcollagen ase
-Ġalb ania
-Ġdepos it
-Ġremineral izing
-Ġvas opress
-Ġcounter clock
-Ġmap k
-Ġrins es
-Ġincid ences
-Ġbio activity
-Ġou a
-Ġgraph ic
-Ġhypothes ize
-15 7
-Ġwash out
-Ġelectron ically
-Ġdeh yd
-Ġabsorb ed
-Ġsy br
-Ġsed iment
-Ġdistin ction
-Ġcure tte
-Ġgap dh
-Ġinjec tions
-Ġvs p
-Ġencour aging
-ole mia
-Ġkeratin ocytes
-Ġkeratin ocyte
-Ġarter ies
-Ġsusp ended
-Ġwavelength s
+Ġexpl icit
+Ġq rt
+hold ers
+otox icity
+Ġhippocamp us
+Ġplate au
+Ġhypox emia
+u ity
+Ġm ad
+ur y
+im etric
+ol l
+ra um
+Ġdis abilities
+Ġwell being
+Ġmob ilization
+Ġemph asis
+Ġoverlap ping
+Ġdup lic
+Ġimped ance
+Ġhbs ag
+Ġso u
+Ġclass ic
+Ġ9 9
+Ġnm r
+Ġpathophys iological
+Ġvolunt ary
+i ating
+r p
+Ġs bs
+ant ed
+Ġout lined
+Ġcomple ting
+Ġmid line
+Ġmt x
+Ġbon fer
+Ġcarbohyd rate
+Ġslic es
+Ġnanopart icles
+ere mia
+Ġpro xim
+Ġpart ner
+Ġox a
+Ġkey word
+Ġfil m
+Ġcluster ing
+Ġexce eded
+Ġrelig ious
+Ġhyperuric emia
+intro duction
+p ivacaine
+ul f
+Ġg ives
+Ġv f
+Ġor b
+Ġwound s
 Ġsulf ate
-Ġnarrow er
-Ġnarrow est
-Ġinpati ent
-Ġkt w
+Ġg b
+ens ed
+Ġdifferent ly
+Ġem ission
+ron i
+Ġsport s
+Ġa ph
+Ġp th
+it on
+ar ray
+Ġenviron ments
+Ġsil ic
+Ġtrack ing
+Ġminis cre
+at rol
+Ġfit ness
+gt t
+Ġsou thern
+r ist
+Ġd og
+Ġg out
+Ġas king
+ver atrol
+Ġfit ting
+Ġbro wn
+Ġh yst
+osp or
+Ġi op
+Ġgraft s
+Ġminor ity
+Ġtach ycardia
+Ġanticip ated
+Ġbonfer roni
+f entanil
+al c
+Ġnor we
+Ġpass ed
+p b
+ol is
+Ġexpl aining
+Ġoper ational
+Ġbrux ism
+Ġact h
+ole mia
+Ġdisp ers
+Ġnan o
+Ġsuperv ision
+3 5
+Ġw et
+Ġco inc
+Ġx yl
+Ġrecogn ize
+Ġov x
+Ġcanad ian
+Ġa th
+Ġc rest
+Ġf iss
+Ġe h
+Ġl ists
+Ġk d
+Ġindividual ized
+Ġrecomb inant
+ed ema
+Ġl en
+ff e
+Ġant ith
+ang i
+Ġdr iv
+Ġsimilar ity
+Ġpub er
+Ġarch itect
+Ġfif ty
+Ġb ms
+ul as
+Ġn am
+Ġcol our
+Ġtub ular
+for ce
+Ġor ific
+Ġam put
+Ġfall ing
+Ġmouth wash
+path ic
+Ġdehyd rogen
+Ġconce al
+Ġp lex
+it r
+Ġde br
+Ġno ise
+Ġreveal s
+Ġv te
+Ġor s
+Ġde co
+Ġwe alth
+Ġdi e
+Ġmod es
+ome g
+Ġfin land
+Ġra p
+Ġbec oming
+Ġprob abilities
+Ġalign ed
+Ġexpress ing
+re p
+Ġd ap
+Ġb rom
+Ġmo ved
+Ġulcer ative
+Ġple ural
+Ġwindow s
+obser ver
+Ġascorb ic
+om orph
+et erm
+Ġrem ed
+Ġprob iotics
+ocyt osis
+Ġrepl ication
+ging ival
+Ġderm atitis
+Ġtib ia
+Ġfibrob last
+Ġh rs
+od al
+Ġext ending
+Ġdes ire
+Ġfacilit ating
+Ġstabil ization
+Ġattend ance
+m t
+Ġth i
+Ġman eu
+Ġadd itive
+Ġcut ting
+Ġallevi ate
+Ġspan ish
+Ġerup tion
+Ġtrigg ered
+Ġincont inence
+os ine
+Ġpro ce
+ogra ft
+Ġ3 6
+Ġorgan is
+Ġalign ers
 Ġorient ed
-Ġanaer ob
-Ġion izing
-Ġdw ell
-Ġcongen itally
-Ġextract ing
-Ġactiv ates
-Ġnow adays
-Ġhol ding
-Ġgranul oma
-Ġgranul omas
-rogen ic
-Ġegyp ti
-Ġquar tile
-Ġcoron ary
-Ġdraw ing
-Ġosteo arth
-Ġeryth ro
-Ġvox els
-Ġadip osity
-Ġleg s
-Ġsuperv ised
-Ġpopular ity
-Ġbasal oid
-Ġsimpl er
-Ġdisagree ments
-Ġrh amn
-Ġcorrec tive
-Ġdiscrimin ate
-Ġcompet ent
-Ġmob il
-Ġingred ient
-Ġever x
-Ġencod er
-Ġsched ule
-Ġdisplay ing
-Ġdiscl os
-Ġdiscl osed
-Ġdiscipl ine
-Ġchip ping
-Ġchew ed
-Ġmirr ors
-Ġunc over
-Ġunre alistic
-Ġosteop er
-Ġallevi ation
-Ġcompati bility
-Ġcolum ns
-Ġinaccur acies
-Ġcorrobor ate
-Ġgra vity
-Ġsymm etry
-ophil us
-Ġlubric ation
-Ġmalays ian
-Ġsext ant
-Ġreposition ed
-Ġsynch ro
-Ġintim a
-Ġimper ative
-Ġgroo ve
-Ġparish es
-Ġamb ulatory
-Ġfriend s
-Ġfer mented
-anth ion
-Ġexec uted
-Ġflor a
-Ġhap a
-Ġdors al
-Ġconsul ted
-Ġreinforce ment
-Ġfall s
-Ġexfoli ated
-Ġkary o
-Ġexcav ation
-Ġcheil itis
-Ġdens enet
-Ġrib s
-Ġdeterg ents
-Ġscholar s
-Ġchemok ines
-Ġinher itance
-Ġniger ia
-Ġflatten ed
-Ġaver aged
-Ġku wa
-Ġenrich ed
-Ġcommit tees
-Ġguard ians
+fl oxacin
+Ġorthop edic
+Ġluc ifer
+e em
+Ġp oc
+Ġn ps
+ch er
+Ġr ub
+Ġal anine
+Ġimmun ore
+he ad
+Ġglut am
+Ġnonin vasive
+b a
+Ġun w
+Ġspl en
+Ġcate chol
+Ġlucifer ase
+l t
+Ġsu v
+Ġspec ulate
+Ġrh in
+Ġepile psy
+omat ous
+b ility
+Ġl up
+im ab
+Ġar gin
+Ġtra becular
+yl ated
+rough t
+Ġsyn ov
+Ġsl ice
+Ġvir ulence
+Ġalle les
+Ġpac ing
+Ġchlor hex
+Ġencour aged
+Ġnutri ent
+Ġp ge
+Ġab ras
+Ġproper ly
+Ġsil ica
+Ġget ting
 Ġhumid ified
-Ġpurch ased
-Ġthal assemia
-Ġanx io
-Ġalve olus
-Ġcomput ational
-Ġcancel led
-Ġtanz ania
-Ġcadaver ic
-Ġpist on
-Ġank yl
-Ġresc ue
-Ġprerequ isite
-Ġfoot note
-Ġinfrequ ent
-Ġprescrib ing
-Ġobst ac
-Ġcalvar ial
-Ġnegl igible
-Ġpropag ation
-Ġjudg ment
-Ġobliter ation
-Ġbiosurfact ant
-Ġbifur cation
-Ġsel dom
-Ġinver ted
-Ġmsc s
-Ġhous ing
-Ġven ous
-Ġperioste um
-Ġie hr
-Ġformul as
-Ġteen agers
-Ġprosper o
-Ġcrevic ular
-Ġboxpl ots
-Ġspreadshe et
-Ġefficientnet b
-Ġmitochond rial
-Ġoverdent ure
-Ġreimburse ment
-Ġunnecess ary
-Ġthrom b
-Ġrevers ed
-Ġseman tic
-Ġiat rogenic
-Ġmonoc rystalline
-Ġmonocl onal
-Ġimmunocom promised
-Ġactu ator
-Ġdelusion al
-Ġadenocarcin oma
-Ġaceton ide
-Ġsubdiv ision
-Ġtracheost omy
-Ġaure us
-Ġthail and
-Ġmath ematic
-Ġmism atch
-Ġoncoh ematological
-Ġalto gether
-Ġresusp ended
-uccess ful
-Ġappar atus
-Ġnotmd dx
-Ġtrunc ated
-Ġregistr ies
-Ġtoothdec ay
-Ġyout ube
-Ġyogh urt
-Ġenabl ing
-Ġundoub ted
-Ġnonparamet ric
-Ġtefl on
-Ġshortcom ings
-Ġcounterclock wise
-Ġosteoarth ritis
-" .
-0 5
-4 0
-4 6
-8 3
-b one
-c at
-d a
-d ers
-e f
-e valu
-e ties
-i as
-i lection
-k a
-n is
-n ian
-n utr
-o ter
-o form
-o ured
-p ers
-p inal
-r ate
-s m
-s u
-t an
-u ates
-u tical
-v o
-v is
-y ads
-Ġ erm
-re ci
-Ġth ing
-Ġth ai
-on ec
-on ucle
-Ġs is
-Ġs ort
-Ġs bl
-Ġs oph
-Ġs anguinis
-Ġo val
-al es
-al ation
-er ves
-Ġc odon
-Ġc ree
-Ġc ens
-Ġc me
-ed ip
-Ġp ns
-Ġp ca
-Ġw it
-Ġw kt
-Ġw enz
-Ġin qu
-Ġan co
-Ġan emic
-Ġf c
-Ġf ee
-Ġf asc
-Ġd or
-Ġd an
-Ġd ol
-Ġd uc
-Ġd og
-Ġd yads
-Ġm x
-Ġm ich
-at o
-at ter
-at tr
-at eness
-or osis
-or kers
-an a
-Ġb g
-Ġb ub
-Ġb ites
-Ġb md
-Ġb olus
-as ted
-ent an
-ic in
-ro us
-ro cal
-ro fen
-Ġe als
-it ate
-it ably
-Ġst ad
-Ġst yle
-ac in
-ac et
-Ġl f
-Ġl cr
-Ġl ob
-Ġl osing
-om iting
-Ġn r
-Ġn if
-Ġn af
-im etric
-Ġg ath
-Ġg aining
-Ġg was
-ur ic
-Ġwi ld
-et ary
-et one
-et te
-os ynthesis
-ol aryng
-ol ayer
-Ġas ter
-Ġas cending
-il ding
-il ient
-un t
-Ġv omiting
-el a
-el itis
-ter ious
-up rofen
-Ġal a
-Ġper oxid
-Ġr z
-Ġr fa
-Ġex cep
-Ġex ogenous
-Ġex change
-Ġres ilient
-Ġbe ar
-Ġbe we
-Ġbe ads
-ot est
-ad ow
-ess ive
-ir ability
-qu am
-Ġch elation
-Ġde ion
-Ġpre pro
-Ġse oul
-Ġsh of
-Ġsh ares
-ap e
-rom a
-rom o
-Ġma h
-odon tist
-em bl
-Ġsc rap
-Ġsc aff
-Ġperi otest
-Ġco operative
-Ġind is
-ub er
-Ġnot ing
-Ġcan on
-Ġpar k
-Ġfo il
-Ġfo ki
-Ġha emat
-Ġpl enty
-ell ation
-ell ate
-Ġall oys
-ch ond
-ch lor
-end ments
-ill in
-Ġtr ich
-Ġtr ipl
-Ġtr ying
-Ġtr uly
-Ġtr iglycer
-Ġmod ify
-Ġacc omm
-Ġno xa
-Ġrec over
-Ġrel ied
-Ġab lation
-Ġsub chond
-Ġinter im
-Ġinter fer
-Ġinter con
-Ġinter observer
-Ġun in
-Ġun av
-Ġint ro
-Ġint agl
-ay ered
-Ġy at
-Ġy ag
-Ġy aw
-Ġam p
-Ġam oxic
-Ġam orph
-Ġam endments
-Ġmeas urable
-Ġk ine
-rap ped
-Ġdet ach
-ost in
-Ġfol ds
-Ġgen us
-Ġgen otyping
-Ġassess es
-ph ine
-Ġout lier
-ose al
-Ġcor ners
-Ġdes cending
-Ġdes irability
-Ġdes quam
-Ġar ith
-Ġimage j
-Ġinv is
-Ġph r
-ograph ies
-Ġcr y
-Ġag rees
-Ġproc rust
-Ġimpl ies
-Ġimpl ication
-Ġbr ittle
-Ġbr aces
-Ġmean time
-ag land
-Ġfir mic
-ath ion
-Ġdisc over
-Ġsup pression
-Ġsup pressed
-Ġsp ee
+ro om
+im ilar
+if e
+Ġform ulations
+Ġmal aria
+Ġlo os
+Ġcann ula
+Ġinterf ere
+Ġembol ization
+Ġde aling
 Ġj un
-Ġj emt
-Ġbut ton
-Ġbut tons
-Ġdem arc
-Ġmin ocycline
-Ġchar ting
-Ġmal formation
-Ġtrans pl
-Ġtrans cript
-Ġcur ative
-ace tic
-ace utical
-Ġsal t
-Ġpost p
-Ġconf er
-Ġprim e
-Ġ3 3
-Ġ3 8
-Ġmon olayer
-Ġem ission
-Ġem erald
-Ġol ig
-Ġstand s
-Ġquestion ed
-Ġend points
-Ġinform ative
-unc iation
-Ġloc ators
-Ġdeterm ines
-Ġtechn ically
-Ġmulti stage
-Ġrem ind
-Ġrem inder
-Ġcent ric
-Ġpred ilection
-Ġcoun ty
-Ġbas ically
-ob ia
-Ġmuc otome
-Ġsm iling
-Ġapp reci
-Ġdo ts
-Ġbacter ium
-Ġmouth s
-Ġgl omer
-Ġfill ers
-Ġpath ologist
-Ġpath ophys
-Ġfactor ial
-Ġfac ing
-Ġfac ts
-Ġhist ology
-Ġoste omy
-Ġoste osynthesis
-Ġpul se
-Ġver b
-Ġsens ations
-Ġmat urity
-Ġvit apex
-Ġep ig
-av es
-av age
-Ġps p
-Ġps is
-Ġps mart
-Ġsoci eties
-Ġrepresent ativeness
-Ġhand le
-Ġhand book
-Ġmor se
-Ġday time
-Ġdm t
-Ġmid stream
-Ġsu ff
-Ġpa i
-Ġachie vement
-Ġachie vable
-Ġoh at
-Ġbuc co
-Ġdevi ance
-Ġsequ entially
-Ġrespond ent
-Ġaut ops
-Ġdentin oid
-Ġadd iction
-Ġair ways
-Ġprom pt
-Ġequ ality
-Ġ4 5
-Ġpractic ing
-Ġpractic ability
-Ġ6 9
-Ġfib roc
-Ġagree ments
-Ġbo ok
-Ġdeep ly
-Ġdeep ened
-Ġ7 8
-Ġresid ed
-Ġcommun icate
-nec ted
-asc us
-Ġpublic ly
-Ġadv ise
-Ġutil ize
-Ġutil izes
-Ġlip ids
-Ġchem o
-Ġchem ot
-Ġapproxim ation
-Ġconsum e
-Ġgingiva e
-pa ired
-Ġshort coming
-Ġ9 2
-Ġ9 6
-Ġ9 8
-Ġ8 5
-Ġbre aking
-Ġsubs urface
-Ġsil encing
-Ġappropri ateness
-Ġsleep ing
-Ġsleep iness
-Ġill ustration
-Ġ201 1
-Ġ201 6
-Ġemploy ees
-Ġmagn itudes
-Ġtransl ators
-Ġtransl ocation
-Ġhydro lysis
-��hydro static
-Ġhydro chlor
-Ġmineral ised
-Ġobjec ts
-Ġultr avi
-Ġbur st
-Ġdam ascus
-Ġdynamic s
-Ġrepl acing
-Ġbu ilding
-Ġinterven e
-Ġanatom ically
-Ġrecip ients
-Ġrecip rocal
-Ġmalign ancies
+Ġasp art
+Ġdrop ped
+Ġcurric ulum
+ot ine
+Ġcr y
+Ġinfl amed
+Ġpar athyroid
+Ġenh ances
+Ġtend on
+Ġchlorhex idine
+Ġl ic
+Ġun related
+Ġref used
+Ġimmun ocomp
+Ġflex ibility
+Ġar ising
+Ġpred n
+Ġimmun omod
+oglob ulin
+Ġgall st
+Ġpiv otal
+and ial
+Ġag itation
+Ġstandard ised
+Ġsal v
+Ġta q
+ef ined
+Ġele ven
+Ġenab ling
+a id
+a ved
+Ġ umb
+Ġth al
+Ġsc anned
+Ġpost s
+Ġ3 4
+Ġgluc os
+54 9
+Ġlaborator ies
+m in
+Ġe cl
+id one
+oc in
+se c
+Ġpartic le
+Ġcontinu ing
+Ġtric uspid
+Ġdehydrogen ase
+Ġf itted
+Ġl aryngeal
+Ġq i
+Ġ201 0
+Ġneuro pathy
+Ġrot ary
+Ġrun ning
+Ġmedi ating
+Ġarg ued
+Ġsupernat ants
+Ġparenchym a
+Ġnorwe gian
+is one
+Ġb it
+ort ion
+Ġref erences
+Ġcommun ic
+Ġneuro psych
+Ġcompan y
+Ġas e
+Ġcon e
+Ġag a
+rot ective
+Ġjournal s
+Ġgamm a
+Ġt ear
+Ġp it
+Ġtrans cripts
+Ġdisc overy
+Ġelectro ly
+Ġswit ching
+Ġflavon oid
+Ġstake holders
+ens es
+Ġra ise
+Ġlig ation
+ol i
+il iary
+oss a
+Ġsk ew
+Ġbra d
+Ġpharmac ists
+Ġaff inity
+Ġtit le
+Ġsuperv is
+Ġplaus ible
+8 8
+h an
+Ġb rought
+ut ive
+Ġle an
+ens is
+Ġk ing
+Ġphotograph s
+Ġf i
+Ġg y
+Ġv ib
+oc ice
+iz z
+Ġdesign ated
+Ġlast ed
+Ġangi ographic
+Ġindepend ence
+Ġnic otine
+Ġd ock
+Ġab c
+Ġview ed
+Ġbu ilt
+Ġmind fulness
+Ġembry o
+om ide
+Ġnot es
+Ġk c
+Ġgu ar
+Ġadapt ive
 Ġlig and
-Ġcomposition s
-Ġmedic ament
-Ġweek ly
-Ġhom ogen
-Ġdys reg
-Ġoff set
-Ġcop y
-Ġdocu ments
-Ġadap tability
-Ġresidual s
-Ġur inary
-Ġmetast ases
-Ġeng land
-Ġblock ed
-Ġprolif erative
-Ġcyto plasm
-Ġcyto plasmic
-Ġgir l
-Ġdiss ected
-Ġiv w
-Ġaccum ulated
-Ġaccum ulate
-Ġmedi ast
-Ġplay ing
-Ġnex co
-Ġnod ules
-Ġot olaryng
-Ġfore part
-Ġcre vice
-Ġobserv able
-Ġlongitud inally
-Ġirreg ularities
-Ġprogress ed
-Ġleuk a
-Ġviol ent
-Ġmc g
-Ġshe ets
-Ġcn v
-Ġwil k
-Ġasymm etrical
-ivari able
-Ġalternative ly
-abric ated
-Ġcc k
-Ġmas ks
-Ġabnorm ality
-Ġcoord ination
-Ġig a
-otom ized
-Ġmic rol
-Ġrob in
-Ġhybrid ization
-Ġden om
-Ġbis gma
-Ġprosthetic s
-Ġosteoc artilaginous
-Ġsy ria
-Ġshif ting
-Ġinh alation
-Ġsusp icious
-Ġdichotom ised
-fill ed
-Ġlung s
-Ġinterm itt
-Ġrepa ired
-Ġcham bers
-Ġdmf ts
-Ġelect romy
-Ġremain der
-Ġfram es
-Ġstabil ize
-Ġorthop a
-Ġactiv ator
-Ġnation wide
-Ġhol der
-Ġcompress ed
-Ġuns uccessful
-Ġconstit u
-Ġput ative
-Ġclus tering
-Ġatheroscl erotic
-Ġter rit
-Ġlamin ates
-Ġmoun ting
-Ġincision al
-Ġduw ls
-Ġoutpati ents
-Ġconj ug
-Ġexpress ing
-Ġrh yth
-Ġperiph ery
-Ġgn athion
-Ġcorro dens
-Ġpharm aceutical
-Ġmoist ur
-Ġswit ch
-Ġlactobacill i
-Ġstere olith
-Ġchrom atin
-Ġdisinf ect
-Ġscat tering
-Ġchile an
-Ġtrain ees
-obacter ia
-Ġpalat ally
-Ġperfect ly
-oprote ins
-Ġib uprofen
-Ġinten tional
-Ġdon ors
-Ġpredis pose
-Ġcaucas ians
-Ġfing ers
-Ġaggreg ation
-Ġmb g
-Ġpossess ed
-Ġpossess es
-Ġoccas ions
-Ġosteop orosis
-Ġabscess es
-Ġctcc s
-Ġanonym ous
-Ġanonym ized
-Ġcontrad ic
-Ġinconsist encies
-Ġnicot in
-20 6
-ii i
-Ġacknow ledge
-Ġpenicill ins
-Ġbil ayered
-Ġho oks
-Ġdele terious
-Ġsuppress es
-Ġretro grade
-olester olemia
-Ġcarbohydr ate
-att le
-Ġect od
-oste al
-Ġcouns el
-Ġcouns elling
-Ġdiscuss ing
-Ġextend s
-Ġign ored
-Ġpresum ed
-Ġbacteri ome
-Ġbacteri omes
-Ġsynch ron
-Ġoverestim ation
-Ġmimic king
-Ġoccasion ally
-Ġvent ral
-Ġali ke
-Ġdisch arged
-Ġlect ure
-Ġfriend ly
-Ġruss ian
-truct ure
-Ġencoun ter
-Ġencoun tering
-Ġcatal ytic
-Ġpum p
-Ġhind iii
-Ġodontobl asts
-Ġculti vable
-Ġdors um
-iagnos ed
-Ġconsul ting
-Ġsubc utaneous
-Ġnecessit ates
-Ġtail ored
-Ġstack ing
-Ġprost ate
-Ġprost agland
-Ġpref abricated
-Ġschem e
-Ġschem es
-Ġderiv atives
-Ġmotiv ational
-Ġinacti v
-Ġdro ps
-Ġbos nian
-Ġuna ware
-Ġunerup tion
-Ġcolomb ian
-Ġmang ostin
-Ġmicropl ate
-Ġinstal led
-Ġveget able
-Ġamplic on
-Ġinev itably
-Ġantagon ist
-Ġchond rocytes
-Ġdisapp ear
-Ġkil wa
-Ġphyl a
-Ġarchae a
-Ġvirul ence
-Ġtender ness
-Ġultrason ographic
-Ġengine ering
-Ġspectrom etry
-hel d
-inter pre
-Ġhon code
-Ġquin tiles
-Ġdiscre te
-Ġerb ium
-Ġhyperch olesterolemia
-Ġphotos hop
-linear ity
-Ġdissem ination
-Ġdissip ation
-Ġtre phine
-Ġdh cp
-Ġrug ae
-Ġjord an
-Ġjoin point
-Ġminipl ates
-Ġeston ian
-Ġaccompl ished
-Ġprevail ed
-Ġneurolog ical
-Ġtess ellation
-Ġheavi ly
-Ġscler osis
-Ġparad igm
-Ġnumb ered
-Ġinsp ire
-Ġantise ptic
-Ġdistinc tive
-Ġboost ing
-Ġveh icle
-Ġreinstru mentation
-Ġimperf ec
-Ġadsorb ed
-Ġabbrevi ations
-rel ations
-Ġsat urated
-Ġwu han
-Ġdash ed
-Ġlaf h
-Ġdispro por
-Ġweare rs
-Ġmucoperi osteal
-Ġbuff alo
-Ġforens ic
-Ġvasopress ors
-Ġegypti an
-Ġrhamn ol
-Ġanxio lytic
-Ġundoubted ly
-nutr ition
-Ġcree p
-edip ine
-Ġwenz hou
-Ġanco va
-Ġnif edipine
-Ġgath ered
-Ġaster is
-Ġperoxid ase
-Ġshof u
-Ġaccomm od
-Ġsubchond ral
-Ġintagl io
-Ġamoxic illin
-Ġamorph ous
-Ġprocrust es
-Ġfirmic utes
-Ġosteomy elitis
-1 00
-2 4
-5 7
-8 5
-8 6
-: .
-a j
-a id
-d omy
-e as
-f ession
-g ens
-g pt
-g onal
-h ang
-i of
-k ee
-l a
-l eration
-l iest
-m in
-m es
-n oma
-n els
-o let
-p uration
-p uts
-q hc
-r ans
-s k
-s y
-s elf
-t z
-t ory
-t ress
-t md
-u ok
-u ze
-v m
-v p
-x aminer
-Ġ ut
-Ġ ire
-Ġt v
-Ġt ac
-Ġt ear
-Ġt ied
-in ium
-re ted
-Ġth p
-Ġs or
-Ġs ad
-Ġs ess
-Ġs por
-Ġs int
-Ġs kele
-Ġs ask
-ti ms
-en ers
-en edi
-Ġc is
-Ġp on
-Ġp ad
-Ġw anted
-Ġw atching
-Ġin active
-Ġin ception
-Ġin gestion
-Ġan im
-Ġf v
-Ġd as
+Ġquad rant
+Ġ ign
+ra ine
+Ġpro ve
+Ġsp ain
+ox ygen
+Ġchart s
+Ġneoplas ms
+Ġplasm id
+Ġserot onin
+t age
+if ier
+Ġon t
+Ġsu fentanil
+Ġar ise
+Ġspectrophot ometer
+Ġabut ment
+ig o
+Ġsed ent
+Ġid i
+Ġsimpl ified
+Ġd fs
+Ġm n
+ip ping
+Ġest eem
+Ġantidepress ants
+Ġtrun k
+Ġth ro
+Ġch f
+Ġsh aring
+Ġdi oxide
+bo ok
+Ġinser t
+Ġth yro
+it ability
+us ive
+Ġcl ot
+Ġtrans duc
+Ġdec ayed
+Ġconstruct s
+c on
+z er
+Ġt d
+Ġdec ay
+Ġinterp ersonal
+h l
+ent a
+Ġn y
+et ies
+ber g
+Ġir rit
+Ġdeg s
+Ġcop e
+Ġide ation
+Ġ um
+Ġo me
+Ġtest icular
+Ġpost t
+Ġcount ing
+Ġmid azolam
+Ġpair wise
+Ġsph inct
+Ġelimin ated
+Ġanalog ue
+Ġinhal ation
+Ġa et
 Ġd ot
-Ġd erm
-Ġd he
-Ġm er
-Ġm chs
-or k
-an cer
-Ġb ill
-Ġb imax
-as al
-ic o
-ic ity
-ic ates
-ic ited
-ro ud
-ar tilage
-Ġre ti
-Ġre evalu
-Ġh h
-Ġh im
-Ġh ur
-Ġh omes
-Ġh idden
-Ġst ating
-Ġst ellate
-ul er
-ac cept
-ac ious
-Ġl up
-Ġl ond
-Ġn ond
-Ġn erves
-im ilar
-Ġg ee
-Ġg amm
-Ġg ains
-Ġg ogn
-Ġg rew
-ur ations
-ig uous
-Ġwi ls
-ud al
-et ected
+ig ma
+Ġsens or
+Ġdel ta
+Ġhumid ity
+Ġstead y
+v t
+Ġd k
+st and
+Ġclass ify
+Ġaut ologous
+urg ery
+Ġperf ect
+lyca emia
+Ġneed les
+Ġaim ing
+Ġcommit ment
+Ġsa w
+Ġcad h
+Ġimpair ments
+Ġcollect ing
+Ġiod ine
+Ġmidw ives
+Ġcrow ding
+m p
+Ġb ay
+Ġn amed
+Ġpath ologies
+Ġmal nutrition
+Ġswe et
+Ġintub ated
+Ġdebr is
+Ġsusp ended
+Ġrecip ient
+Ġcoord ination
+Ġhex ane
+Ġc osm
+Ġp ush
+ph i
+Ġdiagn ost
+oph en
+Ġaut onomic
+Ġlink age
+Ġdrink s
+Ġexplan ations
+Ġect opic
+d na
+Ġs or
+Ġs ct
+Ġde brid
+Ġch op
+Ġinf ra
+Ġwor st
+Ġes r
+Ġoste oblast
+Ġemb ase
+Ġbroad er
+Ġcryst al
+Ġat e
+pec ific
+Ġgl s
+ne ys
+Ġread ings
+clus ive
+Ġhr v
+roc yte
+y x
+Ġd ss
+as i
+id ents
+Ġch b
+Ġat cc
+Ġcur ing
+Ġequ ilib
+Ġ201 2
+Ġshe ath
+Ġhemod ynamics
+Ġmedi ans
+uron ium
+Ġd ense
 os us
-os ystem
-if f
-if t
-if iable
-Ġfor ced
-ol a
-Ġcon form
-Ġcon ca
-ati bacter
-ab domy
-Ġv w
-Ġv pi
-Ġper t
-Ġr f
-Ġr it
-Ġr ules
-Ġr ld
-Ġr uled
-Ġwh r
-Ġex oc
-Ġpro pos
-Ġres h
-Ġres ide
-Ġres ected
-uc ity
-Ġim agen
-ant a
-ir jian
-oc o
-oc clusal
-iz ers
-Ġinc omes
-um atic
-pl us
-pl ay
-pl akia
-pl oys
-Ġme ant
-Ġat om
-Ġcomp ly
-Ġdis g
-Ġse v
-Ġse iz
-Ġsh aking
-Ġad ver
-Ġad seal
-Ġhe p
-Ġhe ard
-Ġhe most
-Ġass embled
-Ġcl ust
-Ġtw i
-Ġma il
-op aus
-Ġoral ly
-age al
-ip ids
-Ġco val
-Ġco ag
-Ġsur pass
-ous tic
-Ġnot ch
-Ġnot with
-est ing
-Ġpar v
-Ġha attr
-ren ces
-Ġcont em
-ari us
-ffec ted
-Ġpl ain
-Ġpl ug
-Ġro ute
-Ġtr ic
-Ġtr im
-Ġtr imes
-Ġmod ifiable
-Ġcons ents
-Ġcons olid
-Ġrec essive
-Ġpr ist
-Ġpr int
-Ġinter occlusal
-Ġinter play
-Ġqu oti
-Ġun id
-Ġun less
-Ġun accept
-form aldehyde
-Ġy ork
-Ġam r
-Ġk en
-Ġk vp
-ast y
-Ġen ding
-Ġpo res
-Ġtim ed
-Ġout ward
-ew an
-ass ed
-Ġfin ish
-Ġup loaded
-ond er
-Ġcor tis
-Ġso aked
-Ġar i
-Ġph arynx
-Ġmo h
-Ġmo tions
-Ġcol ors
-Ġtime frame
-Ġsec urity
-Ġfour ier
-vid one
-Ġdise ased
-Ġsim ulations
-Ġsim ilarities
-ag a
-ag ic
-iter ate
-Ġsup ra
-Ġsup puration
-Ġdef ense
-Ġsp end
-Ġj ia
-Ġj unctions
-Ġmicro vascular
-Ġdem irjian
-Ġmin ip
-ivid ed
-Ġmal nutrition
-Ġtrans ill
-Ġtrans itional
-Ġop posing
-Ġgr and
-Ġgr ay
-Ġunder p
-Ġunder line
-Ġimp utation
-Ġorthodontic ally
-Ġconf ocal
-Ġser opos
-Ġmon ocyte
-Ġem ploys
-Ġstatus es
-Ġ0 6
-Ġ0 00
-Ġz n
-Ġsix th
-Ġwor ding
-Ġsaliv arius
-Ġcondition er
-Ġend otox
-Ġinform ing
-Ġloc ate
-Ġloc ating
-Ġloc ality
-Ġtechn ician
-Ġel ong
-gr an
-Ġfr ustration
-Ġpred ef
-Ġpred nis
-Ġeduc ate
-ob ulin
-par tic
-Ġgeneral ize
-Ġgeneral izing
-Ġsm a
-Ġconduc ive
-Ġear liest
-Ġsch wan
-Ġneg lected
-Ġreview er
-Ġrequ ests
-aren cy
-Ġfac es
-omet r
-Ġidentif ies
-Ġlo oked
-Ġfl o
-Ġfl aws
-Ġoste onec
-Ġcaus ative
-ox acin
-Ġintra orally
-Ġcomb ine
+Ġdys reg
+Ġec z
+Ġcann ab
+Ġx en
+Ġbelie f
+och rome
+Ġkin ds
+Ġgeneraliz ability
+Ġcadh erin
+7 3
+al a
+Ġit aly
+ari um
+Ġph yl
+Ġdel ays
+Ġgo at
+Ġdop amine
+Ġcorticoster oid
+Ġstrept ococcus
+Ġvasopress or
+opoi etic
+Ġm im
+Ġg ab
+Ġpo ison
+Ġextra pol
+Ġcomprom ised
+p oration
+Ġl ma
+ix imab
+Ġret rog
+Ġsurvey ed
+Ġcomplex es
+Ġcontact s
+Ġadip ocytes
+Ġinsp ection
+Ġst igma
+Ġac etic
+Ġit alian
+Ġacc idents
+Ġleuk ocytes
+Ġsir na
+Ġpace m
+Ġacknowled ged
+��guar ant
+Ġf v
+Ġb sa
+os ures
+th ing
+ab ine
+Ġcondition ing
+Ġplan es
+Ġhemorrh agic
+Ġaer obic
+Ġbs i
+Ġseiz ure
+9 5
+Ġdys ph
+Ġchem ilumines
+Ġkid neys
+Ġcop y
+Ġoptim ize
+Ġdownreg ulation
+Ġile um
+Ġanesthet ized
+Ġthro at
+Ġt av
+Ġs ic
+Ġp ra
+it a
+Ġm ail
+ect able
+Ġinter s
+Ġour s
+Ġexp ensive
 Ġphys ically
-av ia
-Ġanterior ly
-Ġps r
-Ġhard er
-Ġnew s
-Ġnew ton
-man n
-Ġhand led
-Ġhand held
-Ġfluor ides
-Ġlength ening
-Ġestim ator
-Ġpoly v
-Ġpa ulo
-Ġpa ucity
-Ġoh qol
-Ġscre ens
-Ġhel ping
-Ġlay ered
-Ġposterior ly
-Ġimmun ochemical
-Ġimmun ode
-Ġimmun ofluorescence
-Ġimmun oglob
-ma x
-Ġseg reg
-Ġvers ions
-Ġsw oll
-Ġexp enses
-Ġsti gma
-Ġprom ise
-Ġ4 7
-Ġfoc al
-Ġprem align
-Ġintere xaminer
+ov es
+Ġcommun icate
+Ġoste oblasts
+it ic
+ib ilities
+Ġap nea
+cop e
+Ġke gg
+Ġvas c
+Ġhaem oglobin
+Ġgradu al
+Ġexce eding
+acill us
+Ġhyst erectomy
+Ġ ich
+il ized
+Ġext end
+Ġrem n
+Ġtub ules
+Ġcompr ises
+Ġneuros urgical
+Ġf ossa
+ro floxacin
+ut er
+Ġhc y
+Ġillust rates
+Ġdichotom ous
+Ġunderestim ated
+Ġt in
+Ġc oc
+Ġb av
+Ġh im
+Ġy east
+Ġca ud
+Ġorgan ized
 Ġfocus es
-Ġfree zer
-Ġcomplex es
-Ġantib iof
-Ġfear s
-Ġeffic acious
-Ġprec eded
-Ġblood stream
-Ġclear fil
-Ġpan els
-Ġpan avia
-Ġheight ened
-Ġhypoth al
-Ġhyper activity
-Ġfunction ally
-Ġresid ues
-reg arding
-Ġbiom echan
-Ġdel im
-Ġdel ta
-Ġmark s
-az i
-Ġpsych o
-Ġml p
-Ġmut ual
-Ġrough ly
-Ġsk ipping
-Ġlogistic al
-Ġfil tering
-Ġil iac
-Ġthough ts
-Ġshort ly
-Ġ9 1
-Ġ9 7
-Ġsqu ares
-Ġtra vel
-Ġcalcul ates
-Ġcalcul ator
-Ġpolymer izing
-Ġ8 0
-Ġ8 9
-Ġoptim ization
-Ġoptim izing
-Ġsubs ample
-otyp ic
-Ġcir cle
-Ġchallen ged
-Ġill iterate
-Ġmaintain s
-Ġemploy ing
-Ġavoid ance
-Ġten fold
-Ġtransl ate
-Ġhydro f
-Ġapex it
-Ġbro ught
-Ġnas omaxillary
-Ġemerg encies
-Ġzircon ium
-Ġdam ages
-Ġcut aneous
-grad uates
-acti veness
-Ġphosph or
-Ġbenef ici
-Ġfp d
-Ġpapill ary
-Ġquanti fies
-Ġcf a
-Ġher tz
-Ġpm ma
-Ġ19 70
-Ġ19 73
-Ġur ic
-Ġur ine
-Ġenrol ment
-Ġphen ol
-Ġaug ment
-thes e
-Ġeng aging
-Ġalter ing
-Ġmis interpre
-Ġintegr ate
-abol ic
-Ġretr acted
-Ġretr uded
-Ġdecl ining
-Ġfibro tic
-Ġmedi ans
-for ward
-Ġorigin ate
-Ġwr iting
-Ġvr fs
-Ġminim ise
-Ġepid emic
-Ġmetabol ites
-Ġpriv acy
-oph ageal
-the tiz
-Ġcolon izing
-Ġillustr ations
-Ġcard iac
-Ġcrow ded
-Ġann ex
-Ġchemical s
-Ġsuture d
-Ġga uze
-Ġlat ency
-Ġampl ify
-Ġmicroorgan ism
-Ġtonsill ar
-Ġprotr uding
-Ġactinomy ces
-Ġconstant ly
-Ġnh i
-Ġtor sion
-Ġden ied
-Ġbis phosph
-Ġgre ece
-Ġexc reted
-Ġincrement al
-Ġdestr uctive
-atch ewan
-Ġsound s
-Ġhg s
-Ġcarbon ated
-Ġattr activeness
-Ġharm on
-Ġacce leration
-Ġpack ages
-Ġinh om
-Ġinh aled
-Ġamel ior
-Ġconc res
-Ġmel ting
-Ġbroad ly
-Ġben z
-Ġadvance ments
-Ġpron unciation
-Ġec m
-Ġorient ations
-Ġphenomen a
-Ġclar ified
-Ġsouth east
-Ġcos metic
-Ġhar v
-Ġquad rants
-Ġprofil ometer
-Ġgovern orate
-Ġconduct ance
-Ġtax on
-Ġpseud omonas
-Ġpay ment
-Ġrejec t
-Ġgi omer
-Ġsafe ly
-Ġamelobl astic
-Ġround ed
-Ġvolunte er
-Ġdim eth
-Ġresol ve
-Ġrm ta
-Ġuniform ly
-Ġnons pecific
-Ġcool ed
-Ġrh abdomy
-Ġchair side
-Ġunderestim ate
-Ġcorrec tions
-Ġlibr aries
-Ġpit uit
-Ġdisinf ected
-Ġabstr act
-Ġbelong s
-Ġtele vision
-Ġclaim s
-Ġtrigg ered
-Ġmetagen omics
-Ġpalat inal
-Ġinfiltr ating
-Ġinfiltr ates
-Ġure mia
-Ġobt urated
-Ġjudge ment
-Ġarg u
-Ġfiss ured
-Ġgp u
-Ġapparent ly
-Ġfavour ing
-Ġpseudovirus es
-Ġrhe ological
-Ġdistor tions
-Ġaggreg atibacter
-Ġinherent ly
-Ġcu ts
-Ġdecom pression
-Ġosteop romo
-Ġdense ly
-Ġbm f
-Ġmicrog aps
-Ġharmful ness
-Ġepidemi ologic
-Ġthreat ening
-Ġcontrad iction
-Ġspectrophot ometry
-Ġvl ogg
-Ġglyc oproteins
-Ġpie zo
-Ġinn ov
-Ġsymm etric
-Ġsymm etrical
-Ġretro cl
-Ġneu rom
-enz a
-Ġhapp en
-Ġhapp ened
-stand ing
-Ġinfr as
-Ġsubd ivided
-Ġunco vered
-Ġmethyl ene
-Ġelectro des
-Ġign ore
-Ġling u
-Ġjc qhc
-Ġtransp arency
-Ġconstruc ting
-Ġintim ate
-Ġonc ology
-Ġcompens ate
-Ġdepr ivation
-Ġsay ing
-Ġsph en
-Ġmicros urgery
-Ġoscill ating
-Ġplasm id
-Ġwashing ton
-Ġvic tims
-Ġpara formaldehyde
-Ġunhe aled
-Ġrational e
-Ġendocrown s
-Ġtb c
-Ġbig gest
-Ġcheil ion
-tiz ing
-Ġinacti vated
-Ġbos nia
-Ġvill ages
-Ġhaem ophilus
-Ġuna ffected
-Ġdiscontin ued
-Ġrepeti tive
-Ġpteryg oid
-Ġpteryg omaxillary
-zz le
-Ġtal k
-Ġtal king
-Ġdress ing
-Ġperic oron
-Ġrelig ious
-Ġmicrostruct ure
-Ġaffirm ative
-Ġdrawback s
-Ġwithdraw al
-Ġmicronucle i
-Ġaud io
-Ġoss ification
-Ġbus y
-Ġef u
-Ġln cr
-tra umatic
-Ġintens ified
-Ġextrap olated
-Ġcautious ly
-Ġerythemat ous
-Ġchromos ome
-Ġtil ted
-osc opic
-Ġsput ter
-Ġdramatic ally
-Ġexplicit ly
-Ġhistopath ologic
-Ġverte br
-Ġmigr ated
-Ġmidwif ery
-pens able
-Ġhapl otype
-Ġtris omy
-Ġethyl enedi
-Ġundersc ores
-Ġdynam ically
-Ġtro uble
-Ġatyp ical
-Ġshah roud
-peri enced
-Ġamph oter
-Ġnecro tizing
-Ġeconom ical
-Ġnarr ative
-Ġbicusp id
-Ġdestro yed
-tw o
-Ġcow orkers
-acchar ides
-Ġlu is
-Ġnich e
-Ġrup ture
-Ġcompuls ory
-Ġallerg ic
-Ġquinol ones
-Ġimprec ise
-Ġelab or
-Ġsymph ysis
-Ġmuscul oskeletal
-Ġmyc obi
-Ġhemorrh age
-Ġoverlo oked
-Ġsediment ation
-Ġerythro plakia
-Ġosteoper io
-Ġkaryo lysis
-Ġankyl osis
-Ġmathematic al
-Ġbg li
-Ġstad t
-Ġprepro cess
-Ġindis pensable
-uber tal
-Ġcanon ical
-Ġtrich omonas
-Ġtripl icate
-Ġinterfer ing
-Ġjun ior
-Ġdemarc ated
-Ġepig ene
-Ġfibroc artilage
-Ġultravi olet
-Ġmediast inal
-Ġleuka emia
-Ġintermitt ent
-fession al
-uok a
-Ġire land
-Ġsess ile
-Ġsint ered
-Ġskele ton
-Ġsask atchewan
-Ġbimax illary
-Ġlup us
-Ġlond on
-Ġwils on
-Ġrld d
-Ġclust ered
-opaus al
-Ġcoval ent
-Ġnotwith standing
-Ġhaattr tmd
-Ġtrimes ter
-Ġquoti ent
-Ġunaccept able
-Ġcortis ol
-Ġpredef ined
-Ġschwan noma
-Ġosteonec rosis
-Ġswoll en
-Ġpremalign ant
-thetiz ed
-Ġpituit ary
-Ġosteopromo tive
-Ġpericoron itis
-2 50
-6 3
-6 5
-6 00
-9 9
-a o
-a ire
-a acetic
-b u
-b st
-b ond
-b ws
-c ase
-c ast
-c ified
-c yl
-e it
-f am
-f ici
-f ord
-f iable
-g c
-g h
-h l
-h ion
-h ops
-h rs
-i et
-i qu
-j oy
-k on
-m u
-m ing
-m ix
-n es
-o j
-o ke
-o eu
-p op
-p yr
-p inephrine
-r uc
-s agittal
-w arr
-y a
-y ren
-z a
-Ġt ar
-Ġt one
-in form
-in ator
-in ucle
-Ġa u
-Ġa traumatic
-re pres
-Ġth uring
-Ġth ings
-on to
-Ġs ro
-Ġs ig
-Ġs ap
-Ġs ich
-Ġs ms
-Ġs tit
-Ġs anti
-Ġs omatic
-Ġs anger
-Ġo ag
-en g
-en ol
-en na
-al an
-er atin
-Ġc ts
-Ġc up
-Ġc iv
-Ġc ub
-Ġc ited
-Ġp end
-Ġp pt
-Ġp ier
-Ġp lex
-Ġw ing
-Ġw ren
-Ġw aves
-es pan
-es thetized
-Ġan tr
-Ġan ces
-Ġan ne
-Ġan esthes
-Ġan esthetized
-Ġf i
-Ġf n
-Ġd ial
-Ġd eline
-Ġm ise
-Ġm ma
-Ġm cp
-at s
-at able
-or ie
-an ha
-an asal
-Ġb am
-Ġb und
-is able
-is ters
-tion ally
-ic able
-ic tions
-ing e
-ing ly
-Ġre ch
-Ġre used
-Ġre activity
-Ġh am
-Ġh cl
-Ġh ots
-Ġe ther
-Ġe ll
-Ġe hrs
-us ing
-us cript
-Ġst ains
-ac eration
-ec ting
-Ġl b
-Ġl l
-Ġl ign
-Ġl ined
-Ġl aw
-Ġl ister
-om n
-om echanical
-Ġn t
-Ġn ore
-Ġn st
-Ġn ause
-Ġn ss
-Ġn uts
-im us
-im onas
-Ġg ates
-Ġg ame
-Ġg mm
-Ġg dp
-ly mp
-ur a
-ur ons
-os ine
-os arc
-Ġfor s
-ol ished
-Ġas b
-Ġas ks
-il k
-il es
-il ization
-Ġcon vention
-od er
-od yn
-id i
-am i
-am us
-Ġv ag
-Ġv io
-Ġal arm
-Ġal ert
-Ġper ine
-Ġr l
-Ġr uler
-Ġex agg
-ge e
-Ġpro ves
-Ġpro active
-Ġres trict
-Ġres embl
-Ġbe ij
-uc l
-uc osal
-Ġim posed
-ad der
-iz ol
-Ġch ee
-Ġde ple
-Ġde pro
-Ġde gran
-um ar
-um eration
-Ġme x
-ys plasia
-Ġcomp ute
-Ġcomp uting
-iv ity
-iv ors
-iv udine
-og o
-og ly
-ib acter
-Ġdis reg
-Ġsh ann
-Ġsh eep
-Ġad vent
-feren ti
-Ġhe in
-Ġsign ing
-Ġsign ifies
-Ġass ent
-Ġcl sm
-and er
-op es
-Ġperi o
-ip ital
-Ġit t
-ia z
-Ġle e
-Ġle ath
-Ġle pt
-est ation
-Ġpar anasal
-Ġpos e
-Ġpos ter
-vi e
-st ud
-ull ous
-Ġcont exts
-ari ous
-Ġpres sed
-Ġpres crip
-Ġpl ated
-Ġall opl
-end a
-end ar
-Ġro di
-Ġtr ip
-Ġtr yp
-Ġtr ace
-Ġtr imm
-Ġtr izol
-Ġmod ifies
-Ġcons or
-Ġreg ained
-Ġno vo
-Ġno zzle
-Ġincl inations
-ors hip
-Ġrel ates
-Ġrel atives
-Ġne oplastic
-Ġcar ing
-Ġcar lo
-Ġrepor ter
-Ġsub epithelial
-Ġinter l
-Ġinter cus
-Ġinter acts
-Ġinter relations
-Ġun res
-Ġun ion
-Ġun equ
-Ġun identi
-Ġun ivariable
-Ġint u
-Ġinclud able
-Ġk erm
-Ġk ang
-Ġk etamine
-Ġk yr
-Ġen for
-Ġen joy
-Ġen umeration
-rol imus
-Ġpo le
-Ġpo ured
-Ġpo vidone
-ph in
-Ġdur able
-Ġsuc tion
-gn ath
-Ġspec ify
-Ġup coming
-Ġar ises
-Ġph antom
-Ġevalu ators
-mo h
-Ġbi oceramic
-lu tion
-Ġdec oder
-Ġag enda
-Ġcal orie
-Ġcal endar
-Ġstr ub
-Ġstr atum
-ex isting
-Ġchan g
-Ġchan nels
-Ġbr itish
-Ġund erm
-Ġund ecal
-ep e
-ag o
-Ġman oeu
-Ġman uscript
-ack et
-Ġsup pl
-Ġradi op
-Ġsp ms
-Ġsp ind
-Ġsp ots
-ult ural
-Ġj b
-Ġj e
-Ġbut term
-Ġed ans
-istic ated
-Ġmicro c
-Ġmicro p
-Ġmicro et
-Ġmicro cr
-Ġcomm ission
-Ġmin ax
-Ġhy ogo
-Ġsubjec tivity
-Ġextr acts
-Ġpop ulated
-Ġprob it
-Ġi ib
-Ġtrans position
-Ġtrans ported
-Ġtrans bond
-Ġform ulate
-Ġdevelop ments
-Ġgr id
-Ġgr ained
-ak o
-Ġsal ts
-Ġunder lines
-Ġunder graduates
-Ġcharacter izing
-Ġlim bs
-Ġpost ural
-Ġpost men
-Ġconf identi
-Ġpain less
-Ġmon te
-Ġmon ocytes
-Ġbl ur
-Ġbl ocking
-Ġol faction
-Ġintr as
-Ġ0 2
-Ġ0 4
-br acket
-Ġz w
-Ġz x
-Ġz oster
-Ġer g
-Ġinform atics
-Ġca udal
-Ġinfl ated
-Ġel icited
-Ġmulti pl
-Ġmulti lay
-Ġrem ed
-ie tic
-Ġimpro per
-our able
-Ġset t
-Ġeduc ators
-Ġterm ination
-Ġcle ans
-Ġcle avage
-Ġmuc o
-Ġmuc oc
-Ġocc ipital
-Ġins ured
-art ens
-Ġrestor ing
-Ġir b
-Ġtes ter
-Ġbacter oid
-Ġsmo other
-Ġdist o
-Ġthrough put
-other ap
-Ġfac ulties
-Ġpal is
-Ġpal sy
-aw a
-Ġgu ang
-Ġfl ask
-Ġarch ive
-Ġarch ives
-ful ly
-Ġoste oin
-Ġatt acks
-Ġfail ing
-Ġprof essions
-ox ane
-Ġvi enna
-Ġevid enced
-Ġsl ots
-Ġhyp oxic
-Ġcase in
-Ġver ruc
-Ġexpos es
-Ġsol ving
-Ġsol vent
-av itated
-Ġcontr asts
-Ġnew er
-Ġcompl ied
-Ġcap ac
-Ġref ine
-Ġmid sagittal
-Ġpers isted
-Ġsu ite
-Ġcategor ization
-Ġsugges tions
-Ġlif espan
-Ġeight een
-Ġpap ules
-Ġu rogen
-Ġwill i
-Ġsurvey or
-Ġlight ing
-Ġcephal ometry
-Ġimmun o
-Ġresist or
-Ġjaw bone
-Ġseven th
-Ġthem es
-Ġsuccess ive
-Ġod d
-to ire
-Ġlog it
-Ġ4 2
-Ġprem ium
-Ġcoh ere
-Ġcomplex ities
-ang ers
-Ġprior itiz
-Ġct nn
-Ġlinear ity
-Ġfinal ize
-Ġdom inated
-Ġbo ole
-Ġstill birth
-Ġcari ology
-Ġprevent ative
-Ġhead set
-Ġdel ib
-Ġdel ays
-Ġmorph oj
-Ġsus pect
-Ġspecial ization
-Ġspecial ties
-Ġpur ity
-Ġreflec tive
-Ġfil tration
-Ġfil ters
-Ġcolor imetric
-Ġadv isable
-Ġx rd
-Ġx anth
-Ġlip oprotein
-Ġconnec tor
-Ġconsum ers
-Ġpol lution
-Ġsepar ating
-Ġview ers
-Ġcond ens
-Ġsurv ivors
-Ġmicrobi ology
-Ġmicrobi omes
-Ġ9 3
-Ġ9 9
-Ġ8 1
-Ġ8 8
-Ġwa ist
-Ġbre warr
-Ġsubs pinal
-me th
-Ġtop ographies
-Ġacro seal
-Ġcir cles
-Ġreach es
-Ġprep onder
-Ġecon omics
-Ġprol ong
-Ġtransl ational
-Ġreal d
-Ġorgan ism
-Ġalg inate
-Ġmineral s
-Ġconfound ed
-ucle ated
-Ġrepl ication
-Ġhs d
-Ġmy co
-Ġev ap
-acti vated
-Ġphosph ol
-Ġlig ating
-Ġhouse kee
-Ġdebr ief
-Ġmedic ated
-Ġplace ments
-Ġq alp
-Ġsb c
-Ġquanti ties
-Ġhom o
-Ġpass age
-Ġoff s
-Ġra ises
-Ġcho king
-Ġadjust able
-Ġbreast f
-Ġpm rs
-Ġtur ns
-Ġweight ing
-Ġcandid ates
-Ġpor ous
-Ġdown stream
-Ġ19 80
-Ġ19 83
-Ġder ive
-Ġent ails
-Ġsa ve
-Ġglass y
-Ġiv ig
-Ġaff inity
-Ġaccum ulations
-Ġmedi ate
-Ġcyt ometric
-Ġtempor arily
-Ġcompr ise
-ament ale
-Ġds am
-Ġodont ology
-oph osphate
-Ġreconstr uctions
-Ġcytok eratin
-Ġsul ph
-Ġmc d
-Ġmc i
-Ġmc m
-Ġmc n
-Ġsuperim posing
-orph ism
-Ġconver ting
-Ġlymph oma
-Ġprop ex
-Ġdeb ate
-Ġdeb ilit
-Ġtransm ucosal
-Ġsd d
-Ġprojec ts
-Ġprojec ted
-Ġprojec tions
-Ġpool ing
-Ġcm f
-Ġcogn ition
-Ġconsult ant
-Ġconsult ations
-Ġrecall ed
-Ġblind ness
-Ġcalibr ate
-Ġcall s
-Ġlat ent
-Ġprefer able
-Ġexperiment ally
-Ġrestric ting
-Ġweak ening
-Ġcarcin omas
-Ġinsu fficiently
-Ġinsu fficiency
-Ġevent ual
-Ġalb eit
-Ġexplore r
-Ġsegment al
-Ġtherm oco
-Ġuseful ness
-Ġfamil ial
-Ġmic ra
-Ġcounter act
-bo ud
-Ġbio inform
-Ġgutta flow
-Ġ200 3
-Ġperf luor
-Ġide ally
-Ġgre y
-Ġord inary
-Ġagg ression
-Ġspe ak
-Ġdil ated
-Ġdil utions
-Ġdil aceration
-Ġpathological ly
-Ġrad boud
-Ġcrystal line
-Ġpolic lin
-de velop
-Ġinterpro fessional
-Ġmini ature
-Ġattr active
-Ġassist ing
-Ġpt c
-Ġlink age
-Ġirrig ating
-Ġencour agement
-Ġpack ed
-Ġpack aging
-Ġdg cts
-Ġnarrow ing
-Ġmun ich
-Ġoverlap ped
-Ġld h
-Ġemb arr
-Ġbound ing
-Ġeg d
-Ġinterm ed
-Ġdmf ss
-Ġacceler ating
-Ġacceler ates
-Ġdisag reed
-Ġorthop edics
-Ġcarry over
-Ġnation ally
-Ġphysiological ly
-Ġhemod ynamic
-Ġconstit utes
-Ġput ty
-Ġfm ud
-Ġfm ps
-Ġtri ad
-Ġmorphological ly
-Ġantic ancer
-Ġprotec ts
-Ġmul tis
-Ġscr ipt
-Ġiran ian
-Ġfas hion
-Ġrm ma
-Ġnons ense
-Ġcounterpar t
-Ġpull ed
-Ġdeterior ate
-Ġgoal s
-Ġpaediatric ian
-Ġstraight forward
-Ġspontaneous ly
-Ġsided ness
-Ġhypomineral ized
-Ġpit ches
-Ġmit otic
-Ġrig orous
-Ġpenetr ability
-Ġdp cs
-Ġdisrup t
-Ġdisrup ts
-Ġtrigg ers
-Ġnotice ably
-Ġprogramm ing
-Ġobt ur
-Ġdiscol ored
-Ġworks hops
-Ġdistress ed
-Ġconclud ing
-Ġexerc ised
-Ġworth y
-Ġworth while
-Ġpure ly
-Ġren dered
-Ġselective ly
-Ġpredis position
-Ġrom e
-Ġpy kn
-Ġexclus ive
-Ġsupr amentale
-Ġhandpi eces
-Ġaggreg ated
-Ġsud anese
-Ġunre lated
-Ġmicrog ap
-Ġconfig urations
-Ġcrystall ized
-Ġunfav ourable
-Ġtun ing
-Ġwet ting
-Ġmess ages
-Ġsuspension s
-Ġconcomitant ly
-Ġthreat s
-Ġsib ling
-Ġanonym ity
-Ġfus ing
-Ġaspir in
-Ġundes ired
-Ġmarket ing
-Ġoverex pressed
-Ġannot ated
-Ġsteroid al
-Ġmicrom orph
-Ġlav a
-Ġdele ted
-Ġtrap ez
-Ġtransition s
-Ġdelay ing
-Ġthermo formed
-Ġadvoc ate
-Ġ199 3
-Ġ199 7
-Ġlubric ant
-Ġaer obic
-anal y
-arr ay
-Ġht v
-Ġshorten ed
-Ġshorten ing
-Ġfish er
-Ġpresum ably
-Ġlogarith m
-Ġxen on
-Ġglyco lytic
-Ġmultin ucleated
-Ġencompass ed
-Ġencompass ing
-Ġtang ents
-Ġthread s
-Ġdest abil
-Ġamb iguous
-Ġswab s
-Ġsph erical
-Ġpec uli
-Ġexec ution
-Ġhair y
-Ġupd ate
-Ġexacerb ating
-Ġsial opaper
-opo ietic
-Ġpara esthesia
-Ġacidogenic ity
-Ġexceed s
-Ġodontobl astic
-Ġkinderg artens
-Ġhierarch y
-Ġnecessit ate
-Ġtail ed
-Ġmp bs
-Ġpref ect
-agl obulin
-Ġderiv ative
-sh ape
-Ġwal es
-Ġvill age
-Ġdeterg ent
-Ġdrink ers
-Ġchemok ine
-Ġrepeti tions
-Ġattenu ated
-Ġflatten ing
-Ġaw ake
-Ġdum my
-Ġdev oid
-Ġunerup ted
-Ġcolomb ia
-Ġnonc avitated
-Ġclassroom s
-Ġmicropl ates
-Ġdoub t
-Ġweakness es
-Ġamplic ons
-Ġinev itable
-Ġpir anha
-Ġwel ding
-Ġascertain ed
-Ġcontig uity
-Ġvivid ness
-Ġextrap ol
-Ġcollective ly
-Ġerythemat osus
-Ġchromos omal
-Ġorbital e
-Ġinex perienced
-Ġdab cyl
-Ġmacrol ide
-Ġmacrol ides
-Ġtab ulated
-Ġlam ivudine
-atiz ation
-Ġunw anted
-Ġweigh ed
-Ġmicrot ensile
-Ġhistor ically
-Ġtown s
-Ġchat gpt
-Ġsevent een
-Ġrelie ve
-Ġpolyphosph ates
-Ġaddic tiveness
-Ġpromp ts
-Ġtradition ally
-Ġosteoconduc tive
-Ġchromat ography
-Ġmetalloprotein ases
-Ġhook ah
-Ġaliqu ots
-Ġthaw ed
-Ġinoc ulated
-Ġmiti gate
-Ġreper toire
-Ġgarg ling
-Ġamoun ted
-Ġsimul ator
-Ġbright ness
-Ġmanip ulation
-Ġzo om
-Ġpulver ized
-Ġslic er
-Ġdisclos ure
-Ġsoph isticated
-Ġdan ish
-Ġdol phin
-Ġdeion ized
-Ġtriglycer ides
-Ġintercon nected
-Ġintro duce
-Ġkine tics
-Ġarith metic
-Ġinvis ible
-Ġverb ally
-Ġchemot actic
-Ġotolaryng ology
-Ġorthopa edic
-Ġstereolith ography
-Ġnicotin ell
-Ġprostagland in
-Ġimperfec ta
-Ġtac rolimus
-Ġpon tic
-Ġfv l
-Ġhur dle
-Ġgamm a
-Ġresh ap
-Ġimagen et
-Ġprist ine
-Ġseropos itivity
-Ġpolyv inyl
-Ġimmunode fici
-Ġimmunoglob ulin
-Ġantibiof ilm
-Ġbiomechan ics
-Ġphosphor us
-Ġbenefici aries
-Ġdimeth acrylate
-Ġinnov ative
-Ġneurom uscular
-Ġinfras tructure
-yren e
-repres ent
-Ġsro h
-Ġsich uan
-Ġsanti ago
-Ġwren ch
-Ġances try
-Ġanne aling
-Ġmise q
-Ġlister ine
-Ġnore pinephrine
-Ġnst a
-Ġnause a
-osarc oma
-Ġvio let
-Ġperine ural
-Ġbeij ing
-Ġchee ks
-Ġdepro te
-Ġdegran ulation
-Ġshann on
-Ġleath ery
-Ġkyr bws
-Ġundecal cified
-Ġmanoeu v
-Ġbutterm ilk
-Ġmicrocr acks
-Ġpostmen opausal
-Ġconfidenti ality
-Ġosteoin duc
-Ġurogen ital
-Ġctnn b
-Ġboole an
-Ġstillbirth s
-Ġbrewarr ina
-Ġsubspinal e
-Ġdebrief ing
-Ġthermoco up
-Ġpykn osis
-0 1
-4 00
-4 70
-5 4
-7 6
-7 8
-8 58
-a gn
-b ed
-b ound
-c ity
-d md
-d ney
-e ther
-e lec
-f in
-f our
-f ically
-f ux
-g al
-g azi
-h n
-h ar
-i ologists
-j iang
-l as
-l ays
-l ining
-l ider
-l osan
-n de
-o tr
-o ise
-o lymer
-p et
-p athic
-q l
-r id
-r ian
-r ym
-r hex
-s en
-s ome
-s ian
-s field
-t c
-t ar
-t ures
-t epe
-u h
-u ation
-v ia
-w anese
-x ide
-Ġ um
-Ġt et
-Ġt ies
-Ġt ib
-Ġt rep
-Ġa ortic
-re t
-re ported
-Ġth r
-Ġth ous
-on ch
-on ema
-on omics
-Ġs io
-Ġs ax
-Ġs aturation
-Ġs yst
-Ġs vm
-ti tis
-ti cemia
-Ġo vari
-Ġo titis
-er ad
-er ations
-Ġc et
-Ġc ie
-Ġc asc
-Ġc ns
-Ġc atch
-Ġc moh
-Ġp ent
-Ġp od
-Ġp tr
-Ġp ins
-Ġp amph
-Ġw t
-Ġw ech
-Ġw ish
-Ġw ise
-Ġw ings
-Ġin ferences
-Ġin growth
-es h
-es ter
-es ign
-Ġan astom
-Ġf ma
-Ġf dr
-Ġf dps
-Ġf di
-Ġf anta
-Ġd ft
-Ġd ms
-Ġd ict
-Ġm ur
-Ġm ts
-Ġm res
-Ġm ors
-Ġm ens
-Ġm gi
-Ġm erc
-Ġm amp
-Ġm uh
-at c
-at r
-or a
-or adi
-or rhex
-th ane
-an i
-an ous
-an ne
-an timicrobial
-Ġb ud
-Ġb ib
-Ġb ag
-Ġb wr
-Ġb ana
-is on
-as cal
-ent ory
-ic a
-ic an
-ing ent
-Ġre cl
-Ġh us
-Ġh op
-Ġh ip
-Ġh oun
-Ġh ope
-Ġh nc
-Ġh acet
-le ep
-Ġe ch
-Ġe ke
-it r
-it ary
-it one
-it ating
-Ġst roma
-ul ose
-ec ked
-Ġl ac
-Ġl un
-Ġl aus
-Ġl ind
-Ġn ur
-Ġn ad
-Ġn rs
-Ġn ij
-im on
-im ab
-im inal
-Ġg m
-Ġg am
-Ġg out
-Ġg aus
-Ġg reg
-Ġg gd
-Ġg bi
-Ġg fr
-ur yl
-ur ane
-ud ate
-et etr
-os se
-os ide
-os omal
-ce ph
-Ġfor th
-ol on
-ol linearity
-Ġas c
-Ġas t
-il um
-il oxane
-Ġcon es
-Ġcon vers
-od ile
-od ivergent
-id ged
-id va
-id rotic
-ati a
-ab c
-am er
-am uscular
-tic ill
-Ġv d
-Ġv o
-el ae
-Ġal end
-Ġal ive
-Ġal titud
-Ġper imeter
-Ġr ings
-Ġwh itish
-Ġex em
-Ġex udate
-Ġpro pri
-Ġpro seal
-Ġres pected
-Ġbe vel
-ion ic
-tr ip
-tr ials
-ot ing
-ot em
-ot ogrammetry
-Ġim er
-Ġis ra
-Ġis fa
-ir d
-oc ular
-qu in
-iz able
-Ġde pressive
-Ġinc h
-Ġme al
-Ġpre b
-Ġpre t
-Ġpre cluded
-Ġpre adjusted
-Ġpre term
-Ġpre existing
-Ġcomp act
-Ġcomp iled
-og lu
-Ġdis l
-Ġdis artic
-Ġse as
-Ġse gn
-Ġse ating
-Ġse attle
-Ġsh all
-Ġsh adow
-ap ill
-oth ing
-Ġad obe
-Ġhe ating
-Ġsign ifying
-Ġass ets
-Ġass urance
-Ġcl erical
-and a
-Ġtw enti
-op y
-op al
-op tim
-op rop
-por ary
-odon tists
-ence ph
-Ġsignific ances
-Ġap i
-ip ette
-Ġdental ly
-Ġit erative
-Ġco ugh
-ia e
-Ġle f
-Ġle ak
-Ġle mes
-Ġsur fact
-ub ated
-ub ular
-Ġtreat s
-pec ting
-pec ified
-Ġpar s
-Ġhealth ier
-st yrene
-Ġfo ti
-Ġinf ar
-Ġinf estation
-enti stry
-Ġpl i
-Ġpl ants
-ill ing
-Ġtr io
-Ġtr ails
-Ġmod ulation
-Ġmod elling
-Ġmod uli
-Ġcons erved
-Ġreg ain
-Ġreg row
-Ġreg imes
-Ġob li
-Ġacc b
-Ġacc ult
-Ġrec a
-ors ed
-Ġrel apsed
-Ġne urons
-Ġpr s
-Ġpr ams
-Ġab dul
-Ġab olished
-Ġsub pop
-Ġsub antimicrobial
-Ġsub optim
-Ġinter r
-Ġinter ior
-Ġinter ferences
-Ġinter maxillary
-Ġqu bit
-Ġun h
-Ġun n
-Ġun t
-Ġun so
-Ġun ified
-Ġun paired
-form ing
-Ġint ent
-Ġint el
-ay ama
-ist a
-Ġy east
-Ġam ine
-Ġam yg
-ens or
-Ġvari ates
-ven ue
-Ġk l
-Ġk etone
-Ġclinical trials
-Ġdet er
-lec tive
-ost atic
-Ġgen isc
-Ġchild care
-ass ment
-ass ay
-ass ium
-gn athic
-Ġfin n
-Ġstatistic ian
-Ġup load
-Ġcontrol l
-Ġar s
-Ġar ts
-Ġar med
-amin ob
-amin etetr
-Ġinv entory
-Ġmax graft
-Ġph il
-Ġph obia
-Ġover coming
-Ġbi ob
-ct g
-Ġmo is
-ograph ically
-lu oric
-Ġdec is
-Ġcr ises
-Ġcr nde
-Ġcr iminal
-Ġag itation
-Ġstr i
-cc s
-Ġproc odile
-Ġbr ay
-Ġbr onch
-Ġund iagnosed
-Ġ2 50
-Ġnon cont
-Ġdisc our
-Ġsup re
-Ġradi o
-Ġdef ensive
-Ġsp it
-Ġj oh
-Ġmin t
-Ġmin us
-ds pathic
-Ġprob ed
-Ġi ia
-Ġi plan
-Ġtrans crip
-Ġtrans palatal
-Ġtrans cribed
-Ġop ted
-Ġop tically
-Ġdi e
-Ġdi ure
-Ġdi ap
-Ġdi ary
-Ġdi aminob
-Ġcur tis
-Ġgr ip
-ak a
-Ġcharacter izations
-Ġconf id
-Ġconf ection
-Ġconf used
-Ġ3 00
-Ġcells ens
-Ġser ially
-Ġstat ure
-Ġem its
-Ġem itted
-Ġem itting
-Ġintr ales
-Ġintr amuscular
-amm aglobulin
-Ġz he
-Ġwor ry
-Ġwhere in
-Ġplan kt
-Ġdr astic
-Ġdr iving
-Ġdr ank
-Ġdr idva
-Ġend orsed
-Ġradiograph ical
-Ġca iro
-echn ology
-Ġloc us
-Ġtechn ological
-tit ution
-Ġdid actic
-hip s
-Ġfr ance
-Ġindividual ized
-Ġperiod ically
-Ġprac tis
-Ġprac tising
-Ġremo ves
-Ġany way
-Ġany where
-Ġinflu ential
-ob is
-ob ut
-Ġexpl antation
-ines cence
-Ġmuc in
-Ġsm og
-Ġins pected
-Ġrestor atives
-Ġir ccs
-Ġidenti ty
-Ġcb i
-Ġprot ected
-Ġgl fs
-Ġgl idden
-Ġpot ency
-Ġpot assium
-Ġanti gens
-Ġforce ps
-Ġdist ancing
-Ġos man
-Ġpe er
-Ġpe tia
-Ġfem ur
-Ġidentif iable
-Ġhist ogram
-Ġparen chym
-Ġeth ically
-Ġeth moid
-Ġresult ant
-Ġfl aw
-Ġfl ipping
-ful ness
-Ġstress ed
-Ġstress ors
-Ġoste oid
-Ġiniti ative
-ox ia
-Ġsl opes
-Ġang ina
-Ġhyp oh
-Ġhyp osal
-Ġhyp odivergent
-Ġver ticill
-Ġgrow s
-Ġexpos ing
-Ġperce p
-Ġsens ors
-Ġsens itis
-Ġsens ibility
-Ġsens odyn
-Ġep q
-Ġps q
-Ġps us
-Ġhard est
-Ġcontr a
-Ġcontr acted
-Ġabs or
-Ġnew cast
-Ġhand ed
-Ġhand les
-Ġfluor oph
-Ġfluor ochrom
-Ġcompl icate
-Ġpulp otomized
-Ġanalyz er
-ator ies
-Ġacid ity
-Ġref ined
-Ġref resh
-Ġhos mer
-Ġmid face
-Ġpoly ether
-Ġpoly styrene
-Ġsym pos
-Ġcategor ize
-Ġachie ves
-Ġsugges tion
-Ġsugges tive
-Ġoh c
-Ġoh e
-Ġoh i
-Ġoh bs
-Ġdevi ated
-Ġsequ elae
-Ġu ws
-Ġrespond s
-ps is
-ps ych
-Ġimmun ologic
-Ġsyn ov
-Ġpow ders
-Ġod ors
-Ġlog ical
-Ġprog lider
-Ġequ ator
-Ġ4 3
-Ġ4 4
-Ġ4 9
-Ġ6 7
-Ġprem ix
-Ġprem ise
-Ġta ught
-Ġfib re
-Ġintere sts
-Ġmembr anous
-Ġrespons iveness
-Ġaccess ory
-Ġmm se
-Ġdistal ize
-Ġexam s
-ogene tic
-vari able
-Ġintroduc tory
-Ġlinear ly
-Ġtool k
-Ġsatis fy
-Ġhyper ther
-Ġhyper lin
-Ġhyper paramet
-Ġhyper variable
-Ġwork er
-mark s
-Ġvir ucid
-Ġspl at
-az iz
-Ġspecial ised
-Ġcement al
-Ġbene ath
-Ġsk ip
-gen erative
-Ġartic ul
-Ġx t
-Ġx y
-Ġhyd ration
-Ġback side
-Ġproportion ately
-Ġsurv ived
-lor a
-pa igns
-Ġ9 000
-Ġ8 3
-Ġ8 4
-Ġoptim ism
-me gen
-Ġtub ing
-Ġsil ane
-Ġsn ack
-Ġcd na
-Ġclean er
-rop y
-Ġpen n
-Ġill um
-Ġill umination
-Ġevery day
-Ġfunctional ity
-Ġmedium s
-Ġrepe ating
-Ġreal m
-Ġorgan is
-Ġhydro lys
-Ġbro thers
-Ġnas o
-Ġultr a
-Ġsee ing
-ux imab
-Ġge ometrical
-Ġerup tive
-plas ms
-Ġmicroscop ically
-Ġirradi ations
-Ġled s
-Ġphosph ates
-Ġsem ic
-Ġfp g
-Ġiss ued
-Ġultras truct
-nt gee
-Ġfav ors
-omat osa
-Ġq ia
-Ġsb i
-Ġsb p
-Ġmass ili
-Ġbin ds
-Ġhom d
-Ġhom ologous
-Ġdys biotic
-Ġpocket ing
-Ġpass es
-Ġcop d
-Ġnan oceramic
-Ġalcohol ic
-Ġesthetic ally
-Ġadap tion
-Ġadap ting
-Ġpor cel
-Ġdown s
-Ġdown loaded
-Ġ19 75
-Ġ19 60
-Ġcran i
-Ġphen otypic
-Ġchlor oform
-Ġent ropy
-Ġpediatric ian
-Ġgerm s
-Ġgerm line
-Ġgerm icidal
-Ġpair ing
-Ġmis class
-Ġlin king
-Ġlater ally
-Ġintegr ating
-Ġintegr ates
-Ġsa fer
-Ġrecogn ise
-Ġdiss imilar
-Ġbirth day
-Ġmedi ator
-Ġcam paigns
-Ġflex ible
-Ġsuperior ly
-Ġpf m
-Ġvr l
-Ġminim izes
-Ġpil oted
-Ġrout ines
-Ġnumer ically
-ron ate
-Ġcre am
-Ġalt man
-Ġplot ting
-ula e
-oph otogrammetry
-Ġprogress ing
-Ġleuk ocyte
-Ġeti ologies
-Ġacqu iring
-Ġfacilit ators
-Ġviol ation
-Ġmc a
-16 8
-Ġobjective ly
-Ġlact ation
-Ġparalle ling
-Ġss is
-Ġlymph ocyte
-Ġstrati fying
-bal anced
-Ġsubstit ution
-Ġcentrif uge
-Ġprospective ly
-Ġrecall s
-Ġnutr ients
-Ġlat via
-Ġprefer ably
-Ġroom s
-Ġmas se
-Ġtons il
-Ġcarcin ogenic
-Ġoverl aps
-Ġcollagen ous
-Ġalb umin
-Ġsegment ations
-Ġfabric ate
-Ġaccep ting
-Ġbes ide
-Ġretain ing
-Ġmic r
-Ġmix tures
-Ġcounter st
-Ġsecre tions
-Ġsecre te
-Ġprincip ally
-Ġincom pati
-Ġker nel
-Ġcondyl ion
-Ġulcer ations
-Ġulcer ative
-Ġ200 1
-Ġ200 4
-Ġ200 6
-Ġ200 9
-Ġden ote
-Ġbs so
-Ġrp ost
-Ġdisp ensed
-Ġcs a
-Ġcs f
-Ġgraph ically
-Ġexc itation
-Ġhypothes ised
-Ġtap e
-Ġtap ping
-Ġatten tive
-de generative
-Ġisch emia
-oin ted
-oin ting
-Ġorganization al
-dom inal
-Ġattr acted
-Ġattr acting
-Ġgland ular
-Ġabsorb ing
-Ġsy dney
-Ġsy rian
-Ġkin ase
-Ġinst ability
-Ġbott les
-Ġcellular ity
-Ġsent ences
-Ġdeath s
-Ġshif ted
-Ġextre m
-Ġamel ogenesis
-Ġedge wise
-Ġsulf ide
-Ġtorque ing
-Ġcat abolic
-Ġfinanc ially
-Ġauthor ity
-Ġec osystem
-Ġextract able
-Ġscienti fically
-Ġnc m
-Ġmunicip al
-Ġfel dspathic
-Ġhar b
-Ġhol istic
-Ġperm it
-Ġperm its
-Ġperm itted
-Ġuns pecific
-Ġcorrespond ence
-Ġtransf ers
-Ġdistingu ished
-Ġhr l
-Ġhr p
-Ġhr ql
-Ġput ting
-Ġfm bs
-Ġrejec tion
-Ġosteo lysis
-Ġsweet ened
-Ġsweet eners
-Ġscar city
-Ġhomogeneous ly
-Ġlamin ar
-Ġnoti fication
-Ġdim ethyl
-Ġdim orphism
-Ġresol ving
-Ġresol utions
-Ġleg end
-eptid e
-Ġsuperv is
-Ġreinfor ces
-Ġreinfor cing
-dt ot
-Ġframewor ks
-Ġns mu
-Ġdeterior ating
-Ġequival ence
-Ġjusti fication
-Ġcorrec ting
-Ġdiscrimin ating
-Ġdiv or
-Ġdiv ide
-Ġtox ins
-Ġgn ation
-Ġpreschool ers
-Ġcorro sion
-Ġstere ophotogrammetry
-Ġautom ix
-Ġpenetr ates
-Ġmultic ollinearity
-Ġdp rs
-Ġdisrup ted
-Ġtrain ee
-Ġtrigg ering
-Ġprotrusion s
-Ġpet ech
-Ġanalog ous
-Ġ00 2
-Ġinfiltr ate
-Ġinfiltr ations
-Ġanthrop ometry
-Ġdiscol or
-Ġdigitiz ation
-Ġstimul ator
-Ġstret ch
-onym ous
-Ġconce aled
-Ġperfor ations
-Ġsep ticemia
-Ġclassify ing
-Ġmultid imensional
-Ġpig mentation
-Ġren ew
-Ġprepar ing
-Ġneuro degenerative
-Ġendoc anthion
-Ġrom ania
-Ġwors en
-Ġexer ting
-Ġtai wanese
-Ġfavour ably
-Ġzygomatic otem
-Ġarom atic
-icill in
-Ġresorb ed
-Ġaden oid
-Ġepis ode
-Ġmention ing
-Ġaggreg ate
-Ġunre acted
-Ġillness es
-Ġtoxic ological
-ze h
-Ġpv l
-Ġdut y
-Ġcrack ed
-Ġendo plasmic
-Ġphysi ology
-Ġphysi otherapy
-Ġdispers ed
-Ġla id
-Ġla uryl
-Ġrbf dp
-Ġant ec
-Ġtoler ated
-Ġperme able
-hy d
-Ġannot ations
-Ġdisturb ance
-Ġglyc oprotein
-Ġthermo plastic
-Ġcollabor ations
-Ġscratch es
-Ġpolar ity
-Ġconscious ness
-Ġbios ynthesis
-Ġ199 0
-Ġintention ally
-Ġlubric ating
-enz idine
-Ġcouns eling
-Ġstir red
-Ġelectro de
-Ġdupl icated
-Ġunemploy ment
-Ġbring ing
-Ġantigen ic
-Ġreplic ates
-Ġuncontroll able
-Ġoccasion al
-Ġencompass es
-Ġtgn c
-Ġtang ent
-Ġlib eral
-Ġcompens ation
-Ġtrib es
-Ġstereomicro scopic
-Ġmillimet re
-Ġsynergistic ally
-dal a
-Ġwithdr awn
-Ġproce eding
-Ġmicros urgical
-Ġremn ant
-Ġexacerb ate
-Ġsun t
-Ġretic ular
-Ġnit r
-Ġnit ric
-Ġvic tim
-Ġmeticul ously
-Ġoverd ose
-Ġhistomorph ometrical
-Ġheads ets
-Ġsupernat ants
-Ġculti vation
-Ġdd wor
-Ġbif id
-Ġasep tically
-iagnos is
-Ġtrabec ulae
-Ġindustrial ized
-Ġstack ed
-Ġimag inary
-Ġtrache al
-Ġkary orrhex
-yd ro
-Ġtight ening
-Ġpip e
-Ġgenotoxic ity
-Ġretest ing
-Ġseminar s
-Ġattenu ation
-Ġinher ited
-Ġconcurrent ly
-Ġrelig ion
-Ġkill ed
-Ġkill ing
-Ġsof ter
-Ġbran ch
-Ġbran ching
-Ġju ven
-Ġinstal lation
-Ġfluctu ations
-Ġveget ables
-Ġmicronucle us
-Ġef p
-Ġcontig uous
-Ġvivid ly
-Ġperp etr
-Ġdisapp ointing
-Ġembr y
-Ġvirul ent
-Ġsubmuc ous
-Ġspectrom eter
-Ġstic ky
-Ġreass ess
-Ġelu tion
-Ġelu ted
-Ġhistopath ology
-Ġimmunore activity
-Ġmidwif e
-92 9
-Ġace tic
-Ġsas ayama
-Ġtouch ing
-atiz ed
-Ġves icular
-Ġbiot echnology
-Ġcri tic
-Ġcri tically
-Ġtransduc er
-Ġhistor ical
-Ġpolys omn
-Ġsteril ized
-Ġevol ve
-Ġcamp us
-Ġpreclud ing
-Ġtwin light
-Ġleuc ite
-Ġune ven
-Ġoutper formed
-Ġimped e
-Ġmultil ink
-Ġsuit ability
-Ġdiges tion
-Ġdiges tive
-Ġhypert ensive
-Ġraj esh
-Ġowners hip
-Ġrefrig er
-Ġpyram id
-Ġpyram idal
-Ġtsal d
-Ġtsal dtot
-Ġeosinophil ic
-Ġproceed s
-Ġautonom ous
-Ġautonom ously
-Ġanton i
-Ġhered itary
-Ġvig orous
-Ġvibr ating
-Ġhepar in
-Ġaber rant
-Ġdecalc ified
-Ġspons orship
-Ġjo ined
-Ġhyal ur
-Ġiq r
-Ġmalay a
-Ġprofess ors
-Ġprecip itate
-Ġslee ves
-Ġphosphory lation
-Ġmisd iagnosis
-Ġdehyd ration
-Ġanaerob es
-Ġkuwa iti
-Ġobstac les
-Ġfasc ia
-Ġexcep tions
-Ġmah alan
-Ġscaff old
-Ġunav ail
-Ġdetach ment
-Ġcorners t
-Ġdesquam ative
-Ġtranscript ase
-Ġconfer ring
-Ġremind ers
-Ġpathophys iological
-Ġsuff ix
-Ġautops y
-Ġbook let
-Ġdysreg ulation
-Ġdenom inator
-Ġasteris k
-Ġsor ted
-Ġsad dle
-Ġdhe a
-Ġreti red
-Ġpert urb
-Ġrit uximab
-Ġdisg ust
-Ġhemost asis
-Ġcoag ulation
-Ġparv imonas
-Ġcontem porary
-Ġtric losan
-Ġtransill umination
-Ġelong ation
-Ġprednis one
-ometr ically
-Ġhypothal amus
-Ġhydrof luoric
-Ġannex in
-Ġtorsion al
-Ġinhom ogeneous
-Ġconcres cence
-Ġharv esting
-Ġrhabdomy osarcoma
-Ġvlogg ers
-Ġvertebr ae
-Ġethylenedi aminetetr
-Ġelabor ated
-Ġpreprocess ing
-Ġepigene tic
-Ġau tis
-Ġcub ic
-Ġpend ulum
-Ġpier re
-Ġantr al
-Ġbam ako
-Ġrl cs
-Ġresembl ing
-Ġdisreg arded
-ferenti ally
-Ġprescrip tions
-Ġtrip le
-Ġtrimm ing
-Ġconsor tium
-Ġintercus pation
-Ġunequ al
-Ġunidenti fied
-Ġintu itive
-Ġkerm an
-Ġkang fux
-Ġradiop aque
-Ġmicrop ipette
-Ġmicroet cher
-Ġremed ies
-Ġmucoc iliary
-Ġbacteroid etes
-otherap eutic
-Ġverruc ous
-Ġwilli ams
-Ġcondens ation
-Ġqalp ntgee
-Ġintermed ia
-Ġmicromorph ology
-Ġtrapez oidal
-analy zer
-Ġhtv c
-Ġpeculi arities
-Ġdeprote inized
-Ġtrep onema
-Ġsyst olic
-Ġovari an
-Ġcet yl
-Ġcmoh k
-Ġpamph let
-Ġwech at
-Ġhoun sfield
-Ġhacet tepe
-Ġlaus anne
-Ġnij megen
-Ġgaus sian
-Ġgreg ory
-osse ous
-Ġalend ronate
-Ġaltitud e
-Ġpropri etary
-Ġisra el
-Ġisfa han
-Ġsegn et
-enceph al
-Ġlemes how
-Ġtrio xide
-Ġobli que
-Ġaccult uration
-Ġsuboptim al
-Ġunso und
-Ġamyg dala
-Ġgenisc a
-Ġbiob ank
-Ġdiaminob enzidine
-Ġconfection ary
-Ġintrales ional
-ammaglobulin emia
-Ġzhe jiang
-Ġplankt onic
-Ġosman gazi
-Ġparenchym a
-Ġhyposal ivation
-Ġverticill ium
-Ġsensodyn e
-Ġnewcast le
-Ġfluorochrom e
-Ġsynov ial
-Ġhyperlin ks
-Ġvirucid al
-Ġultrastruct ural
-Ġmassili ense
-Ġporcel ain
-Ġzygomaticotem poral
-Ġkaryorrhex is
-Ġmahalan obis
-Ġethylenediaminetetr aacetic
-Ġkangfux in
-, "
-0 3
-0 9
-2 1
-4 4
-8 8
-a ve
-a ag
-b el
-b ell
-b les
-b pa
-c or
-c ant
-c ore
-c pre
-d c
-d u
-d est
-d etected
-e g
-e on
-f ast
-f lora
-g is
-g ha
-g ov
-h ul
-i atic
-j d
-k eless
-k gl
-l im
-l uc
-l ished
-l eness
-l urane
-m as
-m ar
-m and
-n i
-n p
-n est
-o ot
-o ag
-p o
-p en
-p ic
-p ig
-p ensive
-p ring
-p tivity
-p aper
-p ointed
-r q
-r ated
-r ins
-s cc
-s ky
-t le
-t ct
-t art
-t oxic
-t gg
-t otal
-u ated
-u itable
-v it
-v ibacter
-w al
-w ord
-w gt
-x ill
-x ceph
-y te
-y der
-y xceph
-Ġ ub
-Ġ velop
-Ġt ent
-Ġt ree
-Ġt ack
-Ġt art
-in b
-in ten
-in osa
-in atus
-Ġa ur
-Ġa rose
-Ġa rous
-Ġa abc
-Ġa venue
-re vibacter
-Ġth omm
-on ates
-Ġs id
-Ġs ant
-Ġs ir
-Ġs end
-Ġs ass
-Ġs ene
-Ġs ri
-Ġs sc
-Ġs roc
-Ġs fa
-Ġs acr
-ti form
-Ġo le
-Ġo ven
-Ġo asis
-Ġo tt
-en tic
-en ia
-en itor
-al though
-er os
-er adi
-er ating
-er ned
-Ġc w
-Ġc ip
-Ġc gi
-Ġc els
-Ġp in
-Ġp ed
-Ġp us
-Ġp ere
-Ġp ge
-Ġp ater
-Ġp ss
-Ġp ick
-Ġp pe
-Ġp ma
-Ġp tm
-Ġp ads
-Ġw on
-Ġw st
-Ġw ang
-Ġw rapped
-Ġw gc
-Ġin puts
-es cence
-Ġan c
-Ġan h
-Ġan hu
-Ġan ionic
-Ġf id
-Ġf its
-Ġf ax
-Ġf uk
-Ġf gg
-Ġf oster
-Ġf erment
-Ġf entan
-Ġf kgl
-Ġd ere
-Ġd ow
-Ġd ip
-Ġd ub
-Ġd end
-Ġd bs
-Ġd row
-Ġd inucle
-Ġd obut
-Ġd jd
-Ġm ere
-Ġm oc
-Ġm cr
-Ġm yl
-Ġm ilit
-Ġm tes
-at en
-at uring
-at ched
-or i
-or ance
-or ne
-or oot
-th on
-th us
-an ine
-an ks
-Ġb w
-Ġb x
-Ġb er
-Ġb ab
-Ġb are
-Ġb rom
-Ġb end
-Ġb ang
-Ġb ax
-Ġb old
-Ġb ank
-Ġb ern
-is ol
-is ability
-tion ately
-as i
-as ure
-ent ed
-ic y
-ic ing
-ic ide
-ic les
-ic its
-ro d
-ro fl
-Ġre feren
-Ġre ex
-Ġre vascular
-Ġre aff
-Ġto d
-Ġto ky
-Ġh it
-Ġh ors
-Ġh ok
-Ġh inge
-le g
-Ġe ap
-Ġe igen
-Ġe fa
-Ġe ucl
-it o
-it as
-it ter
-it ers
-it ations
-us ting
-us si
-Ġst ore
-Ġst ents
-Ġst rap
-Ġst av
-Ġst ayed
-Ġst yles
-Ġst uff
-ere mia
-ul f
-ul ant
-ul cular
-ac a
-ac g
-ac oustic
-ac ami
-ec s
-ec tions
-ec ond
-Ġl is
-Ġl ud
-Ġl ati
-Ġl ach
-Ġl oci
-Ġl ra
-Ġl ank
-Ġl ussi
-om agic
-Ġn i
-Ġn atal
-Ġn nt
-Ġn rt
-im il
-im plant
-im otor
-im ura
-Ġg g
-Ġg y
-Ġg ree
-Ġg ome
-Ġg all
-Ġg ale
-ur ia
-ig ley
-et ti
-os h
-os es
-os tal
-os ities
-Ġwas te
-if entan
-ol s
-ol uble
-Ġas per
-Ġas par
-Ġas yl
-Ġas leep
-il ine
-il ian
-Ġcon g
-Ġcon formed
-Ġcon gl
-od s
-od ium
-od emic
-id om
-id ad
-id ium
-id ov
-id inium
-Ġon yxceph
-ts son
-am ara
-tic ola
-Ġv ls
-Ġv oids
-el le
-ter a
-ter ity
-Ġal iph
-Ġal ara
-Ġper in
-Ġr w
-Ġr im
-Ġr ush
-Ġr ick
-Ġr pe
-Ġr cs
-Ġr ights
-Ġr rs
-Ġwh is
-Ġwh ate
-Ġpro ff
-Ġpro max
-Ġres emb
-Ġbe es
-ion e
-uc k
-Ġcom mented
-ot ong
-ot ens
-ot rophic
-Ġim w
-Ġim mo
-Ġis l
-Ġis ot
-Ġis lands
-ut ory
-ir c
-ir y
-oc c
-oc ard
-oc onstr
-oc ultural
-qu al
-qu er
-qu ence
-qu antit
-Ġch est
-Ġde ploy
-Ġde pressed
-ore z
-ore cept
-igh ter
-Ġinc ap
-um s
-pl icated
-Ġat las
-Ġpre formed
-Ġpre ferentially
-ys ed
-Ġcomp e
-Ġcomp lying
-iv able
-Ġdis hes
-Ġse eding
-Ġse vered
-Ġse psis
-Ġsh a
-Ġsh ed
-Ġsh ush
-Ġsh ades
-ap ine
-ap tan
-Ġad ds
-Ġad hs
-feren tial
-Ġbet nes
-Ġhe ins
-Ġhe man
-Ġass er
-Ġass ured
-Ġass ists
-Ġass uring
-Ġass imil
-Ġcl as
-Ġcl ient
-Ġcl oned
-Ġcl oning
-and o
-and ina
-por ting
-por osity
-we es
-we ar
-we ighted
-em ar
-em ide
-em br
-em akers
-ers on
-Ġsc ant
-Ġsc andina
-Ġperi opaper
-Ġit erations
-und ii
-Ġco a
-Ġco ur
-Ġco ast
-Ġco ex
-Ġind ul
-Ġind oor
-ub lished
-se a
-Ġcan n
-Ġpar amed
-Ġpos ted
-st rength
-Ġinf eri
-Ġinf odemic
-per t
-Ġha w
-Ġha wth
-ich ia
-Ġpres e
-Ġpl ung
-ell er
-Ġall ogenic
-Ġperiodon tists
-ch i
-ug inosa
-ill ed
-ill ar
-ill over
-ill aries
-Ġro se
-Ġtr ust
-Ġtr ays
-Ġtr acks
-Ġtr sk
-Ġmod ular
-ach i
-ach es
-ach ial
-Ġcons pic
-Ġreg isters
-Ġob sc
-Ġno xi
-Ġrec on
-Ġrel aps
-Ġne vir
-Ġcar unc
-Ġcar isol
-Ġab st
-Ġab usive
-Ġab dominal
-fac eted
-Ġsub sc
-Ġinter cellular
-Ġinter vie
-Ġinter bracket
-Ġqu ant
-Ġqu alities
-Ġqu iet
-Ġqu igley
-Ġun l
-Ġun trained
-Ġun balanced
-Ġint ubated
-Ġy ol
-Ġy ang
-Ġy ields
-ens ory
-ard o
-ard itis
-Ġassoci ate
-Ġassoci ates
-Ġk im
-Ġk cl
-Ġk ath
-Ġk och
-ple ts
-Ġwe ather
-ast a
-pro p
-pro duc
-ost ar
-ire ction
-Ġen graft
-yp t
-Ġchild birth
-ph thal
-ph enol
-Ġout growth
-Ġout lines
-Ġout lining
-Ġsuc ce
-Ġup hold
-ond rosis
-ide an
-ose quence
-Ġcor ah
-Ġdes min
-acter ium
-Ġso ce
-valu es
-Ġph usion
-Ġph ag
-Ġevalu ator
-Ġover wh
-Ġover represent
-Ġnum eric
-Ġfound ed
-Ġbi ologic
-Ġbi ode
-ct c
-Ġmo uld
-Ġmo vable
-ograph s
-Ġdec e
-Ġcr aw
-Ġag ammaglobulinemia
-Ġwhen ever
-Ġstr iation
-Ġstr angers
-Ġ1 50
-Ġbr itt
-Ġbr idges
-Ġbr du
-Ġbr achial
-Ġlower case
-ep id
-ep tive
-ag m
-ag le
-ag onal
-ag asta
-ath y
-ath etic
-Ġmaxill o
-Ġcompar ably
-Ġnon con
-Ġnon linear
-ingiv ally
-Ġdisc erned
-Ġsup pose
-Ġclass ifies
-Ġorth o
-Ġdef enses
-Ġdef icits
-Ġsp in
-Ġsp ong
-Ġsp ans
-Ġsp ending
-Ġsp urt
-Ġsp acer
-Ġsp iro
-Ġj ab
-Ġj acc
-Ġbut tress
-Ġed j
-Ġed ition
-Ġed itor
-Ġmicro control
-Ġmicro flora
-Ġmicro implant
-Ġcomm ens
-Ġtyp ing
-te ine
-Ġfive fold
-Ġeffect or
-Ġpop s
-Ġmaterial ise
-Ġbec n
-Ġi ip
-ivid ual
-Ġtrans c
-Ġop n
-Ġop tic
-Ġop scc
-Ġwell ness
-Ġgr d
-Ġgr ant
-ak i
-Ġdep iction
-Ġdep apill
-Ġsal e
-Ġunder develop
-Ġcharacter s
-Ġimp eding
-Ġpost ures
-Ġcro atia
-Ġser ous
-Ġser ology
-Ġvis ibility
-Ġbl and
-Ġbl ister
-Ġbl asted
-Ġbl unt
-Ġsin tering
-Ġol t
-Ġintr uded
-Ġ0 7
-Ġ0 8
-Ġ0 9
-Ġz ah
-Ġz eros
-Ġz idov
-Ġtotal ing
-Ġsix teen
-Ġer oded
-Ġsecond hand
-Ġcondition al
-Ġsoft ening
-Ġdr ains
-Ġend odontist
-Ġend oscopic
-Ġend orez
-Ġend osequence
-Ġloc ator
-Ġel icit
-Ġel dest
-Ġmulti tude
-Ġmulti faceted
-fer ase
-Ġrem emb
-Ġrem eas
-Ġrem ifentan
-ie ties
-Ġsome how
-Ġincis ive
-Ġcle ary
-Ġinflu x
-ob ium
-ob revibacter
-Ġmuc ins
-ha e
-Ġdistrib uting
-Ġins ec
-Ġins pect
-Ġins oluble
-Ġconduc tivity
-Ġbefore hand
-Ġear s
-gi osis
-Ġir ish
-Ġinstr on
-etic ally
-Ġoc clus
-Ġsmo keless
-Ġinfec tive
-Ġrece ptivity
-Ġprot on
-Ġbeha ve
-Ġgl o
-Ġpath osis
-Ġcommon est
-Ġoper ational
-Ġspecific ation
-Ġdist obuccal
-Ġunivers itas
-Ġunivers idad
-Ġos x
-Ġoccur rences
-Ġav iv
-Ġav ascular
-of lurane
-of agasta
-Ġmechan istic
-Ġmechan otherapy
-Ġmechan orecept
-Ġpal e
-Ġpal p
-yl obacter
-Ġthir teen
-Ġhist ories
-Ġtm a
-Ġes tr
-Ġes cal
-Ġes ophageal
-Ġfl ip
-Ġdistribution al
-Ġpubl ish
-Ġoste oph
-Ġoste odent
-Ġdimension ally
-Ġdimension ality
-Ġprof ici
-Ġda hl
-Ġevid ently
-Ġsl ing
-Ġang ulations
-Ġmaj ors
-Ġhyp oxia
-Ġhyp hae
-Ġfe ared
-Ġver on
-Ġver hul
-ogen in
-Ġ5 3
-Ġep inephrine
-Ġsol d
-Ġhard s
-Ġsoci ocultural
-Ġred d
-Ġred ness
-Ġcontr arily
-Ġpotential s
-ocol itis
-Ġnorm ando
-Ġtherap ist
-Ġtherap ists
-Ġnew tons
-ins titution
-Ġvalid ating
-Ġcompl ies
-Ġcompl icating
-Ġpulp otomies
-Ġsingle t
-Ġcap ped
-Ġcap sa
-Ġcap illaries
-Ġprov oking
-Ġprov ocation
-Ġprov oke
-Ġalign s
-Ġday light
-Ġref ix
-Ġref lux
-Ġestim ations
-Ġdm em
-more over
-hol m
-irm ed
-Ġpoly p
-Ġpoly ethyl
-Ġpoly gonal
-Ġsu ited
-Ġsu icide
-Ġsym b
-Ġcategor izing
-ou fl
-pe ople
-Ġlif t
-onal d
-Ġreli abilities
-vent ful
-Ġtum s
-Ġdevi ate
-Ġu oc
-Ġu ae
-Ġaut ocl
-Ġorder ing
-Ġret ino
-Ġlay people
-Ġdig enic
-Ġdig luc
-Ġresist ances
-Ġcarr ies
-Ġvers atile
-Ġsw s
-Ġcult urally
-Ġod onto
-Ġmultiple x
-Ġflow s
-Ġprog enitor
-Ġauth entic
-Ġpractic ally
-Ġ6 8
-Ġadm ixed
-Ġnormal ization
-Ġta u
-cle ft
-Ġfib ron
-Ġfib ril
-Ġdirect or
-Ġdirect ors
-Ġrespons ive
-Ġaccess ories
-Ġfree ly
-Ġmm ps
-Ġmm pa
-Ġgo v
-Ġgel atin
-Ġct v
-Ġprec a
-Ġclear ing
-Ġintroduc es
-Ġdom inance
-Ġbo y
-Ġbo oking
-Ġhal t
-Ġhal ogen
-Ġappear ing
-Ġappear ances
-Ġdeep ening
-Ġhypoth etically
-Ġhyper g
-Ġhyper pig
-Ġhyper inten
-ink led
-Ġcycl er
-ned y
-Ġconstr ictions
-Ġnecess itated
-oma xill
-Ġchr is
-roph osphate
-Ġspl ine
-Ġshap ley
-Ġcontrast ing
-Ġmorph ologic
-Ġpsych otropic
-Ġpress ing
-Ġmut ants
-Ġmut agen
-ros emide
-Ġrough ened
-Ġsk ew
-Ġpur s
-Ġpur se
-Ġartic ulation
-Ġartic aine
-tention ally
-Ġx p
-scop ically
-Ġhyd rate
-Ġchem oradi
-Ġchem ilum
-Ġchem otherapeutic
-Ġapproxim ated
-Ġpol ium
-cep tive
-Ġsepar ates
-Ġconcentr ate
-Ġconcentr ating
-Ġwall ed
-Ġregular ity
-Ġregular ization
-Ġdoc king
-Ġtra jec
-Ġpolymer ic
-Ġpanor ama
-Ġoptim ally
-Ġwa ke
-Ġwa ived
-Ġattrib ution
-Ġdigital ized
-Ġms p
-Ġsubs ite
-Ġsubs ided
-me ga
-ocy tosis
-Ġtop ographic
-Ġexclusion s
-Ġtub ular
-Ġtub erc
-Ġtub ulin
-Ġmus lim
-Ġsn yder
-Ġcd e
-Ġcoll apse
-eric ity
-Ġbar c
-Ġvisual izing
-Ġecon omy
-Ġalong side
-orb ent
-Ġcod ification
-Ġten se
-Ġten ets
-Ġmagn ifications
-Ġtransl oc
-Ġreal izing
-Ġorgan isation
-Ġdetect ors
-Ġfit ness
-Ġic cs
-obl astic
-Ġemerg ent
-Ġmanual s
-Ġbur ns
-Ġrepl en
-Ġtemper ing
-Ġge omagic
-Ġenc aps
-Ġmy ogenin
-Ġerup ting
-grad ation
-Ġmr c
-Ġmr s
-Ġmill ilit
-Ġstain ability
-Ġepithelial ization
-Ġsem ester
-Ġscreening s
-Ġinstit ut
-Ġlig aments
-Ġhem im
-Ġhem ocyt
-Ġmac ao
-Ġpapill omatous
-Ġadvant aged
-Ġmedic ines
-omat osis
-Ġinterpre tability
-Ġtraum atized
-Ġmass es
-Ġmass ive
-Ġpass ively
-Ġcop e
-Ġcop ious
-Ġher ze
-Ġpm pr
-Ġnan of
-Ġadap ter
-Ġsection ing
-Ġcandid osis
-Ġpor tions
-Ġpor osities
-Ġassign ing
-Ġur g
-Ġder otation
-Ġchlor amph
-Ġblock ers
-Ġblock age
-Ġpeak ed
-Ġstre aming
-ili aries
-Ġalter s
-Ġmis con
-Ġlin er
-Ġlater o
-Ġnucle ation
-Ġnucle oside
-oh ex
-Ġcompreh ension
-Ġinteraction al
-Ġmedi ating
-Ġnex tera
-Ġcam oufl
-Ġpf h
-Ġpf ms
-Ġpf de
-Ġwr inkled
-Ġanch ors
-Ġanch oring
-Ġinterview er
-Ġinterview ing
-Ġinterview ers
-Ġaccount ability
-Ġcre a
-Ġexplan ted
-Ġenti ties
-Ġsar pe
-Ġodont ocl
-Ġreconstr uctive
-Ġabund ances
-Ġcolle ges
-Ġoffic ers
-Ġincorpor ates
-the tical
-Ġextern ally
-Ġfal con
-Ġcard i
-Ġarr ive
-Ġrespir ators
-Ġsubstanti ate
-Ġann ounced
-Ġwound s
-Ġirregular ly
-Ġbal tic
-Ġnear by
-Ġconver t
-Ġlymph oid
-Ġprop r
-Ġdeb ond
-Ġdeb atable
-Ġtransm embr
-Ġrev is
-Ġrev olution
-Ġste adily
-Ġfacult ative
-Ġsummar ize
-Ġsubm ission
-Ġsod a
-Ġinequ ities
-Ġcovari ation
-Ġcovari ables
-10 1
-10 5
-Ġedent ate
-Ġcc g
-Ġcc w
-Ġcarcin omatosa
-Ġexpand ers
-Ġreproduc ed
-Ġequal s
-rs f
-Ġrs a
-Ġabnorm ally
-Ġtext bo
-Ġsubg ingivally
-Ġdecid ing
-Ġsegment ing
-zym e
-Ġcys teine
-Ġtnf rsf
-Ġvas oconstr
-bo ard
-Ġthin ning
-Ġthin nest
-Ġmap ks
-cha etes
-Ġ202 3
-Ġker at
-Ġbio activated
-Ġulcer ated
-Ġcoordin ated
-cet ti
-Ġsurround s
-Ġ200 8
-Ġindent er
-Ġden mark
-Ġden oted
-Ġden ticola
-Ġrp ds
-Ġcusp id
-Ġspread er
-Ġmembers hip
-Ġbis phenol
-Ġord ers
-Ġexc iting
-Ġagg l
-Ġspe akers
-Ġdil acer
-Ġemo tionally
-Ġprosthetic ally
-Ġpsor iatic
-Ġah rq
-Ġcav acami
-astom as
-Ġlock er
-Ġattr act
-Ġmacro economic
-Ġmacro scopically
-Ġharm ony
-Ġthor ac
-Ġretrie ve
-Ġretrie ving
-Ġtransform er
-Ġtransform ations
-Ġsulf onate
-Ġconc aten
-Ġucl a
-Ġappe aling
-Ġsplit ting
-Ġswe at
-Ġswe ets
-Ġben gha
-Ġurban ization
-Ġqualitative ly
-Ġconv inc
-Ġrt dc
-Ġcontain ers
-Ġauthor itative
-Ġwar rant
-Ġrepa iring
-Ġspectr al
-Ġelect roc
-sin ess
-Ġec cles
-Ġserious ly
-Ġphotograph er
-Ġphotograph ed
-Ġattain ing
-Ġmoti vated
-Ġactiv ators
-Ġphoto acoustic
-Ġscienti sts
-Ġnc bi
-Ġfif teen
-Ġuns pecified
-Ġuns uitable
-Ġgranul omatosis
-Ġtransf usion
-Ġprofil ometry
-rogen ase
-Ġobstr ucted
-Ġpseud o
-Ġpay ing
-Ġpay ments
-Ġexpect ation
-Ġquar ant
-Ġamelobl astomas
-Ġter tile
-Ġantic aries
-Ġantic oag
-Ġscar ring
-Ġfourth s
-Ġoccup ied
-Ġnanopartic le
-Ġglaz ed
-Ġple omorph
-Ġport ug
-Ġangi otens
-Ġadip ose
-Ġmethan ogen
-Ġmethan obrevibacter
-Ġnons yn
-Ġnons ignificant
-Ġimbal ances
-Ġkh an
-Ġsimpl icity
-Ġgluc onate
-Ġmt ls
-Ġbad ge
-Ġdiscrimin ative
-Ġoxygen ation
-Ġpharm acy
-Ġmoist ening
-Ġdiagn odent
-Ġhypomineral izations
-Ġnorth w
-Ġbul b
-Ġchrom atic
-Ġpathogenic ity
-Ġpersist ing
-Ġautom ate
-Ġpenetr ated
-Ġpenetr ating
-Ġtension s
-Ġmultic lass
-mm ol
-Ġdp ig
-Ġdisrup ting
-Ġunp ublished
-Ġmetagen ome
-Ġpromin ence
-Ġvalu ed
-Ġgram s
-ker atosis
-Ġintraoperative ly
-Ġexh aus
-Ġgovernment al
-Ġsenior ity
-Ġpig ment
-Ġren ewed
-Ġrich ness
-Ġendoc rine
-Ġendoc arditis
-Ġrefr ain
-Ġrefr act
-Ġpy thon
-Ġpy rophosphate
-Ġwors ens
-Ġexer ts
-Ġchew able
-Ġshar ply
-Ġsensor imotor
-Ġment ally
-Ġvsc s
-Ġprelimin arily
-Ġdistor ted
-Ġsemi quantit
-Ġaden ine
-Ġaden oma
-Ġsupr ac
-Ġoroph arynx
-Ġtruth s
-Ġunre li
-Ġmalform ed
-Ġimmig rant
-Ġosteop rogen
-Ġmesh mix
-Ġsustain ing
-Ġadministr ated
-Ġregul ator
-Ġjour ney
-Ġconfig ural
-Ġanticip atory
-Ġanthropometric s
-Ġtun el
-Ġventi l
-Ġcontamin ants
-Ġmeaningful ly
-Ġinaccur acy
-Ġant ofagasta
-Ġanonym ously
-Ġtoler ant
-Ġaspir ates
-Ġindustr y
-Ġindustr ially
-Ġinters ected
-Ġinters urface
-Ġprosth odontist
-Ġexception ally
-Ġhemat opoietic
-Ġts gh
-Ġglyc os
-Ġterti les
-Ġcorrobor ates
-Ġdele tion
-Ġpoin ting
-Ġsuppress ing
-Ġconflic ts
-Ġintraven ously
-Ġcollabor ate
-Ġcollabor ating
-Ġcorticoster oid
-Ġbeauti ful
-Ġsenti strength
-Ġoil s
-Ġfren um
-att ach
-Ġneu rop
-Ġaer uginosa
-Ġhapp ens
-Ġroll s
-Ġstir ring
-Ġnanos truct
-Ġenter ocolitis
-Ġign orance
-Ġaux iliaries
-Ġnb h
-Ġpresum ptive
-Ġrect us
-Ġgeneraliz able
-Ġsynch ondrosis
-Ġxen ografts
-Ġintim ately
-Ġmaf rs
-Ġcrop ping
-Ġtag s
-Ġsph ericity
-Ġfu rosemide
-Ġfer mentation
-Ġproce eded
-Ġadh ering
-Ġmicros omia
-Ġdissol ving
-Ġexacerb ation
-Ġexacerb ated
-Ġsial oprotein
-Ġpum a
-Ġhind ered
-Ġnit rogen
-Ġorific es
-Ġprocl ined
-opo lys
-opo lymer
-Ġrequest ing
-Ġguarant eed
-Ġodontobl ast
-Ġlys ed
-Ġgf b
-Ġcoinc idence
-Ġcoinc ides
-Ġcoinc ident
-Ġneo plasms
-Ġsubc ult
-Ġfirm ly
-Ġfraction al
-Ġfamiliar ity
-Ġworkflow s
-azol ium
-Ġmarking s
-Ġdocument ing
-Ġcada vers
-Ġmacrodes ign
-Ġacknowled ging
-Ġmbl s
-Ġbac cetti
-Ġlic ens
-Ġfort unately
-Ġexfoli ation
-Ġimag ine
-Ġheatm aps
-80 6
-onduc tor
-Ġopt g
-Ġdro plets
-Ġstv c
-Ġscl erotic
-Ġtrack ing
-Ġdiscontin uation
-Ġloose ly
-Ġlabor atories
-Ġniger ian
-26 4
-Ġsan itation
-Ġdt c
-Ġdum mer
-Ġdress ings
-Ġperic ard
-Ġreluct ant
-Ġenrich ment
-Ġju icy
-Ġcommit ment
-Ġdoub led
-Ġfluctu ation
-Ġbiofunctional ization
-Ġafflu ence
-Ġprovisional ized
-Ġprovisional ization
-Ġoss c
-Ġwel ded
-Ġbus iness
-Ġei ken
-trans plant
-trans ferase
-Ġcomput ations
-Ġphyl um
-Ġtaq man
-Ġultrason ically
-Ġafford ability
-Ġsubmuc osal
-Ġtanz anian
-yth ia
-Ġtil ting
-Ġstic ks
-enic ol
-Ġinex pensive
-ano ic
-Ġhon est
-Ġerb b
-Ġflush ed
-Ġverte bral
-Ġimmunore active
-Ġhyperch rom
-Ġcarboxyl ic
-Ġmigr atory
-Ġaggrav ated
-Ġaggrav ate
-Ġtel eradi
-Ġstock holm
-Ġnom inal
-Ġnom ogram
-Ġgather ing
-Ġneph rotic
-Ġunw illing
-Ġevol ving
-Ġcamp ylobacter
-Ġdynam ometer
-Ġvortex ed
-Ġcred ibility
-Ġatp ase
-Ġsevent y
-Ġinterp ol
-Ġune ventful
-Ġoutper forms
-Ġze al
-Ġhandicap ping
-Ġcaps id
-Ġcaps ule
-��polyphosph ate
-Ġcontribut ors
-Ġoverload ing
-Ġmetalloprotein ase
-Ġvapor ization
-Ġneighbour ing
-Ġneighbour hood
-Ġhb p
-Ġlum en
-Ġresor ptions
-Ġresor ptive
-Ġhepar inized
-Ġtriang ular
-Ġconflu ence
-Ġmultif unctional
-Ġiraq is
-Ġpolyol s
-Ġelev ator
-Ġslee ve
-Ġphosphory lated
-Ġdehyd rogenase
-Ġanaerob ically
-Ġdwell ings
-Ġkuwa it
-Ġobstac le
-46 8
-onucle ar
-Ġsort ase
-Ġcens ored
-Ġfc n
-Ġdog s
-Ġmich a
-Ġbub bles
-Ġbites trip
-Ġlob ene
-Ġhaemat oxylin
-Ġunin tentionally
-Ġamp icillin
-Ġtranspl ants
-Ġtranspl anted
-Ġglomer ular
-Ġhydrochlor ic
-Ġhydrochlor ide
-Ġmicrol iter
-Ġmicrol iters
-Ġconstitu ent
-Ġconstitu ents
-Ġrhyth m
-Ġpharmaceutical s
-Ġmoistur izer
-Ġcontradic ts
-Ġinactiv ate
-Ġdisappear ance
-Ġdispropor tionately
-Ġrhamnol ipid
-Ġrhamnol ipids
-Ġut m
-Ġspor ad
-Ġanim ation
-Ġdot ted
-Ġderm at
-Ġreevalu ation
-Ġhim self
-Ġvw cpre
-Ġexoc anthion
-Ġpropos al
-Ġatom s
-Ġseiz ures
-Ġadver tise
-Ġsurpass es
-Ġconsolid ated
-Ġunid imensional
-Ġken nedy
-Ġjia otong
-Ġminip ig
-Ġunderp in
-partic ip
-Ġflo ating
-Ġsegreg ation
-Ġbisphosph onates
-Ġamelior ate
-Ġargu ment
-Ġretrocl ination
-Ġsphen o
-Ġlncr nas
-Ġamphoter icin
-Ġmycobi ome
-fam il
-iqu it
-pyr idinium
-Ġthuring ia
-Ġsig moid
-Ġcts k
-Ġanesthes iologists
-Ġrech ecked
-Ġhots tart
-Ġell ip
-Ġfors ythia
-Ġconvention ally
-Ġalarm ing
-Ġdeple tion
-Ġmex ican
-Ġallopl asts
-Ġpole i
-Ġsuppl ies
-Ġintras ulcular
-Ġerg onomic
-Ġmultipl ication
-Ġmultilay er
-Ġsett led
-Ġpalis ading
-Ġcohere nce
-Ġxanth an
-meth ods
-Ġpreponder ance
-Ġmyco tic
-Ġhousekee per
-Ġhomo zyg
-Ġoffs pring
-Ġbreastf ed
-Ġsulph uric
-Ġmcn emar
-Ġdebilit ating
-Ġbioinform atics
-Ġpoliclin ic
-Ġembarr assed
-Ġprefect ure
-Ġdoubt ful
-Ġreshap ed
-Ġmanoeuv re
-Ġosteoinduc tive
-Ġthermocoup le
-elec tric
-rym al
-Ġthous and
-erad ish
-Ġcasc ade
-Ġmur ine
-Ġmors el
-Ġmens tr
-Ġmerc aptan
-Ġbib li
-Ġrecl ining
-Ġech o
-Ġlac un
-Ġnur ser
-Ġnad ir
-Ġgam ander
-Ġexem pl
-Ġpreb ent
-Ġdisartic ulation
-Ġseas onal
-Ġsurfact ants
-Ġinfar ction
-Ġregrow th
-Ġabdul aziz
-Ġinterr adicular
-Ġcontroll able
-Ġdecis ive
-Ġnoncont act
-Ġsupre me
-Ġtranscrip tional
-Ġdiure tics
-Ġfluoroph ores
-Ġsympos ium
-Ġhyperther mia
-Ġsemic onductor
-Ġmisclass ification
-Ġdivor ced
-Ġpetech iae
-Ġrenew al
-Ġadenoid itis
-hyd ration
-Ġnitr ide
-Ġbifid obacterium
-ydro xy
-Ġjuven ile
-Ġpolysomn ographic
-Ġrefriger ator
-Ġhyalur onic
-Ġautis m
-Ġcetyl pyridinium
-gov ina
-mand u
-vit amin
-Ġvelop h
-Ġtart u
-Ġthomm en
-Ġsass ari
-Ġsacr ific
-Ġott awa
-Ġcip rofl
-Ġcels ius
-Ġpater nal
-Ġpick ed
-Ġwgc na
-Ġanhu i
-Ġfuk uoka
-Ġferment able
-Ġfentan yl
-Ġdub lin
-Ġdbs np
-Ġdrow siness
-Ġdinucle otide
-Ġdobut amine
-Ġmilit ary
-Ġbare ly
-Ġbrom ide
-Ġrevascular ization
-Ġtoky o
-Ġhors eradish
-Ġeap d
-Ġeucl idean
-Ġstav udine
-Ġlach rymal
-Ġlank a
-Ġgree k
-Ġaspar tate
-Ġasyl um
-Ġcongl omer
-Ġaliph atic
-Ġwhate ver
-Ġproff it
-Ġresemb les
-Ġimmo b
-Ġshush tar
-Ġbetnes ol
-Ġheins g
-Ġheman giosis
-Ġscandina vian
-Ġcoex ist
-Ġinferi us
-Ġhawth orne
-Ġplung er
-Ġtrsk f
-Ġconspic uous
-Ġnoxi ous
-Ġrelaps es
-Ġnevir apine
-Ġcarisol v
-Ġintervie wees
-Ġkath mandu
-Ġweather ing
-Ġengraft ment
-Ġoverwh el
-Ġbiode gradation
-Ġcraw ford
-Ġbritt leness
-Ġspiro chaetes
-Ġjacc ard
-Ġmicrocontrol ler
-Ġzidov udine
-Ġrememb ered
-Ġremeas ured
-Ġremifentan il
-Ġmechanorecept ors
-Ġosteodent in
-Ġdahl berg
-Ġverhul st
-Ġcapsa icin
-Ġpolyethyl ene
-Ġautocl aved
-Ġretino ic
-Ġdigluc onate
-Ġfibron ectin
-Ġhyperpig mentation
-Ġhyperinten se
-omaxill ofacial
-Ġchemoradi otherapy
-Ġchemilum inescence
-Ġtuberc ul
-Ġmillilit ers
-Ġhemocyt ometer
-Ġherze govina
-Ġchloramph enicol
-Ġcamoufl age
-Ġtransmembr ane
-Ġtextbo oks
-Ġbengha zi
-Ġangiotens in
-Ġsemiquantit ative
-Ġmeshmix er
-Ġciprofl oxacin
-0 2
-0 6
-0 8
-0 50
-1 15
-3 1
-3 3
-3 5
-4 95
-5 92
-7 00
-9 6
-9 15
-? "
-a ut
-a ult
-a quer
-b ot
-b est
-b its
-b rew
-b ott
-b urg
-b ada
-b da
-c m
-c ip
-c ss
-d ex
-d ental
-d ah
-e al
-f ar
-f it
-f ur
-f ull
-f ibr
-f eedback
-f etamine
-f unctional
-g m
-g u
-g ar
-g ation
-g un
-g ated
-g ulation
-h g
-h il
-h ir
-h ouse
-i ess
-i ors
-j a
-j un
-j ah
-k r
-k in
-k ise
-k etone
-k umar
-k tsson
-k elle
-l on
-l if
-l ity
-l of
-l odent
-l oxacin
-m ineral
-m itted
-n um
-n ary
-n ase
-n ace
-o e
-o ac
-o lec
-o vation
-o active
-o lytic
-o epithelial
-p us
-p el
-p ad
-p ore
-p athetic
-r ib
-r ight
-r ont
-s is
-s ing
-s cribed
-t om
-t ail
-v in
-v ents
-v ital
-w ar
-w ig
-w ered
-y i
-y ama
-z m
-z p
-z ing
-z el
-z ade
-Ġt y
-Ġt us
-Ġt am
-Ġt and
-Ġt ures
-Ġt iter
-Ġt estim
-Ġt ps
-Ġt bs
-Ġt roph
-Ġt read
-Ġt de
-Ġt iring
-Ġt zp
-in an
-in ent
-in ting
-in ct
-in ates
-in ization
-in formation
-Ġa y
-Ġa th
-Ġa us
-Ġa tr
-Ġa vid
-Ġa cellular
-re en
-re ds
-re ktsson
-Ġth i
-on i
-on in
-on od
-on ials
-Ġs ab
-Ġs age
-Ġs ight
-Ġs yp
-Ġs ak
-ti tion
-ti tive
-ti ans
-Ġo ad
-Ġo est
-Ġo int
-Ġo ught
-Ġo lymp
-Ġo phthal
-Ġo mega
-en i
-en n
-en able
-en oid
-en osis
-al al
-al tered
-er r
-er us
-er ont
-Ġc ac
-Ġc olog
-Ġc ared
-ed e
-ed es
-ed ent
-ed ral
-ed dah
-Ġp ore
-Ġp em
-Ġp cc
-Ġp ages
-Ġp co
-Ġp ink
-Ġp cs
-Ġp edic
-Ġp bst
-Ġp lymp
-Ġw s
-Ġw ore
-Ġw ist
-Ġw rap
-Ġw art
-Ġw ished
-Ġw atch
-Ġw inb
-Ġin ac
-Ġin ad
-Ġin val
-Ġin so
-Ġin valu
-Ġin vention
-Ġin ward
-Ġin ert
-Ġin activity
-Ġin lays
-Ġin ferential
-es e
-es ophageal
-Ġan amn
-Ġf ight
-Ġf ag
-Ġf dp
-Ġd q
-Ġd op
-Ġd ust
-Ġd ying
-Ġd iph
-Ġd yes
-Ġd ermal
-Ġm v
-Ġm ond
-Ġm atic
-Ġm ics
-Ġm ening
-Ġm ule
-Ġm els
-Ġm hc
-at ne
-or ient
-th el
-th ree
-an ic
-an im
-an cerous
-an chi
-Ġand es
-Ġand rogen
-Ġb ent
-Ġb ip
-Ġb act
-Ġb ell
-Ġb low
-Ġb isc
-Ġb ah
-Ġb acill
-Ġb oli
-Ġb amp
-Ġb attle
-Ġb ullous
-Ġb cip
-is ser
-is ites
-as ible
-ent uated
-ic c
-ic ul
-ic king
-ic tor
-ic ochemical
-ing ive
-ing ke
-ar n
-ar aldehyde
-Ġre ade
-Ġre ward
-Ġre ps
-Ġre app
-Ġre wards
-Ġre kn
-Ġre bound
-Ġre hydration
-Ġre orient
-Ġto cant
-Ġh its
-Ġh of
-Ġh ung
-Ġh ci
-Ġh urt
-Ġh inder
-le ading
-Ġe b
-Ġe ub
-Ġe uk
-Ġe ager
-it z
-it ory
-it ability
-it our
-us es
-Ġst ew
-Ġst ake
-Ġst aged
-Ġst ories
-Ġst enosis
-ere ll
-ere bral
-ul u
-ul sion
-ul ates
-ul onod
-ac cha
-ec d
-ec k
-ec y
-ec are
-ec tive
-ec ological
-ec onomics
-Ġl id
-Ġl und
-Ġl ose
-Ġl ag
-Ġl ane
-Ġl ux
-Ġl ights
-Ġl atin
-Ġl ci
-Ġl umina
-om ies
-om olar
-om onic
-om eration
-Ġn x
-Ġn ti
-Ġn oc
-Ġn ish
-Ġn yl
-Ġn ice
-Ġn ened
-Ġn othing
-Ġn anda
-im er
-im etic
-Ġg os
-Ġg ad
-Ġg ip
-Ġg est
-Ġg one
-Ġg ases
-Ġg cc
-Ġg ust
-Ġg ung
-Ġg ames
-Ġg arb
-Ġg ini
-Ġg sea
-Ġg eront
-Ġg ingive
-ly cemia
-ur u
-ur ich
-ur man
-ur nal
-ig ent
-ig oid
-et o
-et able
-et ers
-os i
-os oph
-os urgery
-os accharides
-ce in
-ce ment
-if acial
-Ġfor ums
-ol er
-ol ateral
-ol itical
-Ġas a
-Ġas ide
-Ġas cribed
-il le
-il im
-il ot
-il and
-il ia
-Ġcon ges
-Ġcon ferences
-Ġcon ometrically
-od en
-od ec
-od ak
-od entistry
-id ene
-id yl
-id ays
-id rosis
-Ġon s
-ati vity
-ati lity
-Ġor f
-Ġor n
-Ġor bit
-un i
-am ped
-am fetamine
-Ġv erm
-Ġv acc
-Ġv ials
-Ġv bmt
-Ġv enham
-Ġv icious
-Ġv inyl
-Ġv oting
-el or
-el is
-el ly
-ter one
-Ġal oe
-Ġper iv
-Ġper lodent
-Ġr ip
-Ġr go
-Ġr fe
-Ġr nas
-Ġr nase
-Ġwh i
-Ġex ons
-Ġex ak
-Ġpro ges
-Ġpro ving
-Ġpro position
-Ġpro drom
-Ġpro poses
-Ġpro gnathic
-Ġres tr
-Ġres ting
-Ġres ized
-Ġres izing
-Ġres erve
-Ġres embled
-Ġbe ating
-tr on
-tr an
-tr itis
-ot ted
-ot gun
-Ġim itate
-Ġis ced
-Ġis oprop
-ad ione
-ut oy
-ut down
-ver t
-ver sion
-Ġus d
-Ġus eless
-oc in
-oc ys
-oc cus
-oc ortic
-qu ick
-qu ilibrium
-qu oise
-iz uoka
-Ġch im
-Ġch ap
-Ġde ft
-Ġde press
-Ġde als
-Ġde oxy
-ain t
-um a
-pl er
-pl ate
-pl int
-pl ained
-pl asty
-Ġme i
-Ġby pass
-Ġby produc
-Ġat op
-Ġac r
-Ġac ted
-Ġac ta
-Ġac oustic
-ys cale
-ys eal
-Ġcomp utation
-og reen
-Ġse q
-Ġse leg
-Ġsh in
-Ġsh aker
-Ġsh utdown
-Ġsh izuoka
-ap ers
-ap ascal
-oth ermal
-are r
-feren t
-Ġhe x
-Ġhe ar
-Ġhe mi
-Ġhe pati
-Ġhe aring
-Ġhe brew
-Ġass ure
-Ġass emb
-Ġcl oth
-Ġcl ues
-Ġcl ots
-Ġcl icking
-rom eter
-and oned
-Ġare ep
-Ġtw ins
-Ġtw itter
-Ġma z
-Ġma iled
-op ause
-op io
-op enia
-op olitical
-odon t
-we igh
-em ics
-em entia
-Ġsc ent
-Ġsc ass
-Ġtwo fold
-Ġap ert
-Ġco at
-Ġco hes
-Ġind ist
-Ġle ather
-Ġle thal
-Ġle ica
-Ġsur vi
-orm ous
-Ġsize able
-ub ba
-Ġnot ation
-ary otes
-est ine
-est abl
-se e
-Ġcan adi
-Ġpar aker
-Ġpos ed
-Ġpos es
-Ġpos ing
-st rom
-st ep
-ee zing
-Ġinf ested
-per cent
-Ġha us
-ari an
-Ġpl s
-Ġpl asty
-Ġall o
-ong k
-Ġperiodon tic
-ase b
-ill a
-ill ion
-Ġro is
-Ġro ad
-Ġro tor
-Ġtr acts
-Ġmod ulated
-Ġmod ulates
-ach ie
-cl ines
-cl onal
-cl osed
-Ġob e
-Ġacc red
-Ġacc entuated
-ges ic
-Ġno ur
-Ġno hes
-Ġno va
-Ġno bel
-Ġsam i
-Ġrec olon
-Ġrel u
-Ġne isser
-Ġcar ds
-Ġab c
-Ġab l
-Ġab us
-Ġab andoned
-Ġclin dam
-ight ened
-Ġsub com
-Ġinter position
-Ġinter fered
-Ġinter acting
-Ġinter stage
-Ġthere of
-Ġthere for
-Ġdat es
-Ġdat ing
-Ġqu asi
-Ġun il
-Ġun ans
-Ġun pro
-Ġun fe
-Ġun load
-Ġun loaded
-Ġun no
-Ġun filled
-Ġun weighted
-Ġun altered
-Ġint oler
-ay ing
-Ġy ap
-Ġy osh
-Ġam az
-Ġam enable
-ens itis
-ard i
-ard ation
-ard ized
-ven tional
-ven ience
-Ġk m
-Ġk et
-Ġk el
-Ġk ir
-Ġk mo
-Ġk not
-Ġk odak
-Ġval ve
-olog ized
-Ġwe in
-ans en
-atis m
-pro lif
-Ġpresent ly
-ost at
-Ġen qu
-Ġen ormous
-Ġhad s
-Ġfol ic
-rol ateral
-rol ins
-rol ina
-Ġgen io
-Ġgen itour
-Ġpartic ulate
-Ġage usia
-Ġassess able
-Ġtim er
-Ġtim ings
-Ġtim etable
-Ġperform s
-ph ot
-Ġout puts
-Ġout weigh
-Ġsuc c
-gn etic
-Ġspec ulation
-Ġspec ifying
-Ġcor ds
-Ġmeth ohex
-Ġdes k
-Ġdes cent
-Ġdes kt
-Ġdes ensitis
-Ġso y
-Ġar k
-Ġar gue
-amin ated
-amin ase
-amin ogly
-ile ps
-Ġinv ade
-Ġinv iting
-Ġinv ulner
-Ġinv aded
-Ġmed cal
-Ġmed ially
-��max d
-Ġmax ilim
-Ġph aryng
-Ġover lying
-Ġover filled
-Ġover hang
-Ġbi ogen
-Ġbi odent
-Ġbi oseal
-Ġbi ologized
-Ġcell plus
-Ġcol onic
-Ġcol linearity
-lu tition
-Ġtime points
-Ġdec ent
-Ġdec imal
-Ġdec oron
-Ġcr anium
-Ġcr imes
-Ġcr ypt
-Ġag b
-adi ol
-Ġstr aw
-Ġstr ingent
-Ġdise quilibrium
-Ġbr idged
-Ġund ec
-Ġund etermined
-Ġund etected
-Ġdia gonal
-ag as
-Ġman ne
-Ġman ik
-Ġman agers
-Ġnon static
-ric ular
-Ġdisc ard
-Ġdisc ord
-Ġgener ator
-Ġdef ence
-Ġdef ines
-Ġdef ault
-Ġsp ar
-Ġsp illover
-Ġj unctional
-Ġj uris
-Ġj iang
-Ġj inan
-Ġj alal
-Ġj eddah
-Ġfur nace
-Ġcare t
-Ġmicro invasive
-Ġmicro partic
-Ġmicro array
-Ġmicro porosity
-Ġcomm and
-oun cing
-Ġhy gro
-na i
-Ġmand all
-Ġprob abil
-Ġbec lin
-Ġi oc
-Ġmal position
-que faction
-Ġform ations
-Ġform ulating
-Ġop ens
-Ġop tional
-Ġop pose
-Ġop acity
-Ġop aquer
-Ġdi en
-Ġdi etic
-Ġdi ets
-Ġdi urnal
-uth an
-Ġcur ry
-Ġcur tail
-Ġgr ain
-Ġgr ace
-Ġgr iess
-fic ially
-Ġli quefaction
-Ġsal ary
-Ġunder to
-Ġcharacter isation
-Ġimp uted
-Ġimp eded
-tor ies
-Ġpost age
-Ġconf ine
-Ġconf using
-Ġconf ront
-Ġprim ing
-Ġser b
-Ġser ver
-Ġser ving
-Ġrelated ness
-Ġstat utory
-Ġvis ibly
-Ġmon o
-Ġmon obl
-Ġmon ochrom
-Ġmon etary
-Ġbl t
-Ġbl ades
-Ġbl adder
-Ġbl anks
-Ġem a
-Ġem ilia
-Ġintr on
-Ġ0 75
-vers ibly
-Ġz h
-Ġz ip
-Ġz ulu
-Ġz urich
-Ġsaliv ation
-Ġer ics
-Ġmain stream
-Ġinvestig ative
-Ġquestion ing
-Ġless ening
-Ġsoft en
-Ġdr af
-Ġdr ives
-Ġdr ift
-Ġend uring
-Ġend odontists
-Ġca is
-Ġca rolina
-Ġcharacteristic ally
-Ġinfl ation
-Ġloc king
-arg eted
-Ġel usive
-ie th
-Ġsome one
-Ġfr anchi
-Ġcent red
-Ġincis ed
-ption ist
-Ġterm inated
-Ġcle ared
-Ġcle aved
-Ġcle arer
-Ġinflu enza
-ob ullous
-Ġid a
-Ġexpl o
-Ġexpl ants
-Ġgeneral ised
-Ġgeneral isability
-Ġsm r
-ateg ories
-Ġins ure
-Ġins ult
-Ġins ults
-Ġdesign ation
-Ġimm ense
-Ġsch iff
-Ġdo or
-Ġscal pel
-Ġii ib
-Ġprocess or
-Ġcy ano
-Ġrece ives
-Ġrece ptive
-Ġrece ptionist
-Ġneg ate
-Ġneg oti
-Ġsit af
-Ġprot otypes
-Ġrequ isite
-Ġmouth ful
-Ġmouth rin
-inal is
-Ġpot enti
-Ġpot osi
-Ġpath ogn
-Ġoper ate
-Ġoper ates
-Ġspecific s
-Ġanti hy
-Ġanti oxid
-Ġunivers iti
-Ġos tia
-Ġpe king
-Ġstruct urally
-Ġstrength ens
-of ol
-yl ene
-Ġfem oral
-Ġidentif iers
-io id
-Ġlo ops
-Ġlo hs
-Ġgu ess
-Ġes thetical
-Ġes kise
-Ġfl ash
-over sion
-Ġoste otomized
-Ġiniti ates
-Ġiniti ator
-Ġiniti atives
-Ġfail s
-Ġcaus ation
-Ġprof use
-ox amer
-Ġintra osseous
-Ġintra famil
-Ġpul s
-Ġsl b
-Ġsl p
-Ġsl ur
-Ġsl ab
-Ġsl ider
-Ġsl abs
-Ġang ulated
-Ġhyp ot
-Ġhyp erelastic
-Ġlead ers
-cess ible
-Ġcomb at
-Ġver a
-Ġmat tress
-ri tic
-ri ans
-Ġanaly te
-Ġphys icochemical
-Ġep och
-Ġep ileps
-av ail
-Ġconsist encies
-Ġhard ening
-Ġsoci ological
-Ġproduc tive
-Ġproduc tivity
-Ġred irec
-Ġrepresent atives
-Ġcontr ac
-Ġcontr act
-Ġcontr actions
-Ġwater line
-Ġpart ners
-Ġliter atures
-Ġfluor oh
-sc al
-sc ore
-sc atter
-Ġcompl ained
-Ġcompl iers
-Ġcompl icates
-Ġanalyz es
-Ġprov isions
-Ġalign ments
-Ġcross l
-Ġcross ing
-Ġacid ification
-Ġacid uric
-Ġref us
-Ġhum erus
-Ġmid facial
-Ġmid lines
-Ġpers ists
-Ġwid ening
-Ġwid ened
-Ġpoly g
-Ġpoly cr
-Ġpoly acryl
-Ġpoly clonal
-Ġsu kumar
-Ġsym biotic
-Ġsym pathetic
-Ġeven ing
-Ġpa ve
-Ġext ubation
-Ġext ensor
-pe tiform
-Ġlab i
-Ġlab our
-Ġlab eller
-Ġpap ulonod
-Ġmicrob e
-omm un
-Ġsequ ela
-Ġwhe el
-Ġaut ografts
-Ġhel per
-Ġhel ix
-Ġsinus oidal
-Ġret reat
-Ġret ested
-Ġret ardation
-Ġhab ib
-Ġlight ly
-Ġlight weight
-Ġlight fast
-Ġfract ographic
-Ġdentin o
-Ġdentin ogenesis
-vir atne
-Ġimmun ocyt
-Ġperman ently
-Ġperman ova
-Ġrecomm ending
-Ġmen u
-Ġmen adione
-Ġmen opause
-Ġeff lux
-Ġapproach ed
-Ġapproach ing
-Ġsw ell
-Ġsyn th
-Ġsyn onymous
-Ġhuman ization
-Ġdeg lutition
-ind ividual
-Ġprom ises
-omy cin
-Ġintern ally
-Ġcontin ents
-Ġcontin ual
-Ġnormal ize
-Ġnormal isation
-Ġta iz
-Ġfib res
-Ġdifferenti ally
-ih am
-Ġcoh en
-Ġfear ful
-Ġprote ases
-Ġeffic acies
-Ġprec urs
-Ġprec ancerous
-Ġrot ates
-Ġhal ve
-Ġhal ting
-Ġhal ide
-Ġhal imeter
-Ġsatis fying
-Ġhyper plastic
-Ġwork load
-Ġcp q
-Ġ7 4
-Ġ7 00
-Ġelec tive
-Ġconstr ains
-Ġcari ogenesis
-Ġcontact able
-Ġbiom olec
-Ġbiom imetic
-roph izing
-Ġunders ampling
-Ġunders erved
-Ġspl icing
-Ġdel t
-Ġdel amination
-Ġdel aire
-Ġinduc tive
-Ġmorph ogenesis
-az zi
-Ġpsych ology
-Ġpress urized
-ros ine
-Ġrough er
-Ġpur ify
-Ġpur su
-Ġnine ties
-Ġreflec tivity
-Ġsumm ation
-Ġfil aments
-Ġmaxilla e
-Ġutil ising
-ov sky
-Ġx ception
-Ġlip opolys
-Ġconnec t
-Ġchem omechanical
-Ġapproxim ations
-Ġconsum er
-Ġback scatter
-Ġproportion ally
-bl adder
-Ġpol oxamer
-Ġview point
-Ġepithel ioid
-Ġshort age
-Ġpower point
-Ġunderstand able
-Ġwa fer
-Ġseem ingly
-Ġattrib ute
-Ġphot on
-Ġphot ographic
-Ġphot opolymer
-Ġphot othermal
-Ġdigital ization
-Ġms ls
-Ġbre akage
-Ġtop ically
-Ġtop fa
-Ġtop ographical
-Ġrecur red
-Ġrecur rences
-Ġarti fact
-otyp ed
-hold ers
-Ġsn mp
-Ġcd b
-Ġcoll aps
-Ġcoll apsed
-Ġcoll oidal
-com p
-Ġplate aus
-Ġpen g
-Ġpen ins
-Ġbar zeh
-Ġbar thel
-Ġconsent ing
-Ġprotein uria
-Ġill icit
-Ġevery one
-Ġprep ubertal
-Ġincub ate
-Ġstrateg ic
-orb ic
-Ġten ding
-Ġtransl ating
-Ġtransl atory
-Ġtransl ator
-Ġdepartment al
-Ġpneum atization
-Ġreal ize
-Ġorgan ised
-Ġorgan izations
-pre vious
-drom ic
-Ġapex ification
-Ġread mitted
-Ġmild ly
-Ġheter otrophic
-Ġbur n
-Ġbur ning
-Ġbur dens
-Ġsyndrom al
-Ġful fil
-Ġdam ping
-Ġrepl icated
-Ġrepl aces
-Ġge opolitical
-Ġopen bite
-Ġmy od
-Ġmy ocard
-Ġmy oepithelial
-Ġerup tions
-Ġcut ter
-plas ma
-Ġmr nas
-Ġirradi ate
-Ġirradi ating
-Ġinvasive ly
-air s
-Ġexist ent
-Ġsem iland
-Ġanatom ies
-Ġanatom age
-Ġinstit utes
-Ġhem ifacial
-Ġregen erated
-Ġpand emics
-roc yte
-Ġpapill itis
-Ġdebr ided
-Ġmedic aid
-Ġinterpre table
-Ġq i
-Ġq ias
-Ġve ter
-Ġlate x
-Ġquanti fiable
-Ġmar sh
-Ġhom emakers
-Ġhom ecare
-Ġmach ines
-Ġmach ining
-Ġcand ies
-Ġadequ acy
-Ġher bst
-Ġher petiform
-Ġtur quoise
-Ġadap ters
-Ġpor tr
-Ġdown wards
-Ġassign ments
-Ġ19 6
-cp ost
-Ġder ks
-Ġder angement
-Ġenrol ling
-Ġeng ines
-Ġent rap
-Ġent rapped
-Ġdl m
-Ġgerm inal
-Ġvirt ue
-Ġrc u
-Ġmis ch
-Ġmis leading
-Ġlater ality
-Ġnucle otid
-Ġsa ud
-Ġrecogn ised
-Ġrecogn izable
-Ġglass es
-oh y
-Ġretr ained
-Ġcompreh ens
-Ġdecl are
-Ġiv s
-Ġaff airs
-Ġcarb amide
-Ġmedi ates
-Ġeuro cat
-Ġcam pan
-for ce
-Ġorigin ating
-Ġpf oa
-Ġpf ua
-Ġwr ite
-Ġdemineral ize
-Ġprognos es
-Ġfore arm
-Ġfore ground
-Ġfore going
-Ġepid ermal
-gg a
-gg t
-Ġpp m
-Ġnumer ator
-Ġmonom eric
-Ġalloc ating
-Ġkey word
-Ġaesthetic ally
-Ġeti opath
-Ġeti ologic
-Ġpromo ter
-Ġ12 0
-Ġ12 4
-Ġviol ations
-Ġcolon ize
-Ġcolon izers
-Ġperson ally
-Ġindepend ency
-Ġarr iving
-Ġmetastasis ing
-Ġmc as
-olith s
-Ġga ug
-Ġshe kelle
-Ġshe iham
-Ġprin ters
-Ġorthodon tia
-ymph ony
-Ġsept ate
-Ġlact ams
-put able
-Ġlymph ad
-Ġprop elled
-Ġprop ofol
-Ġqual ify
-Ġqual ifications
-Ġameric ans
-Ġapproval s
-Ġtransm it
-Ġip ac
-Ġsd f
-Ġinj ured
-Ġprojec ting
-ococ cal
-Ġpool s
-Ġscrew ed
-Ġopening s
-Ġsubstit uted
-Ġbeg ging
-Ġrepro duce
-Ġrecall ing
-Ġblind ly
-Ġinequ ity
-Ġnutr ient
-Ġinferior ity
-Ġcall ing
-Ġexperiment ation
-Ġtherapeutic s
-Ġcc d
-Ġcv s
-Ġhere after
-Ġdiffer ing
-Ġcarcin ogenesis
-Ġeros ions
-Ġgold en
-Ġgold enh
-Ġcollagen ases
-Ġalb rektsson
-Ġcognitive ly
-Ġtext ual
-Ġtext uring
-Ġtom es
-Ġtom ograms
-Ġabras ives
-Ġfabric ating
-Ġremineral ize
-Ġremineral ise
-Ġcircum scribed
-Ġtherm omechanical
-Ġig m
-Ġretain s
-Ġdeli vers
-Ġdegrad ed
-Ġvas oactive
-Ġthin king
-Ġmap ped
-Ġdrop ping
-Ġincom pet
-Ġsut uring
-Ġana esthetic
-Ġana emia
-Ġstatic ally
-dl ers
-Ġposts urgical
-Ġjud ging
-Ġcoordin ating
-Ġnh s
-Ġwire frame
-Ġexclud es
-Ġdisp ase
-Ġteam work
-Ġgraph ical
-Ġgraph pad
-Ġgre yscale
-Ġamino transferase
-Ġsilic o
-Ġls d
-Ġboard s
-inf ection
-Ġpolic ym
-rup tion
-Ġuc i
-Ġuc sc
-Ġsound ing
-Ġcav itations
-lect omy
-Ġcarbon yl
-Ġassist ants
-Ġmacro vascular
-Ġsy rup
-Ġsy rians
-Ġirrig ate
-Ġexcessive ly
-Ġpredom inated
-Ġpredom inate
-Ġretur ning
-Ġretur ns
-Ġmad rid
-Ġvs mp
-Ġadhere s
-Ġimpair ing
-Ġbreat he
-Ġpreser ves
-Ġhistopathological ly
-Ġkeratin ization
-Ġom itted
-Ġom itting
-Ġom bada
-Ġrein ser
-Ġvascular ization
-Ġnarrow ed
-Ġlockdown s
-Ġconc urs
-Ġcurv atures
-Ġdichotom ously
-Ġperpendicular ly
-Ġimmunohist ological
-Ġpu ros
-Ġmel d
-Ġmel t
-Ġbcl p
-Ġupr ighter
-Ġextra orally
-Ġsmooth ened
-Ġinstitutional ized
-Ġben j
-Ġ14 4
-Ġborder lines
-Ġaccompan y
-ae i
-Ġcompound ed
-press ants
-Ġauthor ized
-Ġaustr ia
-Ġwar ts
-Ġwar time
-Ġwhit ened
-Ġcham fer
-Ġdetermin ations
-Ġpdl cs
-Ġwave one
-Ġwave forms
-Ġion ic
-Ġovere ruption
-Ġcath eter
-Ġfast est
-Ġfast ai
-Ġstabil ised
-Ġstabil izing
-Ġdisag rees
-Ġupreg ulate
-Ġmoti ves
-au er
-Ġpolymorph onuclear
-Ġtetr agonal
-Ġtetr azolium
-Ġhar assment
-Ġhol idays
-Ġgas tritis
-Ġperm ut
-Ġpercenti les
-Ġquad r
-Ġmyop ic
-ah l
-ah edral
-Ġcit ations
-Ġground s
-Ġow ed
-Ġhr v
-Ġconstit uting
-Ġconstit utive
-Ġobstr uctions
-Ġouts et
-bor n
-bor hood
-Ġsen escence
-Ġstop ping
-Ġsubstr uct
-Ġeryth romycin
-Ġter at
-Ġstom ach
-Ġvar imax
-Ġ18 1
-Ġoccup ations
-Ġprotec ting
-Ġing a
-Ġscr ut
-Ġscr ip
-Ġscr atching
-Ġcontrovers ies
-Ġround s
-Ġmorb id
-Ġpronounced ly
-Ġdim eric
-Ġleg ion
-Ġmethan ol
-eptid es
-Ġirre versibly
-Ġsuperv ise
-onas al
-app iness
-Ġuniform ity
-Ġcortic otomy
-Ġfulfill ing
-tg tc
-Ġkh at
-Ġdeterior ates
-Ġsimpl est
-Ġsimpl ify
-Ġspr ayed
-Ġgluc ocortic
-Ġequival ents
-Ġexpress ers
-can y
-Ġauc s
-Ġanth ro
-Ġanter o
-Ġunderestim ating
-Ġdiscrimin atory
-Ġtox in
-cell ulose
-Ġmatch es
-Ġbitewing s
-Ġmit utoy
-Ġdisinf ecting
-Ġ15 7
-Ġpenetr ance
-Ġliquid s
-Ġdc nn
-rose al
-Ġever ted
-Ġunp olymer
-Ġencod ed
-��mf i
-Ġmotor cy
-Ġtough ening
-Ġdisil icates
-Ġkind ly
-Ġformer ly
-Ġzyg oma
-Ġimmunos orbent
-Ġmelan omas
-Ġure mic
-Ġib ge
-Ġhu ang
-acryl ates
-Ġgradi ents
-Ġmillim etric
-Ġtetracy clines
-Ġplatform s
-74 2
-bi ased
-Ġdos ages
-Ġconce ption
-Ġconce ived
-Ġconce ivable
-Ġperfor ated
-Ġexerc ises
-Ġdiscl ose
-Ġyellow ish
-Ġspan ning
-Ġspan ned
-Ġhygien ic
-Ġhemis ections
-Ġembed ding
-Ġud esign
-Ġpig mented
-Ġclock s
-Ġneuro psych
-Ġneuro feedback
-Ġcariogenic ity
-Ġimmunosup pressed
-Ġrom agn
-Ġhund reds
-Ġshar jah
-Ġflav or
-Ġchron odentistry
-Ġbreak s
-Ġtan n
-Ġtan zo
-Ġtan aka
-Ġrb t
-Ġresorb ing
-Ġdistor otation
-Ġaden osine
-Ġregister ing
-Ġspot ted
-Ġfrag ile
-Ġaggreg ates
-95 6
-Ġomd urman
-Ġcel ik
-Ġdeal t
-Ġunre paired
-Ġdecom pens
-Ġmesh ing
-Ġallevi ated
-Ġbm ms
-Ġinvag inatus
-Ġcrack ing
-Ġdistinguish es
-Ġanticip ate
-fr action
-Ġtun is
-Ġfix ing
-Ġmess aging
-Ġla un
-Ġventi lated
-Ġcontamin ations
-Ġcontour s
-Ġhypersens itive
-Ġfus obacteria
-Ġded uc
-Ġtoler ate
-Ġinters ti
-Ġblast n
-Ġblast x
-Ġhemat ologic
-Ġpharmac ists
-Ġts ads
-Ġts ingke
-Ġdimin ishing
-Ġconve y
-Ġconve yed
-Ġka rolins
-Ġdisturb ed
-Ġdisturb ing
-Ġmicrom o
-Ġglyc ol
-Ġinn ovation
-Ġlav age
-Ġdele ting
-iph il
-Ġenvelop ed
-Ġsuppress or
-Ġsynerg ism
-Ġthermo forming
-Ġsenti ments
-Ġvap ors
-Ġneigh borhood
-Ġwax ing
-Ġlubric ants
-Ġsonic fill
-Ġht css
-Ġgross ly
-Ġroll ing
-Ġunco operative
-oste en
-Ġcalip ers
-Ġcylind ers
-Ġcapital s
-Ġdupl ication
-Ġdutch cleft
-Ġsand paper
-Ġpic rust
-Ġpic ogreen
-Ġmart ins
-Ġnb t
-Ġbacteri ostatic
-Ġimmunological ly
-Ġskull s
-Ġrepeat able
-Ġheterozyg ote
-Ġtang ency
-Ġbath room
-Ġlll i
-udd in
-Ġonc ogene
-Ġvent ed
-Ġvent rolateral
-Ġcompens ations
-Ġcompens atory
-Ġsubtr acted
-Ġunex plained
-Ġdiver gent
-Ġpathf inder
-Ġsharp ness
-Ġtu ft
-Ġfer rans
-Ġexec ute
-Ġmeg apascal
-Ġinterrup tion
-Ġupd ates
-Ġencoun ters
-Ġcolumn ar
-Ġgastro esophageal
-Ġsun light
-Ġsial ometry
-Ġcatal ase
-Ġhind ers
-Ġvic inity
-Ġrab bits
-Ġcloud s
-Ġcoop erate
-Ġuncom plicated
-Ġfibrin ogen
-Ġunsatis fied
-14 6
-Ġaap d
-Ġculti vated
-Ġdd wr
-Ġbed s
-Ġlys ol
-Ġlys ate
-Ġincon venience
-Ġdispar ate
-Ġarres ts
-Ġarres ting
-Ġcerti fic
-Ġhyperl ink
-Ġnecessit ating
-Ġcdc m
-Ġintermedi ary
-Ġaeti ologies
-Ġindustrial ised
-Ġrectang les
-Ġvacu olated
-Ġtb st
-Ġbac rep
-Ġaccid ental
-Ġinterfere s
-Ġsoon er
-Ġarte fact
-Ġiod ide
-Ġexcav ator
-Ġmotiv ating
-Ġscarce ly
-Ġpiez osurgery
-Ġpip ed
-Ġpip etting
-Ġwal d
-Ġlr b
-Ġhaem ost
-Ġdownreg ulation
-Ġempir ically
-Ġpermission s
-Ġsandbl asted
-Ġaver aging
-Ġdum mar
-imb ili
-Ġdev ised
-Ġinfra occlusion
-Ġku opio
-Ġbran ches
-Ġmang osteen
-Ġmicrostruct ural
-Ġemer ges
-Ġdoub ts
-Ġprotozo a
-Ġguard ian
-Ġfluctu ates
-Ġpurch ase
-Ġhydrophobic ity
-Ġdimer ization
-Ġmulticent re
-Ġantagon ists
-Ġbenchmark s
-Ġtell s
-Ġthal idom
-Ġpir d
-Ġascertain ment
-Ġalve oli
-Ġperp et
-Ġcomment ers
-Ġindones ian
-Ġidi omatic
-Ġarchae al
-Ġafford able
-Ġsubmuc osa
-Ġcatast rophizing
-Ġstic k
-Ġsore ness
-Ġpes a
-Ġreass urance
-osc opy
-Ġresc ued
-Ġprerequ isites
-Ġinfrequ ently
-Ġnepal ese
-Ġquin tile
-Ġsecure ly
-Ġcalvar ia
-Ġdiscre tion
-Ġnegl igence
-Ġglycer in
-Ġglycer ophosphate
-Ġjudg ments
-Ġbiosurfact ants
-Ġbifur c
-Ġaggrav ation
-Ġaz ithromycin
-Ġson ography
-Ġanesthetic s
-Ġmio h
-Ġba uru
-Ġtouch ed
-Ġeye lets
-Ġlam bda
-Ġves icul
-Ġrug a
-Ġhapl otypes
-Ġweigh ing
-Ġinvest ment
-Ġbiot in
-Ġmanager ials
-Ġjord anian
-Ġminipl ate
-Ġtransduc tion
-Ġethyl ene
-Ġpolys iloxane
-Ġeston ians
-Ġundersc ore
-Ġsteril izer
-Ġprevail ing
-Ġcollaborative ly
-Ġost ectomy
-Ġcred ible
-Ġmist akes
-Ġek g
-Ġchen nai
-Ġchat bot
-Ġatyp ia
-Ġpreclud es
-Ġcovers l
-Ġparas it
-Ġinterp olated
-Ġimped ance
-Ġerad ication
-Ġerad icated
-Ġnecro tising
-Ġaddic tive
-Ġcontribut or
-Ġcontribut ory
-Ġhypert rophy
-Ġraj a
-Ġtradition s
-Ġnarr atives
-Ġosteoconduc tion
-Ġorthopantom ogram
-Ġorthopantom ography
-Ġbicusp ids
-Ġrefrig eration
-Ġdiminish es
-Ġoblig ations
-Ġvapor izer
-Ġaerosol s
-Ġanton ovsky
-Ġmpi i
-there fore
-Ġreper cussion
-Ġhered ity
-Ġgarg le
-Ġdex terity
-Ġtriang le
-Ġamoun ting
-Ġkar achi
-Ġweaken ed
-luor ide
-Ġdecalc ification
-Ġbrist le
-Ġbrist ol
-Ġspons ored
-Ġjo ining
-Ġlimb ic
-Ġconflu ent
-Ġmultif ocal
-Ġglut amine
-Ġglut araldehyde
-Ġprofess or
-Ġcontraind ication
-Ġcontraind ications
-Ġpatch y
-Ġmisd iagnosed
-Ġmobil ized
-Ġmobil izing
-Ġdisclos ures
-Ġunrealistic ally
-onucle ic
-Ġinqu iry
-Ġfc ns
-Ġduc ts
-Ġduc tal
-Ġbub ble
-Ġlob ulated
-Ġexcep tional
-Ġscrap ed
-Ġscaff olds
-Ġunav oid
-Ġphr ases
-Ġdiscover ies
-Ġpostp oning
-Ġpostp ubertal
-Ġolig osaccharides
-Ġappreci ation
-Ġglomer ul
-Ġpathophys i
-Ġautops ies
-Ġhomogen ized
-Ġelectromy ograph
-Ġterrit ory
-Ġterrit ories
-Ġdisinfect ants
-Ġcontradic ting
-Ġectod erm
-Ġectod ermal
-Ġsynchron ization
-Ġsubcutaneous ly
-Ġinactiv ating
-Ġasteris ks
-Ġaccommod ation
-Ġaccommod ate
-rans ky
-Ġut most
-Ġspor ts
-Ġmer its
-Ġbill ion
-Ġnond ysplasia
-Ġnond ementia
-Ġconca ve
-Ġvw cpost
-Ġpropos als
-Ġsev oflurane
-Ġsev ille
-Ġseiz ure
-Ġadver tising
-Ġhep ato
-Ġjia o
-Ġminip rep
-Ġgrand io
-Ġendotox in
-Ġendotox ins
-Ġdelim it
-Ġdelim ited
-Ġaugment ations
-Ġmisinterpre tation
-Ġbisphosph onate
-Ġharmon ious
-Ġtaxon omy
-Ġpiezo electric
-Ġretrocl ined
-Ġlingu oversion
-Ġsphen oid
-Ġaffirmative ly
-Ġlncr na
-Ġamphoter ic
-Ġmycobi omes
-Ġsap i
-Ġstit ches
-Ġciv il
-Ġplex iform
-Ġdeline ate
-Ġbund le
-Ġvag ue
-Ġvag inalis
-Ġalert ness
-Ġexagg erated
-Ġexagg erate
-ogly c
-Ġlept in
-Ġlept otr
-Ġtryp tic
-Ġinterl ocking
-Ġinterrelations hips
-Ġunres tor
-Ġenfor ced
-gnath ia
-gnath ism
-Ġunderm ining
-Ġspind le
-Ġspind led
-Ġmicroc irc
-Ġblur red
-Ġcleans ing
-Ġcapac ities
-Ġrefine ment
-Ġimmuno assay
-Ġprioritiz e
-Ġevap or
-Ġphosphol ipid
-Ġphosphol ipids
-Ġmcd onald
-Ġhemodynamic s
-Ġobtur ating
-Ġdestabil izing
-Ġexecution ers
-Ġextrapol ation
-Ġextrapol ate
-Ġpolyvinyl idene
-Ġimmunodefici ent
-Ġimmunodefici ency
-54 8
-Ġtib ia
-Ġthr ive
-Ġsax ony
-Ġanastom osed
-Ġmuh imbili
-itr ile
-Ġlun ch
-Ġlind i
-imon ious
-Ġasc orbic
-Ġconvers ations
-Ġvd o
-Ġdisl od
-Ġtwenti eth
-opal atal
-Ġlef se
-Ġpars imonious
-Ġsubpop ulation
-Ġunh appiness
-Ġunn amed
-Ġunt argeted
-Ġfinn mark
-Ġphil osoph
-Ġstri king
-Ġbronch ial
-Ġdiap roseal
-Ġconfid ently
-Ġpractis es
-Ġhypoh idrotic
-Ġpercep tron
-Ġsensitis ers
-Ġabsor bs
-Ġtoolk its
-Ġhyperparamet ers
-Ġarticul are
-Ġsnack ing
-Ġillum inant
-Ġorganis ations
-Ġhydrolys ates
-Ġqia quick
-Ġcrani omaxillofacial
-Ġmicr ons
-Ġcounterst ain
-Ġincompati bility
-Ġharb oring
-Ġsupervis or
-Ġdiscolor ations
-Ġperpetr ator
-Ġcritic ised
-Ġtsald ant
-Ġcornerst ones
-Ġintuitive ly
-Ġub iquit
-Ġaur icular
-Ġsid ew
-Ġsene viratne
-Ġssc ecs
-Ġole fin
-Ġpin pointed
-Ġpma q
-Ġmcr a
-Ġbank ur
-rod ysplasia
-Ġreferen ced
-Ġreex amin
-Ġreaff irmed
-Ġtod dlers
-Ġlis dex
-Ġlud wig
-Ġlati tude
-Ġgy na
-Ġgall bladder
-Ġgale azzi
-Ġcong ress
-Ġperin atal
-Ġrush ton
-Ġisl amic
-Ġincap able
-Ġcompe titive
-Ġasser tion
-Ġcour ier
-Ġparamed ian
-pert ensive
-Ġprese lection
-Ġcarunc le
-Ġabst aining
-Ġquiet ly
-Ġphag ocytosis
-Ġoverrepresent ation
-Ġortho analyzer
-Ġcommens al
-Ġblister ing
-Ġocclus ally
-Ġestr adiol
-Ġosteoph ytes
-Ġprofici ency
-Ġveron ococcus
-Ġsold iers
-Ġhards hip
-Ġsymb ols
-Ġfibril s
-Ġpreca utions
-Ġhyperg lycemia
-Ġchris tians
-Ġtrajec tories
-Ġwake fulness
-Ġreplen ished
-Ġencaps ulated
-Ġinstitut et
-Ġurg ency
-Ġmiscon ception
-Ġcardi omy
-Ġdebond ed
-Ġvasoconstr ictor
-Ġaggl omeration
-Ġdilacer ated
-Ġconcaten ated
-Ġconvinc ing
-Ġelectroc ardi
-Ġanticoag ulant
-Ġnonsyn dromic
-Ġexhaus tive
-Ġrefract ory
-Ġsuprac restal
-Ġunreli able
-Ġosteoprogen itor
-Ġventil ator
-Ġglycos aminogly
-Ġnanostruct ures
-Ġsubcult ured
-Ġlicens ing
-Ġunwilling ness
-Ġzeal and
-Ġminipig s
-Ġmenstr ual
-Ġbibli ographic
-Ġnurser ies
-Ġexempl ary
-ydroxy apatite
-Ġveloph aryngeal
-Ġsacrific ed
-Ġconglomer ate
-Ġimmob ilization
-Ġcoexist ence
-Ġtubercul osis
-fibr illar
-hil is
-mineral ized
-num ber
-rib onucleic
-zade h
-Ġtus cany
-Ġtand em
-Ġtures ky
-Ġtestim onials
-Ġtroph ozo
-Ġtread ed
-Ġsyp hilis
-Ġoest rogen
-Ġolymp ua
-Ġcolog ne
-Ġpem ph
-Ġpco a
-Ġpedic le
-Ġplymp us
-Ġwist ar
-Ġinac cessible
-Ġinval id
-Ġinso far
-Ġinvalu able
-Ġfag an
-Ġdop pler
-Ġmond ay
-Ġmening itis
-Ġbact eremia
-Ġreapp lying
-Ġtocant ins
-Ġstake holders
-erell a
-Ġnoc ic
-Ġnish imura
-Ġnyl on
-Ġnened ent
-Ġgos lon
-Ġgest ational
-Ġgarb age
-Ġgingive ct
-Ġperiv ascular
-Ġrip a
-Ġexak t
-Ġproges terone
-Ġprodrom al
-Ġdeoxy ribonucleic
-Ġbyproduc ts
-Ġatop obium
-Ġseleg iline
-Ġhepati tis
-Ġassemb ly
-Ġareep ong
-Ġindist inct
-Ġsurvi ve
-Ġcanadi ans
-Ġparaker atosis
-Ġrecolon ization
-Ġneisser ia
-Ġclindam ycin
-Ġsubcom position
-Ġunans wered
-Ġunfe asible
-Ġunload ing
-Ġunno ticed
-Ġgenio plasty
-Ġgenitour inary
-Ġmethohex ital
-Ġdeskt op
-Ġdesensitis ation
-Ġinvulner ability
-Ġmedcal c
-Ġbiogen eric
-Ġbiodent ine
-Ġdecoron ated
-Ġmanne quin
-Ġmanik in
-Ġjuris d
-Ġjalal uddin
-Ġhygro scopic
-Ġprobabil istic
-Ġdietic ian
-Ġunderto ok
-Ġmonobl ock
-Ġerics on
-Ġcyano acrylate
-Ġnegoti ating
-Ġsitaf loxacin
-Ġmouthrin se
-Ġpathogn omonic
-Ġantihy pertensive
-Ġantioxid ant
-Ġeskise hir
-Ġintrafamil ial
-Ġepileps y
-Ġfluoroh ydroxyapatite
-Ġpolyacryl amide
-Ġpapulonod ular
-Ġlightfast ness
-Ġmyocard ial
-Ġsemiland marks
-Ġqias ymphony
-Ġmarsh field
-Ġnucleotid es
-Ġcampan ia
-Ġgoldenh ar
-Ġvsmp ost
-Ġmitutoy o
-Ġromagn a
-Ġcelik oglu
-Ġkarolins ka
-Ġthalidom ide
-Ġvesicul obullous
-Ġleptotr ichia
-Ġmicrocirc ulation
-Ġlisdex amfetamine
-Ġglycosaminogly can
-0 12
-0 85
-1 000
-1 70
-1 74
-1 78
-2 7
-2 76
-3 6
-3 00
-3 18
-3 38
-4 2
-4 20
-5 5
-5 90
-5 96
-6 6
-7 1
-7 2
-7 60
-8 00
-9 8
-9 30
-a a
-a ac
-a act
-b f
-b es
-b ing
-b ar
-b ul
-b ec
-b et
-b ow
-b and
-b ase
-b led
-b ones
-b ilities
-b den
-b ird
-c am
-c ap
-c act
-c ens
-c ome
-c ons
-c umin
-c arb
-d g
-d or
-d ar
-d ig
-d if
-d el
-d iv
-d em
-d erm
-d iss
-d ays
-d isc
-d rew
-d oor
-d dp
-e b
-e j
-e le
-e ared
-e av
-e ets
-e lect
-e ira
-f b
-f i
-f at
-f ig
-f ive
-f ound
-f pe
-f ather
-f ilms
-g b
-g in
-g ic
-g ac
-g ill
-g ating
-g ium
-g etr
-g was
-g ata
-g ional
-h d
-h o
-h t
-h al
-h ing
-h us
-h am
-h ain
-h aus
-h anes
-h ok
-h adow
-i tic
-i ative
-i ke
-i vers
-i ently
-i ometric
-i atric
-i ella
-i inf
-i osity
-j f
-j o
-j an
-j ets
-j unction
-j uan
-k b
-k c
-k m
-k v
-k w
-k an
-k it
-k ul
-k ins
-k ron
-k illed
-l h
-l r
-l en
-l os
-l ab
-l ate
-l ice
-l uded
-l undii
-m t
-m el
-m ised
-m pre
-m ologic
-m ale
-m ara
-m uch
-n y
-n z
-n il
-n ity
-n ew
-n ever
-n ier
-n ocyt
-n ius
-n getr
-o z
-o on
-o il
-o oc
-o ich
-o ven
-o yl
-o ising
-p c
-p y
-p in
-p ow
-p act
-p ss
-p ediatric
-r is
-r as
-r ac
-r ig
-r ations
-r ay
-r itol
-s r
-s an
-s ur
-s um
-s aw
-s ame
-s ki
-s imilar
-s econd
-t ur
-t tr
-t and
-t op
-t ations
-t est
-t ured
-t ubular
-u f
-u v
-u z
-u en
-u ent
-u ing
-u el
-u ances
-u ardo
-u oden
-v ol
-v ess
-v ating
-v oked
-v uls
-w is
-w ere
-w id
-w ich
-w ater
-w atch
-w ah
-w teen
-x ing
-x ual
-y er
-y ush
-y ang
-z in
-z ig
-z ia
-z one
-z inc
-z ah
-z hou
-Ġ :
-Ġ ia
-Ġ ug
-Ġ ics
-Ġ ibr
-Ġt on
-Ġt ig
-Ġt rom
-Ġt ia
-Ġt ug
-Ġt all
-Ġt ech
-Ġt ms
-Ġt ian
-Ġt ired
-Ġt ung
-Ġt ilt
-Ġt astes
-Ġt abled
-Ġt ale
-Ġt ensor
-in en
-in us
-in ce
-in ted
-in able
-in ak
-in ery
-in ogen
-in itis
-in tegr
-in stru
-Ġa o
-Ġa ro
-Ġa ar
-Ġa vers
-Ġa ics
-Ġa xi
-Ġa uro
-Ġa udi
-re tion
-re ment
-re ate
-re ach
-re led
-re can
-re place
-re yi
-re zinc
-Ġth am
-Ġth rus
-on a
-on an
-on it
-on os
-on able
-on ents
-on ca
-on tia
-on azole
-on avir
-on ias
-on ni
-on iphil
-Ġthe ob
-Ġthe sis
-Ġs pt
-Ġs ons
-Ġs ang
-Ġs orb
-Ġs ake
-Ġs elling
-Ġs ights
-Ġs osa
-Ġs ards
-Ġs accha
-ti x
-ti ed
-ti ter
-ti ge
-ti te
-ti ll
-ti fied
-ti ble
-ti ka
-Ġo ac
-Ġo ts
-Ġo cl
-Ġo mi
-Ġo kc
-Ġo zone
-en k
-en er
-en ac
-en yl
-en net
-en berg
-en opathy
-en zyme
-al f
-al ore
-al ized
-al ex
-al ian
-al most
-al kon
-al ongk
-er as
-er ied
-er ving
-er ately
-er he
-Ġc ic
-Ġc ation
-Ġc res
-Ġc tr
-Ġc able
-Ġc ue
-Ġc ased
-Ġc ex
-Ġc itation
-Ġc enes
-ed ge
-ed entistry
-Ġp b
-Ġp n
-Ġp as
-Ġp up
-Ġp all
-Ġp enc
-Ġp bm
-Ġp ept
-Ġp omer
-Ġp ini
-Ġp ascal
-Ġw ro
-Ġw orm
-Ġw ag
-Ġw ood
-Ġw inding
-Ġw att
-Ġw oven
-Ġw edge
-Ġin el
-Ġin ven
-Ġin gest
-Ġin the
-es c
-es o
-es ed
-es tern
-es lundii
-Ġan er
-Ġan is
-Ġan os
-Ġan tim
-Ġan ov
-Ġan orec
-Ġan za
-Ġan ecd
-Ġf is
-Ġf os
-Ġf ab
-Ġf up
-Ġf led
-Ġf ibular
-Ġf atal
-Ġf ang
-Ġf allen
-Ġf cs
-Ġf dl
-Ġf use
-Ġf hc
-Ġf ern
-Ġf ests
-Ġf aint
-Ġf dg
-Ġf fpe
-Ġd it
-Ġd un
-Ġd ated
-Ġd ad
-Ġd ess
-Ġd ir
-Ġd ign
-Ġd ers
-Ġd ull
-Ġd ak
-Ġd aw
-Ġd ta
-Ġd aps
-Ġd rew
-Ġd iction
-Ġd ella
-Ġd kk
-Ġd osing
-Ġd angers
-Ġd odec
-Ġd alex
-Ġm n
-Ġm ant
-Ġm ies
-Ġm ers
-Ġm ary
-Ġm cl
-Ġm ans
-Ġm ile
-Ġm amm
-Ġm erg
-Ġm itosis
-Ġm vm
-Ġm plus
-Ġm ieth
-at ine
-at ally
-at cc
-at ural
-at ri
-at gg
-or n
-or re
-or ig
-or ding
-or tal
-or se
-or st
-or ates
-or tical
-or onal
-or rees
-or ously
-or pore
-th m
-th opathy
-an tic
-an king
-an xi
-an osine
-Ġand ro
-Ġb ing
-Ġb um
-Ġb ure
-Ġb ug
-Ġb ass
-Ġb ile
-Ġb lu
-Ġb erg
-Ġb uro
-Ġb ca
-Ġb iliary
-Ġb outs
-Ġb atter
-Ġb ivariable
-is k
-is ure
-is ens
-is ons
-is pers
-as a
-as m
-as o
-as y
-as se
-as ures
-as ions
-as ks
-as hi
-as odium
-as plint
-as onable
-ent ric
-ic ed
-ic ter
-ic ted
-ic ell
-ic yl
-ic itis
-ic ron
-ic acies
-ic ola
-ing ing
-ing ually
-ro ad
-ro gram
-ro de
-ro oted
-ro lytic
-ro viral
-ro bacter
-ro toxic
-ro gated
-ro kin
-ro uel
-ar p
-ar u
-ar um
-ar ma
-ar pal
-ar cation
-ar adicular
-ar tial
-Ġre ver
-Ġre ap
-Ġre te
-Ġre int
-Ġre acted
-Ġre acts
-Ġre use
-Ġre acting
-Ġre arr
-Ġre abs
-Ġre amer
-Ġre institution
-Ġre attach
-Ġre establ
-Ġto w
-Ġto ken
-Ġto hok
-Ġh i
-Ġh k
-Ġh v
-Ġh w
-Ġh ed
-Ġh es
-Ġh ir
-Ġh are
-Ġh ose
-Ġh int
-Ġh ither
-Ġh ang
-Ġh fa
-Ġh mm
-Ġh idal
-Ġh ata
-Ġh la
-Ġh ubba
-le b
-le ys
-le te
-le bs
-Ġe ich
-Ġe ug
-Ġe asing
-Ġe gf
-Ġe eg
-Ġe agle
-Ġe uthan
-it age
-it ates
-it ron
-us sion
-us ual
-Ġst t
-Ġst orm
-Ġst ub
-Ġst ool
-Ġst ays
-Ġst ably
-Ġst oring
-Ġst air
-Ġst ones
-Ġst abilities
-Ġst eep
-Ġst agn
-Ġst amped
-Ġst oich
-ul ing
-ul ature
-ul itis
-ul ator
-ul ou
-ul gen
-ul ista
-ul alongk
-ac s
-ac le
-ac ia
-ac ase
-ac ency
-ac ute
-ac avir
-ac arpal
-ec tic
-ec ology
-ec ostal
-Ġl k
-Ġl ent
-Ġl ia
-Ġl ately
-Ġl ute
-Ġl air
-Ġl fs
-Ġl aryngeal
-Ġl obe
-om ore
-om ater
-om idine
-om avirus
-Ġn ol
-Ġn ap
-Ġn op
-Ġn em
-Ġn vid
-Ġn ult
-Ġn br
-Ġn ord
-Ġn omen
-Ġn ps
-Ġn atives
-Ġn ested
-Ġn ails
-Ġn ik
-Ġn ests
-Ġn aked
-Ġn la
-Ġn ucl
-Ġn amara
-Ġn uances
-im et
-im od
-im pl
-im olar
-im ene
-im etry
-im ethyl
-im ilarities
-Ġg ar
-Ġg ate
-Ġg em
-Ġg orm
-Ġg ill
-Ġg ear
-Ġg lu
-Ġg ag
-Ġg ds
-Ġg ob
-Ġg omes
-Ġg gg
-Ġg ca
-Ġg nas
-Ġg tg
-Ġg era
-Ġg han
-Ġg aming
-Ġg erald
-Ġg azi
-Ġg sr
-Ġg imene
-ly tes
-ly tically
-ly zer
-ly bden
-ur ate
-ur bs
-ur ances
-ur ring
-ur ious
-ur tosis
-ur cation
-ur pr
-ig itation
-ig uing
-Ġwi pe
-Ġwith drew
-ud a
-ud en
-et ts
-et res
-et tle
-et omidine
-os um
-os omes
-os oid
-os itol
-ce le
-if ting
-if urcation
-Ġfor going
-ol t
-ol lective
-ol ingually
-Ġas yn
-Ġas rs
-Ġas tra
-Ġas mt
-il or
-il ament
-Ġcon gr
-Ġcon clus
-Ġcon forms
-Ġcon gestion
-od ing
-od il
-od erm
-od rop
-od ermal
-od uoden
-id one
-id ental
-id emia
-id ae
-id oprop
-ow ed
-ow ered
-Ġon ward
-Ġon ye
-Ġon wards
-Ġon lays
-ment al
-Ġor m
-Ġor pt
-ab in
-ab el
-ab ite
-ab ama
-ab uccal
-un as
-un it
-un ion
-un ting
-un eration
-Ġstud io
-am ant
-am ad
-am yl
-am ycin
-am iliar
-am idoprop
-tic k
-Ġv u
-Ġv if
-Ġv oc
-Ġv og
-Ġv ist
-Ġv anc
-Ġv asc
-Ġv isting
-Ġv hn
-res cens
-el ity
-el ong
-el ps
-el ier
-el ters
-el inak
-ter oidal
-up l
-up t
-up es
-Ġal k
-Ġal er
-Ġal ber
-Ġal ta
-Ġal inity
-Ġal anine
-Ġal abama
-Ġper th
-Ġper it
-Ġper vious
-Ġper inucle
-Ġper iles
-Ġper itone
-Ġr q
-Ġr v
-Ġr iv
-Ġr io
-Ġr af
-Ġr pre
-Ġr icap
-Ġwh l
-Ġwh ites
-Ġex it
-Ġex ome
-Ġex ecutive
-Ġex tir
-Ġex pecting
-Ġpro ping
-Ġpro posing
-Ġpro gnathism
-Ġres um
-Ġres ili
-Ġres trained
-Ġres emble
-Ġres pecting
-Ġres ettle
-Ġbe e
-Ġbe ad
-Ġbe verage
-Ġbe agle
-Ġbe wteen
-ion ts
-uc ting
-uc hs
-tr ate
-tr ap
-tr ich
-tr ace
-tr ache
-tr abec
-tr iglycer
-ot ated
-ot ap
-ot te
-Ġim aged
-Ġim posing
-Ġim iqu
-Ġim itating
-Ġim porting
-Ġis g
-Ġis tit
-Ġis tan
-Ġis thm
-ad ual
-ut o
-ut om
-ess ment
-ess ential
-ver a
-ver al
-ver di
-Ġus b
-oc us
-oc co
-oc ae
-oc utaneous
-oc aine
-qu ing
-qu eness
-Ġch ol
-Ġch emic
-Ġch agas
-Ġch ulalongk
-Ġde activation
-Ġde phosph
-Ġde grade
-Ġde qual
-ore gional
-ain ment
-Ġinc ong
-pl ot
-pl ess
-pl ane
-ure thane
-Ġat a
-Ġat omic
-Ġat ubular
-Ġpre con
-Ġpre tes
-Ġpre occ
-Ġpre transplant
-Ġac b
-Ġac p
-Ġac anth
-ys es
-ys ma
-ys plas
-ys ema
-Ġcomp o
-Ġcomp ost
-Ġcomp utes
-Ġgroup ings
-ific ance
-iv ocal
-og el
-ib ulum
-Ġdis tr
-Ġdis oc
-Ġdis ks
-Ġdis position
-Ġdis organ
-Ġdis ulf
-Ġdis putable
-Ġdis junction
-Ġdis integr
-Ġse a
-Ġse es
-Ġse fs
-Ġse pha
-Ġsh en
-Ġsh ore
-Ġsh ip
-Ġsh ine
-Ġsh out
-Ġsh elf
-Ġsh aw
-Ġsh aken
-Ġsh ield
-Ġsh ank
-Ġsh aded
-Ġsh bg
-Ġsh ielding
-Ġsh yama
-Ġsh anxi
-Ġsh elters
-ap a
-ap rep
-ap rezinc
-Ġdif luoride
-Ġad vers
-Ġad ma
-Ġad ela
-Ġpati ence
-Ġdent ation
-Ġdent ogingival
-Ġdent oskeletal
-Ġbet aine
-Ġhe ater
-Ġsign ified
-Ġsign ify
-Ġass esed
-Ġcl on
-Ġcl ad
-Ġcl ue
-Ġcl aus
-Ġcl ade
-Ġcl ips
-Ġcl arith
-Ġcl ocking
-Ġcl othing
-rom ine
-and ro
-and ible
-and ez
-Ġare ca
-Ġtw elf
-Ġtw isting
-Ġtw eets
-ff man
-Ġma al
-op er
-op ed
-op tic
-op md
-op eptide
-op ilot
-op apers
-por ts
-por ter
-por ous
-odon tal
-we alth
-ers ten
-ers son
-Ġsc rol
-Ġsc all
-Ġsc iss
-Ġsc ou
-Ġperi impl
-Ġap q
-Ġap ic
-Ġap ico
-ip ol
-ip zig
-ip artial
-Ġdental s
-und ant
-und ibulum
-Ġco in
-Ġco ach
-Ġco fact
-Ġind ocy
-Ġle an
-Ġle ite
-Ġle aching
-Ġle wis
-Ġle isure
-Ġle ipzig
-Ġsur in
-Ġsur mised
-ub jec
-act ants
-act ures
-se ven
-se lec
-se lective
-se xual
-se veral
-Ġcan ce
-Ġpar ag
-Ġpar acase
-ine a
-ine oplastic
-Ġpos itron
-val ence
-val late
-vi x
-st en
-st ar
-st ated
-st aff
-Ġfo etal
-Ġfo aming
-Ġinf ers
-Ġinf undibulum
-ull ary
-ich ofacial
-enti st
-enti veness
-enti tude
-ren z
-Ġcont oured
-Ġcont ingent
-ari um
-ari ably
-ari ogenic
-Ġpres et
-Ġpres tige
-Ġpl ough
-Ġpl atin
-Ġpl iers
-Ġpl entitude
-ell i
-Ġall en
-Ġall otted
-ch e
-ch ron
-end able
-end ers
-end all
-ug g
-ug s
-ug ular
-ill er
-Ġro e
-Ġro w
-Ġro th
-Ġro str
-Ġro ss
-Ġro utes
-Ġro set
-Ġtr in
-Ġtr ig
-Ġtr ies
-Ġtr aces
-Ġtr usting
-Ġtr illion
-Ġtr ifurcation
-Ġtr ilor
-ach er
-Ġcons ens
-Ġcons angu
-Ġreg ress
-cl in
-cl ature
-Ġacc ustom
-ative ly
-Ġno ises
-Ġno vice
-Ġthree fold
-Ġrec k
-Ġrec ons
-Ġrec edes
-Ġrec reate
-Ġrec tified
-Ġincl usive
-Ġrel oc
-Ġrel ine
-Ġpr n
-Ġpr ab
-Ġpr ices
-Ġpr dx
-Ġpr ato
-Ġpr oroot
-Ġpr agm
-Ġpr ahl
-Ġcar re
-Ġcar los
-Ġcar rouel
-Ġtooth less
-Ġtooth wear
-ive ira
-Ġab used
-Ġab bott
-Ġab fraction
-Ġab orig
-Ġab road
-Ġab acavir
-Ġclin var
-Ġaf rs
-Ġaf ferent
-Ġrepor ters
-Ġsub nas
-Ġsub anal
-Ġsub lux
-Ġsub epid
-Ġsub acute
-Ġsub urbs
-Ġsub unit
-Ġinter acted
-Ġinter cor
-Ġinter individual
-Ġinter tubular
-Ġinter trabec
-Ġafter ward
-Ġafter no
-Ġqu int
-Ġqu art
-Ġqu oted
-Ġqu eries
-Ġqu itting
-Ġqu eried
-Ġun im
-Ġun iz
-Ġun iv
-Ġun per
-Ġun con
-Ġun ins
-Ġun wor
-Ġun pre
-Ġun plan
-Ġun iaxial
-Ġun esp
-Ġun stand
-Ġun inter
-Ġun bound
-Ġun qual
-Ġun attach
-Ġun anim
-Ġun biased
-Ġun usual
-Ġint end
-Ġint estine
-ay gis
-ist em
-ist ance
-Ġy r
-Ġy in
-Ġy rs
-Ġam c
-Ġam m
-Ġam in
-Ġam ple
-Ġam ber
-Ġam put
-Ġam mon
-Ġam ira
-Ġam star
-ens ins
-ens pan
-Ġvari ably
-Ġassoci ating
-Ġk b
-Ġk re
-Ġk al
-Ġk ick
-Ġk pa
-Ġk oh
-Ġk ota
-Ġk obe
-Ġk ato
-Ġk umar
-Ġk oil
-Ġk yush
-Ġk lebs
-Ġk urtosis
-Ġk endall
-Ġk aygis
-Ġval ley
-Ġval leys
-iti m
-iti ts
-iti ators
-Ġwe i
-Ġwe erhe
-atis fied
-pro t
-lec ting
-Ġen r
-Ġen erg
-Ġen vision
-Ġen closed
-Ġfol i
-Ġfol lic
-Ġfol ded
-rol idone
-Ġgen omes
-Ġgen icular
-Ġgen ban
-Ġgen omics
-Ġmay an
-Ġpo uring
-ome in
-ome atal
-ome gal
-Ġassess or
-Ġtim eline
-ph or
-ph ys
-ph ones
-Ġout reach
-ugh ter
-ugh ters
-ass im
-ass ays
-gn er
-Ġspec ulative
-erm oid
-erm ann
-Ġfin er
-Ġup ch
-Ġup wards
-Ġup stream
-Ġcor ner
-Ġcor pus
-Ġmeth ane
-Ġmeth acrylates
-str and
-all a
-Ġso x
-Ġso aking
-Ġso hi
-Ġar d
-Ġar as
-amin i
-amin ar
-Ġinv ivo
-Ġinv ariably
-Ġmed er
-Ġmed iter
-Ġmed ipol
-Ġmed ullary
-enc our
-Ġph q
-Ġph ones
-Ġph obi
-Ġph elps
-Ġph ocae
-Ġevalu able
-Ġevalu ative
-Ġover he
-Ġover treatment
-Ġover jets
-Ġover stated
-ke ys
-mo unt
-Ġbi oc
-Ġbi otype
-Ġbi oroot
-Ġcell ulose
-Ġcell ulitis
-ct cc
-ct tg
-Ġmo ves
-Ġmo vie
-Ġmo orrees
-Ġmo lybden
-Ġparticip ates
-Ġcol ab
-Ġcol itis
-Ġcol umb
-ber t
-ues e
-Ġdenti um
-Ġtime atr
-Ġdec iph
-Ġdec ortic
-Ġdec oded
-Ġcr d
-Ġcr s
-Ġcr iti
-Ġcr ibr
-Ġsec oster
-Ġsec luded
-Ġag encour
-adi um
-Ġcal f
-Ġcal cein
-Ġwho qol
-ior otated
-Ġaccor ds
-Ġperiodonti ts
-Ġstr ipping
-Ġstr icter
-Ġstr ugg
-ex traction
-Ġ1 000
-Ġ1 10
-tain ment
-Ġimpl icate
-Ġimpl icit
-Ġsim on
-Ġbr ier
-Ġbr acing
-ystem s
-Ġund eni
-ep am
-Ġnumber of
-Ġexamin es
-Ġexamin ator
-ag y
+Ġexer ted
+Ġprep are
+Ġexplan atory
+Ġiniti ating
+Ġrig id
+ocon st
+Ġpharmacokin etic
+h es
+ch in
+oc ate
+Ġage ing
+Ġeng aged
+Ġconver g
+Ġencoun ter
+Ġcip rofloxacin
+Ġw s
+Ġg cs
+ati le
+vi e
+Ġaccess ibility
+Ġpept ides
+Ġexamin ers
+Ġdiure tics
+Ġsphinct er
+at re
+Ġgener ating
+Ġoff set
+Ġshort ening
+Ġdig it
+Ġrecess ion
+Ġnsa ids
+Ġantith romb
+Ġo le
+iv ated
+Ġme ant
+Ġtable ts
+Ġaut onomy
+Ġmes i
+Ġtail ored
+Ġscar ce
+an ia
+Ġv an
+Ġex on
+Ġle ct
+Ġcl l
+Ġund ers
+Ġimm ig
+Ġqual ified
+Ġrank ed
+Ġfragment ation
+Ġbiomechan ical
+Ġhypother mia
+Ġdebrid ement
+Ġf bg
+om eth
+Ġsh ang
+Ġsc aling
+Ġacid osis
+Ġdeform ity
+Ġfavour able
+Ġretrog rade
+Ġw elf
+Ġf s
+il s
+Ġris ing
+Ġactiv ates
+Ġvol tage
+Ġdent ures
+avail ability
+Ġdlb cl
+Ġwelf are
+at ics
+Ġin patients
+Ġb ones
+om ics
+Ġos m
+Ġcoun cil
+Ġc ci
+Ġe o
+Ġps s
+Ġep ig
+Ġfac ed
+Ġ8 0
+Ġcho osing
+Ġven a
+Ġsuperior ity
+Ġste el
+Ġhaem orrh
+Ġstrict ure
+Ġcasc ade
+Ġsedent ary
+Ġcomp atible
+Ġtr ich
+Ġobser vers
+ici ous
+Ġdisc s
+Ġimmun ofluorescence
+omm on
+Ġendoscop ists
+Ġparen ting
+Ġcompet encies
+Ġneigh b
+Ġloos ening
+9 8
+Ġcl av
+per g
+Ġca ffe
+Ġdirection s
+Ġasym metry
+Ġdup licate
+Ġenab led
+Ġhierarch ical
+Ġb act
+Ġal iqu
+Ġhyper th
+Ġprot ected
+Ġsampl ed
+Ġstress ors
+point s
+Ġpredisp osing
+Ġmultif act
+ag l
+Ġanalys e
+Ġinit iate
+Ġelect ric
+Ġextraction s
+Ġprolong ation
+Ġspl enic
+Ġhomogene ity
+Ġin active
+Ġtri ang
+Ġtert ile
+Ġshang hai
+en ib
+Ġp ji
+Ġto l
+Ġpre vents
+Ġsyn thetic
+Ġadv ised
+ogene ic
+Ġepiderm al
+Ġcool ing
+im us
+Ġhyper ch
+Ġsk ull
+Ġprop ose
+Ġmes enteric
+Ġhis panic
+Ġinn ate
+Ġclos er
+Ġneutrop enia
+y al
+est ic
+Ġme at
+Ġob li
+Ġexp osures
+Ġlact ob
+Ġspontaneous ly
+Ġf en
+Ġm ci
+Ġrec over
+Ġlim bs
+Ġimmun oglobulin
+Ġmicro t
+Ġ4 8
+Ġsegment al
+Ġpap illa
+Ġteach ers
+Ġcond ylar
+Ġextrem ities
+Ġautoantib odies
 ag ia
-ag ct
-ag asc
-ag tt
-Ġman ages
-Ġman ning
-Ġman ova
-Ġman ches
-Ġman pow
-Ġ2 95
-ath in
-Ġcompar ator
-Ġcompar asions
-Ġnon h
-Ġnon adj
-Ġnon toxic
-Ġnon institution
-Ġnon particip
-Ġnon mineralized
-Ġnon fat
-Ġnon instru
-Ġnon union
-Ġnon selective
-pos ons
-Ġdisc arding
-Ġdisc oid
-Ġdisc ordance
-Ġsup position
-Ġorth ox
-pt ual
-pt otic
-Ġradi od
-Ġradi ant
-Ġradi ometer
-Ġdef icit
-Ġdef ensins
-Ġsp a
-Ġsp ines
-Ġsp inal
-Ġsp astic
-Ġsp aced
-Ġsp itting
-Ġsp arc
-Ġsp inous
-Ġsp ike
-Ġsp oon
-Ġsp asm
-Ġsp urious
-Ġj r
-Ġj mp
-Ġj da
-Ġj elly
-Ġj ugular
-Ġed it
-Ġed ible
-Ġed ited
-Ġed ged
-Ġed emat
-Ġed uardo
-Ġfur nish
-Ġcare rs
-istic s
-Ġmicro d
-Ġmicro fr
-Ġmicro phot
-Ġmicro comp
-Ġmicro elect
-Ġmicro vess
-Ġcomm encing
-Ġcomm itted
-Ġcomm endable
-Ġdem ography
-Ġdem arcation
-Ġmater nity
-oun cement
-Ġmin as
-Ġmin ing
-Ġmin ors
-Ġmin nes
-Ġtyp odont
-Ġgingiv ally
-Ġsubjec ting
-Ġextr usive
-Ġappro ve
-Ġappro ving
-Ġmand ates
-Ġcalc ic
-Ġchar ges
-Ġchar ging
-Ġi er
-Ġmal align
-Ġmal asse
-Ġtrans it
-Ġtrans ference
-Ġtrans itivity
-Ġtrans posed
-Ġtrans aminase
-Ġtrans iently
-Ġtrans porter
-Ġtrans sexual
-Ġtrans posons
-ten tional
-Ġform ally
-ological ly
-Ġdi j
-Ġdi pl
-Ġdi amine
-Ġdi acet
-uth ors
-Ġcur b
-Ġcur cumin
-Ġdevelop ers
-ace ous
-Ġgr iff
-ons cious
-ak ary
-ak ening
-Ġli u
-Ġsal icyl
-Ġunder ne
-Ġunder growth
-Ġunder filled
-Ġunder achie
-Ġlim a
-ough s
-Ġimp ar
-Ġimp ose
-Ġimp actions
-Ġimp uls
-Ġimp rac
-tor ch
-Ġpost code
-Ġpost biotic
-Ġpost extraction
-Ġprim ed
-Ġprim es
-Ġpain ted
-Ġser val
-Ġser oma
-Ġmet re
-Ġmet ers
-Ġmet aph
-Ġmet acarpal
-Ġmon os
-Ġmon ob
-Ġmon of
-Ġmon ophosphate
-Ġbl end
-Ġbl aming
-Ġbl isters
-Ġem ails
-Ġfre undii
-Ġol r
-Ġol s
-Ġol iver
-Ġol sen
-Ġol iveira
-Ġintr ins
-Ġintr ude
-Ġintr aper
-Ġintr icacies
-Ġintr iguing
-amm as
-Ġneed les
-Ġ0 16
-Ġ0 12
-Ġ0 18
-Ġfrequ entist
-Ġstand point
-Ġz i
-Ġz p
-Ġz ops
-Ġz uan
-Ġz hu
-Ġz hou
-Ġz hang
-Ġwor ried
-Ġwor ris
-Ġwhere ver
-Ġer ik
-Ġer verdi
-Ġmain z
-Ġinvestig ational
-ss on
-Ġquestion aire
-Ġless en
-ll ables
-Ġsoft max
-Ġplan ar
-Ġplan ners
-ores istance
-Ġdr ained
-Ġdr aft
-Ġdr ifting
-Ġend es
-Ġend ure
-Ġend ang
-Ġend osseous
-Ġend eav
-Ġend orse
-Ġend opilot
-Ġinform s
-Ġinform al
-Ġinform ational
-Ġradiograph ies
-Ġca val
-Ġresearch ed
-Ġresearch ing
-Ġsug ared
-ym ethyl
-Ġinfl icted
-Ġce a
-Ġce f
-Ġstandard izing
-Ġloc ked
-Ġloc oregional
-Ġdid anosine
-Ġaffec tion
-Ġel ders
-Ġel nil
-Ġobtain s
-Ġobtain able
-Ġmulti organ
-Ġmulti bracket
-Ġmulti vitamin
-Ġmulti rooted
-fer ior
-Ġselec ts
-Ġselec tivity
-Ġrem uneration
-gr ip
-gr ath
-Ġfr ightened
-Ġfr aying
-Ġcriter ium
-ving s
-ord ed
-ord ant
-our a
-our se
-Ġpred ig
-Ġany one
-Ġany how
-Ġany thing
-Ġeduc ator
-Ġadj acency
-Ġindex ed
-Ġexpl ant
-Ġmuc us
-Ġmuc oderm
-Ġexperi ential
-Ġflu x
-Ġflu ent
-Ġflu ence
-Ġflu ores
-ha h
-ha ving
-Ġdistrib ute
-Ġsm op
-Ġsm gi
-Ġsm ith
-Ġsm eared
-Ġins ulator
-Ġins urances
-Ġconduc ed
-Ġconduc tion
-Ġconduc tive
-Ġconduc tor
-Ġimm pact
-Ġimm ortal
-Ġknowledge able
-gi ans
-Ġir ct
-Ġsch ul
-Ġsch ema
-Ġline age
-Ġoc clud
-Ġcb ss
-Ġinfec ting
-Ġneg ativity
-Ġneg lecting
-Ġprot ons
-Ġprot otyping
-Ġbeha ved
-Ġbeha ves
-Ġuni queness
-Ġsamples w
-Ġmouth rins
-Ġgl ue
-Ġgl mm
-Ġgl enoid
-Ġpath ologists
-Ġcommon wealth
-Ġspecific ations
-Ġanti de
-Ġanti ret
-Ġanti plate
-Ġcer vix
-Ġdist omolar
-Ġupper most
-Ġos ap
-Ġos tial
-Ġos aka
-Ġpe a
-Ġpe b
-Ġpe g
-Ġpe el
-Ġpe eling
-Ġpe opl
-Ġpe aking
-Ġpe eso
-Ġav d
-Ġcollec ts
-of iles
-Ġfac ets
-Ġpal ates
-Ġpal mas
-yl s
-yl ase
-Ġhist one
-io ceptive
-00 1
-til ity
-Ġparen chymal
-Ġeth ic
-Ġlo ts
-Ġlo ess
-Ġlo osing
-Ġlo upes
-Ġgu inea
-Ġes ter
-Ġes ri
-Ġfl ight
-Ġfl ared
-Ġfl ag
-Ġfl ood
-Ġfl our
-Ġfl akes
-Ġfl anking
-ick ness
-ick man
-Ġdiscussion s
-Ġarch ived
-Ġstress ing
-Ġdemonstr ation
-Ġdemonstr ative
-Ġoste itis
-Ġoste otome
-Ġatt entiveness
-ox ymethyl
+Ġsug amm
+Ġes cal
+Ġsurv ived
+Ġhar b
+Ġsugamm adex
+Ġac r
+Ġmon o
+Ġspecial ty
+Ġgc f
+Ġconj unction
+Ġine ffect
+u it
+in i
+Ġd eline
+Ġg ath
+Ġem t
+Ġsix ty
+Ġreview ing
+Ġhistological ly
+Ġopp osed
+chym al
+Ġprint ed
+Ġrpm i
+in ous
+is k
+et ically
+Ġacc ompl
+Ġmod ulate
+Ġdef ense
+Ġcharacter ize
+Ġday time
+thes es
+Ġpat ency
+Ġpower ful
+Ġmig raine
+Ġreimburs ement
+Ġwe aring
+yn ess
+Ġstandard ization
+Ġloc ally
+Ġ4 5
+Ġtert iles
+Ġsmo ke
+Ġration ale
+Ġlup us
+s y
+Ġre ass
+ip t
+pl atin
+Ġmedic are
+Ġoff icial
+Ġphosph o
+Ġtend s
+Ġadip osity
+Ġfacilit ated
+Ġpseud o
+Ġdram atically
+Ġdeple tion
+Ġdock ing
+it ate
+Ġh ong
+um ental
+Ġafter wards
+Ġbr ca
+Ġachie vement
+Ġread ily
+Ġcad a
+Ġden aturation
+Ġentire ly
+Ġunc ommon
+Ġaer os
+Ġembry os
+Ġmicrobi ome
+Ġc ities
+Ġaccept ability
+Ġcav a
+Ġemphas ize
+Ġinoc ulated
+Ġm ca
+Ġto wn
+et ine
+Ġwork er
+Ġclass ifications
+Ġreveal ing
+Ġnucle otide
+Ġhypothes es
+Ġhypog lycemic
+Ġcis platin
+ol ism
+ot or
+Ġdis aster
+ost om
+Ġpos it
+Ġdet rim
+Ġtrans it
+Ġplac ing
+Ġmes en
+Ġdeform ation
+Ġelucid ated
+Ġswallow ing
+a peutic
+Ġm oving
+Ġre ject
+Ġex cel
+ment ation
+Ġgroup ing
+Ġgra y
+Ġcyt ochrome
+Ġorgan ism
+Ġevery day
+Ġig e
+Ġkeyword s
+i ro
+ist in
+ver t
+Ġintra c
+arm an
+Ġproper ty
+Ġprod uces
+Ġoptim ized
+Ġjud gment
+Ġreproduc ible
+Ġnav igation
+Ġg ree
+Ġsm art
+Ġret ic
+Ġcount y
+Ġradi ography
+Ġtransf usions
+Ġreser ve
+Ġr itu
+Ġat g
+Ġint ell
+ox ic
+Ġwork sh
+Ġcle aved
+Ġprogram mes
+Ġspe ech
+Ġritu ximab
+Ġw ent
+Ġb id
+Ġst ar
+Ġco exist
+Ġcov ariate
+Ġcam pa
+Ġtoler ability
+Ġgall ic
+onucle ar
+Ġb op
+il ed
+am b
+oc yst
+op re
+Ġsc d
+Ġnormal ization
+Ġrest ore
+Ġwr ist
+Ġtal k
+Ġarab ia
+Ġantid iabetic
+cephal us
+Ġcampa ign
+p op
+t es
+in ction
+Ġs ized
+Ġch in
+Ġcont amin
+Ġab ts
+Ġk ong
+Ġ3 5
+Ġret est
+Ġreact ivation
+Ġhere in
+Ġseal ed
+Ġamyl ase
+b ite
+Ġt ab
+it ating
+Ġinstr umental
+iot rop
+Ġswit ched
+Ġdeb ate
+Ġrheum atic
+Ġvulner ability
+Ġcomprom ise
+Ġnst emi
+Ġdyspe psia
+d d
+th ood
+ag land
+Ġper t
+Ġper ine
+Ġty g
+Ġprop olis
+Ġstaff ing
+Ġincid ents
+Ġedent ulous
+ag g
+Ġinter pro
+Ġsub un
+Ġtra p
+Ġwork s
+Ġprob iotic
+af enib
+Ġhighlight ing
+Ġtransduc er
+Ġdiagnost ics
+Ġc ul
+om onas
+Ġtr is
+unt ing
+Ġimmun ological
+Ġfluor oscopy
+Ġimmunosupp ression
+Ġdeco ction
+Ġv r
+Ġall ogeneic
+Ġro sc
+Ġchar ls
+ob arb
+Ġunivers ities
+Ġspe arman
+Ġtip s
+Ġencour aging
+Ġaver aged
+Ġrelaps ed
+Ġgath ered
+k en
+m oid
+u ation
+Ġst ems
+iz er
+Ġnot ch
+Ġconf lu
+Ġmen opausal
+Ġregist ries
+Ġcb f
+Ġacet one
+Ġdisp osition
+Ġthromboemb olic
+Ġto uch
+Ġenter ing
+Ġdrop out
+Ġdiver tic
+Ġretrie val
+Ġhippocamp al
+Ġweigh ed
+Ġc ros
+Ġf g
+Ġk m
+Ġtrans cribed
+Ġdr yness
+Ġprost agland
+Ġincorpor ating
+Ġia p
+Ġsurprising ly
+Ġkr us
+Ġmur ine
+Ġ ics
+ur a
+Ġinter vie
+Ġun less
+Ġeth anolic
+Ġcho ices
+Ġreferral s
+Ġrevers al
+Ġagon ists
+Ġdisappe ared
+Ġcollabor ative
+Ġpacem aker
+Ġintervie we
+Ġp bc
+Ġd izz
+if act
+Ġmon ol
+Ġsafe ly
+Ġtp o
+Ġlet ter
+ij ing
+Ġsacrific ed
+Ġout patients
+Ġwall is
+Ġging er
+Ġthromb otic
+Ġthor ac
+Ġstrict ly
+Ġappropri ately
+7 8
+c m
+Ġrec on
+Ġsimilar ities
+Ġimmun otherapy
+Ġadv ances
+Ġfamil ial
+Ġneph ropathy
+uls ion
+Ġargin ine
+Ġintell ig
+Ġt ang
+Ġo cular
+Ġb ap
+Ġb ind
+Ġr g
+ph thal
+Ġcol istin
+Ġrespond ent
+Ġ201 1
+Ġdeliv er
+Ġrect um
+Ġbrid ge
+Ġaspart ate
+Ġt u
+Ġcon vers
+ad ian
+Ġun m
+Ġen os
+Ġhospital isation
+Ġmo ist
+Ġmicro h
+Ġprior it
+Ġpelv is
+Ġcarcin omas
+Ġintoler ance
+Ġproxim ity
+Ġtav r
+Ġt aste
+Ġr ules
+em p
+Ġwor d
+Ġdiabet ics
+Ġmut ans
+Ġoperative ly
+Ġann ot
+Ġrob otic
+Ġpie ce
+Ġdepr ivation
+Ġmultifact orial
+Ġbe ijing
+Ġmod ules
 Ġintra vascular
-Ġintra vital
-Ġintra fibrillar
-Ġvi rolog
-Ġda ej
-Ġda ughters
-Ġevid ences
-Ġsl ap
-Ġsl imm
-Ġsl ime
-Ġang led
-Ġang elier
-Ġschool ers
-Ġmaj ored
-Ġpoint less
-Ġfe es
-Ġfe els
-Ġfe kon
-Ġfe aturing
-Ġfe ulgen
-Ġver nier
-Ġperce ptual
-Ġsens ed
-Ġsens ible
-Ġmat ters
-Ġmat su
-Ġmat lab
-Ġmat rig
-oid osis
-Ġep ic
-Ġep oxide
-Ġep oseal
-Ġep iinf
-Ġep istem
-Ġsol dered
-Ġsol vents
-Ġadhes in
-Ġadhes iveness
-ne il
-ne ys
-Ġconsist ence
-Ġred irection
-Ġwater y
-Ġmem orial
-sequ ently
-con sequently
-Ġnew tom
-Ġliter ate
-Ġliter ally
-man y
-ral e
-Ġhand grip
-Ġsing h
-Ġsing ular
-Ġmor k
-Ġmor gan
-Ġmor occo
-cept or
-sc o
-Ġvalid ations
-Ġcompl aining
-Ġcap nocyt
-Ġthick est
-Ġthick ened
-Ġimpact ing
-Ġprov inc
-Ġmoder ated
-Ġmoder ating
-Ġacid ophilus
-Ġref ute
-Ġref ining
-Ġhos ts
-Ġhos ted
-Ġrele ases
-Ġhum oral
-Ġhum ming
-Ġsoc ransky
-Ġhospital izations
-Ġwid owed
-Ġpoly urethane
-Ġsu fficiency
-Ġach ing
-Ġpa hel
-Ġpa ulista
-ou rous
-pe g
-Ġlab io
-Ġlab rale
-Ġoh io
-Ġlif elong
-Ġcrown ed
-Ġmicrob acterium
-vent ed
-Ġtum ourous
-Ġdevi ating
-omm a
-Ġu it
-Ġu icc
-Ġu rokin
-Ġaut oflu
-Ġaut osomal
-Ġhel ices
-Ġorder ly
-Ġret reated
+Ġoper ators
+Ġmicro array
+Ġoxid ase
+Ġconfirm atory
+Ġsupplement al
+Ġemot ion
+Ġphosphory lated
+Ġren in
+Ġknock down
+am ol
+Ġag ency
+Ġsp ray
+Ġtra ff
+Ġpred efined
+Ġcaus ative
+Ġimplant itis
+Ġventil atory
+Ġms cs
+Ġgel s
+Ġds m
+Ġoptim ization
+Ġald osterone
+Ġabbrevi ations
+Ġco ating
+Ġdifferent iating
+Ġincor rect
+Ġarr ang
+Ġlys ates
+Ġter rit
+Ġadvance ment
+Ġepic ardial
+Ġr in
+Ġis r
+Ġis oflurane
+Ġind uc
+Ġnot ing
+Ġtra ine
+Ġhf ref
+Ġthough ts
+Ġiv c
+Ġrins ed
+rastruct ure
+Ġ erg
+Ġs ure
+Ġres veratrol
+op ause
+Ġrel ate
+Ġfound ation
+Ġsim ulate
+Ġset up
+Ġdiet s
+Ġcp gs
+Ġdetect or
+Ġenrol ment
+Ġattribut es
+Ġulcer ation
+Ġaes thetic
+Ġantagon ists
+Ġdecompens ated
+Ġinterfer on
+Ġdizz iness
+in ase
+ur t
+Ġinfl iximab
+Ġmechan ically
+Ġvent ral
+Ġda a
+Ġart ifact
+Ġcongest ive
+Ġbab y
+Ġgenoty ping
+Ġs and
+Ġre ly
+Ġre ality
+Ġmod ulating
+Ġct x
+Ġadh erent
+Ġdis m
+Ġdes irable
+Ġwhere by
+Ġchild birth
+Ġmucos itis
+Ġmeet ings
+Ġfr uct
+Ġmesen chymal
+4 3
+Ġ ;
+on azole
+Ġr uled
+Ġco vers
+Ġbi ases
+Ġimp ly
+Ġcirc adian
+Ġmanip ulation
+alid omide
+Ġdan ish
+Ġd air
+Ġro pivacaine
+Ġdr ive
+Ġps m
+Ġassay ed
+Ġpass age
+Ġapplic ability
+y cline
+Ġap par
+Ġno vo
+Ġop ened
+Ġtn m
+Ġsearch ing
+radi ol
+Ġmyel oid
+Ġdecomp ression
+Ġalkal oids
+Ġf ash
+am ents
+ac ryl
+Ġprof ound
+Ġpsych otic
+Ġ7 0
+Ġrepl ace
+Ġtradition ally
+Ġsecre ted
+Ġassign ment
+Ġtur key
+Ġconven ient
+Ġdissatisf action
+Ġdetrim ental
+on y
+en yl
+Ġl ag
+Ġg w
+Ġfor amen
+Ġcon g
+Ġgen us
+Ġtra in
+Ġexhaus tion
+f c
+n es
+Ġst ays
+oc a
+Ġap oa
+Ġ3 7
+Ġemerg ent
+Ġwa it
+Ġhydro cephalus
+Ġassist ant
+Ġpap ill
+Ġresus p
+Ġacad em
+Ġdispar ities
+Ġappar atus
+, .
+Ġp ill
+Ġm ist
+ak ers
+Ġser ves
+ri age
+Ġstress es
+Ġprior i
+Ġsmok er
+Ġmut ated
+Ġshe et
+och rom
+Ġsd f
+Ġcompet ency
+Ġdescript ions
+tt es
+Ġapparent ly
+Ġanesthesi ologist
+m m
+t w
+Ġtw in
+Ġpost pr
+Ġdisc ard
+Ġstrength ening
+Ġtit les
+Ġillust rate
+Ġcatal ase
+Ġcholang itis
+Ġphenoty pic
+6 3
+Ġa o
+Ġf h
+Ġad ul
+Ġam h
+Ġtrans th
+Ġcalc ified
+Ġcontinu ity
+Ġrelie ve
+Ġord inal
+Ġexacerb ation
+Ġorthodont ics
+prot ective
+Ġcontra cept
+c ore
+o let
+Ġind ian
+Ġnum b
+Ġcoll apse
+Ġpt c
+Ġreconstr ucted
+Ġauthor ities
+Ġgli oma
+Ġimmunost aining
+Ġpostpr andial
+Ġth ail
+Ġl av
+Ġcont em
+Ġtim i
+te g
+ps in
+Ġhs a
+Ġhm g
+Ġsuppl ied
+Ġspectrom etry
+Ġingest ion
+Ġcorrob or
+Ġkrus kal
+Ġthail and
+re x
+Ġf os
+Ġd g
+Ġb h
+om andibular
+Ġsub opt
+Ġcor ne
+Ġstr ip
+gen ic
+Ġexer ts
+Ġx er
+Ġprote ase
+Ġodont ogenic
+Ġny ha
+Ġr me
+Ġout li
+Ġep ds
+Ġmo unted
+Ġradi ol
+Ġback ward
+Ġlum inal
+Ġacceler ated
+Ġinnov ative
+ab p
+Ġcont our
+ph osph
+ie f
+ococ cal
+Ġaneurys ms
+Ġsubset s
+Ġsubc ateg
+Ġderiv atives
+Ġarchitect ure
+b orn
+Ġb ca
+Ġref us
+erg ent
+Ġsyn th
+Ġmus ic
+Ġ20 22
+Ġstrength en
+Ġconsecut ively
+Ġthorough ly
+Ġtyros ine
+Ġmicrocirc ulation
+Ġprecurs or
+Ġase ptic
+Ġome ga
+Ġf ire
+Ġdur ations
+Ġvis ually
+Ġes c
+Ġcycl ing
+Ġrepeated ly
+Ġpass ing
+Ġkeratin ocytes
+Ġtoothbrush ing
+Ġimmers ion
+d ered
+Ġt j
+Ġdi am
+Ġant ip
+Ġmeth anolic
+Ġcompar ability
+Ġcontinu es
+Ġcycl ic
+Ġdim ethyl
+Ġturn ed
+Ġperf or
+Ġprecise ly
+Ġregul ator
+Ġappend ic
+Ġcert ified
+Ġm ib
+Ġex ogenous
+ot ed
+Ġtrans amin
+Ġps i
+Ġhemat opoietic
+Ġrun x
+Ġuter us
+Ġm astic
+Ġb ot
+Ġh ub
+Ġad s
+end ocrine
+Ġsome one
+Ġintra m
+omet abolic
+iot omy
+Ġcop per
+Ġanch orage
+Ġpresum ed
+Ġplex us
+Ġs j
+Ġd ial
+Ġhy al
+Ġprol actin
+Ġmedi ator
+Ġja und
+Ġinterd ental
+Ġcrani ofacial
+Ġrac ial
+Ġdysph agia
+b ow
+u ing
+Ġc fa
+Ġinc on
+Ġlow ered
+Ġconf usion
+Ġhem ostasis
+Ġcre ation
+Ġhypoth al
+Ġelectro de
+Ġpock ets
+Ġtrigg ers
+Ġsubopt imal
+Ġg g
+Ġr ca
+Ġmed line
+Ġconf erence
+Ġi at
+Ġfe v
+Ġdoc uments
+isol one
+Ġinequ ality
+Ġih c
+Ġsyring e
+Ġobli que
+Ġy es
+Ġwork force
+Ġaut ops
+Ġapp et
+Ġphen ol
+Ġcp g
+Ġindust ry
+Ġwebs ite
+Ġt ic
+Ġl ge
+Ġv ort
+Ġgener ic
+Ġlab our
+Ġpol ishing
+Ġtun el
+Ġrid ge
+Ġhistor ical
+p ore
+w t
+Ġw it
+og ly
+Ġcor pus
+Ġpot ency
+Ġaffect ive
+Ġheart s
+orb ent
+Ġradi us
+Ġnod ule
+Ġhard ness
+Ġfram ing
+Ġdiscrimin ate
+Ġattain ment
+Ġconfig uration
+Ġfash ion
+ut ation
+Ġmult ipl
+Ġes thetic
+Ġrh iz
+Ġosteopor otic
+Ġrr na
+Ġcus p
+Ġcannab is
+" ,
+Ġ ud
+Ġg em
+Ġde xt
+Ġstat a
+Ġfin nish
+Ġtra m
+Ġadd iction
+Ġhc ps
+Ġdil utions
+Ġexhib its
+Ġpol it
+a que
+d c
+Ġo esophageal
+Ġac uity
+Ġmet rics
+Ġsp p
+Ġval ves
+Ġbel g
+Ġaltern atives
+Ġpept ic
+Ġstimul ates
+Ġexce ed
+Ġsuppress ing
+Ġverteb ra
+Ġbound ary
+Ġchromos omal
+Ġadul thood
+Ġappet ite
+s d
+ati bility
+Ġim per
+ros p
+Ġsp ut
+other apeutic
+Ġpa h
+Ġlab ial
+ick ing
+bs i
+Ġfung i
+Ġempow er
+2 6
+Ġs gl
+Ġw at
+Ġto ld
+im inant
+ol ia
+Ġv es
+Ġr utin
+ver ted
+Ġap ob
+ici encies
+Ġgl a
+Ġop g
+Ġfra g
+Ġlength s
+rit ic
+Ġemploy ing
+Ġrepl ic
+az ine
+Ġdiscr iminant
+Ġgradu ate
+Ġcharls on
+Ġresusp ended
+Ġsgl t
+o active
+Ġt unnel
+Ġm erg
+Ġper ceive
+Ġmod ify
+Ġimpact ion
+ir s
+Ġinf ertility
+Ġant rum
+Ġar s
+Ġbi ased
+Ġfib rotic
+Ġbacter icidal
+Ġsch olar
+Ġhand le
+Ġpersist ed
+Ġfollic ular
+acc ur
+Ġcircumf erential
+j e
+Ġt ell
+Ġt urb
+Ġth r
+on ins
+Ġme als
+Ġstr ing
+urren ces
+Ġz h
+Ġcir cle
+Ġce a
+Ġfd a
+Ġintr usion
+Ġconstit ute
+chlor ide
+Ġjaund ice
+c ast
+k et
+Ġl ac
+Ġbe ver
+Ġint akes
+Ġstr and
+Ġacid ic
+Ġseiz ures
+Ġscler osis
+Ġlncr na
+iaz ep
+Ġappra isal
+Ġecz ema
+b t
+ic o
+Ġgen ital
+Ġrespon ding
+oles ter
+Ġpal m
+Ġhemat ologic
+Ġdepend ency
+Ġspl int
+ococ ci
+Ġbreak down
+Ġrig orous
+Ġdele tion
+Ġs aps
+Ġin accur
+Ġg ins
+ult s
+Ġhypert rophic
+Ġdec ide
+Ġhypox ic
+Ġcf u
+Ġtheoret ically
+Ġdegen erative
+Ġdepos its
+Ġbup ivacaine
+Ġanaer obic
+Ġsynov ial
+Ġpoison ing
+Ġmastic atory
+Ġt one
+Ġf ell
+Ġre form
+im eter
+Ġat or
+ard s
+Ġmay be
+ric ts
+Ġconf er
+Ġtechn ici
+Ġfib ro
+Ġmen opause
+Ġos c
+Ġga uge
+Ġstent ing
+Ġge ometry
+Ġroc uronium
+Ġbenz od
+Ġamput ation
+Ġs g
+Ġp un
+Ġd ip
+Ġed ition
+Ġguid ing
+Ġir r
+Ġsmok ed
+Ġadh ere
+Ġchallen ged
+Ġlv h
+Ġaden osine
+ethyl ene
+Ġdw elling
+4 8
+Ġt ig
+Ġd end
+ar ance
+id ium
+Ġas ct
+am a
+ad a
+ich ia
+Ġdist ricts
+Ġem ail
+Ġhf nc
+Ġtemper atures
+Ġnh anes
+Ġiniti atives
+Ġtransth oracic
+w d
+Ġat l
+pl anned
+Ġsub gingival
+ox etine
+Ġcardi ometabolic
+Ġresearch es
+Ġvis c
+Ġens ured
+Ġmc p
+Ġcompet ing
+os ites
+ig ens
+ok ing
+Ġshort age
+Ġann ually
+Ġcongest ion
+Ġimmuno assay
+opos terior
+Ġbrad ycardia
+Ġineffect ive
+Ġbenzod iazep
+v ac
+Ġo phthal
+Ġc ured
+Ġb w
+Ġra ys
+Ġlab eling
+Ġplac es
+Ġpel let
+Ġfore arm
+arb onate
+Ġappend ix
+Ġresident ial
+acet amol
+Ġconfident ial
+Ġvig orous
+Ġpolyphenol s
+pore al
+p v
+er ved
+or us
+Ġh us
+Ġl ax
+Ġr ash
+Ġres ten
+Ġsp ar
+Ġes cher
+Ġsol ub
+Ġvolum etric
+Ġve ter
+Ġrespons ibilities
+Ġsleep ing
+Ġprox y
+Ġmanufact uring
+Ġbelong ed
+f ord
+p d
+er ated
+Ġd anger
+Ġh ors
+Ġh ole
+Ġro i
+Ġpar acetamol
 Ġret inal
-Ġlight ening
-Ġlight wal
-Ġsuper position
-Ġsuper oin
-Ġsuper ius
-Ġsuper infection
-Ġcephal ostat
-Ġmucos itits
-Ġfam ous
-Ġlas ts
-erg lass
-vir als
-vir idae
-Ġlay out
-Ġdig ora
-Ġimmun ization
-Ġimmun otherapy
-Ġimmun izations
-Ġimmun omod
+Ġinh ab
+Ġcollect ive
+Ġtele med
+Ġneon ates
+Ġphysi ologic
+Ġhyperth yroidism
+Ġbever ages
+Ġescher ichia
+r ically
+Ġo roph
+Ġp up
+Ġm ere
+rol imus
+Ġsp ite
+Ġfir m
+ov ir
+Ġmedic aid
+Ġexhib iting
+Ġintr ath
+Ġdisadvant ages
+Ġbap wv
+7 5
+Ġp j
+Ġre ble
+im etry
+th is
+Ġcomm ents
+Ġgood ness
+Ġbo ot
+Ġcb t
+Ġvirus es
+Ġdos ages
+Ġcx cl
+ur red
+Ġcom a
+Ġper ox
+ard ness
+Ġassess es
+ogen icity
+Ġel bow
+Ġrecommend s
+Ġchem o
+Ġmak ers
+Ġbirth s
+rig lycer
+Ġcomplain t
+Ġappendic itis
+Ġbelg ium
+in yl
+Ġa rom
+Ġex cis
+Ġun e
+Ġsp ots
+Ġma f
+Ġatt rition
+Ġinstr uct
+Ġpros theses
+Ġvas oconst
+Ġana emia
+Ġmis di
+Ġtransport ed
+Ġconver ting
+Ġobst et
+Ġobst ac
+Ġdisagre ement
+Ġrin se
+Ġv est
+Ġcomp osites
+ri o
+Ġ3 2
+Ġlack ed
+imum ab
+ocy an
+Ġcement ed
+Ġdepos ited
+Ġvict ims
+Ġmicroh ardness
+Ġator vastatin
+Ġret ire
+Ġlymph aden
+Ġmetabol ite
+Ġhom ozygous
+Ġhemod ialysis
+Ġoffer ing
+Ġencod ing
+Ġadjunct ive
+Ġreadm issions
+v it
+Ġb ank
+Ġcas p
+obacter ium
+e z
+Ġp urs
+ad ol
+Ġgl as
+Ġmult in
+Ġterm ination
+Ġprotein uria
+Ġop ac
+Ġloss es
+Ġhelp ing
+Ġprovin ces
+on ed
+Ġin sec
+Ġinfl ation
+ox icity
+Ġdisc ol
+yn thesis
+Ġfl oss
+Ġhypert riglycer
+Ġct a
+Ġhb e
+Ġoxid ant
+Ġpd a
+Ġvac cin
+Ġincor poration
+Ġgynec ological
+o ea
+Ġnot ion
+art an
+Ġk y
+Ġun em
+Ġmed iate
+Ġout flow
+Ġdist inction
+Ġmechan ics
+Ġsl ide
+Ġmac roscopic
+Ġhom ogenous
+Ġnorm s
+Ġslow ly
+Ġlook ed
+Ġfish er
+Ġantipsych otic
+t r
+Ġ rome
+Ġe ther
+Ġper mission
+Ġpl ated
+Ġund et
+Ġest radiol
+Ġneg lig
+Ġcolor imetric
+Ġdisrup t
+Ġeros ive
+Ġhous ed
+j et
+l it
+Ġf b
+Ġg ather
+id azole
+Ġcr s
+Ġcam p
+Ġsupp osed
+Ġneuro endocrine
+Ġgly cer
+Ġarr anged
+Ġsul ph
+Ġaber rant
+Ġidi opathic
+in o
+Ġw ires
+Ġsub pop
+Ġtrans por
+omm od
+Ġfm d
+Ġeti ologies
+Ġresten osis
+b as
+Ġa lex
+Ġd ab
+Ġb c
+ent ric
+Ġeduc ators
+Ġfed eral
+en oid
+Ġw ish
+Ġg ar
+Ġcom ing
+Ġi hd
+Ġmyoc arditis
+ploy ment
+Ġgi ant
+Ġpig s
+Ġug anda
+Ġarrow s
+cor poreal
+Ġcim t
+h ran
+Ġt rough
+Ġdis k
+Ġun planned
+Ġradi ology
+Ġsed ative
+Ġneurolog ic
+Ġasa h
+Ġhomogen ized
+Ġorific e
+Ġintellig ence
+Ġunder weight
+Ġbi ology
+Ġver ification
+Ġplac enta
+Ġadop tion
+Ġstrom al
+ostom ia
+Ġv on
+Ġpre v
+Ġfl ora
+Ġthem atic
+Ġsol vents
+Ġct ni
+load ed
+Ġwar ning
+Ġcontraction s
+Ġaw ake
+Ġconceal ment
+Ġimmunocomp rom
+Ġgast rectomy
+Ġshort ened
+Ġheter ozygous
+Ġeng land
+Ġov a
+Ġimmunos orbent
+Ġprogressive ly
+Ġfollic les
+Ġsensit ization
+Ġfasc ia
+Ġtelemed icine
+w f
+Ġand rogen
+port ed
+Ġk u
+terol ateral
+Ġproblem atic
+Ġscal p
+Ġbif ur
+sacchar ide
+Ġumb il
+Ġxer ostomia
+Ġframing ham
+Ġw b
+ar ith
+Ġch ief
+Ġne a
+Ġap s
+Ġic a
+Ġta vi
+Ġmis car
+Ġcomfort able
+Ġeuth an
+k b
+p i
+Ġd ka
+ra c
+Ġal arm
+ub icin
+Ġstr i
+Ġpost natal
+Ġexpl ains
+Ġic g
+Ġmicro d
+Ġfib rom
+Ġer a
+Ġput ative
+Ġcarri er
+Ġseas on
+Ġdissem ination
+Ġvacu um
+Ġtraject ory
+Ġlen alidomide
+m arin
+w th
+Ġt ag
+Ġb ark
+if erative
+Ġat rophic
+Ġpost ulated
+Ġsuggest ions
+Ġang ulation
+Ġvers ions
+Ġlog arith
+Ġib m
+Ġalign er
+Ġanaes thetic
+Ġorthop a
+itin ib
+Ġfre ed
+Ġt ill
+Ġm ism
+Ġl atin
+ith romycin
+Ġun pa
+Ġar f
+ob l
+Ġsec ure
+Ġcap abilities
+Ġreli ably
+Ġfacilit ates
+Ġneoplas ia
+Ġfiss ure
+Ġm ath
+Ġres erv
+Ġim ip
+ous ly
+Ġam ox
+amic in
+Ġclean ed
+Ġpolymer ization
+Ġmalays ia
+w ell
+Ġa ac
+Ġs st
+Ġb ag
+Ġh ac
+el iness
+Ġte e
+Ġgre y
+Ġstress ed
+Ġmeta plasia
+Ġhs cr
+chol ine
+Ġsc ene
+Ġtrans c
+Ġsix th
+Ġes ter
+Ġdispl ays
+Ġcav ities
+Ġmanifest ed
+Ġeryth ema
+Ġpreser ve
+Ġdistinguish ing
+Ġnlr p
+Ġanticoagul ants
+Ġbrid ging
+Ġanter oposterior
+Ġdecid uous
+Ġirre vers
+Ġinhab it
+at c
+Ġo k
+Ġec onom
+Ġstain less
+Ġtry psin
+e it
+Ġw d
+Ġde ce
+Ġk le
+Ġun met
+Ġphen yl
+Ġta u
+Ġx anth
+Ġtrache a
+Ġcorrespond ed
+raz ol
+Ġlith ium
+Ġsuc rose
+Ġcorne al
+t ures
+in form
+Ġd iph
+ant om
+Ġass emb
+Ġhe avi
+Ġtre g
+Ġj ia
+Ġform ulated
+Ġta pe
+Ġla a
+Ġcertain ly
+Ġskill ed
+Ġwave form
+Ġns cl
+Ġtempor omandibular
+Ġlet ters
+health y
+Ġtann ins
+ocice ptive
+Ġinterviewe es
+Ġtraff ic
+oc omial
+Ġrep ub
+Ġloc us
+Ġbm p
+Ġsw ab
+Ġinteg ral
+Ġnas oph
+Ġcomprehensive ly
+Ġhaem odynamic
+Ġcompens ation
+adj uvant
+Ġmess age
+Ġimmunocomprom ised
+Ġth read
+Ġs ore
+am us
+Ġinter observer
+ath ic
+Ġem r
+oper itoneum
+Ġinh er
+Ġpseud omonas
+Ġneoplas m
+Ġdichotom ized
+Ġneo adjuvant
+Ġc ub
+Ġst s
+Ġcomm ission
+ov irus
+Ġsw iss
+Ġaccompan ying
+Ġnos ocomial
+Ġboot st
+ed ical
+il is
+Ġneuro de
+Ġrevers ible
+Ġclaim ed
+Ġn l
+Ġad r
+Ġle uc
+Ġpl ain
+Ġmal t
+Ġextra corporeal
+Ġfacilit ators
+Ġvar ices
+Ġauthor ity
+Ġtetra cy
+Ġdog s
+Ġt am
+en viron
+Ġn ih
+ac illin
+Ġinf rastructure
+Ġro se
+Ġfl are
+Ġopt ic
+Ġcre am
+Ġplac ental
+Ġinterpre ting
+Ġcouns elling
+Ġacupoint s
+Ġ xi
+Ġto day
+ce in
+Ġv ox
+ren al
+Ġfac ing
+Ġben ch
+Ġrestrict ive
+Ġsubt ract
+Ġnea rest
+Ġs sa
+it or
+Ġl g
+os an
+Ġme x
+Ġdi hyd
+Ġsp aring
+Ġep igen
+Ġmen is
+Ġda pt
+Ġcad m
+Ġcontex ts
+Ġnat ri
+Ġderm al
+Ġcigare ttes
+Ġcholecyst ectomy
+Ġhbe ag
+t ured
+is ters
+Ġl ved
+Ġmod ifying
+Ġj o
+Ġeffic ac
+az one
+rot omy
+Ġgran ules
+Ġclar ified
+Ġinnov ation
+Ġantipsych otics
+Ġp ms
+Ġdet ach
+Ġbi ote
+Ġsp aces
+Ġroom s
+Ġann ulus
+Ġrd w
+Ġlearn ed
+Ġcholang i
+Ġgent amicin
+Ġcontradict ory
+Ġrepub lic
+Ġbootst rap
+Ġs ab
+Ġc iv
+Ġb un
+Ġsc a
+ox ib
+Ġmicro environ
+Ġ5 5
+Ġendoscop e
+Ġrad ix
+Ġgu ardi
+opro st
+Ġden mark
+Ġnp v
+Ġdisadvant age
+raph y
+Ġaga rose
+Ġvib ration
+Ġ ild
+ith elial
+ens ions
+Ġmod elling
+Ġte hran
+Ġend ovascular
+Ġterm in
+Ġang ular
+Ġalb eit
+Ġmp o
+Ġdiscre tion
+Ġadminister ing
+Ġencephal opathy
+Ġbrom ide
+m al
+Ġe z
+om otor
+am ins
+Ġacc ommod
+Ġant igens
+Ġknow ing
+Ġ3 8
+Ġrep orter
+ec an
+Ġgly ca
+Ġtrache ostomy
+Ġdistingu ished
+Ġfri end
+Ġju ice
+Ġbact eremia
+Ġreserv o
+Ġb ph
+Ġn ose
+Ġac ne
+Ġab l
+Ġmed iation
+Ġcardi o
+Ġi ad
+Ġfl ush
+Ġrev isions
+Ġport ug
+Ġpac o
+Ġsy br
+Ġcomputer ized
+Ġvort ex
+Ġamox icillin
+ure tic
+Ġle gs
+Ġun healthy
+Ġro ck
+Ġpract icing
+Ġyo uth
+Ġintro duce
+Ġbiom edical
+Ġhom oc
+Ġtransplant ed
+Ġcheck ing
+Ġvar us
+Ġ200 8
+Ġeryth rocyte
+Ġiniti ative
+Ġking dom
+stand ing
+Ġchemilumines cence
+Ġantithromb otic
+Ġp ix
+or ig
+Ġd in
+oc rit
+Ġk el
+cl onal
+Ġdise ased
+Ġup stream
+Ġz e
+Ġpsych osis
+Ġseal ant
+Ġba ical
+Ġexec utive
+Ġcoron avirus
+cha emic
+om ies
+ut s
+Ġbe g
+Ġinst ances
+Ġdent inal
+Ġbr it
+Ġsal mon
+Ġeng ine
+Ġsig moid
+d ers
+ur nal
+os oph
+Ġas perg
+Ġr fs
+Ġsc aff
+ber ry
+Ġdel phi
+Ġig m
+Ġsurviv ing
+Ġpredom inance
+Ġendoc rin
+Ġparamed ics
+Ġips ilateral
+Ġasperg ill
+Ġa j
+at eness
+os omes
+Ġis chaemic
+Ġsc int
+Ġpr ur
+ros thetic
+Ġobser ving
+Ġapproach ed
+Ġ6 7
+Ġrecogn ised
+Ġmedi ast
+Ġinhal ed
+Ġphysi otherapy
+Ġmism atch
+n um
+Ġper tain
+ac ing
+rol iferative
+Ġtest is
+Ġunder l
+Ġes pb
+Ġz eal
+Ġmicro gl
+Ġ9 5
+Ġspect ral
+Ġna ocl
+Ġinact ivation
+Ġacadem y
+p re
+at ite
+Ġp pe
+an i
+Ġinc ent
+Ġnon c
+Ġmic ron
+Ġocc lud
+Ġprot on
+Ġca ut
+Ġpoly ethylene
+Ġrespons ive
+Ġnod ular
+Ġangi ogenic
+Ġproject ion
+Ġcit rate
+Ġaugment ed
+Ġfollic le
+Ġsubstit ute
+Ġvasopress ors
+Ġbic arbonate
+Ġmaneu ver
+Ġskew ed
+Ġd vt
+Ġm ol
+Ġre operation
+Ġl f
+th romb
+iz ol
+Ġcl one
+Ġte x
+Ġra ising
+Ġprog en
+av ir
+Ġic am
+Ġsummar izes
+Ġchol est
+Ġfif teen
+Ġextr usion
+Ġcontraind ications
+Ġfetus es
+r ug
+Ġmod ifiable
+ice al
+ok ine
+Ġet ching
+Ġthird ly
+Ġpow ered
+Ġcv ds
+Ġtens ile
+Ġaeros ol
+Ġautops y
+Ġinhabit ants
+Ġt ender
+Ġs ati
+Ġind ones
+Ġcan cell
+Ġant itum
+Ġcol ored
+Ġpar ity
+Ġcir cular
+Ġprol apse
+Ġcarcin ogenesis
+Ġhous ing
+Ġcred ibility
+razol ium
+orig inal
+Ġzeal and
+8 7
+b ul
+t ail
+Ġt q
+Ġat f
+Ġser ving
+Ġsecond s
+ov able
+Ġcomb ine
+Ġintraoperative ly
+Ġrh d
+Ġvacc ines
+Ġber ber
+Ġth ai
+Ġd ressing
+ith iasis
+op rotective
+Ġtable t
+Ġ5 2
+fer ol
+Ġge ometric
+Ġexact ly
+Ġunderestim ation
+Ġweigh ing
+omeg aly
+Ġmicroenviron ment
+Ġm th
+Ġb od
+Ġup r
+Ġser ological
+Ġnew born
+Ġneuro pathic
+Ġjust ified
+Ġbackground s
+Ġeryth emat
+Ġosteoc lasts
+Ġattack s
+Ġcontem por
+Ġm ics
+ar an
+ig uous
+am psia
+Ġj ug
+Ġpoly clonal
+Ġmr nas
+Ġalong side
+Ġseal ing
+Ġbul k
+Ġfreed om
+Ġhomoc ysteine
+6 2
+Ġf us
+ol izumab
+Ġr fa
+Ġim ag
+Ġse eds
+ial s
+Ġpre clinical
+ak ed
+Ġsym met
+Ġtherap ists
+Ġvital ity
+Ġpriv acy
+Ġirradi ated
+Ġcros so
+Ġd cs
+Ġl us
+Ġab original
+ari o
+Ġactiv ator
+Ġend ors
+Ġdef iciencies
+ex pl
+Ġed ges
+Ġauth ent
+Ġdeliv ering
+Ġgingival is
+Ġdra wing
+Ġpsori atic
+Ġshr ink
+Ġconstra ints
+Ġequilib rium
+Ġdece ased
+4 7
+Ġth ous
+Ġc ages
+Ġd y
+Ġpro ms
+Ġk l
+ach es
+oth ing
+Ġtotal ly
+Ġel ong
+Ġps c
+Ġnod al
+Ġrele asing
+Ġlt c
+Ġinequ alities
+Ġcra ck
+Ġsynchron ous
+Ġsalv age
+Ġsynth ase
+Ġc ens
+Ġin verted
+ol a
+Ġinf used
+Ġun us
+Ġprof iling
+Ġquantitative ly
+Ġinfilt rate
+Ġinoc ulum
+Ġmening i
+Ġhyperch olester
+Ġnatri uretic
+Ġl u
+Ġle is
+ps cs
+Ġfree ze
+amin ophen
+Ġacet aminophen
+Ġinteract ive
+Ġlamin a
+at o
+ic um
+Ġd ash
+Ġh an
+lect omy
+Ġlab elled
+Ġcirc uit
+Ġaccum ulated
+oe ch
+Ġlys ed
+Ġnarrow ing
+Ġglucocortic oids
+Ġretin opathy
+Ġphil osoph
+Ġradiol uc
+Ġwit ness
+re w
+Ġs ock
+Ġres emb
+ver ty
+Ġmet ron
+Ġpo verty
+Ġover jet
+Ġcare rs
+Ġmon onuclear
+Ġprop ria
+Ġpd t
+orrh ea
+lip id
+Ġmis class
+Ġss i
+Ġhu ge
+Ġslow er
+Ġmyel oma
+Ġelast icity
+Ġpie ces
+Ġneglig ible
+Ġleis ure
+3 3
+x imal
+Ġt ors
+ib er
+na ec
+Ġmic ror
+Ġz o
+Ġweight ing
+Ġeng aging
+Ġalternative ly
+Ġka emp
+utin ib
+Ġmalform ations
+Ġt anz
+Ġch el
+ult ural
+Ġbl and
+Ġorgan isation
+iel ding
+Ġu rolog
+Ġaccess ing
+Ġacqu ire
+Ġfluor id
+Ġstre am
+Ġorthodont ists
+Ġlncr nas
+Ġdysreg ulation
+Ġiat rogenic
+Ġirrevers ible
+6 9
+at onin
+Ġl ies
+Ġwork flow
+Ġsearch es
+Ġbio availability
+Ġpel lets
+Ġswit zer
+Ġarg ue
+Ġconsolid ation
+Ġglucos idase
+Ġdiscard ed
+Ġexcis ed
+Ġswitzer land
+Ġt ma
+Ġa ip
+is ph
+ar r
+Ġbe ats
+Ġde h
+Ġtrans duction
+ogn athic
+Ġanxi ous
+ploy ed
+Ġcryst als
+teg ration
+Ġgla uc
+Ġa pt
+Ġf is
+Ġal f
+Ġqu int
+Ġman us
+Ġsmall est
+Ġcd c
+Ġnat urally
+Ġwr ong
+arc oma
+Ġsel en
+r l
+Ġs aving
+Ġas ians
+Ġv ene
+Ġr iva
+Ġtre m
+ap ine
+Ġsp orad
+Ġct o
+Ġent ity
+Ġ6 5
+Ġcm l
+Ġcaps ules
+Ġgy naec
+k i
+Ġc ensus
+Ġper iton
+one ph
+ric es
+chan ter
+Ġjud g
+Ġpreser ving
+Ġindust rial
+Ġappropri ateness
+Ġtyros inase
+Ġgon ad
+Ġub iqu
+Ġirr itation
+Ġstri king
+Ġkaemp ferol
+Ġa uro
+or ubicin
+ce ae
+Ġag en
+Ġi ra
+duct ase
+Ġir s
+Ġdiffer ing
+Ġmel atonin
+Ġblot s
+Ġorigin ating
+Ġcollect ively
+imm ing
+teb ral
+Ġren der
+Ġrobust ness
+Ġprotect ing
+Ġrepet itive
+Ġaet iology
+Ġc age
+Ġpro of
+Ġhs v
+12 5
+Ġintravenous ly
+Ġsph er
+Ġthrombo lysis
+Ġcin nam
+Ġnation ally
+eterm ined
+Ġsubun it
+Ġcrosso ver
+p rit
+Ġk en
+Ġk ras
+Ġwor ry
+Ġsp end
+Ġend odont
+ici ently
+Ġpar k
+Ġsummar ised
+Ġalbumin uria
+Ġlapa rotomy
+Ġimmers ed
+Ġsevent y
+Ġabras ion
+Ġt ons
+Ġc yl
+Ġb atter
+ardi ac
+Ġconf ined
+Ġimmun od
+Ġinflu ential
+Ġresid ues
+Ġdiss ected
+Ġvisual ize
+Ġallevi ated
+avail able
+Ġstret ching
+how ever
+Ġguarant ee
+Ġo gtt
+Ġh op
+Ġn ations
+om ed
+Ġpro thromb
+am ines
+Ġph q
+Ġph ag
+Ġdef ec
+Ġpredict s
+Ġvis ibility
+Ġ200 9
+Ġneurot rans
+Ġsor afenib
+Ġsput um
+Ġhypertriglycer idemia
+f h
+l c
+l ass
+x ine
+Ġn al
+Ġr ice
+am ph
+Ġres um
+ia e
+Ġexp enses
+Ġquestion ed
+Ġvol atile
+gro wth
+Ġcy an
+Ġopt imum
+Ġut i
+Ġangi oplasty
+Ġrank ing
+Ġald rich
+Ġinterd isciplinary
+Ġjejun um
+s i
+u i
+w l
+Ġa ur
+iff erent
+ep ithelial
+Ġdisc ord
+olar ization
+Ġdecl ared
+Ġdiast ole
+Ġprec on
+Ġ19 9
+Ġconsult ed
+Ġbond ed
+Ġremed ies
+c ip
+m ap
+in one
+Ġc cr
+Ġp cc
+ur able
+Ġk ary
+Ġtr ying
+Ġun int
+Ġperform ances
+Ġem d
+Ġimp lying
+Ġ4 6
+az an
+Ġdp p
+Ġcit iz
+Ġmonol ay
+Ġsubcateg ories
+ul ose
+et te
+ter ious
+Ġdi i
+Ġrel uct
+Ġun expl
+Ġol ds
+Ġpotential s
+Ġmix ing
+Ġabsorb ed
+Ġseal er
+Ġrabb its
+Ġoccas ionally
+Ġphytochemical s
+Ġreject ed
+Ġcadm ium
+Ġperiton itis
+Ġs ily
+Ġf arm
+Ġd ying
+Ġcomp uls
+Ġpl ug
+Ġbi otin
+Ġeff iciently
+Ġweak er
+Ġsha ft
+Ġfr ank
+Ġcovari ance
+Ġdiarrh oea
+Ġcada ver
+Ġreble eding
+Ġh cl
+Ġr ns
+um ann
+op oly
+Ġap oe
+Ġk b
+Ġwhen ever
+Ġpe ers
+Ġintra hepatic
+ax el
+Ġprolif er
+Ġneuro protective
+Ġlink ing
+Ġcontext ual
+Ġasym met
+iabet es
+acill i
+Ġath let
+Ġdiam ond
+Ġbifur cation
+Ġorthopa edic
+Ġagen esis
+Ġt ent
+er ad
+or ax
+ud ine
+Ġat opic
+Ġad opt
+ffect ed
+Ġz yg
+Ġcir cr
+Ġ4 2
+Ġcer am
+Ġta per
+Ġdeliv eries
+Ġpc p
+Ġantimicrobial s
+Ġhd ac
+Ġplasm ids
+rox aban
+Ġpara form
+Ġcoagul opathy
+Ġretire ment
+Ġriva roxaban
+ro le
+om ers
+ist ar
+Ġdis ab
+Ġtr ypt
+Ġro ad
+Ġbi olog
+Ġ2 64
+Ġend otox
+Ġkn ew
+Ġhyper al
+Ġet oh
+Ġimmun obl
+Ġnew s
+Ġ4 7
+Ġload s
+Ġintegr ative
+Ġelectroph ys
+Ġmanufacture rs
+Ġtraine es
+Ġal ert
+Ġcl amp
+Ġtr izol
+Ġph aryngeal
+Ġser a
+Ġdr illing
+Ġdevelop s
+Ġox al
+Ġincis al
+Ġden otes
+Ġtip ping
+Ġbroad ly
+Ġbronch ial
+Ġhol ding
+Ġinconsist ency
+Ġsubstr ates
+Ġdele terious
+Ġreinfor ce
+Ġmitig ate
+Ġcct a
+Ġcatechol amine
+Ġartifact s
+p ine
+Ġo val
+Ġm bc
+Ġg st
+Ġis lets
+Ġcl ock
+Ġant im
+Ġprog ressed
+Ġkn ees
+Ġfig s
+Ġemerg encies
+Ġdispl aced
+Ġadequ acy
+Ġinfilt rating
+Ġmp v
+Ġgp x
+Ġmil itary
+Ġclar ity
+Ġng al
+Ġacknow ledge
+Ġpresum ably
+Ġlaryng oscopy
+Ġureth ral
+Ġtram adol
+Ġhscr p
+n it
+Ġo edema
+Ġp es
+Ġw istar
+ra ge
+Ġv ed
+Ġhe ating
+Ġmay o
+Ġcaus ality
+Ġcyt ogenetic
+Ġdesign ing
+Ġcategor ised
+Ġutil ize
+Ġrough ly
+Ġsap onins
+Ġuna ffected
+Ġhaemorrh age
+ver tebral
+Ġcl ient
+Ġob l
+Ġresp iration
+Ġlong est
+Ġes cape
+Ġcondition al
+imens ional
+Ġessential ly
+Ġassist ants
+Ġwors en
+Ġcompens atory
+Ġfair ly
+Ġparaform aldehyde
+u v
+Ġh inder
+ur ium
+Ġmed ically
+Ġqu e
+Ġbi ocomp
+Ġdiscuss ing
+Ġcur ved
+Ġadv is
+Ġelectro des
+Ġwors ened
+Ġamp icillin
+Ġpip er
+Ġbin ds
+ogly c
+Ġcaut ious
+Ġathlet es
+on ol
+Ġf oci
+pt osis
+Ġheal ed
+Ġdr ill
+Ġdent if
+Ġlo ose
+Ġu ka
+Ġthromb in
+Ġarch es
+Ġjob s
+Ġide as
+Ġminim izing
+Ġendoc arditis
+Ġstabil ized
+Ġacceler ate
+Ġglucocortic oid
+Ġsav ings
+Ġsalmon ella
+Ġberber ine
+Ġcontempor ary
+Ġglauc oma
+Ġis let
+Ġha p
+osp asm
+Ġstr ata
+Ġhyper cap
+Ġread y
+Ġparen ter
+Ġtc ga
+Ġmicrob iology
+Ġburn s
+Ġsy na
+Ġphenomen a
+Ġharv est
+Ġrins ing
+Ġconnect ing
+Ġt te
+il i
+Ġad ds
+Ġac p
+uc cess
+Ġassoci ate
+Ġcalc ulus
+Ġwa ived
+Ġtnf i
+Ġpc v
+Ġuna ware
+Ġminiscre ws
+p ad
+w est
+Ġc ck
+Ġg angl
+Ġch ances
+Ġcl p
+Ġinf requ
+Ġma ze
+Ġoff s
+Ġnit r
+Ġorigin ated
+Ġmaloc clusions
+Ġnotice able
+Ġorganis ational
+Ġhypercholester olemia
+Ġbiolog ics
+3 1
+i us
+i agnosed
+n et
+p y
+Ġe it
+os terol
+ect ing
+ort ical
+Ġch l
+Ġreg ressions
+ric e
+ry lic
+ten ess
+Ġher n
+Ġmr s
+Ġsat urated
+Ġmuc us
+uch er
+Ġspect roscopy
+Ġcertain ty
+Ġseal ants
+Ġepiderm is
+Ġdoub t
+Ġamyloid osis
+Ġparad ox
+Ġconve y
+Ġlon eliness
+Ġenvelop e
+Ġimip enem
+u a
+Ġal a
+ist al
+Ġis ot
+Ġse ated
+Ġinf usions
+Ġk o
+Ġsp i
+Ġbo ok
+Ġpossib ilities
+Ġdich lor
+Ġcompens ate
+Ġtrigger ing
+Ġmotiv ated
+Ġobstet rics
+Ġreservo ir
+Ġd bs
+Ġfo am
+Ġun available
+Ġmod ulus
+Ġen j
+Ġund iagnosed
+Ġimport ed
+Ġtherap ist
+Ġbr ight
+Ġchem istry
+inc ial
+Ġcop ies
+Ġce j
+aps ed
+Ġemphas izes
+Ġimmunomod ulatory
+Ġmetron idazole
+Ġs ant
+en an
+th ere
+Ġph antom
+Ġar c
+Ġfl ask
+Ġill um
+Ġvas oactive
+Ġfast ed
+Ġgel atin
+Ġhypothes ize
+Ġonc ological
+Ġgastroenter ology
+Ġmultim odal
+raum atic
+Ġdispers ion
+Ġpapill ae
+Ġrefus al
+uccess ful
+Ġa ha
+it an
+ly tic
+Ġev ac
+Ġsp ind
+Ġi q
+Ġadh ered
+Ġorth ognathic
+Ġspecial ties
+Ġoc d
+Ġspe ak
+Ġmp n
+Ġeg cg
+Ġincorpor ate
+Ġsequential ly
+Ġnons pecific
+atiz ation
+Ġempower ment
+Ġf sh
+Ġf fr
+as ant
+Ġh cs
+Ġg ently
+Ġis land
+Ġpre load
+Ġsc f
+Ġno ct
+Ġsp ond
+Ġtra il
+Ġpred iabetes
+Ġcs dh
+Ġdeb onding
+Ġvirt ually
+Ġcarbohyd rates
+Ġmetall ic
+g ow
+Ġt x
+ar ach
+os um
+Ġend s
+Ġprog ester
+Ġalt man
+Ġinstitut es
+Ġadhes ives
+Ġnit ro
+Ġattenu ate
+Ġregen erative
+Ġsperm at
+Ġsecret ions
+Ġate lect
+Ġhors erad
+Ġtetracy cline
+Ġbod ily
+Ġprogester one
+Ġhorserad ish
+7 9
+Ġp ter
+as ome
+Ġn dm
+el in
+ut ide
+Ġcent red
+Ġmir ror
+Ġold est
+Ġresid ing
+Ġfraction al
+Ġgu ang
+Ġconn ections
+Ġmob il
+Ġarch wire
+Ġkin etics
+Ġharm on
+Ġuns uccessful
+Ġcosm etic
+Ġcul prit
+Ġglas gow
+a o
+y d
+Ġp unct
+Ġb cc
+ro tein
+Ġg am
+am n
+Ġint ox
+vi x
+Ġimm ature
+Ġpsych o
+Ġ4 3
+Ġmass es
+Ġiv f
+Ġgly co
+Ġfill er
+Ġderm is
+Ġuns atisf
+Ġsb t
+Ġpoll en
+Ġexplicit ly
+Ġbrit ish
+b last
+r ators
+Ġb orders
+Ġst aged
+om atic
+Ġcl on
+Ġit t
+Ġrem ovable
+Ġadminist rated
+Ġpa rox
+Ġ4 4
+Ġchem okines
+Ġsoci etal
+Ġtub er
+Ġcv p
+Ġearli est
+Ġserious ly
+Ġcompl ained
+Ġcardiomy ocyte
+Ġconstant ly
+Ġsuppress es
+bsi ella
+Ġvest ibular
+Ġw u
+Ġw ed
+Ġl ane
+Ġval g
+Ġprov incial
+yn chron
+Ġendoscop ist
+Ġhyd ration
+Ġmap s
+Ġpast e
+Ġpneum operitoneum
+Ġpersonal ized
+rog ens
+Ġsuperv ised
+Ġcompens ated
+Ġdox orubicin
+Ġunpa ired
+Ġkle bsiella
+Ġupr ight
+if t
+ad ays
+Ġliv ers
+Ġrep osition
+Ġmeta ph
+Ġpur ification
+Ġconsum er
+Ġread iness
+Ġven om
+Ġadoles cence
+Ġnow adays
+Ġfore head
+Ġhypog lycaemia
+Ġcephal ospor
+Ġhol istic
+Ġmultipl ied
+r ists
+it ter
+Ġm cs
+Ġb ari
+Ġg ol
+Ġwh e
+pe pt
+Ġev ening
+Ġacc red
+Ġdem ineralization
+Ġif x
+Ġfe et
+Ġep i
+Ġhel ic
+Ġpp cs
+Ġdiss oci
+Ġtox in
+Ġbound aries
+Ġanalyt ic
+Ġbios imilar
+oqu inol
+Ġperip rosthetic
+Ġconfidential ity
+Ġscint ig
+Ġantitum or
+Ġparenter al
+Ġenj oy
+Ġt bs
+Ġc ott
+os ome
+th et
+ot o
+iv ities
+Ġis ch
+Ġse ed
+Ġmed itation
+Ġy ork
+erm al
+Ġtra ce
+Ġneg lect
+Ġeff lux
+Ġent ities
+Ġconsum e
+Ġver b
+ee ism
+Ġresol ve
+Ġexpect ation
+Ġcomparative ly
+Ġurg ency
+Ġcontract ile
+Ġneuros urgery
+Ġb ill
+iz ers
+ast icity
+Ġguid es
+Ġmultiple x
+Ġble aching
+Ġpur ity
+Ġhc ws
+Ġbul b
+Ġanastom otic
+Ġarab ic
+Ġexclus ive
+Ġinterrup ted
+pen oids
+Ġbay es
+Ġlactob acillus
+Ġoutli ers
+Ġpolit ical
+Ġcott on
+c ogn
+Ġl oci
+Ġwh r
+Ġac in
+ater ally
+Ġser ology
+Ġ2 000
+Ġimp re
+Ġmicro g
+Ġ7 3
+Ġaccess ed
+Ġax illary
+Ġsqu ares
+Ġov ary
+Ġvide os
+igm ine
+Ġevap or
+Ġdro ple
+Ġnscl c
+o ot
+Ġs dm
+Ġs onic
+Ġc se
+Ġc ock
+Ġc ts
+Ġre ductase
+Ġst o
+Ġal dh
+Ġph e
+Ġterm inated
+Ġes cc
+Ġret raction
+Ġcd k
+Ġca esarean
+Ġrespond er
+Ġsequ el
+Ġip v
+Ġdrink ers
+Ġlapa roscopy
+Ġsom at
+Ġtur k
+Ġdecompens ation
+Ġfluctu ations
+Ġont ario
+Ġmere ly
+Ġglyca emic
+7 1
+Ġt ia
+Ġin qu
+ul ing
+Ġl avage
+Ġint ima
+Ġso f
+cop rotein
+Ġexc itation
+Ġresist in
+Ġcaregiv ing
+Ġtail ed
+Ġschem atic
+Ġnutri ents
+Ġosse oin
+rosp inal
+Ġjug ular
+on n
+Ġh it
+Ġe rect
+if olia
+Ġex em
+ren e
+Ġag ric
+Ġtra b
+Ġvit amins
+Ġconsum ers
+Ġair ways
+Ġdom estic
+Ġintegr ating
+ria x
+Ġgraph s
+Ġcontract ility
+ompl icated
+Ġdens it
+Ġsuperimp osition
+Ġcaud al
+Ġunus ual
+o ating
+Ġm ul
+Ġr ational
+Ġor ange
+Ġcl ust
+Ġbi od
+Ġj ord
+Ġ3 9
+Ġsl c
+Ġobject s
+Ġintrod ucing
+Ġparas ite
+Ġdut y
+Ġfab p
+Ġchron ological
+Ġceft riax
+Ġescal ation
+Ġepigen etic
+Ġceftriax one
+2 00
+r utinib
+Ġc ca
+Ġh ung
+Ġh gf
+os able
+Ġg ist
+Ġanalys ing
+Ġsub cl
+our se
+Ġox yt
+Ġsyn t
+Ġsol ve
+Ġcontribut ions
+Ġcycl ophosph
+Ġlib itum
+Ġexpand ing
+Ġdemand ing
+Ġempt y
+Ġdiph enyl
+Ġcyclophosph amide
+b urn
+Ġth ing
+Ġo rof
+is cence
+os h
+Ġg fr
+Ġv iment
+Ġr n
+og ether
+Ġpre ca
+Ġcl onal
+Ġsm i
 Ġbel gian
-Ġbel gium
-Ġtem gesic
-Ġperman gan
-Ġmen tions
-Ġmen gh
-Ġeff avi
-Ġul na
-Ġresist ing
-Ġresist ome
-Ġattach ing
-Ġsocial izing
-Ġsw in
-Ġsw ift
-Ġsyn ops
-Ġsyn ergy
-Ġseal apex
-af ung
-af raid
-Ġirr itating
+Ġreal istic
+Ġhepat ocyte
+Ġconsequ ent
+Ġgr and
+Ġameric ans
+Ġechocardi ogram
+Ġnit rate
+Ġneur on
+ott is
+Ġdraw back
+Ġdriv ers
+Ġgallst one
+Ġelectroly te
+Ġumbil ical
+Ġspond yl
+Ġclust ered
+s ion
+Ġw inter
+id is
+Ġfor t
+ist ically
+Ġse a
+Ġinter group
+Ġinter ns
+Ġy ields
+Ġ0 00
+Ġpract iced
+Ġmy ofib
+of en
+Ġread s
+Ġhr p
+Ġcereb rospinal
+Ġunc omplicated
+Ġregul ators
+Ġcoordin ate
+Ġpharmacokin etics
+Ġdiure tic
+Ġpsychiat ry
+Ġstrom a
+Ġelic ited
+Ġsubd ivid
+Ġviment in
+at urated
+as al
+Ġre ward
+ment al
+Ġinf ective
+iss on
+Ġfour teen
+Ġprot ects
+chn ology
+Ġhem ostatic
+Ġhem isph
+Ġct nt
+Ġhydro chloride
+Ġbo ost
+Ġbro ken
+Ġpool ing
+Ġrecip roc
+Ġgraph pad
+Ġren ew
+Ġpenet rating
+Ġdigest ion
+Ġcyl ind
+Ġimmunobl ot
+k er
+Ġp ds
+Ġv l
+ug g
+Ġrel ies
+Ġout d
+par amet
+Ġtem pl
+ins ulin
+Ġbra f
+otox ic
+Ġremod elling
+Ġwithdra wn
+Ġrheumat ology
+ji ang
+Ġnam es
+Ġsporad ic
+Ġcitiz ens
+Ġl ich
+Ġpr s
+Ġpost ure
+Ġneed ing
+Ġintra class
+Ġrandom isation
+med ullary
+Ġhel a
+Ġsusp icious
+Ġmig rant
+Ġinferior ity
+Ġhydrox ide
+Ġuv b
+Ġsah aran
+Ġneuropsych ological
+Ġjord an
+p g
+Ġt ce
+Ġa ad
+Ġth iop
+Ġc ms
+Ġan ne
+Ġb atch
+im on
+Ġv oc
+Ġconf ocal
+ack s
 Ġpat ent
+Ġresid ue
+Ġalt ogether
+Ġleg is
+Ġsuppress or
+Ġfabric ated
+Ġdap i
+uter ine
+t ling
+Ġf ather
+Ġh k
+Ġl un
+Ġg yr
+Ġad p
+Ġle e
+Ġac rylic
+Ġk s
+Ġeffect or
+so ft
+Ġcer vix
+Ġmac es
+Ġasc vd
+Ġpanel s
+Ġfm t
+yal gia
+ar ial
+Ġn i
+Ġl ent
+Ġcomp ares
+Ġresult ant
+Ġperi ost
+Ġprior ities
+Ġent eral
+Ġright s
+Ġcre atine
+Ġbio inform
+Ġsem in
+Ġsen es
+Ġcac o
+Ġrb cs
+Ġextr insic
+Ġbor ne
+Ġconverg ent
+Ġre jection
+Ġr cc
+Ġrem ind
+Ġpul l
+Ġadh d
+Ġdam ages
+Ġide ally
+Ġcg vhd
+Ġseas onal
+Ġmesi od
+Ġinsec urity
+Ġefficac ious
+Ġbatter y
+Ġsynt ax
+d r
+Ġm ag
+Ġb ending
+as ic
+ot rex
+ys ter
+Ġsh ade
+Ġk t
+Ġtr an
+Ġyear ly
+Ġtumor igen
+Ġ6 2
+ges ia
+Ġcran iotomy
+Ġsr p
+Ġactin omy
+Ġintens ities
+Ġorb ital
+umann ii
+otrex ate
+x r
+Ġ :
+Ġc di
+ur ning
+Ġg j
+il ution
+act am
+Ġtw een
+Ġind ometh
+ost al
+Ġap o
+Ġtim p
+Ġmeth otrexate
+Ġpost g
+Ġcharacter ised
+ob ut
+Ġcardi ologists
+Ġcomple teness
+Ġgra ce
+Ġ4 1
+Ġselect ively
+Ġdisp ens
+Ġvo ucher
+Ġthromboemb olism
+Ġrif amp
+Ġmaxim ize
+Ġpor c
+Ġimmunore activity
+Ġglutam ate
+Ġoroph aryngeal
+Ġmath emat
+Ġshrink age
+Ġorof acial
+Ġindometh acin
+Ġth p
+en burg
+Ġc res
+Ġp ick
+it onin
+Ġb g
+ol aryng
+Ġat tained
+Ġmet rop
+Ġmod ulated
+ld l
+Ġsum med
+Ġfract ured
+Ġbur st
+Ġpolic ym
+Ġcompet ent
+Ġglut amine
+Ġsubstit ution
+Ġhapp ened
+olip id
+Ġdissem inated
+w ith
+Ġb angl
+Ġe ps
+id er
+ter ase
+Ġcol ch
+Ġra ises
+Ġsymptom atology
+Ġins ured
+Ġ6 4
+Ġlymph ocytic
+Ġrout es
+Ġobject ively
+Ġneph rot
+Ġabscess es
+Ġpict ures
+Ġtro chanter
+Ġdisinf ection
+Ġfv c
+Ġvox el
+Ġved olizumab
+Ġbangl ades
+Ġth igh
+Ġm k
+Ġm ps
+Ġe os
+Ġto urn
+Ġim atinib
+Ġob s
+Ġrel ied
+ap y
+Ġbl ade
+Ġform ulas
+Ġeight y
+Ġher pes
+Ġ7 2
+Ġwrit ing
+Ġrup tured
+Ġank yl
+Ġencoun ters
+Ġpsychiat rists
+Ġvisc osity
+Ġunexpl ained
+Ġsily marin
+Ġs ri
+Ġp ose
+Ġn n
+Ġg bs
+iv er
+Ġab ortion
+Ġbut anol
+Ġblood stream
+Ġret urning
+Ġmicro soft
+Ġib rutinib
+Ġhip s
+Ġglut en
+Ġparas it
+Ġworksh op
+Ġdiscol oration
+Ġfibrom yalgia
+Ġheavi ly
+a ult
+d p
+Ġn bi
+st ein
+Ġpr p
+Ġimp ressions
+Ġcap ita
+Ġcross ing
+Ġdiscre te
+Ġconstit uted
+oblast oma
+Ġtransm itted
+Ġpalp ation
+Ġprotr usion
+Ġtaq man
+Ġtransamin ase
+Ġatelect asis
+Ġsubdivid ed
+Ġs rs
+Ġe ug
+Ġv ocal
+Ġbet el
+Ġme g
+Ġhad s
+Ġpr l
+Ġocc ip
+Ġnew er
+Ġ5 6
+Ġinst all
+Ġgr anted
+Ġfluor oquinol
+Ġinsu ff
+Ġdon ation
+Ġvar nish
+Ġ200 7
+Ġduct s
+Ġhall mark
+4 2
+Ġs ect
+Ġv h
+Ġcl am
+Ġpl t
+Ġinter cept
+Ġrec urrences
+Ġph le
+oth orax
+Ġgen etics
+Ġdisc ipl
+Ġimp utation
+Ġ8 5
+Ġload ings
+Ġinteg rate
+Ġphot o
+Ġba umannii
+Ġevid ences
+Ġlactam ase
+albumin uria
+Ġpuber ty
+Ġcontamin ated
+Ġhus b
+8 9
+b ound
+n ity
+at g
+Ġch c
+Ġmet ric
+Ġstr ips
+ke let
+ov en
+Ġintra uterine
+Ġrest ra
+Ġoff sp
+Ġcolon oscop
+Ġinterview er
+Ġnorm ative
+Ġcandid iasis
+Ġfer mented
+Ġcounter act
+Ġmineral ization
+Ġmultid rug
+Ġthal ass
+Ġincon clusive
+Ġoffsp ring
+Ġle thal
+Ġme oh
+Ġfo x
+Ġradi ologic
+Ġbacter i
+Ġu i
+Ġcs s
+Ġreflect ive
+Ġteam work
+Ġdeform ities
+obarb ital
+Ġdeh iscence
+Ġ ict
+Ġc fs
+Ġl bb
+Ġas ter
+Ġad rs
+Ġun res
+ak ia
+Ġdr ying
+Ġprop ag
+Ġcp c
+Ġdistal ization
+lu or
+Ġmaf ld
+c ol
+n itus
+el d
+ans h
+Ġant is
+Ġra i
+Ġsym b
+Ġi abp
+Ġhist amine
+red ict
+Ġ5 7
+Ġthir teen
+Ġ6 3
+Ġinterest s
+Ġmut ual
+Ġla ws
+wh el
+Ġhemat ocrit
+Ġglyc ated
+agre lor
+Ġtransp arent
+Ġreinfor ced
+Ġly ophil
+Ġtin nitus
+Ġtourn iqu
+m r
+al imumab
+Ġl bp
+Ġse b
+ad ing
+ari etal
+Ġph c
+Ġover whel
+Ġbi ochemistry
+Ġsp in
+Ġsp ring
+Ġq aly
+Ġcoll ar
+Ġapproxim ate
+Ġproject ed
+Ġ200 5
+Ġeg d
+Ġfulf ill
+Ġord ered
+Ġneigh bor
+Ġprostagland in
+Ġtic agrelor
+Ġs ad
+Ġc u
+as p
+Ġad alimumab
+Ġhe ated
+Ġfol ate
+Ġser ine
+Ġpredict ions
+Ġocc ult
+Ġel ab
+Ġcyt ology
+Ġcult urally
+Ġshort c
+Ġher nia
+Ġbur d
+Ġdisp atch
+Ġsurround ed
+Ġdehyd ration
+Ġbund les
+Ġbin omial
+Ġmening itis
+Ġmetall oprotein
+Ġobt uration
+Ġjun ior
+Ġsupervis ors
+Ġdend ritic
+Ġa ux
+at ric
+Ġp cl
+Ġp ink
+Ġh i
+Ġl ub
+um p
+ip er
+Ġrec lass
+Ġdisc over
+Ġchem otherapeutic
+Ġadverse ly
+Ġ7 8
+Ġdown ward
+Ġpolym yx
+Ġcit r
+Ġconflic ts
+Ġunderest imate
+Ġremn ant
+Ġvaccin ated
+Ġbiote chnology
+Ġimmunod ef
+o al
+o yl
+Ġ ici
+al in
+Ġm erc
+ent re
+res ent
+Ġis oform
+Ġsign ature
+ath eter
+Ġfe e
+Ġent ail
+Ġ9 6
+Ġlink s
+Ġleaf let
+Ġbis phosph
+Ġcholecyst itis
+Ġinfra red
+Ġmerg ed
+je jun
+v ation
+Ġthe ories
+ul i
+ig ong
+ol itan
+ot a
+ot tic
+Ġno v
+Ġy ielding
+Ġsp c
+Ġevalu ates
+oper fusion
+Ġi os
+Ġhist omorph
+Ġel uted
+Ġlip ase
+Ġsoci eties
+Ġder ivation
+Ġpen ile
+Ġtransl ate
+Ġepidemi ologic
+Ġduct al
+Ġendomet rium
+Ġsph yg
+Ġamelior ated
+Ġrepet ition
+Ġpcs k
+j ing
+n ic
+al ys
+Ġe ph
+os umab
+Ġr ings
+Ġat c
+Ġco eliac
+Ġcl ip
+Ġmethod ologies
+Ġsp a
+Ġdef ib
+Ġperiod ic
+Ġcommitte es
+Ġattribut e
+Ġden osumab
+Ġcla ud
+Ġfund ed
+ophil ia
+Ġscann ers
+Ġhapl otype
+Ġpredn isone
+Ġmanus cript
+g ic
+Ġf ic
+Ġdi ary
+Ġk il
+Ġreported ly
+Ġq igong
+opath ies
+Ġnet s
+Ġder ive
+Ġmit otic
+Ġom itted
+Ġelimin ating
+Ġing u
+Ġpredisp osition
+Ġinfer red
+Ġpoc d
+Ġtechnici ans
+Ġhyperal gesia
+kelet on
+Ġsphyg m
+at ide
+ro d
+Ġh ered
+ul ators
+od one
+Ġpre exist
+Ġfo xp
+Ġam ph
+Ġcompar ator
+Ġref ined
+Ġcoh erence
+oph yl
+Ġcle avage
+Ġach e
+Ġsection ed
+Ġgr ip
+Ġtransf used
+Ġtherm ocy
+Ġnitr ite
+Ġspind le
+Ġc af
+Ġp so
+Ġp ector
+Ġd ar
+Ġl it
+Ġv ero
+Ġr ms
+per i
+Ġtr iter
+Ġup ward
+Ġmon omer
+Ġform azan
+Ġsaf er
+Ġ6 6
+Ġutil isation
+Ġalle lic
+oxygen ase
+Ġpector is
+e cl
+n ed
+Ġst ation
+id ing
+ch id
+Ġco aching
+Ġpo isson
+Ġnon paramet
+Ġdeterm ines
+oid es
+Ġimpl ied
+Ġcap ill
+Ġmm ol
+Ġfav ored
+Ġcompli ant
+Ġvar iceal
+Ġfer ro
+Ġsubt le
+Ġhybrid ization
+Ġmamm ary
+Ġhac at
+Ġnonparamet ric
+z ing
+Ġt ym
+Ġp q
+Ġp ph
+Ġin activity
+ul o
+Ġn ice
+ib ly
+and er
 Ġexp on
-Ġexp ands
-Ġexp ense
-Ġexp atri
-enced irect
-Ġ20 3
-Ġsti ffer
-Ġsti gm
-Ġdispl acing
-Ġod or
-Ġflow ers
-Ġoscc s
-ind ex
-Ġair tig
-Ġair scal
-Ġtimes pan
-Ġsocio economics
-Ġequ ated
-Ġequ ity
-Ġequ imolar
-Ġequ ivocal
-Ġmes o
-Ġmes hes
-Ġmes iorotated
-Ġ4 00
-Ġest adual
-Ġax il
-Ġax ially
-Ġprem ises
-Ġfib r
-Ġfib ula
-Ġfib romy
-Ġfib erglass
-Ġdifferenti ates
-Ġlocal ize
-Ġdirect orate
-Ġfocus sing
-Ġabo hab
-Ġfree form
-Ġdistal ized
-Ġdistal isation
-Ġpolym icrobial
-Ġpolym ethyl
-Ġfew est
-ang ular
-ang ulation
-ang kul
-Ġprior ities
-Ġadhesive ly
-Ġclos ures
-Ġprote obacteria
-Ġprote oglyc
-Ġprec ede
-Ġintroduc tions
-Ġrot ten
-Ġrot terdam
-Ġpros pect
-Ġdom inates
-Ġdom hain
-Ġbo k
-Ġbo om
-ival ent
-Ġhal o
-Ġhal ted
-Ġhal ves
-Ġdeep en
-Ġhypoth yroid
-Ġsatis fies
-Ġhyper inflammatory
-Ġhyper keratosis
-Ġhyper prolif
-Ġhyper triglycer
-Ġwork st
-wor ks
-Ġcp r
-Ġresid ency
-Ġresid ences
-reg ulation
-reg ions
-Ġconstr ained
-Ġcari ostatic
-Ġchr ist
-Ġbiom onit
-roph obia
-Ġcommun icated
-Ġcommun icating
-Ġcommun icable
-Ġvir gin
-Ġvir onos
-Ġspl atter
-Ġspl inted
-Ġhead l
-Ġhead aches
-Ġhead films
-Ġdel ve
-Ġdel icate
-Ġdel hi
-Ġmorph ogenetic
-Ġmark ov
-etr ically
-az ine
-az vin
-Ġclinic opath
-Ġpsych opathological
-Ġpsych ologist
-Ġpsych ophys
-Ġans ys
-Ġml n
-Ġcement obl
-Ġskeletal ly
-Ġmut an
-Ġmut ational
-Ġmut ually
-ros pinal
-Ġbleeding s
-Ġrough ening
-Ġpublic ity
-Ġpublic ize
-Ġpur ple
-Ġlogistic s
-gen ase
-Ġsumm aries
-Ġadv ising
+Ġbl unt
+Ġ5 4
+Ġconstit utes
+Ġscr atch
+Ġhapp en
+Ġconcord ant
+Ġcompan ies
+Ġtac rolimus
+Ġvasodil ation
+Ġosse ous
+Ġpuber tal
+Ġneurotrans m
+Ġsequel ae
+Ġo i
+Ġl ld
+ut ase
+Ġle i
+Ġtra ction
+Ġgly coprotein
+Ġnar rative
+Ġcx cr
+Ġneurode gen
+5 9
+Ġf ut
+ar one
+Ġbut y
+Ġfib ros
+Ġgast roscopy
+Ġpoly v
+Ġcontinu ation
+Ġmut agen
+Ġnor ad
+Ġsed iment
+Ġrd n
+Ġrelig ion
+olip oprotein
+Ġcustom ized
+Ġturk ish
+Ġosseoin tegration
+Ġanne aling
+r ance
+Ġw atch
+Ġd q
+Ġd ipl
+as ma
+ct t
+ron tal
+Ġana phyl
+Ġwash out
+Ġcompet itive
+Ġfr ust
+Ġnom inal
+Ġanonym ous
+Ġdisinf ect
+" .
+z hou
+Ġt ca
+Ġo e
+et ron
+ut ri
+Ġv v
+Ġgen etically
+Ġar ip
+ox azole
+Ġpar p
+ron t
+Ġfl uc
+Ġsol ving
+Ġendoc ardial
+Ġvolunte er
+Ġoverestim ation
+Ġspar se
+Ġoxyt ocin
+Ġc ga
+Ġm if
+Ġm bl
+ul ent
+Ġap olipoprotein
+Ġk im
+ak a
+Ġcor ner
+Ġj c
+Ġpath ologists
+Ġcrit ic
+Ġrad icular
+Ġpharmac ology
+Ġip a
+Ġadhes ions
+Ġforce ps
+Ġshif ted
+ynam ically
+Ġimmunosupp ress
+Ġll lt
+Ġoccas ions
+Ġparenchym al
+Ġdispar ity
+Ġdiscl osed
+Ġdro ps
+Ġmca o
+Ġdair y
+Ġosc ill
+Ġprur itus
+Ġarip ip
+m n
+Ġm oney
+ar rhythm
+Ġr an
+Ġor i
+Ġat pase
+Ġco a
+Ġco il
+Ġcal end
+Ġpsych opath
+Ġplant ar
+Ġprepared ness
+Ġkin ases
+Ġrt w
+Ġpac lit
+Ġprefer able
+Ġmultic entre
+Ġia h
+cox ib
+Ġcoordin ates
+Ġaliqu ots
+Ġaccompl ished
+Ġtanz ania
+Ġaripip razole
+Ġpaclit axel
+Ġf used
+is ite
+ro id
+Ġst ir
+Ġst yles
+Ġg v
+ch ool
+Ġcomp ressive
+ost igmine
+Ġint u
+Ġap gar
+cl ing
+ep sin
+Ġgener a
+Ġep c
+me as
+Ġreason ing
+Ġdecl ining
+Ġsummar ize
+itone ally
+Ġbond s
+Ġcag a
+raph s
+Ġclos est
+Ġiad l
+Ġmetrop olitan
+Ġpolyv inyl
+3 9
+a rous
+Ġa pl
+Ġan ore
+Ġf ath
+Ġe gf
+em oral
+og le
+Ġqu it
+ire ction
+Ġj oh
+Ġmin us
+Ġsurv ive
+omy el
+Ġsequ enced
+Ġaccess ory
+Ġsa ved
+Ġdimin ish
+Ġparad igm
+Ġtourniqu et
+Ġingu inal
+Ġt z
+Ġf na
+ar abine
+op ia
+Ġdis pro
+Ġimp uted
+Ġimpl ication
+Ġz n
+Ġpercent iles
+Ġbr u
+Ġprogram med
+Ġstrict ures
+Ġgran ulation
+Ġadren ergic
+Ġace i
+Ġleaf lets
+Ġconstitu ent
+Ġgad olin
+Ġnin ety
+Ġdiscipl ines
+m er
+Ġcom ment
+um ar
+Ġfol ds
+Ġvi olet
+Ġhepat ectomy
+Ġov ari
+Ġalter ing
+Ġrot ational
+Ġdepth s
+Ġdisp osable
+Ġembry onic
+att ered
+Ġexpendit ures
+Ġscholar s
+Ġc ow
+Ġc cc
+Ġb ac
+Ġst igm
+Ġdis cer
+Ġsc l
+Ġinter im
+ap atite
+Ġsim ulations
+Ġpe ek
+Ġreview er
+Ġtechn ically
+Ġip c
+Ġproject s
+Ġenter obacteria
+imm un
+Ġna ive
+Ġprost atic
+Ġesophag itis
+Ġtl c
+Ġlin er
+Ġpreexist ing
+t i
+Ġt pa
+Ġc ec
+ur ge
+Ġal umin
+Ġsyst ole
+Ġsp s
+Ġsp asm
+Ġhyp om
+Ġiss ued
+Ġrot ated
+Ġdermat ology
+Ġpas i
+Ġmunicip alities
+Ġdism utase
+Ġcong ru
+Ġbench mark
+Ġpertain ing
+Ġprogen itor
+Ġpostg raduate
+t rans
+Ġm ab
+Ġg avage
+Ġis h
+Ġse er
+ox in
+Ġfl t
+Ġtechn ological
+Ġlo ops
+Ġ6 1
+Ġmild ly
+Ġrecogn izing
+Ġrs v
+Ġnorm ot
+Ġ19 90
+Ġmix tures
+Ġinsp ired
+Ġiod ide
+Ġoutbreak s
+Ġduplic ates
+Ġpredn isolone
+iotrop ium
+Ġbanglades h
+Ġis thm
+Ġreg isters
+Ġpres chool
+Ġover lo
+cer tained
+Ġtra cing
+Ġgl ute
+ox if
+Ġinteract ing
+Ġnit i
+Ġsil encing
+Ġcompr ise
+Ġlangu ages
+Ġmarginal ly
+Ġureter al
+Ġscop ing
+Ġhypn osis
+Ġtu key
+Ġcontracept ive
+Ġintrath ecal
+Ġtranspor ter
+Ġc ass
+Ġan ion
+Ġas certained
+em br
+og astric
+ac cept
+so fa
+Ġet v
+Ġ5 3
+Ġcategor ization
+Ġpublic ly
+Ġoste os
+Ġphosph orus
+Ġoxid ized
+Ġevery thing
+Ġhepat otoxicity
+Ġampl ic
+Ġeosinophil s
+Ġconsort ium
+Ġtraject ories
+Ġgree k
+Ġsock et
+Ġauro c
+Ġbayes ian
+Ġcock tail
+1 80
+g al
+it ch
+id den
+Ġv wf
+Ġis ra
+Ġun equ
+Ġpart ition
+pec ified
+Ġcomm ence
+Ġfunction ality
+Ġsuggest ion
+ron j
+Ġhyp ov
+Ġfail ing
+thes iology
+Ġpa uc
+ax ial
+Ġhc g
+Ġrecru iting
+Ġhydro c
+Ġthyroid itis
+Ġanaes thet
+Ġfresh ly
+Ġconservative ly
+rof en
+abs orption
+Ġdisagre ements
+Ġchond rocytes
+Ġdriv er
+Ġinduc ible
+Ġobstac les
+Ġaspergill us
+Ġscintig raphy
+Ġporc ine
+Ġgadolin ium
+re al
+Ġc os
+Ġp anc
+Ġm w
+Ġn ss
+Ġv in
+Ġv ice
+ag t
+Ġdis h
+Ġfin ite
+Ġstr ugg
+Ġexam s
+Ġgener ates
+Ġet iological
+Ġcyt ological
+Ġ5 9
+Ġpsych ology
+Ġmot tling
+Ġreach es
+Ġlv mi
+Ġnit rog
+Ġpt x
+Ġphot os
+Ġguide wire
+Ġdisturb ed
+Ġja ws
+Ġtext ure
+Ġtransition s
+ophil ic
+Ġerup ted
+Ġgynec ology
+Ġvill ous
+Ġdk d
+Ġinterpro ximal
+Ġgyr us
+Ġoccip ital
+k es
+l ab
+n ote
+Ġt iter
+Ġs z
+Ġd od
+Ġg aining
+Ġv at
+Ġat rio
+Ġpre ecl
+Ġund es
+ep s
+ob ia
+Ġcancer ous
+Ġel uting
+Ġwhere in
+Ġox y
+Ġheart burn
+Ġent eric
+Ġfree ly
+Ġsusp ensions
+Ġul n
+Ġjust ify
+Ġfram es
+Ġtele health
+Ġsem en
+Ġadvantage ous
+Ġdisrup ted
+Ġperm itted
+Ġvasoconst riction
+Ġnitrog lycer
+k p
+p ers
+Ġw ise
+Ġb ases
+am il
+oc ations
+Ġy ang
+Ġcardi ologist
+Ġinform ants
+Ġstart s
+Ġbur ning
+Ġamb ient
+Ġplatform s
+Ġcast s
+Ġacetyl choline
+Ġintraper itoneally
+Ġherb arium
+Ġinterrup tion
+Ġbud get
+atiz ed
+Ġprothromb in
+Ġvalg us
+w orth
+x ia
+Ġt iotropium
+Ġa q
+Ġthe atre
+Ġo z
+id a
+Ġsc s
+Ġtr uly
+ak age
+Ġtrans genic
+Ġsim ulator
+Ġpredict able
+Ġop ium
+Ġhem olysis
+Ġ5 1
+Ġadv ocated
+Ġsuccess ive
+Ġprofess ions
+zym e
+Ġadop ting
+Ġmultid imensional
+Ġnav ig
+Ġsarc oma
+Ġparox ys
+Ġfath ers
+ation ally
+Ġg ata
+Ġr w
+Ġch ow
+Ġab ol
+Ġar ises
+Ġtra cer
+Ġmon t
+Ġcre ates
+Ġ7 6
+Ġsupp ressive
+Ġconsult ing
+Ġnm b
+Ġhistopath ologic
+Ġcert ific
+Ġcontraind ication
+Ġmesiod istal
+Ġmathemat ical
+Ġt ug
+Ġp ma
+Ġm os
+Ġb cs
+Ġh yster
+Ġne ostigmine
+Ġant ral
+Ġant ise
+Ġty ping
+Ġax es
+Ġaddress es
+Ġanaes thesi
+Ġlifest yles
+Ġopportun istic
+Ġgal ectin
+Ġanomal y
+Ġfaecal is
+Ġoverd ose
+Ġarrang ement
+Ġexpon ential
+f ol
+o ured
+on a
+Ġo es
+Ġb are
+Ġb ub
+ore g
+Ġsh i
+ph en
+Ġun accept
+Ġcal prot
+requ ency
+Ġpoly acryl
+Ġost ium
+Ġgo ogle
+Ġpv t
+Ġion omer
+bor ns
+Ġvd r
+Ġunp redict
+Ġsphygm oman
+Ġcalprot ectin
+b one
+at ran
+Ġs rh
+Ġh z
+Ġe ae
+us ing
+Ġi j
+Ġox yc
+Ġnew borns
+air s
+Ġchem okine
+last y
+Ġtn bs
+Ġcapac ities
+Ġdeep ly
+Ġnumer ically
+Ġdehyd rated
+Ġsustain able
+Ġnac l
+Ġpartners hip
+Ġdens ities
+Ġextrapol ated
+Ġaj cc
+Ġthalass emia
+m l
+ct g
+id el
+Ġv re
+iv udine
+ag in
+Ġint el
+Ġcr f
+ace ae
+ines terase
+Ġvalu ed
+Ġcount ies
+Ġsyn cope
+Ġpsych otropic
+Ġfac et
+ues e
+Ġu h
+Ġhemat ology
+Ġplay ing
+Ġather ogenic
+Ġglyc ogen
+Ġmedi ates
+Ġconj unct
+Ġdiscrimin ating
+Ġsensit ized
+Ġdisplay ing
+Ġprint ing
+Ġbus iness
+Ġsevent h
+Ġconv inc
+Ġlon ge
+Ġdanger ous
+Ġciv il
+Ġcancell ous
+Ġmerc ury
+Ġparoxys mal
+Ġpolyacryl amide
+l ings
+od i
+ess ional
+Ġad c
+Ġsu ff
+Ġob lig
+Ġred ness
+Ġav r
+Ġfib re
+Ġ4 9
+Ġcontribut or
+Ġoste ogenesis
+Ġ8 9
+Ġcat ch
+Ġnh l
+Ġincident al
+Ġshap es
+Ġpolyp ectomy
+Ġcough ing
+Ġmess ages
+Ġdab ig
+Ġportug uese
+Ġthous and
+al ign
+it ations
+ati vity
+ol um
+od g
+Ġr l
+ure a
+ip ine
+Ġk ar
+Ġcons erved
+Ġexp ose
+Ġ5 8
+Ġfac s
+Ġsl ot
+Ġshort ly
+Ġshort est
+Ġsw abs
+Ġpd gf
+Ġlys ate
+Ġmask s
+Ġbios ynthesis
+Ġgn rh
+Ġepig astric
+Ġneighb our
+Ġsolub ility
+Ġnasoph aryngeal
+Ġtex ts
+Ġcalend ar
+Ġdabig atran
+Ġd ms
+is ia
+Ġb ps
+Ġst oma
+Ġg ains
+Ġv oid
+Ġsc attered
+ak i
+Ġnon line
+Ġnum eric
+Ġdist ortion
+Ġdo or
+Ġ6 8
+Ġconst riction
+Ġ9 2
+Ġdom inated
+Ġ200 6
+Ġchromat ographic
+Ġcrypt s
+orad i
+Ġmiscar riage
+Ġcens ored
+Ġunsatisf actory
+Ġoxyc odone
+Ġlonge vity
+n oid
+Ġa is
+Ġf ried
+ud ed
+ad ed
+Ġcl ones
+Ġdi ode
+Ġsub arach
+Ġcar rage
+Ġinvest ment
+Ġhyp op
+Ġinflu x
+Ġadv oc
+Ġelect rom
+Ġ8 2
+Ġbil aterally
+Ġcheck up
+Ġrect ang
+pen es
+Ġattract ive
+Ġaudit ory
+Ġmim ics
+Ġophthal m
+Ġselen ium
+Ġdefec ation
+Ġnoct urnal
+Ġdispro port
+b in
+c et
+o ke
+Ġex it
+ad i
+ap ore
+Ġdur a
+Ġext ends
+Ġtrans vers
+Ġprevent able
+Ġvers a
+ins on
+amin ergic
+oplas ia
+Ġweak ly
+Ġdest ro
+Ġgal act
+Ġempir ic
+Ġvascul itis
+Ġminiscre w
+Ġbari atric
+Ġsect ors
+jejun ostomy
+Ġisthm us
+Ġpauc ity
+Ġatrio ventricular
+s cs
+w ires
+Ġt amp
+Ġg ic
+id yl
+Ġco operative
+Ġint ral
+Ġsup ar
+Ġsix teen
+Ġinform ative
+Ġmic rom
+Ġclass room
+Ġmy cop
+Ġquestion able
+Ġmater nity
+Ġsing apore
+Ġlymph oid
+Ġsw imming
+Ġult imate
+Ġpow dered
+Ġcv c
+Ġprepar ing
+Ġech in
+lor a
+Ġcycl o
+Ġhom ozyg
+Ġtit ration
+Ġpol ished
+Ġillust rating
+Ġfulf illing
+Ġgw as
+Ġburd ens
+Ġimmunodef iciency
+Ġsubarach noid
+b ra
+b ody
+f ted
+k acin
+Ġm ant
+Ġrel ates
+pro l
+ep am
+Ġdist ort
+Ġi u
+Ġop aque
+Ġcoh es
+Ġpa e
+Ġrepresent atives
+Ġaut onom
+Ġsumm er
+Ġthick ened
+Ġnucle ic
+Ġbal b
+Ġped icle
+Ġami kacin
+Ġbrush ed
+Ġpack ed
+Ġspir al
+Ġdram atic
+Ġintent ions
+Ġwarm ing
+Ġhypo albumin
+tw o
+Ġpolymyx in
+oal veolar
+Ġintel lect
+1 16
+6 6
+c d
+o ul
+al co
+ing ly
+ch ild
+Ġpre requ
+pl ot
+uc cal
+Ġk p
+Ġli e
+Ġpath ologist
+Ġany thing
+Ġliter atures
+Ġmonit ors
+Ġ8 7
+Ġacet on
+Ġpneum othorax
+Ġbiological ly
+Ġminim ized
+Ġcit ations
+Ġai h
+Ġaccel eration
+Ġupd ate
+Ġmer op
+Ġeosinophil ic
+Ġunders c
+Ġterrit ory
+Ġcarrage enan
+q l
+Ġm ss
+Ġad vent
+ia p
+Ġfin ished
+Ġspec ially
+Ġsim vastatin
+ke ep
+Ġhyp on
+cem ia
+Ġheter ozyg
+Ġhead s
+Ġrout ines
+oplas mic
+Ġsci atic
+Ġtoler ate
+Ġreh ospital
+ifi ers
+Ġsecret ory
+56 2
+Ġvascul ature
+Ġgab a
+Ġrecon stit
+Ġguardi ans
+Ġcolch icine
+Ġhered itary
+Ġcapill aries
+h er
+Ġc ared
+Ġst ick
+Ġtr u
+Ġant in
+agn osis
+Ġimage j
+Ġstr atum
+Ġhyp ere
+Ġappl ies
+Ġradi of
+Ġ7 1
+ilt ration
+Ġreason ably
+Ġmicrob es
+Ġaff ir
+Ġpv df
+Ġfluores cein
+Ġwidth s
+Ġmh r
+Ġcompart ments
+Ġconve x
+Ġrub ber
+Ġgallst ones
+Ġposit ives
+Ġveter ans
+Ġindones ia
+Ġlub ric
+Ġmerop enem
+b all
+j u
+p ie
+Ġa ided
+Ġp us
+Ġp ce
+Ġh int
+Ġh pa
+Ġl ank
+Ġdes m
+Ġhist one
+Ġol fact
+Ġpa i
+Ġlack s
+iat rics
+Ġ6 9
+Ġ7 9
+Ġventric les
+Ġrepl icate
+Ġpol ish
+Ġcat ast
+Ġrelie ved
+Ġtal king
+Ġwhit ening
+Ġingred ient
+Ġmultip lic
+Ġrelaps es
+Ġdas atinib
+Ġpent obarbital
+Ġoverestim ated
+Ġbenzodiazep ines
+Ġmisclass ification
+Ġinsuff lation
+Ġenterobacteria ceae
+w ak
+Ġd xa
+Ġn u
+Ġn gs
+Ġk ol
+Ġmeas urable
+Ġsup ras
+Ġpred etermined
+Ġhyp operfusion
+Ġmicro le
+Ġer as
+Ġbr and
+Ġtransfer ase
+Ġgovern ance
+Ġcsf p
+Ġvo ice
+rox y
+Ġsustain ability
+Ġamelior ate
+Ġpreecl ampsia
+Ġradiof requency
+Ġolfact ory
+Ġn ag
+Ġl ose
+Ġbe ar
+Ġcl osing
+Ġinter ven
+ish ment
+Ġol ive
+Ġpers ian
+Ġvas ospasm
+Ġeryth romycin
+Ġround s
+Ġaggreg ated
+Ġdut ies
+Ġdisappe arance
+Ġign ored
+Ġhypoalbumin emia
+Ġ xt
+Ġo ac
+Ġd ign
+Ġn gt
+Ġn ested
+om ib
+et ical
+Ġr im
+op y
+Ġat ra
+Ġsh aking
+Ġtre gs
+Ġk pc
+Ġpart ur
+Ġval s
+Ġintern ationally
+Ġinfilt rated
+Ġhard ly
+Ġsteroid al
+Ġphysi otherap
+Ġhomogen ate
+Ġknock out
+Ġgeneraliz able
+Ġpuls ed
+Ġsilic one
+Ġcommunic ating
+m y
+Ġc cs
+ra id
+ab l
+Ġmeth icillin
+Ġhyp oplasia
+Ġpa rotid
+Ġcir cles
+Ġpp is
+Ġattach ments
+Ġsched ules
+Ġeryth rop
+Ġequival ents
+Ġcond ens
+Ġpn h
+Ġoverexp ressed
+Ġtry pan
+Ġprompt ed
+Ġcate chin
+itr ile
+Ġgins eng
+Ġeuthan ized
+c am
+f essional
+r ide
+Ġf ellow
+is in
+Ġm cc
+Ġh ps
+el ig
+od es
+Ġfin ishing
+Ġsm ile
+Ġfur cation
+Ġgl oss
+Ġhyper kal
+Ġear s
+ful ly
+Ġz ip
+Ġquant ities
+Ġms i
+Ġgr id
+Ġpc na
+Ġpal sy
+lip tin
+Ġstool s
+ragm atic
+Ġsubmuc osa
+Ġperp et
+Ġaber rations
+Ġspectrom eter
+Ġinterfer ing
+Ġelic it
+Ġmunicip ality
+Ġconflu ence
+Ġmoist ure
+Ġhmg b
+Ġintram uscular
+Ġceram ics
+0 5
+3 2
+Ġw ake
+Ġd he
+Ġm ra
+Ġst ai
+Ġint imal
+Ġpos es
+Ġvari ances
+Ġrem ember
+ust ion
+Ġrest oring
+Ġextra hepatic
+Ġdam aging
+Ġinvas iveness
+Ġgastro esophageal
+Ġfer ric
+Ġremain der
+Ġemphas izing
+Ġdefinite ly
+Ġintens iv
+Ġencod ed
+Ġbab ies
+Ġgum s
+Ġceft az
+Ġunw illing
+Ġundet ectable
+in ergic
+al k
+it abine
+Ġf le
+Ġm art
+Ġsu itability
+Ġass urance
+Ġaf raid
+ans s
+af il
+Ġloc king
+Ġsept a
+Ġlist ening
+Ġfluor oscopic
+Ġtransf ers
+Ġsee ing
+Ġsir s
+Ġbus y
+avi an
+Ġrhin itis
+Ġcylind rical
+Ġpolicym akers
+4 00
+o ce
+Ġm ronj
+Ġe fa
+Ġas h
+Ġhe v
+Ġk illing
+Ġev l
+Ġover bite
+Ġspec ify
+Ġlip opoly
+ole ic
+Ġster n
+Ġprem en
+iop lasty
+Ġpn d
+Ġsulf oxide
+Ġretro per
+Ġnumb ness
+Ġtig ec
+Ġmultin omial
+o ies
+Ġt act
+Ġs ems
+ur in
+Ġg x
+iv ergent
+Ġout let
+ob iliary
+ob uccal
+Ġident ifies
+Ġansw ering
+Ġpm i
+Ġdisp ensed
+Ġpay ments
+Ġmelan in
+Ġcontrovers y
+Ġdiscrimin atory
+Ġanch or
+Ġphotograph ed
+Ġsick ness
+Ġmultip lying
+Ġgent le
+Ġsuperimp osed
+Ġkc n
+Ġars enic
+Ġhelic obacter
+Ġsubcl avian
+Ġnonline ar
+Ġmicrole akage
+oies is
+4 50
+6 00
+m ann
+y an
+it ant
+Ġf oster
+Ġal k
+ath yroidism
+Ġmodel ed
+Ġec s
+Ġhyd roph
+Ġx l
+Ġrt ms
+Ġnan jing
+Ġpb mc
+Ġbelong s
+Ġgs k
+Ġson ographic
+Ġbot an
+Ġmth fr
+Ġbiocomp atibility
+Ġtigec ycline
+Ġ ers
+Ġh oles
+ati ven
+od yn
+Ġres ins
+Ġad vert
+Ġac arb
+Ġtw ins
+Ġext ens
+Ġradi ologist
+Ġpat ellar
+rop ine
+Ġta ught
+Ġadip ocyte
+Ġaes thetics
+Ġord inary
+Ġinterc ostal
+Ġsib lings
+rep resent
+Ġgar lic
+Ġbeg ins
+Ġpreca utions
+Ġacarb ose
+f ast
+in is
+Ġg ib
+op tic
+Ġap ri
+Ġant ich
+yl ation
+Ġradi ologists
 Ġadv ancing
-Ġartic ulating
-Ġland is
-Ġutil ises
-Ġdescrip tors
-Ġx eon
-Ġconnec tors
-Ġconnec tivity
-Ġvisit ors
-Ġchem istry
-Ġchem oresistance
-Ġapproxim ating
-Ġapproxim ates
-Ġback ing
-Ġback bone
-Ġback bones
-Ġproportion ed
-Ġnetwor king
-Ġpol der
-Ġpol aprezinc
-Ġchec ks
-Ġregular ize
-lor ic
-Ġ8 11
-Ġinser tions
-Ġsitu ated
-Ġoptim ised
-Ġoptim izes
-Ġoptim izer
-Ġwa king
-Ġwa iver
-Ġwa gner
-Ġbor oughs
-Ġphot ography
-Ġphot ochemical
-Ġphot oin
-Ġms v
-Ġms x
-Ġms bi
-Ġsubs ides
-Ġsubs ites
-Ġsubs iding
-Ġsubs ampling
-Ġinstruc tor
-me tical
-ru le
-line arities
-Ġassum es
-Ġarti ficially
-Ġtub er
-Ġtub ings
-Ġtub ule
-Ġsil k
-Ġsil ence
-Ġsil vers
-Ġsil va
-tid a
-tid ine
-Ġmus ic
-Ġsn hg
-Ġacro derm
-Ġclean ness
-Ġclean ings
-com b
-Ġtit led
-Ġtit rated
-rop o
-rop enic
-Ġrecru iter
-Ġpen sion
-Ġbar reled
-Ġmucosa e
-Ġprotein ase
-Ġsleep y
-Ġeas iest
-Ġconsequ ential
-Ġmale ic
-Ġvisual izes
-Ġemploy er
-Ġfunctional ized
-Ġfunctional ities
-orb able
-ect odermal
-ony ms
-Ġcod iagnos
-Ġten th
-Ġmagn et
-Ġmagn ificance
-Ġpneum onias
-Ġreal ism
-Ġhydro lytic
-Ġhydro carb
-Ġalg ometer
-ax es
-Ġmineral ising
-ls kron
-Ġic w
-Ġic es
-Ġobjec ted
-ung s
-obl ast
-Ġread ers
-Ġzir kon
-Ġpneumonia e
-Ġmild er
-Ġheter ogenic
-ucle ar
-Ġultr ap
-Ġultr athin
-Ġbur r
-Ġbur ied
-Ġbur rs
-Ġsee kers
-Ġsee berg
-Ġparti tioned
-Ġdam p
-Ġdam pen
-Ġrepl ied
-Ġrepl anted
-Ġhs ps
-Ġhs pa
-Ġge ography
-Ġge ometr
-Ġge ographically
-Ġenc ode
-Ġopen ness
-Ġopen gwas
-Ġmy el
-Ġerup ts
-Ġcut out
-Ġcut mix
-grad ed
-Ġhor us
+Ġhand book
+Ġmid point
+Ġ8 6
+Ġhydro ly
+Ġarch wires
+Ġperf used
+Ġmuscular is
+Ġnsa id
+Ġappreci ated
+ochrom ocyt
+Ġevac uation
+5 00
+h us
+Ġd sa
+Ġb ir
+Ġb oy
+ro tal
+im eters
+Ġwas te
+Ġis op
+op ram
+Ġit p
+Ġsub th
+Ġacc lim
+Ġrem ineralization
+Ġhist ories
+Ġcyt ometer
+Ġsch w
+Ġann ular
+Ġtm ds
+Ġcham bers
+rag ue
+Ġirregular ity
+Ġneuros urge
+Ġmom ents
+Ġevap orated
+Ġcommunic able
+Ġsmart phone
+Ġimper ative
+Ġtender ness
+Ġevapor ator
+Ġrifamp icin
+Ġcolonoscop ies
+Ġhypon atre
+ativen ess
+Ġp ugh
+Ġw el
+Ġg ag
+Ġat a
+og ue
+Ġsu ited
+Ġac ous
+and em
+Ġk amp
+Ġpo af
+Ġtrans d
+Ġpost p
+Ġfl aps
+Ġcent ury
+Ġic m
+Ġmechan istic
+Ġvi rolog
+Ġcle ans
+Ġlymph omas
+Ġ7 7
+Ġ9 1
+Ġ9 7
+Ġ9 8
+Ġlact ic
+Ġconfound er
+Ġlig ands
+Ġdeterior ated
+Ġaggreg ate
+Ġbul lying
+Ġexacerb ate
+Ġsubs idence
+Ġvc am
+Ġoffic ers
+Ġscaff old
+Ġceftaz id
+f ram
+Ġt il
+an cre
+ct c
+Ġcon dom
+Ġbe at
+Ġwh tr
+ver n
+Ġab and
+Ġdat es
+Ġtrans well
+Ġhyper insulin
+Ġdemonstr ation
+Ġrat ers
+Ġhr t
+ck ing
+Ġhypothal amus
+Ġassemb ly
+Ġincent ives
+Ġlyophil ized
+Ġintellect ual
+Ġceftazid ime
+c idin
+f atin
+Ġ ire
+Ġc ine
+Ġw om
+Ġin otropic
+Ġe uc
+Ġg il
+Ġpro hib
+Ġhyper plastic
+Ġoper ate
+Ġox ford
+Ġlog ist
+Ġinteg rin
+Ġaltern ate
+Ġdepend ently
+Ġoptim izing
+Ġtoxic ities
+Ġtranscript ase
+Ġconcurrent ly
+Ġglycos ylated
+Ġdepict s
+Ġorganis ations
+Ġerythemat osus
+child ren
+b ut
+v is
+Ġa us
+Ġp arietal
+Ġm bs
+Ġe bp
+ot ax
+ot actic
+Ġev s
+Ġmet als
+Ġsm ir
+Ġocc luded
+Ġep cs
+Ġlead er
+omet rically
+Ġbacter ium
+Ġms h
+Ġdig ested
+Ġqual ification
+Ġpol and
+Ġbcl c
+Ġinact ivated
+Ġremn ants
+Ġtpo ab
+Ġjudg ement
+Ġken ya
+Ġexem pl
+Ġbioinform atics
+Ġc ements
+Ġf ert
+Ġch en
+Ġap c
+vi an
+ap p
+Ġout line
+Ġref uge
+Ġhyp och
+Ġhand led
+Ġos s
+Ġreal ized
+Ġce iling
+Ġsil ent
+Ġtt g
+Ġstabil ize
+Ġpolyph arm
+Ġmultim orbid
+Ġinters ection
+Ġconvers ation
+Ġantip roliferative
+Ġmisdi agnosed
+Ġelectrophys iological
+alco holic
+Ġhyponatre mia
+Ġas thm
+Ġcon clusive
+Ġv ka
+op ril
+Ġde ox
+Ġat ropine
+Ġcomp ressed
+Ġse p
+Ġun meas
+Ġph r
+enc l
+Ġact ed
+Ġar bs
+Ġte en
+Ġmm ps
+Ġ8 8
+Ġmt v
+Ġnm da
+Ġillust ration
+Ġrelie ving
+Ġhol ds
+Ġveget able
+Ġcus ps
+Ġsoc ially
+Ġcytos olic
+Ġarb it
+Ġinaccur ate
+2 64
+h id
+r ill
+s f
+Ġt andem
+Ġw orm
+Ġre ce
+Ġl ens
+um inal
+op es
+Ġat om
+Ġtwo fold
+pl ay
+Ġrec re
+Ġrisk y
+ass ment
+Ġso y
+Ġconsid ers
+Ġprom ise
+Ġhep cidin
+Ġlip s
+Ġhand over
+Ġmid pal
+Ġmc m
+Ġsensit ivities
+Ġrecess ive
+Ġcaucas ians
+Ġenvelop es
+Ġmib g
+Ġubiqu it
+Ġhypercap nia
+Ġpter yg
+Ġsphygmoman ometer
+Ġt ts
+Ġp ir
+Ġd ress
+ur ring
+Ġsp ending
+Ġsym metry
+Ġterm ed
+uss ion
+Ġstrength ened
+Ġcb d
+Ġmention ing
+Ġpet role
+Ġrv f
+fl urane
+Ġbott le
+Ġaggrav ated
+Ġconsolid ated
+Ġstret ch
+Ġeh r
+Ġretic ulum
+Ġpetrole um
+p ow
+Ġp end
+Ġm ip
+Ġb end
+ent ive
+Ġn ick
+od erm
+ys eal
+ers en
+end or
+Ġpr ices
+Ġdes er
+ob acterial
+Ġthera peut
+Ġi ia
+Ġhypoth etical
+Ġ8 1
+Ġthick er
+Ġvs mcs
+Ġgran ular
+Ġexacerb ated
+Ġhomogen ates
+Ġgranul oma
+Ġsound s
+Ġcool ed
+Ġdox yc
+Ġpostt raumatic
+Ġfluc onazole
+Ġanore xia
+h f
+y cl
+Ġa rous
+Ġw ang
+Ġv b
+em ble
+ag c
+Ġdis ag
+Ġro of
+Ġend o
+Ġdr g
+ox aban
+Ġed oxaban
+Ġel l
+Ġdo ac
+Ġca vi
+Ġgluc agon
+Ġdm f
+Ġ8 3
+Ġ9 3
+ling ual
+Ġport able
+Ġincis ional
+Ġarr ive
+Ġsf e
+Ġot us
+Ġtransm ural
+Ġinput s
+Ġram us
+Ġhydroxy apatite
+Ġfruct ose
+Ġrhiz oma
+Ġinfrequ ent
+Ġphe ochromocyt
+f il
+v ar
+Ġt sa
+Ġb z
+ult ure
+ub ated
+Ġinfl ated
+Ġem a
+Ġbec k
+Ġso x
+Ġso aked
+Ġmain land
+Ġrep aired
+Ġct c
+Ġhf s
+Ġla un
+Ġarth roscopic
+Ġinterpret ations
+Ġstom atology
+Ġtransition al
+Ġspread ing
+Ġah f
+Ġpum ps
+Ġnic u
+Ġpolyph en
+Ġweakness es
+Ġoccas ional
+Ġsuppl ies
+Ġlute olin
+Ġmonolay er
+Ġdign ity
+Ġmidpal atal
+z in
+z olid
+Ġan terolateral
+Ġb pa
+Ġh idden
+os itis
+ol ine
+Ġcon ical
+Ġr pe
+ist ribut
+Ġch ip
+qu ant
+ac ute
+per idone
+Ġun se
+Ġam end
+Ġph pt
+Ġro w
+Ġro x
+Ġproc alc
+Ġbas ically
+Ġmon omers
+Ġanti em
+Ġclass ifying
+Ġneg lected
+Ġang er
+Ġeven ly
+Ġadv ocate
+Ġanes thesiology
+Ġplas ter
+Ġmut ational
+Ġcv r
+Ġ9 4
+Ġview ing
+Ġtract s
+rel in
+Ġtet razolium
+Ġbox es
+oblast ic
+Ġcircumf lex
+Ġql q
+Ġlogarith mic
+Ġmediast inal
+irection al
+Ġunaccept able
+Ġunmeas ured
+er ge
+Ġc z
+Ġf riction
+Ġd ul
+Ġh unt
+Ġst ayed
+ur ine
+Ġch ains
+Ġcal f
+Ġprob and
+Ġstandard ize
+Ġline zolid
+Ġox imetry
+Ġadminist rators
+Ġprop idium
+Ġmm r
+Ġapproxim ation
+Ġsa ve
+Ġutil ised
+Ġconsent ed
+Ġveloc ities
+Ġcn n
+Ġaggrav ate
+Ġirrit able
+Ġlect ure
+Ġreplic ates
+Ġzyg omatic
+Ġdisproport ion
+Ġacous tic
+Ġdoxyc ycline
+Ġp co
+Ġm bp
+Ġb ang
+Ġst ains
+Ġcon ceiv
+il ation
+Ġit erative
 Ġev oked
-Ġev andro
-Ġmicroscop es
-Ġmill ions
-Ġphosph orous
-Ġphosph opeptide
-Ġbenef ited
-Ġsem ia
-Ġsem ipartial
-pati ent
-Ġfp ds
-Ġinstrument ations
-Ġlig ase
-Ġlig ands
-Ġmac ules
-Ġregen erate
-Ġsci encedirect
-Ġexplain able
-Ġexplain ability
-Ġcomposition ally
-Ġpapill oma
-Ġpapill omavirus
-nt p
-nt on
-Ġfav oured
-uk i
-Ġq c
-Ġq iac
-Ġq ray
-Ġq assim
-Ġq azvin
-Ġve t
-Ġve au
-agen er
-agen ous
-Ġmar ria
-Ġmar mara
-Ġmar wah
-Ġmass ively
-Ġbin ocular
-Ġhom olog
-Ġdys m
-Ġdys plastic
-Ġdys keratosis
-Ġmesial isation
-Ġdescriptive ly
-Ġpass ages
-Ġmach inery
-Ġra vera
-Ġintrusion s
-Ġcheck point
-Ġcop enh
-Ġcop olymer
-Ġher itability
-Ġcho ke
-Ġadjust ability
-Ġpm p
-Ġtur b
-Ġtur in
-Ġnan oseal
-Ġnan omater
-Ġnan odrop
-Ġnan ogel
-Ġadap ts
-Ġcandid al
-Ġcandid ate
-Ġdown grade
-Ġ19 50
-Ġ19 86
-Ġur ge
-Ġur ges
-Ġur ging
-Ġphen otyping
-Ġtransfer rin
-thes ia
-opath ies
-opath ogen
-Ġent ail
-Ġgerm ans
-Ġachieve ments
-Ġstre am
-Ġrc us
-Ġmis rec
-Ġmis fit
-Ġmis information
-Ġcirc uit
-Ġintegr in
-Ġsa har
-Ġrecogn ising
-Ġrecogn izes
-Ġasym ptotic
-Ġdiss imilarities
-Ġretr actions
-Ġdecl ines
-Ġfibro vascular
-Ġna eslundii
+Ġmult ile
+ob ulin
+Ġhyper cal
+Ġel ution
+Ġq s
+Ġiv us
+Ġlv m
+Ġpb mcs
+Ġdiscrimin ative
+Ġcoup ling
+Ġtap ered
+Ġhaemat oma
+Ġbms c
+Ġharb oring
+Ġglycer ol
+Ġc ere
+Ġc st
+Ġp ns
+ro st
+ul izumab
+Ġbe ads
+ial dehyde
+Ġco oper
+Ġro is
+Ġinv itation
+Ġcar ries
+Ġret ard
+Ġhem s
+Ġelev ations
+ci ent
+Ġcm c
+Ġip ss
+Ġpac ific
+Ġ200 3
+Ġaust ria
+Ġsul cus
+Ġstop ping
+Ġgh relin
+Ġgut ta
+Ġpossess es
+Ġnad ph
+Ġtown s
+Ġvertebra e
+Ġpolypharm acy
+Ġt as
+Ġp anss
+Ġd ansh
+Ġb os
+ul itis
+Ġfor th
+Ġint uss
+Ġep a
+Ġmy x
+Ġmal ond
+Ġir b
+Ġconcentr ate
+Ġmembr an
+Ġhead aches
+Ġneuro tic
+opl akia
+Ġchrom atin
+Ġsinus itis
+Ġtransform ing
+Ġformal dehyde
+Ġexce eds
+Ġdestr uctive
+Ġgf p
+Ġtransc atheter
+Ġthiop ental
+Ġfox o
+f ir
+l oid
+v alu
+Ġc pt
+it re
+om ings
+Ġab rup
+Ġam s
+Ġdur al
+Ġag s
+Ġem erge
+Ġcal m
+Ġcal or
+Ġear th
+Ġindex ed
+Ġhb p
+Ġmorph ometric
+Ġrepl icated
+Ġfill ings
+Ġchol inergic
+Ġast rocytes
+Ġquad rup
+Ġstrept ococci
+Ġsubstit utes
+Ġey el
+Ġber lin
+Ġvolunt arily
+Ġdecid ing
+Ġprev ail
+Ġsubtract ing
+ifferent iated
+Ġintox ication
+Ġshortc omings
+Ġferro ptosis
+Ġcommence ment
+Ġprocalc itonin
+Ġmultile vel
+l ofen
+Ġc pe
+Ġin version
+Ġre lying
+ra ys
+up rofen
+ag liptin
+ad ow
+Ġind ent
+Ġtr uth
+Ġsub lingual
+Ġpo le
+Ġem g
+Ġident ifiable
+Ġfig o
+Ġpar am
+arg ine
+Ġve gfr
+Ġgo es
+Ġib uprofen
+odont ia
+Ġappear ing
+Ġsinus es
+Ġproject ions
+Ġflex ural
+Ġarg ument
+Ġbreak s
+Ġfragment ed
+Ġquar ters
+Ġretain ers
+Ġspiritual ity
+Ġcarbapenem ase
+Ġmalform ation
+Ġproce ed
+Ġxen ograft
+Ġdisab led
+nit ine
+Ġdrople ts
+Ġsubth em
+6 17
+n l
+Ġt rol
+Ġf ight
+ic an
+or ate
+Ġm oxib
+Ġst unting
+Ġas pro
+ut ional
+Ġch ile
+Ġper cha
+Ġstat ing
+Ġant ec
+Ġser t
+Ġnon f
+Ġimp uls
+Ġref eren
+Ġi an
+ron ate
+Ġang el
+Ġcap n
+Ġcommun ications
+Ġmuc in
+Ġstro kes
+Ġcp d
+ula e
+Ġkin etic
+Ġaccum ulate
+Ġocclus ive
+Ġamin oglyc
+Ġwithd rew
+Ġah i
+Ġmh t
+Ġtrop ical
+Ġcoordin ator
+Ġperm it
+Ġbig ger
+Ġblast ocyst
+Ġpert inent
+Ġdext rose
+Ġsubpop ulations
+Ġfriend ly
+Ġfluorid ated
+Ġnal ox
+Ġsyna ptic
+Ġrece ipt
+Ġmoxib ustion
+Ġaspro sin
+9 37
+Ġo ven
+Ġc ps
+al ed
+os ides
+up loid
+ot ro
+ort isone
+Ġac a
+Ġmult il
+Ġgener ations
+Ġcardi over
+Ġmal p
+Ġeight een
+Ġ7 4
+Ġdm c
+Ġov ulation
+Ġprescrib e
+Ġorigin ate
+Ġdop aminergic
+Ġter at
+Ġelectrocardi ographic
+Ġimmig rants
+Ġnormot ensive
+Ġaceton itrile
+Ġintuss us
+Ġmalond ialdehyde
+at able
+Ġs ella
+Ġp af
+ic c
+an in
+im azolam
+ad h
+Ġph age
+Ġsp ong
+unction al
+Ġdist ension
+Ġmicro f
+hol der
+Ġflow er
+Ġq sofa
+Ġprofessional ism
+Ġhs c
+Ġperiodont ium
+Ġperiodont ology
+Ġangi ogram
+Ġmar sh
+Ġnf atc
+Ġsed ated
+Ġshif ting
+Ġrob ot
+Ġglyc ine
+Ġple iotrop
+Ġpossess ed
+Ġgf d
+Ġexec ution
+Ġimmob ility
+Ġsupervis or
+lipid aemia
+h t
+w ley
+ed ent
+or ptive
+Ġn ociceptive
+os im
+ine a
+ost rid
+Ġag p
+Ġdep ended
+Ġrem imazolam
+Ġbas ement
+thes e
+Ġca e
+rh iz
+roscop e
+vir al
+Ġpharmac ist
+Ġpol ice
+Ġ200 2
+Ġglyc ation
+Ġauc s
+Ġcoord inated
+Ġmanufact ured
+Ġeu ros
+Ġgree ce
+Ġharvest ing
+Ġneurodegen erative
+Ġcow ork
+0 1
+er us
+Ġf q
+Ġb di
+Ġl amp
+ect om
+oc ular
+Ġle th
+Ġcl o
+Ġinter play
+ugh ter
+Ġcr rt
+Ġwor ried
+Ġend ing
+Ġwork up
+Ġps qi
+Ġsol itary
+Ġmental ly
+Ġcod on
+Ġaccount ability
+Ġstratif y
+Ġcereb ellar
+Ġchrom ium
+Ġpersist ing
+Ġtit ers
+Ġmor oc
+Ġicd as
+Ġlin oleic
+Ġunfav our
+Ġrod ents
+Ġpoll ution
+Ġcorrob orated
+Ġglycos ides
+Ġreadm itted
+Ġxyl itol
+Ġkd igo
+Ġfloss ing
+Ġrender ing
+Ġcompuls ory
+Ġlegis lation
+g el
+Ġs se
+Ġl inc
+ol amine
+if lo
+ud ing
+un ity
+Ġme c
+Ġj ur
+Ġpredict ability
+Ġhist ogram
+Ġintra medullary
+Ġvi et
+Ġcost ly
+Ġct g
+Ġmuc ous
+Ġ8 4
+Ġshe ets
+Ġprec eded
+Ġrot ating
+Ġchromat ogram
+Ġperic ardium
+Ġinoc ulation
+Ġmarket ing
+Ġspo ke
+Ġdiscl osure
+Ġencompass ing
+Ġfrag ility
+Ġtermin ology
+Ġaux iliary
+Ġdiscer n
+pie ce
+g u
+Ġre in
+Ġh on
+Ġl ying
+ia o
+lud ing
+Ġafter load
+ple asant
+Ġover s
+Ġret reatment
+Ġcomb ines
+Ġdent ate
+Ġmass eter
+oxid ase
+Ġdysfunction s
+Ġemploy ee
+Ġrank s
+Ġfil ters
+Ġparal ysis
+Ġfed eration
+Ġdistinct ive
+Ġallevi ating
+Ġtaiw anese
+Ġsubcutaneous ly
+Ġpolar ity
+Ġclinicopath ologic
+Ġclav ul
+Ġinterpro fessional
+Ġperfor ations
+Ġhusb and
+Ġarbit rary
+r ip
+Ġa y
+al g
+Ġin elig
+it ance
+Ġf cs
+Ġf fa
+Ġb bb
+im ulated
+Ġbe vac
+op a
+Ġob sc
+Ġun pleasant
+Ġincre ments
+Ġpr as
+Ġj um
+Ġkn ife
+Ġes i
+Ġmicro v
+Ġacute ly
+Ġshort en
+Ġpd ac
+Ġster ilized
+Ġbp d
+inf ected
+erent ially
+Ġmill er
+Ġconver t
+Ġeryth rocytes
+Ġviol ent
+Ġdivers ion
+Ġgir l
+Ġine v
+Ġtel om
+Ġirre lev
+Ġfabric ation
+Ġaph th
+Ġrn ase
+Ġmyofib rob
+Ġimmunoblot ting
+Ġtumorigen esis
+embr ane
+Ġautonom ous
+Ġhyperkal emia
+Ġdisag ree
+Ġnalox one
+Ġunfavour able
+m g
+Ġc et
+Ġp ragmatic
+Ġf ap
+or ia
+im er
+ip ple
+se pt
+ay a
+Ġcl ostrid
+Ġmed iter
+Ġy l
+Ġcor n
+ri an
+Ġbr du
+Ġcam ero
+Ġdiv erg
+Ġacqu iring
+Ġport ions
+Ġmp i
+Ġenter ococcus
+Ġshap ing
+Ġevol ving
+Ġthin ner
+Ġfulf il
+Ġrepeat ability
+Ġaw ak
+Ġelectrocardi ography
+Ġsustain ing
+Ġaccident al
+Ġcampaign s
+Ġxanth ine
+Ġkel oid
+Ġsenes cence
+Ġbru cell
+Ġoverlo oked
+Ġmediter rane
+i ors
+u h
+Ġs re
+Ġw ine
+ent in
+an asal
+ul ic
+Ġst n
+Ġall odyn
+Ġmet er
+Ġam en
+du oden
+Ġhealth ier
+form ed
+Ġfl i
+Ġfl ash
+Ġcondition ed
+Ġmicro albuminuria
+Ġfra x
+Ġsleep iness
+Ġaccept ing
+Ġoccup ations
+Ġpulp al
+Ġhl h
+Ġgraph ical
+Ġsac ral
+Ġparas ternal
+Ġmidw if
+Ġallerg en
+Ġsubd ural
+Ġcasp ases
+Ġthermocy cling
+Ġtamp on
+keep ing
+Ġwom ac
+Ġneurotic ism
+Ġbevac izumab
+b ia
+Ġt ired
+at emia
+Ġs oph
+Ġd ha
+Ġm ission
+Ġb yst
+as ters
+Ġg ang
+ud en
+ab d
+ac a
+Ġcl d
+Ġmod ular
+Ġtime fram
+Ġpub lish
+Ġdom inance
+Ġagg ression
+Ġhab itual
+Ġglyc ol
+Ġgovern ments
+ocar cin
+Ġfoot note
+Ġgland ular
+Ġexacerb ations
+Ġpredisp ose
+Ġcari ogenic
+Ġthyro xine
+Ġconverg ence
+Ġphle b
+Ġviet nam
+Ġcamero on
+Ġmediterrane an
+b est
+d am
+Ġth umb
+Ġp are
+Ġp de
+Ġre hyd
+Ġe es
+ul ism
+Ġl uting
+un ion
+Ġcomp ly
+Ġne pal
+Ġall oy
+Ġall ograft
+Ġtr p
+Ġun co
+Ġassess ors
+Ġdem arc
+Ġdef lection
+Ġic er
+ful l
+Ġsl n
+Ġquant ifying
+ru v
+Ġfraction ated
+Ġteach er
+Ġpref ect
+Ġglycem ia
+ze ch
+Ġaneurysm al
+Ġanc est
+Ġtro ub
+Ġunw anted
+Ġcholangi ocarcinoma
+num er
+Ġwed ge
+Ġnephrot oxicity
+Ġneighbor hood
+a w
+t ive
+ab a
+Ġpre med
+Ġsh allow
+ost atin
+Ġtr iph
+Ġpo uch
+Ġdes aturation
+ond er
+Ġdevelop ments
+Ġhyper m
+Ġhyper par
+Ġinflamm asome
+ec yl
+Ġimpact ing
+hol m
+Ġut is
+Ġstrateg ic
+Ġincl ined
+Ġsle e
+Ġmiss ense
+Ġbrain st
+Ġmel ting
+Ġphot omic
+Ġtransl ational
+Ġcephal ograms
+Ġrod ent
+lyca emic
+Ġtriang le
+Ġposit ron
+Ġthorac otomy
+Ġengine ering
+Ġelong ation
+Ġdissoci ation
+v able
+Ġp ga
+Ġn ap
+Ġn cc
+od ynamics
+ag a
+ip p
+Ġdis asters
+Ġcl ips
+end an
+Ġmed ullary
+Ġcol p
+ane urys
+oph an
+Ġca vern
+Ġent ries
+Ġpm n
+Ġast rag
+Ġvag al
+Ġtur ning
+Ġvect ors
+Ġwebs ites
+Ġmicrocirc ulatory
+Ġnv af
+Ġperine ural
+Ġics i
+Ġunem ployed
+Ġmicrod ilution
+Ġendors ed
+Ġprecon dition
+Ġeug enol
+Ġunpredict able
+i et
+x l
+Ġt on
+Ġs na
+Ġc zech
+Ġd ust
+Ġm old
+Ġb br
+ro ot
+om atosis
+ur v
+ur onic
+Ġg ated
+oc le
+ell er
+Ġne oint
+Ġsc ap
+Ġap ap
+Ġno acs
+Ġparticip ates
+Ġec og
+Ġcre b
+Ġschool children
+Ġge o
+Ġspl icing
+Ġarr ived
+Ġcement less
+Ġcolum ns
+Ġautoimm unity
+Ġneph rectomy
+Ġtach y
+Ġche ek
+Ġautoantib ody
+Ġsymmet rical
+omyel itis
+Ġprerequ isite
+3 00
+5 5
+y ag
+Ġw ax
+an o
+Ġn ci
+Ġg ma
+res ults
+Ġsub f
+Ġclin d
+ract ed
+Ġar res
+Ġar te
+Ġes rd
+Ġlif es
+Ġpsych ologists
+Ġlog ical
+Ġblock age
+Ġhydro lysis
+Ġagg l
+Ġlater ally
+Ġresidual s
+Ġpulp itis
+Ġju ven
+Ġcorrobor ate
+Ġisch aemia
+Ġisra el
+Ġcondens ation
+Ġunse lected
+Ġcowork ers
+: .
+p red
+t m
+Ġa om
+on yl
+Ġl is
+ens it
+Ġmet ach
+Ġsub acute
+Ġqu in
+Ġra ds
+Ġi as
+yl ene
+Ġabove mentioned
+Ġagre es
+Ġig t
+Ġcompl ied
+Ġdelay ing
+Ġfibrin olysis
+Ġschem es
+Ġpara vertebral
+Ġlev osim
+Ġbig gest
+sacchar ides
+Ġcatechol amines
+Ġads orption
+Ġstring ent
+lofen ac
+Ġclavul an
+Ġclind amycin
+f p
+Ġt fs
+en a
+Ġin exp
+Ġd av
+Ġb ib
+Ġl st
+el enburg
+ist ein
+Ġinc omp
+Ġsu cking
+Ġind uctive
+ell ite
+Ġinf low
+Ġgen istein
+Ġinv ari
+Ġhyp eremia
+Ġmo h
+Ġsyn ergy
+Ġrepresent ativeness
+Ġdisch arg
+Ġsn oring
+Ġcorrect ing
+Ġmc g
+bi osis
+Ġsut uring
+Ġmamm alian
+Ġscop us
+agl iflo
+Ġfire f
+Ġamph oter
+Ġori ental
+Ġintu itive
+Ġlevosim endan
+Ġa qu
+ic y
+Ġm ct
+Ġe pha
+Ġst ell
+ur ations
+Ġse g
+Ġdis hes
+Ġind eterm
+Ġme k
+Ġfo etal
+Ġpl s
+Ġfol ic
+Ġconcent ric
+Ġfe ces
+rop in
+Ġcross bite
+Ġemb olic
+Ġste at
+Ġconsult ant
+Ġinsp iration
+Ġhyperg lycaemia
+Ġpref rontal
+Ġparas ites
+Ġfing ers
+Ġdic lofenac
+Ġtrim eth
+Ġlect ures
+Ġunem ployment
+Ġhypoch lor
+8 6
+g h
+l ay
+Ġf rs
+Ġn es
+Ġn rm
+id p
+est rogen
+ep razole
+Ġwell ness
+Ġimpro per
+Ġprop osal
+Ġshort ness
+Ġcontribut ors
+Ġroot ed
+Ġmr d
+Ġendoscop ically
+Ġcross ed
+Ġfraction ation
+Ġmorph ologic
+Ġpharmac otherapy
+Ġmembers hip
+Ġperiph ery
+Ġnat uro
+Ġtrend elenburg
+Ġip mn
 Ġaccum ulating
-Ġaccum ulative
-Ġcarb oxymethyl
-Ġeuro ba
-Ġeuro transplant
-Ġcam eras
-Ġflex ofiles
-Ġnod al
-Ġnod atum
-Ġram i
-Ġram p
-Ġram ifications
-for ation
-Ġcomputer s
-Ġwr ists
-Ġke ys
-Ġke gg
-Ġmanif ests
-Ġdemineral izing
-Ġminim ization
-Ġglob e
-Ġpil omat
-Ġfore gone
-Ġnone x
-Ġreciproc ation
-Ġther most
-Ġther abite
-Ġmetabol ize
-Ġmetabol ite
-els k
-Ġaccount able
-Ġds p
-Ġalloc ate
-Ġhis ti
-Ġhis tidine
-Ġrun t
-oph osph
-oph aga
-Ġvitamin s
-opl ates
-Ġpromo tional
-Ġ12 1
-Ġ12 5
-Ġ12 8
-Ġfacilit ator
-ochem ically
-down regulation
-the y
-Ġabr idged
-Ġabr upt
-Ġarr ange
-Ġrespir ation
-Ġsubstanti ated
-li ya
-Ġann ouncement
-Ġmc grath
-Ġmc neil
-Ġenhance ments
-Ġsuscepti bilities
-Ġbal kan
-Ġattend ances
-Ġfalse ly
-Ġlymph atic
-Ġrap idity
-Ġprop ia
-Ġprop idium
-Ġprop onents
-Ġdeb ated
-Ġstrati fy
-Ġcentr ally
-Ġip ex
-Ġmig rant
-Ġrev ol
-Ġrev ise
-Ġrev man
-Ġstem ming
-Ġunderw ood
-Ġsubstit utions
-Ġsubstit uting
-ced ented
-Ġbeg un
-Ġemph ysema
-Ġsummar ises
-Ġsubm it
-Ġsubm erged
-Ġsubm icron
-Ġemp tied
-Ġswed es
-Ġinferior ly
-Ġcalibr a
-Ġcalibr ators
-Ġcall ip
-Ġlat encies
-aryn go
-Ġparallel ism
-Ġcc nd
-Ġmas king
-Ġreaction ary
-Ġrestric ts
-Ġweak ens
-Ġactin obacteria
-Ġpurpose ly
-Ġpurpose ful
-Ġcentrifug ing
-Ġown er
-Ġown ed
-Ġhere by
-Ġreproduc tive
-Ġdiscrep ant
-Ġdepend ant
-Ġdepend ents
-Ġdepend ency
-Ġcollagen olytic
-Ġinterd igitation
-ino in
-Ġtom ograph
-Ġtom ographic
-Ġcerv ically
-Ġabras iveness
-Ġabras ivity
-Ġaccep ts
-Ġremineral ising
-Ġcircum vallate
-wh en
-wh ich
-Ġhome work
-Ġtonsill itis
-Ġmic afung
-Ġmix er
-Ġsecre t
-Ġconst ants
-Ġ16 08
+Ġbran ching
+Ġdeb rief
+Ġlob es
+Ġcup s
+Ġabnorm ally
+Ġallerg ies
+Ġcholest asis
+Ġnorad renal
+Ġmidwif ery
+Ġ ix
+Ġf ms
+or ov
+Ġb ia
+Ġh one
+if era
+Ġas cribed
+Ġar i
+ici an
+Ġintra d
+Ġsens ors
+Ġmat rices
+Ġsl it
+Ġhs d
+Ġdown loaded
+Ġbal ancing
+Ġaden omatous
+Ġste ep
+Ġexperiment ation
+Ġattenu ates
+Ġion ization
+Ġprogress es
+Ġpy el
+Ġpenet rate
+Ġcarbap en
+Ġbif id
+Ġhistor ically
+Ġclot ting
+Ġune ven
+Ġglyco lysis
+Ġundes irable
+Ġinev itable
+Ġmetach ron
+i ates
+n ov
+Ġc ds
+Ġin otro
+Ġn ond
+Ġst ores
+Ġres ections
+Ġim r
+st ud
+Ġco ar
+Ġsc ars
+Ġqu asi
+Ġbl oating
+Ġcr uz
+Ġser opos
+Ġend emic
+Ġpar s
+Ġdel iber
+Ġmicro struct
+Ġdys plastic
+Ġoste omyelitis
+Ġdec ont
+Ġcommit ted
+Ġlv ot
+Ġms c
+Ġpharmac ologic
+Ġsecre ting
+Ġcompreh ension
+Ġconcept ion
+Ġown ers
+Ġcran ioplasty
+Ġtt m
+Ġscar ring
+Ġaud io
+Ġho ok
+for ward
+Ġmicroorgan ism
+Ġelast ography
+Ġpoll ut
+Ġallerg ens
+Ġdissatisf ied
+Ġrip a
+Ġclav icle
+Ġcaffe ine
+Ġdivertic ulum
+Ġunint ended
+Ġtrypt ophan
+Ġlich en
+Ġinexp ensive
+Ġc em
+Ġw ood
+Ġe ep
+Ġn est
+ol ol
+Ġbe e
+Ġde ployment
+Ġim v
+Ġse q
+ac ies
+ac itinib
+Ġpl atin
+Ġra as
+Ġsex t
 Ġcontinu um
-Ġwrit ers
-Ġker as
-Ġker atosis
-Ġgly ca
-Ġbio eth
-Ġbio assay
-Ġbio analyzer
-Ġbio avail
-Ġjud ges
-Ġcoordin ator
-Ġcoordin ators
-Ġnh ird
-Ġwire less
-Ġcoating s
-Ġsurround ings
-Ġindent ed
-Ġindirect ness
-Ġplastic ization
-Ġtor ino
-Ġtor onto
-Ġtor quing
+Ġoff ices
+Ġmig rated
+Ġlig aments
+Ġrh abd
+Ġpg c
+Ġquad rants
+Ġgd f
+Ġdh s
+Ġencod es
+Ġmicros ph
+Ġprecip itate
+Ġedent ulism
+Ġphenol ics
+Ġmicror na
+Ġhemisph ere
+Ġaphth ous
+Ġhyperpar athyroidism
+Ġphotomic rog
+Ġjuven ile
+agliflo zin
+Ġamphoter icin
+Ġcarbapen ems
+r one
+Ġo ocytes
+Ġc ant
+Ġc ysteine
+Ġb ai
+Ġres orb
+act one
+Ġdi os
+Ġk cl
+Ġheal ers
+Ġund ifferentiated
+Ġsp ons
+Ġsp ouse
+Ġdef er
+Ġdef ines
+Ġsm d
+Ġsym ph
+Ġif g
+Ġyo un
+oty ping
+Ġmuc inous
+Ġrs a
+Ġqual ities
+Ġunst imulated
+Ġaver ages
+oqu ine
+Ġsort ed
+Ġtrich rome
+Ġkol m
+t l
+re t
+on ge
+Ġp bl
+ed och
+Ġl uts
+Ġg ame
+Ġcon duc
+Ġgro ove
+Ġk illed
+Ġreg ime
+cl s
+Ġdem ineral
+Ġdef ault
+Ġimp osed
+Ġed it
+Ġline age
+Ġyo uden
+Ġradi op
+Ġmark s
+Ġdys biosis
+Ġsl ug
+Ġhand ed
+Ġadh ering
+Ġmap ped
+less ness
+Ġcycl ospor
+Ġleuk oplakia
+Ġcomposition s
+Ġmethyl ene
+Ġtt c
+Ġgovernment al
+Ġcoup le
+Ġtransp aren
+Ġsevent een
+Ġinterc ourse
+Ġascertain ment
+Ġgab ap
+Ġannot ation
+Ġlav ender
+Ġgonad otrop
+Ġactinomy cet
+Ġparam ount
+Ġawak ening
+Ġconduc ive
+h and
+z z
+Ġt an
+Ġo ab
+Ġin ex
+Ġd or
+Ġd and
+Ġgen omes
+Ġdist raction
+Ġevalu able
+Ġfunction ally
+Ġsec ured
+Ġcorrel ating
+Ġgeneral ization
+Ġantib i
+Ġinst ant
+Ġpoly saccharide
+Ġdys men
+Ġct p
+Ġflow s
+Ġenrol ling
+Ġvascular ization
+Ġlinear ly
+Ġselect ivity
+Ġeg ger
+Ġevol ved
+Ġcontain er
+Ġlm r
+Ġparas ym
+Ġhuve c
+Ġretain er
+Ġpopular ity
+Ġlaryng oscope
+Ġhypn otic
+Ġneuropsych iatric
+Ġwitness ed
+Ġtact ile
+Ġantich olin
+Ġtampon ade
+Ġastrag al
+Ġmetachron ous
+Ġkolm og
+Ġgabap entin
+7 7
+f iltration
+n ps
+Ġs ga
+Ġo idp
+Ġc es
+Ġd bb
+Ġb cr
+Ġh odg
+et ary
+os arcoma
+Ġg bd
+Ġex ons
+Ġr nas
+Ġch m
+Ġsc rotal
+Ġty ph
+Ġles ional
+Ġpan ic
+Ġincub ating
+Ġdil i
+Ġpc ps
+Ġsegment ed
+Ġadapt ability
+pr int
+Ġcollagen ase
+Ġgranul omatous
+cyst ic
+Ġfluctu ation
+Ġingest ed
+Ġelectroly tes
+Ġnumb ered
+Ġhypothal amic
+Ġsubpop ulation
+Ġmultimorbid ity
+Ġyoun gest
+4 9
+Ġc ce
+Ġc ys
+Ġp par
+Ġan orectal
+is ations
+Ġre e
+Ġe ag
+Ġl osing
+il ent
+Ġco at
+pro p
+Ġser rated
+Ġdisc ount
+Ġmic rol
+Ġhyp oech
+Ġpur ple
+Ġair flow
+Ġcv s
+cell ulose
+Ġevery one
+Ġfav oring
+rophil ic
+Ġnar r
+Ġfund us
+Ġchol edoch
+Ġsr cc
+Ġinconsist encies
+no ea
+Ġstraight forward
+Ġgenoty pic
+Ġunre li
+ky o
+Ġderiv ative
+Ġrap amycin
+Ġdot ted
+Ġcoexist ing
+Ġphilosoph y
+Ġoutd oor
+Ġhydroc ortisone
+Ġlipopoly saccharide
+Ġretroper itoneal
+Ġirrelev ant
+Ġtransparen cy
+l act
+m ill
+t le
+Ġs q
+Ġo g
+Ġd yst
+Ġl ns
+Ġwh ites
+Ġch s
+Ġch it
+Ġit ching
+ast es
+Ġam m
+Ġout l
+Ġperi anal
+Ġstr iat
+Ġtra de
+oper oxidase
+Ġpar ag
+Ġdeterm inations
+Ġsit osterol
+Ġmat urity
+Ġaut osomal
+ereb ral
+Ġcompreh ens
+oscler osis
+Ġunc overed
+Ġclar ithromycin
+Ġmas ked
+Ġgli omas
+Ġtens or
+Ġhv kp
+Ġoffic inal
+Ġkill ip
+Ġmaneu vers
+Ġcaffe ic
+Ġworksh ops
+Ġpix el
+Ġquint ile
+Ġobs ess
+Ġrehospital ization
+Ġhydroph obic
+alg am
+Ġd ere
+Ġb ct
+ure th
+Ġsub ch
+Ġam n
+Ġam algam
+Ġqu ot
+Ġcol omb
+Ġag encies
+Ġag ilent
+Ġpost ural
+Ġlif t
+Ġfail s
+Ġsuper numer
+Ġda wley
+Ġsumm ing
+Ġcp i
+Ġms u
+Ġtb il
+Ġcall ing
+Ġden oted
+Ġvul gar
+Ġhyperg lycemic
+Ġter penoids
+Ġscal ed
+Ġoverest imate
+uz umab
+Ġfen est
+opre cip
+Ġsediment ation
+Ġcleans ing
+8 5
+Ġt ort
+Ġt sc
+Ġc vi
+et ent
+id ity
+Ġas ide
+od arone
+Ġal s
+Ġsh iv
+ip line
+Ġpart y
+Ġbl oc
+Ġend oplasmic
+Ġgener ator
+Ġdisc ipline
+Ġfl ank
+ores t
+Ġes m
+Ġmo i
+Ġmark ing
+Ġpsych otherapy
+Ġpsych ologist
+Ġdl p
+Ġdl t
+Ġpathological ly
+Ġbreath s
+gl ottic
+organ ic
+Ġwu han
+Ġpheochromocyt oma
+Ġpolyphen olic
+istribut ion
+Ġhodg kin
+Ġnarr atives
+l oxacin
+s cre
+Ġc ation
+or h
+Ġm vi
+Ġn il
+Ġn gf
+Ġst arch
+Ġg pa
+id ym
+Ġr uss
+ag ger
+Ġse oul
+act ivation
+Ġam y
+Ġant eg
+ace ous
+Ġi ib
+Ġextract ing
+Ġdiffic ile
+Ġpros th
+Ġtn t
+Ġmetabol ically
+Ġhouse keeping
+Ġnh is
+Ġcement o
+Ġchol ine
+Ġfilt rate
+Ġile al
+Ġtransm embrane
+Ġecc entric
+Ġhaemat ological
+Ġtof acitinib
+Ġmicros urgical
+Ġfamiliar ity
+Ġneurot oxicity
+Ġcompassion ate
+Ġterrit ories
+Ġlymphaden ectomy
+Ġoverwhel ming
+Ġuln ar
+Ġrectang ular
+Ġdestro y
+Ġinelig ible
+Ġindeterm inate
+Ġplatin um
+Ġvulgar is
+h al
+j s
+k l
+r at
+Ġt ilt
+Ġo gd
+Ġc itation
+Ġre int
+Ġto ile
+Ġg ig
+Ġas i
+ant ic
+op rim
+Ġch ads
+qu in
+uc k
+Ġy g
+Ġsp rague
+Ġsug ars
+Ġcalc ifications
+Ġhyper d
+Ġet oac
+Ġstand s
+Ġprot otype
+Ġimmun ization
+Ġtemper ament
+Ġsa o
+Ġtend encies
+Ġselect in
+Ġcyst atin
+Ġunc omfort
+Ġrestric ting
+Ġcement ation
+Ġreconstruction s
+Ġpy ruv
+Ġdoub led
+Ġstake holder
+Ġpdl scs
+Ġql b
+Ġont ology
+Ġpseudo aneurys
+Ġcontracept ives
+Ġallodyn ia
+Ġkolmog orov
+l iness
+it ters
+Ġm ts
+em c
+Ġhe k
+Ġev d
+Ġy in
+Ġcor p
+Ġtime points
+Ġtra c
+Ġes p
+Ġhyp ok
+ec d
+Ġcult uring
+Ġpa x
+Ġble ed
+Ġsynd ecan
+Ġinject ing
+Ġmac rol
+Ġpd r
+Ġlinear ity
+Ġhc p
+Ġenc aps
+Ġmd t
+Ġ19 80
+Ġami odarone
+Ġgradu ates
+Ġlongitudinal ly
+Ġom eprazole
+Ġround ed
+Ġord ers
+Ġpig ment
+Ġprecip itation
+Ġsel dom
+Ġtv r
+Ġprecurs ors
+ometh ane
+Ġprostagland ins
+Ġmicrogl ia
+Ġbuty rate
+Ġtrol ox
+Ġsupernumer ary
+Ġuncomfort able
+f an
+g ly
+Ġw rap
+Ġan b
+it rin
+Ġb erg
+Ġl ining
+Ġv ign
+op ur
+Ġper iv
+Ġcont ing
+Ġhe ard
+ens itive
+Ġqu iet
+Ġtim eline
+Ġser ially
+ob e
+Ġet co
+Ġgre w
+Ġpoly s
+Ġsingle ton
+Ġdm n
+Ġcam er
+Ġinterview ers
+Ġpp ci
+Ġbrain s
+Ġcath epsin
+Ġassum es
+Ġtb ars
+Ġcement um
+Ġnar c
+Ġpf o
+Ġbronch i
+Ġlm ics
+Ġcarbon yl
+Ġpure ly
+Ġintens ified
+Ġsyndrom ic
+Ġmanager ial
+oxygen ation
+Ġinher itance
+Ġkary otype
+Ġfluoroquinol ones
+Ġnitroglycer in
+Ġsmir nov
+Ġbrainst em
+Ġf z
+Ġm cr
+Ġh q
+Ġto kyo
+im ax
+Ġwh ate
+oc r
+ort c
+vi ii
+ug rel
+Ġgl argine
+duct or
+Ġhyper activity
+Ġvis fatin
+Ġcommon est
+Ġneg ot
+Ġfib res
+Ġequ ity
+orph y
+Ġanxi olytic
+Ġcoll ine
+Ġdysfunction al
+Ġod or
+Ġsa q
+Ġcav itated
+Ġnas ogastric
+Ġaff erent
 Ġden g
-Ġden oting
-Ġden aturing
-Ġden oising
-Ġdisp utes
-Ġcs hc
-Ġcusp al
-Ġgraph ite
-Ġgraph ics
-Ġperf used
-Ġligament ous
-Ġide as
-Ġgre ene
-Ġgre enspan
-Ġord u
-Ġord inance
-Ġagg rec
-Ġagg recan
-Ġspe eding
-Ġspe aker
-Ġtap ed
-Ġox ides
-Ġdil igence
-etric s
-Ġyour self
-Ġkap a
-Ġdiscom for
-15 0
-Ġincrement ally
-Ġcrystal lin
-Ġjoint ly
-Ġincomplete ly
-rup ted
-Ġah med
-Ġgc oc
-Ġras h
-Ġbeam s
-Ġdigit ations
-Ġhg pp
-lect ual
-Ġcarbon aceous
-dom ain
-abil ization
-Ġattr action
-Ġintrac erebral
-Ġmacro regions
-Ġprophyl axes
-Ġsy llables
-Ġmeet ings
-Ġirrig ator
-Ġdb p
-Ġdb ar
-Ġvide otap
-Ġalle lic
-Ġforeign ers
-Ġaid ing
-Ġinjec ting
-Ġinjec table
-Ġmad agasc
-Ġharm ed
-Ġharm less
-Ġvs mpre
-Ġkn g
-Ġkn hanes
-Ġkn orst
-Ġtransverse ly
-Ġencour ages
-pr inting
-Ġpack s
-Ġinh aling
-Ġfresh men
-Ġdg zm
-Ġcomprom ises
-Ġlithuan ians
-Ġkeratin izing
-Ġkeratin isation
-Ġom is
-Ġvascular ity
-Ġrare r
-Ġrare faction
-Ġtransform ative
-Ġestablish es
-Ġsulf on
-Ġsulf oxide
-hard t
-Ġconc ordant
-ips es
-Ġabsolute ly
-Ġdichotom ize
-Ġdichotom isation
-Ġimmunohist ochemically
-Ġpu zz
-Ġpu tida
-Ġmel ted
-unct ure
-Ġappe tite
-Ġsmooth ly
-Ġxyl ol
-Ġxyl ene
-Ġxyl azine
-fill ings
-Ġccc d
-Ġcustom ize
-Ġcustom ised
-Ġben zo
-Ġvestib ule
-Ġcolour s
-Ġconv ince
-Ġperiodont opathic
-Ġpron ouncing
-Ġscreen er
-Ġauthor ization
-Ġauthor ised
-Ġcommercial ized
-cy cl
-Ġwar p
-Ġwar ning
-Ġwar rants
-Ġwar burg
-Ġwar saw
-Ġkee ps
-Ġdetermin ability
-Ġdmf r
-Ġelect roma
-Ġec d
-Ġec ori
-Ġdiagram s
-Ġfram ed
-Ġwave form
-Ġphotograph ers
+Ġlipoprotein s
+Ġhapp ens
+Ġconvers ations
+Ġune vent
+Ġcephalospor ins
+Ġclam ping
+Ġpartur ients
+Ġschw ann
+Ġpras ugrel
+Ġdebrief ing
+Ġrhabd omy
+Ġwhate ver
+b f
+k o
+it i
+it ates
+Ġb acilli
+Ġe ortc
+ur f
+Ġas best
+Ġr arity
+am ple
+Ġor r
+Ġsc ra
+Ġfull ness
+Ġtr pv
+ogen es
+Ġred ox
+Ġ0 2
+Ġcyt ometric
+Ġnec ro
+ulin ic
+Ġmm e
+Ġda i
+Ġorig ins
+Ġglob in
+Ġprod uc
+Ġpurp os
+Ġmaintain s
+Ġampl ify
+gt c
+Ġperf orated
+Ġboard s
+Ġbott les
+Ġcatal yz
+Ġcytos ol
+Ġpep sin
+Ġintrac ardiac
+Ġinstruct or
+Ġmeningi oma
+Ġendotox in
+Ġdentif rice
+Ġunres ectable
+Ġcec um
+Ġire land
+Ġparasym pathetic
+Ġc ardia
+Ġm re
+Ġb ull
+Ġe ea
+Ġn othing
+Ġst l
+ra x
+Ġex ud
+Ġch r
+Ġad am
+ac up
+Ġne bul
+Ġsub class
+Ġqu id
+ater nal
+Ġem ulsion
+Ġps p
+Ġintra g
+Ġmy ocytes
+Ġsens ations
+Ġfem or
+Ġadd is
+Ġhuman istic
+Ġcontrast s
+Ġepid idym
+Ġheight ened
+Ġprec ed
+igen in
+Ġcomput ational
+Ġvag ina
+Ġtempor arily
+Ġcarri age
+Ġperic arditis
+Ġdh c
+Ġolig o
+Ġstead ily
+Ġcrystall oid
+Ġobt ur
+Ġimmig rant
+Ġneighb oring
+Ġdrawback s
+Ġoes ophag
+Ġcatch ment
+Ġintussus ception
+Ġhypok al
+Ġt ad
+in ib
+Ġin organic
+ic ulous
+Ġd ara
+us in
+Ġn ord
+ol ved
+Ġdi le
+Ġmet ers
+Ġmet iculous
+Ġpl ating
+Ġar d
+Ġj i
+Ġsp onge
+ox ia
+Ġ0 3
+Ġmat ters
+Ġinterview ing
+dom inal
+Ġsepar ating
+Ġrepl acing
+Ġevent ual
+Ġalb ino
+Ġopen ness
+Ġdl qi
+Ġjust ice
+Ġleuk emic
+Ġpac s
+Ġfore ns
+Ġpay ing
+Ġsubm andibular
+Ġspread s
+Ġdiag onal
+Ġcaps ular
+Ġcit ric
+Ġlib r
+Ġaggreg ates
+Ġabsent eeism
+Ġprompt ly
+Ġcardiop rotective
+anal yz
+Ġmenstr uation
+Ġanonym ized
+Ġvict im
+Ġcurric ula
+Ġsib o
+Ġlic ensed
+Ġarom atic
+Ġradioluc ent
+Ġwhe el
+Ġisoform s
+Ġantise ptic
+ectom ized
+Ġtrimeth oprim
+opur inol
+h r
+Ġa ix
+Ġo int
+er ate
+Ġin ception
+Ġd oll
+Ġd obut
+Ġm fs
+ent ine
+id ol
+ol ateral
+Ġcomp act
+Ġne ovascular
+Ġpos terolateral
+Ġro che
+Ġpr x
+Ġman ic
+Ġend urance
+Ġgl oves
+ons cious
+ite al
+Ġinform ing
+Ġins ure
+Ġdo acs
+Ġthrough put
+Ġintra observer
+Ġimpl icit
+omet ers
+Ġfat ality
+Ġmand ib
+Ġanterior ly
+Ġimpair s
+Ġdiv or
+Ġvac a
+Ġsecre te
+Ġoccup ancy
+Ġeg c
+Ġenter obacter
+Ġdissol ution
+Ġmex ico
+Ġdetach ed
+Ġaccommod ate
+Ġbaical in
+Ġreluct ant
+Ġaccred itation
+Ġfut ile
+Ġtru eness
+Ġarous al
+Ġsubthem es
+Ġtimefram e
+Ġshiv ering
+o es
+r ust
+s u
+Ġp av
+ed uc
+Ġw st
+Ġd li
+Ġd ots
+Ġl inal
+Ġex ported
+Ġcom mented
+Ġch at
+Ġcomp ressions
+Ġcomp iled
+Ġwe ather
+Ġme p
+Ġsc ot
+Ġall opurinol
+Ġser ous
+Ġunder take
+Ġbut t
+Ġwor n
+Ġsp acer
+Ġimp ella
+Ġmy d
+of emoral
+Ġsusp ect
+Ġtox ins
+Ġens ures
+Ġstratif ying
+Ġqual ifications
+Ġbal f
+Ġpv s
+Ġamb iguous
+Ġmach ines
+Ġmineral s
+Ġpig mentation
+Ġrf ca
+Ġuniform ly
+Ġdepr ived
+Ġappreci ation
+Ġhall uc
+raum a
+Ġgins en
+Ġinstruct ors
+Ġgather ing
+Ġmeningi omas
+Ġobl iter
+Ġlei omy
+trans ferase
+Ġanteg rade
+Ġdobut amine
+c arin
+j a
+k t
+Ġn cr
+os se
+ter dam
+Ġpre hypert
+Ġsh adow
+ell es
+Ġcl si
+end oscopy
+Ġap i
+Ġab aba
+Ġall ied
+oth o
+Ġcor ds
+Ġcomm and
+Ġdef ective
+Ġcal if
+ob enz
+Ġrep olarization
+Ġloc ate
+Ġpa res
+Ġequ ality
+Ġmac rovascular
+Ġshe ep
+Ġthyroid ectomy
+Ġtransfer ability
+Ġlact ation
+Ġwid ow
+Ġsurviv in
+Ġchlor ogenic
+Ġseal ers
+Ġln m
+Ġren dered
+13 3
+Ġug ib
+Ġwavelength s
+Ġosteoclast ogenesis
+Ġkh at
+Ġsweet ened
+Ġaliqu ot
+Ġbenzodiazep ine
+Ġinher ited
+Ġcrack s
+oneph ritis
+Ġalumin um
+Ġdul oxetine
+Ġdysmen orrhea
+j in
+u ze
+on ates
+en afil
+it azone
+Ġb acillus
+el v
+ort al
+Ġtre es
+uc osal
+Ġab pm
+Ġfact s
+Ġdet ox
+Ġdisc our
+Ġfactor ial
+Ġstro be
+Ġphosph olip
+Ġalcohol ism
+Ġlv dd
+Ġmt b
+Ġjust ification
+Ġsd b
+Ġminim ise
+ta wa
+Ġintr ig
+Ġpf ge
+Ġ14 6
+Ġnorth west
+Ġdisadvant aged
+Ġhh v
+Ġvap or
+Ġtol l
+Ġperine al
+Ġzh ang
+ket amine
+Ġreposition ing
+Ġdod ecyl
+Ġconceiv able
+pred n
+Ġcalif orn
+i od
+u ft
+Ġa ic
+en atide
+Ġp gi
+Ġw m
+it uric
+Ġf its
+Ġm x
+em ide
+Ġper ist
+ell uft
+Ġsc n
+Ġap ps
+aus s
+Ġro ds
+Ġunder line
+Ġhospital ised
+Ġdist ally
+ident ified
+Ġgra ins
+Ġreceiv es
+Ġadj ud
+Ġcomb at
+Ġeduc ate
+Ġadd ict
+Ġconcentr ates
+Ġta a
+Ġgr inding
+Ġincis ions
+Ġqualitative ly
+Ġden om
+Ġpack ages
+Ġom n
+Ġlabel s
+Ġot tawa
+Ġethnic ities
+Ġquad ric
+Ġls m
+Ġtrust worth
+Ġsubs id
+Ġanc ova
+Ġexec uted
+Ġpsychiat rist
+Ġfis etin
+Ġdichlor omethane
+Ġreciproc ating
+Ġdispens ing
+Ġclaud in
+Ġantin ociceptive
+Ġlank a
+Ġpend elluft
+ocarcin omas
+Ġamm onia
+Ġforens ic
+o jejunostomy
+Ġd if
+Ġd um
+ro cal
+Ġh ns
+ab dominal
+em ics
+Ġis q
+Ġsh s
+Ġcl ipping
+Ġab o
+Ġtr iton
+Ġpr ison
+ox an
+Ġref rig
+Ġic f
+oph ytes
+Ġpoly t
+Ġmr p
+Ġprofess or
+Ġmit ogen
+Ġsitu ated
+Ġdecl ines
+Ġtc p
+Ġassign ing
+Ġtb st
+Ġsten otic
+Ġrun s
+Ġbronch oscopy
+Ġpref erentially
+Ġdisl ocations
+bor ne
 Ġmaster y
-Ġanaer obe
-Ġcath olic
-Ġhif i
-Ġclar ification
-Ġupreg ulating
-Ġadjunc ts
-Ġsouth eas
-Ġapplic ator
-Ġpolymorph ic
-Ġaustral ians
-Ġtetr a
-Ġtetr ahedral
-Ġtetr asodium
-Ġather oma
-Ġhar ness
-Ġhol m
-Ġhol t
-Ġhol st
-Ġperm uted
-Ġperm selec
-Ġuns up
-Ġuns killed
-Ġuns urpr
-Ġgranul ocytes
-12 0
-ah im
-Ġcit rate
-Ġcit robacter
-oscl erosis
-Ġground water
-Ġgovern ate
-Ġgovern ments
-Ġgovern orates
-rane an
-Ġslow ing
-Ġow ens
-Ġcoch ran
-Ġdap i
-Ġmom bell
-Ġlist ening
-Ġlist wise
-ards hip
-Ġtax es
-Ġhydroxy ethyl
-Ġhydroxy vitamin
-Ġouts tand
-Ġpseud onym
-70 3
-70 9
-Ġrejec ting
-Ġstop per
-Ġstop watch
-Ġtri age
-Ġquar tiles
-Ġcoron ectomy
-Ġsector al
-Ġ13 4
-Ġsafe gu
-Ġprincipal s
-Ġeryth rocyte
-Ġeryth ropo
-Ġter nary
-Ġscar s
-Ġfourth ly
-Ġoccup y
-med ia
-med etomidine
-Ġcere sa
-Ġft as
-Ġnig rescens
-Ġstudent es
-Ġscr atched
-Ġcontrovers ially
-Ġnoti fied
-Ġkore ans
-Ġmoun t
-Ġvolunte ered
-Ġport o
-Ġfas ted
-Ġdim ers
-Ġdim med
-Ġdim ples
-Ġadip ogenic
-Ġadip ok
-Ġleg acy
-Ġleg itim
-Ġmethan ogenesis
-gd u
-Ġnm m
-Ġnm t
-Ġnm ct
-Ġnons mo
-Ġnons teroidal
-23 3
-hr agm
-Ġpull ing
-Ġmature d
-Ġns a
-Ġns aid
-Ġcool ant
-Ġkh omein
-Ġoverc omes
-Ġdecont aminated
-Ġsimpl istic
-Ġsimpl ification
-Ġequival ently
-Ġrepair s
-Ġpush ed
-Ġfund ed
-Ġbad ersten
-Ġjusti ce
-Ġjusti fies
-Ġjusti fiable
-Ġcorrec tional
-Ġmesi olingual
-Ġoxygen ator
-imm un
-cell i
-Ġmethodological ly
-Ġmoist ened
-Ġverify ing
-Ġswit ching
-Ġswit ched
-Ġempow ered
-ocompati bility
-Ġpit x
-Ġmit osoid
-Ġbul im
-Ġbul lying
-Ġstere otypes
-Ġcompet e
-Ġ15 2
-Ġradiological ly
-Ġpersist ently
-Ġautom ation
-Ġautom ating
-Ġtele ph
-Ġpenetr ations
-era j
-Ġng s
-Ġnp ddp
-Ġdisrup tive
-Ġdisrup tions
-Ġplat ysma
-Ġencod ers
-Ġmf cs
-Ġmotor ic
-Ġbic onca
-Ġanalog s
-Ġanalog y
-Ġroc king
-Ġunf old
-Ġunf amiliar
-Ġmann itol
-Ġmelan in
-Ġmelan oac
-Ġcurriculum s
-Ġprogramm ed
-Ġure thane
-Ġband ing
-Ġband wid
-Ġhu jo
-Ġdiscol oured
-Ġsched ules
-Ġdigitiz ations
-Ġattemp ting
-Ġpel vis
-Ġexerc ising
-Ġafric ans
-Ġinten tions
-Ġarg in
-Ġarg ues
-Ġmultid irectional
-Ġhemis ected
-Ġthermocycl er
-Ġdetrim ent
-Ġpig ments
-Ġgp fs
-Ġclock ed
-Ġneuro sc
-Ġneuro trans
-Ġ24 0
-Ġ24 6
-Ġendoc rin
-Ġpredis posed
-Ġpredis poses
-Ġantifungal s
-Ġrefr action
-Ġrefr ained
-Ġdefinitive ly
-Ġneutral ize
-Ġpy torch
-Ġball istic
-Ġchew ers
-Ġshar q
-Ġshar ma
-Ġsurpr ise
-Ġflav in
-Ġflav us
-Ġfavour s
-Ġosseointegr ated
-Ġmirr oring
-Ġdark ened
-Ġnd a
-Ġrhe in
-umin ate
-Ġextrac orpore
-Ġfrag mentation
-Ġfifth s
-04 6
-Ġcu ff
-Ġine fficient
-Ġunre asonable
-Ġarm y
-Ġdecom posed
-oxy genase
-Ġhypo zin
-Ġhypo trich
-Ġmesh work
-Ġsustain able
-Ġsustain ability
-Ġsustain ably
-Ġadministr ator
-Ġadministr ators
-Ġbonfer onni
-otid yl
-Ġbod ied
-Ġkid neys
-Ġwealth ier
-Ġnorthern most
-Ġcrystall oid
-Ġdistinguish able
-Ġanticip ation
-Ġhundred th
-38 8
-fr ames
-Ġmess eng
-Ġbss ro
-Ġhm b
-Ġcontamin ating
-Ġcontour ing
-Ġ25 4
-Ġfront omaxillary
-Ġfront onasal
-Ġappra ised
-Ġincorrect ly
-Ġant ineoplastic
-Ġfus es
-Ġded uctive
-Ġded upl
-Ġnac l
-osin ate
-Ġaspir ated
-Ġaspir ate
-Ġperme ant
-Ġperme abilization
-Ġiso amyl
-Ġneut ropenic
-Ġmandib ula
-Ġblast ing
-Ġelectric ity
-Ġhemat ological
-Ġproblematic ally
-Ġtemporal is
-Ġoxid ation
-Ġoxid ase
-Ġsyring es
-Ġchronological ly
-20 358
-Ġts b
-Ġacet one
-Ġacet yl
-Ġparaf unctions
-Ġka unas
-Ġmasseter ic
-Ġmicrom eter
-Ġmicrom etres
-Ġglyc ine
-Ġglyc idyl
-Ġcorrobor ating
-Ġpancre as
-Ġpancre atitis
-Ġbil ayer
-Ġbil aminar
-Ġho oked
-Ġho ffman
-leuk oplakia
-Ġrub bed
-Ġdele tions
-Ġtrap door
-Ġobl igation
-Ġarrow head
-Ġvisc ous
-Ġretro gnathic
-Ġthermo elastic
-Ġaggress iveness
-ran i
-wa ve
-Ġrep elling
-Ġbios ystems
-Ġdiast ase
-Ġ01 4
-Ġsmart phone
-Ġsmart phones
-Ġsynthes ize
-Ġsynthes ised
-Ġadvoc ates
-Ġ199 6
-ophil ic
-Ġarray c
-Ġarray l
-Ġcasp ases
-Ġimposs ibility
-Ġamalgam ation
-Ġamalgam ate
-han i
-Ġhapp y
-Ġhapp ening
-Ġroll er
-Ġsubd iagnos
-Ġinterleuk ins
-Ġsou za
-Ġretrom ta
-Ġenter ococcus
-Ġenter opathic
-Ġenter tainment
-Ġelectro static
-Ġelectro encephal
-Ġelectro lytes
-Ġpic os
-Ġpic king
-Ġfro st
-Ġreag ents
-yst one
-Ġpresum e
-Ġsubcl ass
-Ġintell igent
-Ġmaxim ally
-Ġmaxim ise
-Ġmaxim ilian
-Ġbacteri ocin
-Ġreplic ating
-Ġoverestim ate
-Ġcereb rospinal
-Ġfinger printing
-Ġrheum atic
-ij i
-ij m
-Ġtgn ss
-Ġtang ible
-Ġtang ential
-Ġdest ination
-Ġonc ological
-Ġonc ogenesis
-Ġbeh alf
-Ġcompens ated
-Ġmaf b
-Ġcancell ation
-Ġcancell ations
-Ġsubtr act
-Ġsubtr active
-Ġamb ient
-Ġamb ivalent
-Ġagar wal
-Ġdiver sion
-Ġdiver ging
-Ġdepr iving
-Ġswab bed
-Ġcutoff s
-Ġporphy rins
-ethyl d
-Ġmillimet res
-Ġsharp en
-Ġrehabilit ated
-Ġtag ged
-Ġfu zz
-Ġfu jian
-Ġfer rule
-Ġmpa h
-anth oma
-Ġche ap
-Ġmeg a
-Ġmeg akary
-Ġadh d
-Ġhair line
-Ġrox olid
-Ġtrac ers
+Ġcontraind icated
+Ġprotr uding
+Ġosteoblast ic
+Ġhyal uronic
+Ġdiscord ant
+Ġspi rom
+ynchron y
+Ġbib li
+Ġunreli able
+Ġintrig uing
+Ġtrustworth iness
+u ine
+in ement
+re on
+al d
+Ġm ys
+Ġn se
+Ġg ases
+id ene
+th ms
+Ġal iz
+am i
+Ġab p
+Ġcr cs
+Ġsup ers
+Ġj oin
+Ġes ketamine
+Ġps ma
+Ġhem olytic
+Ġcle ared
+Ġmus h
+Ġinser ting
+Ġtransfer ring
+Ġmar fan
+Ġfluor osis
+Ġassign ments
+Ġpv cs
+Ġsurviv or
+Ġcat ar
+Ġsr c
+Ġequival ence
+Ġpn i
+Ġinfarct ed
+acryl ate
+Ġagric ultural
+Ġpropag ation
+Ġmss a
+Ġhyperinsulin emia
+Ġrecre ational
+Ġamend ments
+Ġreint ubation
+9 6
+k v
+m eth
+ol ization
+Ġha art
+Ġout s
+Ġant imal
+Ġover se
+ures is
+ron ectin
+Ġel lip
+Ġgra fted
+Ġfib ril
+Ġpoly cystic
+Ġstim ulatory
+Ġsw oll
+Ġpharmac odynamic
+Ġcheck s
+Ġmis oprost
+Ġtit rated
+Ġ200 1
+Ġmethyl predn
+Ġosteop enia
+Ġss ris
+Ġglyc yr
+Ġrol l
+Ġstabil izing
+Ġshunt ing
+Ġeros ions
+Ġtax a
+Ġdepict ing
+Ġlymphaden opathy
+Ġcub ic
+Ġendocrin ology
+Ġcircr na
+Ġillum ination
+icy lic
+Ġchit osan
+Ġdeng ue
+Ġswoll en
+w ed
+Ġt ss
+on v
+Ġc il
+Ġp ud
+Ġp aternal
+Ġf di
+ion ic
+as y
+os it
+Ġg it
+el ed
+st im
+Ġpl asticity
+Ġcr ush
+Ġhyp odontia
+Ġinvol unt
+Ġhum erus
+Ġaut oreg
+Ġfree zing
+Ġreli ance
+Ġnor the
+Ġmetabol ized
+Ġmar pe
+Ġmes ang
+Ġmes io
+ogl itazone
+Ġpi oglitazone
+Ġweak ened
+Ġdigital ly
+Ġneur axial
+Ġframework s
+Ġshunt s
+Ġfist ulas
+Ġcac s
+inflamm ation
+Ġimmunore active
+Ġbaical ein
+Ġtrab ec
+Ġeph ed
+Ġcyclo oxygenase
+Ġhint on
+Ġmush room
+Ġmisoprost ol
+f lex
+i ometry
+Ġs pt
+Ġg tt
+ag o
+Ġcl imb
+pt an
+Ġtest es
+Ġag nps
+Ġpresent ly
+Ġman oe
+Ġbut ton
+Ġli ra
+Ġfl ag
+Ġintervent ricular
+Ġmy oglobin
+Ġz ym
+Ġmac ces
+Ġpeak ed
+Ġdiv ergent
+Ġga uze
+Ġwar rants
+Ġprefer ably
+Ġvert ically
+Ġmethyl ated
+Ġincorpor ates
+Ġsemi quant
+Ġsud an
+Ġdn c
+Ġine vit
+Ġfilter ing
+Ġmunicip al
+burg h
+Ġencephal itis
+Ġthi obarb
+Ġsplen omegaly
+Ġcoexist ence
+Ġdropout s
+Ġanaphyl axis
+Ġworm s
+Ġstell ate
+Ġaliz arin
+Ġinevit ably
+? "
+f ish
+h p
+Ġp ell
+or in
+ent ional
+Ġg ard
+Ġr ut
+Ġal ve
+ag inal
+ag ulated
+oc o
+Ġass ure
+Ġco ur
+Ġpos ter
+Ġj et
+Ġcar nitine
+Ġi ot
+yl ate
+Ġprob ed
+Ġhyp ophys
+Ġcd ai
+Ġ5 00
+Ġbre ad
+Ġcre v
+he et
+Ġov aries
+Ġattempt ing
+Ġdp n
+Ġmill il
+Ġmil der
+ethyl ation
+Ġrhy thms
+Ġigf bp
+Ġolig onucle
+Ġcoron a
+Ġreass ess
+Ġpriorit ize
+Ġocclud in
+Ġapt t
+Ġpremed ication
+Ġarte fact
+Ġasbest os
+carin ic
+Ġcaliforn ia
+Ġmethylpredn isolone
+b ing
+Ġa it
+Ġs ii
+Ġd us
+Ġh ers
+Ġn ab
+ly m
+od ed
+Ġind isp
+ost at
+Ġte g
+Ġnon union
+Ġsp r
+Ġtra ced
+Ġgl u
+Ġgl ab
+Ġcalc ane
+Ġel u
+Ġhum eral
+Ġhom eless
+Ġcorrect ive
+Ġdex a
+Ġcentr ally
+Ġasc itic
+Ġocclus ions
+Ġdiscont in
+Ġsem ester
+Ġfear s
+Ġvide olaryng
+Ġmineral ized
+Ġile us
+Ġshr na
+Ġsimpl icity
+Ġmast ication
+Ġtight ly
+Ġconv uls
+Ġchron ically
+Ġophthal mic
+Ġkl otho
+Ġcircr nas
+Ġdensit ometry
+Ġasthm atic
+Ġcyclospor ine
+Ġhns cc
+c ab
+Ġt di
+Ġa as
+on ium
+Ġh osp
+Ġh amp
+Ġn ha
+Ġl ves
+Ġg od
+Ġv ine
+ch s
+Ġper itoneum
+pl ants
+Ġassess or
+Ġ1 50
+Ġins ult
+Ġhem i
+Ġer c
+Ġent hus
+Ġsn acks
+oh ep
+plant ation
+Ġcheck point
+Ġchi rop
+Ġsed atives
+Ġsil icate
+Ġfil ament
+Ġstrict a
+Ġoutput s
+ofl av
+Ġbreak fast
+Ġmyel operoxidase
+Ġthrombo lytic
+Ġtoothp astes
+Ġretain ing
+Ġrequest s
+Ġattract ed
+Ġegypt ian
+Ġasymmet ric
+acup uncture
+Ġcatar act
+Ġthiobarb ituric
+Ġdiscontin ue
+, "
+en na
+Ġan h
+es e
+ur ate
+Ġg le
+ra ft
+Ġpro active
+ac etic
+Ġap ix
+Ġqu inol
+Ġmod ulates
+Ġtim ed
+Ġpos ed
+ub er
+ital opram
+Ġfin ish
+Ġover pro
+cept or
+Ġfl ip
+Ġred und
+Ġet ch
+Ġfe es
+Ġop n
+Ġfib ronectin
+Ġpros per
+Ġcoll apsed
+Ġventric ul
+Ġneuro cogn
+Ġbo iling
+Ġbiom ater
+Ġcarb oxy
+Ġamb ulation
+Ġaer ial
+Ġrecip rocal
+Ġdele ted
+Ġanch oring
+ares is
+Ġphyl ogenetic
+Ġdial ogue
+Ġpark inson
+Ġcautious ly
+Ġhern iation
+oven ous
+Ġnick el
+Ġsre bp
+Ġapix aban
+a ut
+b ivudine
+f en
+v c
+Ġs ial
+Ġc ot
+Ġre bound
+us ers
+Ġn ras
+Ġg rs
+ra ined
+am ing
+Ġspec k
+Ġcal oric
+Ġir isin
+Ġmr c
+Ġcontrast ing
+Ġhc w
+Ġmagn ifying
+Ġdeep est
+Ġden ote
+Ġgradu ated
+Ġreconstr uct
+Ġfer mentation
+Ġjud ge
+Ġhypot ensive
+Ġtel bivudine
+Ġgastroenter ologists
+Ġpatch y
+Ġbid irectional
+Ġhyal uron
+Ġmicron utri
+Ġtrem or
+amph enic
+Ġtempl ates
+Ġfrust ration
+Ġpsychopath ology
+idel ity
+Ġextens or
+Ġlifes pan
+Ġnoradrenal ine
+Ġmys elf
+d ays
+on ing
+Ġf es
+Ġl ta
+ol ithiasis
+Ġcon du
+ab olism
+Ġbe verage
+od ys
+Ġex enatide
+op ec
+Ġde ion
+Ġat s
+ens ory
+Ġph arynx
+Ġexp osing
+Ġag t
+Ġval pro
+Ġsm ell
+Ġmult is
+ord ered
+Ġins ults
+Ġanti hy
+Ġz he
+Ġmark ov
+Ġct rp
+Ġcommun icated
+Ġread ers
+Ġiv s
+Ġdiss imilar
+cal c
+Ġbo iled
+Ġhemod ynamically
+yg d
+Ġane uploid
+Ġdecomp osition
+Ġpod ocyte
+Ġfa ith
+otom ies
+Ġpalp able
+Ġovert reatment
+Ġparamed ic
+Ġcard s
+Ġimmob ilization
+Ġorific es
+Ġepig l
+Ġmycop l
+emc omit
+Ġindisp ens
+Ġchirop ract
+Ġzhe jiang
+b acter
+h c
+Ġo cs
+Ġc w
+Ġf idelity
+ic l
+Ġm all
+id us
+il icate
+Ġex agger
+ant ine
+Ġr u
+Ġrel ational
+Ġam ygd
+ism us
+Ġmo f
+Ġsex ually
+Ġrecommend ing
+Ġunivers ally
+Ġpat ella
+Ġcolon ized
+Ġhs cs
+Ġbra ce
+Ġaden ocarcinomas
+Ġchlor amphenic
+Ġsouth east
+Ġcounter st
+Ġsph ere
+Ġsuture d
+Ġvegf a
+Ġara chid
+Ġtrip lic
+Ġground ed
+Ġgt r
+Ġlev ofl
+Ġkeratin ocyte
+Ġureth ra
+Ġxyl ene
+Ġbms cs
+Ġreluct ance
+Ġcres tal
+Ġreclass ification
+Ġbisphosph onates
+Ġcatast rophic
+Ġactinomycet emcomit
+f oot
+Ġc ma
+Ġe ec
+ul oplas
+Ġn ul
+os yn
+ol ution
+Ġas m
+Ġal opec
+Ġap d
+Ġcr ic
+cept ors
+Ġmon oc
+Ġhyper and
+Ġhem e
+Ġcult ivation
+Ġil k
+Ġsol ved
+Ġincl usive
+bo ard
+Ġcam k
+Ġcp ap
+Ġmc v
+inf ection
+Ġpt p
+Ġmis es
+Ġbes ide
+Ġsuic id
+Ġattenu ating
+Ġonc ologists
+Ġmv d
+ocal cin
+Ġstrept oz
+Ġkeratin ized
+anz apine
+Ġneutrop enic
+Ġsuc ce
+Ġglutam yl
+Ġrigid ity
+Ġarrang ements
+Ġlogarith m
+Ġglute al
+Ġneurosurge ons
+Ġbyst ander
+Ġdischarg es
+Ġmanoe uv
+Ġindispens able
+b les
+i ologic
+l l
+Ġ urs
+Ġs keleton
+im at
+th ree
+Ġv ip
+ot r
+ot ub
+Ġr um
+oc ardial
+Ġpo orest
+Ġol anzapine
+Ġestim ations
+Ġresid ency
+row s
+Ġdiv ide
+Ġtc am
+Ġconfound ed
+Ġmig rants
+Ġnm d
+Ġtri ad
+Ġmultic ol
+Ġlm wh
+Ġcontract ing
+Ġnation ality
+Ġvasopress in
+Ġorthodont ist
+Ġstere otactic
+Ġcrystall oids
+Ġproce eded
+Ġsplen ocytes
+Ġmesi obuccal
+Ġalex a
+Ġgangl ion
+Ġsant a
+Ġacin et
+Ġpolyvinyl idene
+Ġanaesthesi ologists
+Ġsymph ysis
+Ġpyruv ate
+Ġlevofl oxacin
+9 2
+i ently
+s aturated
+Ġp orphy
+Ġb iph
+Ġh w
+Ġh pe
+Ġinc urred
+Ġch rist
+Ġim aged
+Ġant it
+Ġsystem ically
+Ġ0 7
+Ġel f
+Ġcyt arabine
+Ġfac es
+Ġec oh
+Ġopt ed
+Ġoste ocalcin
+Ġstill birth
+roscop ically
+Ġpp m
+Ġemb arr
+gt g
+Ġgp i
+Ġah r
+Ġdia z
+Ġcoup les
+Ġembed ding
+Ġsoc s
 Ġinterrup t
-Ġovers hadow
-Ġ26 2
-Ġ26 4
-Ġcentur ies
-Ġdissol ve
-Ġplasm inogen
-Ġhydrophilic ity
-mod erate
-Ġsial opapers
-Ġcatal og
-Ġcatal ysed
-Ġpun ch
-Ġpum ice
-Ġhap tic
-Ġgh pss
-opo ulou
-Ġunm atched
-Ġuncom promised
-Ġoverd ispers
-Ġhistomorph ometry
-Ġrefuge e
-Ġmicron utr
-Ġinhab ited
-Ġfundament ally
-Ġpunct ate
-Ġfanc oni
-Ġlys ates
-Ġlys osomal
-Ġrational ized
-Ġcoinc ide
-Ġcoinc idental
-Ġsubc ategories
-rolog y
-Ġsmoker lyzer
-Ġ79 0
-Ġpsychometric s
-Ġknock out
-Ġpleasant ness
-Ġoutbreak s
-19 0
-60 3
-60 5
-Ġexfoli ate
-Ġimag ining
-Ġimag inable
-Ġpref ers
-Ġclot ting
-Ġkary orrh
-Ġ17 8
-Ġspir ito
-Ġhomeost atic
-Ġexcav ators
+Ġjejun al
+Ġundet ected
+Ġpix els
+Ġfarm ers
+Ġclock wise
+opy ran
+Ġfiref igh
+Ġsteat ohep
+Ġpseudoaneurys m
+usin ersen
+Ġvine gar
+Ġactinomycetemcomit ans
+Ġacinet obacter
+8 2
+o o
+o ate
+Ġ ist
+Ġa u
+Ġs end
+Ġo ocyte
+Ġd ga
+Ġe igen
+Ġn usinersen
+iv ocal
+Ġno af
+Ġunder re
+vent ion
+ep rist
+Ġbi ob
+Ġpop l
+av icular
+oid osis
+Ġintra epithelial
+Ġmo unting
+Ġhem angi
+Ġexc it
+Ġgast rin
+Ġaut ogenous
+Ġsl iding
+Ġfoc uss
+Ġinject able
+Ġbur k
+Ġmar riage
+Ġtransl uc
+Ġds g
+Ġdeb ated
+Ġirrig ated
+Ġsubt raction
+Ġgf ap
+Ġlr p
+Ġdispers ed
+Ġsulph ate
+Ġmif eprist
+Ġhypochlor ite
+Ġgonadotrop in
+Ġquadric eps
+Ġalopec ia
+Ġsteatohep atitis
+Ġmifeprist one
+g ls
+h em
+v p
+at ectomy
+Ġc gi
+ion ine
+Ġn ms
+Ġn aring
+Ġg auss
+ot ri
+ir y
+Ġus ability
+Ġsh aken
+Ġris peridone
+Ġgl ottis
+Ġpar ac
+Ġi k
+Ġhyper int
+Ġpract ically
+Ġgeneral ize
+osph ate
+Ġphen yle
+Ġdispl ace
+Ġheight s
+Ġinfilt rates
+Ġpv l
+Ġcarb ox
+Ġhard ware
+Ġlas ers
+Ġcentrif uge
+Ġcalib er
+Ġid h
+Ġcond ensed
+Ġarrhythm ic
+Ġcutoff s
+Ġthin ning
+ameth oxazole
+Ġhapp y
 Ġmotiv ate
-Ġmotiv ates
-Ġhemisphere s
-Ġpiez oceramic
-sh otgun
-Ġtight ly
-Ġaa of
-Ġpip ette
-Ġwal k
-Ġdic lof
-Ġdro ol
-Ġdens ennet
-Ġhall marks
-Ġlr p
-Ġexon eration
-Ġshr na
-Ġclen ch
-Ġfores ee
-Ġhaem in
-Ġtrack er
-Ġdiscontin ue
-Ġlabor ious
-Ġrepeti tion
-Ġnasoph arynx
-Ġfavor ably
-Ġhomogenous ly
-Ġherpes viridae
-Ġentr ainment
-Ġmisalign ed
-��directional ity
-Ġattenu ating
-Ġattenu ates
-Ġdisadvantage ous
-Ġdiffuse ly
-Ġplei otropic
-Ġmartens ite
+Ġconform ed
 Ġunexpected ly
-Ġaw akening
-Ġaw liya
-Ġov ary
-Ġov sen
-Ġpth lh
-Ġdress ed
-Ġgent amycin
-Ġperic arp
-Ġdev ising
-Ġfourteen th
-Ġnonc oll
-Ġnonc arious
-Ġnonc ommun
-Ġju ice
-Ġju ices
-Ġmicrostruct ures
-Ġmicrostruct ured
-Ġtransg enders
-Ġappend icitis
-Ġfluctu ating
-Ġattack ed
-Ġ57 8
-Ġsolub ilization
-Ġhumid ification
-Ġpsychi atr
-Ġevolution ary
+Ġment ors
+Ġsplen ectomy
+Ġposts urgical
+Ġlactob acilli
+Ġperox yn
+Ġky oto
+Ġdash ed
+Ġcadaver ic
+Ġhypov olemia
+Ġbotan ical
+Ġdecont amination
+Ġantimal arial
+Ġneurocogn itive
+uloplas min
+Ġecoh is
+b ear
+f ront
+n ier
+o is
+Ġt df
+Ġa rose
+Ġp am
+ed ia
+is ional
+Ġb bs
+Ġh ce
+ot ocin
+em inal
+Ġch ap
+lud es
+ari ans
+oth yro
+Ġcal iper
+Ġimp ing
+Ġi root
+Ġneg atives
+Ġsens ing
+Ġnew cast
+Ġent rance
+Ġobserv able
+reg ard
+Ġvas pin
+Ġpv r
+Ġlig ated
+Ġunc onscious
+iop rine
+Ġdrain s
+Ġchromat ograms
+Ġanth ocyan
+Ġaz ithromycin
+Ġgranul ocyte
+Ġfront line
+ifer ous
+cor onary
+Ġconfig urations
+Ġafford able
+rac urium
+Ġkamp o
+Ġprehypert ension
+Ġmesang ial
+Ġiot n
+Ġchloramphenic ol
+Ġsuicid ality
+Ġnewcast le
+i osis
+w ich
+on ad
+Ġs be
+en h
+Ġp gl
+Ġm pa
+Ġb arium
+as on
+Ġn ri
+Ġl ia
+ch i
+Ġex tern
+pl ess
+Ġinf erence
+vi olet
+ath ioprine
+ap ride
+Ġcor ros
+Ġdes flurane
+ex amic
+Ġpreval ences
+Ġintra p
+oscop es
+Ġprevent ative
+Ġtooth ache
+Ġmiss ions
+Ġglob ulin
+Ġmap ks
+Ġinteract s
+Ġchrom o
 Ġadapt ations
-Ġaffirm ed
-Ġaffirm ing
-Ġsarc oidosis
-Ġsarc osinate
-Ġspray ing
-Ġantagon istic
-Ġmicronucle ated
-Ġreservoir s
-Ġarbitr arily
-Ġtell i
-Ġaud itory
-Ġwel come
-Ġanx a
-Ġanx ieties
-Ġdyn asplint
-Ġbow el
-Ġchond ro
-Ġchond rodysplasia
-Ġinfusion s
-Ġintens ification
-Ġintens ify
-Ġkil ograms
-agg c
-Ġmicroenvironment al
-Ġembr ace
-Ġembr asure
-Ġ55 5
-ocyt openia
-hu a
-Ġcoc ci
-Ġcoc amidoprop
-Ġpist acia
-Ġank le
-Ġbord ered
-Ġbatch es
-Ġreass ign
-Ġelu ate
-odynamic s
-Ġadren o
-Ġprescrib e
-Ġobst etrics
-Ġarc tic
-Ġarc gis
-Ġsput um
-Ġsput tered
-Ġlozen ge
+Ġrepro d
+Ġ200 4
+Ġscaven ge
+Ġbreak ing
+Ġopp osing
+Ġalkal oid
+Ġfiber optic
+Ġmyc obacterium
+Ġgranul ocytes
+Ġlev ator
+atum umab
+Ġniv ol
+Ġgn b
+Ġreser ved
+Ġscop olamine
+Ġencompass es
+Ġconstra ined
+Ġmalays ian
+Ġosm otic
+Ġretic ul
+Ġmenis cus
+oech st
+Ġprolifer ating
+Ġbill ion
+Ġtran examic
+Ġabrup t
+Ġpare coxib
+Ġgig ant
+l ink
+Ġc id
+Ġp vi
+Ġf ae
+as c
+ar um
+Ġh oechst
+Ġn ude
+ig el
+op oside
+Ġby h
+Ġco lectomy
+Ġcl othing
+we igh
+Ġint imate
+Ġall oxan
+Ġpl ank
+Ġqu en
+Ġant ever
+Ġen um
+lect ric
+Ġgl enoid
+Ġet oposide
+Ġprob abil
+ie u
+Ġmal di
+Ġbenef ited
+Ġsal ary
+Ġsch ist
+Ġill iter
+Ġcer uloplasmin
+Ġmac ce
+Ġver a
+resp ons
+Ġtop ography
+Ġhepat oprotective
+line arity
+Ġadapt ing
+Ġoccup ied
+Ġlt pa
+gl utide
+Ġwr ite
+Ġadrenal ectomy
+Ġcomprom ising
+Ġaz athioprine
+ocon version
+Ġultra violet
+Ġpatch es
+Ġconflu ent
+Ġgynaec ological
+Ġ000 1
+Ġcohes ive
+Ġmicrov essel
+Ġglycyr rhiz
+Ġlira glutide
+Ġtriplic ates
+Ġmulticol linearity
+Ġt ns
+Ġd pscs
+Ġd alys
+Ġre arr
+Ġe i
+Ġst ory
+id osis
+Ġv p
+Ġne at
+Ġexp ense
+Ġact ors
+Ġen orm
+Ġpe king
+af e
+Ġhyp osp
+Ġmy opathy
+Ġmus carinic
+Ġknowledge able
+let ions
+Ġprogram ming
+Ġhome opathic
+inf lation
+Ġphot on
+ull a
+Ġhypox emic
+Ġconcomitant ly
+Ġlys ine
+Ġlob ular
+Ġanalog ues
+Ġneutral izing
+Ġpk c
+Ġgynec ologic
+Ġfebr ile
+Ġscal er
+Ġaggrav ation
+Ġcontra ception
+Ġvig il
+Ġorb it
+itr ite
+Ġmicrot iter
+Ġmisdi agnosis
+Ġdetach ment
+Ġillum ina
+peri enced
+Ġintral uminal
+Ġrefuge es
+Ġell agic
+Ġtroub les
+Ġstreptoz otocin
+Ġgauss ian
+Ġperoxyn itrite
+Ġnivol umab
+Ġprobabil istic
+j d
+m b
+m o
+Ġt ci
+Ġt io
+Ġa av
+Ġp orous
+Ġm cl
+Ġm illed
+Ġh n
+Ġe ol
+Ġe ws
+Ġch eng
+Ġad ar
+pt ics
+Ġqu otes
+Ġte lev
+Ġrem inder
+Ġif i
+ps on
+Ġexpl o
+Ġloc omotor
+Ġneg ativity
+Ġprof it
+Ġvalid ating
+Ġher oin
+ci ence
+Ġmut ually
+Ġhyd rophilic
+Ġpp p
+Ġta e
+Ġadip okines
+Ġfall ers
+roc ed
+Ġdra ft
+Ġbio activity
+Ġpret est
+Ġelectro acupuncture
+Ġtherm o
+Ġurg ently
+Ġpy ram
+Ġestrogen ic
+Ġmultif ocal
+Ġcef otax
+Ġperip roced
+Ġmex ican
 Ġflush ing
-Ġauton omy
-Ġimmunore actants
-Ġpolish er
-Ġphotosensitiz ers
-Ġdissem inated
-Ġdissem inate
-Ġcarboxyl ase
-Ġpropag ated
-Ġglycer ol
-Ġglycer ine
-Ġglycer aldehyde
-bacter ium
-Ġtab ulation
-Ġtel edentistry
-Ġaz ad
-Ġaz har
-Ġson ication
-Ġsel en
-Ġinver sion
-Ġdh cs
-Ġhous ed
-Ġnom inally
-Ġgather ings
-Ġperioste al
-Ġplant arum
-Ġneph rotoxic
-Ġinvest ments
-Ġmicrot ube
-Ġtransduc ers
-Ġformul ary
-Ġ34 3
-Ġsla ughter
-Ġsteril ization
-Ġevol ved
-Ġsaving s
-Ġcrevic es
-Ġboxpl ot
-Ġspreadshe ets
-Ġaccompl ish
-Ġmitochond ria
-Ġneurolog ic
-Ġoverdent ures
-Ġreimburse ments
-Ġvortex ing
-Ġunnecess arily
-Ġtc ga
-Ġcred it
-Ġmist aken
-Ġmist reatment
-Ġmist aking
-Ġchen gdu
-Ġpreclud e
-Ġshah id
-Ġheavi er
-Ġleuc ine
-Ġleuc ocyte
-Ġparas ite
-Ġparas itosis
-peri odontal
-class ified
-class ifications
-Ġrelie ved
-Ġrelie ving
-Ġintense ly
-Ġamph etamine
-Ġnumb ness
-Ġours elves
-Ġsparse ly
-Ġze it
-Ġze idi
-Ġerad icating
-Ġranking s
-Ġmultil abel
-Ġremember ing
-Ġinsp ired
-Ġdistinc tions
-Ġpromp ted
-Ġpromp ting
-Ġeconom ically
-Ġinterpret ations
-Ġveh icles
-Ġvegf a
-Ġraj aei
-Ġdsd na
-Ġreinstru mented
-Ġorthopantom ograph
-Ġrefrig erated
-Ġsudden ly
-Ġoblig ated
-Ġoblig ate
-Ġoblig atory
-Ġdestro ys
-Ġaliqu ot
-Ġaliqu oted
-Ġneighbour s
-Ġabbrevi ation
-Ġmiti gation
-Ġbh aru
-Ġreform at
-Ġreform ulated
-acchar ide
-Ġlos es
-Ġlum p
-Ġnich es
-Ġgt q
-Ġvan ishing
-Ġvig orously
-Ġvibr ational
-Ġrup tured
-Ġdex amethasone
-Ġdex tran
-Ġdex medetomidine
-Ġcompuls ive
-Ġseat s
-Ġaber ration
-Ġaber rations
-Ġquinol one
-Ġkar ary
-Ġkar lskron
-Ġsimul ant
-Ġbrist les
-Ġmanip ulating
-Ġhyal inization
-Ġimprec ision
-Ġ03 7
-Ġzo e
-Ġelab orate
-Ġglut am
-Ġpulver ization
-Ġslic ing
-Ġcontraind icated
-Ġsymph yseal
-Ġelev ate
-Ġelev ating
-Ġhemorrh agic
-Ġoverlo oking
-Ġerythro leukoplakia
-Ġuncover ing
-Ġosteoper foration
-Ġkaryo lytic
-Ġthromb in
-Ġthromb osis
-Ġthromb ocytopenia
-Ġmathematic ally
-46 1
-pers on
-sm ile
-vis it
-vis its
-Ġsort ases
-Ġsoph omore
-Ġcens oring
-Ġwit ness
-Ġinqu ired
-Ġinqu iring
-Ġdol ichofacial
-Ġduc reyi
-Ġdog an
-Ġmich elinak
-Ġnr cc
-Ġdeion ised
-Ġscrap ing
-Ġfoil s
-Ġhaemat opoietic
-Ġtriglycer ide
-Ġintercon nec
-Ġunin tentional
-Ġamp ure
-Ġkine tic
-Ġdetach ed
-Ġdesquam ated
-Ġarith metical
-Ġinvis ibility
-Ġphr ase
-Ġphr asing
-Ġcry o
-Ġcry ogenic
-Ġcry otherapy
-Ġolig odontia
-Ġremind ed
-Ġappreci ated
-Ġsuff ers
-Ġchemot axis
-Ġburst one
-Ġhomogen ization
+Ġparadox ical
+Ġevl wi
+Ġcalor ie
+Ġanticholin ergic
+Ġunevent ful
+4 6
+y re
+Ġt ar
+Ġm z
+Ġm oca
+ar ter
+Ġst y
+Ġl ca
+Ġv ials
+Ġwh isk
+ir d
+op ter
+Ġpre pro
+Ġsh ar
+ost eal
+Ġmeth oxy
+Ġunder lined
+Ġcalc ulator
+Ġhist i
+Ġic ds
+Ġret entive
+Ġvi i
+Ġexer tion
+Ġhome opathy
+Ġta urine
+Ġplan ar
+Ġce le
+Ġadip sin
+Ġprolong ing
+Ġacup ress
+ipl atin
+Ġdra ined
+Ġhygi en
+Ġrepro duction
+Ġnan ofib
+Ġlar v
+Ġcapt uring
+Ġamp c
+Ġheat map
+Ġacceler ating
+Ġjour ney
+Ġworth y
+Ġaffil iation
+Ġepiderm idis
+Ġfu ros
+Ġexh aled
+Ġanticip ate
+Ġtk i
+Ġrap port
 Ġdysreg ulated
-Ġdenom ination
-Ġelectromy ographic
-Ġelectromy ography
-Ġorthopa edics
-Ġterrit orial
-Ġconjug ation
-Ġconjug ated
-Ġconjug ative
-Ġrhyth ms
-Ġrhyth mic
-Ġmoistur izing
-Ġmoistur izers
-Ġdisinfect ant
-Ġnicotin amide
-Ġectod ysplas
-Ġcounsel ed
-Ġsynchron ize
-Ġsynchron ous
-Ġprostagland ins
-Ġunaware ness
-Ġdisappear s
-Ġimperfec tions
-Ġdispropor tionally
-hang elsk
-Ġtear s
-Ġsor ting
-Ġpad ua
-Ġanim ations
-Ġdhe eraj
-Ġmer it
-Ġbill ions
-Ġreti rement
-Ġreevalu ated
-Ġconform ity
-Ġconca vity
-Ġconca vities
-Ġpert inent
-Ġrit onavir
-Ġexoc rine
-Ġdisg usting
-Ġhep at
-Ġhep atic
-Ġhemost atic
-Ġparv ula
-Ġtrim med
-Ġconsolid ation
-Ġunid irectional
-Ġmoh amm
-Ġtransill uminate
-Ġgrand father
-Ġunderp owered
-Ġ000 1
-Ġelong ated
-Ġprednis olone
-Ġfaces can
-Ġsegreg ating
-Ġhypothal amic
-Ġtravel s
-Ġhydrof loric
-Ġaugment in
-Ġmisinterpre ted
-Ġmisinterpre tations
-Ġharmon isation
-Ġinhom ogeneity
-Ġamelior ated
-Ġconcres cent
-Ġbenz ene
-Ġbenz alkon
-Ġrhabdomy oblastic
-Ġargu ably
-Ġvlogg er
-Ġlingu istic
-Ġvertebr a
-Ġethylenedi amine
-Ġpreprocess ed
-Ġepigene tics
-bu ffer
-bu ilt
-fam ily
-iet in
-pyr rolidone
-Ġtar trate
-Ġthuring ian
-Ġstit ching
-Ġcts b
-Ġplex ig
-Ġdial ysed
+Ġatl as
+Ġconvinc ing
+Ġsemiquant itative
+Ġantever sion
+c n
+h eld
+l ax
+Ġt ff
+Ġt apse
+Ġa vi
+Ġp em
+it ar
+Ġh il
+Ġn rt
+et tes
+Ġg q
+od ial
+od ium
+op p
+Ġco oking
+Ġcl oth
+Ġph g
+Ġext ran
+cc s
+Ġunder pin
+Ġlif ting
+Ġmal a
+Ġexc urs
+Ġpoly g
+Ġadv ise
+ins ured
+istic ated
+ather apy
+Ġmd as
+Ġlact ating
+Ġampl itudes
+Ġpet ri
+mic ron
+16 0
+Ġaustral ians
+Ġthreat s
+Ġallevi ation
+Ġcarbon ate
+Ġsudden ly
+Ġrb v
+Ġduplic ation
 Ġdeline ated
-Ġrech arge
-Ġham per
-Ġhots p
-Ġell ipses
-Ġll od
-Ġfors us
-Ġdeple ted
-Ġmex ico
-ibacter ium
-Ġhein rich
-Ġposter o
-stud ents
-Ġallopl ast
-Ġtryp sin
-Ġinterl abial
-Ġinterrelations hip
-Ġenfor ce
-Ġenjoy ed
-Ġphantom s
-Ġbioceramic s
-Ġsuppl anted
-Ġje op
-Ġje jun
-Ġmicroc occus
-Ġcommission er
-Ġblur ry
-Ġerg onomics
-Ġmultilay ered
-Ġcleans ed
-Ġmuco epid
-Ġdisto angulation
-Ġpalis ade
-Ġguang xi
-Ġguang hua
-Ġcapac itance
-Ġcohere nt
-Ġprioritiz ed
-Ġdelib eration
-Ġdelib erately
-Ġpreponder ant
-Ġprolong ing
-Ġmyco plasma
-Ġevap oration
-Ġhousekee ping
-Ġbreastf eed
-Ġmcn amara
-Ġbioinform atic
-Ġperfluor ooc
-Ġpoliclin ico
-develop ment
-Ġembarr assment
-Ġmultis urface
-Ġmultis ensory
-Ġmultis lice
-Ġobtur ate
-Ġdestabil ization
-Ġexecution er
-Ġreshap ing
-Ġpolyvinyl pyrrolidone
-Ġmanoeuv res
-Ġosteoinduc tion
-Ġthermocoup les
-dmd patient
-ret inoin
-Ġthr ush
-Ġcatch ment
-Ġpent ecostal
-esign er
-Ġanastom osis
-Ġdict ated
-Ġdict ate
-atc gt
-Ġbud s
-Ġbag s
-Ġhus band
-Ġhop ed
-Ġhop eless
-Ġhope fully
-imon ian
-Ġforth coming
-Ġconvers ation
-Ġvo i
-Ġpret esting
-Ġtwenti es
-opal atine
-Ġiterative ly
-Ġcough ing
-Ġleak ages
-Ġsubpop ulations
-Ġunn atural
-Ġintel lectual
-Ġdeter rent
-Ġfinn gen
-Ġphil ip
-Ġstri ker
-Ġdiscour age
-Ġdiscour aging
-Ġjoh n
-Ġdiap hragm
-Ġconfid ential
-Ġworry ing
-Ġpractis ed
-Ġflaw less
-Ġhypoh idrosis
-Ġsensitis ation
-Ġrefresh er
-Ġrefresh ed
-Ġtoolk it
-Ġhyperparamet er
-Ġillum inated
-Ġorganis ational
-Ġhydrolys ate
-Ġdissimilar ity
-Ġtonsil s
-Ġcarcinogenic ity
-Ġcounterst ained
-Ġincompati ble
-Ġextrem ity
-Ġextrem ities
-Ġharb ors
-Ġsupervis ors
-Ġantec edents
-Ġantec edent
-Ġvictim ization
-Ġperpetr ators
-Ġembry onal
-Ġreassess ed
-Ġreassess ment
-Ġpyramid obacter
-Ġunavail able
-Ġunavail ability
-Ġcornerst one
-Ġperturb ed
-Ġisrael i
-encephal y
-88 8
-aag ag
-cor rect
-tct ag
-Ġtent ative
-Ġtack le
-Ġarous al
-Ġarous als
-Ġsant os
-Ġsir na
-Ġsir nas
-Ġped erson
-Ġpere s
-Ġwon kw
-Ġanc ient
-Ġanc illary
-Ġanh idrotic
-Ġfid ucial
-Ġfid elity
-Ġdere gulation
-Ġdend ritic
-Ġdend rogram
-Ġmere ly
-Ġmyl ohy
-Ġbab y
-Ġbab ies
-Ġbern ardo
-Ġeigen values
-Ġstrap s
-acg tgtc
-Ġgome z
-Ġasper gill
-Ġrick ets
-Ġrick etts
-Ġwhis kers
-Ġwhis ker
-Ġisot onic
-Ġisot retinoin
-Ġdeploy ed
-Ġdeploy ment
-Ġsha vings
-Ġshed s
-Ġshed ding
-Ġassimil ation
-Ġclas p
-Ġclas ps
-Ġclient ele
-Ġcoa uthors
-Ġindul ged
-Ġindul gence
-Ġcann ulation
-Ġhaw ley
-Ġobsc ured
-Ġrecon f
-Ġsubsc ale
-Ġsubsc ales
-Ġunl ock
-Ġyol o
-Ġyol ov
-irection ally
-Ġsucce ed
-Ġsucce eded
-Ġdece ased
-Ġdece mentation
-Ġnoncon ventional
-Ġspong i
-Ġspong y
-Ġjab al
-Ġjab our
-Ġgrant ing
-Ġdepapill ation
-Ġdepapill ated
-Ġunderdevelop ed
-Ġunderdevelop ment
-Ġzah ngetr
-Ġzah rani
-Ġinsec ts
-Ġinsec urity
-Ġglo ved
-Ġglo ves
-Ġescal ated
-Ġescal ating
-Ġredd y
-Ġredd ish
-Ġpolyp eptide
-Ġauthentic ated
-Ġctv ox
-Ġmutagen ic
-Ġskew ness
+Ġves icles
 Ġpurs ue
-Ġbarc odes
-Ġbarc oded
-Ġtransloc ated
-Ġhemim andibular
-Ġhemim andible
-Ġnanof ill
-Ġodontocl astic
-Ġodontocl asts
-Ġpropr ieties
-Ġpropr ioceptive
-Ġrevis ited
-Ġrevolution ized
-Ġkerat otic
-Ġkerat ocys
-Ġthorac ic
-Ġquarant ine
-Ġpleomorph ic
-Ġpleomorph ism
-Ġportug al
-Ġportug uese
-Ġnorthw est
-Ġnorthw estern
-Ġchromatic ity
-Ġneurop eptides
-Ġpericard ium
-Ġhyperchrom atism
-Ġteleradi ography
-Ġteleradi ographs
-Ġinterpol ation
-Ġneighbourhood s
-Ġmicha elis
-Ġsporad ic
-Ġsporad ically
-Ġdermat ological
-Ġadvertise ments
-Ġunderpin ning
-particip ants
-Ġellip se
-Ġhomozyg ous
-Ġhomozyg ote
-Ġlacun ar
-Ġlacun ae
-Ġoverwhel ming
-fur ther
-Ġty rosine
-Ġtam ba
-Ġay tan
-Ġatr ial
-Ġsab ur
-Ġsak uma
+Ġopac ities
+Ġmenis cal
+Ġdentif rices
+Ġinterns hip
+Ġcitr us
+Ġdefib rill
+Ġdansh en
+l p
+in ator
+Ġs fa
+Ġc ia
+Ġp ray
+or um
+Ġe ac
+Ġon wards
+Ġv fa
+ch ange
+Ġch ick
+Ġac yl
+Ġco res
+Ġman ometry
+Ġnon t
+ob a
+Ġli u
+Ġfl ut
+Ġform ally
+Ġes thetics
+Ġep p
+Ġcd t
+Ġmem orial
+Ġct n
+Ġhel per
+Ġ20 23
+Ġhand piece
+Ġda ptomycin
+Ġmultiv essel
+Ġmuc orm
+Ġorth og
+Ġenrol le
+Ġcognitive ly
+Ġcontact ing
+Ġtm z
+Ġspl ints
+Ġbuffer ing
+ash i
+yc osis
+Ġhour ly
+Ġmv o
+Ġrelax ed
+Ġexpand er
+Ġbronch us
+Ġket oac
+Ġnarrow er
+Ġworth while
+Ġrect us
+odil ution
+Ġdeal t
+Ġabut ments
+Ġevap oration
+Ġpert urb
+Ġarom atherapy
+Ġobstac le
+Ġradioluc ency
+Ġtma o
+Ġerect ile
+Ġdhe a
+Ġsoph isticated
+Ġcolline arity
+Ġprosper o
+Ġhyposp ad
+Ġfuros emide
+Ġextran odal
+u ated
+Ġo mission
+Ġp yro
+ed ics
+Ġw art
+Ġm ich
+as aki
+Ġh ang
+Ġl od
+Ġg ets
+ra ck
+up h
+Ġal ters
+ult ation
+Ġdis ilicate
+Ġap ices
+Ġpl c
+Ġam d
+Ġout weigh
+Ġmult ist
+Ġdisc onn
+Ġgra vity
+Ġcurrent s
+oph ore
+Ġextra oral
+Ġadh f
+Ġos lo
+ilt on
+Ġreal ize
+Ġinvasive ly
+Ġtg c
+Ġbio eth
+Ġcandid emia
+Ġthor ax
+Ġid a
+Ġhu a
+Ġsurvivors hip
+Ġexcell ence
+Ġsulf amethoxazole
+Ġgd p
+vas ation
+Ġintens ification
+Ġacetab ulum
+Ġepile ptic
+Ġblast s
+Ġlute in
+Ġdf u
+Ġproce eding
+Ġcada vers
+Ġwat ching
+Ġmediast in
+Ġmetalloprotein ase
+Ġij v
+Ġtransvers al
+Ġata ad
+Ġowners hip
+Ġhypophys itis
+Ġnul lip
+Ġhyperand rogen
+Ġchromo endoscopy
+Ġcefotax ime
+Ġacupress ure
+e i
+f ib
+Ġt st
+Ġt ms
+Ġt cs
+Ġt ier
+Ġs ich
+Ġp ore
+Ġw og
+Ġd ynam
+Ġb sis
+ent ricular
+Ġe ft
+Ġto e
+Ġn q
+om eric
+ere sis
+Ġg ensin
+ol ds
+ut aneous
+ist ine
+Ġnot with
+Ġmet agen
+Ġph a
+Ġexp iration
+Ġcr i
+Ġext ubated
+Ġra ces
+Ġtrans esophageal
+Ġwork st
+Ġcent ric
+Ġvi enna
+Ġlength ening
+Ġemot ionally
+rad icular
+Ġreconstr uctive
+Ġunc on
+Ġenter pr
+Ġsy ph
+Ġcf p
+Ġscient ists
+11 7
+Ġconstit ution
+Ġtal ked
+Ġundert aking
+Ġpu fa
+Ġdw ell
+Ġment oring
+Ġsarc oidosis
+Ġkill er
+Ġdext ran
+Ġfrag ile
+Ġadvis ory
+Ġshi raz
+Ġmembran ous
+Ġclostrid ium
 Ġoint ment
-Ġophthal mologic
-enn ial
-Ġcac l
-Ġpbst g
-Ġws l
-Ġwrap ping
-Ġwinb ugs
-Ġinad vert
-Ġanamn esis
-Ġdq a
-Ġmv bf
-Ġmels en
-Ġbip olar
-Ġbisc uits
-Ġbah ri
-Ġbacill i
-Ġhof mann
-Ġeb sco
-Ġeub acterium
-Ġeuk aryotes
-itz ender
-Ġstew ardship
-ecy cline
-Ġlid ocaine
-Ġgust atory
-eto oth
-Ġconges tive
-Ġvacc ine
-Ġrestr ains
-Ġisoprop anol
-Ġchim era
-Ġchap ters
-Ġdepress ors
-Ġbypass ing
-Ġshutdown s
-Ġmaz zeh
-Ġapert ure
-Ġcohes ion
-percent age
-Ġhaus dor
-Ġobe id
+osse ous
+Ġinvolunt ary
+Ġcondu it
+Ġdeion ized
+Ġperiproced ural
+Ġhypospad ias
+Ġgensin i
+Ġnotwith standing
+b ony
+o ons
+p ost
+Ġt ack
+al though
+Ġh se
+Ġv ic
+Ġde letions
+Ġad e
+Ġac pa
+Ġcl ub
+Ġtre ad
+Ġun availability
+Ġthan ks
+Ġcol ors
+Ġtrans ection
+Ġwor ries
+Ġcomm enced
+ace a
+Ġevalu ators
+Ġconf used
+ord ial
+Ġins ol
+Ġprof iciency
+Ġdel t
+Ġcult iv
+Ġpa ulo
+roph in
+Ġ4 00
+ople gia
+Ġoff line
+otherap ies
+Ġcoll ision
+Ġnecess itating
+Ġneuro blast
+Ġrecogn ise
+Ġcomput ing
+Ġdrain ing
+Ġoverlap ped
+Ġrig or
+Ġconjug ate
+Ġpuls es
+Ġmu eller
+Ġnin th
+omorph ic
+Ġimmunocomp etent
+Ġmim icking
+amb ia
+Ġcorrobor ates
+Ġwish es
+Ġmicror nas
+Ġgangl ia
+Ġabol ished
+Ġerythrop oi
+Ġantiem etic
+Ġhypoech oic
+Ġspeck le
+Ġvalpro ate
+en oic
+Ġm end
+om ogene
+Ġl ingu
+et es
+et amine
+Ġon d
+Ġex fol
+ac il
+Ġab duction
+Ġcan on
+Ġun ified
+Ġout per
+Ġser ocle
+ice ps
+Ġ0 8
+Ġhyp od
+Ġnormal ize
+Ġang pt
+Ġec onomy
+uch i
+Ġneuro vascular
+Ġsn are
+Ġmd p
+Ġpneum ococcal
+Ġepith el
+Ġpt g
+Ġabsorb able
+Ġmill imeters
+Ġshap iro
+Ġuns u
+Ġgraph ically
+Ġput ting
+ethyl ated
+Ġanth ra
+Ġsubstit uted
+Ġcoordin ators
+Ġsay ing
+Ġmitig ated
+Ġaph asia
+Ġsilic on
+Ġmouthwash es
+Ġlax ative
+Ġvasoconst rict
+Ġoxal ate
+Ġacin ar
+Ġlun ch
+Ġmbs r
+Ġpteryg oid
+Ġretard ation
+Ġcavern ous
+Ġfirefigh ters
+Ġketoac idosis
+Ġserocle arance
+t ro
+y er
+ed a
+al t
+Ġl und
+od u
+Ġsh op
+Ġac lr
+und er
+Ġind oor
+agn etic
+Ġover time
+Ġprov isional
+ines ia
+Ġfl ight
+Ġhyper lact
+Ġel astom
+Ġav s
+Ġmy opia
+Ġeth idium
+Ġadminist rations
+Ġestim ator
+Ġabs or
+Ġcult ivated
+Ġflu oxetine
+Ġlv ad
+Ġla hs
+Ġtrig eminal
+Ġnear by
+Ġaff airs
+Ġpv a
+Ġpm f
+Ġcc d
+Ġpurch ase
+Ġcond yles
+Ġhoriz on
+Ġple ase
+Ġempir ically
+Ġcytos cape
+Ġpostt reatment
+Ġsand wich
+Ġgem c
+Ġurolog y
+Ġremind ers
+represent ed
+Ġlibr aries
+Ġoverpro duction
+Ġarachid onic
+b u
+b rain
+l uc
+o ub
+s ky
+t onic
+Ġt iva
+Ġo op
+Ġc ylin
+Ġc ocaine
+Ġd ac
+Ġh cr
+Ġn is
+Ġl ox
+Ġl arynx
+im urium
+Ġg ras
+Ġal oe
+Ġcomp ute
+Ġper itum
+ell um
+pl ing
+Ġfol in
+Ġund erm
+Ġser oconversion
+Ġover growth
+Ġmin s
+Ġclass ifier
+Ġep it
+Ġless ons
+Ġeduc ating
+Ġdys lipidaemia
+Ġec ological
+Ġlymph ovascular
+Ġhal it
+Ġx g
+Ġcycl er
+Ġacup unct
+Ġepisod ic
+Ġbuc col
+Ġdc fh
+Ġprogress ing
+Ġanalog ous
+Ġnons ignificant
+Ġelast ics
+Ġcast or
+Ġreinfor cing
+Ġfiss ures
+Ġgam es
+Ġpsycho educ
+pept ide
+Ġcardiover sion
+Ġmalp osition
+Ġepigl ottis
+Ġplank tonic
+Ġmucorm ycosis
+Ġgemc itabine
+c oming
+Ġs ild
+Ġp x
+or ient
+et ra
+et razolium
+Ġg ate
+ol ith
+Ġr ic
+ag ers
+Ġde ployed
+st atic
+Ġsh aker
+ens ives
+ast ro
+Ġdur ability
+Ġra v
+Ġtrans s
+Ġbi of
+Ġneed ling
+Ġmain st
+Ġprim e
+Ġii ia
+Ġlo ved
+Ġachie vable
+Ġhf no
+ole c
+Ġpal at
+Ġmd c
+Ġdocument ing
+Ġshock able
+Ġconstruct ing
+ars eness
+Ġrh amn
+Ġformula e
+Ġfore cast
+omer ase
+Ġtherm odilution
+Ġincident ally
+Ġabst inence
+Ġsubt otal
+Ġelast in
+Ġanastom oses
+Ġultrason ographic
+Ġcure tt
+Ġpathogen icity
+Ġmotiv ational
+Ġvill ages
+Ġprecip itating
+Ġhapl otypes
+Ġunderl ines
+Ġsati va
+Ġisot onic
+Ġmont real
+Ġelectrom y
+Ġoss ification
+Ġancest ry
+Ġmicrosph eres
+Ġelastom eric
+Ġcylin der
+Ġsild enafil
+h ist
+in ogen
+re otide
+Ġan emic
+Ġb ace
+Ġg ists
+Ġfor get
+ect omies
+oc er
+Ġinc omes
+art icular
+uc ci
+Ġint ron
+Ġwhich ever
+Ġafter ward
+Ġun insured
+Ġperform s
+ond on
+ang ement
+Ġes wl
+Ġpoint ing
+Ġmal function
+Ġgluc an
+Ġfat s
+Ġchem ically
+Ġapp osition
+Ġhb x
+Ġax onal
+Ġpd c
+Ġpharmac ies
+Ġoh d
+Ġht g
+Ġhazard ous
+Ġpediatric ians
+ii i
+Ġsched uling
+Ġprote olytic
+Ġanomal ous
+Ġrib osomal
+Ġham ilton
+Ġgli oblastoma
+Ġmidw ife
+Ġradio immun
+Ġeuth yroid
+avir in
+Ġcinnam on
+Ġendodont ics
+Ġnitro cellulose
+endor f
+Ġinex perienced
+Ġperiv ascular
+Ġobtur ator
+Ġephed rine
+Ġtread mill
+odu oden
+Ġhalit osis
+m ask
+m wt
+Ġs ss
+Ġo lym
+Ġw ales
+Ġn ens
+id ate
+th rough
+od in
+Ġal ar
+Ġis l
+Ġco bas
+end a
+Ġinter cellular
+ap arin
+Ġdes cent
+Ġpar v
+Ġlim on
+Ġgra ms
+Ġpers ists
+Ġent rap
+Ġagre ements
+Ġexcept ions
+Ġech ogenicity
+sc an
+Ġlist en
+Ġthickness es
+Ġip i
+Ġrt a
+��matr igel
+Ġeg g
+Ġhor se
+Ġuns pecified
+Ġlib eral
+Ġpod ocytes
+Ġsent in
+Ġphyt o
+Ġcouns el
+Ġrib avirin
+Ġcatal ytic
+Ġrecess ions
+Ġson ography
+anal ysis
+inter pre
+Ġradio activity
+Ġreimburs ed
+Ġtear s
+Ġintrac erebral
+Ġchin ensis
+Ġtechnici an
+ocyan ate
+oneph rosis
+Ġaur icular
+Ġoxal iplatin
+Ġreinforce ment
+Ġflask s
+Ġentail s
+Ġovari ectomized
+Ġleth ality
+Ġcurett age
+e um
+f i
+Ġt ie
+in ating
+Ġa eration
+Ġo ks
+Ġw ms
+is d
+Ġst asis
+im et
+Ġpro cr
+Ġal ber
+ain t
+Ġdis ks
+ost in
+Ġme ets
+Ġab ort
+Ġun if
+Ġdur able
+Ġem inence
+ograph ically
+av idin
+Ġintra ventricular
+of er
+Ġnec rot
+Ġdent oalveolar
+Ġbr ist
+Ġdec ub
+Ġcam pus
+Ġspecial ised
+Ġhydro gel
+Ġms d
+Ġschool ing
+Ġaden omy
+Ġpass es
+Ġcompet ition
+Ġradiograph ically
+Ġfil ms
+Ġaspir ated
+Ġphysiological ly
+Ġsem antic
+Ġsr ta
+Ġuns pecific
+Ġham s
+prot ection
+28 2
+Ġradio active
+Ġnail s
+Ġremed y
+Ġtransamin ases
+Ġchel ation
+Ġconvey ed
+Ġstern otomy
+Ġastragal us
+Ġbiob ank
+Ġcfp wv
+Ġerythropoi etin
+o ors
+Ġs anger
+Ġo micron
+Ġc me
+Ġp og
+Ġp fa
+Ġst d
+Ġst ations
+Ġg ob
+Ġg ord
+Ġg ries
+ol ent
+Ġfor g
+ot ing
+Ġr cs
+oc c
+qu est
+Ġdis in
+Ġco umar
+Ġsign atures
+Ġrec alc
+one c
+Ġro yal
+Ġj ack
+Ġsm bg
+ish man
+Ġer t
+Ġca h
+ochem ically
+bp a
+bal anced
+Ġalb i
+Ġaltern ating
+Ġface mask
+Ġpv b
+Ġtoler able
+Ġmis use
+Ġhp dl
+Ġlas so
+Ġunc over
+Ġaspir ates
+Ġstom atitis
+Ġlc x
+Ġeye b
+Ġho arseness
+Ġadvance ments
+Ġaz a
+Ġinact iv
+Ġcrystall ine
+Ġoffic er
+omeg al
+Ġchemilumines cent
+Ġendodont ically
+Ġdiscord ance
+Ġpiper acillin
+Ġcertific ate
+Ġvals artan
+Ġedit orial
+Ġneovascular ization
+Ġacupunct ur
+Ġdecub itus
+b actam
+h o
+j ian
+r c
+Ġth rice
+Ġs di
+al f
+al gia
+it o
+Ġd ps
+Ġm osa
+Ġto ugh
+ol ide
+Ġv ae
+Ġr ts
+op oiesis
+Ġde af
+Ġad vers
+Ġsh bg
+ac ia
+Ġfo f
+ill s
+Ġcr ises
+Ġsp ina
+Ġchar ges
+Ġsim pler
+Ġblood y
+cept ions
+ri ages
+Ġkn h
+Ġinform ant
+Ġhyper p
+Ġel apsed
+Ġintra coronary
+Ġpress ing
+Ġret ired
+Ġfib ula
+Ġcyt omegal
+Ġpoly saccharides
+Ġsk im
+omet rical
+Ġaut ism
+Ġbr ings
+Ġhypoth yroid
+Ġdig oxin
+Ġthromb i
+Ġlight s
+Ġpc nl
+Ġtc d
+Ġtc f
+Ġinstrument ed
+Ġped iatrics
+Ġhp i
+Ġgradu ation
+rog ram
+Ġhd pscs
+Ġscar c
+Ġtor res
+Ġwil k
+Ġsynthes ize
+Ġyeast s
+Ġosm ol
+Ġlax ity
+Ġresemb les
+Ġbiotin ylated
+Ġantim yc
+Ġneurotransm itter
+Ġlaun ched
+Ġhypercal cemia
+Ġpollut ants
+Ġtyph imurium
+Ġamn iotic
+oprecip itation
+Ġrhabdomy olysis
+Ġclimb ing
+Ġenorm ous
+Ġinsol uble
+Ġhyperlact atemia
+Ġgries s
+8 3
+b ec
+b ank
+e lect
+r ator
+Ġp ectin
+Ġd be
+le c
+Ġe j
+Ġn ich
+Ġl ined
+Ġl ondon
+Ġv hd
+Ġsh ot
+Ġsc oli
+Ġun av
+Ġsub dom
+Ġunder pow
+Ġpath s
+Ġct rl
+Ġpul led
+Ġsl ing
+Ġcategor ize
+orph ous
+Ġchem opre
+Ġsatisf ying
+Ġphosph oric
+Ġbur r
+Ġcytok er
+Ġx f
+uk a
+Ġlig ature
+Ġhypothes ised
+Ġast roc
+Ġblack s
+Ġdw i
+Ġdd d
+Ġwt p
+Ġbath ing
+Ġanonym ity
+Ġsib ling
+Ġconfer red
+Ġtranspor ters
+Ġeconom ically
+Ġtors ion
+Ġfluorid ation
+Ġtons ill
+Ġisland er
+Ġagric ulture
+Ġfort unately
+Ġsemin iferous
+Ġdar atumumab
+Ġneurotransm itters
+Ġaq p
+Ġepp endorf
+Ġsyph ilis
+Ġunav oid
+m at
+Ġt all
+Ġp z
+it ers
+Ġb hi
+Ġh ter
+le ar
+Ġl ign
+Ġl ove
+os yl
+Ġg ov
+Ġr uling
+Ġres emble
+Ġch or
+Ġle w
+Ġdis ordered
+Ġfo res
+Ġaf l
+Ġun ip
+Ġpresent eeism
+ang li
+Ġdep ress
+Ġdem ir
+Ġpop f
+Ġ3 00
+Ġq at
+Ġcoll oid
+Ġphen ols
+ucle ated
+ole mic
+Ġcas ual
+Ġpersist ently
+Ġlum p
+Ġrh o
+Ġballoon ing
+Ġwr ith
+Ġker at
+Ġfibrin olytic
+Ġswe at
+Ġscr utin
+Ġpolar ization
+Ġtrun c
+Ġsharp ly
+Ġhapl o
+Ġhmg cr
+Ġmicrogl ial
+Ġnov ice
+Ġaus c
+Ġslee ve
+Ġseg reg
+onv uls
+Ġbuccol ingual
+w u
+Ġa il
+Ġw is
+Ġan hyd
+Ġf ai
+Ġf pm
+Ġh hs
+ch t
+Ġle yd
+Ġme a
+Ġit ch
+Ġint ric
+Ġtr ismus
+ach ed
+Ġen ox
+Ġman g
+Ġsim ulating
+Ġsug ary
+Ġpar af
+Ġinform atics
+ores p
+Ġpain less
+Ġct t
+ems a
+Ġcap it
+Ġdent ofacial
+Ġcolon isation
+Ġcp et
+Ġcollection s
+Ġmatch es
+az e
+Ġstay ing
+Ġla vi
+Ġassist ing
+Ġgi emsa
+Ġhar ms
+Ġdissol ve
+Ġglass es
+Ġcn c
+Ġls d
+Ġses amin
+Ġnons urv
+Ġff pe
+Ġexcre ted
+Ġsynerg istically
+Ġtransp ulmonary
+Ġaver aging
+Ġabras ive
+Ġmail ed
+Ġdigit ized
+Ġerg onomic
+Ġrestra int
+ophyl l
+Ġaband oned
+Ġreferen ced
+Ġdere g
+Ġji ang
+Ġolym pus
+Ġscarc ity
+Ġleyd ig
+c ens
+p ia
+u its
+Ġa ap
+Ġin ph
+ing e
+Ġre up
+Ġn ph
+om ast
+Ġg ep
+Ġg ca
+el ly
+Ġv m
+ot ella
+Ġis b
+op roliferative
+Ġle u
+Ġtw itch
+pl a
+Ġsc vo
+Ġrec urring
+Ġam c
+Ġam orphous
+Ġqu ery
+Ġte gd
+ep ime
+Ġj p
+Ġsm c
+Ġcal p
+Ġconf ron
+oper idol
+Ġol v
+Ġav m
+Ġml r
+Ġec gs
+Ġq n
+Ġprogn oses
+Ġquant itation
+ax imin
+Ġtub ulin
+Ġiv ig
+Ġhal operidol
+Ġrot ations
+Ġwid ening
+Ġmanifest s
+Ġss d
+Ġmil ieu
+Ġion izing
+Ġuns up
+Ġonc ogenic
+Ġaw a
+Ġtransm it
+Ġmas c
+can al
+acet ate
+Ġlactam ases
+Ġcef epime
+Ġhydroxyl ase
+Ġcoagul ase
+Ġbring ing
+angi ogenic
+Ġwaveform s
+Ġze bra
+Ġbiod entine
+Ġvoc ational
+Ġimmunosuppress ants
+Ġunequ al
+Ġfellow s
+Ġintensiv ists
+oderm a
+Ġprefect ure
+scre en
+arter ial
+Ġunsu itable
+Ġunderpow ered
+Ġtegd ma
+Ġzebra fish
+Ġa ar
+Ġs ip
+Ġo estrogen
+Ġc q
+Ġw em
+Ġan amn
+Ġm pt
+us es
+Ġg ond
+Ġg hd
+ad o
+ers on
+Ġind igo
+Ġun infected
+ub lished
+Ġser ologic
+Ġdep ar
+Ġdep olarization
+Ġhospital isations
+Ġmin oca
+Ġi ac
+Ġsubject ively
+yl on
+Ġhyper c
+Ġel ders
+Ġintra canal
+Ġgeneral is
+hol ding
+Ġec n
+Ġchem oradi
+Ġcut s
+Ġheter ogenous
+Ġod d
+Ġx in
+Ġgu inea
+Ġtransfer rin
+Ġcorresponding ly
+Ġadip ogenesis
+Ġpt r
+Ġtm p
+Ġconsult ants
+Ġscaven ger
+Ġarg uments
+Ġcorrespond ence
+Ġmv p
+Ġneph rolog
+Ġwr ink
+Ġcolumn ar
+Ġnp c
+Ġwil son
+Ġappend age
+Ġirregular ities
+Ġexercis ing
+emat ous
+Ġanch ored
+Ġcoordin ating
+Ġsupra ventricular
+va ptan
+Ġspectrophot ometrically
+Ġrif aximin
+Ġdiscl ose
+otin ib
+Ġsacrific e
+Ġarteri osclerosis
+Ġtol vaptan
+Ġmist akes
+Ġquint iles
+Ġphag ocytosis
+Ġgol den
+Ġhomozyg otes
+prol actin
+Ġindent ation
+Ġmoroc co
+Ġprecondition ing
+Ġmicrostruct ure
+analyz er
+Ġmycopl asma
+Ġporphy rom
+itar ism
+Ġsentin el
+onec rosis
+Ġosmol ality
+Ġchemoradi otherapy
+f ur
+r na
+Ġ erm
+Ġt ian
+Ġc bp
+Ġp if
+Ġp its
+Ġw on
+Ġin ad
+Ġm ural
+Ġh di
+Ġe gs
+Ġn im
+Ġn ocice
+Ġst ip
+Ġl x
+Ġv g
+Ġv ce
+Ġv ial
+Ġris es
+ren ic
+Ġvari eties
+Ġtime point
+Ġen ema
+ym ia
+yst em
+Ġnon resp
+ted ly
+Ġocc urrences
+oma x
+Ġdys m
+Ġapproach ing
+Ġec a
+Ġsl ip
+Ġlog it
+Ġmetabol omics
+Ġven o
+Ġmc id
+Ġadip ogenic
+Ġsummar izing
+Ġhar assment
+Ġclar ification
+Ġinsp ected
+Ġonc ogene
+Ġonc ologic
+Ġrelax ant
+Ġspir onol
+Ġrecall ed
+Ġjunction s
+Ġstrept avidin
+Ġmultif acet
+Ġcris pr
+Ġpic u
+Ġreinfor ces
+Ġnin et
+Ġnv p
+Ġthym us
+Ġsilic o
+Ġnam ing
+Ġdeline ation
+Ġelong ated
+Ġrenew al
+Ġosteos ynthesis
+Ġaffir m
+Ġdress ings
+Ġinotro pes
+Ġparag angli
+Ġcrev icular
+Ġcorros ion
+Ġhcr u
+Ġperitum oral
+Ġenox aparin
+Ġreup take
+Ġmultifacet ed
+b il
+b enz
+n our
+y el
+Ġt le
+Ġo di
+Ġc ep
+Ġf um
+ro up
+Ġl pl
+Ġbe ad
+od ing
+ot ides
+Ġr iv
+Ġk oa
+Ġar ic
+Ġar ni
+te kin
+cl avicular
+Ġpo res
+Ġtrans g
+Ġfir mic
+Ġpost c
+Ġmon te
+Ġsyn onym
+Ġhum oral
+Ġec ulizumab
+Ġent rop
+Ġpat ell
+Ġsl ov
+Ġextra cranial
+Ġos f
+Ġdm t
+Ġmot if
+Ġsa es
+Ġpolym ic
+Ġmit f
+ened i
+Ġsn ap
+Ġthromb ectomy
+Ġhemat uria
+Ġmig rate
+Ġneurolog y
+Ġtransl ations
+Ġaspir ate
+Ġsul bactam
+Ġlt d
+Ġhol ter
+Ġappend ectomy
+Ġtrip t
+okin ase
+Ġperm its
+Ġsubs ample
+Ġvd bp
+ancer ous
+Ġuro th
+Ġunp ublished
+Ġtab ulated
+Ġeuthan asia
+Ġguardi an
+Ġsomat ostatin
+Ġmetalloprotein ases
+Ġcolomb ia
+Ġdoll ars
+Ġlinal ool
+Ġspironol actone
+Ġfirmic utes
+Ġt es
+Ġc ecal
+Ġp ten
+Ġw an
+Ġm health
+Ġb ure
+an ian
+Ġn em
+Ġst ap
+il le
+ant a
+Ġus tekin
+st one
+Ġsur pass
+Ġk ir
+ill on
+Ġph ones
+Ġph obia
+Ġno x
+Ġresp ite
+Ġund oub
+cc a
+ang ements
+Ġref inement
+Ġfl or
+Ġmy otub
+Ġmal absorption
+Ġhum or
+ram ine
+Ġview point
+Ġdetect s
+Ġvisit ors
+Ġsn uff
+Ġjoint ly
+Ġpharmac op
+Ġpm dd
+itu itarism
+Ġpac ifier
+Ġintr anasal
+Ġsph ing
+Ġretrie ve
+Ġviol ation
+isp ect
+Ġhorizontal ly
+Ġuv a
+Ġirrig ant
+Ġswe ating
+Ġswe ets
+Ġperme abil
+Ġstra it
+Ġmf i
+Ġunexp osed
+Ġlactam s
+Ġpharmaceutical s
+Ġhind ered
+Ġpill s
+Ġoutli er
+Ġok ay
+Ġsati ety
+Ġeuros core
+Ġbifid obacterium
+Ġofficinal is
+Ġhypokal emia
+Ġdivor ced
+Ġhers elf
+Ġimping ement
+Ġschist os
+Ġscoli osis
+Ġunavoid able
+Ġustekin umab
+b ed
+i osity
+Ġo ment
+Ġp ect
+Ġe fs
+Ġg ink
+ce p
+Ġr ass
+Ġr bl
+Ġal end
+Ġus t
+Ġsh ed
+Ġdi uresis
+Ġap cs
+Ġab cg
+Ġev t
+oth elial
+ep ile
+ob ular
+Ġpe f
+Ġhyper ther
+Ġanti epile
+our a
+Ġmo unt
+Ġfra p
+Ġmus lim
+Ġprofess ors
+Ġdam p
+Ġmorph ologies
+Ġeng raft
+Ġangi o
+Ġdiv isions
+Ġposterior ly
+Ġantioxid ative
+Ġanaes thetics
+Ġgran ule
+Ġpb w
+Ġdeterior ating
+Ġple th
+Ġabstract ed
+Ġsupra glottic
+Ġef c
+Ġsplit ting
+Ġcert ification
+Ġimped e
+Ġpor osity
+Ġbit ter
+Ġthyro t
+Ġmicrot ub
+Ġfibro ids
+Ġaster isk
+Ġdipl oma
+Ġcooper ate
+Ġclo ud
+Ġfenest ration
+othyro xine
+Ġflut ter
+Ġcanon ical
+Ġporphyrom onas
+l able
+on i
+at im
+Ġs ie
+Ġo ts
+Ġw pa
+or ice
+Ġb ort
+Ġl anes
+Ġg an
+ot ion
+ag ue
+qu ilib
+Ġtw ist
+ther apy
+Ġha e
+Ġam mon
+Ġdise quilib
+cr istine
+Ġen erg
+Ġinv alid
+cc c
+Ġsp ous
+Ġhyper co
+Ġ0 4
+Ġhyp ocal
+Ġspecific ities
+Ġep ist
+Ġquestion ing
+Ġlo h
+Ġextra vasation
+Ġshort ages
+Ġill umin
+Ġsatisf y
+Ġerr one
+Ġhepat oma
+Ġpal atine
+Ġpt l
+Ġvs d
+Ġpv c
+Ġoh s
+erv ical
+Ġnovel ty
+Ġanatom ically
+Ġstimul ator
+Ġelectro chem
+Ġns pt
+Ġuns afe
+Ġresusc itated
+Ġdegrad ed
+Ġnic otin
+Ġcg m
+Ġethiop ian
+ofib rate
+Ġsubun its
+Ġlac un
+Ġauthent ic
+Ġresemb ling
+Ġtent h
+Ġvin cristine
+Ġbare ly
+Ġtherapeut ics
+Ġphotomicrog raphs
+Ġnord ic
+Ġantihy perg
+Ġphenyle phrine
+Ġgob let
+Ġpolymic robial
+ispect ral
+p ene
+v ia
+Ġc ic
+Ġc gf
+it idine
+Ġd ge
+Ġb ach
+Ġh ast
+um ina
+am ily
+are r
+ac g
+Ġind ist
+Ġha q
+Ġk re
+Ġtr if
+Ġun in
+Ġun identified
+pro tein
+Ġresp ected
+Ġrem ineral
+Ġfl a
+roph yl
+Ġgluc uron
+Ġflow able
+Ġbacter oid
+Ġda ughter
+Ġos as
+Ġcp q
+Ġhepat obiliary
+hyd raz
+Ġinh omogene
+Ġauthor ized
+Ġurban ization
+Ġmorphological ly
+Ġfp ms
+Ġelement ary
+Ġdermat ologists
+Ġsupra gingival
+Ġpu er
+ode ox
+Ġdiaphragm atic
+Ġinterc onn
+Ġannot ated
+Ġcovers lip
+ez omib
+Ġsymmet ric
+Ġmobil isation
 Ġaccred ited
-Ġnour ishment
-Ġnobel replace
-Ġabl ating
-Ġabus ers
-Ġunil aterally
-Ġunpro voked
-Ġintoler ance
-Ġkm no
-Ġkir celli
-Ġwein berg
-Ġenqu ired
-Ġsucc ession
-Ġark hangelsk
-Ġpharyng itis
-Ġcrypt ococcal
-Ġundec ided
-Ġspar ser
-Ġjiang su
-Ġcaret akers
-Ġmicropartic les
-Ġgrace y
-Ġserb ian
-Ġmonochrom atic
-Ġdraf ted
-Ġexplo ited
-Ġsmr rs
-Ġpotenti ating
-Ġpuls atility
-Ġslur ry
-Ġhypot ension
-Ġepoch s
-Ġredirec ting
-Ġcontrac ep
-Ġcrossl ink
-Ġrefus al
-Ġpolyg ons
-Ġpolycr ystalline
-Ġhabib zadeh
-Ġimmunocyt ochemistry
-Ġsynth ase
-Ġprecurs or
-Ġdelt oid
-Ġpursu ing
-Ġlipopolys accharides
-Ġwafer less
-Ġcollaps ibility
-Ġpenins ula
-Ġqi aprep
-Ġveter ans
-Ġportr ay
-Ġ196 4
-Ġentrap ment
-Ġcomprehens iveness
-Ġetiopath ogenesis
-Ġgaug es
-Ġlymphad enopathy
-Ġincompet ent
-Ġpolicym akers
-Ġreinser ted
-Ġbenj amini
-Ġpermut ational
-Ġquadr atic
-Ġsubstruct ures
-Ġterat ogenic
-Ġinga alp
-Ġscrut inized
-Ġscrip ts
-Ġmorbid ities
-Ġglucocortic oids
-Ġunpolymer ised
-Ġmotorcy cle
-Ġneuropsych iatric
-Ġtann erella
-Ġtunis ian
-Ġlaun ched
-Ġdeduc ed
-Ġintersti tial
-Ġmegapascal s
-Ġcertific ate
-Ġhaemost ats
-Ġperpet uate
-Ġbifurc ates
-Ġcoversl ip
-Ġparasit ology
-Ġraja ee
-Ġrepercussion s
-Ġunavoid able
-Ġglomerul osclerosis
-Ġpathophysi ology
-Ġhepato cellular
-Ġsapi enza
-Ġunrestor able
-Ġevapor ator
-Ġdislod ge
-Ġphilosoph y
-Ġubiquit ous
-Ġsidew ays
-Ġgyna ecological
-Ġcardiomy opathy
-Ġelectrocardi ogram
-Ġexhaustive ly
-Ġtrophozo ites
-Ġpemph igoid
-Ġnocic eptive
-Ġgingivect omy
-Ġjurisd ictions
-012 6
-bes ides
-cons istent
-disc ussion
-new c
-pediatric ians
-san jan
-vol tage
-zah n
-Ġug anda
-Ġibr ahim
-Ġton etti
-Ġtig ecycline
-Ġtrom s
-Ġtung sten
-Ġtensor flow
-Ġaar hus
-Ġavers ive
-Ġaxi ostar
-Ġauro cc
-Ġaudi ence
-Ġtham aseb
-Ġthrus ting
-oniphil us
-Ġtheob romine
-Ġsang on
-Ġsorb itol
-Ġcation ic
-Ġcased esigner
-Ġcenes thopathy
-Ġpup il
-Ġpall iative
-Ġpenc il
-Ġpept oniphilus
-Ġwro ught
-Ġworm s
-Ġwag staff
-Ġinel igible
-Ġinven tions
-Ġanis otropic
-Ġanov as
-Ġanorec tic
-Ġfdl c
-Ġfern andez
-Ġfests itzender
-Ġdit ched
-Ġdun n
-Ġdir t
-Ġdign ity
-Ġders imonian
-Ġdull ed
-Ġdak j
-Ġdaps one
-Ġdodec yl
-Ġmant el
-Ġmies cher
-Ġmans oura
-Ġmamm alian
-Ġmieth ke
-Ġandro gens
+Ġverb ally
+Ġsymb ol
+Ġvirolog ical
+Ġteen agers
+Ġaminoglyc osides
+Ġstriat um
+Ġhalluc inations
+Ġinad vert
+Ġentrop y
+Ġundoub tedly
+d o
+n an
+o ters
+at ography
+Ġw ished
+Ġh st
+Ġn ma
+Ġl or
+im ents
+ra ding
+Ġv ss
+Ġch ord
+ib e
+Ġper imen
+pe zil
+ost osis
+Ġk erm
+Ġall iance
+Ġgen it
+Ġhy rax
+Ġup loaded
+Ġover lying
+Ġconf erences
+Ġfl ares
+ont o
+Ġret r
+Ġanalyz es
+Ġcap sa
+Ġq c
+Ġsa e
+Ġgly ceral
+Ġdone pezil
+Ġendoth elin
+Ġagg ress
+Ġfacilit ator
+onic a
+Ġantico agulated
+Ġhor n
+Ġdecis ive
+Ġbranch ed
+Ġsen iors
+Ġot olaryng
+Ġbronch odil
+Ġdn ase
+Ġtf c
+Ġlev othyroxine
+Ġhaemat oxylin
+Ġmast ectomy
+Ġdoub ling
+Ġsmear s
+Ġdeple ted
+Ġcry op
+Ġharb ored
+Ġscaff olds
+Ġinstall ation
+Ġcheckup s
+encl amide
+Ġjum ping
+Ġginsen oside
+Ġsty let
+Ġnonsurv iv
+Ġengraft ment
+Ġbort ezomib
+Ġdisequilib rium
+1 000
+j t
+m ma
+s m
+s al
+Ġa ve
+Ġc ues
+Ġp om
+Ġd ict
+Ġm um
+Ġb ent
+Ġh ms
+Ġl mic
+el a
+Ġr ia
+op rol
+ure n
+pl us
+pl ots
+Ġit b
+Ġk w
+Ġstat ut
+Ġant ire
+Ġpartic ulate
+val ence
+Ġgl ib
+ite k
+Ġmin nes
+our inary
+Ġret icular
+Ġimmun ophen
+Ġox acillin
+ne asy
+Ġprom oters
+Ġelev ate
+Ġcs p
+Ġperiodontal ly
+Ġemb ra
+Ġhr ql
+Ġmicroscop ically
+Ġprec ancerous
+lu ent
+Ġpi k
+Ġdepend ability
+Ġuc p
+Ġeg gs
+Ġdirection al
+Ġamb ig
+Ġdisp osal
+Ġhu h
+Ġom t
+Ġoct reotide
+Ġuk r
+Ġneph ritis
+Ġground s
+Ġamelior ation
+Ġeti ologic
+onas al
+Ġcasc ades
+Ġperiost eal
+Ġinstall ed
+Ġmyofibrob lasts
+Ġgit b
+Ġabsor pt
+olec ules
+Ġhter t
+Ġshed ding
+Ġglyceral dehyde
+Ġminnes ota
+4 1
+f as
+h en
+Ġc opt
+Ġp estic
+ion ate
+Ġd ang
+Ġn ipple
+Ġst i
+Ġg br
+el ong
+op rophyl
+ure ment
+st omy
+Ġsh v
+Ġinf ancy
+Ġph d
+Ġgen uine
+Ġro e
+Ġup lc
+ric etin
+ond ral
+Ġhist ograms
+Ġprob ands
+Ġspecific ations
+Ġexpl ant
+Ġmy osin
+Ġcomplic ating
+rain ing
+Ġdys s
+Ġprior itis
+Ġdirect ors
+Ġq or
+Ġq alys
+Ġlip olysis
+Ġmir r
+Ġdev ast
+ucle ar
+Ġta z
+Ġmt dna
+Ġsn b
+Ġprec luded
+��pt u
+Ġoh i
+Ġmis le
+Ġemph ys
+Ġmp c
+10 5
+Ġarr iving
+Ġnan od
+Ġdc f
+Ġlt b
+Ġjud gments
+Ġgradi ents
+opress in
+Ġnons urgical
+Ġlearn ers
+Ġstaphyl ococci
+Ġoccas ion
+Ġhh cy
+Ġanaer ob
+Ġconceal ed
+Ġimmunoglobulin s
+Ġdihyd roxy
+Ġerythemat ous
+Ġspher ical
+Ġneighbour hood
+Ġundersc ores
+Ġtoile t
+Ġdiaz epam
+Ġorthog onal
+Ġnullip arous
+Ġnecrot izing
+Ġknh anes
+Ġcytomegal ovirus
 Ġbure au
-Ġbug base
-Ġblu etooth
-Ġberg en
-Ġburo ta
-Ġbatter y
-Ġreap plied
-Ġreint ubation
-Ġreabs orption
-Ġreattach ment
-Ġtohok u
-Ġhare i
-Ġhither to
-Ġhang s
-Ġhidal go
-Ġeich ner
-Ġeug enol
-Ġeuthan ized
-Ġstair case
-Ġstagn ation
-Ġstoich iometric
-Ġlute us
-Ġlair d
-Ġnvid ia
-Ġnult y
-Ġnbr m
-Ġnord ic
-Ġnomen clature
-Ġnucl isens
-Ġgorm an
-Ġgnas hing
-Ġgera is
-Ġghan a
-Ġgerald o
-Ġgimene z
-Ġasyn chron
-Ġasmt l
-Ġconclus ively
-oduoden ectomy
-Ġonye aso
-Ġvoc ational
-Ġvasc ulature
-Ġalta ir
-Ġperinucle ar
-Ġperiles ional
-Ġriv as
-Ġraf sanjan
-Ġextir pation
-Ġresili ence
-Ġresettle ment
-trache al
-Ġimiqu imod
-Ġistit uto
-Ġistan bul
-Ġchemic o
-Ġchulalongk orn
-Ġdephosph ory
-Ġdequal inium
-Ġprecon dition
-Ġpretes ted
-Ġpreocc up
-Ġacanth osis
-Ġcompost ela
-Ġdisulf ide
-Ġsepha rose
-Ġshout ing
-Ġadvers ities
-Ġadela ide
-Ġclarith romycin
-Ġtwelf th
-Ġscrol ling
-Ġscall oped
-Ġsciss ors
-Ġscou trace
-Ġperiimpl antitis
-Ġcofact ors
-Ġindocy anine
-Ġparacase i
-Ġplough ing
-Ġplatin um
-Ġrostr al
-Ġroset te
-Ġregress ed
-Ġaccustom ed
-Ġpragm atic
-Ġaborig inal
-Ġsubnas ale
-Ġsubanal ysis
-Ġsublux ation
-Ġsubepid ermal
-Ġintercor relations
-Ġintertrabec ular
-Ġafterno on
-Ġquart z
-Ġunins ured
-Ġunwor n
-Ġunpre cedented
-Ġunplan ned
-Ġunstand ardized
-Ġuninter rupted
-Ġunqual ified
-Ġunattach ed
-Ġamput ation
+Ġgenit ourinary
+d ai
+f o
+i q
+l os
+t rial
+u vastatin
+Ġs ellar
+en zyme
+Ġw f
+Ġb an
+Ġb am
+Ġb dm
+Ġb ispectral
+Ġre absorption
+Ġh un
+Ġh ds
+Ġl ands
+et a
+Ġg ms
+Ġg ga
+el ian
+Ġv af
+Ġv ldl
+Ġex ome
+ot opic
+Ġr ul
+Ġde cel
+Ġinc ap
+ib a
+Ġle ver
+Ġass er
+Ġwe ib
+Ġbet amethasone
+Ġme pivacaine
+Ġgen otoxic
+ract or
+Ġar ith
+Ġte c
+ang u
+Ġwor ding
+Ġcomm ens
+Ġdist ancing
+Ġcharacter izing
+Ġdr d
+Ġdisc iplinary
+Ġinvestig ational
+Ġaut ograft
+Ġcs cs
+Ġunderstand able
+Ġbar th
+Ġhead ings
+Ġpolym ers
+Ġconvent ionally
+Ġplot ting
+Ġgastro stomy
+Ġprec lude
+Ġspl ine
+Ġorigin ates
+Ġden ied
+Ġalign s
+Ġsha res
+Ġros uvastatin
+Ġinstitutional ized
+Ġdc b
+Ġsph enoid
+Ġmor ris
+oe lectric
+organ ization
+Ġcart rid
+Ġanalog s
+Ġcarcin ogenic
+Ġaty pia
+onom ics
+Ġaber ration
+Ġtax onomic
+Ġmu ac
+Ġafford ability
+Ġduplic ated
+Ġtraine e
+Ġprolactin oma
+Ġwb v
+Ġguang zhou
+Ġimpre cision
+Ġhistomorph ometric
+Ġconjunct ival
+Ġprevail ing
+Ġhyperd ivergent
+Ġintrag astric
+Ġdnc b
+Ġdisplace ments
+Ġworkst ation
+6 1
+c ale
+j ug
+v aginal
+Ġt ed
+Ġc ing
+Ġc ve
+Ġb aff
+ro ad
+Ġn irs
+Ġg un
+ati l
+il in
+um en
+Ġch im
+ib ial
+Ġsh h
+per fusion
+Ġdi amin
+Ġk ps
+Ġk da
+ans etron
+Ġlow ers
+Ġy ao
+Ġbl ame
+Ġpo v
+Ġinv isal
+Ġj elly
+Ġtra ces
+Ġma o
+Ġdr b
+Ġcardi oresp
+Ġep oxy
+Ġstatus es
+oph ytic
+Ġbenef ici
+Ġextra c
+Ġu ae
+Ġconc luding
+Ġexperimental ly
+Ġbra ces
+ocy cline
+Ġla i
+Ġfeel s
+Ġsouth west
+Ġintr atum
+Ġclean liness
+Ġpay er
+Ġbreak through
+Ġbronch oscope
+Ġesophag ectomy
+Ġwil le
+Ġglomer ul
+Ġgranul omas
+Ġpremature ly
+Ġseas ons
+Ġultra filtration
+Ġtro uble
+rastruct ural
+Ġsynov itis
+Ġfen ofibrate
+Ġchel ating
+Ġdisinfect ants
+amil iar
+Ġphysiotherap ists
+Ġpremen opausal
+Ġmandib les
+Ġscot land
+elv ic
+stim ulation
+Ġnorthe ast
+Ġcounterst ained
+Ġextern ally
+Ġlarv ae
+Ġond ansetron
+Ġdepar affin
+Ġnanod rop
+Ġinvisal ign
+Ġcardioresp iratory
+e as
+l ide
+u ate
+w elling
+at urity
+Ġo asis
+Ġc ush
+Ġst ories
+Ġis ometric
+Ġcomp atibility
+ac yl
+Ġwe in
+Ġhe pes
+Ġanalys er
+Ġk f
+Ġrec anal
+Ġcr h
+Ġup g
+Ġsp ink
+Ġma u
+Ġsym path
+Ġimmun ologic
+Ġgast rop
+Ġec v
+Ġadjust able
+Ġregist r
+Ġcb hi
+Ġshock s
+als is
+Ġphot ographic
+Ġnh i
+Ġmill ing
+gl ut
+Ġmelan ogenesis
+Ġcorrection s
+Ġcontract ed
+Ġva ult
+Ġgd ps
+Ġelement al
+Ġperm iss
+Ġsimpl ify
+Ġbolus es
+Ġstere omic
+Ġarteri ovenous
+Ġpakistan i
+Ġmad rs
+Ġcoinc ident
+Ġextrapol ation
+Ġincorrect ly
+Ġintrath oracic
+Ġky ph
+Ġcinnam aldehyde
+ophyl line
+Ġstation ary
+Ġadvent it
+Ġdesm opressin
+Ġdeser ves
+Ġsubch ondral
+icl ovir
+Ġsich uan
+Ġlimon ene
+Ġcytoker atin
 Ġammon ium
-Ġkyush u
-Ġklebs iella
-Ġkaygis iz
-Ġweerhe ijm
-Ġfollic le
-Ġgenban k
-Ġmediter ranean
-Ġphobi as
-Ġphocae icola
-Ġoverhe ating
-Ġmolybden um
-Ġcolumb ia
-Ġtimeatr isk
-Ġdeciph er
-Ġdecortic ation
-Ġcribr iform
-Ġsecoster oid
-Ġagencour t
-Ġundeni ably
-Ġnumberof newc
-Ġmanches ter
-Ġmanpow er
-Ġnonadj acent
-Ġnoninstitution alized
-Ġnoninstru mented
-Ġspastic ity
-Ġedemat ous
-Ġmicrofr actures
-Ġmicroelect rode
-Ġmicrovess el
-Ġminnes ota
-Ġmalasse zia
-Ġdiacet ate
-Ġgriff ith
-Ġsalicyl ate
-Ġunderne ath
-Ġunderachie ving
-Ġimprac tical
-Ġpostbiotic s
-Ġmonob ond
-Ġmonof ilament
-Ġintrins ically
-Ġintraper itone
-Ġzuan ba
-Ġworris ome
-Ġmouthrins es
-Ġantide pressants
-Ġantiret roviral
-Ġpeopl es
-Ġdaej eon
-Ġslimm er
-Ġangelier i
-Ġfekon ja
-Ġmatrig el
-Ġepiinf o
-Ġcapnocyt ophaga
-Ġprovinc ial
-Ġhumming bird
-Ġurokin ase
-Ġautoflu orescent
-Ġlightwal ker
-Ġsuperoin ferior
-Ġimmunomod ulatory
-Ġpermangan ate
-Ġmengh ini
-Ġeffavi renz
-Ġsynops is
-Ġexpatri ates
-Ġstigm atis
-Ġairtig ht
-Ġairscal er
-Ġfibromy algia
-Ġabohab ib
-Ġproteoglyc ans
-Ġhypothyroid ism
-Ġhyperprolif eration
-Ġhypertriglycer idemia
-Ġbiomonit oring
-Ġvironos tika
-Ġpsychophys iological
-Ġcementobl asts
-Ġphotoin itiators
-Ġacroderm atitis
-Ġcodiagnos tix
-Ġzirkon zahn
-Ġseeberg er
-Ġgeometr ies
-Ġqiac ube
-Ġmarria ges
-Ġcopenh agen
-Ġnanomater ials
-Ġmisrec orded
-Ġsahar an
-Ġcarboxymethyl cellulose
-Ġeuroba rometer
-Ġmicafung in
-Ġglyca emic
-Ġbioeth ics
-Ġbioavail ability
-Ġcshc n
-Ġaggrec ans
-Ġcrystallin ity
-Ġmadagasc ar
-Ġdgzm k
-Ġelectroma gnetic
-Ġsoutheas tern
-Ġpermselec tivity
-Ġunsurpr ising
-Ġmombell i
-Ġoutstand ing
-Ġbiconca ve
-Ġmelanoac anthoma
-Ġbandwid th
-Ġhujo el
-Ġneurotrans m
-Ġextracorpore al
-Ġhypotrich osis
-Ġmesseng er
-20358 0
-Ġsubdiagnos es
-Ġenteropathic a
-Ġfuzz y
-Ġoverdispers ion
-Ġkaryorrh ectic
-Ġdiclof enac
-Ġovsen ik
-Ġnoncoll agenous
-Ġnoncommun icable
-Ġpsychiatr ist
-Ġcocamidoprop yl
-Ġkarlskron a
-Ġmichelinak is
-Ġectodysplas in
-Ġdisgusting ness
-Ġbenzalkon ium
-Ġmucoepid ermoid
-Ġperfluorooc t
-Ġwonkw ang
-Ġmylohy oid
-Ġaspergill us
-Ġzahngetr agener
-Ġkeratocys ts
-Ġinadvert ently
-Ġhausdor ff
-Ġasynchron ism
-" ;
-" ?
-, ,
-, ;
-0 15
-0 11
-0 14
-0 80
-0 25
-0 86
-0 99
-1 7
-1 89
-1 47
-2 16
-2 15
-2 13
-2 12
-2 18
-2 14
-2 90
-2 100
-2 85
-3 75
-3 60
-3 45
-3 500
-3 40
-3 42
-4 3
-4 8
-4 9
-4 18
-4 38
-4 32
-4 40
-4 24
+Ġcapsa icin
+n amic
+r v
+r ct
+Ġ ids
+Ġc ach
+Ġw age
+Ġd ess
+Ġd ad
+an ib
+Ġh ur
+Ġn sw
+ur i
+un ate
+Ġr x
+um n
+ad an
+ac ity
+Ġcont iguous
+Ġmet ane
+Ġpl b
+Ġinter change
+Ġph l
+Ġph al
+Ġno ac
+Ġresp imat
+Ġbl ed
+Ġj ar
+Ġadm it
+Ġprog est
+Ġmin ocycline
+Ġatt r
+Ġps g
+Ġspecific ation
+Ġintra bony
+Ġlif elong
+Ġca rot
+Ġent it
+Ġhf ov
+Ġpow ders
+Ġcs r
+Ġhyd r
+Ġtn i
+Ġback bone
+Ġtop ically
+Ġgu an
+Ġfill ers
+Ġmorbid ly
+Ġblind ness
+Ġss ri
+Ġstimul ant
+Ġft ir
+Ġliqu ids
+Ġinterf eres
+Ġcortic osterone
+ronch ial
+Ġelast ase
+Ġquar antine
+Ġhcm v
+Ġunre cogn
+Ġfasc ial
+Ġsort ing
+Ġthal amus
+Ġphyl um
+Ġunders core
+Ġdisab ling
+Ġrepetition s
+Ġbub ble
+Ġtelom ere
+Ġtachy arrhythm
+Ġsubf raction
+Ġconting ency
+Ġpurpos ive
+Ġbiph asic
+Ġenrolle es
+Ġmosa ic
+g rast
+i est
+j o
+n oon
+r ater
+t etrazolium
+Ġs que
+Ġp gs
+ic us
+Ġd rew
+ar ried
+Ġn ud
+ith ic
+Ġg ee
+il umab
+ch es
+Ġpro cl
+od ine
+Ġind welling
+Ġinf ert
+Ġk an
+Ġall icin
+Ġmeth ionine
+Ġra b
+cent ral
+Ġbas ilar
+Ġmean ings
+Ġpe cul
+Ġav f
+Ġca a
+Ġrest art
+Ġur ate
+ulin um
+Ġachie ves
+Ġposition al
+opt otic
+ras idone
+Ġgo iter
+Ġpd w
+Ġperson ally
+Ġmt c
+oh d
+Ġpancreatic ojejunostomy
+Ġrot avirus
+Ġkin emat
+Ġrepair s
+Ġvar ic
+Ġvert ucci
+Ġnc cls
+Ġpf e
+Ġhypog onad
+Ġinterf ered
+Ġencour ages
+Ġveh icles
+Ġpb m
+Ġunf amiliar
+Ġantagon istic
+Ġplasm inogen
+chol inesterase
+Ġinterm olar
+Ġindust ries
+Ġimbal ances
+Ġlith uan
+Ġprecip itated
+ophosph ate
+Ġfirm ly
+lit azone
+Ġalarm ing
+Ġspher icity
+Ġfibros can
+Ġreconstit uted
+Ġlubric ation
+Ġzip rasidone
+Ġisop rop
+Ġearth qu
+Ġobsc ure
+Ġdemineral ized
+Ġcorp uscular
+Ġdetox ification
+Ġoverse as
+Ġautoreg ulation
+Ġartefact s
+Ġconvuls ions
+Ġneuroblast oma
+Ġcalp ain
+Ġgink go
+Ġaggress iveness
+oprophyl axis
+Ġweib ull
+Ġinfert ile
+Ġpecul iar
+Ġkinemat ics
 5 2
-5 000
-5 50
-5 74
-5 79
-5 99
-6 2
-6 50
-6 23
-6 20
-6 14
-6 19
-6 60
-6 80
-6 25
-6 30
-7 70
-7 23
-7 80
-7 26
-7 600
-8 16
-8 10
-8 12
-8 70
-8 81
-8 76
-8 27
-8 42
-8 72
-9 00
-9 60
-9 46
-9 31
-9 71
-9 48
-? ",
-a er
-a at
-a im
-a ud
-a un
-a am
-a uc
-a ip
-a vid
-a ery
-a ural
-a verage
-a ise
-a ires
-a ros
-a uter
-a he
-a era
-a udal
-a pless
-a rophobia
-b c
+Ġs est
+Ġs gc
+Ġc ed
+Ġan s
+Ġm st
+Ġto d
+Ġst ab
+os ap
+st on
+Ġsh oes
+Ġac f
+Ġinter rater
+Ġun ic
+Ġam r
+Ġassoci ates
+Ġph renic
+Ġag itated
+Ġinv aded
+Ġdef ensive
+our acil
+Ġmem m
+omet rics
+Ġq w
+Ġequ als
+Ġhb c
+Ġorth o
+Ġcv mi
+Ġmit igation
+Ġdevi ated
+Ġce ased
+Ġarth ral
+Ġpolymorph ic
+Ġpm d
+Ġmis con
+Ġhard y
+Ġflex or
+Ġcollect ors
+Ġoptim ism
+Ġfund s
+Ġnt m
+ias m
+Ġtea es
+Ġmotiv ations
+Ġantipl asm
+Ġtric l
+Ġtight ness
+Ġcred ible
+Ġlute al
+Ġsav r
+Ġguarant eed
+Ġantithromb in
+Ġmonol ithic
+Ġunm arried
+Ġopac ity
+Ġassemb led
+Ġportug al
+Ġindones ian
+amph etamine
+Ġmonolay ers
+Ġclon idine
+Ġverb atim
+Ġvoid ing
+Ġmicrof lora
+Ġcamer as
+reon ine
+Ġtroubles ome
+Ġchick en
+Ġmainst ay
+nour ished
+Ġstatut ory
+9 80
+k at
+n b
+o vi
+w estern
+Ġa ag
+Ġth reonine
+er cept
+Ġw aking
+Ġb ss
+Ġst ack
+Ġl cs
+Ġcon cre
+Ġse eding
+Ġass ured
+Ġind olent
+Ġcl ots
+Ġdi urnal
+Ġafter noon
+Ġam a
+Ġag enda
+Ġser opre
+Ġman ia
+Ġmult itude
+anc iclovir
+Ġcomplic ate
+Ġbm c
+Ġoste olysis
+Ġoste onecrosis
+ca ve
+Ġmut ants
+amin a
+eg u
+Ġmetast as
+12 0
+Ġhaem od
+Ġeg j
+Ġna oh
+Ġsubm erg
+Ġrevers ing
+ran ulin
+Ġartific ially
+Ġpolyp oid
+Ġnons m
+Ġff p
+Ġdermat ological
+Ġdisap point
+Ġsick le
+Ġration ing
+Ġanter o
+Ġecl ampsia
+Ġpriorit ized
+Ġpalm ar
+vit amin
+Ġprev otella
+Ġsubtract ed
+Ġincent ive
+omed ial
+Ġadvis able
+Ġcephalospor in
+Ġimpre gn
+Ġnss i
+phen oidal
+align ment
+Ġradiop aque
+Ġfibril s
+Ġtelev ision
+Ġninet een
+Ġglib enclamide
+grast im
+9 7
+g m
+n ex
+re ction
+Ġs id
+it z
+Ġd v
+Ġm ong
+el le
+ut amide
+Ġv ad
+Ġv oids
+Ġpro ct
+Ġres ort
+Ġat ria
+Ġen z
+Ġ1 20
+ang es
+Ġchar ged
+Ġty r
+ob actam
+Ġcardi oplegia
+Ġresearch ed
+hip s
+Ġmy algia
+oph arm
+Ġlip ophilic
+Ġpul mon
+Ġsal ts
+Ġchem erin
+Ġquant ile
+Ġlymph edema
+Ġutil izes
+Ġhc d
+Ġinser ts
+Ġcb a
+Ġnas ion
+Ġminor ities
+Ġmp m
+Ġdp c
+Ġsexual ity
+Ġsf i
+Ġemphas ised
+Ġtext book
+Ġbd d
+Ġsv m
+Ġbreak points
+Ġprote asome
+bi ased
+Ġacceler ates
+Ġchromos omes
+Ġug t
+Ġintent ional
+Ġconnect ivity
+Ġhierarch y
+Ġnotice ably
+Ġmiscar riages
+Ġkel oids
+Ġparasit emia
+Ġseb aceous
+Ġmos apride
+Ġpopl iteal
+Ġdefibrill ator
+Ġdelt oid
+Ġpatell ofemoral
+oprol ol
+9 3
+h u
+w ave
+in ates
+Ġth as
+Ġs aff
+Ġp essary
+Ġd j
+Ġd cr
+Ġd ma
+Ġand rogens
+Ġb at
+Ġb sc
+Ġe is
+Ġn yst
+Ġg pr
+Ġfor um
+il ia
+Ġr ug
+Ġr rs
+um a
+Ġde oxy
+igh ter
+Ġsign et
+Ġpres pecified
+ap illary
+Ġclinical trial
+Ġag i
+Ġover f
+Ġmon op
+Ġest rogens
+Ġpe el
+Ġgra v
+Ġexc itability
+Ġcd kn
+Ġent ers
+ise q
+Ġut most
+Ġoste otomies
+Ġvas ore
+Ġcentral ized
+Ġplan us
+Ġprep onder
+Ġimpair ing
+Ġglob e
+rad ed
+Ġintr usive
+Ġhu ang
+Ġgall ate
+nat ally
+Ġeryth roid
+iop ancre
+oz oa
+Ġhd a
+Ġdeb il
+Ġuns aturated
+Ġmh c
+cess ing
+Ġcontain ers
+Ġsap i
+67 7
+Ġinequ ities
+Ġmer ck
+Ġcollabor ate
+Ġbf p
+Ġdysp noea
+29 3
+Ġarb itr
+Ġexhaus tive
+Ġconv ol
+Ġsuction ing
+Ġrip c
+Ġole ic
+Ġdeline ate
+Ġsand blast
+Ġoroph arynx
+Ġpj p
+Ġocclud er
+Ġvene ers
+Ġasymmet rical
+Ġtaper ing
+Ġantis ense
+Ġphysiotherap ist
+Ġdum my
+Ġtranss phenoidal
+Ġlands cape
+Ġbarth el
+4 60
+c ons
+f all
+g rip
+k as
+r ons
+Ġp is
+Ġb tc
+Ġe bs
+Ġn oc
+ut a
+Ġv icious
+Ġr ux
+Ġad ropin
+Ġpre oxygenation
+Ġper k
+Ġsu i
+Ġgro in
+Ġle ban
+Ġdis regard
+Ġco ad
+Ġcont ours
+art um
+Ġcan cel
+Ġmet ac
+ach ian
+Ġag vhd
+Ġmeth amphetamine
+Ġman i
+Ġprov ing
+ox acillin
+av a
+ian a
+Ġz no
+Ġmal ada
+orb ital
+Ġct ace
+Ġdirect or
+Ġq ing
+Ġsl s
+Ġdeg ran
+Ġx dr
+Ġpercept ual
+Ġtg s
+Ġpt cs
+Ġpm ma
+Ġexpect ant
+Ġcum s
+Ġ12 5
+Ġpurpose ful
+Ġcc u
+Ġvert igo
+Ġtp b
+Ġencour agement
+Ġoverc oming
+Ġnano em
+Ġaeros ols
+Ġfruct us
+Ġdihyd ro
+Ġbootstrap ping
+Ġunint entional
+Ġtent ative
+Ġko os
+Ġmul berry
+Ġankyl osis
+Ġpso as
+Ġoscill ometric
+Ġcongru ent
+Ġdiverg ence
+Ġperist alsis
+Ġhosp ice
+Ġhamp ered
+Ġuroth elial
+Ġalend ronate
+Ġseropre valence
+Ġleban on
+l ists
+s ct
+y na
+Ġa le
+Ġo y
+er ations
+Ġan p
+Ġm ce
+Ġb te
+Ġh ilar
+Ġe w
+Ġn act
+Ġst ance
+im aging
+Ġg one
+res veratrol
+Ġv mp
+od ipine
+Ġhe ar
+Ġinf erences
+Ġab road
+Ġk iss
+Ġun respons
+Ġun biased
+Ġmed ially
+Ġacc ent
+Ġstat ure
+Ġar med
+ub o
+Ġpo i
+Ġcr ash
+Ġra o
+yl ase
+Ġyo urs
+ec s
+Ġcyt ogen
+ten one
+Ġpsych omotor
+Ġstruct urally
+Ġsuccess ively
+Ġpur ine
+Ġhf e
+Ġms p
+Ġrepe ating
+az ep
+Ġla id
+Ġmd ct
+Ġster ols
+12 99
+gg c
+Ġmyel odys
+Ġconserv ation
+Ġuncertain ties
+Ġfas ci
+Ġpathophys iologic
+Ġcustom ers
+Ġpalp itations
+Ġsynchron ized
+Ġstere otypes
+Ġglucos amine
+Ġcaud ate
+Ġreass uring
+Ġtris omy
+Ġez h
+lipid emic
+Ġtons il
+Ġconvey ance
+Ġspondyl itis
+Ġlbb b
+Ġrw anda
+Ġhypop ituitarism
+Ġeag le
+Ġcour age
+Ġexagger ated
+Ġreprod uced
+Ġcele coxib
+Ġalber ta
+Ġadenomy osis
+Ġnonsurviv ors
+Ġabsorpt iometry
+l ock
+t led
+y p
+Ġs ns
+al is
+es m
+Ġf ss
+Ġd tc
+is er
+Ġb old
+as ure
+ct um
+le ep
+ul se
+Ġn w
+em poral
+Ġis c
+Ġpre formed
+Ġco ast
+Ġro tenone
+ym ic
+yst ole
+Ġprov oke
+Ġcal g
+Ġfl oating
+Ġet om
+Ġany one
+Ġz ol
+Ġz ambia
+Ġpoly un
+Ġgluc oside
+Ġsit agliptin
+Ġmac int
+Ġnecess itates
+Ġx p
+Ġprec ordial
+itt ance
+Ġge or
+Ġorigin ator
+Ġhard er
+Ġfil ial
+Ġcomput ation
+Ġcollect s
+Ġcf r
+Ġintegr ons
+emb olization
+ophil us
+Ġba h
+Ġhistopathological ly
+Ġimmunosupp ressed
+Ġdissol ving
+Ġket one
+Ġembol i
+Ġtha wed
+Ġspir it
+Ġdup ilumab
+Ġrib s
+Ġpolar ized
+Ġcrani ectomy
+Ġfn ab
+Ġconform ity
+Ġvasodil atation
+Ġencompass ed
+Ġlic orice
+Ġsphincter otomy
+Ġtriang ular
+Ġaccompl ish
+Ġincon ven
+Ġpup ils
+Ġtrem end
+Ġhyster oscopy
+Ġpell icle
+bear ing
+Ġlingu istic
+Ġwrith ing
+Ġantiepile ptic
+Ġhyperco agul
+3 20
+f ield
+r if
+Ġt pe
+Ġt af
+Ġth iaz
+Ġs yl
+Ġp ib
+Ġp isa
+es h
+ic ating
+Ġd un
+Ġm oves
+Ġh irs
+Ġto cop
+Ġst ump
+om iasis
+Ġl ux
+Ġl ytic
+Ġcon go
+Ġis otype
+Ġis lands
+Ġsh en
+Ġsh ig
+Ġcl im
+ph ig
+Ġab b
+Ġun id
+Ġgen otoxicity
+Ġinv is
+Ġser ov
+str ual
+Ġnon alcoholic
+Ġdist ention
+Ġpost al
+val ent
+Ġso il
+Ġtra y
+Ġconf ront
+Ġ0 9
+Ġel n
+Ġav en
+Ġct l
+Ġq r
+atin i
+Ġbu f
+Ġhydro alcoholic
+Ġoxygen ated
+Ġess ence
+Ġgr ant
+Ġpharmac odynamics
+Ġlact ose
+Ġpass ages
+Ġpm v
+Ġcentr ality
+Ġmis interpre
+Ġseem ingly
+Ġure ase
+Ġaust rian
+ope pt
+Ġcruc iate
+Ġaccompan y
+Ġns d
+Ġoverc row
+Ġinner vation
+Ġmyc obacterial
+Ġbt p
+Ġpic ryl
+Ġcytos keleton
+Ġarteri oles
+Ġperfect ly
+Ġimper f
+Ġbeg un
+Ġresum ption
+Ġsyna pt
+Ġhgf s
+Ġtempl ating
+Ġelab orate
+Ġmutagen ic
+arrhythm ic
+Ġcertific ates
+Ġkcn q
+Ġlogist ics
+Ġfert ilization
+Ġbiomater ials
+Ġpem phig
+Ġmediastin um
+Ġhyperandrogen ism
+Ġnq o
+Ġprocr ast
+Ġdevast ating
+Ġhydr onephrosis
+Ġmani kin
+Ġetom idate
+Ġpolyun saturated
+Ġtocop her
 b h
-b n
-b in
-b on
-b as
-b ro
-b om
-b ut
-b ies
-b able
-b ach
-b all
-b ss
-b ox
-b ne
-b ang
-b ody
-b bl
-b mi
-b ella
-b umin
-b enz
-b idden
-b iguous
-b agy
-c d
-c k
-c n
-c v
-c z
-c is
-c ar
-c ur
-c ad
-c ut
-c ub
-c end
-c ally
-c ay
-c all
-c ct
-c iss
-c onstr
-c anti
-c ogn
-c ken
-c restal
-c ica
-c oses
-c ostal
-c idyl
-c ommun
-c ollective
-c agct
-d f
-d w
-d y
-d z
-d ac
-d et
-d ated
-d ia
+f d
+j an
+m etic
+n m
+r ha
+t ra
+Ġt ct
+Ġt xa
+Ġs ending
+Ġp ips
+Ġd qi
+Ġb out
+Ġh re
+Ġh ilum
+Ġe k
+Ġe ust
+Ġst ore
+id o
+ol itinib
+Ġr ps
+iv ility
+am pati
+ir ater
+Ġinc ivility
+iz able
+Ġsu it
+Ġsu ite
+Ġab irater
+ater ol
+Ġtrans plants
+Ġstr y
+Ġem odin
+Ġsm t
+Ġref resh
+Ġed m
+Ġphys ic
+Ġet ched
+Ġhyp osal
+Ġep iph
+Ġret ina
+Ġmal od
+Ġca pe
+oint ense
+Ġvit a
+Ġexer ting
+Ġcv vhd
+Ġbu y
+Ġintern ally
+Ġinfilt rative
+Ġgerm line
+Ġmel phal
+Ġlate x
+Ġleuk ocytosis
+Ġfr anc
+Ġros ig
+Ġrepro duce
+Ġneur ite
+Ġvag us
+Ġcolum bia
+Ġabst raction
+Ġevol ve
+Ġrheumat ism
+Ġmicroc aps
+Ġexercis ed
+Ġanch ors
+Ġexplor ative
+Ġff q
+Ġwean ed
+Ġdepos it
+Ġstock holm
+Ġcpp opt
+Ġoverd ent
+Ġtd is
+Ġbav m
+Ġlved v
+Ġobl igation
+Ġamplic ons
+Ġpanc yt
+Ġoxy resveratrol
+Ġmultiplic ity
+oce le
+Ġlogist ical
+Ġpleiotrop y
+Ġproduc ers
+Ġdenom inator
+Ġexcurs ion
+ofer rin
+Ġcryop res
+Ġdiamin obenz
+Ġmacint osh
+Ġabirater one
+Ġhyposal ivation
+Ġmelphal an
+a per
+g lycer
+p o
+Ġan agen
+Ġf st
+Ġre ven
+Ġn par
+Ġg ct
+Ġwas ting
+Ġv ha
+Ġv ats
+Ġis oqu
+oc ortical
+Ġde acet
+ap amil
+Ġsp ats
+Ġend op
+Ġprov es
+Ġref ine
+Ġform ulate
+Ġanti res
+Ġz i
+Ġweek ends
+Ġrepresent ations
+Ġbene ath
+Ġbr ands
+arch e
+Ġresid ed
+Ġver apamil
+Ġoxid ants
+Ġreact ed
+Ġneuro path
+Ġpp g
+Ġhr ct
+rot ection
+Ġhom o
+Ġfluor ouracil
+Ġfav ors
+Ġwash es
+Ġgerm inal
+Ġleuk openia
+Ġdp i
+Ġphosphory l
+Ġci ocal
+Ġdiscontinu ing
+Ġsy d
+Ġmb t
+Ġdistinct ly
+atch ed
+Ġnight time
+Ġdeterior ate
+Ġket ocon
+Ġdownreg ulating
+Ġdb d
+Ġamelior ating
+Ġgeograph ically
+Ġvill age
+Ġureter ic
+Ġeeg s
+Ġxyl azine
+Ġirrit ability
+Ġpush ed
+Ġinduc er
+Ġvortex ed
+Ġharmon ization
+Ġdefib rillation
+Ġtym panic
+Ġdisinfect ant
+Ġreconstit ution
+Ġinterven e
+Ġmacrol ide
+Ġdile mma
+Ġrefrig er
+Ġmall ampati
+Ġnmd ar
+asc ial
+Ġej ac
+Ġqat ar
+Ġarith metic
+Ġconcre te
+Ġclinicaltrial s
+Ġrux olitinib
+Ġyours elf
+Ġeust achian
+Ġrosig litazone
+4 80
+8 00
 d ong
-d ans
-d les
-d na
-d omen
-d ri
-d ma
-d uring
-d ynamic
-d ened
-d ler
-d irect
-d ca
-d isciplinary
-d irec
-d eep
-d isability
-d imethyl
-e a
-e an
-e ological
-e br
-e vic
-e ier
-e faction
-e ye
-e bi
-e tium
-e ij
-e zi
-e vo
-e elis
-e bert
-e bacterium
-f c
-f h
-f el
-f ir
-f ical
-f ap
-f em
-f ia
-f ine
-f ari
-f ting
-f all
-f ile
-f lu
-f ak
-f its
-f idence
-f av
-f ins
-f ism
-f itt
-f asc
-f cs
-f ighting
-f ilt
-f ident
-f requ
-f inally
-f orest
-f lective
-f omycin
-f luoride
+in us
+Ġs orb
+Ġo ps
+Ġp ia
+Ġw es
+Ġw ol
+Ġin ert
+Ġd ol
+Ġb gl
+Ġh ed
+Ġg if
+Ġbe v
+ot ation
+ot ility
+iv itis
+em en
+oc utaneous
+Ġim id
+Ġpre max
+Ġco bal
+Ġbet ulinic
+Ġme ga
+ph ae
+ari ous
+Ġun balanced
+Ġpart ies
+Ġph thal
+Ġfol k
+Ġcor rid
+ric ted
+Ġmeth acrylate
+ber t
+Ġ2 50
+Ġexam ines
+Ġred istribution
+Ġprotein ase
+Ġinit iators
+oph yt
+Ġca ve
+Ġaut umn
+Ġcs i
+Ġproduct ive
+Ġla e
+Ġgu ilt
+Ġmes al
+Ġster ilization
+Ġhom ologous
+Ġnut r
+Ġnut s
+Ġarth roscopy
+Ġcheck lists
+Ġstent ed
+Ġphot otherapy
+Ġfil iform
+Ġpack ing
+Ġdisturb ing
+oz apine
+Ġpseud ocyst
+Ġinhal er
+Ġresc ued
+Ġmf c
+Ġdichotom ised
+Ġgad d
+Ġuro genital
+Ġthi ol
+Ġlved d
+Ġmicrog raphs
+Ġinqu iry
+Ġfluoroquinol one
+Ġbisphosph onate
+Ġkil ograms
+Ġstrugg le
+400 2
+Ġdemarc ated
+prop ylene
+Ġdestroy ed
+Ġschwann oma
+Ġtrabec ulae
+Ġbyh wd
+Ġwart s
+Ġsubmerg ed
+Ġarbitr arily
+Ġmalada ptive
+Ġketocon azole
+a ro
+er ts
+ed ents
+Ġf ep
+ent ery
+Ġh nc
+Ġl ots
+Ġg af
+Ġg rief
+Ġg bg
+ig mentation
+ol on
+ol us
+un tain
+od amine
+od aterol
+Ġal umina
+Ġus d
+Ġper c
+Ġgro oves
+ast ically
+Ġinter vertebral
+Ġcor poration
+Ġsm m
+Ġol odaterol
+Ġav oids
+Ġret rom
+ung in
+Ġca i
+Ġhel pless
+co al
+Ġstrength ens
+Ġak in
+Ġemploy ers
+Ġgu ard
+Ġlay ered
+Ġlact oferrin
+Ġnorm og
+Ġfav oured
+Ġpen is
+Ġturn s
+Ġflex ure
+Ġleg end
+Ġtom ographic
+Ġinadequ ately
+Ġhl hs
+13 1
+Ġdia per
+Ġdors um
+Ġelast ance
+Ġld ac
+Ġpip et
+Ġpic o
+29 4002
+Ġtk as
+Ġhypn otics
+rep itant
+Ġinsert ions
+Ġtrich lor
+Ġpiper ine
+Ġadvert is
+Ġnonf atal
+Ġseropos itivity
+Ġoesophag us
+Ġail ments
+fur ther
+Ġtaz obactam
+Ġgastrop aresis
+Ġisoqu erc
+Ġciocal te
+l ers
+o ad
+w er
+z ed
+Ġt roc
+at uring
+en n
+Ġp ag
+al asia
+al izumab
+Ġin k
+Ġf gs
+Ġd sc
+Ġh co
+Ġe pl
+Ġn cep
+Ġst ably
+ly sin
+Ġg amb
+ig est
+Ġas ks
+Ġcon ut
+ch c
+od opa
+ine al
+Ġac ycl
+Ġk v
+ug r
+Ġsub epithelial
+oth oracic
+Ġqu ies
+Ġen force
+Ġser ver
+Ġchar coal
+Ġsm ith
+Ġcar lo
+Ġpar is
+Ġhyper icum
+ores ist
+Ġprof il
+Ġbody weight
+Ġmark ets
+Ġprom inence
+Ġorgan izing
+Ġent hes
+Ġur tic
+Ġprop ri
+Ġcolon oscopic
+Ġorder ing
+Ġtub ule
+Ġmac ron
+Ġmac roscopically
+az epam
+he im
+Ġlight ing
+Ġnit rous
+Ġprem ise
+ars al
+Ġsd ldl
+Ġfr c
+aster ide
+Ġhemorrh ages
+Ġpulp otomy
+Ġslow ing
+Ġcapt ures
+Ġbmd cs
+Ġdecomp ressive
+Ġadrenal ine
+Ġquad r
+Ġcup ping
+Ġresil ient
+Ġaz ac
+Ġham per
+Ġbic uspid
+Ġtoothbrush es
+Ġtun ica
+Ġobstetric ians
+oac etic
+Ġql f
+Ġmerg ing
+vac rol
+Ġiq r
+Ġbcc ao
+Ġsad ness
+Ġimmunosuppress ant
+Ġoz one
+Ġfried man
+Ġobliter ation
+Ġpray er
+Ġmultist age
+Ġpsychoeduc ation
+Ġmasc ulin
+Ġbacteroid etes
+Ġsyd ney
+b ach
+c omp
+j ud
+k d
+u ximab
+w or
+y in
+Ġs ult
+Ġs ister
+ed onia
+al one
+es thesia
+Ġf gd
+Ġh iat
+Ġe af
+Ġn sc
+Ġl ing
+Ġl ts
+ch oic
+Ġex empt
+Ġr rm
+ys m
+Ġcomp elling
+Ġper imeter
+st ick
+ac ag
+pl ates
+ph y
+Ġk ss
+Ġreg imes
+Ġcons ents
+Ġinv ag
+ici ans
+Ġref use
+Ġcar vacrol
+Ġav b
+ry pt
+Ġprot raction
+Ġox imeter
+Ġml h
+Ġsl opes
+Ġdiet it
+Ġos b
+Ġu ap
+Ġphosph olipid
+Ġbu ff
+Ġneuro genic
+Ġneuro imaging
+Ġeuro qol
+Ġnorm other
+Ġmc w
+Ġinsu fficiently
+Ġaff lic
+Ġht o
+Ġfer ulic
+Ġtherm ometer
+Ġker atitis
+Ġmyc obacteria
+Ġsubs pec
+Ġherb st
+Ġflat ten
+Ġgastroenter itis
+Ġdisagre ed
+Ġabbrevi ated
+Ġnad ir
+agl utide
+Ġwat ers
+Ġunderl ie
+luor ide
+Ġcritic ism
+Ġbub bles
+Ġdistort ed
+Ġdisproportion ately
+Ġhon est
+Ġoligonucle otide
+Ġnanofib ers
+Ġforg ot
+Ġantire tro
+Ġwein berg
+Ġcarot ene
+0 3
+m wd
+r k
+r atory
+Ġt ir
+Ġt ick
+er ating
+Ġc ary
+al utamide
+Ġan ca
+Ġf lud
+is ks
+Ġm ma
+Ġl pr
+Ġg k
+od ia
+Ġex o
+Ġr ci
+Ġad t
+Ġle ishman
+Ġcl ues
+ph ase
+Ġaf e
+Ġgen bank
+Ġcor il
+Ġinv ading
+Ġtrans cranial
+Ġtra pe
+ency cl
+Ġcar m
+Ġkn ot
+Ġi ugr
+Ġ0 6
+Ġav n
+Ġrep ress
+Ġmy ricetin
+Ġacid ity
+Ġir d
+Ġir i
+Ġpoly propylene
+xi ous
+Ġos aka
+Ġendoscop ies
+Ġbleeding s
+Ġair borne
+Ġhyd rate
+Ġbar c
+Ġbar icit
+Ġmit osis
+Ġms m
+Ġenc l
+Ġtend ons
+ocardi um
+Ġprem aturity
+oplas m
+Ġfil aments
+Ġnm es
+Ġvag ue
+to ok
+Ġnt is
+Ġchromat ograph
+Ġot itis
+Ġia i
+Ġelucid ation
+ira bility
+Ġgal n
+Ġpredisp osed
+Ġld a
+Ġlev odopa
+Ġanc illary
+Ġcate ch
+Ġhydroxy pro
+Ġintub ations
+Ġintub ating
+Ġgenoty ped
+Ġanesthet ist
+Ġreflection s
+Ġvasodil ator
+opoi etin
+Ġimmob il
+Ġstar vation
+Ġthread s
+Ġtors ional
+Ġque ens
+Ġlent ivir
+Ġelab orated
+Ġunwilling ness
+Ġrehyd ration
+Ġspreads heet
+Ġenthus iasm
+Ġilliter ate
+Ġdynam ometer
+atil ity
+Ġarthral gia
+Ġenz alutamide
+yna ptic
+Ġinvis ible
+Ġdiaminobenz idine
+Ġbaricit inib
+i ol
+u in
+Ġt iv
+on itis
+Ġs is
+Ġc rop
+Ġf od
+Ġb q
+Ġb urs
+Ġb fr
+ct ation
+Ġh osm
+Ġe pt
+Ġst orm
+Ġfor amina
+ch en
+Ġex clusions
+ot axis
+Ġcom et
+Ġpre ad
+Ġsc ott
+Ġk az
+Ġpl h
+Ġlevel ing
+Ġinter radicular
+Ġno xious
+Ġfin ancing
+Ġunder took
+Ġtrans vaginal
+Ġproc urement
+Ġpost ulate
+Ġstatist ician
+Ġintra group
+Ġmo untain
+Ġcoh erent
+Ġeth ic
+Ġradi os
+Ġtumor al
+Ġcap ping
+Ġlip ogenesis
+Ġbr imon
+ument ed
+Ġhyd rol
+Ġver te
+Ġtraum as
+Ġvascular ity
+Ġundergo es
+Ġutil ising
+Ġrele ases
+Ġla ac
+Ġster num
+opl anin
+Ġpv n
+Ġexcess ively
+Ġneurolog ist
+Ġmill imeter
+Ġnc ds
+Ġpf c
+Ġpolymer ized
+Ġupreg ulate
+Ġmv pa
+Ġsv v
+ocal yx
+Ġple asant
+Ġbox plot
+Ġnarrow ed
+Ġparas itic
+Ġgd t
+Ġsev o
+Ġdh f
+Ġtal in
+Ġirrig ants
+Ġmarket ed
+Ġhot air
+Ġambul ances
+Ġmicros at
+Ġdoub ts
+Ġdyspe ptic
+Ġdk k
+Ġinaccur acy
+Ġeconom ical
+Ġneurode velop
+Ġleuc ine
+Ġjo ined
+Ġthous ands
+sept al
+Ġinvari ance
+Ġhone ys
+Ġresorb able
+Ġfae ces
+Ġmetagen omic
+Ġmisle ading
+Ġrecanal ization
+Ġearthqu ake
+Ġantiplasm odial
+Ġimpregn ated
+Ġpreponder ance
+Ġcvvhd f
+Ġhosm er
+Ġbrimon idine
+l m
+Ġt ank
+in in
+in ia
+Ġa head
+re me
+er ule
+Ġc ft
+Ġp ps
+Ġm ond
+Ġn emat
+Ġl ars
+os per
+ig otes
+ra b
+Ġv br
+Ġv rs
+ch at
+igh th
+Ġad nex
+Ġper one
+Ġsh all
+Ġle ague
+Ġac n
+Ġint im
+Ġout growth
+Ġfin asteride
+Ġdes irability
+Ġover use
+ass ays
+vent ilation
+Ġj im
+Ġsm cs
+Ġprov oked
+Ġgl ial
+Ġbas ket
+Ġmon nier
+ust ine
+Ġaffect ion
+Ġbeing s
+gen esis
+Ġir f
+Ġcle arer
+Ġdys k
+Ġec pr
+Ġequ ivocal
+Ġprop rio
+Ġhand ic
+Ġve illon
+Ġlocal ised
+Ġdm fs
+bo ost
+Ġcoll aps
+Ġsection ing
+Ġsa a
+Ġpc f
+Ġana plastic
+Ġarth ropathy
+Ġtg p
+Ġpolymorph onuclear
+mark able
+Ġom itting
+Ġball oons
+Ġpyl orus
+Ġjud ging
+ips y
+Ġincomplete ly
+roplast ies
+Ġdup lex
+Ġcis tern
+umb ent
+Ġmann itol
+Ġagree ing
+Ġche b
+Ġunre al
+Ġtriple t
+Ġantid i
+Ġappreci ate
+lin ic
+Ġpush ing
+Ġperox is
+pre vious
+Ġauthent icated
+Ġubiqu itin
+Ġtuber cle
+Ġbiosimilar s
+Ġparasit aemia
+Ġgigant ol
+Ġmend elian
+Ġprocrast ination
+Ġcoril agin
+f our
+n y
+in umab
+Ġc og
+Ġc te
+Ġp pt
+Ġf fs
+ic able
+Ġm oxif
+ent ed
+Ġe ce
+Ġg ss
+ol ab
+res ia
+Ġv im
+Ġat resia
+ip ar
+se ver
+Ġac rome
+Ġco erc
+Ġsc ad
+Ġap igenin
+Ġall ocate
+Ġtr x
+Ġreg row
+Ġinter can
+Ġy at
+ub e
+Ġend e
+val vular
+Ġcardi othoracic
+duct s
+Ġcalc ine
+Ġchild bearing
+Ġmy h
+Ġmy of
+Ġz ju
+Ġweek days
+Ġsk ov
+Ġur inal
+Ġprop os
+Ġmoder ation
+Ġdm p
+Ġpp c
+Ġarth ritic
+Ġpen k
+20 35
+Ġrh odi
+Ġoccup ying
+Ġtransl ators
+Ġcc dc
+Ġcompl aining
+Ġdeb atable
+Ġot u
+14 6
+Ġradiological ly
+Ġcin namic
+Ġinner v
+Ġworkpl aces
+Ġelectron ically
+Ġdimin ishing
+Ġneurot rophic
+Ġunre markable
+Ġunp re
+Ġbrad y
+ochrom atosis
+Ġhypercap nic
+Ġtriter penoids
+Ġcorner stone
+Ġamplic on
+Ġpremen strual
+Ġneoint imal
+Ġsext ants
+Ġwidow ed
+Ġchiropract ic
+Ġspina e
+Ġemphys ema
+Ġvasore lax
+Ġpremax illa
+Ġtrape z
+2035 80
+m eric
+t g
+in ce
+en ger
+Ġp xr
+Ġw g
+Ġd yn
+Ġm se
+Ġb ri
+Ġre oper
+Ġh ca
+Ġe health
+Ġe ighth
+os etron
+Ġas leep
+Ġv itek
+Ġis i
+Ġus p
+Ġch fr
+Ġcomp ress
+Ġper ceiv
+st at
+se cre
+ay o
+Ġcl ove
+ph or
+ph ones
+Ġcons cient
+oth i
+Ġqu itting
+Ġmod elled
+Ġbl s
+Ġpo f
+Ġunder di
+Ġj in
+Ġdist ens
+ines cence
+Ġfl s
+ogen in
+Ġop md
+Ġcaus ation
+Ġvi ii
+Ġsingle t
+Ġsal es
+ind ividual
+Ġmid s
+Ġu f
+Ġflu x
+Ġlast s
+Ġabdom inis
+Ġiv w
+Ġgu iz
+Ġmar ine
+Ġbirth weight
+Ġrt ka
+Ġsd c
+Ġbio assay
+Ġfd ps
+Ġrh oa
+Ġleuk aemia
+Ġulcer ated
+Ġrepair ing
+fact or
+Ġoptim ally
+ran in
+Ġmelan omas
+fl av
+Ġtur c
+Ġprote ases
+Ġtf ap
+Ġrf c
+Ġethyl enedi
+Ġnons ter
+Ġspan ning
+Ġbip ss
+Ġcholang iopancre
+Ġdisappe ar
+Ġbf gf
+37 5
+Ġnd ga
+Ġmitig ating
+ulf an
+Ġpup s
+Ġmultin ucleated
+Ġnasoph arynx
+Ġjo ining
+Ġdin ner
+Ġerect or
+Ġperiost eum
+Ġaster isks
+Ġintensiv ist
+Ġcz p
+Ġjur kat
+Ġphleb otomy
+Ġamygd ala
+Ġfocuss ed
+hydraz yl
+Ġdyss ynchrony
+Ġpancyt openia
+Ġazac itidine
+Ġqueens land
+Ġende av
+Ġconscient ious
+1 50
+2 000
+f b
+s ome
+Ġ encycl
+Ġt ester
+Ġc ory
+Ġp ins
+al anine
+Ġan ov
+Ġf be
+Ġd x
+Ġd osed
+Ġd ream
+Ġn atal
+om ab
+el or
+Ġex oscope
+Ġper u
+Ġle mes
+se y
+Ġtw itter
+Ġcl ozapine
+Ġne em
+Ġab at
+Ġdat ing
+Ġsub end
+Ġam az
+Ġam ounted
+rol ithiasis
+Ġbl urred
+Ġpr c
+Ġtrans iently
+Ġnon users
+ex y
+Ġimm ortal
+Ġanti arrhythmic
+Ġav ascular
+Ġher itability
+Ġtraining s
+Ġenh ancer
+Ġtub al
+Ġbra df
+Ġbreast f
+Ġaden ine
+Ġplay ers
+Ġcolle ges
+Ġmob ilized
+Ġresol ving
+ced ural
+Ġsinus oidal
+Ġulcer ations
+Ġchlor oquine
+Ġhydrox ych
+Ġsom atization
+Ġpb i
+Ġevident ly
+Ġsap onin
+Ġpolyp osis
+Ġgastroenter ologist
+Ġlith otr
+Ġdic om
+Ġtens ions
+Ġtj a
+Ġaspergill osis
+Ġcse a
+Ġhung er
+Ġtrochanter ic
+Ġjoh ns
+olum bar
+Ġcolp oscopy
+Ġadam ts
+Ġgond ar
+Ġrul er
+Ġentit led
+Ġmyelodys plastic
+Ġrefriger ator
+Ġantiretro viral
+Ġmonnier i
+Ġrhodi ola
+Ġlemes how
+Ġbradf ord
+0 8
+m ur
+Ġa ward
+re m
+on ergic
+Ġs ong
+Ġb ost
+an ar
+Ġst itch
+om n
+Ġl ach
+Ġl adder
+ig s
+op ian
+Ġse ph
+port ing
+Ġcl en
+ost im
+Ġsc it
+Ġk at
+Ġexp ired
+Ġy emen
+Ġup front
+Ġcare r
+Ġdevelop ers
+Ġconf ers
+Ġform ic
+ral ine
+Ġprot aper
+Ġgeneral ised
+Ġflow ers
+Ġpul ling
+Ġmoder ator
+Ġda as
+Ġcirc uits
+ucle ation
+Ġneuro b
+Ġstaff ed
+Ġnucle atum
+Ġbro ther
+Ġfall opian
+Ġarth roplasties
+Ġrot ator
+Ġjap onica
+Ġepis iotomy
+Ġpm x
+ochond ral
+Ġmp d
+10 4
+Ġnm ol
+Ġnan os
+Ġmb i
+Ġpyl oric
+Ġpb f
+Ġrd na
+Ġbronch oalveolar
+Ġoverexp ressing
+Ġtur meric
+Ġcuff s
+Ġsi wak
+Ġdn mt
+Ġpossess ing
+Ġmesh es
+Ġmess aging
+Ġfluctu ating
+Ġreflex es
+cephal ic
+Ġthorac olumbar
+Ġpun ch
+Ġmalt ophilia
+Ġresum ed
+Ġscf p
+Ġdiphenyl tetrazolium
+Ġpick ed
+Ġglute us
+Ġgag s
+sf ield
+Ġbrucell osis
+Ġclavulan ate
+osit ory
+Ġxin jiang
+Ġmyotub es
+Ġbenefici aries
+Ġunrecogn ized
+Ġdegran ulation
+Ġpicryl hydrazyl
+Ġantires orptive
+Ġmacron utri
+Ġmasculin ity
+Ġsult an
+Ġmoxif loxacin
+Ġcalcine urin
+0 21
+m inant
+Ġt roph
+in p
+Ġa ws
+at rial
+Ġw in
+al va
+Ġan ecd
+Ġm ans
+an at
+Ġh ob
+Ġh br
+Ġh dm
+Ġe ip
+Ġto cil
+un k
+Ġv ick
+Ġbe clin
+op ard
+Ġat o
+rom a
+Ġnot ification
+Ġit erations
+Ġsc and
+Ġinter related
+Ġy q
+Ġfact ory
+Ġresp ir
+acter ium
+Ġfour ier
+Ġ1 000
+Ġtra f
+ex t
+ex ia
+Ġmin ip
+Ġfl d
+Ġpe ace
+Ġhyper oxia
+Ġshould ers
+Ġmy r
+Ġmicro part
+Ġhypert onic
+of ovir
+Ġbacter oides
+Ġopt ional
+Ġvit d
+me an
+Ġvir ulent
+Ġbiops ied
+Ġx pert
+Ġthromb oplast
+Ġgr ass
+Ġspe aker
+Ġcall osum
+Ġpen al
+Ġsd a
+Ġden ial
+Ġcomput ers
+Ġtri aged
+Ġeg b
+Ġprincip ally
+Ġhar p
+Ġlt l
+Ġfal cip
+Ġcomplement ed
+Ġmor in
+Ġrich ness
+Ġattend ees
+Ġautophag ic
+Ġalp ps
+Ġupd ates
+Ġine fficient
+Ġje opard
+Ġll t
+Ġche ap
+Ġvill i
+Ġsyring es
+Ġub t
+Ġfinger print
+Ġhypother mic
+Ġgb m
+Ġacth ar
+Ġamput ations
+Ġunm atched
+Ġgem ini
+Ġturb idity
+Ġzh ong
+Ġdisrupt ions
+Ġalex and
+Ġcholest atic
+Ġurolog ical
+Ġhinder ing
+Ġboost ing
+Ġankyl osing
+Ġreclass ified
+Ġvals alva
+Ġbrucell a
+Ġpyel onephritis
+Ġinsure rs
+Ġmonoc entric
+orient ation
+Ġgeneralis ability
+Ġambig uity
+Ġcytogen etics
+Ġcobal t
+Ġfalcip arum
+0 2
+d ish
+z i
+in ite
+at ching
+Ġc ocon
+Ġp cis
+Ġf anc
+Ġm le
+Ġb ree
+Ġh oun
+Ġl umin
+Ġl bc
+ig an
+if lor
+Ġcon ceived
+ter ing
+Ġr iver
+oc umented
+op edia
+Ġk cc
+Ġun ce
+ak ary
+Ġar pe
+Ġcr bd
+Ġover arch
+Ġperiod ically
+Ġsyn ovi
+Ġcyt oprotective
+Ġweek end
+Ġfac ets
+Ġdeg rade
+Ġult rastructural
+Ġclear ing
+Ġcs c
+Ġgo hai
+Ġconst rict
+Ġoc n
+Ġta o
+Ġconfirm ability
+Ġbo oster
+Ġpi ety
+Ġpv p
+Ġalign ing
+Ġtri os
+Ġcc v
+Ġhar bor
+Ġharm ony
+Ġsr b
+Ġrv ot
+Ġaort as
+Ġcontin ent
+Ġbreak age
+Ġleak s
+Ġdisrup ting
+Ġsac ro
+Ġiniti ates
+Ġgd ft
+Ġile oce
+Ġmf n
+Ġhapp ening
+okin etic
+Ġbiv entricular
+Ġdefinitive ly
+Ġspectrophot ometric
+iment ary
+Ġbor rel
+Ġecl s
+Ġpit ts
+78 23
+Ġintram ural
+Ġstriking ly
+Ġheterozyg otes
+ancre atic
+hid rosis
+Ġcapn ography
+Ġpleiotrop ic
+Ġcoar se
+Ġredund ant
+Ġparac rine
+Ġschistos omiasis
+acyl glycer
+Ġphysic ochemical
+Ġmicrocaps ules
+Ġosb pl
+Ġcatech ins
+Ġregrow th
+Ġencycl opedia
+Ġlithotr ipsy
+Ġtocil izumab
+Ġcocon ut
+Ġhoun sfield
+0 12
+d isc
 g y
-g er
-g it
-g ment
-g ot
-g ant
-g ut
-g rom
-g ers
-g age
-g ell
-g ene
-g man
-g ets
-g reg
-g ling
-g he
-g tt
-g ingival
-g ae
-g lass
-g ulatory
-g ctg
-g ativity
-g tgtc
-g ctcc
-g hani
-h m
-h ed
-h or
-h le
-h ot
-h ad
-h igh
-h um
-h og
-h ary
-h ine
-h ist
-h ens
-h ak
-h ort
-h art
-h oid
-h man
-h ism
-h ensive
-h ner
-h ina
-h ole
-h ydr
-h inol
-h att
-h ime
-h ift
-h tar
-h ubba
-h hal
-h uda
-i ut
-i enti
-i ase
-i ens
-i ace
-i itis
-i oma
-i rop
-i ography
-i atives
-i ogl
-i olabial
-i ologist
-i eller
-j c
-j i
-j n
-j in
-j ab
-j ad
-j ust
-j ith
-j acent
-j eni
-j evic
-k g
-k j
-k o
-k x
-k as
-k et
-k ine
-k ill
-k str
-k all
-k ines
-k ier
-k ind
-k ok
-k ert
-k rus
-k han
-k no
-k eep
-k eted
-k oseal
-k aryotes
-k auer
-k ransky
-k fb
-k hah
-l k
-l n
-l le
-l ot
-l ut
-l og
-l ia
-l ative
-l oss
-l ord
-l io
-l isted
-l az
-l agen
-l icate
-l icular
-l isation
-l ighting
-l ades
-l actic
-l ospor
-l ady
-l ipidemia
-l aq
-l bert
-m c
-m l
-m r
-m w
-m at
-m om
-m et
-m ol
-m ut
-m ies
-m ap
-m op
-m em
-m st
-m ild
-m ans
-m ile
-m icro
-m ail
-m ined
-m int
-m acy
-m atic
-m ium
-m ified
-m other
-m ri
-m itis
-m ma
-m pa
-m orb
-m ask
-m itus
-m dsc
-m mp
-m osaic
-m etal
-m poral
-m acg
-m eters
-m strom
-m bow
-m acher
-n m
-n on
-n en
-n an
-n ge
-n ut
-n ical
-n oc
-n ine
-n ist
-n our
-n ick
-n oid
-n ma
-n iotic
-n eling
-n ino
-n itus
-n umer
-n atally
-n uclear
-o es
-o ic
-o ar
-o ly
-o ab
-o uc
-o qu
-o op
-o vel
-o amin
-o vic
-o ins
-o ining
-o ai
-o tics
-o immune
-o plasm
-o ara
-o trans
-o zyme
-o economics
-o plasma
-o enzyme
-o cele
-o oxygenase
-p g
-p m
-p ti
-p as
-p om
-p ts
-p ain
-p pl
-p able
-p ine
-p ost
-p ds
-p ace
-p ines
-p etic
-p aren
-p ool
-p ful
-p ator
-p ping
-p ocl
-p ina
-p itus
-p ole
-p dt
-p tics
-p uscular
-p ubertal
-p illover
-p ilot
-p uni
-p apers
-q c
-q s
-q er
-r c
-r x
-r ion
-r ad
-r ies
-r ain
+g ative
+k it
+Ġp ess
+Ġw l
+Ġh hip
+Ġe ic
+os amine
+Ġpro kin
+Ġex ocrine
+Ġres ide
+Ġcl er
+Ġsc p
+uc oid
+Ġtr ib
+Ġpl ur
+ach i
+oth y
+Ġro ux
+Ġpr andial
+Ġund etermined
+Ġser otype
+Ġfour fold
+Ġdep ersonal
+Ġsp asticity
+Ġchar act
+Ġsubject ivity
+Ġmal le
+Ġorgan ised
+Ġdirect ive
+Ġaut ofluorescence
+Ġchem otaxis
+Ġmid f
+Ġble eds
+Ġnecess itate
+eg rad
+Ġsupp lying
+Ġpc d
+rogen esis
+Ġprec ludes
+Ġrot terdam
+oun ce
+Ġminim izes
+Ġbed time
+Ġros marin
+Ġnh ps
+Ġfer ment
+Ġupreg ulating
+Ġviol ations
+Ġmelan ocytes
+Ġsubt ilis
+ou ver
+Ġded uced
+Ġpu fas
+Ġtel edent
+Ġbath s
+Ġvanc ouver
+Ġcoron ally
+ryl ate
+Ġpuls atile
+Ġgse a
+max illary
+Ġsynchron y
+Ġserot onergic
+Ġcoinc ide
+Ġsj z
+Ġtam oxif
+Ġez et
+Ġjudg ements
+Ġinfrequ ently
+Ġdrople t
+Ġhung ary
+Ġovari ectomy
+Ġubiquit ous
+Ġdiscount ing
+Ġcholedoch olithiasis
+Ġadjud icated
+Ġexcit atory
+Ġenum eration
+Ġangpt l
+Ġxg boost
+Ġentrap ment
+Ġeyeb row
+Ġconfron ted
+Ġstereomic roscope
+Ġdebil itating
+Ġurinal ysis
+Ġnonster oidal
+Ġunce mented
+Ġteledent istry
+5 8
+b it
 r and
-r ull
-r ct
-r ag
-r ak
-r action
-r int
-r aw
-r ically
-r itt
-r uous
-r ontal
-r amine
-r atch
-r ange
-r ams
-r atable
-r mined
-s al
-s es
-s ar
-s ec
-s ter
-s up
-s ity
-s ors
-s ied
-s ix
-s amin
-s ag
-s ins
-s thetic
-s ung
-s olution
-s ters
-s angu
-s chool
-s how
-s urgical
-s her
-s avir
-s uch
-s uccessful
-s ka
-s essive
-s leep
-s iloxane
-s uda
-s ubjec
-s atisfied
-s thesia
-s pillover
-t p
-t at
-t ud
-t ol
-t ase
-t eeth
-t cc
-t ages
-t led
-t ene
-t ten
-t echn
-t ob
-t aw
-t ographic
-t etr
-t own
-t ection
-t uk
-t gf
-t ella
-t aper
-t rophic
-t ata
-t zi
-t ats
-t inen
-t rophobia
-t fap
-u i
-u o
-u os
-u ine
-u ke
-u ating
-u ade
-u til
-u ising
-u rolog
-u zz
-u fficiency
-u elle
-u quer
-u lectomy
-u mental
-u iller
-v d
-v s
-v y
-v on
-v an
-v ac
-v ad
-v ies
-v ate
-v oth
-v und
-v amin
-v ail
-v ability
-v ism
-v ival
-v isions
-v estib
-v sky
-v anic
-w b
-w k
-w o
-w er
-w ad
-w ip
-w est
-w ari
-w end
-w ser
-w ould
-w ak
-w ood
-w he
-w can
-w ares
-w ij
-w elled
-w elve
-w abs
-w elly
-x l
-x s
-x ies
-x ia
-x ine
-x ication
-x ner
-x erost
-x tg
-y k
-y z
-y as
-y ro
-y ear
-y mo
-y ric
-y ness
-y co
-y to
-y cle
-y go
-y roc
-y back
-y ema
-y ria
-y att
-y lectomy
-y ttr
-y tten
-z al
-z ed
-z an
-z ur
-z if
-z ol
-z ated
-z ers
-z ari
-z led
-z yn
-z he
-z ale
-z han
-z aws
-z array
-z epam
-z ko
-z yk
-Ġ ull
-Ġ ental
-Ġ ict
-Ġ umb
-Ġt d
-Ġt x
-Ġt ec
-Ġt id
-Ġt uc
-Ġt ir
-Ġt ph
-Ġt aus
-Ġt esti
-Ġt pt
-Ġt amm
-Ġt ick
-Ġt onic
-Ġt ne
-Ġt edi
-Ġt ires
-Ġt reg
-Ġt pa
+v b
+Ġt ics
+Ġa oe
+re tin
+Ġw gc
+Ġan abolic
+Ġto t
+Ġn ur
+ur ized
+et ti
+Ġg ds
+ce ctomy
+Ġas ystole
+il ast
+Ġon sd
+Ġr al
+Ġis othi
+oc ent
+og astro
+Ġit n
+Ġk or
+Ġthree fold
+ren t
+Ġcor por
+ix ation
+Ġcare t
+Ġdef ence
+Ġdr ank
+cept ive
+Ġimp ressive
+Ġanti angiogenic
+Ġstress or
+Ġradi omics
+Ġpoly d
+Ġimplant able
+Ġplace ments
+rop ion
+Ġmr cp
+Ġcre ative
+Ġcontrast ed
+ann on
+Ġsynd esm
+Ġvascular ized
+Ġneu roph
+Ġhr r
+Ġgr p
+Ġgr fs
+Ġpal atini
+Ġalt itude
+Ġtg ab
+hyd roxy
+erv ised
+Ġwar med
+Ġtt x
+Ġarg ues
+Ġdelir ious
+Ġoverl ay
+Ġintention ally
+Ġones elf
+Ġnom ograms
+Ġgs rs
+Ġpon atinib
+Ġtuberc ulous
+Ġrins es
+pic uous
+Ġniger ian
+Ġcoinc ided
+Ġsalv ia
+Ġskew ness
+Ġstrand ed
+Ġdisrupt ive
+Ġspermat ogenesis
+Ġsuff ers
+Ġelectrom agnetic
+Ġbend am
+Ġamen able
+Ġclavulan ic
+Ġencaps ulated
+Ġwheel ch
+Ġnaring in
+Ġwis dom
+Ġhyperther mia
+Ġperimen opausal
+Ġcartrid ge
+Ġcach exia
+Ġmonop olar
+Ġisoquerc itrin
+Ġperone al
+Ġcholangiopancre atography
+Ġthromboplast in
+Ġoverarch ing
+Ġwgc na
+g aly
+h ad
+i ologies
+s ulf
+x ial
+z u
+Ġt ual
+Ġt ps
+Ġp ale
+it ives
+Ġf ds
+Ġd ub
+Ġd ca
+Ġb ell
+Ġe ap
+Ġn if
+Ġst an
+il a
+il ine
+Ġon lay
+od end
+ag og
+ag ittal
+Ġsh and
+ac onazole
+Ġcont ag
+Ġme cc
+Ġdi acetate
+Ġfo et
+Ġap repitant
+Ġful minant
+Ġmet at
+Ġpart um
+Ġph s
+Ġgen omics
+Ġcr im
+Ġman uka
+Ġbut yl
+Ġj py
+Ġpop ulated
+Ġcompar ators
+Ġed a
+Ġcalc ulates
+Ġpot ato
+Ġclass ically
+Ġmort em
+Ġep och
+Ġmy o
+Ġmal nourished
+ec oxib
+Ġcd dp
+Ġir p
+Ġlab elling
+Ġml d
+Ġml pa
+Ġlip of
+Ġaut otrans
+Ġsl t
+Ġmen arche
+Ġmass on
+Ġproportion ally
+arch itect
+ru ff
+Ġflu ency
+Ġmir i
+last ic
+Ġdepart ure
+Ġemploy er
+cal ib
+Ġmt m
+Ġmes entery
+Ġpi i
+Ġele gans
+Ġoh ss
+Ġmis under
+raction ated
+Ġgp c
+Ġpurch asing
+Ġnc p
+Ġvel i
+Ġtoxic ological
+Ġcontin ence
+Ġot m
+Ġtranscript ome
+Ġmanage able
+Ġperic ardi
+Ġstrept ococcal
+Ġlad a
+Ġmas linic
+Ġuniform ity
+Ġras ch
+Ġsubc ult
+Ġfung us
+Ġcrow ded
+cap ular
+Ġparathyroid ectomy
+Ġrecon n
+Ġendors ement
+Ġdy ad
+Ġcompuls ive
+Ġbook s
+Ġguang dong
+Ġcitr ull
+Ġpsychopath ological
+Ġmant le
+Ġimpuls ivity
+Ġjur isd
+Ġalve oli
+Ġrum ination
+Ġbioeth ics
+Ġhams ters
+Ġunsup ervised
+Ġhypogonad ism
+Ġtocopher ol
+Ġintercan ine
+Ġbost on
+7823 13
+Ġezet im
+Ġtual ang
+2 10
+3 34
+g art
+h orm
+o ys
+s en
+Ġo at
+Ġp ont
+Ġw w
+od s
+ot ent
+op ag
+Ġass ault
+Ġsign ing
+pt s
+Ġsc ree
+ph th
+Ġk ds
+Ġinter sp
+Ġpres erv
+Ġout standing
+Ġpos aconazole
+Ġar bor
+Ġen amic
+Ġsp acing
+Ġend ocardium
+Ġsim pson
+Ġsm y
+Ġmon os
+Ġref rain
+Ġfl att
+Ġhyper hidrosis
+Ġep icate
+Ġwill i
+Ġfib ular
+Ġq d
+Ġmat rine
+Ġent ero
+Ġlog ic
+Ġhand grip
+Ġmoder ated
+Ġlym e
+Ġlymph oblastic
+Ġlocal ities
+Ġread ability
+Ġsitu ational
+Ġx st
+Ġsn ack
+Ġprognostic ation
+Ġlay pers
+Ġqual ify
+opl an
+Ġlater ality
+Ġvs mc
+Ġfet oprotein
+Ġsil ence
+Ġden ature
+Ġhaem ostatic
+Ġsimple x
+Ġcc f
+Ġperman ently
+Ġput ty
+Ġnom encl
+Ġconstit utional
+Ġaud i
+Ġcontract s
+Ġlp d
+Ġinhal ational
+romb opag
+Ġbeh alf
+Ġtransp osition
+Ġcollabor ations
+Ġspectrophot ometry
+Ġvacu ol
+Ġtrim med
+Ġlax atives
+Ġspar cl
+Ġpurs ued
+Ġku wa
+Ġleuc ocyte
+Ġsonic ated
+Ġsea we
+Ġjordan ian
+Ġrehyd rated
+Ġdeliber ate
+Ġlves v
+Ġanh edonia
+Ġshop ping
+Ġunif rac
+Ġastroc yt
+Ġausc ultation
+Ġintratum oral
+Ġvick ers
+Ġharp ag
+Ġezetim ibe
+b os
+f action
+g ers
+h ouse
+l as
+r andom
+Ġt ut
+Ġo ro
+Ġo ught
+Ġf ak
+Ġf ps
+Ġb dl
+Ġb ipl
+Ġh ims
+Ġn ir
+Ġst agn
+et etra
+Ġg rit
+em esis
+oc and
+op elvic
+Ġsh rs
+Ġfo bt
+Ġhy phae
+Ġcare ers
+Ġsp ores
+Ġpost ed
+Ġso ap
+Ġsm p
+Ġmain stream
+Ġanti hist
+Ġmy ositis
+Ġimmun oprecipitation
+Ġca ro
+Ġct r
+Ġgluc one
+Ġach alasia
+Ġve i
+Ġoste ocytes
+Ġhydro chlor
+Ġgastro duoden
+Ġgu ess
+eless ness
+Ġpneum atic
+Ġsummar ies
+Ġchlor ine
+weight ed
+Ġss n
+Ġdrop ping
+Ġphenomen ological
+Ġhypog lycaemic
+17 782313
+Ġmultic entric
+Ġneon ate
+Ġobstruct ed
+Ġopening s
+Ġpref erential
+Ġhol der
+Ġsi rolimus
+Ġhapp iness
+Ġdele g
+Ġhous es
+Ġsubc ortical
+Ġram p
+Ġamelior ates
+Ġvc v
+Ġrc d
+Ġappra ised
+Ġoverd ist
+Ġthym ic
+Ġrhiz ome
+Ġveter inary
+Ġinsec ure
+Ġsigmoid oscopy
+Ġmicron ucle
+Ġchl am
+Ġdoubt ful
+Ġcongru ence
+Ġnavig ated
+Ġexempl ified
+Ġoutl ining
+Ġtrac ings
+Ġspirom etry
+Ġtript olide
+Ġnonsm ok
+Ġquies cent
+Ġjim ma
+Ġperoxis ome
+Ġacrome galy
+Ġpropos als
+Ġseph adex
+Ġcharact ers
+ogastro duoden
+Ġbendam ustine
+Ġnomencl ature
+Ġhims elf
+h ap
+x in
+at gg
+Ġs ight
+Ġs ays
+en es
+Ġo w
+Ġc ram
+Ġan cient
+Ġd ros
+Ġb che
+Ġh ma
+Ġst uff
+Ġl ud
+os c
+Ġcon clus
+Ġr so
+Ġr neasy
+Ġal c
+Ġal ph
+am s
+Ġch ur
+Ġch cl
+Ġsh im
+Ġsh annon
+Ġsign ifies
+Ġaf g
+Ġap a
+Ġtr us
+pro x
+Ġqu er
+Ġqu et
+Ġy a
+Ġy y
+Ġsam s
+Ġen ucleation
+Ġsup erm
+ros ide
+Ġgl ue
+Ġcal ories
+Ġic r
+Ġintra osseous
+Ġpress ed
+Ġless en
+Ġmy enteric
+ec avir
+oph aryngeal
+Ġprom in
+Ġhel ix
+Ġadd itives
+Ġq ia
+Ġent ecavir
+Ġelect rosp
+more over
+Ġmoder ating
+Ġelev ating
+vir us
+Ġneuro inflammation
+Ġmar s
+Ġster nal
+Ġcav itation
+Ġga e
+Ġven et
+Ġip f
+agen ic
+Ġped ig
+Ġ19 70
+Ġht a
+Ġpm c
+Ġcc nd
+Ġenter itis
+eed back
+Ġid f
+Ġfer rous
+Ġstom at
+Ġrol ling
+Ġuns ure
+Ġcontin ents
+Ġpn pla
+Ġlob ectomy
+Ġprote omic
+Ġacceler ometer
+Ġerad icate
+Ġorthop edics
+Ġham d
+Ġgynec ologists
+Ġpathogen etic
+Ġpie z
+Ġtrimes ters
+Ġphosphat id
+Ġbf m
+Ġeosinophil ia
+Ġrid ges
+Ġsubd iv
+Ġpostt est
+asi rox
+Ġtin y
+Ġimmig ration
+Ġaccompl ishment
+Ġesc italopram
+Ġcholangi ography
+Ġdensit ometric
+Ġbiod egrad
+Ġechin ocand
+Ġpostp oned
+Ġdefer asirox
+Ġcation ic
+Ġprison ers
+opyran oside
+Ġhyperint ense
+Ġunrespons ive
+Ġshig ella
+Ġreven ue
+Ġretrom olar
+Ġurtic aria
+Ġreoper ations
+Ġdistens ibility
+Ġepicate chin
+Ġchlam yd
+z y
+Ġa asi
+Ġw af
+Ġin let
+or afenib
+Ġb n
+Ġb iting
+Ġh ell
+os itol
+Ġg os
+Ġv ur
+Ġbe vel
+am er
+Ġim f
+ost ril
+Ġsc ant
+Ġaf r
+Ġab lated
+Ġtr usted
+oci ous
+Ġun bl
+Ġmed ulla
+Ġout re
+Ġy u
+ak h
+Ġund ocumented
+Ġstr uts
+Ġconf using
+Ġimp ract
+Ġet s
+Ġel oqu
+Ġany way
+Ġav p
+Ġeff usions
+Ġsl b
+Ġprop ionate
+Ġbr ine
+Ġtub ing
+Ġcp k
+ucle otide
+Ġsupp ose
+Ġcb l
+Ġip r
+Ġinteract ed
+Ġrespect ing
+Ġpt b
+be an
+Ġmis pl
+ga ag
+Ġcc m
+Ġabsolute ly
+Ġss b
+Ġdc p
+Ġhd p
+Ġarg u
+Ġlys osomal
+Ġelimin ates
+14 0
+Ġtet ram
+Ġregen erated
+Ġfeature d
+Ġlm p
+Ġeb ra
+Ġconjug ation
+Ġcleft s
+att ract
+Ġmess enger
+Ġeti opath
+osm in
+Ġinherent ly
+Ġaggrav ating
+Ġanonym ously
+Ġlb w
+Ġscatter ing
+Ġign ore
+Ġrecover ing
+Ġcorrobor ating
+Ġbca a
+Ġaccommod ation
+Ġantim ut
+Ġsenes cent
+Ġanaphyl actic
+Ġcass ette
+Ġanaesthesi ologist
+Ġneoint ima
+Ġesm olol
+Ġsubclass es
+Ġepididym al
+Ġtransluc ency
+Ġanthocyan ins
+Ġradioimmun o
+Ġintric ate
+Ġegs m
+Ġspous es
+Ġcopt is
+Ġflatten ed
+Ġbree ch
+disc ussion
+Ġcaro ten
+b el
+b ond
+i ations
+w orm
+z el
+Ġt at
 Ġt elling
-Ġt cs
-Ġt abol
-Ġt ads
-Ġt asting
-Ġt akers
-Ġt iff
-Ġt ntp
-in y
-in er
-in ic
-in ig
-in ib
-in op
-in val
-in ition
-in ell
-in ch
-in iti
-in ide
-in clusion
-in atory
-in ities
-in ately
-in ised
-in ished
-in erg
-in ators
-in ction
-in tention
-in isation
-in omatous
-in ii
-in avir
-in opathy
-in ositol
-Ġa in
-Ġa as
-Ġa it
-Ġa qu
-Ġa vi
-Ġa ok
-Ġa head
-Ġa wa
-Ġa att
-Ġa ky
-Ġa unt
-Ġa leg
-Ġa kin
-Ġa acgtgtc
-Ġa jith
-re a
-re b
-re r
-re y
-re as
-re um
-re ased
-re gn
-re te
-re ogen
-re yg
-re tentive
-re porting
-re ports
-re valence
-Ġth igh
-Ġth ia
-Ġth ong
-Ġth ric
-Ġth ym
-Ġth ie
-Ġth urs
-Ġth rust
-Ġth iaz
-Ġth war
-Ġth ammas
-on j
-on en
-on et
-on id
-on ut
-on ality
-on ium
-on yl
-on itis
-on oid
-on atal
-on ically
-on iasis
-on key
-on tium
-on otic
-on nected
-on za
-on anoic
-on version
-on itrile
-on vuls
-on bach
-Ġthe at
-Ġthe or
-Ġthe ft
-Ġthe si
-Ġthe ses
-Ġs g
-Ġs j
-Ġs q
-Ġs x
-Ġs om
-Ġs ip
+Ġs chn
+er ia
+Ġc el
+Ġw ing
+Ġf rict
+Ġm pe
+Ġm yl
+Ġb iceps
+ar ic
+Ġre ap
+Ġre uter
+Ġe lected
+Ġto ur
+Ġn ct
+Ġl op
+Ġl yc
+Ġcon ization
+Ġcon cave
+Ġv oric
+ch ip
+ter one
+Ġstud io
+op les
+Ġpre l
+ac r
+Ġwe chat
+Ġcl ick
+Ġsc o
+Ġsc id
+Ġk up
+Ġun rest
+Ġsub urb
+Ġph i
+Ġro ws
+Ġpo ured
+Ġen for
+yst ems
+Ġsup reme
+cer a
+Ġtrans septal
+Ġnon random
+Ġbi op
+val es
+Ġdr astically
+Ġadm itting
+ox ane
+Ġcompar ably
+yl um
+Ġcalc uli
+Ġpe oples
+Ġterm inate
+Ġpers u
+oph yte
+Ġpa ad
+fer ior
+Ġextra medullary
+Ġost ial
+Ġdec ap
+Ġcm d
+Ġmac ros
+rs s
+Ġms ap
+Ġx r
+Ġthromb oprophylaxis
+Ġmc d
+Ġantic onvuls
+Ġprec ocious
+Ġnf kb
+Ġrespect ful
+Ġweak ening
+Ġachieve ments
+Ġpen ic
+itu ents
+Ġexplore r
+Ġhp d
+Ġmp p
+Ġsubsc ore
+Ġwal d
+Ġslow ed
+Ġgraph ic
+Ġcham om
+Ġfalse ly
+Ġdest abil
+Ġcarcin oid
+Ġdiscrimin ated
+oqu inone
+Ġsun light
+Ġreflex ology
+Ġconform s
+Ġtax onomy
+Ġafford ed
+Ġbup ropion
+Ġproxim ally
+Ġcry o
+Ġmeant ime
+agg reg
+Ġcros st
+Ġreplace ments
+Ġbag s
+Ġphenyl alanine
+Ġhop ed
+Ġbiocomp atible
+Ġmetaph yseal
+Ġpae onol
+Ġtired ness
+Ġtort uous
+Ġpolys omn
+Ġpares thesia
+Ġphospholip ids
+Ġlutein izing
+Ġadvers ity
+Ġtrunc ated
+Ġanamn esis
+980 59
+Ġsorb itol
+Ġtamoxif en
+Ġflatt ening
+Ġconclus ively
+Ġquer ied
+Ġfrict ional
+d ac
+g ram
+k ins
+t ation
+Ġf xa
+Ġh et
+ul u
+Ġn ylon
+Ġst ew
+Ġl one
+et il
+et ac
+th us
+Ġbe ating
+um arin
+Ġres ectable
+oc or
+oc ating
+Ġch ong
+Ġle ica
+Ġco aches
+Ġwe i
+pl s
+Ġinf lection
+Ġha i
+Ġha is
+Ġreg orafenib
+Ġpr ud
+Ġpr ong
+Ġag r
+Ġra ge
+ond ylar
+Ġcomm encing
+Ġsm e
+Ġtra cers
+Ġdr c
+Ġmon etary
+ron ine
+Ġpe gc
+Ġps d
+Ġnormal izing
+Ġop a
+Ġline ages
+Ġeth ically
+Ġca z
+Ġmm t
+Ġpros p
+Ġcoll im
+Ġcs d
+Ġiv r
+Ġgr c
+Ġbiom ass
+Ġga o
+Ġaden ovirus
+Ġmig ratory
+Ġlat itude
+Ġassist ive
+Ġsegment ations
+Ġepith eli
+Ġped un
+Ġprem ix
+Ġweak en
+Ġexpress es
+Ġfr id
+ococ c
+Ġmill ig
+Ġchol inesterase
+Ġpil ocar
+Ġnc bi
+Ġinterf aces
+Ġcontin ually
+Ġfm f
+Ġiniti ator
+Ġantagon ism
+Ġpw d
+Ġesophag ogastroduoden
+Ġcontract ure
+aryng itis
+gc d
+can o
+Ġmotiv ating
+Ġepile pt
+Ġchond ro
+Ġole cran
+Ġcong ress
+Ġud ca
+Ġnih ss
+Ġgonad al
+Ġpunct ures
+Ġadvoc ates
+Ġgx v
+Ġtil ted
+Ġdand ruff
+Ġoutl ines
+Ġvign ettes
+Ġpreced e
+Ġvideolaryng oscope
+Ġgle ason
+Ġembarr assment
+Ġbiof eedback
+Ġunip olar
+Ġtmp rss
+Ġelectrochem ilumines
+Ġadventit ia
+Ġcarm ine
+Ġmicrosat ellite
+Ġunreal istic
+Ġileoce cal
+Ġisothi ocyanate
+Ġreuter i
+etac oplan
+Ġpegc etacoplan
+7 2
+n n
+w p
+w r
+Ġc we
+ed ipine
+Ġw ore
+Ġw fs
+Ġan v
+it oring
+Ġf sc
+Ġre vert
+Ġst airs
+Ġl let
+os ensory
+ati a
+Ġcon vales
+el and
+Ġv ye
+am ong
+Ġus able
+Ġab rog
+Ġk och
+Ġev ans
+Ġinter rog
+rol izumab
+Ġar v
+Ġup set
+Ġj l
+Ġj s
+Ġsp v
+Ġsp inous
+Ġdist ressed
+ob ronchial
+Ġmin ing
+ok en
+Ġpe i
+Ġsever ities
+Ġmort alities
+Ġvis u
+Ġimmun ized
+Ġer bb
+Ġbm ms
+Ġaut ocl
+Ġcategor izing
+Ġsch iff
+Ġinject or
+Ġstro op
+Ġver um
+Ġhemat omas
+ogl oss
+Ġmg cl
+Ġ19 99
+Ġkin der
+Ġten ofovir
+Ġdon ated
+yg luc
+Ġauthor ization
+Ġsuic ides
+Ġds p
+rel ations
+Ġtrache otomy
+Ġcf dna
+Ġscient ifically
+Ġfm ri
+Ġace is
+Ġple asure
+Ġrelax ing
+Ġconstit uting
+Ġconstit utive
+Ġschizophren ic
+Ġexacerb ating
+Ġho os
+Ġtl v
+Ġworkload s
+Ġpu i
+igm oid
+raph ic
+Ġbt x
+Ġacetyl cholinesterase
+Ġneural gia
+Ġphosphat idyl
+Ġwashing ton
+Ġretro viral
+Ġsarc omas
+Ġlam ivudine
+Ġsuv max
+Ġmn gs
+Ġencounter ing
+Ġtouch ing
+Ġdial ys
+Ġtag s
+Ġbook let
+Ġintox icated
+Ġbacteri ostatic
+Ġunres olved
+Ġneighbour ing
+Ġadvoc acy
+Ġconvex ity
+Ġsupras capular
+Ġxt t
+Ġprohib ited
+rost omy
+Ġsse p
+Ġobsess ive
+uber tal
+Ġhygien ists
+Ġcing ulate
+Ġhydroxych lor
+iflor in
+Ġdepersonal ization
+Ġnif edipine
+Ġvoric onazole
+Ġpenic ill
+Ġolecran on
+Ġllet z
+ygluc ose
+: :
+d y
+f ang
+k k
+z b
+Ġt cc
+en amel
+er ally
+Ġw pv
+Ġan i
+ct tt
+Ġh os
+Ġis at
+qu am
+Ġsh ame
+ip ated
+ge us
+uc er
+Ġtr in
+Ġtr ident
+Ġph ages
+Ġout ward
+Ġexp ed
+Ġen qu
+Ġser osal
+Ġfound ed
+ace pt
+Ġstr ide
+Ġdef lation
+ograph ies
+Ġimp eded
+Ġimp ulse
+Ġinvestig ates
+Ġrep ressed
+Ġset tled
+Ġmy ri
+Ġmy ef
+Ġimmun opos
+Ġer l
+Ġradi oi
+Ġsk ip
+Ġct cl
+Ġbeha ve
+Ġsucc inyl
+Ġlymph openia
+Ġrespond s
+Ġax illa
+Ġpp arg
+Ġsour ced
+Ġbil ingual
+Ġexcept ional
+Ġhom olog
+Ġnorm o
+Ġinfarction s
+Ġtg t
+Ġpt fe
+Ġcircum s
+Ġcarb am
+Ġmp fl
+Ġoptim istic
+Ġtp c
+Ġclar ifying
+ingu ish
+Ġsr l
+Ġmh z
+Ġunf ractionated
+Ġhm r
+Ġts g
+Ġrepeat s
+Ġbul ky
+Ġnerv osa
+Ġnp y
+Ġmas pin
+Ġbrid ges
+Ġpas p
+Ġson ograph
+Ġbus ulfan
+Ġrelaps ing
+Ġrequest ing
+Ġali ke
+ocate chin
+Ġsplint ing
+Ġester ase
+Ġtex as
+Ġphilosoph ical
+Ġcyan oac
+Ġmyx oma
+ocr atic
+Ġcalcane us
+Ġsubdom ains
+Ġnocice ption
+Ġbach elor
+Ġpropri etary
+Ġhydroxypro line
+Ġhandic ap
+Ġveillon ella
+othy ronine
+prox en
+Ġprosp ects
+h ar
+l ithiasis
 Ġs ell
-Ġs ong
-Ġs ill
-Ġs ple
-Ġs pro
-Ġs olar
-Ġs ures
-Ġs ke
-Ġs its
-Ġs oss
-Ġs arg
-Ġs ledge
-Ġs ade
-Ġs anc
-Ġs ains
-Ġs ier
-Ġs ays
-Ġs ending
-Ġs ider
-Ġs ender
-Ġs aph
-Ġs agl
-Ġs ift
-Ġs anta
-Ġs omn
-Ġs orbent
-Ġs gar
-Ġs vert
-Ġs ongk
-Ġs vy
-ti ly
-ti ps
-ti go
-ti bility
-ti fication
-ti gate
-ti omeatal
-ti bacterium
-ti fical
-ti vism
-Ġo en
-Ġo ed
-Ġo is
-Ġo ud
-Ġo ce
-Ġo ment
-Ġo ch
-Ġo ug
-Ġo so
-Ġo tis
-Ġo ds
-Ġo tor
-Ġo ily
-Ġo ks
-Ġo clusal
-Ġo kr
-Ġo ecd
-en o
-en u
-en en
-en ot
-en ib
-en tive
-en ich
-en ch
-en ets
-en idine
-en iable
-en cher
-en otypic
-en kr
-en juan
-al a
-al z
-al en
-al ted
-al act
-al ition
-al ance
-al so
-al king
-al ene
-al ization
-al ane
-al ty
-al arm
-al cohol
-al ibration
-al ways
-al ysis
-al usia
-al nutrition
-al aj
-al ypt
-al gesic
-al bumin
-al vanic
-er k
-er an
-er ig
-er ati
-er ology
-er ational
-er red
-er vation
-er ogenic
-er nec
-er ogram
-er ra
-er tia
-er jian
-er board
-er hensive
-er wood
-er tification
-Ġc ed
-Ġc ul
-Ġc im
-Ġc ati
-Ġc ib
-Ġc age
-Ġc ary
-Ġc vi
-Ġc ull
-Ġc enti
-Ġc ay
-Ġc yp
-Ġc ures
-Ġc ct
-Ġc ages
-Ġc ak
-Ġc ust
-Ġc ps
-Ġc cp
-Ġc ili
-Ġc akes
-Ġc ze
-Ġc eng
-Ġc atia
-Ġc abin
-ed s
-ed le
-ed ation
-ed uc
-ed ence
-ed ication
-ed ler
-ed odontists
-Ġp im
-Ġp ly
-Ġp uc
-Ġp ine
-Ġp ich
-Ġp ens
-Ġp ile
-Ġp ace
-Ġp ms
-Ġp br
-Ġp unc
-Ġp ust
-Ġp av
-Ġp cp
-Ġp itted
-Ġp bi
-Ġp iment
-Ġp antom
-Ġp asted
-Ġp aves
-Ġp ctc
-Ġw k
-Ġw in
-Ġw an
-Ġw ic
-Ġw ol
-Ġw are
-Ġw op
-Ġw age
-Ġw ong
-Ġw ins
-Ġw ets
-Ġw isc
-Ġw inter
-Ġw aters
-Ġw onder
-Ġw ander
-Ġw person
-Ġw bc
-Ġw enjuan
-Ġw ernec
-Ġin at
-Ġin gr
-Ġin ns
-Ġin wards
-Ġin bre
-Ġin opress
-Ġin anim
-Ġin icell
-Ġin ositol
-Ġin built
-Ġin iatives
-Ġin ertia
-es tic
-es tr
-es em
-es cent
-es hip
-es cal
-es co
-es tration
-es min
-Ġan tis
+Ġo ic
+Ġp emb
+Ġf id
+Ġf un
+Ġf ont
+Ġd ectin
+Ġd ipping
+ent orial
+an ercept
+ar land
+Ġe en
+Ġto lu
+Ġst ars
+os idase
+Ġres ign
+Ġat omic
+Ġk ines
+Ġk yn
+Ġmet oprolol
+Ġun weighted
+enc er
+Ġj ones
+Ġem pathic
+Ġi o
+Ġet est
+Ġet anercept
+Ġsecond arily
+Ġintra ocular
+Ġz on
+Ġz oster
+Ġvol cano
+Ġdel usion
+Ġii ib
+Ġil iot
+Ġdys g
+Ġorgan ize
+Ġur ge
+Ġmac erated
+Ġdown s
+Ġstaff s
+az omib
+Ġmagn ified
+och ez
+Ġmanifest ing
+Ġuc b
+Ġrh b
+Ġden ervation
+Ġhp m
+Ġtransl ates
+Ġaa ad
+Ġnm bas
+Ġna proxen
+Ġreturn s
+Ġglyc oside
+Ġoptim ise
+Ġaer ob
+Ġgh q
+Ġsph eres
+Ġrd c
+Ġtsh r
+Ġcn v
+Ġdentition s
+Ġintest ines
+ylin ositol
+Ġfu el
+Ġsynerg ism
+Ġattract iveness
+Ġgon i
+Ġquarter ly
+Ġfibro id
+Ġvigorous ly
+Ġperox ides
+Ġxi ang
+Ġserving s
+Ġresum e
+Ġclaud ication
+Ġlit igation
+Ġbz d
+valu es
+Ġquadrup le
+Ġblastocyst s
+Ġix azomib
+Ġspons ored
+Ġdand el
+Ġmillil iter
+Ġmala wi
+Ġhaemod ialysis
+Ġbuf alin
+Ġovercrow ding
+Ġimperf ect
+Ġcorrid or
+Ġtroc ar
+Ġlentivir us
+Ġantidi arrh
+Ġalexand ria
+Ġpitts burgh
+Ġoutre ach
+Ġargu ably
+Ġkinder gart
+Ġmyri ad
+Ġradioi odine
+Ġpemb rolizumab
+Ġiliot ibial
+ochez ia
+Ġs ale
+Ġc uc
+Ġp ws
+Ġw wi
+it ors
+Ġf ly
+Ġm iat
+Ġm isf
+Ġb im
+Ġb low
+Ġb ism
+Ġn en
+il iac
+am pling
+Ġch ills
+ore nal
+act ivated
+Ġtw i
+Ġsc fa
+Ġtr imming
+Ġpres epsin
+Ġhy oid
+Ġcor neum
+Ġpr i
+Ġser otypes
+Ġj ad
+Ġdisc ourse
+Ġli ked
+Ġref ill
+Ġfl c
+Ġet post
+Ġes e
+Ġhyp oplastic
+Ġexpl os
+Ġpub ic
+Ġimmun ocyt
+Ġz ofen
+Ġil le
+Ġbm al
+Ġemerg es
+Ġmir t
+Ġorth ostatic
+Ġbil oba
+Ġspect roscopic
+Ġinteg ron
+Ġinterp ol
+Ġldl r
+Ġce us
+Ġhemat emesis
+Ġmig rating
+Ġcereb ellum
+Ġcompreh end
+Ġtb m
+Ġnit rates
+Ġblind ly
+Ġnm ba
+Ġepithelial ization
+Ġcolleag ue
+Ġintrod uces
+Ġtt o
+Ġintegr ates
+ophil a
+Ġsom n
+Ġspeed s
+Ġphyt oconst
+Ġng r
+Ġses qu
+Ġmicroc yst
+Ġchole lithiasis
+Ġmanip ulated
+Ġfn eda
+Ġkr g
+Ġintermitt ently
+Ġabc am
+Ġhaemorrh agic
+Ġturb inate
+Ġdy ads
+Ġresemb led
+pept idase
+Ġjoh n
+Ġmant el
+Ġheterozyg ote
+Ġfoster ing
+Ġalk yl
+Ġtransd ermal
+Ġeuc al
+Ġpublish ing
+Ġdeliber ately
+Ġvign ette
+Ġcrush ed
+Ġmicronutri ent
+Ġmicrovessel s
+Ġpyram idal
+Ġunderpin ning
+Ġdeparaffin ized
+Ġsubfraction s
+further more
+Ġenthes itis
+Ġsubspec ial
+Ġborrel ia
+Ġwheelch air
+Ġshand ong
+Ġcrim inal
+Ġchamom ile
+Ġpilocar pine
+Ġelectrochemilumines cence
+Ġhydroxychlor oquine
+Ġzofen opril
+0 6
+h ans
+n is
+Ġs ulin
+Ġo u
+Ġc en
+Ġw ife
+Ġd ong
+Ġd de
+Ġb kv
+an um
+an yl
+ar ction
+Ġh ig
+Ġst ric
+Ġwith holding
+Ġg oth
+Ġas ph
+Ġfor sy
+Ġr and
+Ġr no
+ir it
+Ġch ocol
+Ġim h
+st y
+pl en
+Ġcl b
+Ġsc fe
+ast igotes
+Ġap n
+Ġreg ress
+Ġcell ulose
+Ġsub cellular
+oth ane
+ract able
+Ġpr inter
+Ġpo ult
+Ġcr n
+Ġte fl
+Ġra man
+Ġgl ans
+Ġsome how
+Ġform ulating
+ival ence
+Ġexc av
+Ġer p
+Ġelect ros
+Ġimplant ations
+Ġextra intestinal
+Ġlymph angi
+Ġpur ulent
+Ġbar r
+Ġepid emics
+Ġrev olution
+he i
+Ġmagn et
+wh en
+Ġhis pan
+Ġmel asma
+Ġpt mc
+Ġaccum ulates
+Ġdescript ors
+Ġpm ns
+Ġtransf emoral
+Ġunc or
+Ġtri acylglycer
+Ġbrush es
+Ġboard ing
+Ġdop a
+Ġtail or
+Ġcephal ic
+Ġhol id
+Ġts n
+Ġpad s
+Ġelucid ating
+Ġglomer uli
+Ġprompt ing
+Ġstaphyl ococcal
+Ġfc m
+Ġacetyl sal
+abs orb
+Ġtmj s
+Ġnb nc
+Ġexhaus ted
+Ġmaxim ally
+Ġsan itation
+Ġtk r
+Ġcoinc idence
+Ġaet iologies
+Ġreass urance
+Ġtrap ped
+Ġtang ent
+Ġbh p
+Ġbh t
+Ġsab oura
+Ġisot ope
+Ġbright ness
+Ġscf as
+Ġtuber osity
+Ġlegis l
+Ġgj d
+Ġnephrot oxic
+Ġbacteri oph
+Ġbuty ric
+Ġwel c
+Ġsext ant
+Ġree valu
+Ġcemento enamel
+Ġasi atic
+Ġaneuploid y
+Ġwhisk ers
+Ġgq d
+Ġhpdl cs
+Ġcary ophyll
+Ġvbr b
+021 47
+Ġtolu ene
+Ġdandel ion
+Ġsulin dac
+Ġtefl on
+Ġsaboura ud
+0 71
+c yt
+d q
+f ound
+g re
+i ren
+l ore
+z a
+Ġt ied
+Ġt ls
+Ġp ist
+Ġan ions
+it age
+Ġf x
+Ġb ough
+Ġb fs
+as a
+Ġe go
+ul is
+ul ary
+Ġn ca
+Ġn alb
+Ġg cc
+ra cheal
+Ġv erm
+Ġv sc
+Ġr ush
+ical c
+Ġis oflav
+Ġor n
+Ġch ips
+Ġpre inc
+Ġac ini
+Ġwe p
+pe ak
+Ġtr iv
+ong ru
+rol ina
+Ġinv it
+Ġinv ade
+osp ira
+Ġdep olar
+Ġend orph
+Ġty phi
+Ġtra ys
+Ġgl az
+Ġmult ior
+ox amine
+Ġimp ose
+Ġpar at
+Ġi oss
+Ġmort is
+Ġ3 20
+Ġes ters
+Ġz ro
+00 1
+Ġhem ophilia
+Ġsmok eless
+amin ase
+Ġdev oted
+Ġmac rom
+Ġax s
+Ġpd d
+Ġspecial ization
+Ġpolym eric
+Ġhal othane
+Ġdil ator
+Ġrev is
+Ġmagn itudes
+Ġclinic o
+onia z
+Ġip o
+Ġsuscept ibilities
+Ġsess ile
+Ġsd h
+Ġart em
+Ġrh r
+Ġtransl ating
+Ġdement ed
+Ġna h
+Ġna phth
+Ġtom ato
+Ġid o
+Ġchol era
+Ġuk as
+17 99
+Ġmach in
+Ġrup tures
+Ġlob ar
+Ġprote omics
+Ġlimb ic
+Ġsig e
+Ġanalyt es
+Ġdermat ologist
+Ġbic y
+Ġhydroxy urea
+Ġtun isia
+Ġcrani oc
+aden oma
+otin ine
+Ġvacu oles
+Ġacknowled ging
+Ġfavor ably
+Ġunders erved
+Ġerg onomics
+Ġchemo attract
+Ġobstet rical
+Ġku h
+Ġheavi er
+Ġabl ative
+Ġmol ds
+Ġdy es
+Ġvene er
+Ġvene ering
+Ġworry ing
+Ġrenew ed
+Ġmeg akary
+Ġrms sd
+Ġstir ring
+Ġpartition ed
+Ġhyster oscopic
+Ġinterven ing
+Ġerythrop oiesis
+Ġflash es
+Ġruss ian
+Ġprosth odont
+Ġmanoeuv re
+uph ine
+Ġawa iting
+Ġinterconn ected
+Ġtremend ous
+Ġjpy w
+Ġimpract ical
+Ġsuccinyl choline
+Ġcyanoac rylate
+Ġbism uth
+Ġeucal ypt
+Ġhispan ics
+Ġnalb uphine
+; .
+r ix
+in atum
+re ds
+Ġp ons
+Ġin ward
 Ġan ym
-Ġan aphyl
-Ġan abolic
-Ġan eg
-Ġan war
-Ġan encephaly
-Ġf om
-Ġf ess
-Ġf are
-Ġf ay
-Ġf ared
-Ġf ire
-Ġf ond
-Ġf les
-Ġf ages
-Ġf ade
-Ġf sts
-Ġf ps
-Ġf ont
-Ġf fe
-Ġf ishing
-Ġf tm
-Ġf ighting
-Ġf ellow
-Ġf hi
-Ġf ascial
-Ġf iro
-Ġf eces
-Ġf xa
-Ġf umar
-Ġf uchs
-Ġf iji
-Ġf esem
-Ġd x
-Ġd in
-Ġd ar
-Ġd ies
-Ġd ib
-Ġd ell
-Ġd ong
-Ġd ome
-Ġd ass
-Ġd ile
-Ġd te
-Ġd ds
-Ġd ough
-Ġd ines
-Ġd elf
-Ġd aren
-Ġd read
-Ġd de
-Ġd pi
-Ġd nas
-Ġd hs
-Ġd ipping
-Ġd zz
-Ġd icalcium
-Ġd ako
-Ġd ammas
-Ġd ntp
-Ġm k
-Ġm z
-Ġm ing
-Ġm ab
-Ġm up
-Ġm ot
-Ġm um
-Ġm ari
-Ġm ong
-Ġm ug
-Ġm ct
-Ġm esti
-Ġm ack
-Ġm te
-Ġm tor
-Ġm ll
-Ġm oss
-Ġm ort
-Ġm eral
-Ġm itis
-Ġm isc
-Ġm uk
-Ġm ission
-Ġm ams
-Ġm ocking
-Ġm ogh
-at y
-at ti
-at th
-at le
-at ul
-at un
-at ell
-at rol
-at ct
-at ered
-at tem
-at tain
-at te
-at ox
-at to
-at ov
-at ry
-at tg
-at acc
-at ada
-at urity
-at cat
-at rans
-at urations
-or is
-or ize
-or ations
-or ans
-or ting
-or ized
-or ological
-or ough
-or ily
-or af
-or anes
-or row
-or lin
-or rec
-th a
-th s
-th en
-th at
-th ro
-th ion
-th rom
-th em
-th est
-th one
-th ose
-th ym
-th mia
-th ora
-th enia
-th ritol
-th ickness
-an in
-an ent
-an ing
-an ly
-an ate
-an ial
-an ide
-an gth
-an ization
-an terior
-an gi
-an yl
-an imal
-an ins
-an ella
-an ians
-an ik
-an idium
-an illa
-an zhou
-an uclear
-Ġand ersson
-Ġand ean
-Ġand reas
-Ġand alusia
-Ġb n
-Ġb ion
-Ġb ore
-Ġb ull
-Ġb ach
-Ġb ans
-Ġb cc
+or se
+Ġb gc
+Ġre rt
+Ġre wards
+Ġst alk
+om on
+Ġl onic
+et ts
+Ġg es
+Ġas cs
+Ġas ca
+il ate
+Ġv ns
+ch ec
+ot roph
+iv ers
+ag ens
+Ġis oniaz
+Ġor if
+oc ap
+Ġinc ongru
+Ġat v
+og g
+og roup
+st ar
+Ġac i
+ia pine
+per idin
+Ġdi aries
+Ġinf erential
+Ġab g
+Ġk sy
+Ġext ensions
+Ġwho qol
+ile ction
+Ġso ce
+Ġpred ilection
+Ġsec uk
+Ġmic elles
+Ġgra in
+Ġclass ifies
+Ġhyp okines
+Ġhypert ensives
+Ġml st
+Ġscre ens
+Ġbacter iological
+Ġmm u
+Ġmid brain
+Ġventil ators
+ole an
+Ġreact s
+Ġhs i
+Ġneuro genesis
+Ġrad ion
+Ġconsent ing
+Ġvisual izing
+Ġpc ia
+imin arily
+Ġhemat opoiesis
+Ġport ray
+Ġregular ity
+Ġip tw
+Ġpet co
+Ġoh p
+Ġht m
+Ġden v
+Ġown ed
+Ġphot ob
+Ġcat abolism
+Ġmp ns
+Ġpf cc
+Ġft o
+Ġcortic otomy
+Ġnight s
+Ġdiag rams
+Ġsulf ur
+Ġple omorphic
+Ġdisrup ts
+Ġacquisition s
+Ġsi ha
+Ġmask ing
+Ġamel oblastoma
+att le
+Ġexch anged
+Ġinnov ations
+Ġmun ich
+Ġcircumst ance
+Ġstret ched
+Ġbiomechan ics
+Ġmodest ly
+Ġempow ering
+Ġnad h
+Ġimmob ilized
+Ġthym idine
+Ġcoinc ides
+Ġvaccin ations
+Ġflush ed
+bul bin
+Ġfus obacterium
+Ġira e
+Ġdrill s
+Ġwhe at
+Ġenjoy ment
+Ġoz on
+Ġnag asaki
+Ġeyel ash
+Ġcoar ctation
+Ġdios bulbin
+Ġquinol one
+Ġparaf unctional
+Ġtian jin
+Ġthyrot oxic
+Ġconscientious ness
+Ġabat acept
+Ġquet iapine
+Ġeloqu ent
+Ġprel iminarily
+Ġepitheli oid
+Ġsesqu iter
+Ġbough t
+Ġanym ore
+Ġsecuk inumab
+c ontrol
+g ut
+g ene
+v est
+re lation
+on se
+Ġo ge
+Ġp ause
+Ġin ch
+Ġin growth
+it ical
+Ġof d
+Ġf ucoid
+Ġd orm
+Ġm ia
 Ġb ak
-Ġb ish
-Ġb ough
-Ġb gi
-Ġb ros
-Ġb ae
-Ġb ama
-Ġb omb
-Ġb wa
-Ġb han
-Ġb dx
-Ġb udd
-Ġb aker
-Ġb ogg
-Ġb inge
-Ġb ird
-Ġb irc
-Ġb km
-Ġb arium
-is n
-is en
-is er
-is ce
-is el
-is trib
-is eness
-is econd
-is lative
-is oara
-as or
-as om
-as ter
-as tr
-as ad
-as ia
-as tal
-as ized
-as hes
-as ured
-as ters
-as omal
-as pha
-as urable
-as aj
-as thenia
-ent ation
-ent ritt
-ent erology
-ic on
-ic uc
-ic ke
-ic acy
-ic ator
-ic ides
-ic ules
-ic iting
-ic ella
-ic ellular
-ic atively
-ing er
-ing ed
-ing osine
-ing aki
-ro e
-ro in
-ro le
-ro sion
-ro cent
-ro sed
-ro va
-ro ids
-ro scopic
-ro scope
-ro aches
-ro best
-ro version
-ro gating
-ro test
-ro benz
-ro tene
-ar al
-ar at
-ar or
-ar us
-ar im
-ar ity
-ar ate
-ar ach
-ar ater
-ar te
-ar cin
-ar ns
-ar ina
-ar son
-ar affin
-ar zi
-ar ani
-ar fism
-Ġre y
-Ġre up
-Ġre ut
-Ġre fere
-Ġre op
-Ġre vel
-Ġre its
-Ġre though
-Ġre lying
-Ġre pre
-Ġre organ
-Ġre bal
-Ġre hard
-Ġre amed
-Ġre introduc
-Ġre introduction
-Ġre versal
-Ġre forms
-Ġre using
-Ġre activated
-Ġre analy
-Ġre venue
-Ġre weighted
-Ġre infection
-Ġre bec
-Ġre nton
-Ġre classified
-Ġre built
-Ġre zif
-Ġto e
-Ġto t
-Ġto es
-Ġto ul
-Ġto ly
-Ġto ur
-Ġto ile
-Ġto ms
-Ġto ss
-Ġto sc
-Ġto ffee
-Ġto la
-Ġto lbert
-Ġh ud
-Ġh ts
-Ġh un
-Ġh ers
-Ġh ull
-Ġh ue
-Ġh ill
-Ġh ans
-Ġh ass
-Ġh ide
-Ġh mo
-Ġh ack
-Ġh ood
-Ġh ob
-Ġh omet
-Ġh ics
-Ġh omic
-Ġh och
-Ġh oh
-Ġh ca
-Ġh igg
-Ġh ilt
-Ġh mp
-Ġh iding
-Ġh itting
-Ġh att
-Ġh amp
-Ġh ams
-Ġh unt
-Ġh eners
-Ġh ilum
-Ġh eck
-Ġh ansen
-Ġh ermann
-Ġh ickman
-Ġh ench
-le es
-le ment
-le tic
-le ted
-le ver
-le igh
-le ther
-le wa
-le ash
-le aved
-le thal
-le ander
-le idom
-le welly
-le arns
-Ġe un
-Ġe uc
-Ġe ys
-Ġe ber
-Ġe jec
-Ġe ust
-Ġe af
-Ġe bmt
-Ġe ik
-Ġe hu
-Ġe iff
-Ġe uv
-it in
-it ant
-it ous
-it ee
-it ors
-it onal
-it rix
-it ters
-it ra
-it ope
-it ories
-it onin
+Ġe pec
+Ġn pr
+Ġn ostril
+Ġl gg
+id ad
+id ian
+ab lation
+Ġbe aut
+Ġal gin
+Ġis ov
+Ġat enol
+act iv
+Ġad ap
+Ġco infection
+Ġdes ensit
+ass ed
+Ġspec ulative
+Ġj rl
+Ġstr ut
+Ġdist ract
+Ġfir ing
+Ġma e
+Ġi ol
+ok es
+Ġps v
+Ġset tle
+Ġcoh en
+Ġhem oc
+oph obia
+Ġcd x
+Ġpsych oactive
+Ġsaf egu
+Ġdec alc
+Ġcoll oids
+Ġaccess ion
+Ġsepar ations
+Ġvas p
+Ġhome ostatic
+Ġbo olean
+otox in
+Ġtg a
+opro fen
+Ġge ography
+Ġpac ed
+Ġmp ap
+Ġpriv ile
+Ġlang er
+Ġds dna
+Ġhemorrh oids
+rel la
+Ġpay ers
+Ġuns ur
+Ġka rol
+Ġka iser
+Ġwant ing
+Ġfoot ball
+Ġrelax ants
+Ġpig mented
+Ġice a
+anth us
+Ġerup t
+Ġpip ette
+Ġhydroxy vitamin
+Ġvt q
+pen oid
+Ġpin p
+Ġkh z
+Ġhv pg
+Ġtann in
+Ġthym ol
+ulf ate
+Ġlic ense
+Ġequilib ration
+Ġsic u
+Ġpriorit ization
+Ġmist aken
+Ġantip yre
+ez ing
+Ġumbil icus
+Ġcens oring
+Ġspermat ozoa
+Ġpunct ured
+Ġhusb ands
+Ġhypom ineral
+Ġanaesthet ized
+Ġdeser ve
+Ġsert oli
+Ġaminoglyc oside
+Ġyl ls
+Ġdav id
+Ġnaturo pathic
+Ġintrad ermal
+Ġseropos itive
+rat entorial
+Ġtrac ked
+Ġnebul ized
+Ġshar ps
+Ġkre bs
+Ġpestic ides
+Ġmetac arp
+Ġciocalte u
+Ġturc ica
+Ġlaypers ons
+Ġdenature d
+Ġpromin ently
+Ġsuburb an
+Ġcircums cribed
+Ġasph yx
+Ġchocol ate
+inatum omab
+Ġfucoid an
+Ġatenol ol
+l ays
+p etic
+q ing
+r ath
+w ood
+Ġ ies
+Ġs ider
+Ġc ied
+Ġc otinine
+Ġp ione
+Ġw ro
+Ġf an
+Ġf ake
+Ġf umar
+or oot
+Ġd st
+Ġand rogenic
+Ġb art
+Ġb cp
+Ġre inter
+Ġn pm
+os ities
+ra ulic
+ch ester
+ot on
+Ġr bp
+ist ed
+oc ultural
+est one
+ib rotic
+Ġcomp ressing
+Ġsh ip
+ip ient
+Ġass ets
+Ġac nes
+orm ack
+ia a
+Ġdi ethyl
+Ġap ically
+Ġrec urred
+Ġun pro
+Ġun rup
+ill es
+Ġant iph
+Ġbl inatumomab
+ak uch
+ric k
+ater gic
+Ġrem un
+Ġatt emp
+Ġhyper secre
+Ġindividual ised
+Ġchild care
+Ġmedic aments
+Ġps r
+Ġps w
+Ġrep ar
+Ġrep ression
+Ġrep ository
+Ġfe a
+Ġep vs
+Ġop rk
+Ġz f
+Ġcyt ore
+Ġii h
+Ġtumor ous
+Ġlab s
+Ġct d
+Ġflow ing
+Ġhand held
+Ġbre f
+Ġlocal isation
+Ġcann ulas
+Ġaccount able
+Ġangi ographically
+Ġadip ocyt
+Ġface book
+pr ising
+Ġge ometrical
+Ġstre et
+bb b
+Ġcat s
+Ġvar ico
+Ġenter oscopy
+Ġpriv ately
+Ġdistress ing
+Ġinfect ing
+Ġrv d
+Ġba ro
+Ġdiarrh eal
+Ġpotent iation
+Ġbox plots
+Ġara chn
+Ġhm ox
+Ġnr k
+Ġtor onto
+Ġquick er
+arth rosis
+Ġtrust ing
+Ġhomogen ization
+Ġug s
+Ġgf i
+Ġdiaph yseal
+Ġgn ri
+Ġrm r
+Ġscler otic
+Ġsun screen
+Ġvict oria
+Ġlamin ar
+Ġcollateral s
+Ġnst e
+Ġcoc c
+Ġpriorit izing
+Ġfruct osamine
+phosph ory
+Ġsubcateg ory
+Ġves icular
+Ġpurs uing
+Ġvox els
+Ġsock ets
+Ġgynaec ology
+Ġreposition ed
+Ġsomat osensory
+Ġbatch es
+Ġrestra ined
+Ġcritic ized
+Ġcondom s
+Ġsert raline
+ureth ral
+Ġdlp fc
+Ġdysm otility
+Ġdecel eration
+Ġnyst atin
+Ġfranc is
+Ġrrm m
+Ġflud arabine
+Ġscott ish
+Ġneuroph ys
+Ġoverdist ension
+Ġacetylsal icylic
+Ġunsur prising
+Ġunrup tured
+akuch inone
+2 99
+8 23
+b m
+b ox
+c at
+m ond
+x f
+Ġt id
+Ġs x
+Ġs pro
+Ġin lay
+Ġd ome
+Ġd med
+Ġm uric
+as th
+ro th
+Ġh ay
+Ġn x
+Ġst ing
+Ġg cl
+Ġcon cise
+od ox
+Ġr ls
+oc ine
+Ġch ung
+Ġch amp
+Ġle b
+Ġle h
+ac ral
+Ġint end
+Ġy kl
+Ġact u
+Ġcr on
+ep id
+Ġboth ers
+Ġcomm od
+ograph ical
+Ġrelated ness
+Ġdr ives
+Ġmon oxide
+Ġmin ds
+yl obacter
+Ġcalc itonin
+Ġpe an
+Ġhyper inflation
+Ġins ect
+uss is
+ont in
+Ġic v
+Ġnormal ised
+ung als
+Ġconduct ive
+Ġsens ibility
+Ġmicro plates
+Ġpoly ureth
+Ġq wl
+Ġequ itable
+Ġill icit
+Ġoste olytic
+Ġoste ochondral
+Ġlength y
+Ġu fh
+Ġdev ised
+Ġvir gin
+Ġcomplex ities
+Ġrecept ion
+Ġwall ed
+Ġax ons
+inc ense
+Ġig d
+Ġangi opoietin
+Ġgu il
+Ġglob us
+Ġalt ru
+Ġlist ing
+Ġendothelial ization
+Ġ19 98
+Ġbrief ing
+Ġpm ol
+Ġcellular ity
+Ġhar ris
+Ġaer ated
+Ġinadequ acy
+Ġba rot
+Ġsph en
+Ġmyel in
+Ġhost s
+Ġpts s
+Ġirradi ance
+Ġrr ms
+Ġallevi ates
+Ġhair s
+Ġexacerb ates
+Ġcg mp
+Ġrig our
+aria e
+ched uled
+Ġsuperf amily
+Ġantif ungals
+anth in
+Ġcust omer
+Ġbrach y
+Ġolig onol
+Ġfre ib
+Ġdiscl osing
+Ġarteri olar
+Ġtk is
+Ġri y
+Ġhind ers
+Ġnv h
+Ġglutam atergic
+Ġumb rella
+Ġbit ew
+Ġextrapol ate
+Ġofficial s
+Ġinterviewe e
+Ġinaccur acies
+Ġpup illary
+Ġcamp ylobacter
+Ġscalp el
+Ġlved p
+Ġfrank incense
+Ġdichlor ofluores
+Ġexem ption
+Ġlent iviral
+Ġremind ed
+Ġoverwhel med
+Ġcatast roph
+Ġphr ases
+Ġdisproportion ate
+Ġdif luoride
+Ġparkinson ism
+Ġmich igan
+Ġfla ws
+Ġcoverslip s
+Ġretr usion
+Ġcommens al
+Ġchim eric
+Ġperc ussion
+Ġharpag oside
+Ġelectrosp ray
+Ġjad ad
+Ġmultior gan
+Ġattemp ters
+Ġvarico ce
+0 4
+f ig
+h om
+Ġ iph
+Ġs ax
+al atal
+Ġan is
 it arian
-it rea
-it robenz
-us ins
-us iveness
-us awa
-us ceptive
-us uke
-ation ary
-ation ality
-Ġst d
-Ġst z
-Ġst ent
-Ġst ur
-Ġst ati
-Ġst ab
-Ġst um
-Ġst rom
-Ġst ee
-Ġst ance
-Ġst atis
-Ġst ood
-Ġst aw
-Ġst yl
-Ġst arch
-Ġst och
-Ġst acks
-Ġst amp
-Ġst agg
-Ġst oll
-Ġst uates
-Ġst rapped
-Ġst yrene
-Ġst uck
-Ġst ahl
-Ġst adium
-Ġst omma
-Ġst alking
-Ġst ationary
-ere ther
-ere br
-ere ogeneity
-ere nce
-ere bell
-ere sthesia
-ul is
-ul ent
-ul os
-ul ding
-ul se
-ul ants
-ul pt
-ul ins
-ul man
-ul gg
-ul ograms
-ul opathy
-ul ana
-ul gar
-ul anic
-ul omegal
-ac i
-ac id
-ac ile
-ac ct
-ac ities
-ac ode
-ac att
-ac agg
-ac alc
-ac gt
-ac aine
-ac itating
-ac ctg
-ac uated
-ac aca
-ac gga
-ac agtt
-ve a
-ve y
-ve ments
-ve ct
-ve itis
-ve fl
-ec ity
-ec ess
-ec ke
-ec aps
-ec otomy
-ec tious
-ec osystem
-ec anoic
-ec ourse
-Ġl v
-Ġl il
-Ġl uc
-Ġl iz
-Ġl ore
-Ġl op
-Ġl end
-Ġl ug
-Ġl ied
-Ġl iti
-Ġl uted
-Ġl ang
-Ġl inc
-Ġl ighted
-Ġl anes
-Ġl ca
-Ġl umb
-Ġl au
-Ġl ively
-Ġl ange
-Ġl actic
-Ġl ai
-Ġl umin
-Ġl enet
-Ġl arynx
-Ġl aryng
-Ġl ira
-Ġl mu
-Ġl uck
-Ġl ighter
-Ġl enn
-Ġl apa
-Ġl alla
-Ġl aryngo
-Ġl onza
-Ġl anzhou
-Ġl arson
-Ġl lewelly
-om i
-om s
-om ad
-om ers
-om ach
-om ass
-om ized
-om ian
-om inal
-om gro
-om eric
-om ography
-om ogenous
-om otor
-om edic
-om edics
-om pet
-om acs
-om strand
-om ouc
-om oniasis
-Ġn k
-Ġn n
-Ġn ul
-Ġn id
-Ġn ip
-Ġn ance
-Ġn ag
-Ġn ets
-Ġn irm
-Ġn ih
-Ġn az
-Ġn air
-Ġn ops
-Ġn emat
-Ġn emen
-Ġn chs
-Ġn alc
-Ġn lr
-Ġn lk
-Ġn enets
-im at
-im it
-im id
-im ate
-im ary
-im atic
-im ately
-im ental
-im ony
-im ara
-im edes
-im etrically
-Ġg is
-Ġg ur
-Ġg and
-Ġg ase
-Ġg yp
-Ġg ak
-Ġg br
-Ġg ha
-Ġg ics
-Ġg ilm
-Ġg ets
-Ġg pa
-Ġg iver
-Ġg athers
-Ġg tex
-Ġg ams
-Ġg arc
-Ġg soft
-Ġg arth
-Ġg gt
-Ġg izan
-Ġg alp
-Ġg ogg
-Ġg emt
-Ġg avage
-Ġg sk
-Ġg assed
-Ġg estation
-Ġg illing
-Ġg ecs
-Ġg arn
-Ġg dna
-Ġg inig
-Ġg alvanic
-Ġg atto
-ly l
-ly tics
-ly cidyl
-ur n
-ur y
-ur in
-ur ip
-ur sion
-ur ved
-ur ist
-ur ization
-ur ational
-ur ities
-ur ably
-ur ino
-ur oradi
-ur vey
-ig y
-ig an
-ig us
-ig ating
-ig ms
-ig ently
-ig ibility
-ig ung
-ig rants
-ig ara
-ig rams
-ig erence
-Ġwi en
-Ġwi red
-Ġwi fe
-Ġwi ped
-Ġwi pes
-Ġwith st
-Ġwith hol
-ud ent
-ud os
-ud all
-ud ication
-ud io
-ud arzi
-et z
-et ment
-et les
-et ect
-et abol
-et tes
-et een
-et ano
-et gee
-et uses
-os it
-os il
-os ted
-os ion
-os pl
-os ome
-os itive
-os yn
-os yl
-os itis
-os pital
-os omatic
-os ra
-os ci
-os etting
-os ample
-os trip
-os pore
-os pas
-os arcin
-ce ived
-ce mented
-ce gen
-Ġwas hes
-Ġwas for
-Ġwas filt
-if e
-if i
-if al
-if lu
-if fer
-if ference
-if fs
-if ert
-if ei
-if eng
-if ferenti
+Ġf ad
+or and
+Ġd ir
+Ġm oring
+ro red
+Ġe ular
+us able
+ur ant
+Ġas xl
+Ġv co
+Ġv ili
+am ides
+Ġres et
+Ġde activation
+ib us
+og y
+Ġpre albumin
+ip idus
+Ġco enzyme
+Ġhe e
+Ġit ra
+Ġrec umbent
+Ġsub q
+Ġsub lux
+Ġph asic
+Ġris c
+Ġbl f
+Ġcor nea
+Ġpr ick
+Ġra ms
+Ġdr illed
+Ġimp eding
+ok a
+Ġsome body
+Ġhyper ker
+Ġins ipidus
+af or
+Ġbefore hand
+Ġav ulsion
+Ġmedic ament
+Ġfe ared
+Ġear l
+Ġep stein
+Ġmy cel
+Ġimmun ogenicity
+Ġz a
+Ġmicro wave
+Ġsol di
+Ġconcentr ating
+Ġextra version
+Ġsw ine
+Ġinstit uted
+Ġhb i
+Ġhb m
+Ġmir rored
+Ġcann ulated
+Ġx a
+Ġsn ail
+Ġsn ake
+Ġmd rd
+Ġcort ices
+Ġov id
+Ġeurope ans
+Ġped ic
+opro te
+Ġrt is
+Ġten fold
+Ġlig ating
+10 9
+Ġleg it
+Ġfix ing
+oz o
+Ġoct ad
+Ġmyel o
+Ġvolunte ered
+Ġpharmacological ly
+Ġsulf onyl
+Ġdest ination
+Ġsuperv ising
+Ġcephal ogram
+Ġsent ences
+Ġcarcin omatosis
+Ġautophag osomes
+Ġrf vi
+yr ib
+Ġwire less
+can cer
+Ġcari ogram
+Ġendometri oma
+vas cul
+Ġhaemat uria
+Ġtransp os
+Ġmanip ulations
+Ġdt i
+Ġpiv ot
+Ġswallow s
+Ġmamm als
+max imal
+Ġmicrobi omes
+Ġconstra int
+Ġaph eresis
+Ġath le
+Ġthal amic
+Ġdense ly
+Ġtriang ulation
+Ġdism iss
+Ġpun ishment
+Ġfb n
+Ġlg ib
+Ġphag ocytic
+Ġalert ness
+Ġactinomy ces
+Ġzn se
+Ġnaturo path
+meth ods
+Ġvigil ance
+Ġerrone ous
+Ġencl osed
+Ġplh iv
+Ġmetat arsal
+Ġlipof ect
+Ġglucone ogenesis
+Ġchlamyd ia
+Ġlyc ium
+Ġesophagogastroduoden oscopy
+Ġlonic era
+Ġisoniaz id
+Ġpolyureth ane
+Ġfreib urg
+b w
+c ain
+g li
+h igh
+u er
+at id
+at tt
+at racurium
+Ġo ecd
+Ġw oven
+al i
+Ġf bpa
+Ġd fa
+Ġd ynamically
+as terol
+an ic
+Ġe wd
+Ġn iss
+im plantation
+Ġwith stand
+th emia
+Ġas ma
+ab c
+Ġv iv
+Ġv and
+Ġr ce
+Ġr cr
+Ġr ss
+Ġr pr
+ag as
+act ed
+Ġsh c
+se a
+pl oys
+Ġne vi
+Ġint ractable
+Ġrec order
+Ġph ns
+Ġno ur
+Ġant ine
+Ġcol ons
+vent ive
+Ġtrans cutaneous
+Ġj am
+Ġj cs
+Ġproc ured
+Ġend ophytic
+Ġmon omeric
+yt oin
+ict ions
+Ġred o
+oid ectomy
+ival ent
+Ġmedic ated
+Ġps lr
+Ġintra abdominal
+Ġimpl aus
+oph ores
+Ġeduc ator
+ne ath
+Ġchronic ity
+Ġprop oses
+Ġprop ylene
+Ġlo ud
+Ġcer na
+Ġsw i
+Ġcam b
+Ġdev oid
+Ġneuro le
+Ġdiss ecting
+aps ular
+Ġlist ened
+Ġlat rine
+Ġpand emics
+Ġnas o
+old ed
+Ġuc lp
+Ġpv at
+Ġcarb ide
+10 1
+Ġillust rative
+Ġcovari ables
+16 3
+Ġseek s
+ai ke
+gl obulin
+Ġion ic
+Ġpilot ed
+Ġcoch lear
+Ġvo i
+Ġcontain ment
+Ġwithdraw als
+Ġlp v
+Ġperme able
+Ġect asia
+Ġmicros urgery
+Ġimbal anced
+Ġsarcop enic
+Ġcompartment al
+Ġpiv c
+Ġosteoclast ic
+Ġsoon er
+Ġhes peridin
+Ġinsignificant ly
+Ġabc b
+Ġum ec
+Ġdivertic ulosis
+Ġads orb
+Ġthr ive
+Ġopac ification
+Ġky ung
+Ġunderl ining
+ynchron ization
+Ġfibros ing
+Ġstir red
+Ġwake fulness
+Ġdeox yrib
+Ġchile an
+Ġphleb itis
+Ġunco up
+Ġprosth odontic
+Ġscra ped
+Ġflip ped
+Ġapd t
+Ġunderre porting
+Ġrav ulizumab
+omax illary
+Ġanaerob es
+Ġprocl ination
+Ġradioimmuno assay
+Ġphytoconst ituents
+Ġpoult ry
+Ġmuric ata
+Ġmoring a
+k r
+n ac
+r ata
+Ġt fa
+Ġt acks
+Ġa ed
+Ġs ra
+Ġs br
+Ġthe r
+Ġp ve
+Ġp eth
+al ine
+Ġf aint
+Ġd ak
+Ġd bc
+an x
+ct s
+ct tc
+Ġh en
+ul oplasty
+ur ich
+os igmoid
+im ed
+im plant
+Ġg ating
+Ġas o
+el n
+Ġv ca
+em bl
+Ġad cs
+Ġpre empt
+se p
+ac ological
+Ġcl ue
+Ġme atus
+uc idal
+Ġfo v
+Ġap atite
+Ġcons er
+Ġqu eries
+Ġy uan
+Ġbl unted
+cl ock
+Ġcol oured
+Ġser bia
+Ġunder neath
+cent rif
+Ġj ew
+Ġsp m
+Ġsp pb
+Ġfl air
+Ġcalc ar
+ec a
+ne uro
+Ġdistribut ing
+Ġpoly n
+Ġpoly sty
+Ġgluc ometer
+ram ycin
+Ġlip oic
+Ġsal id
+ind o
+Ġsat ur
+Ġinsulin omas
+Ġhf m
+Ġhf abp
+Ġsequ est
+Ġvir ucidal
+Ġmac roc
+Ġcv cs
+rob enz
+Ġak aike
+Ġdil u
+Ġhepat omegaly
+Ġann ounce
+Ġhom ology
+Ġnetwork ing
+Ġada ption
+Ġtb x
+Ġchi kv
+Ġsd nn
+Ġbio elect
+Ġcc ns
+Ġafric ans
+Ġaug ments
+Ġhydrox yt
+Ġtp p
+Ġfourth ly
+Ġcounter clock
+Ġabund ances
+14 4
+Ġfas cin
+Ġantigen ic
+Ġdh i
+Ġpron ation
+Ġcis atracurium
+Ġecc o
+Ġbrid ged
+Ġsenior ity
+Ġextr uded
+Ġcollabor ating
+Ġprofession ally
+Ġcra ft
+Ġtetra hyd
+Ġcontradict s
+Ġargin ase
+Ġpert ussis
+ogly can
+Ġtag ged
+Ġeconom ics
+Ġleuc ocytes
+Ġefficac ies
+ecan oic
+Ġdin it
+Ġque ue
+Ġhit achi
+Ġhallmark s
+Ġsymb ols
+Ġfic b
+Ġnavig ate
+Ġmycop h
+Ġhomozyg ote
+Ġsupras ellar
+Ġgib co
+Ġhydroly s
+Ġubiquit ination
+pow er
+Ġfulfil ment
+zz le
+Ġobsess ions
+Ġintriguing ly
+Ġinterrupt ions
+Ġhemangi oma
+Ġoutper form
+Ġalar ms
+Ġinadvert ent
+Ġmirr ors
+Ġsest rin
+Ġphthal ate
+comp ared
+Ġforgot ten
+Ġantidiarrh eal
+Ġforsy th
+Ġradion uc
+Ġthyrotoxic osis
+Ġbarot rauma
+Ġcounterclock wise
+v atinib
+Ġt ing
+Ġs ads
+Ġo oh
+Ġc ina
+Ġan us
+ic ence
+Ġd rows
+Ġm ict
+Ġb ore
+Ġh ots
+Ġl acer
+Ġg ip
+Ġg anciclovir
 if lora
-Ġfor a
-Ġfor k
-Ġfor amin
-Ġfor gone
-Ġfor get
-Ġfor bidden
-Ġfor got
-ol f
-ol ent
-ol am
-ol um
-ol ved
-ol ian
-ol ta
-ol uted
-ol ism
-ol ishing
-ol ense
-ol opl
-ol isation
-ol au
-ol actic
-ol anton
-Ġas ex
-Ġas ians
-Ġas ah
-Ġas crib
-Ġas ton
-Ġas ai
-Ġas phy
-Ġas accha
-Ġas vs
-Ġas xl
-il on
-il er
-il ent
-il un
-il ant
-il ical
-il ate
-il ution
-il ane
-il ator
-il ty
-il ink
-il arily
-il ton
-il tering
-il nius
-Ġcon qu
-Ġcon val
-Ġcon ner
-Ġcon formation
-Ġcon clusive
-Ġcon index
-od al
-od ied
-od ds
-od ities
-od ox
-od ental
-od ih
-od els
-od ialysis
-od ians
-od iver
-od yst
-od ulatory
-od iaz
-id u
-id en
-id ol
-id el
+il osis
+ra ying
+Ġv n
+Ġor list
+Ġsh ik
+Ġass ert
+Ġnot ified
+Ġassoci ating
+Ġy am
+Ġy ld
+Ġpo ct
+Ġcr bsi
+Ġsp oken
+eth ical
+Ġrem oves
+Ġgl ottic
+Ġimp art
+Ġpar ap
+ination al
+uct ively
+Ġmo a
+Ġz urich
+Ġct la
+Ġlip oma
+orph ine
+Ġquant itated
+Ġcer umen
+Ġdm ba
+Ġscreening s
+Ġcs le
+cem ic
+Ġphosph or
+Ġpcr s
+Ġig an
+Ġwhat man
+Ġx iao
+Ġip n
+Ġip t
+Ġhdl c
+Ġnit rop
+Ġprem align
+Ġrt i
+igen ic
+Ġden oting
+Ġhp f
+Ġflex ed
+Ġds pp
+Ġsem inal
+gg g
+Ġion ized
+Ġpod cast
+icin ch
+Ġnr c
+Ġsig lec
+Ġscr ipt
+Ġnk t
+Ġpk u
+Ġendometri oid
+Ġfu jian
+Ġram osetron
+Ġatmosph eric
+Ġsurrog ates
+Ġcarbapenem ases
+Ġplaus ibility
+Ġlam ellar
+Ġimmunomod ulators
+Ġescal ated
+Ġvisc ous
+Ġalex ith
+Ġoval e
+Ġhern ias
+Ġnitroglycer ine
+Ġcohes ion
+Ġeyel id
+Ġyl ds
+Ġarres ted
+Ġcomprehens iveness
+Ġwrap ped
+Ġomn ibus
+Ġcamk ii
+Ġeft r
+Ġsynonym ous
+Ġtextbook s
+Ġstan ford
+Ġafg han
+Ġstric ter
+Ġlipofect amine
+Ġpolysty rene
+Ġsalid roside
+Ġmycoph enol
+Ġdrows iness
+Ġhots p
+Ġorlist at
+Ġpremalign ant
+e pt
+g ib
+l one
+s ki
+z s
+Ġt pt
+Ġt br
+Ġt onic
+at cc
+Ġs sh
+Ġc iss
+Ġd ance
+Ġm dm
+Ġb icinch
+Ġre app
+Ġh ill
+Ġh nf
+Ġn di
 id ia
-id ist
-id ans
-id ered
-id onic
-id ou
-id az
-id adian
-id dens
-id gman
-id igung
-ow a
-ow ard
-ow ski
-Ġon o
-Ġon ych
-Ġon lay
-ment able
-ati f
-ati m
-ati es
-ati tic
-ati um
-ati ens
-ati fied
-ati fying
-ts total
-ts uki
-ts aun
-Ġor fs
-Ġor ino
-Ġor tiz
-Ġor chi
-Ġor top
-Ġor icell
-Ġor lady
-Ġor tob
-ab e
-ab adi
-ab etic
-ab ella
-ab ras
-ab owski
-un en
-un ic
-un ate
-un ba
-un oglu
-Ġstud i
-am as
-am ong
-am ities
-am ps
-am ping
-am ides
-am eric
-am aged
-am ella
-am ura
-am ora
-am bled
-am biguous
-am anik
-am abe
-tic ut
-tic ism
-tic eship
-Ġv ial
-Ġv and
-Ġv se
-Ġv ied
-Ġv olog
-Ġv ak
-Ġv ie
-Ġv gi
-Ġv oid
-Ġv to
-Ġv inc
-Ġv oy
-Ġv bm
-Ġv omer
-Ġv ime
-Ġv ocation
-Ġv gm
-Ġv yas
-Ġv ulgar
-Ġv ilnius
-res orbable
-res thesia
-res tha
-el ed
-el es
-el ion
-el and
-el ocol
-el man
-el ung
-el let
-el oad
-el ometry
-el ker
-el kv
-el sson
-el nick
-el igibility
-ter al
-ter ia
-ter ix
-ter ols
-ter inen
-up id
-up ilar
-up illary
-up uncture
-Ġal ow
-Ġal are
-Ġal ia
-Ġal ph
-Ġal ha
-Ġal dr
-Ġal ask
-Ġal iment
-Ġal sa
-Ġal oud
-Ġal sh
-Ġal dehy
-Ġal moh
-Ġal har
-Ġal car
-Ġal huda
-Ġal qer
-Ġal zhe
-Ġper ch
-Ġper ple
-Ġper fer
-Ġper uan
-Ġper acetic
-Ġper mount
-Ġr x
-Ġr ud
-Ġr if
-Ġr id
-Ġr uc
-Ġr ain
-Ġr ist
-Ġr ond
-Ġr ized
-Ġr uth
-Ġr br
-Ġr hes
-Ġr ne
-Ġr itt
-Ġr ayed
-Ġr dr
-Ġr umination
-Ġr stud
-Ġr onald
-Ġr agas
-Ġr gb
-Ġr uling
-Ġr ungs
-Ġr uos
-Ġr icuc
-Ġr arity
-Ġr ationality
-Ġwh ine
-Ġwh ipl
-Ġwh eezing
-Ġwh alen
-Ġex e
+ut ic
+ter ity
+Ġwh ipple
+op exy
+Ġch ea
+Ġat racurium
+og ing
+Ġpre g
+Ġsh ield
+Ġsh eds
+Ġsc ns
+Ġdi amine
+Ġha w
+Ġha pt
+vi en
+Ġpres et
+Ġun im
+Ġthere of
+Ġpos ing
+Ġar rays
+Ġpo em
+Ġcr d
+Ġen v
+Ġover represented
+Ġsup ination
+Ġra in
+osp atial
+Ġsp il
+Ġem ploys
+Ġty rp
+Ġappro ximal
+ob is
+oper i
+Ġmin oxid
+Ġed iting
+Ġsec uring
+Ġel usive
+Ġol t
+Ġhyp ointense
+Ġexpl ores
+Ġsin ensis
+Ġcd m
+Ġpoly neuro
+ves ical
+Ġisol ating
+Ġprop osing
+Ġsal vi
+ind ole
+Ġinsulin oma
+Ġflu v
+Ġpow ers
+Ġcs m
+emi us
+Ġview er
+Ġreact ing
+Ġutil ities
+Ġax on
+Ġneuro fib
+Ġtop ological
+Ġpsychological ly
+Ġcas el
+Ġcheck points
+Ġprox ies
+Ġpt cl
+ofil m
+Ġpet ros
+Ġspl ice
+Ġpv g
+Ġhaem ostasis
+Ġsha ved
+onin ic
+Ġcc p
+Ġprost atectomy
+Ġemp agliflozin
+Ġaort o
+ophys in
+Ġvul var
+ocl ax
+Ġsb f
+Ġbronch itis
+Ġcontrovers ies
+Ġker nel
+Ġperic or
+Ġjunction al
+Ġded uctive
+acc ording
+Ġrb m
+Ġpresum ptive
+Ġinfluenz ae
+Ġfavour ing
+Ġblank et
+Ġcytos orb
+Ġexhaus t
+Ġyog urt
+Ġglycos ylation
+Ġabbrevi ation
+Ġtk m
+Ġbrown ish
+Ġlen vatinib
+Ġpit fall
+Ġign oring
+Ġtol uid
+Ġconflu ency
+Ġprolactin omas
+Ġosc illation
+Ġmisclass ified
+Ġtriter penes
+Ġconjunct ivitis
+Ġgalact osidase
+Ġaband on
+Ġams terdam
+Ġarres ts
+Ġfemor is
+Ġmicronutri ents
+Ġcloth es
+Ġgras p
+Ġabort ions
+Ġpif b
+azep ine
+Ġadnex al
+Ġintim acy
+Ġunpre ced
+Ġyq fs
+Ġgoth enburg
+Ġaxs pa
+Ġmachin ery
+Ġantiph osph
+Ġarachn oid
+Ġleb anese
+Ġcina hl
+Ġmycophenol ate
+Ġchea per
+Ġminoxid il
+0 7
+d et
+m as
+m ates
+n ormal
+p inal
+w ater
+Ġt bo
+in burgh
+Ġc so
+Ġc umin
+Ġp ck
+Ġp ica
+Ġw i
+Ġf ch
+Ġf viii
+Ġd dh
+Ġm ms
+Ġb row
+Ġb vs
+ct gt
+Ġh pt
+Ġh its
+Ġg aze
+el astic
+ab er
+ch d
 Ġex port
-Ġex pects
-Ġex iting
-Ġex oph
-Ġex changed
-Ġex porting
-Ġex ostar
-Ġex oenzyme
-Ġex sangu
-ge an
-ge ber
-ge ym
-ge me
-ge mia
-Ġpro qu
-Ġpro form
-Ġpro hib
-Ġpro ps
-Ġpro line
-Ġpro plan
-Ġpro dig
-Ġpro karyotes
-Ġpro xies
-Ġres ver
-Ġres ort
-Ġres uture
-Ġres az
-Ġres ists
-Ġres izes
-Ġres pects
-Ġres urg
-Ġres ampling
-Ġres truct
-Ġres erved
-Ġres ample
-Ġres erves
-Ġres ecting
-Ġres ective
-Ġres erving
-Ġbe er
-Ġbe ech
-Ġbe ak
-Ġbe he
-Ġbe gg
-Ġbe aut
-Ġbe zm
-Ġbe aty
-Ġbe etles
-ion ine
-ion ix
-ion izing
-ion ibacterium
-uc ch
-uc onazole
-uc cally
-uc eno
-Ġthat the
-Ġcom a
-Ġcom is
-Ġcom itee
-tr up
-tr ad
-tr ical
-tr um
-tr ics
-tr acted
-tr imethyl
-ot as
-ot ate
-ot ally
-ot ons
-ot ency
-ot ool
-ot land
-ot eness
-ot als
-ot onin
-ot ocin
-ot trup
-Ġim b
-Ġim am
-Ġim por
-Ġim ip
-Ġim ark
-Ġim position
-Ġim press
-Ġim pressed
-Ġim ani
-Ġim idaz
-Ġis por
-Ġis of
-Ġis omet
-Ġis hib
-Ġis omal
-Ġis opro
-Ġis oflurane
-Ġis aac
-Ġis mail
-Ġis rct
-Ġis tat
-ant e
-ant an
-ant ly
-ant ou
-ad d
-ad u
-ad an
-ad ent
-ad ine
-ad dition
-ad ental
-ad ri
-ad den
-ad dam
-ad ata
-ad iaz
-ad zadeh
-ad asa
-ut a
-ut or
-ut ter
-ut ogenic
-ut omatic
-ut ense
-ut arate
-ess en
-ess es
-ess enz
-ir i
-ir ation
-ir ub
-ir ates
-ir yn
-ir ane
-ir cle
-ir ling
-ir anta
-ir sag
-ir angth
-ir abadi
-ver te
-ver bal
-Ġus able
-Ġus earch
-Ġus ui
-oc ent
-oc op
-oc ers
-oc ue
-oc ay
-oc ating
-oc ru
-oc yst
-oc rit
-oc uria
-oc onazole
-oc orre
-oc oronal
-oc onversion
-oc erebell
-qu i
-qu ant
-qu ia
-qu ality
-qu asi
-qu ennial
-iz el
-iz ant
-iz obium
-iz zled
-Ġch s
-Ġch ter
-Ġch ib
-Ġch ores
-Ġch ocol
-Ġch erv
-Ġch ees
-Ġch aper
-Ġch imes
-Ġch alo
-Ġch sy
-Ġch ao
-Ġch illed
-Ġch km
-Ġch aud
-Ġch lord
-Ġch zhan
-Ġch orological
-Ġch isel
-Ġch elion
-ies er
-ies is
-ate eb
-ate mporal
-Ġde ub
-Ġde ox
-Ġde uter
-Ġde uts
-Ġde identi
-Ġde acet
-Ġde activated
-Ġde otte
-Ġde escal
-ore tic
-ore ll
-ore nce
-ore activity
-ore fraction
-ore opmd
-ore flective
-ain es
-ain ab
-ain ted
-Ġinc ur
-Ġinc ogn
-Ġinc urable
-Ġinc arn
-Ġinc urring
-Ġinc entive
-ign e
-ign ac
-um i
+Ġis oelectric
+op razole
+est rogens
+ib at
+qu al
+og ranin
+st ra
+ac opp
+pl ace
+Ġcl oned
+Ġaf m
+Ġap f
+Ġk ang
+Ġpl i
+oth romb
+Ġy ms
+Ġy akuchinone
+Ġund ere
+ix ibat
+ep a
+Ġsp ac
+Ġgl ide
+ox itin
+Ġmon key
+Ġli ability
+Ġdid actic
+Ġed inburgh
+Ġmo e
+Ġlif ted
+Ġca iro
+Ġct m
+de velop
+Ġprol ine
+Ġsal ience
+Ġdeg rading
+Ġwa iver
+Ġunderstand ings
+Ġfacil itation
+Ġbra un
+Ġhydro d
+Ġplan ing
+Ġgastro cn
+sc ore
+Ġpharmac o
+Ġbro ch
+wh ich
+Ġgerm ac
+Ġrot a
+eli oma
+Ġdescript ively
+Ġleuk otri
+Ġsha hid
+Ġvar imax
+Ġglut ar
+Ġosteop ontin
+Ġpack aging
+Ġcardiomy opathies
+Ġah sct
+Ġupreg ulates
+Ġtail oring
+Ġmineral ocortic
+organ ized
+Ġpad i
+Ġile ocol
+Ġtf pi
+Ġkind ly
+Ġupd ating
+Ġinfarct s
+Ġencod e
+Ġbenz ene
+Ġtach yc
+Ġuncontrol lable
+Ġgm bh
+Ġrac ism
+Ġvill us
+Ġslic ed
+Ġcontrad iction
+Ġattain ing
+Ġlamin in
+Ġlb m
+Ġnanopart icle
+Ġchair side
+Ġphil ips
+Ġbav ms
+Ġcontamin ants
+Ġmultipl anar
+Ġrigorous ly
+Ġatl anta
+Ġtons ils
+Ġtrypt ic
+Ġspi ke
+Ġbcc s
+abl eness
+Ġfle cain
+Ġvirolog ic
+Ġncc n
+Ġmicrol iters
+Ġzym ography
+hem oglobin
+Ġreticul ocyte
+Ġhisti ocytes
+Ġtack le
+Ġsegreg ation
+Ġmang ostin
+Ġtle o
+Ġnicotin amide
+Ġwille ms
+Ġmiscon ceptions
+Ġoverf itting
+Ġconvol utional
+Ġsynapt ophysin
+Ġnutr itive
+Ġcaret akers
+architect ure
+Ġkuwa it
+Ġbipl ane
+Ġvenet oclax
+Ġtriv ial
+Ġchemoattract ant
+Ġalgin ate
+Ġcron bach
+Ġriy adh
+Ġhfm ref
+Ġfluv oxamine
+Ġtoluid ine
+Ġunpreced ented
+Ġflecain ide
+2 50
+e ider
+m ish
+n ot
+r us
+s imilar
+w ls
+Ġc ormack
+Ġp ineal
+Ġan ise
+Ġd ass
+Ġm na
+Ġb ites
+ar rays
+Ġre aming
+Ġe ot
+Ġn co
+Ġl ov
+if en
+Ġas dh
+Ġv ivid
+od ermal
+Ġr umin
+Ġr bbb
+am inal
+Ġor g
+Ġad i
+Ġpre ceptors
+ell s
+pe g
+pe ople
+ree k
+Ġk if
+Ġpl agl
+ose pt
+Ġun load
+Ġfin s
+Ġinv ite
+Ġte var
+Ġcomm iss
+Ġstr ang
+Ġdem ography
+Ġdr t
+Ġred dish
+Ġps h
+Ġps l
+Ġhem a
+Ġdel icate
+Ġdel usions
+yz ed
+oph arynx
+Ġca o
+Ġdistribut e
+Ġinst illation
+Ġlab a
+Ġsk ipping
+Ġbacter aemia
+Ġmat lab
+Ġsal ient
+Ġfree zer
+Ġstim ulations
+Ġsumm it
+Ġphen ytoin
+Ġcv a
+Ġmand ated
+Ġver ifying
+Ġiv a
+Ġrepl en
+aps ilosis
+Ġdl m
+Ġhemat ochezia
+Ġplay er
+Ġven n
+Ġmouth s
+Ġconstruct ive
+Ġlum inescence
+Ġsubstant iated
+Ġste ering
+Ġoh t
+Ġbio equ
+Ġcyst ectomy
+icular is
+Ġinterpret ive
+osen ess
+Ġpack s
+Ġarg ent
+Ġlook s
+Ġput s
+Ġsurround ings
+Ġsv t
+Ġpb st
+Ġple ura
+Ġcoch ran
+Ġwr f
+Ġhm w
+Ġter ipar
+Ġtur p
+Ġdh m
+Ġpig ments
+Ġsurpr ise
+Ġson ication
+Ġcef oxitin
+Ġconform ation
+Ġelic iting
+raum atized
+Ġsct g
+Ġtriang les
+Ġsmart phones
+Ġtab ulation
+Ġdivertic ulitis
+Ġthorac oscopic
+Ġdip stick
+Ġrash es
+Ġsolub ilized
+Ġunpa id
+Ġdin ucleotide
+Ġprogen itors
+Ġprolifer ator
+Ġchl oral
+Ġguang xi
+Ġstrugg ling
+Ġperpet rators
+Ġadvert ising
+Ġangel es
+Ġtriph osphate
+Ġnest s
+Ġsupers cript
+Ġglab rata
+Ġenterpr ises
+Ġnich e
+Ġchemopre ventive
+Ġregistr ars
+Ġphal anx
+Ġisoprop anol
+Ġnanoem ulsion
+Ġmalod or
+Ġacycl ovir
+Ġgss g
+Ġchur ch
+Ġphosphatid ylinositol
+��kup ffer
+Ġprud ent
+Ġhypersecre tion
+Ġrams ay
+Ġpreempt ive
+Ġgastrocn emius
+Ġteripar atide
+c ps
+d st
+f ood
+l on
+p ds
+Ġt ess
+Ġp ue
+es on
+Ġf ate
+as pase
+Ġh x
+Ġh gg
+Ġto fr
+Ġst ood
+Ġl oper
+im od
+ce a
+ol n
+Ġv ire
+od ular
+ot ong
+em atic
+Ġal isk
+ag tt
 um es
-um ping
-um ped
-um arin
-um ann
-um dar
-um onen
-pl on
-pl ated
-pl ication
-pl aced
-pl atin
-pl aces
-pl aque
-pl icable
-Ġgro pus
-Ġme f
-Ġme k
-Ġme ib
-Ġme ij
+Ġres ect
+Ġres az
+ad or
+rom al
+Ġsh f
+ac cess
+Ġdis ulf
+Ġhe el
 Ġme yer
-Ġby stand
-ure n
-ure ment
-Ġat e
-Ġat ec
-Ġat act
-Ġat rop
-Ġat opy
-Ġat mega
-Ġat atct
-Ġat elocol
-Ġpre cr
-Ġpre cal
-Ġpre co
-Ġpre fr
-Ġpre max
-Ġpre odont
-Ġpre hist
-Ġac s
-Ġac ar
-Ġac ms
-Ġac yl
-Ġac pa
-Ġac ron
-Ġac ker
-Ġac umin
-Ġac etal
-Ġac ini
-Ġac rid
-Ġac aact
-Ġac arophobia
-Ġac upuncture
-ys er
-ys ide
-ys can
-ys terols
-Ġcomp ass
-Ġcomp ose
-Ġcomp ile
-Ġcomp te
-Ġcomp acted
-Ġcomp elling
-Ġcomp omer
-Ġcomp acting
-Ġcomp elled
-Ġcomp erhensive
-iv ated
-iv ir
-iv ary
-iv ile
-iv ash
-og ain
-og um
-og ingiv
-og old
-og alact
-ib is
-ib ur
-ib ers
-ib urg
-Ġdis able
-Ġdis per
-Ġdis ple
-Ġdis ten
-Ġdis pose
-Ġdis appro
-Ġdis odium
-Ġdis fig
-Ġdis till
-Ġdis fav
-Ġdis asters
-Ġse ed
-Ġse ize
-Ġse ymo
-Ġse erig
-Ġse ulgg
-Ġse vefl
-Ġse ifert
-ial y
-ial is
-ial em
-ial ist
-Ġsh p
-Ġsh s
-Ġsh as
-Ġsh am
-Ġsh and
-Ġsh op
-Ġsh ee
-Ġsh ell
-Ġsh erm
-Ġsh ack
-Ġsh ark
-Ġsh ih
-Ġsh ame
-Ġsh rin
-Ġsh ields
-Ġsh imm
-Ġsh ofer
-Ġsh iro
-Ġsh uff
-Ġsh ams
-Ġsh aved
-Ġsh ading
-Ġsh otgun
-Ġsh oes
-Ġsh yness
-Ġsh erwood
-Ġsh ingaki
-Ġsh ulman
-Ġsh restha
-Ġsh antou
-Ġsh ivash
-ap on
-ap an
-ap tic
-ap ore
-ap ort
-ap ically
-ap ped
-ap illary
-ap point
-ap tability
-ap oly
-ap rint
-ap ositive
-Ġdif ft
-Ġdif etti
-oth rom
-oth ane
-oth iaz
-are lia
-Ġad am
-Ġad ition
-Ġad rs
-Ġad amant
-feren ts
-Ġdent aid
-Ġdent omaxillofacial
-Ġdent urist
-Ġdent aport
-Ġbet aines
-Ġbet apositive
-Ġhe ine
-Ġhe be
-Ġhe pes
-Ġhe yd
-Ġhe arten
-Ġhe ista
-Ġhe athy
+Ġha ens
+Ġaf i
+Ġtr ibut
+Ġy un
+Ġgen esis
+Ġcol ours
+Ġcr m
+Ġunder nutrition
+Ġspec ulation
+Ġnon adh
+Ġdr astic
+Ġpar anasal
+Ġins ensitive
+uss ions
+Ġav l
+Ġexpl ants
+Ġic w
+Ġmy ogenic
+Ġprof icient
+Ġmal ay
+Ġhem ochromatosis
+Ġfra med
+ha vi
+Ġca rolina
+Ġmem ories
+Ġmm f
+Ġadh eres
+Ġsoci ocultural
+Ġmultiv it
+ca a
+Ġpros pect
+Ġcompound ed
+Ġstrain ing
+Ġhal o
+Ġhydro static
+Ġfast est
+Ġangi i
+Ġmt bs
+Ġsn ow
+Ġsn ot
+Ġlateral ization
+rot um
+Ġtc ms
+Ġann ounced
+Ġrecogn izes
+Ġmg us
+Ġspe akers
+Ġtb a
+Ġpancreatic oduoden
+Ġpt v
+12 7
+Ġstem ness
+Ġkore ans
+Ġcollagen ous
+Ġfil grastim
+Ġfr b
+Ġtri iod
+Ġimmunohist ochemically
+Ġhd t
+Ġion m
+Ġka w
+Ġnt g
+Ġpb a
+Ġmh la
+Ġopp osition
+Ġexpand able
+Ġter ror
+Ġdeform ed
+Ġcuff ed
+Ġpw b
+Ġpy r
+Ġtrop onins
+Ġrevascular isation
+Ġlos artan
+Ġappend iceal
+Ġcg c
+Ġcomprom ises
+Ġae b
+Ġae bp
+Ġtl rs
+Ġsupra clavicular
+Ġgt p
+Ġquerc itrin
+Ġevolution ary
+Ġbios ystems
+Ġmer its
+Ġih ca
+Ġfn h
+Ġanesthet ists
+Ġcef uro
+Ġdk p
+Ġcosm etics
+Ġate z
+Ġxen ob
+Ġphyl l
+Ġreform s
+Ġhors es
+Ġbiote ch
+oglyc ans
+Ġparadox ically
+Ġglyco lytic
+Ġipa q
+Ġabol ish
+represent ation
+Ġfert ile
+Ġantec edent
+Ġmarsh all
+Ġmoroc can
+Ġnarc otic
+Ġdiscour aged
+Ġphospholip ase
+Ġpolyt raumatized
+Ġgard en
+Ġsucce eded
+Ġeigen values
+Ġcoumar ic
+Ġhyperp igmentation
+Ġmicrotub ule
+Ġglomerul onephritis
+Ġtricl osan
+Ġsaff ron
+Ġcancel led
+Ġafflic ted
+Ġtiv ap
+Ġdysk inesia
+Ġsco oter
+Ġnonrandom ized
+Ġchondro itin
+Ġhpm cp
+Ġsoldi ers
+vascul ature
+Ġbioelect rical
+Ġshik onin
+Ġbicinch oninic
+Ġreapp ra
+Ġsalvi anolic
+Ġglutar aldehyde
+Ġloper amide
+Ġresaz urin
+d b
+e y
+o um
+r ines
+v h
+w as
+Ġt me
+Ġa ro
+at ase
+en berg
+Ġb irc
+Ġb illing
+Ġh ess
+Ġn go
+Ġl pe
+ig er
+id ation
+ud y
+ab ad
+Ġis p
+ore n
+Ġat r
+Ġac rom
+Ġco ils
+Ġcl oxacillin
+Ġne fa
+Ġsc iss
+Ġfo ley
+Ġk urt
+Ġtr f
+Ġreg ressed
+Ġun il
+Ġun ethical
+Ġcons picuous
+Ġam ple
+ome p
+Ġdet er
+Ġover ly
+Ġbi oc
+Ġj at
+Ġsp ur
+Ġsm iling
+ograph s
+Ġmon oter
+Ġi im
+Ġfl ies
+Ġfl atus
+Ġprim ip
+Ġear r
+Ġz y
+Ġfem in
+Ġpa rous
+Ġach illes
+air d
+Ġve c
+Ġincl usions
+Ġmyoc yte
+Ġendoscop es
+Ġhyd raulic
+Ġnecess itated
+Ġcenter ing
+Ġmiss es
+Ġtren ding
+Ġgastro jejunostomy
+Ġul na
+Ġmd cs
+Ġster il
+Ġce o
+Ġcycl ase
+Ġather ogenesis
+Ġinfilt rations
+Ġprec luding
+oster on
+Ġmel ena
+Ġminim ization
+Ġger ont
+Ġduct us
+Ġci h
+Ġadren ocortical
+Ġonc ologist
+Ġsmooth ing
+Ġtoxic ology
+Ġot orh
+Ġrd d
+cy cler
+Ġoverc or
+Ġdiffuse ly
+Ġcatal pol
+Ġhex a
+Ġsubs ided
+anth ol
+Ġham art
+Ġagree ableness
+Ġneurot oxic
+Ġaggrav ates
+Ġnb f
+Ġhope fully
+Ġintoler ant
+Ġempow ered
+Ġmn g
+Ġchin ense
+Ġgenital ia
+Ġjia otong
+Ġprolifer ate
+Ġpreca ution
+obut y
+oyl quin
+Ġmutagen icity
+Ġaffir med
+Ġbir ch
+Ġatom s
+Ġantiem etics
+Ġantibi ofilm
+Ġquot ations
+Ġruss ia
+Ġpreced es
+Ġurs olic
+alt ered
+Ġacupunctur ist
+Ġmpt p
+Ġnephrolog y
+Ġnonresp ond
+Ġslov enia
+Ġwpa i
+Ġantihyperg lycemic
+Ġzol ed
+Ġhre mi
+Ġhelpless ness
+Ġtrichlor oacetic
+calib ur
+Ġcaryophyll ene
+Ġisov olum
+Ġfrancis co
+Ġbitew ing
+Ġradionuc lide
+Ġspil anthol
+oylquin ic
+d in
+f lu
+r n
+w ar
+z h
+z ocine
+Ġa od
+at ose
+Ġin access
+Ġf ih
+Ġd al
+Ġm oc
+Ġm he
+Ġb other
+Ġn bs
+Ġn ipt
+Ġl w
+Ġl pa
+et anib
+ud in
+ut ism
+Ġv kas
+Ġr pp
+Ġres ynchronization
+ys sin
+Ġch ic
+ip tin
+Ġle mon
+ell ation
+Ġcl if
 Ġhe idel
-Ġass ayed
-Ġass ert
-Ġass emble
-Ġass embl
-Ġass iut
-Ġass osci
-Ġcl s
-Ġcl op
-Ġcl ip
-Ġcl ay
-Ġcl ox
-Ġcl av
-Ġcl si
-Ġcl amp
-Ġcl amped
-Ġcl erk
-Ġcl imate
-Ġcl amping
-Ġcl umping
-rom e
-rom ic
-reat oduodenectomy
-and e
-and ed
-and ard
-Ġare al
-Ġare nas
-Ġtw ee
-Ġtw ist
-Ġtw isted
-Ġtw inc
-Ġtw eed
-Ġtw een
-Ġtw osample
-ff ens
-ff ord
-ff co
-ff aj
-ff icacy
-Ġma e
-Ġma gg
-Ġma ker
-Ġma ze
-Ġma fr
-Ġma ulana
-op ack
-op ne
-op ros
-op old
-op ography
-op rec
-op orous
-op erated
-op revalence
-por ation
-por ated
-por ulating
-we is
-we ges
-em s
-em le
-em per
-em ade
-em inal
-em onic
-em sa
-em ori
-em kit
-em ethyld
-ers ons
-ers onal
-ers tructure
-ers core
-ers tats
-Ġsc b
-Ġsc ip
-Ġsc ree
-Ġsc out
-Ġsc ene
-Ġsc our
-Ġsc ha
-Ġsc anc
-Ġsc abs
-Ġsc ulpt
-Ġsc otland
-Ġsignific atively
-Ġsignific anly
-Ġperi opath
-Ġperi opro
-Ġperi ocular
-Ġperi apically
-Ġap om
-Ġap olar
-Ġap ice
-Ġap osens
-Ġap di
-Ġap arat
-Ġap atitic
-ip ated
-ip red
-ip pa
-ip itation
-ip emia
-ip uncture
-Ġdental care
-Ġit k
-Ġit ch
-Ġit erm
-Ġit eration
-und i
-und ed
-und ancy
-Ġco vi
-Ġco ined
-Ġco ins
-Ġco ok
-Ġco erc
-Ġco inf
-Ġco ales
-Ġco ats
-Ġco existing
-Ġco occ
-Ġco enzyme
-Ġco bbl
-Ġco alition
-Ġco orlin
-Ġco astal
-Ġco usins
-Ġco omass
-Ġco umarin
-Ġind ents
-Ġind uration
-Ġind eterm
-Ġind uv
-Ġind raw
-Ġind welled
-Ġind ifference
-ia vi
-ia gn
-ia ged
-Ġle o
-Ġle ver
-Ġle one
-Ġle verage
-Ġle ung
-Ġle va
-Ġle ita
-Ġle aves
-Ġle bon
-Ġle pping
-Ġle voth
-Ġle iden
-Ġle opold
-Ġsur mount
-Ġsur rey
-ding e
-ub les
-ub ital
-ub eral
-ub ator
-tal w
-Ġnot ting
-Ġtreat able
+Ġme f
+Ġme h
+ph e
+Ġint ras
+Ġpl os
+Ġun altered
+Ġro ast
+Ġpr bc
+Ġext inction
+Ġag c
+Ġval ley
+Ġevalu ator
+Ġmult inational
+Ġcar p
+Ġed v
+Ġpain s
+Ġlong us
+Ġvis co
+ism a
+Ġloc om
+Ġloc ating
+Ġret ail
+Ġmo z
+Ġimmun isation
+Ġhem oh
+Ġmicro p
+Ġmicro albumin
+Ġmicro arrays
+Ġexc ited
+Ġang led
+roph ied
+Ġbm b
+ty pe
+Ġtak ots
+Ġresist ances
+Ġsl ur
+Ġbr in
+Ġbr to
+Ġfree hand
+Ġlymph ang
+Ġos ce
+Ġu icc
+let t
+Ġmac eration
+Ġder angements
+Ġx iap
+Ġmi u
+pa per
+ereb y
+Ġtransplant ations
+ogl iptin
+Ġchrom ogranin
+Ġrank in
+Ġhemod ilution
+Ġarm y
+Ġleg ally
+Ġcc b
+Ġnh p
+Ġdiscontinu ous
+Ġintrod ucer
+Ġelectro encephal
+Ġtherm oco
+Ġadren o
+Ġdeb ul
+Ġunique ly
+Ġdemand ed
+Ġlm ca
+Ġethyl ene
+Ġpredisp oses
+Ġlin n
+Ġperm utation
+Ġrb f
+Ġrelig iosity
+Ġmuscul ature
+Ġelectrophores ed
+Ġappra is
+Ġappra ise
+Ġtrim oxazole
+Ġappreci able
+Ġdap agliflozin
+Ġthyro globulin
+Ġws l
+Ġmicrot ome
+Ġcasp of
+Ġzo om
+Ġkary otyping
+Ġque bec
+Ġrestra ints
+mr na
+Ġkar n
+Ġkcn j
+Ġay ush
+Ġbia xial
+Ġnil otinib
+Ġyg j
+Ġcatalyz es
+Ġreassess ed
+Ġcamk iv
+Ġintrap ulmonary
+Ġenterpr ise
+Ġjack son
+Ġparagangli oma
+Ġpharmacop uncture
+Ġhst nt
+Ġkerm an
+Ġbronchodil ator
+Ġbreastf ed
+Ġgastroduoden al
+Ġpolysomn ography
+Ġchong qing
+Ġlanger hans
+Ġvand etanib
+oging ival
+Ġalisk iren
+Ġhaens zel
+Ġtriiod othyronine
+Ġheidel berg
+Ġhemoh im
+Ġtakots ubo
+a ortic
+d ata
+h ua
+p ically
+re cent
+on ian
+er able
+Ġc italopram
+Ġp ant
+ed o
+Ġf omm
+Ġd nt
+Ġd iction
+Ġm ers
+Ġm pr
+ro ch
+ct gg
+us a
+Ġn aked
+om ucosal
+Ġl yn
+Ġl ake
+Ġl rt
+Ġg ogg
+Ġas ylum
+ut ively
+od rine
+Ġr ar
+em ens
+ys es
+ys tein
+ore tic
+ore ctum
+Ġse at
+Ġper it
+Ġdis aggreg
+Ġco b
+Ġcl oseness
+art mental
+Ġne iss
+Ġha h
+and an
+Ġab ductor
+Ġtr kb
+Ġinter ior
+Ġmod ulatory
+Ġmod ulator
+ap enem
+Ġpr b
+Ġup coming
+Ġdes min
+Ġser pin
+Ġbut ein
+Ġspec ifying
+Ġnon cancer
+Ġstr ipping
+Ġproc o
+Ġsm s
+ft s
+Ġadm ittance
+Ġbas ophil
+Ġcar ib
+hib ition
+Ġcent roid
+Ġel t
+Ġprot ons
+Ġmal perfusion
+rh o
+Ġsurf act
+Ġhep a
+ins ically
+Ġquant iles
+Ġquant ifiable
+Ġincub ate
+Ġmuc operi
+Ġsumm ation
+Ġmac ular
+Ġtop o
+Ġprep ubertal
+Ġsn f
+Ġsn l
+Ġattribut ion
+oh ex
+aps es
+Ġhemat ogenous
+Ġfluor odeox
+Ġpap aya
+Ġpass ively
+Ġpen umb
+Ġdrink er
+Ġdex terity
+Ġhaem odynamics
+Ġsten oses
+Ġserious ness
+Ġgi ardia
+Ġsha h
+Ġdon ating
+Ġnh ird
+Ġamin osal
+Ġdu o
+Ġemphas ise
+Ġcf m
+Ġuk pds
+Ġmor ale
+Ġsb d
+Ġconstit utively
+Ġter penes
+Ġprote obacteria
+Ġpw t
+Ġnarrow est
+Ġrheumat ologists
+Ġnic orand
+Ġband ing
+Ġerad icated
+Ġki om
+67 1
+Ġll l
+Ġbenz yl
+Ġcrani osyn
+Ġmaxim izing
+Ġpin o
+Ġhes hou
+Ġali en
+Ġconce aling
+Ġgross ly
+Ġimmunost im
+Ġphenoty ping
+Ġphil ipp
+Ġneighb ors
+Ġstar ved
+Ġtraff icking
+Ġpup il
+Ġvest ib
+Ġcancell ation
+Ġimag ine
+Ġprothromb otic
+Ġplug s
+Ġelectrophys iology
+Ġneglect ing
+Ġinqu ired
+Ġbioinform atic
+Ġclam ped
+Ġnov ices
+Ġdiminish es
+Ġanaesthet ists
+Ġfle mish
+Ġhydroly zed
+Ġtransd uced
+Ġrefuge e
+Ġtan aka
+Ġquot ient
+urf ace
+Ġmanoeuv res
+Ġlia ison
+Ġlew is
+prolactin emia
+Ġfasci itis
+Ġhirs utism
+Ġejac ulation
+Ġadvertis ements
+Ġneurodevelop mental
+osper mia
+Ġperceiv ing
+Ġmids agittal
+flav one
+Ġethylenedi amin
+Ġclen ching
+etetra acetic
+Ġbiodegrad able
+Ġslb zs
+Ġfsc n
+Ġbicy cle
+Ġwro te
+Ġantine oplastic
+osteron ism
+Ġotorh inol
+Ġfih oa
+Ġcaspof ungin
+Ġfluorodeox yglucose
+Ġnicorand il
+Ġheshou wu
+i ant
+l av
+l la
+m ar
+u at
+Ġt ay
+Ġs ia
+Ġs led
+Ġs ema
+Ġs sis
+Ġthe sis
+Ġp ension
+Ġp br
+Ġp gn
+Ġin att
+Ġf allen
+Ġd ce
+Ġd ice
+Ġd ds
+Ġb k
+Ġh ut
+Ġst ee
+Ġl cc
+Ġl bd
+Ġon s
+el ic
+ut ations
+ut ination
+Ġv icin
+ot emporal
+Ġr pa
+Ġr io
+Ġr yr
+Ġr ik
+Ġr wt
+Ġres ted
+Ġor ch
+oc s
+op rotection
+Ġim c
+Ġat ax
+Ġad ductor
+Ġind ium
+Ġsign ifying
+ell i
+Ġcl i
+Ġap ple
+Ġun obser
+Ġam ine
+Ġacc u
+Ġqu oted
+Ġmod ifiers
+Ġexp ressive
+Ġexp ands
+Ġbl ended
+Ġfin n
+int ensive
+Ġinfl icted
+Ġj ump
+Ġpost ures
+Ġdr p
+Ġdr ps
+ri asis
+Ġpar apsilosis
+Ġred irect
+Ġimm inent
+Ġprim es
+Ġlong a
+Ġlong standing
+Ġprob it
+Ġic cs
+Ġloc ality
+Ġloc ked
+Ġep o
+Ġret racted
+Ġarter itis
+Ġhem ip
+Ġabs ences
+Ġradi otra
+omm un
+Ġang ry
+Ġorgan elles
+Ġmus ashi
+Ġlip o
+Ġaut ocrine
+oty pic
+Ġut ero
+Ġsw imm
+Ġhf md
+xim e
+ious ly
+Ġconst ipated
+Ġexist ent
+Ġder iving
+Ġneuro protection
+Ġlv sd
+Ġconvent ion
+Ġprepar ative
+Ġdig a
+Ġech ogenic
+Ġmes a
+Ġrs od
+Ġbp m
+Ġga ug
+Ġperiph erally
+Ġprolong s
+Ġprem ium
+Ġ19 95
+Ġpm r
+Ġsil k
+Ġsil ness
+Ġcat abolic
+Ġillust rations
+Ġger iatrics
+Ġexclud es
+Ġgas ping
+Ġwal ked
+Ġdiscrep ant
+Ġfinanc ially
+Ġren ders
+Ġpb n
+19 9
+Ġwors ens
+Ġthreat ened
+Ġsubt est
+Ġtap ping
+Ġhund reds
+Ġdisl od
+Ġglomer ulus
+Ġtl f
+Ġexception ally
+Ġef alizumab
+Ġcra ving
+orad iation
+Ġchond rogenic
+Ġchond rocyte
+Ġscatter plot
+Ġperip ancreatic
+mt uzumab
+Ġcosm in
+Ġxen on
+Ġlect in
+Ġhyperch lore
+Ġmoist ur
+Ġira q
+Ġphle gm
+Ġdipl oid
+Ġintu ition
+Ġalumin ium
+Ġconvinc ed
+Ġhypere choic
+abl ative
+Ġneurosurge on
+Ġmacrol ides
+Ġaddict s
+Ġreassess ment
+Ġasm q
+Ġnms c
+Ġglycyrrhiz in
+Ġperturb ation
+Ġvasoconstrict or
+Ġtough ness
+Ġjiang su
+Ġtod dl
+Ġale mtuzumab
+Ġnormother mia
+Ġnemat odes
+Ġaward ed
+Ġsyndesm otic
+Ġantimut agenic
+Ġschn eider
+Ġvisu ospatial
+Ġsafegu ard
+Ġhyperker atosis
+Ġpolyn omial
+Ġantiphosph olipid
+3 38
+7 4
+j ust
+k ok
+s ha
+Ġa per
+Ġa xi
+re tt
+Ġth un
+on f
+on iflorin
+Ġs vi
+Ġs ake
+Ġo ce
+Ġo ir
+Ġp im
+es artan
+Ġf im
+Ġd ies
+Ġm ash
+Ġm sept
+an im
+Ġre organization
+Ġh in
+us an
+ul ata
+Ġn z
+Ġst ear
+om ia
+ere rs
+ur p
+Ġl xa
+Ġl aird
+ud an
+ist a
+Ġres or
+Ġor chid
+op yr
+ys gg
+Ġinc ipient
+Ġch yl
+Ġad duction
+Ġper if
+Ġsh an
+Ġac m
+ay er
+Ġcl sm
+Ġne pri
+Ġsc rotum
+and ers
+ug reek
+Ġpl ast
+Ġrec ons
+Ġrec oded
+Ġpres t
+Ġy uk
+ub ular
+Ġund efined
+Ġnon m
+Ġcomm in
+Ġcomm ands
+Ġsp ices
+Ġdist obuccal
+Ġval er
+Ġli uz
+Ġcar ina
+anc in
+Ġprim ing
+Ġins et
+af v
+Ġvis itation
+Ġloc oreg
+Ġep k
+chn ic
+Ġimmun ology
+Ġoper ates
+Ġmal alignment
+Ġpoly uria
+Ġcur b
+Ġgrow s
+Ġcy ps
+Ġchem oradiation
+Ġcontribut ory
+Ġgood s
+Ġcer amide
+Ġult rastructure
+Ġflu ent
+amin ar
+Ġdivid es
+Ġcommit ments
+Ġhs os
+Ġappear ances
+Ġdown g
+Ġdil at
+Ġdil ute
+Ġhepat orenal
+Ġemb al
+Ġx rd
+Ġpal est
+Ġadip okine
+Ġchrom ogen
+Ġnit rof
+Ġpi h
+Ġtm t
+Ġdepend ant
+Ġsouth western
+Ġcla vien
+Ġfore most
+Ġcran berry
+Ġglyc ocalyx
+Ġtt r
+Ġtrache ostom
+Ġft r
+17 4
+brid ge
+Ġstabil izers
+Ġvirt ue
+Ġunf it
+Ġprote olysis
+Ġsi emens
+Ġicp c
+Ġrheumat ologist
+Ġirregular ly
+Ġtap b
+Ġff i
+Ġreinf ection
+Ġreinf arction
+Ġligament ous
+Ġcompan ions
+Ġhaemat ocrit
+Ġtel omerase
+Ġacetyl ation
+Ġcra b
+Ġmultip arous
+ofluores cent
+Ġpuls atility
+Ġremote ly
+Ġpor cel
+Ġghana ian
+Ġtd r
+Ġole ifera
+Ġfen ugreek
+Ġrefus ing
+Ġsg b
+Ġmicrod ialysis
+Ġauro cs
+Ġgol imumab
+Ġbill roth
+Ġshortc oming
+Ġtym s
+Ġtym pan
+Ġdistort ions
+Ġtherapeut ically
+Ġaggl utination
+Ġenterobacter ales
+Ġepithel ia
+Ġepit opes
+Ġisl am
+Ġdereg ulated
+Ġpov idone
+Ġproct itis
+Ġenforce ment
+olab ial
+Ġdialys ate
+Ġendorph in
+Ġantipyre tic
+osept al
+Ġcefuro xime
+Ġpenumb ra
+Ġcraniosyn ostosis
+Ġethylenediamin etetraacetic
+Ġstee per
+Ġvicin ity
+d al
+r iz
+y ce
+Ġa we
+Ġa plastic
+Ġs ff
+Ġs per
+er up
+Ġc ym
+Ġp ka
+Ġw ort
+Ġw ants
+Ġf np
+Ġm ock
+Ġm dl
+Ġh ars
+le a
+Ġl hd
+Ġg gc
+Ġv iz
+Ġde a
+Ġpre natally
+Ġper ind
+Ġne x
+ens u
+Ġk cs
+Ġk arach
+Ġall ium
+Ġinter phase
+oth elioma
+Ġy c
+out s
+Ġen ven
+Ġser osa
+ros arcoma
+ace us
+Ġpred iabetic
+Ġgener ational
+Ġref low
+Ġdecre ment
+Ġed ematous
+Ġfl our
+arg in
+Ġhyper bil
+Ġprim itive
+ange al
+Ġknow s
+Ġer i
+Ġca erule
+Ġml c
+de gib
+Ġunivers iti
+Ġpul ver
+Ġsl a
+Ġextra vascular
+Ġoste ophytes
+Ġmid term
+Ġsat ellite
+ci ences
+Ġwater y
+hy p
+Ġu acr
+Ġconc av
+Ġod am
+Ġder angement
+Ġneuro horm
+Ġneuro intensive
+Ġoc p
+Ġta uro
+Ġms a
+Ġla afv
+Ġdepartment al
+Ġbreast s
+Ġpool s
+ofil ament
+Ġauto analyzer
+the y
+oly tics
+Ġcbct s
+Ġenter ococci
+Ġdp ds
+Ġintr insically
+Ġcentrifug ing
+Ġtele cons
+Ġsubsc ores
+Ġtt f
+Ġnc d
+Ġrhe in
+Ġlc se
+Ġpn ets
+Ġot c
+13 0
+Ġsac rum
+rect ed
+Ġdark er
+plast y
+Ġreper c
+Ġcarcin ogens
+Ġdn i
+Ġscr atching
+Ġhous ework
+Ġll c
+Ġhaemat ology
+Ġpic c
+Ġmer it
+Ġkr gcd
+ij ue
+Ġgent amycin
+Ġee ge
+Ġsuv r
+Ġannot ations
+Ġinduc ers
+Ġlav a
+Ġglas degib
+Ġict us
+Ġfut ility
+Ġmultiplic ative
+Ġtelom eres
+Ġvietnam ese
+Ġtriph ala
+Ġsna i
+Ġintuitive ly
+Ġnecro psy
+Ġspr ings
+Ġcric oid
+Ġmentors hip
+Ġquen ching
+Ġhang ing
+Ġwog onin
+Ġmuslim s
+Ġhypocal cemia
+Ġinhomogene ous
+Ġkyph osis
+Ġgamb ling
+oresist ance
+Ġcft r
+Ġscand ina
+Ġpreserv ative
+Ġhydrochlor ic
+Ġqia amp
+Ġstew ards
+inguish able
+Ġasphyx ia
+Ġrepar ative
+Ġleh ane
+Ġearl obe
+omep razole
+Ġvec uronium
+Ġproco agul
+Ġotorhinol aryng
+Ġnepri lysin
+Ġperind opril
+Ġkarach i
+b on
+c ulated
+f urt
+l us
+p ulmonary
+s es
+x ual
+Ġt ew
+Ġs ene
+Ġs izing
+Ġs roc
+Ġo acs
+Ġf gg
+ic ide
+Ġd ers
+Ġd indo
+Ġm ari
+Ġb ival
+as ms
+an p
+Ġre nt
+Ġh ereby
+Ġe or
+Ġe ut
+ur ved
+Ġl ds
+os ic
+ol ix
+ol itis
+Ġon ab
+Ġbe we
+Ġr q
+um an
+ort isol
+Ġinc ised
+Ġsh ut
+ac on
+Ġind ians
+eren cing
+Ġhe i
+Ġap r
+Ġab usive
+Ġmet ocl
+Ġreg ained
+Ġinter relations
+Ġrec ur
+Ġmed it
+Ġexp osition
+Ġbl ister
+cl ines
+Ġfin ds
+Ġag at
+Ġman power
+ire otide
+Ġj as
+Ġsp oc
+Ġsp raying
+Ġem ayo
+Ġdef enses
+Ġrem s
+Ġgl m
+Ġmon ophosphate
+Ġref erent
+av ancin
+Ġhyper lipidaemia
+Ġif abp
+Ġes omeprazole
+Ġhyp of
+Ġreceiv ers
+Ġop cab
+Ġmy omet
+Ġmicro vasculature
+ec um
+Ġfem urs
+Ġnew man
+Ġgast roscope
+of sky
+Ġct gf
+Ġcap a
+Ġhel met
+Ġadd wor
+Ġbel t
+Ġlip oxygenase
+ca pt
+Ġmid odrine
+Ġappe aling
+Ġcm use
+ns l
+Ġartic ulation
+Ġrecept ive
+rit ol
+Ġperiodont ists
+Ġms f
+Ġhepat otoxic
+az apine
+Ġhip ec
+Ġsept oplasty
+Ġdig its
+Ġmt ca
+Ġintern ists
+Ġster ility
+Ġconn ector
+Ġsuperior ly
+Ġsubstant iate
+Ġwid ened
+Ġbio act
+Ġrh odamine
+rad ine
+be havi
+Ġmis wak
+ga a
+Ġinterpret able
+Ġcompl ies
+Ġdemograph ical
+Ġbd q
+Ġtherm oform
+Ġsir ius
+Ġrich est
+irubin emia
+Ġsta pler
+Ġanalyt ics
+Ġdn r
+Ġanthrop ometry
+Ġcac l
+Ġmicroc rack
+Ġenab lers
+Ġff m
+Ġpas ireotide
+Ġfistula e
+Ġexch anges
+Ġheparin ized
+Ġpin ene
+Ġhes itant
+Ġconceptual ized
+Ġnail ing
+Ġglycos amin
+Ġhyperuric emic
+Ġharb our
+Ġspray ed
+Ġprofound ly
+Ġpalm itic
+Ġhop elessness
+Ġprecon ception
+Ġfrank furt
+Ġgst m
+Ġtbs a
+Ġimpre cise
+imon ian
+Ġpq s
+Ġanaesthet ist
+Ġexponential ly
+Ġophthalm ology
+Ġbeck man
+Ġbang kok
+Ġfight ing
+Ġdemarc ation
+Ġnarc otics
+Ġpares is
+Ġaddict ive
+Ġbread th
+Ġtar iff
+Ġoutper formed
+Ġanthra cy
+Ġelectromy ography
+Ġlign ans
+Ġwrink les
+Ġroe o
+Ġphl f
+Ġkan amycin
+Ġsapi en
+Ġepl bd
+Ġcrop ped
+Ġpii inp
+Ġnonsmok ers
+Ġmyelo ablative
+Ġpolyneuro pathy
+Ġnonadh erence
+Ġreappra isal
+Ġnonrespond ers
+Ġkarn ofsky
+Ġheshouwu yin
+Ġlocoreg ional
+Ġporcel ain
+Ġscandina vian
+Ġstewards hip
+Ġders imonian
+b v
+x w
+Ġt art
+Ġt dm
+in able
+Ġa version
+at gt
+Ġs arm
+Ġs gt
+Ġo ec
+Ġf cr
+Ġm og
+Ġb ish
+Ġre aring
+Ġre usable
+Ġe te
+Ġn id
+Ġl ch
+ig gs
+ol ate
+ol ase
+if eration
+il obular
+up ivacaine
+Ġr ge
+Ġwh ee
+ag ag
+Ġse i
+Ġsu fficiency
+Ġsh in
+Ġgroup ings
+Ġass ent
+Ġme pol
+Ġne fer
+ph ot
+Ġha v
+Ġap rem
+Ġab yssin
+Ġk ip
+Ġsub mission
+ach us
+Ġy ag
+ren one
+Ġbl ades
+one gative
+ub a
+Ġen bd
+Ġup wards
+ix afor
+Ġunder represented
+Ġtrans peptidase
+Ġem itted
+Ġsm oc
+Ġfur n
+ob struct
+Ġident ifier
+Ġi us
+Ġform ations
+Ġform ats
+Ġstand point
+Ġhyp ophosph
+Ġday light
+Ġear ning
+Ġop ens
+Ġmy food
+Ġox c
+Ġcaus ally
+Ġmicro angi
+Ġfib rogenesis
+Ġer oded
+Ġpoly cy
+Ġpoly peptide
+Ġrest lessness
+fer ases
+Ġq fr
+Ġtem pt
+Ġchem otactic
+Ġcontr arily
+Ġmr l
+Ġsw t
+opath ological
+Ġhb l
+Ġu yg
+Ġtool kit
+Ġdam a
+Ġcm i
+Ġcp a
+Ġview points
+Ġapproxim ated
+Ġsa phen
+Ġiv ab
+Ġhepat ology
+Ġkid s
+Ġnucle oside
+Ġce ph
+Ġrs i
+Ġadip or
+Ġsummar ises
+sw ana
+rin i
+Ġpen g
+Ġcentr ilobular
+Ġbreath e
+Ġom ron
+Ġseek ers
+Ġcf ss
+Ġendoc an
+Ġrevers es
+Ġah cl
+Ġoverl aps
+Ġfm z
+Ġmind ful
+Ġai ha
+Ġsb ce
+Ġpotent iate
+Ġorient ated
+Ġter pin
+Ġprote us
+Ġtranscript omic
+Ġrepeat able
+Ġgd a
+Ġpenet rated
+Ġperme ation
+Ġtransm itting
+Ġnons ense
+Ġscr ub
+Ġprompt s
+Ġgt g
+Ġrm gic
+Ġhh c
+36 1
+Ġyellow ish
+Ġbad uan
+Ġscler osing
+Ġscler oderma
+Ġpin nac
+Ġfung icidal
+Ġfundamental ly
+Ġvasodil ators
+Ġign or
+Ġineffect iveness
+Ġvr k
+mm as
+Ġud ma
+Ġthr iving
+Ġemail s
+Ġfb xw
+Ġyouth s
+Ġneurotrans mission
+there fore
+Ġhemisph eres
+Ġcres cent
+Ġnn os
+Ġtz p
+Ġstigm asterol
+Ġpartition ing
+Ġoblig ations
+opram ide
+Ġfcs ems
+Ġamen orrhea
+Ġhq d
+Ġproduc er
+Ġepididym is
+Ġdile mmas
+Ġquinol ones
+Ġdisconn ection
+Ġantimyc obacterial
+Ġwem v
+Ġwan fang
+Ġpermeabil ized
+Ġindist inguishable
+Ġextrac ardiac
+Ġnud t
+Ġhypercoagul ability
+Ġpipet ted
+Ġkaz akh
+Ġsubend ocardial
+Ġccf dna
+Ġsubdiv ision
+Ġcaroten oids
+Ġinvit rogen
+Ġpinp rick
+hom oc
+Ġalexith ymia
+Ġspac ers
+Ġargent ina
+Ġovercor rection
+Ġdiction ary
+ystein emia
+Ġphilipp ines
+Ġhyperbil irubinemia
+Ġprocoagul ant
+Ġmetocl opramide
+Ġmepol izumab
+Ġaprem ilast
+Ġsaphen ous
+Ġbaduan jin
+Ġpinnac le
+a emic
+s k
+Ġs ro
+Ġs bc
+Ġp ier
+Ġw are
+Ġof t
+Ġf gfr
+or ily
+Ġd act
+Ġm ould
+Ġb ts
+ent adol
+ing en
+Ġh erm
+Ġh urt
+Ġe ber
+Ġg ef
+Ġg kb
+il ide
+ot te
+em an
+Ġis okinetic
+oc us
+Ġde zocine
+ib inin
+ib acterium
+Ġat raumatic
+st ro
+ac ac
+Ġco factor
+art oum
+Ġtre hal
 ary otic
-ary lether
-est a
-est one
-est ep
-est ones
-est udio
-est amps
-est otals
-act or
-act ant
-act ored
-pec trum
-pec ialist
-se as
-se vere
-se ier
-Ġcan all
-Ġcan thion
-Ġpar ity
-Ġpar ath
-Ġpar ties
-Ġpar ks
-Ġpar ama
-Ġpar acr
-Ġpar alysis
-Ġhealth ily
-ine ous
-ine hart
-Ġpos its
-Ġpos ology
-Ġpos ters
-val ue
-vi ar
-vi ate
-vi oral
-ition s
-ition ally
-st l
-st on
-st ain
-st op
-st ay
-st atistic
-st anes
-st atus
-st abs
-st atter
-Ġfo ul
-Ġfo resh
-Ġfo ams
-Ġfo vea
-Ġfo etuses
-Ġinf ancy
-Ġinf used
-Ġinf initi
-vel ed
-vel le
-ull age
-per form
-per itone
-per imental
-Ġha y
-Ġha ens
-Ġha avi
-Ġha ematological
-Ġha hn
-Ġha ffaj
-ich ung
-ich mann
-enti es
-ren cy
-ren nma
-ren ticeship
-Ġcont ec
-Ġcont ure
-Ġcont ag
-ari ed
-Ġpres so
-Ġpres yn
-Ġpres erv
-Ġpres ervative
-Ġpres urgical
-Ġpres troke
-Ġpres urgery
-Ġpres pecified
-Ġpres urvey
-Ġpl ating
-Ġpl icated
-Ġpl orer
-Ġpl acode
-Ġpl urip
-ue h
-ell s
-ell en
-ell ent
-ell ated
-ell um
-ell ors
-ell osis
-Ġall ied
-Ġall usion
-Ġall iance
-Ġall dl
-Ġall ogenous
-Ġall uding
-Ġall oplastic
-ong elli
-Ġperiodon tically
-Ġfull est
-ch o
-ch ures
-ch ke
-ch ak
-ch land
-ch aft
-ch oric
-ch arged
-ch berg
-ch ez
-ch ison
-ch ecked
-ch wer
-ch rome
-end ence
-end odontic
-Ġwhich bu
-ug i
-ug ness
-ill i
-ill ation
-ill eri
-ill iant
-ill oliths
-ill imet
-Ġro os
-Ġro od
-Ġro up
-Ġro vers
-Ġro usp
-Ġro cha
-Ġro udi
-Ġro ws
-Ġro che
-Ġro uiller
-Ġro ugness
-Ġtr an
-Ġtr ag
-Ġtr ade
-Ġtr ick
-Ġtr ains
-Ġtr ih
-Ġtr aps
-Ġtr iaz
-Ġtr ieth
-Ġtr pc
-Ġtr iaged
-ear th
-Ġmore no
-Ġmod y
-Ġmod ifier
-Ġmod ares
-Ġmod elled
-Ġmod ulatory
-ach ed
-ach ian
-ach idonic
-Ġcons ole
-Ġcons ola
-Ġcons erving
-Ġcons ervation
-Ġreg ist
-Ġreg laz
-cl s
-cl ub
-cl one
-cl ish
-cl air
-cl ave
-Ġob j
-Ġob so
-Ġob sessive
-Ġob weges
-Ġob viate
-Ġacc ession
-Ġacc ru
-Ġacc used
-Ġacc ented
-Ġacc retion
-Ġacc utom
-Ġthan k
-Ġno un
-Ġno vic
-Ġno hs
-Ġno body
-Ġno vamin
-Ġanalys er
-Ġsam sung
-oci ation
-oci ties
-Ġrec reated
-Ġrec ateg
-Ġrec ont
-Ġrec umb
-Ġrec ker
-Ġrec ycl
-Ġrec oded
-Ġrec ede
-Ġrec ourse
-Ġrec alibration
-Ġrec ertification
-Ġrec esses
-Ġincl ines
-Ġrel ay
-Ġrel vas
-Ġrel atable
-Ġne xy
-Ġne bn
-Ġne pom
-Ġne onatal
-Ġne uroradi
-Ġpr p
-Ġpr ide
-Ġpr ints
-Ġpr onged
-Ġpr isons
-Ġpr aise
-Ġpr asad
-Ġpr udent
-Ġpr amanik
-Ġcar lin
-Ġcar tographic
-Ġcar inii
-Ġtooth aches
-Ġab u
-Ġab et
-Ġab ated
-Ġab ate
-Ġab led
-Ġab ik
-Ġab aq
-Ġab using
-Ġab del
-Ġab domen
-Ġab udall
-Ġaf ferents
-ight ening
-ces fully
-duc tion
-fac estotals
-Ġsub ple
-Ġsub ord
-Ġsub ging
-Ġsub urb
-Ġsub fl
-Ġsub forms
-Ġsub cellular
-Ġsub field
-Ġsub famil
-Ġsub rogated
-Ġsub domain
-Ġsub family
-Ġsub jacent
-Ġsub nuclear
-Ġsub them
-Ġsub arach
-Ġinter ph
-Ġinter ms
-Ġinter ne
-Ġinter cal
-Ġinter arch
-Ġinter gen
-Ġinter go
-Ġinter activity
-Ġinter cepts
-Ġinter class
-Ġinter tw
-Ġinter change
-Ġinter ceptive
-Ġinter fur
-Ġinter fibrillar
-Ġinter rogated
-Ġinter oper
-Ġinter costal
-Ġinter rogating
-Ġinter leaved
-Ġinter verte
-Ġinter appoint
-Ġqu ater
-Ġqu otes
-Ġqu eas
-Ġqu encher
-Ġqu iryn
-Ġun str
-Ġun ite
-Ġun int
-Ġun ord
-Ġun man
-Ġun resp
-Ġun mark
-Ġun etr
-Ġun me
-Ġun iting
-Ġun esthetic
-Ġun aff
-Ġun ra
-Ġun stead
-Ġun used
-Ġun time
-Ġun obser
-Ġun struct
-Ġun trans
-Ġun hel
-Ġun itek
-Ġun interpre
-Ġun bu
-Ġun oise
-Ġun ison
-Ġun establ
-Ġun closed
-Ġun antic
-Ġun classified
-Ġun just
-Ġun vac
-Ġun esco
-Ġun attain
-Ġun icellular
-Ġun leash
-Ġun cemented
-Ġun ambiguous
-Ġun earth
-Ġeffec ted
-Ġeffec tivity
-low er
-form er
-form ations
-form ative
-Ġint ension
-Ġint akes
-Ġint uss
-Ġint welve
-ay an
-ay ment
-ay ashi
-Ġlow ers
-ist ak
-ist ae
-ist opathy
-Ġy d
-Ġy h
-Ġy un
-Ġy ass
-Ġy uan
-Ġy amam
-Ġy ttr
-Ġy uen
-Ġy usuke
-Ġy amabe
-Ġam id
-Ġam ines
-Ġam ended
-Ġam ps
-Ġam arant
-Ġam assed
-Ġam itr
-Ġam ylase
-Ġam niotic
-Ġam aral
-Ġam irabadi
-ens i
-ens en
-ens ible
-ater istics
-one ment
-one ous
-one gativity
-one urolog
-one edle
-ard d
-ard ize
-ard iac
-Ġmeas urably
-Ġvari o
-Ġk ul
-Ġk ven
-Ġk ual
-Ġk ob
-Ġk ines
-Ġk aw
-Ġk ne
-Ġk ih
-Ġk ont
-Ġk az
-Ġk ivo
-Ġk uro
-Ġk abil
-Ġk wan
-Ġk ids
-Ġk urt
-Ġk avy
-Ġk sa
-Ġk sh
-Ġk la
-Ġk ats
-Ġk ungs
-Ġk cis
-Ġk dca
-Ġk ratch
-Ġk atada
-Ġk asaj
-Ġk omi
-Ġk utter
-Ġk ocuria
-Ġk ieser
-Ġk ateeb
-Ġk arelia
-Ġk ullage
-Ġk rennma
-ple ted
-ple ct
-Ġval o
-Ġval es
-Ġval ide
-Ġval enc
-Ġval ves
-Ġval iable
-Ġval div
-iti ous
-iti ves
-iti vities
-iti ba
-Ġwe xner
-Ġwe apon
-ans as
-ans ive
-ans son
-ans aker
-ans hah
-ast in
-ast ating
-ast atic
-ast oid
-ast onec
-Ġlevel ed
-Ġlevel ling
-Ġlevel ler
-pro fessional
-pro fit
-so uni
-Ġdet in
-lec ules
-lec oxib
-lec yst
-ost atistic
-ost osis
-ost omat
-Ġen act
-Ġen low
-Ġen cr
-Ġen ucle
-Ġen umer
-Ġen igm
-Ġen thus
-Ġen oyl
-Ġen clave
-Ġhad laq
+ffect ive
+Ġab vd
+Ġab alone
+lud ec
+Ġtr d
+Ġexp oses
+Ġy i
+Ġbl astom
+Ġactiv ators
+Ġj tt
+Ġsp ill
+Ġpost pro
+Ġdr f
+Ġcal ip
+ox al
+Ġli ensin
+Ġest onia
+Ġhyper v
+Ġform ative
+Ġgra pe
+Ġins em
+Ġins ula
+Ġic tal
+Ġintra partum
+Ġintra vesical
+Ġep m
+Ġz m
+Ġz r
+Ġdesign ation
+ych olic
+Ġir ish
+Ġpa q
+Ġct b
+Ġsaf role
+Ġsal ic
+Ġdeg ludec
+Ġmm c
+ind ed
+Ġdec orin
+Ġcs x
+Ġib p
+Ġmak er
+dm d
+Ġhs l
+Ġmorph ogenesis
+Ġtop ois
+Ġdiss ections
+rot est
+Ġqual ifying
+sh an
+Ġgerm in
+Ġtg g
+Ġaff luent
+ka wa
+Ġsil ibinin
+rad ial
+Ġinterpret ability
+Ġfear ful
+Ġeryth ritol
+Ġsr d
+Ġnc cl
+Ġsubm it
+Ġrv s
+Ġln c
+Ġparalle led
+Ġarrhythm ogenic
+Ġmyel oproliferative
+Ġneph rolithiasis
+Ġfoot print
+Ġjaw bone
+Ġdetermin istic
+Ġtap entadol
+Ġswe ep
+Ġrect osigmoid
+bd a
+Ġdermat ologic
+Ġld t
+Ġinequ ity
+Ġpip eline
+Ġinappro pri
+Ġmicros por
+Ġber n
+Ġolig odend
+Ġanticip atory
+Ġepic ond
+Ġmamm ea
+Ġkh artoum
+Ġperip artum
+Ġcard inal
+Ġpoc s
+Ġpostt rans
+Ġcoc ci
+Ġelectric ity
+Ġdg ts
+Ġbot swana
+Ġves icle
+Ġzh u
+Ġmanus cripts
+map k
+uv ants
+Ġmobil ize
+imon ious
+Ġsemin ars
+Ġtumorigen ic
+Ġrifamp in
+Ġpph s
+Ġuh plc
+Ġsuff erers
+Ġtransvers us
+Ġclassroom s
+Ġdeox yn
+Ġtowns hip
+Ġdansh ensu
+Ġgang rene
+Ġcomprehens ibility
+Ġchr ys
+Ġwhisk er
+Ġhypod ivergent
+Ġohd g
+Ġert apenem
+Ġacupunctur ists
+Ġtonsill olith
+Ġsandblast ing
+Ġnoc ad
+Ġeaf ad
+Ġinvag ination
+Ġunderdi agnosed
+Ġcitrull inated
+icalc ium
+Ġhemoc lip
+Ġbothers ome
+Ġmineralocortic oid
+Ġnefer ine
+Ġivab radine
+Ġliensin ine
+l af
+p f
+r b
+y i
+Ġ ue
+Ġt cr
+in osis
+Ġa ig
+Ġa iv
+Ġs emic
+en zym
+Ġw ip
+Ġf sw
+Ġf usions
+Ġd cc
+Ġb ion
+Ġh pr
+Ġh ott
+om s
+Ġl ant
+Ġl ph
+Ġl ighter
+Ġg av
+Ġg ung
+ig ration
+id ious
+ol ingual
+Ġr ud
+Ġr yg
+Ġal ogliptin
+ist ics
+Ġis otropic
+ir umab
+ir udin
+op c
+op en
+Ġde arth
+Ġus s
+Ġch ipping
+og o
+Ġac es
+Ġco ul
+Ġco hip
+Ġsc j
+uc a
+uc irumab
+Ġfo b
+Ġk al
+Ġpl w
+Ġinter individual
+Ġun ve
+Ġun class
+Ġam is
+Ġph aryngitis
+so as
+Ġhas mcs
+Ġup t
+ric ated
+ass a
+Ġra pe
+ros ine
+Ġstr ands
+Ġcal v
+ob upivacaine
+Ġimp r
+Ġet oric
+Ġinvest ments
+Ġthen ar
+Ġil iop
+Ġcost ing
+br t
+Ġsal aries
+Ġquant ifies
+Ġmass achus
+Ġble omycin
+Ġhyd atid
+Ġta ip
+Ġmi i
+Ġpc dna
+Ġdl ts
+Ġnas olabial
+Ġarch ive
+Ġped is
+Ġ10 6
+Ġweak est
+Ġwid est
+Ġtract ography
+Ġpm t
+Ġfd r
+Ġfd rs
+Ġden aturing
+Ġentire ty
+Ġphot ography
+Ġhard s
+Ġure mia
+Ġpredom in
+Ġfar nes
+Ġintr an
+Ġnan og
+Ġfix ative
+Ġfix ator
+Ġsy ria
+Ġast rocyte
+Ġcf us
+Ġinfect ivity
+Ġns cs
+Ġrv a
+Ġlc np
+Ġflavon ols
+Ġlys holm
+Ġmelan ocytic
+Ġreper to
+Ġdeform ations
+Ġrhythm ic
+Ġdh t
+Ġcg rp
+Ġtrack s
+Ġdisl ocated
+Ġpu v
+Ġerup tive
+Ġlev obupivacaine
+kin in
+radu ates
+Ġram ucirumab
+Ġesbl s
+Ġflat ulence
+Ġdispar ate
+Ġbb t
+Ġkh an
+Ġhes it
+Ġment hol
+Ġvasodil atory
+Ġjejun ostomy
+ris k
+Ġorb icularis
+Ġours elves
+Ġdism al
+Ġtrain er
+Ġamh ara
+Ġcontem pl
+Ġconfer ring
+Ġwb cs
+Ġimip ramine
+oprost one
+Ġdin oprostone
+Ġauthent icity
+Ġkl f
+Ġenjoy ed
+Ġoutd oors
+Ġperiost in
+Ġneurodegen eration
+Ġosteos arcoma
+Ġcivil ian
+Ġfacs calibur
+her bal
+Ġacclim atized
+Ġkamp ala
+Ġgil z
+Ġterat oma
+Ġleth arg
+Ġhyperm ethylation
+stud y
+Ġhq s
+Ġleiomy oma
+Ġcalcane al
+Ġsucce ed
+otri ol
+Ġicds c
+Ġcoumar ins
+Ġpect oral
+Ġpleth ora
+Ġkf x
+Ġdisappoint ing
+Ġaccent uated
+Ġpemphig us
+Ġnormog lycemic
+Ġdietit ian
+Ġlach n
+Ġsubcult ured
+Ġenfor ced
+Ġille gal
+Ġmirt azapine
+Ġsublux ation
+Ġvire mia
+Ġswimm ers
+Ġliuz ijue
+Ġcaerule in
+Ġetoric oxib
+Ġmassachus etts
+0 125
+4 29
+l v
+n g
+n ary
+r nas
+t ory
+u ating
+y ung
+re mia
+Ġth io
+on ents
+Ġs ke
+er i
+Ġin gen
+es i
+Ġf lic
+Ġm di
+as in
+ar is
+Ġre w
+Ġre ar
+ct omies
+Ġh np
+Ġst is
+Ġl an
+Ġg ym
+Ġas rs
+Ġas ynchrony
+Ġcon ceive
+ab alin
+Ġv ri
+Ġex osomes
+ot rophic
+Ġal z
+Ġcom atose
+op al
+Ġch on
+og aber
+act ively
+Ġsh enz
+ip otriol
+Ġac ryl
+pl ed
+Ġit g
+Ġam nes
+Ġacc ult
+Ġph n
+Ġph obic
+Ġris en
+ap a
 Ġfol ding
-Ġfol der
-Ġfol licular
-Ġfact o
-Ġfact ures
-Ġfact ored
-ting en
-rol s
-Ġgen ic
-Ġgen ew
-Ġgen ital
-Ġgen amic
-Ġgen esis
-Ġgen ova
-Ġgen code
-Ġgen otypic
-Ġgen otyped
-Ġgen uine
-Ġgen estudio
-yp ted
-yp ox
-yp rep
-Ġpartic pation
-Ġpartic ularities
-Ġtheir s
-Ġmay er
-Ġpo ur
-Ġpo und
-Ġpo ison
-ome ther
-ome thane
-Ġchild smile
-Ġassess ors
-Ġassess essment
-Ġtim isoara
-Ġtim estamps
-ph i
-ph arm
-ph alan
-ph erson
-ph arma
-ph agia
-Ġdur a
-Ġdur um
-Ġout lying
-Ġout let
-Ġout going
-Ġout dated
-ugh ing
-ugh out
-Ġsuc cesfully
-ass en
-ass es
-ass essment
-Ġsurfac er
-Ġspec ular
-Ġspec ks
-Ġspec ulations
-erm ack
-Ġfin ial
-Ġfin ds
-Ġstatistic a
-Ġstatistic ians
-olar ct
-olar ization
-Ġup to
-Ġup most
-Ġup set
-Ġup arse
-Ġup grade
-Ġup held
-Ġup graded
-Ġup keep
-ond rodysplasia
-Ġcor d
-Ġcor yn
-Ġcor ros
-Ġcor oll
-Ġcor rid
-Ġcor bella
-Ġcor puscular
-Ġcor tella
-Ġcor poration
-Ġmeth y
-Ġmeth icillin
-Ġmeth ionine
-str ate
-Ġdes mo
+Ġcol a
+Ġval ine
+Ġcharacter izes
+Ġprog ranulin
+Ġbas dai
+Ġcalc ipotriol
+Ġhyper osm
+Ġhist ochemical
+Ġstandard isation
+Ġany where
+Ġret inol
+Ġadj uvants
+Ġconduct ance
+Ġimmun ofluorescent
+Ġz hou
+Ġz oning
+Ġz eta
+Ġles ogaber
+Ġcyt oskeletal
+Ġcd h
+Ġir is
+Ġpa ws
+Ġsol d
+Ġec f
+Ġlip ogenic
+Ġtem p
+Ġlocal ize
+Ġmid way
+ops is
+Ġmot ile
+Ġregist rations
+Ġauthors hip
+omp artmental
+ss on
+Ġrev ise
+Ġemb od
+Ġnucle otides
+Ġbiom olecules
+Ġens uing
+Ġtradition s
+Ġburden ed
+opl atin
+Ġather othromb
+Ġdiast ema
+Ġchrom ogenic
+Ġarch ived
+Ġrot or
+Ġpt f
+Ġkin ematic
+Ġpv d
+Ġoh da
+Ġht tl
+Ġtoler ant
+Ġhygi enic
+Ġibd q
+Ġabsorb ent
+Ġpredom inated
+Ġeg m
+Ġintr at
+Ġcentrifug al
+Ġmill ions
+Ġpanel ists
+Ġrhe i
+11 3
+Ġarg uing
+Ġsmooth ed
+Ġbreak point
+Ġduoden oscope
+Ġace o
+Ġsulf on
+Ġaud ience
+Ġvo ices
+Ġfa ult
+Ġprote ome
+Ġwhit ish
+Ġmf ml
+Ġaz t
+Ġveget ation
+Ġmcf arland
+Ġsupra c
+Ġgt f
+Ġinterd ep
+Ġbenz oate
+Ġcollabor ators
+Ġdissem inate
+Ġfre y
+Ġmtor c
+Ġgon ial
+Ġnonin ferior
+Ġwalk er
+Ġprotr uded
+Ġlam a
+rep ared
+Ġase pt
+Ġturb id
+Ġsolub il
+Ġhole p
+Ġseason ality
+Ġglyca emia
+Ġnonc ardiac
+Ġindustrial ized
+ifferent iation
+Ġmul ler
+olipid emic
+Ġpartnership s
+Ġoblig atory
+Ġspong i
+Ġpars imonious
+Ġphotomicrog raph
+Ġinstant aneous
+Ġdbb m
+Ġeag er
+Ġfz d
+Ġmcr pc
+Ġtransluc ent
+Ġrearr angement
+Ġanhyd rous
+Ġhtert mrna
+Ġmetane phrine
+Ġserov ars
+Ġcryopres erved
+Ġcler ks
+Ġrosmarin ic
+Ġpersu as
+Ġremun eration
+Ġpreg abalin
+Ġbioequ ivalence
+Ġmucoperi osteal
+usan li
+Ġryg b
+Ġlesogaber an
+Ġhttl pr
+4 88
+7 00
+a way
+g ren
+m ds
+p os
+w ered
+Ġt ph
+Ġa in
+Ġa ec
+re c
+at rophin
+Ġs und
+Ġthe or
+Ġc roc
+Ġw ond
+Ġw fp
+Ġf op
+Ġf les
+Ġd ci
+Ġm ch
+Ġm wt
+Ġre used
+Ġre implantation
+Ġn ak
+Ġn ik
+Ġl ucid
+Ġg tc
+id en
+ch rom
+Ġr ft
+Ġal dehyde
+am ers
+ir i
+Ġch ees
+Ġse h
+Ġsh ielding
+Ġle p
+Ġac df
+Ġbet atrophin
+Ġdi x
+ph oid
+Ġap elin
+Ġap noea
+Ġk rt
+Ġall ogenic
+Ġreg ain
+Ġinter cus
+Ġun amb
+Ġam id
+Ġph f
+oth ec
+Ġant iap
+te k
+Ġcol ic
+Ġover st
+Ġunder develop
+Ġtrans radial
+Ġj nc
+Ġend omy
+Ġsm r
+ob ility
+Ġident ities
+Ġprim ed
+Ġhist oric
+Ġgra z
+Ġmicro phot
+Ġdistribut ive
+Ġgluc ans
+Ġur ination
+Ġ20 30
+Ġsl d
+Ġmoder ators
+Ġproportion ate
+ci i
+Ġhyd rated
+Ġmot ives
+Ġsa i
+Ġutil ise
+Ġneuro behavi
+Ġmetabol omic
+Ġrecru its
+Ġdevi ate
+struct ured
+Ġavoid able
+Ġvisual isation
+Ġmt bi
+Ġnucle ation
+Ġlact ulose
+Ġbp rs
+Ġip e
+Ġcall us
+Ġintensive ly
+Ġfd c
+Ġlig ase
+Ġrh c
+Ġestablish es
+Ġprefer ring
+Ġeg cs
+Ġgover ning
+Ġstrict uring
+Ġoct ogen
+Ġrv sd
+Ġln g
+Ġinterf acial
+Ġannual ized
+Ġintermed iates
+Ġsv c
+Ġcontin ual
+Ġviol ated
+Ġfron to
+Ġobstruct ing
+Ġamp d
+Ġhol low
+Ġpod s
+Ġfa ec
+Ġattend ances
+Ġket o
+Ġpseud ot
+Ġtob ramycin
+Ġrefract ive
+Ġls be
+Ġtemporal is
+Ġlh rh
+Ġcrypt ogenic
+Ġurea pl
+etal a
+Ġtric ycl
+ik es
+Ġmamm ography
+Ġchond rot
+Ġcef azol
+Ġhydroxyl ation
+Ġmad cam
+Ġvf d
+Ġimmunomod ulator
+Ġirrit ant
+Ġphyl a
+Ġinters cal
+Ġinters ecting
+Ġdivertic ula
+Ġdg p
+Ġbot ulinum
+Ġveter an
+Ġisot retin
+pept ides
+Ġisra eli
+Ġhypov olemic
+Ġphotos ensit
+Ġburdens ome
+Ġundersc oring
+Ġlaun ch
+Ġpco a
+Ġwood en
+Ġmcr c
+Ġbull ous
+Ġexud ate
+Ġbutt ock
+Ġspirom etric
+Ġbibli ometric
+Ġstillbirth s
+Ġchap ter
+Ġpyram id
+Ġpolyg on
+Ġinactiv ating
+Ġdps c
+Ġantimyc otic
+yel ination
+Ġenerg ies
+Ġexplant ation
+Ġvaric ose
+Ġunrest ricted
+Ġdysg lycemia
+Ġserpin b
+Ġelt rombopag
+Ġtracheostom ized
+Ġhott ip
+Ġtaip ei
+Ġhesit ancy
+Ġisotretin oin
+b iotic
+d em
+f in
+v us
+w g
+x y
+y ces
+Ġt ies
+Ġt uc
+Ġc ves
+Ġp omeg
+Ġw ky
+Ġand erson
+as se
+an one
+ct cc
+Ġh ans
+Ġe be
+Ġst c
+Ġst ad
+Ġst air
+et o
+Ġg pt
+Ġg arg
+th etically
+ol ding
+if c
+Ġas l
+Ġbe ag
+ot ecan
+Ġr ld
+Ġal fa
+ag cc
+op enic
+Ġde w
+ort em
+Ġby pro
+ial ytic
+Ġpre jud
+ip uncture
+Ġco ok
+Ġco urt
+Ġind ef
+Ġsign ify
+pt ans
+Ġsignific ances
+ary l
+Ġk un
+Ġun ans
+Ġun bound
+Ġmod ulators
+Ġbl u
+Ġag ac
+yst all
+Ġdep iction
+Ġsp asms
+Ġem uls
+Ġdem on
+val ue
+urs ive
+Ġed c
+Ġhyper ventilation
+Ġhyper homoc
+Ġif a
+Ġav a
+Ġic is
+Ġz usanli
+Ġbm gls
+Ġdent o
+Ġsl ns
+Ġbr g
+Ġoff ending
+Ġapp reh
+Ġcolon oscope
+amin idase
+ochem otherapy
+Ġback wards
+Ġpd f
+Ġangi ogenin
+Ġhr m
+Ġmagn ifications
+Ġmes ially
+Ġlay out
+Ġopen ly
+Ġrecogn ising
+Ġster ol
+Ġven ipuncture
+Ġmc n
+Ġpt bd
+hyd rate
+12 3
+Ġdepend ents
+Ġstem med
+Ġide gli
+Ġspl an
+Ġcarb oplatin
+gt a
+10 7
+Ġtransport ing
+Ġcc g
+rog rams
+Ġnh f
+Ġsem aglutide
+Ġcf i
+Ġgh s
+Ġtransition ing
+Ġuns cheduled
+Ġnt i
+Ġmh v
+Ġorient ations
+Ġterminal s
+Ġdownreg ulate
+Ġelectroph oretic
+exp ression
+Ġank les
+Ġsubstit utions
+Ġiod ized
+Ġcrypt ococcus
+prot ected
+Ġbt i
+Ġaver ted
+Ġinterleuk ins
+Ġintub ate
+onucle ic
+Ġju xt
+Ġbud s
+Ġbud eson
+ref lex
+Ġoffic ially
+Ġemphasis es
+Ġsct e
+Ġsynth et
+Ġperfor atum
+Ġsj s
+Ġrhiz omes
+Ġthr ust
+Ġpj h
+Ġretire es
+Ġok c
+Ġclon ing
+Ġhelic opter
+Ġadvoc ating
+Ġvb me
+Ġdiscern ible
+Ġoriental is
+Ġantibi ogram
+Ġchrist ian
+enh anced
+Ġprepro cessing
+Ġmala ise
+Ġphyto estrogens
+Ġchemopre vention
+Ġoment um
+Ġlacun ae
+Ġindist inct
+uren ine
+rha phy
+Ġneurob iological
+Ġkcc q
+Ġreconn ection
+Ġjurisd ictions
+Ġetiopath ogenesis
+Ġpedun culated
+Ġpparg c
+Ġkines i
+Ġuncor rected
+Ġtriacylglycer ol
+Ġpeth idine
+Ġdilu ent
+Ġcraft ing
+Ġphyll anthus
+Ġdebul king
+Ġnoncancer ous
+Ġenven om
+Ġinsem ination
+Ġletharg y
+Ġshenz hen
+Ġpomeg ran
+Ġunans wered
+Ġidegli ra
+4 90
+9 39
+a ur
+g ui
+l ines
+y es
+Ġt fl
+Ġo ys
+Ġo rom
+Ġo ophore
+Ġc ib
+Ġc qi
+Ġp aus
+Ġf udan
+Ġd iz
+Ġd ib
+Ġd vd
+Ġb imax
+as er
+Ġl cl
+ant o
+em orrh
+ist ant
+op us
+ac id
+Ġdis acchar
+Ġco i
+eren ol
+Ġcl um
+Ġhe ath
+Ġaf ld
+Ġap athy
+Ġk um
+Ġk lt
+Ġk edo
+Ġall ocating
+Ġtr ast
+Ġcell ulitis
+Ġun loaded
+Ġun erup
+Ġun structured
+Ġcons cience
+Ġam mp
+Ġacc r
+ap i
 Ġdes orption
-Ġdes ires
-Ġdes erve
-Ġdes aturation
-Ġdes icc
-Ġdes cend
-Ġdes alted
-Ġdes aturations
-acter istics
-Ġso il
-Ġso res
-Ġso up
-Ġso oth
-Ġso br
-Ġso fa
-Ġso hn
-Ġso kransky
-ix ture
-Ġcontrol ed
-Ġar ric
+lect ive
+int ed
+Ġj ag
+Ġproc yan
+Ġproc aspase
+Ġem itting
+Ġpost m
+Ġdr um
+Ġdr ift
+Ġgl ides
+Ġmult ib
+Ġimp ending
+Ġed u
+Ġpath ogn
+Ġif r
+Ġstandard izing
+Ġdo h
+uss ide
+Ġhyp ochond
+Ġimpl icate
+Ġsyn ch
+Ġil i
+Ġpoly herbal
+otic a
+Ġct as
+Ġcap illa
+Ġinjur ious
+Ġelect rogram
+Ġda h
+Ġut r
+Ġvit il
+Ġcre ativity
+Ġcam s
+Ġcoll ated
+Ġwa ited
+Ġgo itre
+Ġcv ms
+Ġvas a
+Ġvas ectomy
+Ġcad re
+Ġabdom in
+Ġhead ed
+Ġpp cm
+Ġrepl ied
+Ġmes othelioma
+Ġwound ed
+Ġven ules
+Ġpneum onitis
+Ġechocardi ograms
+ipl ostim
+Ġprem ises
+Ġmouth gu
+Ġ19 60
+Ġ19 75
+Ġrot ate
+orrh oea
+Ġdeep en
+Ġnutrition ist
+Ġdex ket
+Ġdoct oral
+Ġgi k
+Ġbuc co
+Ġgran zyme
+Ġconver ts
+Ġinsp ect
+Ġrevers ibility
+Ġarg on
+Ġfm c
+Ġmyel opathy
+Ġpum ping
+Ġneph rin
+Ġschiz oid
+Ġpy th
+oblast omas
+Ġtf b
+Ġcurc uma
+15 7
+Ġhg d
+Ġelectrocardi ograms
+18 00
+Ġendometri otic
+Ġvd z
+Ġsynthes izing
+Ġram adan
+Ġmer idian
+Ġrm t
+idin o
+Ġabundant ly
+Ġfn b
+Ġmur mur
+Ġpep ck
+Ġlamin ectomy
+Ġub e
+rastruct ures
+Ġrom iplostim
+Ġretin oic
+Ġallo ys
+Ġpra q
+cope pt
+Ġacr idine
+Ġfg id
+iber cept
+Ġ199 7
+Ġgj t
+asp iration
+Ġlld t
+Ġoscill ations
+Ġbac opa
+Ġacclim atization
+Ġearth worm
+Ġantec edents
+Ġscap ula
+Ġinotro pe
+Ġeec m
+Ġexfol iated
+Ġepit ope
+Ġisl amic
+Ġeditorial s
+Ġafl ibercept
+Ġparagangli omas
+Ġsurpass ed
+Ġotolaryng ology
+Ġtachyarrhythm ias
+osap onin
+Ġaven ue
+Ġstry chn
+Ġradios urgery
+Ġanecd otal
+ocent esis
+Ġstomat ological
+Ġechinocand in
+Ġcrosst alk
+Ġadap ter
+Ġpean ut
+Ġnaturopath s
+Ġting ling
+Ġhapt oglobin
+Ġgermac rone
+Ġkurt osis
+Ġcarib bean
+Ġtew l
+Ġunamb iguous
+Ġantiap optotic
+Ġcefazol in
+Ġhyperhomoc ysteinemia
+Ġsplan chnic
+Ġbudeson ide
+Ġpomegran ate
+Ġdexket oprofen
+9 29
+a es
+a ver
+c um
+e or
+i ers
+j ala
+q ip
+r usside
+s artan
+z t
+re ported
+Ġth alidomide
+Ġs rage
+Ġo j
+Ġo ds
+Ġo gs
+Ġc imp
+Ġp ft
+Ġp chc
+ed l
+Ġw md
+Ġf erm
+Ġf ond
+ic ates
+Ġd re
+Ġm q
+Ġb sh
+Ġb inge
+an na
+ar cop
+Ġe uk
+Ġst uck
+om el
+Ġg own
+id ic
+Ġv hl
+Ġal erts
+iz aro
+Ġch ds
+Ġsh l
+Ġsh ades
+se al
+ost a
+Ġme gt
+Ġdi osmin
+and ard
+Ġk iaa
+��pl umb
+Ġinter l
+Ġmod y
+ap ar
+ap optotic
+Ġar yt
+ub ital
+Ġup m
+Ġup ar
+Ġser icin
+Ġover active
+Ġunder way
+Ġra f
+Ġj yg
+Ġsp ms
+Ġem ir
+Ġtra ils
+Ġprov oking
+yl v
+Ġcorrel ational
+oid y
+Ġav idin
+Ġhyp oc
+Ġrep ly
+Ġprot amine
+Ġmy asth
+Ġz ing
+oph ot
+ne bacter
+Ġca hd
+Ġca ecum
+omm it
+Ġil izaro
+Ġsk q
+roph enyl
+Ġrest ores
+Ġec ology
+Ġdirect ives
+Ġq ct
+Ġmat t
+Ġunivers it
+Ġher petic
+Ġlymph oproliferative
+Ġcre ase
+ax ine
+Ġdm ards
+Ġmuc ogingival
+Ġcross es
+Ġhypoth etically
+Ġdom peridone
+Ġplac ent
+Ġmorph ea
+Ġhal ves
+rot erenol
+Ġfill s
+Ġnorm oxic
+Ġlat encies
+Ġcereb ro
+Ġather oma
+Ġmg mt
+Ġantic ipation
+Ġjust ifying
+Ġpt gs
+20 6
+Ġcompet ences
+Ġcyst oscopy
+be i
+Ġsinus oids
+Ġphot odynamic
+Ġger ani
+Ġss r
+Ġsf c
+Ġbroad en
+Ġft c
+Ġonc ogenes
+Ġsmooth ly
+Ġrich er
+Ġpref ab
+Ġhol m
+Ġregen erating
+Ġpenet rance
+Ġnic p
+Ġtal ents
+Ġdb v
+Ġtibial is
+Ġextrem es
+Ġff as
+Ġpeg ylated
+Ġperm itting
+Ġmultif unctional
+Ġvd ac
+perm int
+Ġgn ps
+24 0
+Ġolig uria
+Ġvc d
+Ġtravel ling
+Ġlaryng oscopic
+Ġnb t
+Ġdic er
+Ġvict or
+Ġmur f
+Ġpin point
+ming ham
+Ġlockdown s
+Ġnv c
+Ġbrom ocr
+Ġimmunomod ulation
+ipt ine
+Ġperfor ating
+Ġmib i
+Ġpun ical
+Ġlatin o
+Ġtrypsin ized
+Ġphenyl indole
+Ġtors o
+Ġgelatin ase
+Ġlun ar
+Ġsemin ar
+Ġscratch es
+agt g
+Ġdhe as
+Ġbir mingham
+Ġisop roterenol
+Ġexempl ary
+Ġmyofibrob last
+imer ism
+Ġscap ular
+Ġintrad ialytic
+Ġmoi ety
+quin ones
+Ġanh ui
+Ġhyaluron idase
+Ġmof etil
+Ġnaring enin
+Ġhygien ist
+Ġclub s
+Ġbrist ol
+Ġchor ionic
+omast ia
+Ġstip ulated
+Ġprogest in
+Ġoverdent ure
+Ġhiat al
+Ġproprio ceptive
+Ġmyof ascial
+Ġamaz on
+Ġjohns on
+Ġmicropart icles
+Ġsynovi um
+Ġpess im
+Ġplur ip
+Ġmidf ace
+Ġautotrans plantation
+Ġsuperm ix
+Ġpaeonol um
+Ġprong f
+Ġdelusion al
+Ġholid ays
+Ġbacterioph ages
+Ġcommod ities
+Ġbrachy therapy
+urant oin
+Ġpancreaticoduoden ectomy
+obuty ric
+Ġlrt i
+Ġalien ation
+Ġnitrof urantoin
+Ġbival irudin
+Ġsarm e
+Ġoec ad
+Ġpredomin ately
+Ġendomy ocardial
+Ġinterscal ene
+Ġindef inite
+Ġbimax illary
+Ġilizaro v
+Ġbromocr iptine
+7 80
+8 1
+a ec
+h q
+i ie
+p om
+u o
+w ig
+Ġa cellular
+Ġa zil
+Ġs str
+Ġo man
+Ġp ages
+Ġw ob
+Ġw ages
+it ching
+or ally
+Ġd ft
+ar ma
+Ġre ent
+Ġre ex
+Ġh pl
+Ġl af
+et t
+et axel
+ly s
+Ġwith hold
+Ġg at
+Ġg ur
+Ġg ust
+Ġg gg
+Ġg wi
+ol or
+ol ence
+Ġas par
+un ia
+il ated
+el ph
+Ġpro actively
+am end
+am ples
+qu inone
+Ġpre cious
+Ġgro oming
+Ġle c
+Ġle ep
+Ġac oa
+Ġtw e
+end azole
+Ġme ca
+Ġme ats
+Ġdi ol
+Ġap atinib
+Ġful ing
+Ġab ca
+Ġk ur
+Ġpl enty
+Ġeffect ors
+Ġun protected
+Ġy k
+Ġant iven
+Ġhy men
+Ġcor ac
+Ġcol oring
+Ġpo bs
+cr itical
+Ġen kt
+ile o
+yst emic
+Ġser onegative
+ces cens
+na round
+Ġma h
+Ġmon ica
+Ġimp oses
+Ġmin ors
+Ġi ip
+Ġed h
+Ġatt entive
+Ġpe kk
+Ġhyper prolactinemia
+Ġhyp olipidemic
+Ġdiscuss es
+Ġret ract
+Ġpract ising
+Ġz en
+Ġz nf
+Ġcomplic ates
+Ġmicro in
+Ġca erin
+Ġprop osition
+Ġvers atile
+Ġlo a
+Ġaccur acies
+Ġ6 00
+Ġher itage
+Ġcer cl
+Ġmid night
+Ġmid cab
+Ġsle pt
+Ġmot ions
+Ġreal ization
+Ġpp b
+Ġdeliv ers
+he ets
+he imer
+Ġla ughter
+Ġx x
+Ġpc ce
+Ġmes othelial
+Ġinterpre ter
+Ġfluor o
+12 9
+Ġten ure
+Ġden uded
+Ġcyst itis
+Ġleuk oc
+rup ted
+Ġenter ocytes
+Ġstimul ants
+Ġmil an
+Ġintegr ins
+Ġadren ocortic
+Ġdiver ted
+Ġstabil izer
+Ġchew ers
+13 5
+Ġ18 1
+Ġdark ness
+Ġhm od
+Ġinconsist ently
+Ġsent ence
+Ġthreat en
+Ġtur naround
+Ġeb m
+Ġlad en
+Ġneutral ization
+idin ium
+Ġih h
+Ġih t
+Ġvt i
+Ġju ices
+Ġsuppl ier
+Ġanonym ised
+aden itis
+Ġpep permint
+Ġhes p
+Ġinterstit ium
+omat oid
+Ġlic ens
+Ġumb ell
+Ġtear ing
+Ġcaffe oylquinic
+Ġtrap ping
+Ġfos f
+Ġdiam idino
+Ġtig it
+Ġatl l
+Ġchemo immun
+bas al
+Ġbc me
+Ġku jala
+Ġbifur c
+Ġmalt ase
+Ġrock all
+Ġisch ial
+Ġspondyl o
+Ġsparse ly
+Ġmultiplic ation
+600 125
+Ġpostp one
+Ġasthm atics
+Ġatom oxetine
+Ġabrup tion
+Ġantec ubital
+Ġaggl omer
+Ġpyel oplasty
+Ġsubch ronic
+Ġamy rin
+Ġdiscour age
+Ġelu ent
+Ġenthus i
+Ġptp n
+Ġvigil ant
+occ up
+Ġtonsill ar
+Ġdereg ulation
+Ġpharmacop oe
+Ġpleth ysm
+Ġhast v
+Ġpermiss ive
+Ġtachyarrhythm ia
+Ġlithuan ia
+Ġvasorelax ant
+Ġcory nebacter
+Ġmicronucle us
+Ġalc ian
+Ġmispl acement
+Ġmetacarp al
+Ġfumar ate
+Ġadipocyt okines
+Ġnitrop russide
+Ġafghan istan
+Ġenv ision
+Ġpitfall s
+Ġundere xp
+Ġlocom otion
+Ġinappropri ately
+Ġreperto ire
+Ġtrast uzumab
+Ġglides cope
+Ġazil sartan
+Ġantiven om
+Ġenkt cl
+d ock
+e le
+f u
+m us
+n on
+s ul
+w an
+y ly
+re r
+Ġthe ophylline
+Ġo oz
+Ġw its
+Ġf ag
+Ġd ith
+Ġm ate
+Ġm nc
+ar as
+Ġh j
+Ġl vi
+Ġg ini
+ra vel
+ab utin
+Ġv nt
+ot ulinum
+Ġr irs
+ag al
+ist ries
+Ġis se
+Ġres orptive
+Ġinc ur
+Ġad ls
+ad in
+Ġper vasive
+Ġle f
+Ġle fs
+are unia
+ac etin
+Ġco ag
+Ġco ach
+Ġco umarin
+Ġind ap
+Ġcl se
+Ġcl oac
+Ġne p
+we ar
+Ġdi o
+ph s
+Ġk gn
+Ġk wak
+Ġev oke
+Ġun ani
+oth yroid
+Ġpos pom
+Ġresp ects
+Ġcr ying
+cre w
+Ġnon function
+Ġbi ocer
+Ġsp are
+Ġstr ive
+Ġsm mc
+Ġadm a
+oper ic
+Ġed ible
+Ġed wards
+Ġfl ax
+duct al
+Ġpe c
+Ġhyper lipidemic
+Ġintra vit
+Ġintra ductal
+Ġpract icum
+Ġgeneral izing
+Ġz er
+Ġz ah
+Ġmal ar
+Ġdel ong
+Ġmicro aspiration
+ha h
+Ġpa hs
+ink ing
+Ġrest ruct
+Ġcap rini
+Ġfat alities
+Ġlo zen
+Ġextra pulmonary
+Ġsequ encer
+Ġu ve
+let oe
+Ġflu vastatin
+Ġheter od
+Ġak inesia
+Ġreflect ance
+Ġgastro protective
+Ġx od
+Ġattribut ing
+Ġmar cescens
+Ġlay people
+Ġbp v
+opl iteal
+Ġpneum ocyst
+hyd rof
+Ġprescrib ers
+Ġge j
+Ġdeep ening
+Ġdim ers
+Ġminim ising
+urb it
+Ġtit re
+Ġtip ped
+Ġenter opathy
+Ġhar med
+Ġglut amic
+Ġds l
+Ġsf r
+Ġtt t
+Ġcomputer ised
+Ġharm ing
+Ġwithdra wing
+Ġsulf uric
+Ġsuperv ise
+Ġrd q
+Ġapplic ator
+fl amend
+Ġschiz oa
+Ġesophag ogastric
+Ġcontract ures
+Ġreson ate
+Ġplasm odium
+Ġhaemat opoietic
+Ġpic os
+Ġcra c
+Ġrc m
+Ġlr nc
+Ġly cop
+Ġfluctu ate
+Ġnanop ore
+Ġrif le
+Ġrif abutin
+Ġtax onom
+Ġment or
+Ġdisinf ected
+Ġfine ly
+Ġlute a
+Ġunp repared
+Ġnv ivo
+Ġtransduc ers
+con azole
+Ġmono amine
+Ġtab riz
+Ġautops ies
+Ġdend rogram
+Ġendocrin ologists
+Ġnal p
+Ġ199 4
+Ġunsatisf ied
+Ġparox etine
+Ġmetaph ors
+Ġcounteract ing
+Ġhi it
+Ġdiscover ing
+Ġantise ptics
+Ġhypop nea
+Ġgalact ose
+Ġundersc ored
+Ġnu anced
+Ġmembran aceus
+Ġnonf at
+Ġcps p
+Ġay urved
+stud io
+Ġnebul izer
+rust ation
+Ġbutt ress
+Ġventricul ostomy
+Ġeec p
+Ġrearr angements
+Ġexplo ited
+Ġpalat ally
+Ġinhomogene ity
+Ġdang gui
+Ġlithuan ian
+Ġptcs c
+Ġconfront ation
+Ġguiz hi
+Ġhypokines ia
+Ġniss l
+Ġcasel oad
+Ġzy flamend
+Ġrbf pd
+Ġsled ai
+Ġreperc ussions
+Ġtopois omerase
+laf axine
+Ġiliop soas
+Ġaccult uration
+Ġfaec ium
+Ġferm t
+Ġindap amide
+Ġintravit real
+0 9
+f it
+h el
+u cel
+z o
+on ion
+Ġthe ta
+Ġp ending
+Ġan z
+Ġf w
+Ġd aly
+is en
+Ġb omb
+Ġh ood
+Ġh inge
+Ġe ia
+Ġe of
+Ġe eli
+Ġe edl
+Ġto wer
+Ġn cl
+Ġst un
+om onic
+Ġl oses
+Ġas n
+ra i
+el alis
+ab e
+Ġv pa
+Ġbe ach
+Ġpro anp
+ot i
+iv oc
+em as
+ag gt
+ir r
+op io
+Ġch agas
+ip ore
+Ġac ag
+Ġare na
+Ġdis organized
+Ġco valent
+Ġind uctively
+Ġme vt
+Ġit ero
+Ġsc orad
+Ġk am
+Ġk me
+Ġk cal
+Ġafter care
+Ġtreat able
+Ġrec ap
+Ġsub ord
+Ġmed ull
+Ġph t
+Ġmod s
+Ġtim eliness
+Ġy m
+Ġy ale
+Ġar p
+Ġar ts
+ub ic
+Ġcr isp
+Ġra g
+Ġra asi
+Ġtrans glut
+Ġj h
+Ġj er
+Ġj ama
+Ġj azan
+Ġj hp
+Ġsp d
+Ġsim ulators
+Ġdef ens
+ri ol
+Ġsome where
+Ġpe e
+Ġif e
+Ġet ts
+Ġpot ently
+Ġclass ed
+ps is
+Ġox cl
+Ġvol ixibat
+Ġcd yn
+Ġang ulations
+Ġmat s
+Ġaut os
+ick ed
+Ġimplant ology
+cin ol
+orph ism
+Ġmm i
+Ġoste oid
+Ġble ached
+bers ome
+Ġanxi olytics
+Ġu em
+Ġconcer t
+Ġib w
+Ġcm tm
+Ġvas omotor
+Ġtn bc
+Ġdown load
+Ġlv peg
+Ġner d
+Ġoxygen ase
+Ġhepat os
+Ġla h
+Ġtnf a
+Ġdoc etaxel
+Ġann oy
+roc umab
+Ġ10 3
+Ġtb l
+Ġvs p
+Ġdim eth
+Ġfet uin
+Ġneurolog ists
+Ġrh gh
+Ġcum bersome
+Ġcc n
+Ġarr ange
+Ġid elalis
+Ġgas l
+Ġqol rad
+Ġperioperative ly
+Ġns qip
+Ġmb d
+Ġobstruction s
+emb ered
+osin us
+Ġmach ined
+Ġgingiv omucosal
+Ġpotent iated
+Ġlib ido
+Ġexpand ers
+Ġsent iment
+Ġord inate
+Ġaid ing
+Ġfacult ative
+Ġhg b
+Ġorthop antom
+Ġscr ip
+Ġshr imp
+90 3
+otra c
+Ġpresum e
+Ġ23 1
+Ġmanip ulator
+Ġscler ostin
+Ġcoron oid
+Ġfluctu ated
+aden omas
+Ġcircumf erences
+ofib rosis
+Ġsynchron ization
+uan idine
+Ġspot ted
+Ġali rocumab
+Ġecho es
+Ġparamed ian
+Ġcard am
+Ġbor g
+Ġpent a
+Ġhold ers
+Ġmad rid
+Ġgout y
+Ġaet iological
+Ġvr f
+Ġkm ds
+Ġmist letoe
+Ġku opio
+Ġimag inable
+Ġltc f
+Ġgynaec ologists
+Ġcyan idin
+Ġ199 6
+Ġfoam y
+Ġhung arian
+Ġankyl ogloss
+Ġpropag ated
+Ġspin osum
+Ġentail ed
+Ġhydroc arb
+Ġpma h
+Ġpae oniflorin
+ql q
+Ġcvr fs
+Ġbos well
+Ġspong es
+Ġallograft s
+Ġunco ated
+Ġton ometry
+Ġcheek s
+55 64
+Ġspons or
+Ġtort u
+Ġoligonucle otides
+Ġcheng du
+Ġdwell ers
+Ġpog onion
+Ġtransg ender
+Ġbdm ards
+Ġmetane ph
+Ġhbr p
+Ġwilli ams
+Ġtetram ethyl
+Ġresign ation
+Ġzon ulin
+Ġimmunocyt ochemistry
+Ġglaz ed
+Ġmacrom olecules
+Ġnah co
+Ġprosthodont ics
+Ġitra conazole
+Ġwhipple i
+Ġhaw assa
+Ġsciss ors
+Ġvisco elastic
+Ġapprais als
+Ġinatt ention
+Ġunobser ved
+Ġperif ocal
+Ġpseudot um
+Ġprefab ricated
+Ġpharmacopoe ia
+Ġcorynebacter ium
+Ġpneumocyst is
+Ġlycop ene
+Ġidelalis ib
+Ġankylogloss ia
+2 60
+b ro
+b ones
+d el
+k ill
+p ation
+t ical
+t ox
+Ġt arc
+re cht
+at ted
+en i
+Ġc j
+Ġc iting
+Ġp ene
+Ġw k
+es ign
+Ġf vd
+is ites
+Ġm ary
+Ġre oxygenation
+Ġh at
+Ġe ur
+Ġe ad
+Ġn ga
+Ġst och
+ere tin
+Ġl ister
+et ence
+Ġg ac
+el der
+ab o
+ect asis
+od ic
+oc cus
+Ġch t
+ib an
+Ġse af
+Ġse attle
+Ġco al
+Ġind is
+Ġme hg
+Ġsc ab
+Ġall oh
+Ġcan a
+ari us
+Ġpl d
+Ġun ravel
+Ġno zzle
 Ġar cs
-Ġar be
-Ġar ias
-Ġar ora
-Ġar jun
-Ġar iji
-Ġar bagy
-Ġar isen
-Ġar rosion
-Ġar idia
-Ġar achidonic
-amin es
-amin ating
-Ġtest able
-Ġtest ori
-Ġris en
-Ġris es
-Ġinv ite
-Ġinv itation
-Ġinv ested
-Ġinv ades
-Ġinv ading
-Ġmed ved
-Ġmed io
-Ġmed rx
-Ġmed ilink
-Ġshowed that
-enc k
-enc ers
-Ġph are
-Ġph ix
-Ġph ds
-Ġph asc
-Ġph asic
-Ġph arma
-Ġph leb
-Ġmethod ologic
-Ġrisk y
-Ġover t
-Ġover ly
-Ġover pres
-Ġover con
-Ġover gro
-Ġover com
-Ġover time
-Ġover pass
-Ġover taken
-Ġover flow
-Ġover rated
-Ġover hydration
-Ġover see
-Ġover fillings
-Ġover development
-Ġover seas
-Ġnum py
-ke ystone
-ke ypox
-Ġfound ations
-Ġfound ational
-mo ud
-mo bility
-pres ive
-pres so
-Ġbi otypes
-Ġbi ochemistry
-Ġbi ostar
-Ġbi optic
-Ġbi odynamics
-Ġbi olum
-Ġbi ostatistic
-Ġcell titer
-ct ta
-ct gc
-ct atcgt
-ct tcc
-Ġmo tive
-Ġmo ose
-Ġmo ons
-Ġmo tility
-Ġmo ebi
-Ġmo vies
-Ġmo zan
-Ġmo leander
-Ġmo ulding
-Ġmo urino
-Ġmo irangth
+cl idine
+Ġdifferent iates
+Ġte ic
+ond s
+Ġactiv ations
+ail s
+Ġnon se
+Ġj r
+ke ys
+Ġval v
+Ġfur in
+Ġdr unk
+Ġgl o
+Ġmon ob
+Ġmon ofilament
+Ġident ifiers
+Ġmin ipl
+Ġed x
+Ġfl otrac
+arg ase
+Ġhyper vascular
+Ġimm ense
+Ġhyp oman
+Ġloc ator
+Ġop d
+Ġop mds
+Ġox ldl
+Ġmal aya
+Ġsyn apse
+Ġexc iting
+Ġct pg
+Ġfac it
+de hyd
+Ġbr uk
+Ġost ia
+Ġcolon izing
+Ġlymph o
+Ġsw l
+Ġcam phor
+Ġhf ot
+hy clidine
+ales e
+Ġconc ur
+Ġtub ul
+Ġsubst udy
+Ġheter otopic
+ours es
+Ġnet est
+Ġpp pm
+Ġperiodont ist
+Ġenzym atically
+Ġelder care
+Ġbelie ves
+Ġlight cycler
+Ġtransfer able
+Ġldl c
+Ġinternal ization
+Ġcav d
+crib ing
+Ġip d
+Ġmouth rin
+Ġvs cs
+Ġuc la
+Ġgc m
+Ġfil tek
+Ġabsorb ing
+Ġperf ection
+Ġinferior ly
+Ġenter tain
+Ġmill imet
+Ġmill ipore
+Ġsmo other
+Ġdu wl
+Ġlt p
+Ġput amen
+Ġsen na
+Ġdry er
+Ġfas o
+Ġquad as
+Ġlm na
+Ġdut p
+Ġcn l
+arth roplasty
+Ġcoup let
+Ġcord ifolia
+Ġtf i
+infl amed
+Ġarab ian
+Ġembedded ness
+18 4
+Ġpeg asp
+Ġwild type
+edic ine
+Ġlot ion
+Ġbios ciences
+Ġdysp areunia
+Ġrod d
+Ġgastroenter ological
+Ġhypers ensitive
+Ġmetall o
+Ġreser ves
+Ġtann er
+Ġinfer olateral
+Ġrhin osinus
+Ġqi agen
+Ġobli qu
+Ġescal ating
+Ġdecoction s
+Ġcbf v
+Ġivc d
+Ġerg osterol
+Ġacadem ics
+Ġintram ucosal
+Ġtanz anian
+Ġaur icle
+Ġfrank fort
+ili itis
+Ġhistomorph ometry
+180 11
+Ġkar ne
+Ġlank an
+Ġtil ting
+Ġphr ase
+Ġbz ds
+Ġbos entan
+Ġsse o
+Ġpouch itis
+Ġhyperm obility
+Ġinvari ably
+Ġcds s
+Ġcys c
+Ġencaps ulation
+Ġpurpos ively
+Ġfilament ous
+Ġsial adenitis
+Ġcric othyroid
+rack et
+Ġek g
+Ġverte x
+Ġrespir ator
+Ġsacro iliitis
+Ġww cps
+Ġsmy gt
+Ġseawe eds
+Ġstagn ation
+Ġssn hl
+Ġreap pe
+Ġkyn urenine
+Ġxiang ya
+Ġpreinc ubated
+Ġguil ty
+Ġpedic led
+Ġconser ving
+Ġprimip arous
+Ġatax ia
+Ġyuk yung
+Ġneurohorm onal
+Ġagat ston
+Ġmicroangi opathy
+Ġacryl amide
+Ġhyperosm olar
+Ġchees e
+Ġpathogn omonic
+arcop enia
+Ġfosf omycin
+Ġchemoimmun otherapy
+Ġcrac ked
+ivoc ally
+Ġpene hyclidine
+Ġmouthrin se
+Ġpegasp argase
+f em
+f ive
+i osus
+k erm
+n k
+n ion
+n ational
+y ema
+Ġ igh
+in er
+in otecan
+Ġa eg
+Ġth j
+Ġs ang
+en f
+Ġo o
+Ġc js
+Ġp gt
+al amin
+Ġin vers
+es ional
+Ġf uk
+Ġm arm
+an ous
+Ġh ert
+Ġh enan
+Ġto v
+Ġst yl
+ur us
+Ġl j
+Ġg ies
+Ġpro anth
+Ġr ve
+Ġr gs
+Ġr fl
+em oglobin
+Ġis a
+op ulmonary
+Ġinc ar
+Ġim q
+Ġim s
+Ġpre occup
+st an
+ac l
+Ġare col
+Ġdis eng
+Ġme py
+Ġsc cs
+ph in
+ens en
+Ġap ne
+Ġsur c
+Ġpl m
+Ġpl wh
+Ġinter maxillary
+Ġam ber
+Ġph ased
+oth iaz
+Ġy e
+Ġy hq
+Ġro f
+Ġup ec
+ple ural
+Ġser r
+Ġstatist ica
+Ġbas il
+Ġgener ous
+Ġcar pal
+Ġcardi otoxicity
+Ġed ih
+Ġfl aw
+Ġinform ational
+Ġhyper vir
+Ġexperi ential
+Ġic eland
+Ġep wv
+chan ical
+Ġir inotecan
+inu x
+Ġdys geus
+Ġflow ering
+Ġaut istic
+ins ka
+Ġbre eding
+Ġfract al
+Ġsw ift
+opath ology
+opath ogens
+Ġdec itabine
+Ġhb f
+Ġconst ants
+Ġartic ulated
+Ġreal ism
+Ġhs ops
+Ġexist ential
+omp ens
+Ġpd cs
+Ġpp f
+Ġla is
+Ġnucle oli
+Ġx bp
+Ġsn u
+Ġsn hg
+Ġaltern ation
+Ġmg so
+Ġarch ives
+Ġarth rod
+Ġpap ules
+Ġele cs
+Ġpet ech
+Ġspl ines
+Ġoh c
+Ġsd g
+Ġmis cell
+Ġtransf ixation
+Ġleg umes
+Ġprost atitis
+Ġafric ana
+Ġrestric ts
+Ġnan ocomp
+Ġsf lt
+Ġdc d
+Ġdiscontinu ations
+Ġom d
+Ġelectro static
+Ġphenomen ology
+Ġpf ic
+Ġtransition ed
+Ġnt ms
+Ġintermed ia
+ophys ical
+Ġabst ain
+19 4
+13 2
+Ġcab in
+Ġbis ap
+80 3
+Ġfp dr
+Ġfacult ies
+Ġmicroc atheter
+otrop y
+Ġneutral ize
+Ġmas ld
+Ġgf w
+Ġdd r
+Ġmer capt
+Ġrm b
+Ġtun ing
+Ġsple ens
+Ġzirc onium
+Ġasd as
+Ġunre ported
+Ġmaxim us
+Ġconform ational
+Ġment on
+Ġimt m
+omod ulation
+Ġobstetric ian
+Ġvascul opathy
+Ġoperational ized
+Ġrhin oplasty
+Ġpit ch
+Ġfen nel
+Ġdeline ating
+Ġpill ars
+Ġfh it
+Ġtig ray
+Ġxanth ones
+Ġengine ers
+Ġpertain s
+Ġocclud ing
+Ġtq f
+Ġceram ides
+Ġnews paper
+Ġclon ogenic
+Ġneuron av
+Ġlich enoid
+Ġpolicym aking
+Ġmk k
+Ġpq ct
+Ġpce a
+stud ies
+Ġpollut ant
+Ġofficinal e
+Ġeea a
+fen idone
+Ġburk ina
+Ġanthra quinones
+Ġpostc ode
+Ġcalg ranulin
+Ġmesal azine
+Ġimmortal ized
+Ġantihist amines
+Ġshim ad
+Ġmillig ram
+Ġforsyth ia
+Ġtbo ae
+Ġtachyc ardi
+Ġconcav ity
+stro ke
+Ġdeoxyn ucle
+Ġoophore ctomy
+Ġpostm ortem
+Ġpunical agin
+otulinum tox
+Ġuve itis
+Ġbruk er
+Ġarecol ine
+Ġdysgeus ia
+Ġarthrod esis
+otulinumtox ina
+1 53
+b our
+g ement
+g ets
+h ort
+m eter
+m ethyl
+v in
+w il
+Ġ iz
+Ġa ov
+Ġa eln
+on o
+at ate
+Ġs ne
+Ġc lev
+Ġc ocl
+Ġf j
+Ġf ta
+Ġf eng
+Ġm enses
+Ġb j
+Ġre orientation
+Ġh art
+le ted
+Ġe oe
+Ġe adi
+Ġe uph
+Ġn op
+ur ition
+ur bs
+Ġl ol
+Ġl end
+Ġwith held
+id d
+id ins
+ut ell
+Ġex os
+Ġex cer
+ot onic
+iv ist
+Ġis os
+Ġim ids
+Ġcomp lying
+Ġad o
+ad ine
+ad dition
+Ġsh eng
+Ġsh aded
+Ġass uring
+Ġac ral
+ac ytic
+Ġbet aine
+Ġcl ad
+Ġcl icking
+Ġhe bei
+ost e
+end ence
+Ġev ar
+Ġtr iceps
+Ġmet as
+Ġpl n
+Ġpl ann
+Ġrec s
+Ġun inter
+Ġam es
+Ġam star
+Ġph on
+Ġqu ater
+Ġmod al
+ap ers
+Ġfol fir
+Ġexp ulsion
+ren orphine
+Ġhy l
+Ġro di
+ser ine
+Ġover sh
 Ġparticip atory
-Ġcol ic
-Ġcol ds
-Ġcol oring
-Ġcol de
-Ġcol linearities
-ber y
-ber ates
-ber to
-iss ity
-iss ance
-iss ibility
-lu ter
-lu oron
-Ġtime frames
-Ġdec ays
-Ġdec oration
-Ġdec ellular
-Ġdec iles
-Ġdec eptive
-Ġdec edent
-Ġdec ennial
-Ġboth r
-Ġboth ered
-Ġobser ves
-Ġcr a
-Ġcr ater
-Ġcr ush
-Ġcr ust
-Ġcr ick
-Ġcr af
-Ġcr imin
-Ġcr ime
-Ġcr ash
-Ġcr ista
-Ġcr onbach
-Ġcr atered
-Ġcr ashes
-Ġcr ippa
-Ġcr istae
-Ġsec t
-Ġsec ular
-Ġroot ward
-Ġag encies
-Ġag itated
-Ġag tgg
-Ġag ilent
-adi er
-adi ation
-adi ene
-Ġcal oric
-Ġcal cemic
-Ġcal zol
-Ġcal amities
-ech ing
-ech oic
-ech enich
-Ġfour fold
-tem a
-tem eier
-ite x
-Ġperiodonti al
-Ġstr aining
-Ġstr iving
-Ġstr ands
-Ġstr uble
-Ġstr ange
-Ġstr anger
-Ġstr aws
-Ġstr iae
-Ġstr uck
-Ġstr atov
-Ġstr anded
-ex ct
-ex posing
-cc cat
-cc aag
-cc aact
-cc cagct
-cc acagtt
-Ġindic a
-Ġ1 13
-vid opo
-Ġproc ured
-Ġproc era
-Ġproc alc
-Ġproc urement
-les ion
-Ġimpl acement
-Ġimpl ode
+Ġra aa
+ber ger
+Ġbi ostat
+Ġj oy
+Ġsp ines
+Ġend uring
+Ġdist illation
+Ġem pa
+Ġsm v
+Ġcharacter ise
+ox a
+Ġhyper stimulation
+Ġcent imeters
+Ġextract ive
+Ġgra d
+Ġins ensitivity
+ov agal
+Ġvis omit
+Ġav ms
+Ġic n
+Ġret rop
+acy cl
+chan in
+Ġcaus tic
+Ġmicro architecture
+ade h
+Ġec d
+Ġlip osomal
+Ġbenef icence
+Ġsl im
+Ġbr as
+cin ate
+Ġcy r
+Ġmm o
+Ġappe al
+ann an
+Ġdetail ing
+Ġstren uous
+Ġcs ii
+iot omies
+Ġib a
+Ġcod ons
+Ġinhibition s
+Ġdil uting
+Ġrev man
+Ġenc rustation
+Ġvisual ised
+ocy anine
+Ġalb endazole
+Ġbp i
+Ġbal ances
+Ġpurp ura
+Ġped est
+Ġcheck er
+Ġmouth piece
+Ġdra ws
+Ġarm our
+Ġcompet e
+Ġbio chanin
+Ġtransport s
+Ġtri hydroxy
+Ġid r
+Ġom i
+Ġgovern ed
+Ġlt x
+Ġnc ws
+Ġcf x
+Ġscaven gers
+Ġemp yema
+Ġaml odipine
+Ġlys osomes
+Ġpreser ves
+Ġrich mond
+Ġappoint ed
+Ġround ing
+Ġwr ists
+Ġia a
+Ġcarcin ogen
+Ġnp i
+Ġnic los
+Ġdb a
+Ġhoney b
+Ġmeaningful ly
+Ġdisappe ars
+Ġtun is
+Ġtravel ed
+Ġtravel led
+Ġbb ps
+Ġmu as
+Ġarteri osus
+Ġbup renorphine
+Ġintoler able
+Ġunw ell
+Ġepig all
+Ġsore ness
+Ġlg v
+Ġcinnam om
+Ġgst t
+Ġnoct uria
+Ġinqu ire
+Ġspondyl od
+Ġvh n
+Ġcounteract ed
+rod erm
+Ġfrust rated
+Ġbenchmark s
+Ġnavig ating
+Ġmos qu
+Ġrl os
+Ġextens ors
+Ġpir fenidone
+obulin emia
+Ġposter o
+Ġxf zy
+Ġscrutin ized
+Ġaffirm ative
+Ġglucuron ide
+Ġrug osa
+Ġtentative ly
+Ġkiss ing
+sever al
+Ġmyr rh
+Ġprokin etic
+Ġpedig ree
+Ġmacros omia
+Ġlone ly
+Ġimmunopos itive
+Ġcarbam azepine
+Ġreinter vention
+Ġdichlorofluores cein
+Ġpetros al
+Ġdisulf ide
+Ġtcms p
+sha pe
+Ġaper ture
+Ġbish op
+Ġalz heimer
+Ġembod ied
+Ġbeag le
+Ġdew ax
+Ġooz ing
+Ġteic oplanin
+Ġrhinosinus itis
+Ġrfl p
+Ġhsops c
+Ġelecs ys
+Ġmiscell aneous
+Ġvisomit in
+Ġniclos amide
+1 38
+a el
+b en
+b and
+c ase
+l ife
+m ph
+o ud
+r ally
+t otal
+w atch
+in ization
+Ġa ell
+at ers
+at ri
+en ers
+Ġc ch
+Ġp act
+Ġp amph
+Ġw isc
+Ġin o
+it n
+es ters
+Ġf ars
+Ġm int
+Ġh ant
+Ġh ff
+Ġh ts
+Ġe in
+Ġe og
+Ġto go
+ur ities
+Ġl ately
+et ium
+im otor
+Ġg vs
+ig ms
+th s
+if rct
+ra ce
+ow ed
+ab ular
+Ġpro apoptotic
+Ġr ch
+Ġis g
+Ġres urf
+Ġor m
+Ġde ploy
+iz ine
+Ġpre in
+Ġanal yte
+Ġsc utell
+Ġdi ath
+Ġk oh
+Ġpl gf
+Ġsub glottic
+Ġmed calc
+Ġmod ifier
+Ġpr ince
+Ġcr ut
+Ġcr cl
+Ġup f
+ym ethyl
+iss a
+Ġunder ut
+ace ll
+Ġend ang
+Ġem rs
+Ġevalu ative
+Ġrem embered
+Ġprov ocation
+Ġbas ing
+Ġimp a
+Ġmin ced
+ust ice
+Ġed itor
+yn thetic
+Ġpe af
+Ġif t
 Ġimpl icating
-Ġimpl oding
-Ġsim ark
-Ġsim ps
-Ġsim ilarily
-Ġbr ion
-Ġbr ass
-Ġbr ust
-Ġbr av
-Ġbr ains
-Ġbr ings
-Ġbr amant
-Ġbr uising
-Ġbr inell
-Ġbr atth
-Ġbr idgman
-Ġbr illiant
-Ġund eb
-Ġund eniable
-Ġund etect
-Ġund ifferenti
-Ġund amaged
-ep tor
-ep ines
-ep sen
-Ġnumber ing
-Ġdia zepam
-Ġexamin ators
-odontic s
-ag t
-ag ation
-ag ion
-ag ue
-ag ens
-ag ulation
-ag ination
-ag tgg
-ag ggt
-ag tctag
-ag reb
-Ġfir ings
-Ġman ia
-Ġman ometric
-Ġman ged
-Ġman eu
-Ġman hatt
-Ġman kind
-Ġman zal
-ack ing
-Ġ2 10
-Ġ2 13
-Ġ2 23
-ath ized
-Ġmaxill ar
-Ġnon cr
-Ġnon fer
-Ġnon red
-Ġnon operative
-Ġnon resp
-Ġnon com
-Ġnon oral
-Ġnon vascular
-Ġnon norm
-Ġnon inf
-Ġnon med
-Ġnon organic
-Ġnon viral
-Ġnon ionic
-Ġnon vital
-Ġnon biased
-Ġnon essential
-Ġnon porous
-Ġnon linearities
-Ġnon cycl
-Ġnon metal
-Ġnon nen
-Ġnon pain
-Ġnon rand
-Ġnon alcohol
-Ġnon resorbable
-Ġnon ionizing
-Ġnon verbal
-Ġnon operated
-Ġnon stop
-Ġnon profit
-ric ulomegal
-Ġsurg ed
-pos ively
-pos itories
-Ġdisc ounts
-Ġdisc onnected
-Ġsup ress
-Ġsup plying
-Ġsup erstructure
-Ġsup positories
-Ġgener gy
-Ġfirst born
-Ġappl iable
-Ġclass ed
-Ġorth ophosph
+Ġcase in
+Ġeth ane
+Ġcur iosity
+Ġinj ustice
+Ġcap itation
+Ġq hg
+ulin a
+Ġsl ack
+Ġbr iggs
+Ġlo e
+opt ysis
+Ġke uls
+Ġoste itis
+Ġoste opathic
+Ġphen azine
+Ġcross link
 Ġorth odox
-pt een
-Ġradi opro
-Ġradi obacter
-Ġradi osensitiz
-Ġdef ies
-Ġdef ences
-Ġdef ending
-Ġdef lected
-Ġdef rag
-Ġdef erred
-Ġsp b
-Ġsp am
-Ġsp ores
+Ġsatisf act
+emi as
+Ġmand ate
+Ġspecial ity
+Ġta ad
+Ġgr at
+Ġmi o
+Ġmi rab
+Ġalb a
+Ġven lafaxine
+lo ok
+Ġip m
+Ġgerm ination
+Ġped agog
+Ġnit ros
+Ġchi k
+Ġpt a
+Ġpt ca
+oly mer
+Ġcro atia
+Ġid d
+Ġcran io
+Ġchart ing
+Ġast il
+17 0
+Ġmyel ofibrosis
+Ġamp ullary
+arb ase
+Ġlib eration
+Ġ00 2
+Ġket ofol
+Ġbul g
+Ġformer ly
+Ġrib bon
+yr yl
+Ġff d
+Ġhomogen izer
+Ġtl g
+Ġcure ttes
+Ġ31 50
+Ġlin ol
+Ġgranul osa
+Ġdiaph ysis
+99 9
+Ġcha o
+Ġrm pa
+Ġbab es
+Ġvc m
+Ġtravel ing
+Ġexert ional
+Ġmening eal
+Ġimmuno assays
+Ġodont oblasts
+Ġparad igms
+Ġuro g
+Ġhv ns
+Ġrecomb ination
+Ġimmunost ained
+Ġlam bda
+Ġdispers ive
+Ġpoc us
+Ġposts ynaptic
+Ġsensor imotor
+Ġvan ill
+Ġaliqu oted
+Ġreplic as
+Ġorthopa edics
+Ġwitness ing
+Ġira es
+Ġtx l
+Ġharmon ized
+Ġsof ter
+Ġunequ ivocal
+Ġfibre optic
+Ġstick y
+Ġqlq x
+fir st
+Ġcruz i
+Ġconting ent
+Ġellip tical
+Ġzym osan
+Ġhemi arthroplasty
+Ġredund ancy
+Ġcarboxy lic
+Ġdissimilar ity
+Ġik dc
+Ġinactiv ate
+odeox ycholic
+Ġembra ce
+Ġgms ys
+Ġasser tion
+Ġcush ion
+Ġcush ing
+Ġmong olia
+Ġcalg ary
+Ġabb ott
+ophyt on
+Ġmesal amine
+igest ive
+Ġquadr atic
+Ġfod map
+Ġcollaps ibility
+Ġcoerc ion
+Ġmacronutri ents
+Ġcontag ious
+Ġlegisl ative
+Ġmict urition
+Ġhpt lc
+Ġinaccess ible
+Ġsurfact ant
+Ġaccu ifrct
+Ġtelecons ultation
+Ġmicrocrack s
+Ġasept ically
+Ġdix on
+Ġneurobehavi oral
+Ġtricycl ic
+Ġunerup ted
+Ġprocyan idin
+Ġplumb agin
+Ġaryt enoid
+Ġaspar ag
+Ġvnt r
+Ġschizoa ffective
+Ġseaf ood
+Ġshimad zu
+Ġclev udine
+Ġlol lip
+Ġquater nary
+5 000
+h ift
+i ji
+p on
+s ka
+Ġ ues
+Ġt ile
+Ġt inea
+Ġa at
+Ġs yt
+Ġs ry
+Ġthe ater
+er ixafor
+Ġan xa
+Ġm ud
+Ġb aker
+Ġb sep
+an oid
+ct ct
+Ġh ic
+Ġe opc
+Ġn j
+Ġn uc
+Ġn bd
+Ġl ut
+Ġl ug
+Ġg ron
+Ġg ift
+Ġas ynchron
+res tal
+up s
+Ġex s
+ot rig
+ot idyl
+Ġr zb
+Ġal isma
+Ġch w
+Ġim n
+Ġim rt
+ib c
+ib izumab
+og onin
+ip ients
+Ġle verage
+Ġdis organization
+Ġco om
+Ġcont usion
+Ġit eration
+Ġinf o
+and ering
+Ġab u
+Ġpl erixafor
+Ġinter atrial
+Ġpres ynaptic
+Ġsub analysis
+ular in
+Ġph y
+Ġph os
+Ġout look
+Ġro ss
+Ġpr oroot
+Ġcr l
+Ġfin ances
+Ġte ens
+Ġbi ores
+Ġj ig
+Ġsp ared
+Ġsp iro
+Ġend onasal
+Ġtra verse
+Ġpred ic
+Ġgl ove
+Ġi ou
+yn d
+Ġet a
+Ġmic u
+Ġgra ys
+Ġav c
+Ġspecific s
+Ġrequ isite
+Ġsin tering
+Ġsin ularin
+Ġhem os
+rain s
+Ġmicro im
+Ġexc ipients
+oph thal
+Ġcd r
+Ġlab oring
+Ġteeth ing
+Ġchange over
+Ġsing ular
+Ġsaf est
+gn ancy
+Ġextra ord
+Ġda id
+Ġcolon izers
+Ġmr m
+Ġcre w
+Ġunt rans
+Ġmuc ocutaneous
+hy oid
+hy brid
+rome chanical
+Ġcoll oidal
+aff e
+Ġhyd rom
+Ġcv m
+Ġcp itn
+Ġsupp ur
+Ġreal ities
+Ġstaining s
+Ġhydro per
+bp gi
+Ġdecl are
+Ġx u
+Ġbelie ving
+Ġul m
+Ġmap se
+Ġrs f
+sh ot
+sh ine
+Ġga a
+ier i
+Ġjust ifies
+Ġblot ted
+Ġten nis
+Ġpm op
+Ġhaem ophilus
+Ġben in
+Ġgc p
+Ġgi i
+10 3
+omal acia
+Ġmill i
+16 1
+Ġdiscontinu ity
+Ġea at
+Ġfer r
+Ġfund ic
+Ġnc m
+Ġln f
+omple x
+Ġmor ality
+Ġdimension ality
+Ġmh b
+Ġmyel os
+Ġdeterior ates
+Ġneph rotic
+Ġ18 0
+Ġ18 2
+Ġattend ant
+Ġts cc
+Ġpseud op
+Ġbul ging
+pan cre
+Ġpig tail
+Ġrf e
+Ġhelpful ness
+Ġempt ive
+Ġmas ters
+Ġorthodont ically
+Ġham str
+23 1
+acet abular
+Ġtel ed
+Ġcha per
+Ġmanip ulative
+oxy lic
+Ġsun shine
+Ġche il
+Ġpor osities
+Ġstere oty
+Ġment ha
+Ġvast us
+Ġsyring ic
+Ġureth roplasty
+Ġeu h
+Ġperpendicular ly
+Ġcontradict ing
+Ġswitch ers
+oll agen
+Ġequilib rated
+hes ive
+Ġcouncil s
+Ġtang ible
+Ġdiscard ing
+Ġxi amen
+Ġvortex ing
+Ġimag er
+Ġworkflow s
+Ġendotox emia
+Ġko j
+Ġmpn st
+Ġupright ing
+Ġvoc s
+ansh inone
+iper idone
+Ġthermocy cler
+Ġdq b
+Ġran ibizumab
+Ġstigm atization
+urea uc
+Ġheterozyg osity
+Ġantin uclear
+Ġirb esartan
+Ġcant on
+Ġcolomb ian
+Ġbibli ographic
+Ġfes o
+Ġanthocyan in
+Ġunderm ine
+Ġelectromy ographic
+Ġoment in
+Ġremineral isation
+Ġhun an
+Ġasser ted
+opharm aceutical
+Ġmisinterpre tation
+Ġoverdent ures
+Ġpread ip
+Ġcranioc ervical
+Ġkarol inska
+Ġugs r
+Ġgeront ological
+Ġthermoco up
+Ġbioact ivities
+Ġabyssin ica
+Ġcoul ter
+Ġunclass ified
+Ġlachn ospira
+Ġebe acopp
+Ġtransglut aminase
+Ġtortu osity
+Ġproanth ocyan
+Ġrof ecoxib
+Ġuninter rupted
+Ġepigall ocatechin
+0 73
+a er
+g rim
+h n
+h im
+h ole
+j dd
+p n
+q or
+r fs
+x s
+y ang
+Ġt gn
+it ious
+Ġf el
+Ġand re
+Ġb ns
+Ġb ureauc
+Ġh ints
+Ġst ops
+om par
+Ġl icking
+ig il
+th a
+ol u
+ud al
+Ġv all
+Ġv cr
+Ġv illin
+od ent
+Ġr ko
+Ġal ab
+am ar
+Ġinc urable
+Ġby f
+Ġch ws
+ess ion
+Ġse ating
+Ġgro c
+ip us
+se psis
+ine ural
+Ġac b
+ac cc
+ac alc
+Ġind ole
+Ġnot ions
+Ġdiff used
+Ġcl r
+Ġne oform
+Ġsc ared
+Ġk ot
+Ġmet avir
+Ġmet eor
+Ġinter t
+Ġsub g
+ans hah
+Ġqu orum
+Ġy ar
+Ġant ile
+Ġar isen
+Ġpr v
+Ġpr ide
+cr s
+Ġag d
+Ġte o
+vent ional
+Ġnon p
+Ġbi ot
+Ġcomm link
+ogra de
+Ġdem rnas
+eth anol
+Ġcharacter isation
+Ġrem itted
+Ġmon oton
+Ġcardi ography
+ust omed
+Ġpe a
+Ġprim rose
+ont on
+Ġes cap
+Ġfe cl
+Ġret ractor
+Ġimmun ot
+ek s
+Ġeff iciencies
+Ġsurvival s
+Ġpa ve
+Ġcir chip
+Ġvi abilities
+Ġnec ros
+ves icular
+Ġbm le
+Ġdirect ory
+Ġq ci
+Ġq ef
+Ġut recht
+Ġcam ou
+Ġhb ot
+me al
+oxid ation
+Ġcp is
+Ġdetect ability
+Ġbiops ych
+Ġspecial izing
+Ġmorph ometry
+Ġbo ug
+Ġpc nsl
+Ġprod romal
+Ġpal iperidone
+Ġnorm oxia
+Ġcort isone
+Ġip ah
+Ġjust ifiable
+Ġste erable
+Ġbio analyzer
+Ġpm vs
+Ġlig atures
+Ġrepro gram
+Ġhar ness
+Ġnan om
+Ġoptim ised
+Ġclean er
+Ġflav ones
+Ġpil grim
+Ġlt bi
+Ġns rct
+Ġmb f
+Ġtherm oplastic
+Ġdeb t
+acent esis
+Ġ14 0
+Ġhl jdd
+Ġland i
+cess ed
+isc itis
+Ġhm c
+Ġpod oplanin
+Ġaud its
+Ġbis ulf
+Ġquick i
+Ġmood s
+Ġls g
+opic lone
+Ġdisl odg
+Ġveget arian
+Ġinfant ile
+Ġsimpl est
+Ġfu ji
+Ġbath room
+mon itoring
+Ġsperm atic
+Ġaminotrans ferases
+Ġepic ardium
+Ġreflex ive
+Ġvacu olization
+Ġureth ane
+Ġspot ting
+Ġvig ileo
+Ġchair s
+Ġpdl f
+Ġqt d
+Ġcoinc iding
+Ġrap d
+Ġsuv mean
+Ġqi ang
+Ġsic ca
+Ġws ls
+Ġole anolic
+Ġdimethyl sulf
+Ġlac eration
+Ġpurs uit
+Ġsulph uric
+inform ation
+Ġsab g
+Ġtermin us
+Ġsymb olic
+Ġmutagen esis
+Ġnominal ly
+Ġintral esional
+Ġxenograft s
+Ġovers ight
+Ġincomp atible
+Ġcant ile
+Ġmicrol iter
+Ġcatalyz ed
+Ġmeticulous ly
+Ġbiomater ial
+Ġunderre ported
+Ġproceeding s
+Ġhypod ense
+Ġwms d
+Ġrecalc ulated
+Ġpermeabil ization
+Ġtwist ing
+Ġkerm anshah
+Ġunic ompartmental
+Ġinconven ience
+Ġinnerv ated
+Ġfoet us
+Ġdros ophila
+Ġdestabil ization
+Ġconvales cent
+Ġphosphatidyl serine
+Ġbim odal
+Ġartem isia
+Ġcytore ductive
+Ġbaro reflex
+phosphory lation
+Ġneurophys iological
+Ġsphen o
+Ġaorto iliac
+Ġadreno ceptor
+Ġprimes cript
+Ġpulver ized
+Ġignor ance
+Ġtrehal ose
+Ġazt reon
+Ġunderdevelop ed
+Ġcercl age
+Ġuem r
+Ġincar cer
+Ġaov c
+Ġcirchip k
+Ġcamou fl
+Ġbisulf ite
+3 99
+b ites
+e ze
+g are
+h ed
+j v
+j ured
+p ater
+w orthy
+w ogonin
+z ia
+Ġ istan
+Ġt pl
+Ġt ense
+Ġt orn
+in cis
+Ġa op
+Ġa he
+re tic
+Ġth y
+Ġs ach
+Ġs orption
+en et
+Ġo rot
+Ġo pls
+Ġw n
+Ġw ic
+es unate
+Ġd cl
+Ġd pa
+Ġm ose
+Ġm ite
+Ġm ilt
+Ġto s
+Ġn up
+Ġn wi
+Ġst p
+Ġst hd
+Ġl enses
+Ġl kb
+et um
+os ocial
+id iol
+ati bacter
+ol li
+il uted
+ow a
+ab ulary
+ant icip
+Ġal m
+Ġcom t
+Ġcom ed
+Ġis fa
+am bi
+am ivir
+ir ies
+Ġor f
+oc umab
+act g
+Ġme bo
+Ġit c
+ard o
+ph eresis
+Ġk yr
+ug a
+ug ib
+Ġtr icalcium
+Ġrec a
+Ġrec o
+Ġun ity
+Ġun anim
+Ġun anticip
+ill oside
+ach y
+Ġam t
+Ġtim er
+Ġtim ings
+Ġy out
+erm ost
+Ġhy phal
+ub erc
+Ġinv iting
+Ġman ec
+ang ular
+Ġtrans bond
+Ġbi ogenesis
+Ġj m
 Ġsp ark
-Ġsp ouse
-Ġsp ok
-Ġsp aring
-Ġsp onge
-Ġsp oke
-Ġsp atul
-Ġsp icules
-ult urally
-ult urable
-Ġdiagnos able
-Ġj ar
-Ġj ul
-Ġj ig
-Ġj am
-Ġj ak
-Ġj ane
-Ġj itt
-Ġj ang
-Ġj oy
-Ġj ung
-Ġj ones
-Ġj ok
-Ġj cp
-Ġj uan
-Ġj acks
-Ġj ames
-Ġj ails
-Ġj oa
-Ġj eremia
-Ġj ansen
-Ġj enk
-Ġj peg
-Ġj pg
-Ġj inger
-Ġj ansaker
-Ġj epsen
-Ġbut t
-Ġbut ani
-Ġed o
-Ġed its
-Ġed man
-Ġed ax
-Ġed ef
-Ġed ardd
-Ġfur in
-Ġfur unc
-Ġfur haus
-Ġfur usawa
-Ġsample array
-trib utory
-Ġcare ers
-Ġcare taking
-king e
-Ġmicro dr
-Ġmicro jet
-Ġmicro ca
-Ġmicro cy
-Ġmicro flex
-Ġmicro hy
-Ġmicro arr
-Ġmicro abs
-Ġmicro phthal
-Ġmicro ecological
-Ġmicro gnathia
-Ġmicro titer
-Ġmicro ecology
-Ġmicro porous
-Ġmicro aer
-Ġmicro retentive
-Ġmicro tips
-Ġmicro ecosystem
-Ġmicro abras
-Ġcomm ences
-Ġcomm enced
-Ġcomm ands
-Ġcomm uting
-Ġcomm odities
-Ġdem ethyl
-Ġdem aros
-Ġdem erjian
-led o
-led ent
-oun i
-Ġmin k
-Ġmin p
-Ġmin ia
-Ġmin ds
-Ġmin ty
-Ġmin ibr
-Ġmin ced
-Ġmin isce
-Ġmin olta
-cr aft
-cr anial
-cr istopathy
-te ilun
-Ġinto xication
-Ġhy oid
-Ġques ts
-Ġgingiv ial
-port ant
-Ġsubjec tiveness
-Ġsubjec tivism
-Ġextr ude
-Ġextr uding
-Ġextr aradicular
-Ġextr abuccal
-na round
-na issance
-Ġappro vement
-Ġappro ves
-Ġappro imately
-Ġmand ated
-Ġmand ate
-Ġpatient ly
-Ġmaterial istic
-Ġcalc ific
-Ġcalc ite
-Ġcalc ifying
-Ġprob st
-Ġprob atory
-Ġprob ands
-Ġchar ted
-Ġchar ged
-Ġchar ateristics
-Ġbec ker
-Ġi it
-Ġi ked
-Ġi was
-Ġi hu
-Ġi kb
-Ġi owa
-Ġmal ic
-Ġmal ar
-Ġmal tit
-Ġmal ocl
-Ġmal treatment
-Ġmal adj
-Ġmal function
-Ġmal ho
-Ġmal development
-Ġmal mstrom
-Ġmal nour
-Ġmal olactic
-Ġtrans oral
-Ġtrans duce
-Ġtrans itory
-Ġtrans disciplinary
-Ġtrans cranial
-ten ite
-ten ax
-Ġform a
-Ġform ers
-Ġform yl
-Ġform az
-Ġform alities
-Ġoutc oming
-Ġoutc ompet
-Ġop d
-Ġop ts
-Ġop ting
-Ġop io
-Ġop pressed
-Ġop acities
-Ġdi aries
-Ġdi odes
-Ġdi arr
-Ġdi hyd
-Ġdi hydr
-Ġcur l
-Ġcur ro
-Ġcur vi
-Ġcur ving
-Ġcur ious
-Ġcur iosity
-Ġcur rency
-Ġcur itiba
-Ġdevelop er
-ace a
-Ġgr p
-Ġgr ants
-Ġgr its
-Ġgr amm
-Ġgr av
-Ġgr ains
-Ġgr ind
-Ġgr inder
-Ġgr oning
-Ġgr ytten
-Ġgr acile
-Ġgr atifying
-Ġgr abowski
+Ġend ure
+Ġend note
+Ġem se
+Ġdem yelination
+ident ical
+Ġdef lated
+Ġso res
+ior rhiz
+Ġadm et
+Ġbas el
+ob ilia
+Ġlim a
+Ġpe le
+Ġhyper active
+cop d
+ont ine
+Ġes a
+Ġps is
+Ġrep utation
+Ġprot racted
+Ġret ching
+Ġpub chem
+Ġlif elines
+Ġcoh ab
+Ġeth moid
+Ġacid ophilus
+of iltration
+Ġpsych ometrically
+Ġbm ipp
+Ġgluc onate
+br and
+Ġhel ical
+fer t
+Ġec ap
+ram ni
+Ġbr s
+ick s
+Ġdm d
+Ġhb pc
+Ġconc urs
+Ġreli abilities
+Ġpancre atectomy
+Ġhome bound
+Ġnor wogonin
+rit es
+Ġbil aminar
+Ġrepl ica
+Ġgly copept
+iph oid
+Ġsn r
+Ġlight ly
+Ġens emble
+pa w
+och oline
+Ġldl t
+Ġsaliv ation
+Ġaden oid
+Ġhemat ologists
+Ġ" ,
+Ġechocardi ograph
+Ġgerm s
+Ġtg r
+Ġtb md
+Ġchi asm
+Ġpt z
+Ġconsult s
+Ġstem ming
+Ġht x
+Ġart esunate
+Ġexpect ing
+Ġaspir ations
+Ġrecruit ability
+Ġtele ph
+Ġtele monitoring
+Ġbuc k
+Ġapproval s
+Ġmotor cy
+Ġgraph ics
+Ġunderg raduates
+Ġpn n
+Ġmh s
+Ġpg p
+Ġevol ocumab
+Ġphyt osterol
+Ġaggreg atibacter
+Ġfas d
+Ġpractical ity
+Ġsud anese
+Ġterminal ly
+Ġspir ulina
+Ġmood le
+Ġdownreg ulates
+Ġtap es
+Ġconven iently
+Ġosteo in
+Ġregister ing
+Ġwc d
+Ġsensit izing
+Ġdermat omy
+Ġhex ad
+Ġug andan
+Ġld f
+Ġlept osp
+Ġcast ing
+Ġtuberc ulum
+Ġcrypt ococcal
+Ġram ec
+eng ers
+Ġhbs s
+Ġunre ason
+Ġpuls ation
+Ġimposs ibility
+Ġmacro albuminuria
+Ġconceptual ization
+Ġment ions
+Ġuro sepsis
+ech am
+Ġarteri ography
+Ġcrystall ization
+Ġretin ac
+Ġphenoty pically
+Ġreass ured
+Ġunm ethylated
+Ġcontour ing
+Ġflush es
+Ġlus pater
+Ġstream lined
+chanter ic
+Ġkary otypes
+blast ine
+Ġcitizens hip
+Ġvoc abulary
+Ġobs qor
+Ġmeg r
+Ġvh r
+Ġintercept s
+Ġseb ocytes
+Ġfulfill ment
+Ġunequ ivocally
+Ġvin blastine
+Ġbusiness es
+Ġsox h
+itre tin
+Ġcardiover ter
+Ġcolp oscopic
+Ġdhs gt
+Ġyg jd
+Ġard ipus
+Ġpgi i
+Ġpolyt rauma
+Ġmillil iters
+Ġhyaluron an
+Ġhyaluron ate
+Ġembarr assed
+enh agen
+Ġacyl car
+Ġperturb ations
+Ġtgc v
+Ġskim med
+Ġtall er
+Ġdepress ant
+Ġkerat ocyst
+omast oid
+Ġlacun ar
+Ġunin jured
+Ġrestart ed
+Ġedm onton
+Ġbuff ers
+Ġbrady kinin
+Ġdream s
+Ġvitd bp
+Ġsonograph ers
+Ġcuc urbit
+Ġexcav ation
+Ġisoflav ones
+Ġoctad ec
+Ġcamb odia
+Ġkaw asaki
+Ġisovolum ic
+Ġslur ry
+Ġons ite
+Ġaiv r
+Ġmultib racket
+Ġdefens ins
+Ġspondylod iscitis
+Ġmicroim plants
+pancre atic
+Ġalab ama
+Ġaztreon am
+Ġistan bul
+Ġdcl k
+Ġmilt iorrhiz
+Ġisfa han
+Ġunanticip ated
+Ġyout ube
+ramni os
+Ġluspater cept
+Ġardipus illoside
+5 50
+6 20
+b io
+d ont
+e at
+e ol
+f used
+g st
+i ency
+n est
+r imal
+s an
+w in
+w al
+Ġa ie
+Ġa erc
+Ġo rex
+Ġc ie
+Ġc rot
+Ġw onder
+Ġf pa
+or p
+Ġd va
+is o
+Ġm hd
+Ġm iseq
+an y
+Ġh ain
+Ġh ram
+Ġh vs
+Ġe uploid
+Ġe elv
+Ġto es
+Ġn cs
+Ġn dl
+Ġn nt
+om inant
+Ġl ind
+ig uat
+il k
+Ġon oo
+Ġv omit
+ch ain
+Ġpati ence
+Ġpro insulin
+Ġr yp
+Ġal ata
+Ġch u
+Ġch er
+ib und
+act t
+Ġle pro
+Ġle iden
+Ġtw ent
+Ġco ix
+ell ular
+Ġbet h
+Ġcl asp
+end al
+pt othec
+Ġinf rastructures
+Ġap one
+Ġk on
+Ġk ins
+Ġk pa
+Ġtr na
+ose xual
+Ġmed l
+ach ol
+Ġpos th
+Ġpos ters
+Ġy ol
+Ġy ap
+dition ing
+Ġcontrol lable
+Ġra phe
+Ġnon ver
+ep i
+Ġsp ati
+Ġsim iao
+Ġprov isions
+ob t
+Ġdisc ourses
 ons in
-ons ive
-ak s
-ak ata
-ak ani
-ak iri
-fic ations
-ish ita
-ish nan
-Ġdep araffin
-Ġdep olarization
-itive ly
-Ġcorre x
-Ġli ability
-Ġreduc er
-Ġreduc tase
-Ġsal ud
-Ġsal ter
-Ġsal ute
-Ġsal ame
-Ġsal ient
-Ġsal mon
-Ġsal esp
-Ġsal imetric
-Ġsal aam
-Ġsal utogenic
-Ġsal aried
-Ġunder ized
-Ġunder treatment
-Ġunder pr
-Ġunder represent
-Ġunder lining
-Ġunder reported
-Ġunder wear
-Ġunder fillings
-Ġunder cut
-Ġcharacter ise
-Ġlim eira
-Ġlim ongelli
-Ġimp art
-Ġimp ute
-Ġimp inge
-Ġimp inging
-Ġimp regn
-Ġimp inged
-Ġimp urities
-Ġimp atiens
-tor al
-tor is
-Ġpost ulation
-Ġpost ulate
-Ġpost ulating
-Ġpost part
-Ġpost graduates
-Ġpost traumatic
-Ġpost test
-Ġpost cur
+oper azone
+Ġi ws
+Ġatt itudinal
+Ġpe gf
+Ġhist idine
+Ġins ist
+Ġav id
+Ġpract ise
+Ġmo aa
+Ġimmun ochemical
+Ġsin o
+Ġprocess or
+Ġestim ators
+ma i
+Ġheart be
+Ġang inal
+Ġil ium
+Ġcost al
+Ġml a
+Ġadv ising
+Ġbel ly
+Ġaut oradi
+ither to
+Ġsal ut
+Ġlo up
+Ġmid foot
+Ġult rath
+Ġdm ard
+Ġcam ps
+Ġu ws
+Ġconc ludes
+Ġsepar ator
+Ġfinal ized
+Ġrecept ivity
+Ġver r
+ole cular
+Ġhead ing
+Ġalcohol s
+Ġlv a
+Ġheterogene ities
+Ġmi k
+Ġov oid
+Ġtrend ed
+Ġip w
+Ġfield work
+Ġconcept ions
+Ġtb is
+Ġampl at
+Ġrot em
+Ġste am
+12 1
+12 2
+Ġoh l
+Ġht q
+Ġethn ically
+rup tion
+Ġgc v
+Ġleg ion
+Ġcollect or
+Ġeg cc
+Ġenter ocol
+Ġintr ar
+Ġfold ed
+Ġfore foot
+Ġcran iotomies
+Ġelectro anat
+Ġmb g
+Ġhd f
+Ġinterf erences
+Ġvul gare
+19 5
+Ġstabil isation
+Ġsent iments
+enz hou
+Ġaud iometry
+Ġembol us
+Ġcontrovers ially
+Ġneoplas ias
+Ġfist ul
+Ġirrig ating
+Ġlp o
+Ġrecall s
+Ġpolyp ill
+Ġosteoc on
+Ġsubstit uting
+Ġae copd
+utin in
+Ġarab in
+Ġapex ification
+Ġveget ative
+Ġld c
+Ġbenz oic
+olip ids
+Ġmast oid
+Ġexec ute
+Ġoverload ed
+Ġmanip ulate
+Ġtetra chloride
+Ġcef operazone
+Ġscc m
+Ġbud dh
+Ġelic its
+aa a
+Ġbv z
+Ġbuild s
+Ġee os
+Ġate o
+Ġpra e
+Ġginger ol
+Ġthorac o
+Ġpiece wise
+Ġsetup s
+Ġpill ar
+Ġlac rimal
+Ġwarning s
+Ġeconom ies
+Ġreservo irs
+Ġendocrin ological
+47 4
+Ġselen ite
+Ġcyan osis
+Ġcylind ers
+Ġglycoprotein s
+Ġdish on
+Ġisthmus es
+Ġechin acea
+Ġsems s
+Ġtachy p
+Ġnond iabetic
+Ġnecro inflammation
+Ġpepsin ogen
+Ġexud ates
+Ġmx m
+Ġadjud ication
+Ġellip so
+osyn cr
+Ġhemangi omas
+Ġchap ters
+Ġnich es
+Ġdemir jian
+Ġhaplo identical
+Ġcapit ulum
+Ġmotif s
+Ġstap le
+Ġinadvert ently
+Ġvaric ella
+Ġmong ol
+Ġsandblast ed
+Ġsyl vian
+Ġserov ar
+Ġaven ues
+Ġpread mission
+Ġcheb ulinic
+Ġanov as
+Ġastrocyt omas
+Ġsell ae
+Ġfont an
+Ġrhb mp
+Ġexplos ion
+Ġdesensit ization
+Ġadsorb ed
+Ġuncoup ling
+stra ble
+Ġterror ist
+Ġpalest ine
+Ġonab otulinumtoxina
+ortisol ism
+Ġwhee zing
+Ġsro h
+Ġhards hip
+Ġnik on
+Ġoctogen arians
+Ġdemon strable
+Ġsynthet ase
+Ġleukoc atch
+Ġadrenocortic otropic
+Ġspondylo arthritis
+Ġneuronav igation
+Ġtachycardi as
+Ġwisc onsin
+Ġgron ingen
+Ġteled erm
+Ġbiopsych osocial
+Ġdislodg ement
+Ġdimethylsulf oxide
+Ġcamoufl age
+ptothec in
+Ġultrath in
+6 98
+c ard
+d nf
+i os
+j j
+u y
+z ole
+Ġa ides
+re te
+re ctal
+on it
+Ġo ci
+er ational
+Ġp lect
+Ġw ong
+Ġin lays
+Ġf og
+ic iguat
+Ġd te
+Ġd xr
+Ġb ass
+Ġb of
+Ġb cg
+ent olamine
+an ation
+Ġh we
+Ġh ru
+Ġh itherto
+Ġn ogo
+Ġst unted
+Ġl anc
+Ġl ga
+Ġl fc
+ot ome
+ot ted
+am ans
+ir radi
+ore ceptors
+ain er
+Ġle on
+are rs
+Ġass et
+Ġac roch
+Ġare ca
+Ġdis ser
+Ġhe in
+Ġtre ph
+Ġme q
+we i
+Ġsc b
+Ġab a
+Ġsub maximal
+ach ment
+Ġph entolamine
+Ġqu ote
+ren ergic
+Ġant ep
+Ġar ist
+Ġar sa
+Ġvari ate
+Ġup a
+Ġag no
+Ġman ometer
+Ġsup ratentorial
+Ġbut yryl
+Ġtrans urethral
+Ġbi ometric
+Ġbi ochemically
+Ġend ophytes
+Ġem etic
 Ġpost natally
-Ġpost endodontic
-Ġcro en
-Ġcro uz
-Ġimplant able
-Ġconf ers
-Ġconf ines
-Ġconf ron
-Ġconf use
-int endence
-Ġprim ates
-Ġprim itive
-Ġprim acaine
-Ġdetec ts
-Ġdetec tions
-Ġ3 16
-Ġ3 23
-Ġ3 38
-Ġ3 75
-Ġ3 11
-Ġknow able
-cer al
-cer ning
-Ġpain ting
+Ġso ho
+Ġdr gs
+Ġbas ophilic
+Ġimp utations
+Ġkn ots
+Ġpar acell
+Ġi er
+Ġfl ood
+Ġet p
+Ġmic a
+Ġins ur
+Ġprob dnf
+Ġwhere ver
+Ġvis a
+Ġinvestig ative
+Ġep ulis
+Ġmo ly
+Ġsens es
+Ġdel ib
+Ġca im
+of ibular
+Ġsol utes
+Ġec ons
+Ġur d
+Ġelect rograms
+Ġsl ots
+Ġbr ug
+Ġsch o
+Ġhand off
+Ġfoc ally
+Ġsucc umb
+Ġke ap
+Ġsuccess es
+Ġoste ophyte
+Ġdm rs
+bo ud
+Ġdec edents
+Ġhb pm
+Ġreli ant
+Ġcv vh
+Ġstart le
+Ġver iciguat
+Ġlv o
+Ġoc pd
+Ġtop ographic
+ened ione
+Ġcop enhagen
+Ġmt p
+Ġcb ds
+Ġsn iff
+Ġobject ivity
+Ġlight ness
+bal ance
+Ġann on
+Ġport o
+Ġport s
+Ġcort actin
+Ġtend inous
+Ġprec ont
+itt in
+Ġconcept ually
+Ġmel ittin
+Ġampl ifications
+Ġweak ens
+Ġpt n
+Ġpass aged
+Ġaff in
+ogram metry
+Ġnatural is
+Ġcarb a
+Ġwave one
+Ġoccup y
+Ġtransl ator
+ids on
+Ġhar sh
+Ġiran ians
+Ġlar c
+Ġpil low
+Ġeryth roderm
+Ġmanual s
+Ġcf l
+Ġscaven ged
+Ġliqu or
+Ġhd acs
+Ġ14 8
+Ġhl p
+Ġsolid arity
+Ġkeep s
+14 7
+arb oxylic
+Ġtempor ally
+Ġaud iological
+Ġdistinguish es
+Ġprote oglycans
+Ġpad n
+Ġpy ogenes
+Ġlm b
+Ġautophag osome
+Ġrf viii
+Ġafrican um
+Ġinoc ula
+Ġfab ry
+Ġanastom osed
+Ġpara ph
+Ġdermat ophytes
+Ġsupra basal
+Ġdesc end
+Ġgt ps
+Ġintens ify
+23 5
+kin ase
+Ġsubc ostal
+Ġmicros omes
+Ġcred ential
+Ġeuth yroidism
+gtt g
+35 8
+Ġarchitect ural
+Ġcommunic ative
+Ġidi osyncr
+Ġcannab idiol
+Ġxen iji
+Ġexceeding ly
+Ġcaffe inated
+Ġretic ulin
+Ġlag os
+teg rated
+Ġsj c
+Ġpun itive
+Ġepigen etics
+Ġimag ery
+Ġspher oids
+Ġphag ocytes
+Ġendotox emic
+Ġenjoy able
+Ġcts s
+Ġreward ing
+Ġfic us
+Ġplantar um
+Ġbenchmark ing
+Ġunpredict ability
+Ġpartur ient
+Ġmcm aster
+fir med
+Ġquadrup ole
+Ġeyel ids
+Ġdyst rophy
+Ġnil otica
+Ġberg hei
+Ġbronchi ectasis
+Ġwidow hood
+Ġmx gst
+Ġpud endal
+Ġalve olus
+Ġglab ra
+Ġelu ates
+Ġhomeless ness
+Ġmultis ystem
+Ġexfol iation
+Ġpog o
+Ġmea ib
+Ġepist axis
+Ġerrone ously
+Ġremineral izing
+Ġpuer per
+Ġpemphig oid
+olon ization
+igest ion
+Ġhydrol ase
+Ġverte br
+Ġautocl aved
+Ġphotob i
+Ġcatastroph izing
+Ġnco a
+Ġunload ing
+Ġyun nan
+iger ous
+Ġroast ed
+Ġkinesi ophobia
+Ġmouthgu ards
+ommit ment
+Ġtwe ets
+Ġenthusi astic
+Ġmonob ond
+dehyd es
+Ġnanocomp osite
+Ġchecker board
+Ġrch op
+Ġlandi olol
+Ġunreason able
+Ġlepro sy
+Ġdishon est
+Ġacroch ord
+Ġparacell ular
+4 20
+c osis
+h aus
+i ifc
+j ama
+n ip
+r illary
+s ter
+Ġt ads
+on ance
+Ġs les
+Ġs olic
+Ġo he
+Ġc ph
+Ġp ari
+Ġw se
+Ġw ii
+al ib
+al so
+al ene
+it rant
+Ġf cp
+ic ul
+Ġd tic
+Ġd gs
+is ch
+Ġb pts
+as u
+Ġe ads
+ve y
+Ġn its
+ig raphy
+Ġas v
+un a
+il ver
+il imumab
+Ġbe er
+ant rone
+ot rophin
+em ar
+est radiol
+Ġad ct
+Ġper istal
+Ġsu cr
+ip rofen
+Ġass im
+Ġind uration
+art a
+Ġtre pon
+Ġme atal
+Ġme onf
+Ġit l
+Ġit ga
+Ġne echam
+Ġinf od
+Ġsur al
+Ġev o
+Ġmet am
+Ġpres urgical
+Ġam ide
+Ġam ended
+pro b
+ap ular
+alu able
+Ġhy g
+te ch
+Ġvari ates
+ugh ters
+Ġro th
+Ġro str
+Ġen act
+Ġup j
+Ġinv aluable
+Ġfound ations
+ang en
+ang ing
+cer v
+Ġtrans ected
+ros thesis
+Ġj ss
+Ġsp rays
+Ġma z
+Ġgl n
+Ġi w
+amm agl
+Ġfl x
+Ġpain t
 Ġpain kill
-Ġser ine
-Ġser af
-Ġser ologic
-Ġser pina
-Ġser otonin
-Ġser oconversion
-Ġser oprevalence
-Ġser onegativity
-Ġrelated ly
-Ġstat ue
-Ġmet res
-Ġmet acy
-Ġmet rical
-Ġmet atrans
-Ġmet adata
-Ġmet apoly
-Ġvis otool
-Ġvis ceral
-Ġmon ir
-Ġmon se
-Ġmon oph
-Ġmon ochlor
-Ġmon key
-Ġmon obe
-Ġmon oxid
-Ġmon ocycline
-Ġmon onuclear
-Ġmon keys
-Ġmon umental
-Ġmon roe
-Ġmon keypox
-Ġbl oc
-Ġbl ended
-Ġbl ots
-Ġbl au
-Ġbl amed
-Ġbl unting
-Ġbl omma
-Ġbl omstrand
-Ġem ographic
-Ġem bl
+Ġcent ro
+Ġcent ur
+Ġextract or
+Ġpot s
+Ġel c
+Ġindividual ization
+Ġol g
+Ġav xs
+ry onic
+Ġhyp os
+Ġhyp opharynx
+Ġintra articular
+Ġpub is
+Ġappl anation
+Ġtechn etium
+Ġox yn
+Ġfib rotest
+Ġnew ton
+Ġang ulated
+Ġpoly c
+Ġsol ids
+chem ical
+Ġserv ants
+Ġsing ing
+cs h
+Ġdent igerous
+Ġbenef itted
+Ġthir st
+gn ath
+Ġcategor izes
+Ġpan ell
+Ġchem otherapies
+opt osis
+Ġmr as
+Ġmid osta
+Ġsocial ization
+Ġallow ance
+Ġsw ing
+Ġos elt
+Ġmuc oid
+Ġconc urred
+Ġcross head
+Ġartic aine
+Ġdom inating
+Ġoxid izing
+Ġpd us
+Ġcath olic
+Ġsusp ending
+ck s
+Ġx y
+Ġgr inder
+Ġmd ck
+Ġinternal ized
+Ġobtain able
+Ġlat a
+Ġip ilimumab
+Ġhis pid
+Ġadip o
+Ġnas otracheal
+Ġassign s
+Ġpi wil
+Ġwid en
+Ġstre ak
+Ġfd v
+Ġsil ane
+Ġhaem olytic
+Ġmis alignment
+Ġhard ening
+Ġ12 3
+nas al
+rog l
+Ġamin obutyric
+Ġsem esters
+fact ors
+Ġaer od
+Ġsy rian
+Ġom j
+Ġparal yzed
+Ġns l
+Ġhd rs
+Ġdeb ates
+emb ryonic
+Ġstiff ening
+ran ular
+Ġretrie ving
+Ġpg rna
+Ġneph ro
+14 5
+Ġunf olded
+Ġts p
+Ġvaginal is
+Ġbul ge
+Ġperic arp
+Ġoverc ommitment
+Ġtrack er
+Ġosteo arth
+Ġveget arians
+Ġpas cs
+Ġunderestim ating
+au er
+Ġpip e
+Ġstock s
+Ġvt d
+Ġcrani oca
+Ġtrun nion
+Ġadjunct s
+Ġtight ening
+Ġlaryng oscopes
+Ġinos itol
+Ġmature d
+Ġnd p
+Ġscop es
+Ġpalp itation
+Ġ29 3
+Ġdens er
+Ġperip ortal
+Ġgamm opathy
+Ġee cc
+Ġextrapol ating
+Ġmicroh emorrh
+Ġradiol ab
+Ġchemo embolization
+Ġbc vi
+Ġfriend liness
+Ġlu ad
+Ġurolog ic
+Ġloose ly
+Ġmetaph ysis
+Ġdissoci ated
+Ġevapor ative
+Ġophthalm ological
+Ġmicrom otion
+Ġmart in
+Ġvb md
+Ġforth coming
+Ġobsc ured
+Ġlst s
+Ġincomp etence
+Ġnes fatin
+Ġresorb ed
+Ġradiop acity
+Ġcamer amen
+Ġnegot iation
+Ġburk itt
+Ġvic order
+Ġrecalc itrant
+Ġdeaf ness
+mat is
+Ġfellows hip
+prolactin omas
+Ġnim odipine
+Ġantihyperg lycaemic
+Ġprioritis ed
+Ġwf ns
+eas tern
+Ġregistr ar
+Ġinterchange able
+Ġsque ezing
+Ġinconven ient
+Ġmacronutri ent
+Ġminip igs
+Ġsnack ing
+Ġwelc ome
+ocap nia
+Ġozon ated
+Ġdorm ant
+Ġnkt cl
+Ġtpt d
+Ġleukotri ene
+Ġileocol on
+Ġmoz ambi
+Ġhut t
+Ġrent rop
+Ġpolycy themia
+Ġblastom eres
+Ġhypochond riasis
+Ġeuk aryotic
+Ġmyasth enia
+Ġcorac oid
+Ġhesp eretin
+Ġnep alese
+Ġstoch astic
+elder ly
+Ġhant avirus
+igil ance
+Ġqiang gu
+Ġdermatomy ositis
+Ġnonver bal
+Ġtelederm atology
+Ġbof j
+Ġantep artum
+Ġmidosta urin
+Ġoselt amivir
+Ġmozambi que
+3 15
+e b
+k lr
+l ach
+p wt
+s ub
+s app
+v ille
+z v
+z opiclone
+Ġ ibut
+Ġa or
+re li
+Ġth b
+Ġs osic
+Ġo ird
+Ġo ulu
+Ġc ect
+Ġc yn
+Ġp icking
+Ġp rague
+Ġw enzhou
+al er
+Ġan im
+ic ola
+ion g
+or ters
+or iness
+or aminal
+Ġm am
+Ġb af
+an icum
+ro wn
+Ġh gin
+le cs
+Ġst adi
+ur ality
+Ġl xr
+im etic
+Ġg ans
+ud il
+Ġon ion
+Ġv ai
+Ġpro ptosis
+ant i
+ag ar
+Ġis m
+Ġde als
+Ġde acon
+est ab
+Ġch ym
+Ġch abc
+ure as
+act c
+Ġad ducts
+Ġpre co
+Ġsh el
+Ġsh ops
+ign ment
+Ġass ists
+Ġco iling
+Ġsign ified
+art ic
+Ġtre k
+ost atus
+ast rich
+Ġab md
+Ġk bp
+Ġinter incis
+Ġun att
+Ġun enhanced
+Ġacc ru
+Ġheal er
+Ġmod ifies
+ract yl
+Ġsam c
+dition al
+ak t
+Ġvari ably
+Ġvari abilities
+Ġcor ners
+Ġcr us
+Ġser ostatus
+Ġte ch
+Ġra is
+Ġperi o
+Ġend ocytosis
+Ġend osteal
+Ġend obronchial
+Ġend orse
+Ġchar les
 Ġem ax
-Ġem ble
-Ġem press
-Ġem ittance
-Ġem mel
-Ġem anate
-Ġem irates
-ulti vable
-Ġfre y
-Ġfre uden
-Ġfre mitus
-Ġfre tibacterium
-Ġfre iburg
-Ġcomple ments
-Ġsin k
-Ġsin ter
-Ġsin ha
-Ġsin clair
-Ġol tra
-Ġol cay
-Ġol omouc
-Ġintr ons
-Ġintr icate
-Ġintr atum
-Ġintr uding
-Ġintr aind
-Ġintr aradicular
-Ġintr abuccal
-Ġintr anuclear
-Ġintr arater
-Ġintr usiveness
-its geme
-its chak
-amm ed
-amm ery
-amm onium
-Ġneed iness
-Ġ0 000
+Ġdem mi
+Ġval d
+Ġma astrich
+ri end
+Ġdisc ounted
+Ġref ining
+oper itoneal
+Ġmin ister
+Ġsec a
+Ġif v
+Ġcomple ters
+cop ic
+Ġposs um
+Ġes zopiclone
+Ġrep urp
+Ġexpl anted
+Ġop c
+Ġsin omen
+Ġhem ophag
+Ġhem optysis
+Ġdel hi
+Ġacid ification
+Ġanalyz ers
+orb ol
+Ġradi ant
+Ġdys th
+Ġprom astigotes
+Ġbm ds
+Ġec u
+Ġdirect ing
+ram er
+Ġcategor isation
+iat ry
+Ġda ughters
+Ġke en
+Ġlymph atics
+Ġallow able
+Ġu ic
+Ġpromot or
+ops in
+Ġcm y
+Ġcm klr
+Ġod ys
+Ġreason ed
+Ġtemper aments
+dm ards
+Ġreal m
+Ġpd x
+Ġlv s
+Ġpp gl
+Ġdil ate
+Ġms v
+Ġrad boud
+Ġangi osarcoma
+Ġwhat sapp
+Ġprep re
+Ġx uan
+Ġsn hl
+Ġtnf r
+uk ang
+Ġglob ular
+Ġthromb oses
+Ġgr ids
+Ġpeak ing
+Ġpc g
+Ġtc fa
+Ġcycl ical
+Ġrs m
+Ġcorrect ness
+Ġkit chen
+Ġrank ings
+Ġnf c
+Ġprem orbid
+Ġlum bos
+Ġpap ain
+Ġcircum vent
+Ġge om
+Ġht t
+Ġtract us
+Ġnatural istic
+gt tt
+Ġpac a
+Ġtransl oc
+Ġcat at
+Ġinstruction al
+Ġsouth eastern
+Ġseptic emia
+Ġauthor itative
+Ġfix ture
+Ġom pa
+Ġclar ke
+Ġhd fs
+Ġjud ges
+Ġards net
+Ġaort opathy
+Ġintermed iary
+Ġmor gan
+Ġdimension ally
+17 8
+Ġmultic ultural
+Ġsv a
+Ġoverl ength
+Ġtong ues
+Ġactin obacteria
+Ġpotent iating
+Ġcephal ad
+Ġprotect or
+Ġpy kn
+Ġbound ed
+Ġcanad ians
+Ġgd na
+Ġeb d
+Ġeb t
+Ġrefract oriness
+Ġls v
+Ġbs m
+Ġbs mi
+Ġmf d
+Ġtrust worthy
+Ġham burg
+Ġtel es
+Ġpic us
+Ġmer ge
+eng ine
+Ġimped es
+Ġclos ures
+Ġrac fs
+Ġmaxim ise
+Ġunnec ess
+Ġgon ion
+Ġoccupation ally
+Ġsplen ocyte
+min ist
+Ġdot atate
+Ġcoc cy
+Ġosm olar
+Ġtu ft
+Ġmist ake
+Ġjo anna
+Ġze iss
+Ġoutd ated
+Ġbg h
+Ġhistomorph ological
+ctt g
+Ġframes hift
+Ġuh m
+ju ana
+Ġnu ances
+Ġperist omal
+Ġteg aser
+Ġsubdom ain
+Ġtransmit ral
+Ġslov akia
+Ġstap ed
+Ġflor id
+Ġflor ida
+Ġangio edema
+Ġnicotin ic
+Ġpom c
+Ġsque eze
+Ġgeor gia
+Ġhypercoagul able
+opept idase
+Ġhiat us
+Ġhydrol ate
+Ġabrog ated
+Ġhyperchlore mia
+Ġstear ic
+Ġdilat ations
+Ġmari juana
+Ġgermin oma
+Ġflic k
+Ġamnes ia
+Ġnoninferior ity
+Ġphotosensit izer
+Ġvitil igo
+Ġpyth on
+Ġzing iber
+Ġdeoxynucle otidyl
+Ġtunis ian
+Ġsatisfact orily
+Ġlollip ops
+Ġsoxh let
+Ġaerod igestive
+Ġibut ilide
+Ġmaastrich t
+Ġtegaser od
+5 1
+c ally
+e an
+h pg
+n ered
+x c
+Ġ ive
+in ox
+Ġa ya
+Ġth cs
+Ġs omal
+Ġo ed
+Ġo ud
+Ġc able
+Ġc ree
+Ġp ab
+Ġp be
+or rhaphy
+Ġd iter
+Ġm op
+Ġm ov
+Ġm orb
+Ġb ert
+ent h
+as tern
+Ġh ent
+Ġh ull
+Ġn fs
+Ġn ij
+ere ctomies
+Ġl q
+Ġl sc
+ly c
+Ġg gd
+id i
+id ases
+ati v
+ud a
+il age
+el m
+ab i
+ch u
+Ġex ou
+Ġal er
+ag inous
+um c
+ir an
+oc ality
+ver y
+Ġch p
+Ġch an
+og est
+Ġper tained
+Ġle x
+Ġass es
+Ġco ats
+eren one
+Ġhe pt
+Ġme ws
+ph ant
+ph arm
+Ġap af
+Ġk ts
+Ġtr m
+ill ofacial
+ans ia
+Ġy an
+Ġy ing
+Ġant e
+Ġant ir
+ide a
+Ġar gs
+Ġro ads
+Ġmeas les
+Ġpr iap
+ub bles
+Ġcr ib
+Ġund iluted
+Ġser p
+Ġover protection
+Ġte as
+Ġman chester
+Ġ1 10
+Ġtrans abdominal
+Ġnon clinical
+ep ar
+Ġbi k
+Ġindic a
+Ġj ian
+Ġj mp
+Ġdist o
+Ġfive fold
+Ġdr ip
+Ġgl en
+ob icity
+ale xin
+Ġdecre mental
+yn in
+Ġfl o
+Ġfl urb
+Ġlong ifolia
+ane heim
+Ġvis ibly
+Ġvis cera
+Ġes cul
+Ġps ph
+Ġic b
+Ġep bd
+Ġconduct ivity
+Ġmy opathies
+Ġz iz
+Ġz ls
+Ġadminist rator
+Ġhem iple
+Ġnew sp
+Ġcir s
+Ġpoly ol
+Ġpsych otherapeutic
+Ġbm is
+Ġbel hes
+Ġequ is
+gn er
+Ġsal ty
+Ġpan nic
+Ġsoft ness
+Ġlymph oplasm
+Ġlocal izing
+opath s
+Ġmuc o
+Ġanxi eties
+Ġcam ptothecin
+Ġhb dh
+Ġartic ulating
+Ġparen thood
+Ġver bas
+Ġbar bit
+Ġstep ping
+Ġprolif erated
+Ġhs s
+Ġpolym ethyl
+Ġpp gls
+Ġig r
+Ġdevi ance
+Ġlear ner
+ule ucel
+Ġgr aneheim
+Ġaltern ifolia
+Ġnorm od
+otox ins
+Ġga pt
+oun saturated
+pr ints
+Ġarm d
+Ġarm ament
+Ġfd p
+Ġfd cs
+Ġsil va
+Ġlas r
+Ġss ih
+Ġid b
+Ġlar val
+Ġtt p
+Ġion omycin
+Ġba uh
+Ġah m
+Ġah so
+Ġren oprotective
+Ġpb to
+Ġstomach s
+Ġfeed s
+Ġlob ule
+Ġinn om
+Ġrobust ly
+13 9
+Ġbronch ospasm
+Ġaggreg ating
+Ġts po
+Ġterminal ia
+Ġtha wing
+Ġconnected ness
+ira j
+Ġile ostomy
+25 1
+Ġschem a
+Ġneuros ensory
+Ġnk x
+Ġmf ms
+Ġect atic
+att g
+Ġdele ting
+Ġkap p
+Ġpara valvular
+Ġabscess us
+Ġld n
+Ġmyc n
+asm as
+Ġgf j
+Ġdraw ings
+Ġcompan ion
+Ġbic ortical
+Ġfavour ably
+Ġolig os
+Ġscler otherapy
+Ġcurv atures
+Ġchond ral
+Ġconform ing
+Ġmacro st
+Ġfriends hip
+Ġattract ing
+Ġtrim ethyl
+md d
+Ġuro d
+Ġuro path
+Ġsas ang
+Ġobt us
+Ġhyst erectomies
+Ġsupervis ory
+Ġtd p
+Ġome z
+Ġchop art
+Ġpra vastatin
+Ġws let
+98 7
+Ġperine um
+Ġtouch ed
+Ġintellig ent
+Ġstrip ped
+Ġpj s
+Ġreble ed
+Ġwb cc
+Ġbrit ain
+Ġmicrogl obulin
+Ġnonc ompl
+Ġlus c
+Ġhop kins
+Ġ199 3
+Ġfarm ing
+Ġspermat ogenic
+asal azine
+Ġosteos arcopenia
+lab eled
+rill ar
+Ġbos utinib
+Ġangel ica
+Ġterat omas
+Ġneighborhood s
+Ġnes irit
+Ġinstant ly
+Ġflank ing
+Ġncr t
+Ġnorthe astern
+Ġantit ry
+Ġhyperint ensity
+Ġmdp f
+Ġhtg w
+Ġdisin tegration
+Ġsip uleucel
+Ġfum es
+Ġsynonym s
+Ġillumin ated
+Ġhms cs
+Ġew ss
+Ġunid imensional
+Ġcryopres ervation
+Ġdeacet ylase
+Ġwaf er
+ococc aceae
+Ġpenicill ins
+Ġtrident ata
+Ġsomn olence
+Ġeucalypt us
+ogroup s
+Ġrfvi iifc
+Ġathle tic
+Ġvestib ule
+Ġmedit ators
+Ġsbc d
+opal atine
+Ġcib ers
+kerm ansia
+ompens ated
+addition ally
+Ġmetas cape
+Ġein stein
+Ġastil bin
+Ġlinol enic
+Ġlachnospira ceae
+Ġorot racheal
+Ġperistal tic
+Ġcranioca udal
+Ġdeacon ess
+Ġlumbos acral
+Ġgeom agic
+Ġpriap ism
+Ġflurb iprofen
+Ġnewsp apers
+Ġbauh inia
+Ġnesirit ide
+7 6
+7 21
+8 4
+? ;
+b ur
+c ot
+e us
+f ar
+f inder
+g r
+n etin
+o ok
+p ace
+t is
+y o
+Ġt inct
+Ġt etric
+in or
+in ones
+Ġa ia
+Ġa ads
+Ġs ot
+Ġs ak
+Ġs int
+Ġs olar
+Ġs way
+Ġs rt
+Ġs ift
+Ġc ke
+Ġc ains
+Ġp ens
+Ġw p
+al ytic
+Ġin so
+or chid
+Ġd af
+Ġd tt
+Ġm abs
+Ġb x
+Ġb oss
+an us
+Ġh bo
+Ġe oa
+Ġn ing
+Ġn ort
+Ġn aps
+Ġst oring
+ur an
+Ġl uted
+Ġl apse
+Ġl lr
+Ġg ced
+ig e
+ig ated
+ol imus
+Ġfor n
+Ġfor sk
+il grastim
+ow ard
+ow ski
+Ġv gg
+ect asia
+Ġr gc
+Ġis or
+Ġde qi
+Ġch iba
+Ġim am
+Ġse cular
+Ġad f
+ain ted
+ac i
+Ġco f
+Ġco bb
+Ġit mb
+Ġsc rap
+Ġsc lc
+Ġcan e
+Ġtr ies
+Ġpl ma
+Ġrec alib
+Ġsub fert
+Ġacc re
+Ġqu o
+Ġtim elines
+Ġsam inor
+Ġbl isters
+Ġar id
+Ġpr icing
+pec ies
+Ġdes quam
+Ġser o
+Ġtrans arterial
+Ġj ing
+Ġj inf
+Ġsp at
+Ġsp anned
+Ġsp urt
+Ġem pathetic
+Ġem igration
+Ġval erate
+Ġpost anes
+Ġso up
+Ġsm eg
+Ġsm urf
+Ġtra vers
+Ġrem ota
+Ġmon ounsaturated
+Ġtotal ing
+Ġref ute
+av iness
+Ġvalu ation
 Ġ0 25
-Ġ0 85
-Ġ0 78
-vers ing
-br ide
-br itt
-br uck
-acy tic
-Ġz echn
-Ġz ha
-Ġz anc
-Ġz af
-Ġz ame
-Ġz ole
-Ġz ale
-Ġz ij
-Ġz ik
-Ġz no
-Ġz wr
-Ġz inb
-Ġz enot
-Ġz aror
-Ġz unba
-Ġz amora
-Ġz ucch
-Ġz ainab
-Ġz agreb
-ature d
-Ġet a
-Ġet tema
-terior ly
-Ġwhere fore
-Ġer asing
-Ġer len
-Ġer iogl
-Ġer zur
-Ġer reyg
-Ġer itrea
-Ġmain stay
-Ġsecond arily
-Ġcondition ers
-Ġcondition ally
-ss i
-ss en
-atic al
-atic ally
-atic ians
-Ġquestion ary
-Ġquestion aires
-Ġsoft ens
-Ġsoft ness
-Ġsoft wares
-tim ulation
-Ġplan ed
-Ġplan et
-Ġplan um
-Ġplan imetric
-Ġplan imetrically
-ores i
-ores een
-ores cein
-Ġdr ip
-Ġdr aining
-Ġdr ks
-Ġdr iver
-Ġdr ivers
-Ġdr smile
-Ġend ometric
-Ġend emic
-Ġend oph
-Ġend orph
-Ġend omicro
-Ġend osc
-Ġend note
-Ġend onasal
-Ġend oscopy
-Ġend opathogen
-Ġend omotor
-ian ia
-Ġinform ations
-Ġinform ally
-Ġinform atization
-Ġinform aticians
-Ġits x
-Ġca e
-Ġca o
-Ġca res
-Ġca ha
-Ġca uter
-Ġca fs
+di agnosis
+Ġep worth
+Ġmy ectomy
+Ġz es
+Ġz nt
+Ġsin onasal
+Ġhem ofiltration
+Ġcyt openia
+Ġcyt olytic
+Ġcd cl
+ha o
+ne f
 Ġca ught
-Ġca rotene
-Ġca viar
-ym ptomatic
-ym onkey
-ym odels
-Ġinfl atun
-Ġce ase
-Ġce ased
-Ġce ases
-Ġce be
-Ġce fr
-Ġce lecoxib
-Ġstandard izations
-Ġran ova
-Ġloc o
-Ġloc ulation
-oss al
-Ġfollowing s
-arg ing
-arg inine
-Ġtechn ics
-Ġtechn icians
-Ġtechn etium
-tit ors
-Ġaffec tive
-Ġel ite
-Ġel uting
-Ġel apse
-Ġel bow
-Ġel taw
-Ġel iciting
-Ġel ionix
-Ġel astin
-Ġmulti ply
-Ġmulti plan
-Ġmulti step
-Ġmulti media
-Ġmulti morb
-Ġmulti professional
-fer roni
-Ġrem ake
-Ġrem des
-Ġrem oteness
-ie h
-ie u
-Ġinflamm ations
-Ġinflamm aging
-Ġinflamm atories
-Ġinflamm osome
-vic s
-vic le
-vic ular
-Ġsampl ings
-Ġsome where
-Ġimpro bable
-Ġfr anc
-Ġfr ances
-Ġfr ustr
-Ġfr cs
-Ġfr yback
-Ġfr izzled
-Ġcent roid
-Ġcent roids
-Ġindividual ised
-Ġsever ities
-ord able
-our ing
-our ce
-our ced
-Ġposs ession
-Ġlong bott
-Ġpred ication
-Ġpred ecess
-Ġincis o
-Ġremo ver
-Ġany cub
-ark ed
-Ġadj unction
-Ġadj oining
-Ġadj udication
-amic in
-Ġcorrel ative
-Ġcorrel ating
-Ġterm ed
-Ġterm inate
-Ġcle ave
-Ġcle fting
-ning ton
-Ġinflu encers
-Ġbas ion
-Ġbas que
-Ġbas ilar
-Ġbas elines
-Ġbas ophil
-Ġbas cd
-ob a
-ob es
-ob arb
-ob uccally
-par able
-par isons
-Ġid p
-Ġid s
-Ġid ent
-Ġexpl icable
-Ġexpl oding
-Ġexpl orations
-Ġexpl osion
-Ġgeneral ist
-Ġgeneral ise
-Ġgeneral ising
-Ġlesions core
-Ġaccur acies
-Ġmuc or
-Ġmuc opolys
-Ġmuc ogingiv
-Ġflu ted
+Ġcost a
+ty rosine
+Ġrest less
+Ġml hf
+Ġhel ium
+Ġdirect orate
+ram idal
+Ġent rep
+Ġelect rons
+Ġextra py
+Ġut stein
+Ġsoft ening
+cel ona
+Ġoste oprote
+Ġlocal izations
+Ġmr is
+Ġcre ws
+ored uced
+Ġsw k
+Ġdm r
+Ġdm mr
+ges terone
+Ġcs bc
+Ġorth otopic
+Ġdesp air
+Ġcm ml
+Ġmac a
+Ġphosph oprotein
+Ġcp ot
+Ġbar celona
+Ġsa ik
+Ġak kermansia
+Ġhc n
+Ġhydro lytic
+Ġms l
+Ġrev ol
+lex ion
+Ġsqu alene
+Ġmap cs
+Ġpal ms
+Ġresour ced
+ogl u
+Ġather omatous
+Ġmg c
+Ġfluor ides
+Ġprec arious
+Ġarch iving
+Ġrare r
+Ġrare faction
+Ġpersonal ised
+Ġsubstant ive
+Ġste via
+Ġele phant
+20 10
+Ġpv ac
+Ġdim orphism
+Ġpm tr
+Ġgc n
+Ġphot osh
+Ġjan us
+Ġcum ulated
+Ġvacc aria
+Ġtri am
+Ġpredom inate
+Ġtele metry
+Ġfore going
+ger in
+Ġom vs
+Ġpret ested
+Ġtp vb
+Ġoct ave
+ips ia
+Ġtib b
+Ġrecip e
+Ġmv v
+Ġpn l
+Ġpn et
+Ġpn ens
+19 0
+Ġneon atic
+Ġlob ulated
+Ġpotent iates
+Ġchew ed
+Ġamp ulla
+Ġ00 3
+Ġhm pv
+Ġpod ocin
+Ġregen erate
+Ġts b
+Ġnr g
+Ġanalog y
+Ġtranscript ions
+Ġsap as
+Ġva ptans
+Ġcin acalc
+Ġanthrop ometrics
+Ġbs so
+Ġhipp urate
+Ġpossess ion
+Ġcomfort ably
+Ġae h
+Ġded ication
+Ġmas lach
+Ġbol t
+Ġperm issions
+Ġunderestim ates
+Ġexh al
+Ġsubmuc ous
+Ġsynthes ised
+Ġbt g
+Ġgn ath
+Ġjn et
+Ġcra e
+Ġnac lo
+Ġrp d
+37 6
+Ġaccident ally
+Ġcholecyst olithiasis
+Ġdt x
+Ġlr g
+Ġconv ince
+Ġsel ana
+Ġtro ch
+Ġiso jama
+omod ulin
+Ġmicrobi ologic
+Ġnano hybrid
+Ġlup eol
+Ġvan illin
+Ġhaemorrh ages
+Ġdivertic ular
+Ġtrain ers
+rex ia
+Ġhyal ine
+Ġsput ter
+Ġzh eng
+Ġrash ps
+Ġperox yl
+Ġsca phoid
+Ġendocrin ologist
+Ġscint illation
+Ġfis cal
+Ġsporad ically
+Ġaur ant
+Ġmicrog rams
+Ġantis ocial
+Ġfic oll
+Ġamplic or
+Ġstrugg led
+Ġprerequ isites
+Ġstern ocle
+Ġgil let
+Ġlinc oln
+Ġfap i
+Ġarres ting
+Ġlis u
+Ġcys lt
+Ġait d
+opter in
+Ġepithel ization
+Ġrhamn oside
+Ġphyto estrogen
+Ġdang ers
+Ġmirr oring
+Ġisoprop yl
+Ġpulmon ale
+Ġmpm ri
+Ġdihydro chloride
+Ġguiz hou
+Ġpolyd ipsia
+iline ar
+Ġastrocyt oma
+Ġcryo ablation
+Ġisat uximab
+Ġjohn ston
+ifen acin
+Ġspur ious
+Ġfim br
+opyr im
+Ġsene gal
+Ġanthracy cline
+Ġtempt ing
+Ġgef v
+Ġtonsillolith s
+Ġlant us
+Ġwond ered
+Ġbypro ducts
+Ġmcn emar
+Ġplann ers
+Ġfolfir inox
+Ġgrays cale
+Ġkoj ic
+Ġpilgrim s
+Ġcantile ver
+Ġwn j
+Ġphytosterol s
+Ġpegf ilgrastim
+Ġverr uc
+Ġtreph ine
+Ġphotobi omodulation
+Ġcentur ies
+Ġoxyn tic
+Ġstadi ometer
+Ġprepre gnancy
+Ġnormod ivergent
+Ġarmament arium
+Ġcibers ort
+Ġcke o
+alytic um
+Ġforsk olin
+Ġjinf ukang
+Ġentrep rene
+Ġextrapy ramidal
+Ġosteoprote gerin
+Ġphotosh op
+Ġcinacalc et
+Ġisojama icin
+Ġsternocle id
+0 14
+4 64
+a wa
+b ased
+c ommun
+h ot
+k un
+k illed
+p ox
+q c
+y bf
+z ine
+in ters
+Ġa ob
+re y
+Ġth om
+on ent
+Ġc ater
+Ġc otrans
+Ġc iliary
+Ġp ff
+Ġw o
+al ap
+Ġf k
+Ġf ca
+Ġf hl
+Ġd ining
+Ġm ff
+ro ft
+Ġre r
+Ġh olog
+Ġe em
+Ġe ets
+ul ph
+Ġn pa
+om ical
+id erin
+ol ong
+Ġcon es
+Ġon fh
+Ġbe i
+Ġal kb
+ag er
+ag ac
+ag olix
+am ped
+ys c
+Ġim iqu
+ore ceptor
+Ġat ractyl
+og ast
+Ġad ri
+ad elph
+Ġper ib
+Ġper sever
+st ed
+Ġsh oe
+ine us
+Ġac v
+Ġco fil
+Ġdiff raction
+Ġcl n
+art erectomy
+Ġdi en
+ph l
+Ġfo il
+Ġap b
+Ġab users
+Ġk ze
+ug ation
+Ġcan agliflozin
+Ġtreat s
+Ġrec ist
+Ġun cl
+Ġun ass
+Ġacc ustomed
+Ġph m
+Ġph ox
+rol l
+Ġstat ically
+Ġant on
+Ġpr ca
+Ġpr isms
+Ġpr onto
+Ġdes kt
+Ġag tr
+ew ald
+Ġmeth an
+Ġra j
+osp inal
+int erest
+Ġwor ded
+Ġdep ots
+Ġinfl ating
+Ġproc umb
+Ġend plate
+Ġsm h
+Ġma hid
+Ġgl iss
+Ġmon ozyg
+Ġmon keys
+ob ium
+ob aric
+Ġimp et
+Ġref rained
+ust at
+Ġi ud
+Ġi ui
+Ġhyper amm
+Ġpath ob
+Ġpain det
+Ġcent rom
+Ġnormal isation
+Ġear ned
+erg oline
+Ġset back
+Ġmy oblasts
+Ġz j
+Ġeff erent
+Ġmicro centrif
+Ġnew est
+Ġer at
+Ġacid emia
 ha ve
-ha vioral
-Ġdistrib utes
-Ġdistrib utor
-Ġsm ad
-Ġsm elling
-Ġsm iled
-Ġsm orkers
-uct ors
-Ġins ist
-Ġins pite
-Ġins pects
-Ġins ulating
-Ġins tig
-Ġins tigate
-Ġdesign ate
-Ġdesign ations
-Ġconduc ing
-Ġconduc ts
-Ġapp reh
-Ġapp ointed
-Ġapp renticeship
-Ġparamet rically
-Ġimm erged
-Ġimm anent
-Ġknowledge ability
-Ġear n
-gi oma
-Ġir m
-Ġsch ell
-Ġsch ra
-Ġsch war
-Ġsch iller
-Ġsch loss
-Ġsch nut
-Ġsch wend
-Ġsch imid
-Ġsch luter
-Ġdo a
-Ġdo f
-Ġdo uch
-Ġscal ar
-Ġinstr uctors
-Ġthen were
-Ġidenti ties
-Ġidenti fications
-Ġprocess ors
-Ġoc p
-Ġoc cluded
-Ġoc clusive
-Ġoc ulograms
-onstr ated
-Ġcb t
-anc kx
-anc erscore
-Ġbacter iological
-Ġsmo kes
-Ġinfec t
-Ġinfec tivity
-Ġcy bers
-Ġcy nical
-Ġcy anide
-Ġrece ivers
-Ġneg ating
-Ġprot amine
-Ġprot uber
-Ġrand all
-Ġrandom ise
-Ġrandom izing
-Ġrandom izations
-ste in
-Ġrate itschak
-aren al
-Ġmouth fe
-Ġmouth pi
-Ġgl m
-Ġgl oor
-Ġgl ider
-Ġgl ickman
-Ġgl ioma
-Ġgl iddens
-Ġgl abella
-Ġpot ently
-Ġpredic able
-Ġfill s
-Ġpath s
-Ġpath osystem
-ration ality
-Ġcommon ality
-Ġcommon alities
-Ġoper on
-Ġoper atory
-Ġspecific ities
-Ġif u
-Ġif ference
-yn ucle
-yn thes
-yn oph
-Ġanti di
-Ġanti psych
-Ġanti prolif
-Ġanti virals
-Ġanti throm
-Ġcer con
-Ġcer agl
-Ġdist olingual
-Ġdist obuccally
-Ġunivers ita
-clud e
-Ġos more
-Ġos lo
-Ġos aki
-Ġos tiomeatal
-Ġos terix
-Ġfactor ability
-Ġrepres sors
-Ġoccur r
-Ġoccur ance
-Ġpe tit
-Ġpe valence
-Ġposition er
-Ġstruct uring
-ust ment
-Ġav ulsion
-Ġcollec tions
-Ġcollec tor
-Ġgend ered
-of ect
-of unction
-of rontal
-Ġmechan otrans
-ith i
-Ġfac s
-Ġfac eted
-Ġfac scal
-Ġfac ilate
-Ġpal m
-Ġpal ind
-Ġpal estine
-Ġpal sied
-aw i
-aw fully
-yl ine
-yl oid
-yl phosph
-yl meth
-Ġthir st
-Ġthir ties
-Ġyears and
-Ġfem ap
-Ġfem urs
-Ġfem oris
-omet abolic
-Ġhist ocytes
-Ġhist ograms
-Ġhist ogenetic
-Ġhist ocompatibility
-Ġhist oplasma
-io tical
-io va
-io vision
-00 3
-00 6
-00 7
-00 9
-00 400
-00 872
+Ġhum ane
+Ġsol ifenacin
+Ġpsych otherap
+Ġq jt
+Ġtem ple
+Ġoff enders
+Ġlo u
+Ġlo yal
+Ġsoft ened
+Ġcolon ography
+Ġke ys
+Ġsuccess ion
+Ġmr t
+Ġproportion ality
+Ġunt rained
+Ġunt oward
+Ġdm l
+Ġpros thetics
+Ġcs u
+Ġvir b
+Ġ8 00
+Ġmac con
+cell s
+Ġphosph odies
+Ġbar berry
+Ġpancre at
+Ġreal ised
+Ġcod ers
+Ġbra ve
+Ġneuro chemical
+Ġpp ix
+Ġms us
+Ġlear nt
+Ġdiss ect
+Ġeas iest
+Ġangi ograms
+Ġla pt
+Ġnucle ase
+Ġgr iff
+Ġpc wp
+oh si
+Ġrecogn izable
+Ġdl g
+Ġcav b
+crib e
+Ġ" .
+Ġport a
+Ġip l
+hyd ramnios
+Ġrt o
+Ġhaem ophilia
+urb id
+Ġneck l
+Ġflex ors
+10 2
+Ġure mic
+Ġure alyticum
+Ġeg bs
+Ġmethyl transferase
+Ġmill is
+Ġneutrophil ic
+Ġpret ty
+Ġhemoglobin opathy
+Ġdu ke
+Ġtp w
+Ġpsori asin
+Ġclaim ing
+Ġrv r
+Ġrecip es
+Ġwear able
+Ġsir iraj
+Ġhypot onic
+Ġland ing
+Ġforward ed
+isp ers
+Ġlob ules
+Ġsulf asalazine
+Ġtet rand
+Ġcoch in
+Ġcab ergoline
+Ġthin nest
+Ġdistinguish able
+Ġenl arge
+Ġantagon ize
+Ġprote as
+Ġmultid et
+Ġpy roph
+Ġbound ing
+Ġbul let
+ze in
+Ġgd cl
+Ġcarbon ated
+Ġdh yz
+Ġfp ybf
+34 2
+Ġtf k
+Ġsurpr ised
+sin ce
+Ġmyc otic
+Ġlin ers
+Ġunfort unate
+Ġgynec omastia
+Ġrelig ions
+Ġcast ration
+Ġcrypt orchid
+60 9
+Ġbrach io
+Ġanticip ating
+Ġcoron ectomy
+Ġsun scre
+Ġche bul
+Ġnb as
+Ġthrombocyt osis
+Ġconsolid ations
+Ġpalp ated
+Ġhes c
+ham netin
+Ġanter omedial
+Ġbuilding s
+Ġsan itary
+Ġrom ania
+ris ome
+Ġphil adelph
+Ġcry ob
+Ġecl ip
+Ġsensor ineural
+Ġpacem akers
+Ġscarce ly
+Ġrg pm
+43 1
+Ġdistinction s
+Ġsst w
+Ġtam sul
+Ġdisadvantage ous
+num ber
+Ġendotox ins
+nit ines
+Ġnitro tyrosine
+Ġharmon ious
+Ġepi ya
+Ġbiod istribution
+Ġphoto activated
+Ġnorad renergic
+Ġvv r
+Ġoscill ating
+Ġbru ising
+Ġhypom ineralization
+Ġcass iae
+Ġsz c
+Ġconjunct iva
+Ġdms co
+Ġhydroph obicity
+Ġeuc ast
+otax in
+Ġiterative ly
+Ġfq rs
+Ġrein ser
+Ġcet uximab
+Ġunco operative
+Ġfenest rations
+Ġdivor ce
+Ġleiomy osarcoma
+Ġrefrig erated
+Ġcil ost
+Ġrut aec
+Ġeigen value
+Ġbyh wt
+Ġprepro cedural
+Ġdisconn ected
+Ġptg bd
+Ġbrist les
+Ġhams ter
+Ġcapit ellum
+Ġleu ven
+Ġmpt a
+Ġcoincident al
+Ġgrav idity
+Ġdisregard ed
+Ġcoast al
+Ġclim atic
+Ġkat z
+Ġmisunder standing
+Ġintersp ace
+Ġcollim ator
+Ġkindergart en
+Ġsubspecial ty
+Ġspro uting
+Ġtranspos ons
+Ġabandon ment
+Ġtribut aries
+Ġunil aterally
+Ġoce ania
+Ġresor ptions
+Ġvaler iana
+Ġepicond yle
+Ġhnp ccs
+Ġclerks hip
+Ġfond apar
+Ġvictor ian
+Ġdith i
+Ġmary land
+Ġimmunot urbid
+Ġtrepon ema
+ammagl obulinemia
+Ġvald ecoxib
+Ġunnecess arily
+Ġnij me
+Ġequis etum
+Ġisor hamnetin
+Ġsmeg matis
+Ġcyslt r
+Ġsternocleid omastoid
+Ġalkb h
+Ġimiqu imod
+Ġdeskt op
+Ġprocumb ens
+Ġmahid ol
+Ġpaindet ect
+ohsi ung
+Ġtetrand rine
+Ġsunscre ens
+Ġphiladelph ia
+Ġtamsul osin
+Ġfondapar inux
+9 1
+d uring
+i eth
+i rosis
+k m
+k an
+o esophageal
+o zyme
+p rom
+t est
+t ight
+v olved
+w alk
+Ġ ence
+Ġa eds
+Ġth aps
+Ġs age
+Ġs gd
+Ġthe ses
+Ġo ag
+Ġo olong
+Ġc eg
+Ġc els
+Ġp oles
+Ġf xr
+Ġd ect
+Ġd ated
+is ot
+Ġm ing
+Ġm up
+Ġand rost
+Ġb uch
+Ġb az
+as ps
+Ġre verted
+Ġe est
+Ġe bl
+Ġe rection
+Ġst t
+om avirus
+ur is
+Ġl il
+Ġl ends
+ith ine
+Ġcon a
+ra ff
+el ast
+Ġv ct
+ch eng
+Ġr vef
+Ġr viii
+em atically
+um atic
+um ps
+Ġres embl
+op ol
+op opliteal
+Ġus eless
+Ġch ori
+Ġch illed
+Ġch olester
+Ġch imerism
+ib i
+Ġcomp action
+og on
+Ġad es
+rom ic
+Ġsh w
+Ġsh elf
+Ġac g
+ac at
+Ġind ifferent
+Ġwe chs
+Ġcl s
+Ġcl asps
+Ġhe ps
+per se
+Ġha ic
+ich o
+Ġap ip
+Ġap ph
+Ġab us
+Ġk ig
+Ġk ora
+Ġev ush
+Ġtr pm
+Ġpl ag
+Ġrec y
+Ġun cinate
+Ġincre tin
+Ġbl unting
+one an
+ak in
+Ġen olase
+Ġfin ance
+ym et
+Ġdes ires
+Ġinv itations
+ix ic
+Ġtrans anal
+Ġwor risome
+Ġsp astic
+Ġsp np
+Ġsp vc
+Ġdist ended
+Ġdist rust
+val ine
+Ġsm hr
+Ġappro ve
+ox ides
+Ġli able
+Ġimp ute
+Ġi owa
+Ġfl acc
+yl la
+Ġphys alin
+Ġpe b
+Ġhyper bar
+Ġmic ra
+Ġanti inflammatory
+Ġdo i
+Ġclass ifiers
+Ġol kin
+Ġinvest ed
+our t
+Ġhyp a
+Ġfe b
+Ġfe aturing
+Ġret rof
+Ġimpl icates
+Ġmo on
+Ġprof ibrotic
+Ġmicro calc
+Ġer ic
+med s
+Ġca res
+oscop ies
+Ġmark ings
+arget ed
+Ġdent oskeletal
+Ġq ds
+Ġq pc
+Ġsingle chain
+Ġunivers idad
+Ġur at
+Ġliter ate
+Ġsuper infection
+Ġmeta plastic
+Ġbre ach
+Ġcer ule
+Ġincl inations
+Ġhf a
+Ġmac cat
+Ġsepar ates
+Ġconst ellation
+Ġcv b
 Ġparen theses
-Ġparen teral
-Ġeth idium
-Ġlo x
-Ġlo an
-Ġlo ud
-Ġlo osen
-Ġlo oks
-Ġlo hman
-Ġlo vd
-Ġcancer ous
-Ġcancer ization
-Ġgu ilt
-Ġgu yatt
-Ġgu anidium
-Ġgu imara
-Ġgu ilty
-Ġes co
-Ġes ters
-Ġes rs
-Ġes cher
-Ġfl are
+Ġder ives
+Ġdown t
+Ġmetabol izing
+Ġlv idd
+gment al
+Ġoc it
+Ġoc ad
+Ġpp os
+Ġpp ds
+Ġenc ro
+Ġbo oking
+Ġx api
+Ġgr ants
+Ġlact ase
+Ġcycl ins
+Ġsod a
+Ġvac ut
+Ġbirth day
+Ġmc ns
+Ġfluor opyrim
+Ġarth rosis
+Ġnf at
+Ġmel t
+Ġampl ifying
+phyl la
+12 4
+Ġrt t
+Ġuc r
+Ġspl ash
+Ġbio engine
+Ġpm l
+Ġart a
+Ġcyst aden
+Ġmacroph ylla
+gt gg
+Ġpel od
+Ġhp br
+rog li
+dh s
+Ġtransform ations
+Ġpept idase
+Ġpack aged
+Ġoptim ising
+Ġpulp ectomy
+Ġflav an
+Ġns f
+Ġendoc ervical
+Ġpf r
+Ġliqu ir
+Ġinsp ections
+Ġrol ls
+11 5
+Ġuns us
+Ġuns killed
+Ġlc pt
+Ġka ohsiung
+Ġah us
+Ġmh o
+ophag y
+Ġcarry over
+13 6
+Ġunf air
+Ġtur bo
+Ġvaginal ly
+Ġaugment ing
+Ġunst ained
+Ġgerd q
+Ġpsychos omatic
+Ġhair less
+Ġtal ks
+Ġbs ysc
+27 7
+Ġdichotom ization
+Ġdermat omes
+Ġald rete
+ocomp atibility
+Ġhybrid ized
+Ġbt b
+Ġacetyl ated
+Ġdoub let
+Ġring er
+Ġnac rt
+onucle ase
+Ġchond rosarcoma
+Ġpin ch
+Ġnonin vas
+Ġmicrobiological ly
+Ġwalk ability
+Ġsacrific ing
+Ġcoagul ans
+Ġchron otropic
+Ġlam otrig
+Ġpth rp
+35 00
+Ġamput ated
+Ġfi q
+Ġfv cr
+Ġmail ing
+Ġws f
+Ġfs fi
+Ġclav icular
+Ġtang ential
+Ġads cs
+bas eline
+Ġthread ed
+Ġtermin ating
+Ġauthent ication
+Ġccr t
+Ġdissoci ative
+Ġmeg ac
+Ġkil ogram
+Ġtriter pene
+Ġundes ired
+Ġbps d
+Ġfried ewald
+prol iferation
+Ġkp cs
+Ġstick s
+Ġhypere mic
+Ġmart ens
+Ġevl w
+Ġindent ations
+Ġbyst anders
+Ġslee ves
+Ġpls vc
+Ġnegot iated
+Ġbull osa
+Ġintrag ast
+Ġfemor opopliteal
+Ġhypokal aemia
+Ġinsure r
+Ġlinal yl
+Ġnha ea
+Ġfocuss ing
+opter a
+Ġnont oxic
+Ġpyro sequ
+Ġunderm ined
+Ġnocice pt
+Ġfum ig
+Ġbronchodil ators
+Ġgun shot
+Ġwille brand
+Ġtricl isia
+Ġcoad minist
+Ġthiaz olid
+Ġinert ia
+Ġdietit ians
+Ġmond ay
+Ġproprio ception
+Ġvasorelax ation
+phor ine
+Ġstitch es
+Ġzhong shan
+Ġprokin etics
+Ġpont ine
+Ġanticonvuls ant
+Ġerl angen
+Ġkindergart ens
+Ġelectros urgical
+Ġlymphangi oma
+Ġasiatic a
+Ġmegakary ocytes
+Ġportray ed
+Ġsulfonyl urea
+Ġdeoxyrib ose
+Ġjew ish
+Ġatez olizumab
+Ġchic ago
+Ġdnt p
+Ġtoddl ers
+Ġthun ber
+Ġkazakh stan
+Ġcalip ers
+Ġzm he
+Ġplw ha
+Ġlucid um
+Ġcloac ae
+cinol one
+bro ok
+Ġobliqu ity
+18011 33
+bour ne
+Ġneoform ans
+Ġreprogram ming
+Ġmiltiorrhiz a
+Ġdgs y
+Ġaccru ed
+Ġecu ador
+Ġoverlength ening
+Ġantir he
+Ġtriam cinolone
+Ġexhal ation
+Ġgillet ii
+Ġcofil in
+Ġgliss onean
+Ġmonozyg otic
+Ġbrachio cephalic
+Ġcilost azol
+Ġnijme gen
+Ġwechs ler
+Ġevush eld
+Ġhyperbar ic
+Ġlamotrig ine
+b ai
+e h
+f ss
+g ate
+g ulatory
+k g
+l og
+l oxacillin
+m u
+n orm
+p aglutide
+u ers
+Ġt ant
+Ġt ard
+Ġt ds
+in amide
+en avi
+Ġo rac
+Ġc ish
+Ġp st
+Ġp dm
+Ġw y
+Ġw ak
+Ġw omb
+Ġin mates
+Ġf ct
+Ġf ads
+or ates
+Ġb ush
+an oprost
+Ġre b
+Ġre estab
+Ġh ir
+Ġh amm
+Ġh ok
+Ġh off
+Ġh unting
+Ġe eds
+Ġe otaxin
+ve t
+Ġn alid
+Ġst ec
+et ocin
+os i
+Ġg ale
+Ġg di
+Ġg az
+Ġg irth
+ol ens
+ol inesterase
+ra e
+Ġon co
+ut ol
+Ġv if
+Ġv sa
+Ġv ls
+Ġbe es
+Ġbe ars
+Ġr ath
+Ġr ick
+em n
+Ġres net
+Ġres hap
+op etala
+ys f
+Ġch ms
+ib d
+ore rs
+Ġat d
+ad ustat
+rom ide
+Ġsh pt
+Ġsh iat
+ine x
+Ġdis orientation
+Ġco infected
+Ġbet anin
+Ġcl bp
+end ered
+Ġint rom
+ich i
+ich annel
+Ġab used
+Ġk ops
+ug u
+Ġmet tl
+Ġinter gen
+Ġinter tw
+Ġun bear
+Ġcons ole
+pro sky
+Ġph ell
+Ġph arb
+ap ed
+Ġdur mill
+Ġra a
+Ġbut ter
+ang uine
+Ġtrans hepatic
+Ġnon elderly
+Ġj b
+Ġsp ikes
+Ġproc ollagen
+Ġem path
+Ġrem in
+Ġrem issions
+ox on
+Ġmon ocytic
+Ġcharacterist ically
+Ġi ab
+Ġi yc
+Ġed ited
 Ġfl ame
-Ġfl orescent
-Ġfl anks
-Ġfl asks
-Ġfl apless
-Ġfl uconazole
-Ġfl orence
-ick s
-Ġarch iving
-Ġarch eological
-Ġarch imedes
-Ġnec ros
-Ġnec toric
-Ġnec issity
-ock a
-Ġstress ogenic
-Ġoste ons
-Ġoste ointegr
-Ġoste ogenetic
-Ġoste omeatal
-Ġoste omacs
-Ġoste odyst
-Ġatt in
-Ġatt ga
-Ġiniti ators
-Ġdimension less
-ount able
-Ġcaus ally
-Ġprof itability
-ox in
-ox il
-ox ically
-Ġbrush er
-Ġbrush ers
-Ġintra vent
-Ġintra uter
-Ġpul pless
-Ġvi i
-Ġvi rous
-Ġvi rometer
-Ġda q
-Ġda vis
-Ġda eg
-Ġda iry
-Ġda unting
-Ġda vidopo
-Ġsl c
-Ġsl r
-Ġsl id
-Ġsl ated
-Ġsl ip
-Ġsl ang
-Ġsl active
-Ġsl itting
-Ġsl ash
-Ġsl oter
-Ġsl ums
-Ġsl umped
-Ġang er
-Ġang ell
-Ġschool work
-Ġhyp ophosphate
-Ġhyp hal
-Ġhyp hens
-Ġhyp eresthesia
-Ġhyp oreflective
-Ġhyp opne
-Ġhyp ofunction
-Ġperformance previous
-Ġmajor ities
-cess ed
-cess es
-cess ing
-Ġcomb ating
-Ġcomb ionts
-Ġcomb inatory
-Ġcase i
-Ġcase ating
-Ġfe et
-Ġver acity
-Ġver tex
-Ġver gata
-Ġver tigo
-Ġver ocay
-Ġexpos ition
-Ġperce ives
-Ġperce ivable
-Ġsens es
-Ġsens ing
-Ġsens itivities
-Ġmat os
-Ġmat ures
-Ġmat te
-Ġmat ru
-Ġmat the
-Ġmat tsson
-Ġmat suda
-Ġmat urational
-ane a
-Ġvit ally
-Ġvit tek
-Ġvit apan
-ogen y
-ogen es
-ri ad
-ri age
-ta u
-ise ly
-Ġanaly is
-Ġanaly tes
-Ġ5 70
-Ġ5 50
-Ġ5 74
-Ġ5 14
-Ġ5 30
-ety angkul
-Ġvol itional
-Ġvol tages
-Ġphys ico
-Ġep on
-Ġep iph
-Ġep imer
-Ġep itope
-Ġep ulis
-Ġep iflu
-Ġsol o
-Ġsol utes
-Ġsol icit
-Ġsol icited
-av olt
-onic ity
-Ġadhes ions
-Ġps k
-Ġps ipred
-Ġhard y
-Ġhard en
-Ġproduc er
-Ġproduc ers
-Ġred ress
-Ġred ox
-Ġred acted
-Ġred irect
-Ġred undant
-Ġred istrib
-Ġred undancy
-Ġrepresent ations
-Ġcontr actile
-Ġcontr acting
-Ġwater lines
-Ġmem arian
-Ġmem orize
-Ġsurve ymonkey
-Ġabs ciss
-Ġnorm oxic
-Ġnorm oxia
-Ġnorm odiver
-sequ ential
-con cluded
-con vuls
-con cerning
-Ġchange over
-ound ecanoic
-Ġnew man
-Ġnew bor
-Ġnew born
-ins chaft
-Ġliter al
-ral ised
-Ġfluor ine
-Ġfluor ochemical
-Ġfluor ometry
-Ġfluor ometer
-Ġfluor osed
-Ġfluor chrome
-ks an
-Ġsing apore
-Ġmor in
-Ġmor row
-Ġmor gell
-Ġmor adzadeh
-Ġmor ishita
-sc s
-sc an
-sc ov
-sc ale
-sc aling
-Ġvalid ates
-Ġcompl iment
-Ġcompl utense
-Ġpulp o
-Ġlength y
-Ġlength ened
-Ġlength ways
-Ġbias ing
-Ġcap b
-Ġthick ens
-Ġthick eners
-Ġthick ener
-Ġrecord ers
-Ġimpact on
-cal cemia
-Ġprov oked
-Ġmoder ator
-Ġbeing s
-Ġyoung sters
-Ġcross lin
-Ġcross checked
-Ġacid ified
-Ġacid ov
-Ġday care
-Ġday lighting
-Ġref ired
-Ġref use
-Ġref iring
-Ġref using
-Ġref works
-Ġref iltering
-Ġref actored
-Ġhos kins
-Ġhos hina
-co ating
-co vsky
-Ġceph ems
-Ġestim ators
-Ġload cell
-Ġhum eral
-Ġhum ane
-Ġdm a
-Ġdm d
-Ġdm so
-Ġdiab ru
-Ġmid i
-Ġmid gest
-Ġmid orb
-Ġmid day
-Ġmid points
-Ġmid crestal
-hol z
-irm ing
-Ġpers ian
-Ġpers uade
-Ġhospital ised
-Ġbiof unctions
-Ġwid en
-Ġwid est
-Ġpoly gen
-Ġpoly hex
-Ġpoly eth
-Ġpoly lines
-Ġpoly amide
-Ġpoly vidone
-Ġpoly ester
-Ġpoly prop
-Ġpoly tom
-Ġpoly wave
-Ġpoly but
-Ġpoly dimethyl
-Ġpoly lactic
-Ġpoly techn
-Ġpoly arylether
-Ġpoly choric
-Ġpoly pharm
-Ġservic emen
-Ġsu icidal
-Ġeven ed
-Ġach ili
-Ġach ondrodysplasia
-Ġcategor ise
-Ġcategor isation
-Ġpa x
-Ġpa ys
-Ġpa ved
-Ġpa rotic
-Ġpa epe
-Ġpa olon
-Ġpa rod
-Ġpa jn
-Ġpa edodontists
-Ġpa olanton
-Ġpa resthesia
-Ġpa etyangkul
-Ġdiagnostic ally
-Ġext ant
-Ġext ubated
-Ġext inction
-Ġext roversion
-Ġgood s
-Ġachie vability
-ou ver
-ou fia
-ou jeni
-Ġlab ile
-Ġlab ially
-Ġoh b
-Ġoh tsuki
-Ġlif ts
-Ġlif ted
-Ġlif ting
-Ġlif ecy
-Ġlif ecourse
-Ġbuc ci
-Ġbuc hner
-Ġeight eeth
-Ġpap ain
-Ġpap ular
-Ġpap yr
-Ġpap ua
-Ġpap anic
-Ġreli ant
-Ġreli ance
-Ġmicrob ially
-Ġmicrob alance
-Ġresin ous
-Ġtum efaction
-Ġsequ els
-Ġsequ estration
-Ġwhe els
-Ġvarious ly
-xi as
-Ġscre eching
-Ġu i
-Ġu w
-Ġu tr
-Ġu iv
-Ġu fl
-Ġu isn
-Ġu veitis
-Ġerr ant
-Ġerr oneous
-Ġwill mann
-Ġaut och
-Ġaut onomic
-Ġaut oph
-Ġaut ograft
-Ġaut opolymer
-Ġaut ocorre
-Ġaut orefraction
-ps ka
-Ġret ina
-Ġret arded
-Ġret ests
-Ġret inopathy
-Ġhab er
-Ġlight en
-Ġlight ning
-Ġlight cycl
-Ġsuper oxide
-Ġsuper iors
-Ġsuper ficially
-Ġsuper fi
-Ġsuper family
-Ġsuper aural
-Ġsuper fine
-Ġsuper charged
-Ġsuper intendence
-Ġcephal ography
-Ġreduced ebr
-Ġfract ography
-Ġlas so
-Ġalveolar is
-Ġcountr yside
-anti al
-anti aca
-aken ed
-vir us
-Ġlay down
-Ġlay pers
-Ġtraining s
-Ġdig e
-Ġdig imatic
-Ġdig lycidyl
-Ġdig oxin
-Ġimmun ogenic
-Ġimmun oph
-Ġimmun osen
-Ġimmun opathological
-Ġimmun ochemistry
-Ġimmun ologists
-Ġimmun ogold
-Ġbel ly
-Ġbel ts
-Ġbel ated
-Ġbel arus
-Ġrecomm edation
-Ġmen g
-Ġmen opausal
-Ġmen oufia
-Ġul m
-Ġul teriorly
-Ġseg uro
-Ġseg elnick
-Ġseg former
-Ġsymptom less
-Ġbuccal e
-Ġvers e
-Ġvers ican
-Ġvers atility
-Ġsocial ize
-Ġsocial ization
-Ġsw an
-Ġsw ay
-Ġsw ish
-Ġsw ord
-Ġsw aps
-Ġsw irling
-Ġsw inehart
-Ġsyn thetized
-Ġsyn onyms
-Ġpd a
-Ġpd hs
-Ġpow ers
-Ġthem e
-Ġthem atic
-Ġcult urable
-af a
-af e
-af ield
-af old
-Ġirr itants
-Ġirr itations
-Ġpat el
-Ġpat ching
-Ġpat ters
-Ġpat ni
-Ġpat ented
-Ġpat rols
-Ġexp ired
-Ġexp iration
-Ġexp ansive
-Ġaffected subjec
-Ġdeg li
-Ġdeg idi
-Ġdeg reased
-ogn omy
-Ġsuccess ors
-Ġsuccess ively
-Ġ20 45
-Ġsti ppl
-Ġdispl aces
-Ġod i
-Ġod orous
-Ġod hl
-Ġod ynoph
-to oth
-to fore
-to omb
-to uch
+Ġcalc it
+Ġel cm
+Ġol k
+Ġol s
+Ġes h
+Ġprot ocate
+Ġeth amb
+Ġhem obilia
+Ġstress ing
+Ġca ecal
+Ġradi ating
+Ġil r
+of luor
+Ġdys uria
+Ġct pa
+Ġgluc opyran
+Ġsing h
+Ġaut ocor
+Ġsal ping
+Ġgene va
+Ġlog ically
+Ġshort ens
+ocyt openia
+Ġmuc oad
+Ġhf c
+oy a
+amin er
+Ġphen obarbital
+Ġcs h
+Ġever olimus
+Ġcp o
+Ġhome work
+Ġnor floxacin
+Ġmiss iss
+Ġneuro stimulation
+Ġpd b
+Ġpd ff
+Ġlv t
+Ġmorph ogenetic
+Ġta ue
+Ġeng el
+Ġschool ers
+Ġul c
+Ġpc om
+ask a
+Ġconn ects
+Ġwound ing
+Ġven ography
+Ġprec ession
+Ġcolle g
+Ġpancreatic obiliary
+rin ogen
+Ġdra g
+Ġbio assays
+Ġstre m
+Ġpm u
+Ġcarb etocin
+Ġleuk oreduced
+Ġsten opetala
+Ġpel leted
+bb ing
+Ġdon ate
+Ġ12 4
+Ġcat tle
+Ġinstitutional ization
+Ġss z
+Ġherbal ists
+Ġid we
+Ġfore front
+Ġpbs ct
+Ġsr f
+Ġcapt opril
+Ġpf m
+Ġinsp ire
+Ġblue berry
+lim ited
+Ġsv cam
+22 87
+Ġpg cg
+Ġ00 5
+Ġaud iting
+Ġattend ants
+Ġbon enavi
+Ġcn r
+Ġcin pwt
+Ġaggressive ly
+Ġfp d
+Ġng os
+27 36
+Ġbypass ing
+Ġdimin ution
+Ġupd rs
+Ġtl if
+Ġsupra orbital
+Ġfifth s
+Ġfc pe
+Ġmultif ocality
+Ġwarrant ing
+Ġlh l
+Ġbeh esh
+Ġtel ogen
+Ġmicros omal
+Ġpaediatric ians
+Ġtrun cation
+Ġrp ob
+Ġrc ws
+Ġmaxill omandibular
+Ġenlarg ing
+Ġtriple ts
+acchar ides
+Ġreflex ivity
+Ġconsolid ate
+44 2
+Ġthym oquinone
+Ġfilm array
+Ġvib rations
+Ġsic am
+Ġintrac yt
+oxic am
+Ġsj vo
+Ġtell s
+Ġpalm itate
+Ġdip per
+Ġdip ped
+Ġdip ept
+Ġhypertriglycer id
+Ġneglig ence
+Ġjia o
+Ġcub ital
+Ġtetracy clines
+Ġlg r
+Ġphilosoph ers
+Ġplug in
+Ġspi ked
+Ġpunct ual
+Ġmetaph or
+Ġvl p
+Ġthiop urine
+Ġcolch icum
+Ġthigh s
+Ġvarnish es
+Ġlbb ap
+59 2
+Ġmab e
+Ġoblig ed
+Ġgaba ergic
+Ġbotan y
+Ġhandover s
+Ġrox adustat
+Ġreferen cing
+Ġmoh amm
+Ġmct s
+Ġdhs mt
+Ġdios core
+Ġspons ors
+Ġdefer red
+Ġscra ping
+Ġginsen osides
+Ġshs st
+Ġjoin point
+Ġspt d
+Ġgard ening
+Ġspr int
+Ġlves d
+Ġreconstruct ing
+otr ys
+Ġmethoxy flurane
+Ġscrutin y
+Ġjp ysf
+Ġkw cs
+Ġpestic ide
+Ġhds s
+Ġincap acity
+Ġbout ons
+Ġdhf zt
+Ġpenk id
+Ġconstrict ive
+Ġcram ps
+Ġbiop rosthetic
+Ġinterrog ation
+Ġcen pf
+Ġrcr i
+Ġhotsp ot
+Ġbroch ure
+Ġjat amans
+Ġcob bl
+Ġneiss eria
+Ġrecons id
+Ġglycosamin oglycan
+Ġharbour ing
+429 358
+ystall ine
+Ġbiocer amic
+Ġzer umb
+Ġautos am
+Ġead yn
+Ġminipl ates
+Ġperfection ism
+Ġcrut ches
+Ġmyelos upp
+Ġmeteor ological
+Ġkyr g
+Ġleptosp irosis
+Ġapone u
+Ġellipso id
+Ġbrug ada
+Ġaffin ities
+cerv ical
+Ġpanell ists
+Ġsinomen ine
+Ġdysth ymia
+Ġpannic ulitis
+Ġeoa h
+Ġmultidet ector
+Ġcryptorchid ism
+Ġhypa phorine
+Ġantirhe umatic
+Ġshiat su
+Ġdurmill one
+Ġethamb utol
+Ġmucoad hesive
+2736 100
+Ġbehesh ti
+b uk
+f ear
+h ong
+j or
+l ong
+l ene
+m ath
+o terol
+v ol
+w ai
+y f
+y ama
+Ġt bp
+Ġa pe
+Ġa ura
+Ġth c
+Ġs isters
+Ġo gg
+er ba
+Ġp di
+Ġw ks
+it res
+is chem
+Ġm ack
+Ġm oxa
+Ġb att
+ar pa
+ar iness
+ct a
+Ġh ide
+Ġh icc
+Ġe ub
+Ġst arbase
+ur idine
+Ġl ord
+Ġl fa
+Ġl pm
+ith in
+os up
+im ension
+Ġg ug
+Ġfor rest
+Ġcon hd
+il on
+ra il
+Ġon onin
+Ġv pt
+Ġv endor
+Ġbe et
+ant es
+Ġr anc
+ag h
+Ġde central
+Ġim itate
+ib ia
+st en
+Ġsh ou
+se ed
+Ġdis artic
+Ġco in
+Ġind igestion
+Ġwe ap
+Ġwe arers
+Ġit as
+Ġne un
+Ġint ronic
+Ġint imately
+Ġap rv
+Ġsur m
+Ġab w
+Ġab raded
+lud ge
+Ġk vp
+Ġall ocations
+ari e
+Ġrel ocation
+Ġinter lock
+Ġun limited
+Ġsub ser
+ap lex
+Ġout set
+Ġno body
+enc ia
+Ġy ct
+Ġy jv
+Ġy erba
+Ġgen ec
+ract ice
+ual a
+Ġcr ime
+Ġen a
+Ġen vis
+Ġext em
+Ġdes k
+Ġunder cut
+Ġunder use
+Ġnon operative
+Ġj bi
+Ġsp n
+Ġsp ore
+Ġchar cot
+Ġem olli
+Ġso i
+Ġty ped
+Ġma ff
+Ġmon omorphic
+Ġconf erencing
+ob otrys
+Ġimp osing
+Ġpar c
+Ġpar ab
+Ġi oc
+Ġi uc
+Ġsubject ing
+Ġfl ss
+Ġcalc ific
+Ġhyper met
+Ġhyper filtration
+Ġcomple ments
+Ġhist o
+Ġel a
+Ġel ih
+Ġps cs
+Ġprot o
+Ġintra orally
+Ġloc o
+Ġmanag ements
+Ġdel im
+Ġmicro ct
+Ġcyt open
+Ġabs c
+Ġabs i
+of rontal
+Ġcur able
+otic ed
+Ġdys bacter
+ove c
+br ile
+Ġhel min
+Ġq p
+Ġsl l
 ople gic
-Ġinitial ized
-Ġinitial izing
-Ġsum c
+Ġsch m
+Ġbre vis
+ca ag
+Ġdiet ician
+Ġhf rs
+Ġmut agens
+ges ic
+Ġresid ences
+eg a
+Ġcp cs
+Ġbar b
+Ġstep one
+Ġevery body
+Ġhs od
+abil itation
+Ġdown wards
+Ġpd gfr
+Ġlv gls
+Ġpp vs
+Ġhepat is
+he art
+Ġsupplement ing
+Ġx ba
+Ġthromb omodulin
+Ġbenefit ing
+Ġdl co
+Ġcas r
+Ġameric as
+Ġlat anoprost
+Ġbirth ing
+ets u
+Ġadapt or
+Ġnf l
+ipl oid
+Ġlum ens
+Ġpt t
+hyd ro
+Ġaff ymet
+Ġstre aked
+Ġcarb achol
+Ġhp b
+Ġgi raff
+Ġros em
+Ġure ters
+Ġeg vb
+Ġna i
+Ġcompl imentary
+Ġamin og
+Ġgp f
+Ġcalib rator
+Ġss m
+16 2
+Ġea ep
+Ġvertical ization
+Ġgovern orate
+Ġdu i
+Ġpil ates
+nat a
+Ġnc or
+Ġball s
+gl ute
+Ġtherm ometers
+Ġft es
+Ġuk raine
+Ġflavon ol
+pp d
+Ġstabil izes
+Ġhost ility
+Ġhm d
+Ġia uc
+Ġpseud om
+Ġpy ogenic
+Ġalkal osis
+Ġoverc omes
+Ġaffil iations
+Ġstra w
+Ġrib osome
+Ġmas p
+Ġsensit ize
+Ġheterogeneous ly
+Ġtl h
+Ġll a
+Ġinterd ig
+Ġhydroxy ethyl
+arc omas
+Ġretain s
+Ġfamiliar ize
+Ġfn bpa
+Ġinterrup ting
+Ġlaryng ospasm
+Ġunn oticed
+Ġgm cs
+Ġarb utin
+Ġradio isot
+Ġprecip itates
+Ġfung iform
+Ġbud ding
+Ġmu o
+Ġti w
+athyroid al
+Ġretin as
+Ġobt urated
+Ġie q
+Ġrip e
+Ġantith yroid
+sec ond
+Ġqi wei
+Ġgy ra
+Ġmn cs
+Ġtd t
+Ġesr cc
+Ġguarant ees
+Ġtrich ophyton
+Ġkm o
+Ġcoating s
+Ġerg ometer
+Ġmist rust
+Ġsg r
+Ġdip pers
+75 1
+Ġarom atase
+Ġbc ma
+Ġbootstrap ped
+Ġnonc ont
+net t
+Ġpunct ate
+Ġvalg anciclovir
+Ġbacteri uria
+Ġcu ve
+Ġgv l
+oxif ene
+Ġcass ia
+Ġcere us
+Ġcapn operitoneum
+Ġcorn in
+Ġmcg ill
+Ġcomprehens ible
+Ġmoi eties
+Ġcorp ectomy
+Ġwrap ping
+Ġschwann omas
+Ġgle paglutide
+Ġventricul operitoneal
+Ġpolyg onal
+Ġradioimmun oprecipitation
+Ġrts m
+Ġastroc ytic
+Ġfores ee
+onvuls ive
+Ġanamn estic
+Ġhyperc ortisolism
+Ġunin volved
+Ġchord ae
+Ġimmunophen otype
+Ġanaerob ically
+Ġstack ed
+opept ide
+Ġcistern s
+Ġral oxifene
+Ġcontag ion
+Ġanticonvuls ants
+Ġgoni ometer
+Ġiliotibial is
+Ġbeaut if
+Ġdecalc ified
+Ġaltru ism
+fig ure
+Ġmultivit amins
+Ġorch est
+Ġotorhinolaryng ology
+Ġfurn ace
+Ġuyg ur
+Ġcalv arial
+Ġmatt ress
+Ġhymen optera
+Ġscab ies
+Ġigh v
+Ġcabin et
+Ġddr rs
+Ġdewax ed
+Ġmirab ilis
+Ġgroc ery
+Ġboug ie
+Ġhain an
+Ġecons ult
+Ġrostr al
+Ġodys sey
+Ġggd gt
+Ġinnom inate
+Ġmlhf q
+Ġadri amycin
+Ġmicrocentrif uge
+Ġproteas omal
+Ġresembl ance
+Ġbioengine ering
+Ġpyrosequ encing
+Ġthiazolid ined
+Ġnalid ixic
+Ġunbear able
+Ġiyc f
+Ġcalcit riol
+Ġjatamans i
+Ġzerumb one
+Ġautosam pler
+Ġkyrg yz
+Ġcytopen ias
+Ġdysbacter iosis
+Ġaffymet rix
+c ont
+g us
+h og
+m od
+r r
+t elling
+y elin
+Ġa ast
+Ġa ef
+re can
+on oside
+at gc
+Ġs ludge
+Ġc ay
+Ġc ren
+Ġp ust
+Ġf ess
+Ġf ma
+Ġf use
+ic one
+Ġd pt
+Ġd ick
+is etron
+Ġm ating
+Ġm ines
+Ġm ie
+Ġm ha
+Ġm oll
+Ġm sofa
+Ġand rop
+Ġb res
+Ġb ni
+an ed
+an jan
+ar athyroidism
+Ġh ing
+Ġh od
+le vel
+Ġto w
+Ġto fa
+ere lla
+Ġl ans
+Ġg ed
+Ġg we
+Ġg ivers
+ig old
+ati ze
+Ġfor cing
+Ġv od
+up lex
+ot ons
+ot ime
+Ġis oprost
+Ġres ts
+Ġim i
+Ġper il
+ip in
+se q
+Ġac is
+und ii
+Ġdis ass
+Ġdis cectomy
+Ġco el
+port ant
+Ġind ocyanine
+Ġcont oured
+end ym
+end othelial
+ia ph
+Ġne ure
+Ġinf est
+Ġinf und
+uc ine
+Ġap ns
+Ġk sa
+Ġall os
+Ġob vi
+Ġafter math
+Ġam f
+Ġph cs
+ap c
+Ġy r
+Ġy tt
+Ġgen u
+ren d
+all oon
+Ġant ig
+Ġfollow ers
+Ġbl amed
+Ġhy orh
+aus t
+Ġcol m
+Ġext ras
+Ġund ist
+Ġte gner
+ang le
+osp ong
+Ġdep s
+Ġperi implant
+Ġj w
+Ġj iro
+Ġsp ans
+Ġend os
+Ġend ostatin
+Ġend arterectomy
+Ġem ts
+Ġval ence
+ox yl
+Ġmon ocytosis
+Ġscore card
+Ġli que
+Ġed n
+Ġatt entional
+Ġresearch ing
+Ġform oterol
+Ġpain ting
+Ġgra vis
+ds j
+ound s
+ov aginal
+uss els
+Ġes ax
+Ġes ka
+Ġps ycin
+Ġfe c
+Ġprot est
+hip p
+Ġcomb ating
+Ġhem ogram
+Ġhem oly
+Ġsyn ergic
+Ġfem ora
+Ġer b
+med ical
+Ġca val
+Ġpa af
+Ġrat g
+Ġsol es
+Ġec o
+Ġec ur
+Ġec os
+li er
+Ġsaf p
+Ġq us
+Ġpul ps
+Ġsl r
+Ġbr ns
+Ġimplant ing
+Ġsal ad
 Ġsum s
-Ġsum ac
-ind ered
-ind eed
-ind entation
-Ġlog an
-Ġnet osis
-Ġnet tle
-Ġadd itonal
-Ġadd itives
-Ġallow ance
-Ġprofession ally
-way hi
-Ġprom ised
-Ġequ itable
-Ġequ ilibr
-Ġequ idist
-Ġwear s
-omy ces
-omy tes
-omy coses
-Ġmes ang
-Ġmes ofacial
-Ġmes oph
-Ġmes oporous
-Ġ4 000
-Ġ4 04
-Ġ4 20
-Ġ4 47
-Ġpractic ality
-Ġintern asal
-Ġ6 20
-Ġ6 60
-Ġ6 83
-Ġfoc ally
-Ġmarg ination
-Ġmarg olis
-Ġest udos
-Ġax in
-Ġax illa
-Ġax haus
-Ġax elsson
-Ġax yprep
-Ġax iovision
-Ġprem ixed
-Ġprem edication
-Ġprem aturity
-Ġprem adasa
-Ġadm it
-Ġadm ira
-Ġadm ixture
-Ġcontin ent
-Ġcontin ually
-Ġsystematic s
-Ġsystematic al
-Ġnormal ities
-Ġnormal ised
-Ġnormal izing
-Ġnormal ising
-Ġprofessional ism
-Ġta urate
-Ġta hani
-Ġta hm
-Ġta acatt
-Ġta ichung
-Ġfib ered
-Ġfib roma
-Ġintere set
-Ġlocal izing
-Ġlocal izations
-Ġstrong yloid
-Ġespec ialy
-Ġfree zers
-Ġmm hg
-ih iro
-ih ilator
-Ġgo iter
-Ġgo zel
-Ġgo udarzi
-Ġgo etz
-Ġgo iania
-Ġlife times
-iel le
-ang ent
-ang ing
-Ġantib iotical
-Ġgel man
-Ġprogram ing
-Ġagree ing
-Ġagree able
-Ġexperimental group
-Ġclos et
-vari ous
-Ġct an
-Ġct ab
-Ġprote omic
-Ġprote omics
-Ġprote olytic
-Ġprote asomal
-Ġte o
-Ġte at
-Ġte ens
-Ġte ichmann
-Ġprec arious
-Ġprec erebral
-Ġprec edence
-Ġprec urved
-ero virus
-Ġlinear ized
-Ġrot ate
-Ġpros thetical
-Ġpros kauer
-Ġfinal ized
-Ġfinal ization
-Ġfinal izing
-Ġele gant
-Ġdom s
-Ġdom inate
-Ġbo il
-Ġbo ots
-Ġbo oster
-Ġbo oked
-Ġbo ley
-Ġbo oks
-Ġbo iled
-Ġbo iling
-Ġbo osted
-Ġbo geym
-Ġbo ferroni
-ival is
-Ġpan as
-Ġpan outs
-Ġpan cher
-Ġpan phot
-fact orily
-Ġhal le
-Ġhal ved
-Ġhal othane
-Ġtool bar
-Ġdeep ithelial
-Ġsatis factorily
-Ġstep ano
-Ġhyper active
-Ġhyper activation
-Ġhyper cellular
-Ġhyper mes
-Ġhyper mineralized
-Ġhyper cap
-Ġhyper plane
-Ġhyper algesic
-Ġhyper mobility
-Ġhyper calcemia
-inc ter
-Ġreason ing
-Ġreason abl
-ink le
-Ġwork up
-Ġwork and
-Ġwork group
-Ġwork day
-Ġwork force
-Ġwork days
-Ġwork places
-Ġcp us
-Ġcp ap
-Ġble ed
-Ġble ached
-Ġble kinge
-Ġ7 10
-Ġ7 53
-Ġ7 22
-Ġ7 46
-abl ly
-Ġresid es
-Ġaffect ation
-Ġcycl in
-Ġcycl ophosph
-Ġcycl ooxygenase
-reg or
-reg ular
-reg istr
-Ġelec ted
-Ġelec tir
-Ġelec toral
-Ġact ors
-Ġconstr ue
-Ġconstr aining
-Ġnecess ities
-oma uro
-ogenic ity
-ont on
-ont ocl
-Ġbiom ineral
-Ġbiom odulatory
-Ġbiom echenich
-roph oretic
-Ġcommun ality
-Ġcommun icates
-Ġvir idans
-Ġunders ide
-Ġlayer ing
-ych lor
-ych osocial
-arch ae
-Ġtong ren
-Ġtong ues
-Ġtong ji
-Ġspl its
-Ġspl ice
-Ġspl inting
-Ġpock ed
-och eck
-Ġhead ed
-Ġhead ing
-Ġhead rest
-Ġhead light
-Ġhead board
-Ġcontrast ingly
-Ġdel ated
-Ġdel ves
-Ġdel mop
-Ġdel phi
-Ġecc entric
-Ġinduc ible
-Ġmorph ometry
-Ġauthors hip
-etr a
-etr ies
-etr ix
-own s
-az e
-az ione
-Ġsus pects
-Ġsus pecting
-Ġclinic gpt
-oy ed
-oy ance
-Ġpsych otic
-Ġpsych ometrically
-Ġpsych osomatic
-Ġpsych oneurolog
-Ġenh ancer
-Ġzero ed
-Ġsr y
-Ġsr pska
-Ġml in
-Ġml ps
-Ġcement oid
-Ġmut tuk
-Ġmut uelle
-ros ensory
-ros timulation
-Ġrough ed
-Ġsk ieller
-Ġsk yroc
-Ġsk ottrup
-Ġsk yscan
-Ġdivid er
-Ġdivid es
+orph ic
+iat a
+Ġcre a
+Ġ7 00
+Ġcam bridge
+Ġhf up
+Ġregion ally
+Ġorth obotrys
+Ġconst ricted
+Ġmot ilin
+Ġod q
+Ġphosph okinase
+Ġsupp uration
+Ġback rest
+Ġhs fs
+Ġbra cing
+Ġoc ps
+Ġmit omycin
+Ġhydro ps
 Ġstate wide
-Ġpur posed
-Ġpur ged
-Ġpur ported
-Ġpur ports
-Ġpur ulent
-Ġpur posively
-Ġnine fold
-Ġreflec tions
-Ġreflec tor
-Ġsumm ative
-Ġstim ulations
-Ġfil ing
-Ġfil ament
-Ġfil iform
-Ġfil iation
-Ġcolor ation
-Ġcolor ant
-Ġcolor ants
-Ġcolor imeter
-Ġcolor imetry
-Ġadmin strate
-Ġadv ises
-Ġsour ced
-Ġsour cing
-Ġartic o
-Ġartic ulated
-Ġutil izations
-ov ascular
-ov olt
-Ġil s
-Ġx q
-Ġx u
-Ġx in
-Ġx ing
-Ġx un
-Ġx age
-Ġx yle
-Ġx cp
-Ġx iang
-Ġx ho
-Ġx erogenic
-Ġlip oma
-Ġlip ogenesis
-Ġlip osarcoma
-Ġlip osomal
-Ġlip pert
-Ġlip oxygenase
-Ġlip ophilic
-Ġlip ofect
-Ġconnec ticut
-osph onate
-osph aera
-Ġhyd rated
-Ġchem ibis
-Ġnor a
-Ġnor the
-Ġnor rh
-Ġnor wich
-Ġsubst andard
-Ġback ed
-Ġback wards
-Ġback prop
-Ġback step
-Ġback log
-Ġgene jet
-Ġgene pharma
-Ġproportion ate
-bl ing
-bl ue
-bl ood
-bl otted
-Ġpol ice
-Ġpol ling
-Ġpol imer
-Ġpol astr
-Ġpregn ancies
-Ġgrad ation
-Ġgrad able
-Ġgrad ers
-cep tions
-Ġinvas iveness
-Ġinvas ivity
-Ġview points
-Ġchronic ity
-Ġcond ense
-Ġcond ylectomy
-Ġcond oms
-Ġhp mc
-Ġconcentr ically
-Ġepithel ia
-Ġepithel ization
-read ing
-read ability
-Ġregular ized
-Ġmicrobi otas
-lor odih
-Ġshort listed
-Ġtoothbrush er
-Ġtoothbrush ed
-Ġ9 10
-Ġ9 15
-Ġ9 18
-Ġ9 73
-Ġunderstand ably
-Ġunderstand ings
+Ġging ive
+Ġconsequ ential
+Ġla o
+Ġla ugh
+Ġsn aps
+Ġce ae
+ring e
+Ġagg recan
+Ġip th
+Ġsummar ise
+Ġnit rophenyl
+Ġmel bourne
+Ġchi ari
+Ġchi ang
+Ġlum inex
+Ġpap ac
+pr ings
+Ġvs r
+Ġge b
+Ġuc g
+Ġpv gs
+Ġsd t
+Ġbio im
+Ġtransl ocated
+Ġtransl uminal
+Ġaa u
+Ġchlor o
+Ġattach ing
+Ġrob in
+Ġcompl iances
+Ġcalib rate
+ofol in
+Ġtrache obronchial
+Ġconver ge
+Ġhydrox yc
+Ġharm onic
+Ġsr q
+Ġcf ir
+Ġaes thetically
+Ġrhe ological
+ran ul
+Ġbey otime
+Ġparalle ling
+Ġparalle ls
+Ġpn b
+Ġpn cd
+Ġdiarrh oe
+Ġhyperg lycaemic
+Ġtet rad
+Ġcoch lea
+Ġnom i
+Ġdivers ified
+Ġpad dock
+Ġtor ques
+Ġcarcin o
+Ġgd nf
+Ġcn g
+Ġcn o
+Ġmethodological ly
+Ġalkal i
+Ġeb n
+Ġplasm atic
+Ġbott lene
+Ġneuros ph
+Ġswe ats
+Ġresil iency
+Ġkind ness
+otrop ics
+18 5
+Ġine fficiency
+Ġperm uted
+Ġfu zz
+Ġbt fc
+99 2
+gian a
+Ġrm m
+Ġsick er
+Ġfair ness
+Ġatp iii
+luores cein
+Ġfamiliar ization
+Ġrc f
+Ġpak t
+Ġlb bp
+ky rin
+omechan ical
+Ġbud gets
+Ġrid ers
+Ġappreci ably
+Ġintense ly
+Ġsan it
+Ġcrystall ized
+Ġath ens
+Ġinfra clavicular
+Ġsheath s
+Ġcoc a
+Ġcaud ally
+Ġdigit ization
+Ġhyperth yroid
+Ġcollaborative ly
+Ġoblique ly
+Ġsaps ii
+Ġglycer ophosphate
+Ġtq ss
+Ġendors ing
+isph eric
+Ġira k
+Ġken yan
+Ġbatter ies
+Ġtrypt ase
+Ġpter ional
+Ġharmon isation
+Ġherpes virus
+Ġdiscover ies
+Ġtz q
+Ġpae onia
+Ġhypere xt
+Ġremember ing
+Ġlipopoly saccharides
+Ġretroper itoneum
+Ġhyperinsulin emic
+but amide
+fil ament
+Ġcere als
+Ġimpuls iveness
+Ġmalp ractice
+Ġcet p
+Ġdiverg ing
+Ġaggl om
+Ġhook s
+Ġodor ata
+flex ion
+Ġvideolaryng oscopy
+odys plasia
+Ġantit uberc
+Ġcarbox yl
+Ġilliter acy
+Ġhang zhou
+Ġvasoconstrict ors
+Ġuncover ing
+Ġdemir nas
+Ġparaf unction
+Ġecn q
+Ġnim art
+Ġriv ers
+Ġepist em
+Ġdict ated
+Ġimmunophen otyping
+Ġupg rade
+Ġpermiss ible
+Ġmetastas ize
+Ġmisinterpre ted
+Ġdeacet ylation
+Ġphosphoryl ates
+Ġavn rt
+Ġbq t
+Ġjeopard ize
+Ġeic osan
+agog ues
+Ġvacuol ation
+Ġdros ha
+Ġlud wig
+Ġepilept ogenic
+Ġaerob ically
+Ġfly ers
+Ġpist on
+Ġorn ithine
+Ġdepolar izing
+chec k
+Ġbeaut y
+Ġactu arial
+Ġaltru istic
+Ġimplaus ible
+Ġneurole ptic
+Ġpericor onitis
+Ġxenob iotics
+Ġlw bs
+Ġygj dsj
+Ġaminosal ic
+Ġmash had
+Ġislam abad
+Ġeut opic
+obstruct ive
+Ġpier ce
+Ġspongi osum
+Ġumbell ata
+Ġnonfunction al
+Ġrestruct uring
+Ġentertain ment
+Ġmillimet res
+Ġbulg aria
+Ġbabes iosis
+Ġdaid zein
+Ġkot min
+Ġnecros ectomy
+Ġacylcar nitines
+Ġcucurbit acin
+Ġaerc ap
+Ġamplat zer
+Ġannon acin
+Ġobtus ofolin
+Ġmaccon key
+Ġnoninvas ively
+Ġthunber giana
+Ġintergen erational
+anguine ous
+Ġcobbl estone
+ischem ic
+Ġranc d
+glute al
+Ġsgr q
+Ġandrop ause
+Ġesax erenone
+Ġpsycin fo
+6 95
+9 4
+a is
+b ase
+b den
+d ar
+h uman
+j n
+k h
+m aps
+m tc
+m eca
+n ar
+r ina
+u lectomy
+Ġt ending
+in n
+in ators
+Ġa ab
+at em
+en ke
+Ġo im
+Ġw andering
+Ġin a
+Ġin ha
+Ġf ren
+Ġf cc
+Ġd gf
+Ġm pl
+Ġb gd
+ent on
+an thes
+ar ms
+Ġre op
+Ġre aff
+Ġh ul
+Ġh ib
+Ġh ics
+Ġh ired
+ul en
+ul otomy
+Ġn el
+Ġn so
+Ġst or
+Ġst il
+os core
+Ġg ie
+Ġg arc
+th i
+th y
+Ġfor k
+Ġcon cha
+Ġv ps
+Ġbe ef
+Ġpro ph
+Ġr j
+Ġr y
+iv c
+am ten
+ir mer
+oc clusion
+op arietal
+Ġde cent
+Ġch al
+ore duction
+Ġse es
+act yly
+Ġad obe
+Ġad ela
+Ġac acia
+ac yt
+ac ids
+Ġind em
+Ġdiff us
+Ġcl om
+ther a
+Ġit m
+Ġne b
+ge hog
+per idine
+Ġha wth
+Ġaf b
+Ġanalys t
+Ġk inking
+Ġk ramer
+Ġtr pc
+Ġsub int
+pro s
+Ġout lets
+Ġgen ex
+Ġcor i
+Ġcr ist
+Ġcr ust
+Ġcr fs
+Ġup ps
+acter ic
+agn es
+Ġag me
+Ġag omel
+cc o
+Ġman ne
+Ġnon pro
+Ġbi otype
+Ġindic um
+Ġsp aced
+Ġ2 677
+Ġem cc
+Ġsim ex
+Ġsim ulates
+Ġdem ethyl
+Ġdem yelin
+Ġdef l
+Ġso iling
+Ġtra ding
+Ġma oto
+Ġfur a
+Ġmult iph
+Ġmon obl
+Ġconf inement
+Ġcar n
+Ġcardi ological
+Ġpar acentesis
+Ġest onian
+Ġfl l
+ok er
+Ġcorrel ative
+Ġif gf
+Ġmic rone
+Ġcent imeter
+Ġocc lude
+Ġel d
+Ġel is
+Ġpress or
+Ġsampl er
+erg ics
+ock ed
+Ġpers ulfate
+Ġz ag
+Ġsens ible
+Ġcoh osh
+Ġeff luent
+Ġhem if
+ec k
+thes iological
+oph enol
+Ġir m
+Ġca pec
+Ġpa prosky
+Ġhypert rophied
+Ġcir cs
+Ġil io
+Ġcur tail
+Ġdys lipidemic
+Ġct ca
+Ġcap ped
+Ġserv o
+Ġtarget scan
+Ġmater ially
+Ġresist ive
+li oides
+Ġq max
+Ġpat ents
+Ġsl ime
+Ġach es
+Ġsch irmer
+rop ical
+Ġhuman ized
+Ġelev ates
+Ġsw im
+Ġdm e
+Ġdec ann
+Ġib l
+rob l
+rob acter
+Ġver ge
+Ġmucos ae
+Ġneuro peptide
+Ġiv dd
+Ġperiodont opathic
+Ġrad ium
+Ġcath elic
+Ġavoid ant
+Ġinterp osition
+Ġplan meca
+Ġmagn a
+Ġcb c
+Ġhom em
+Ġinterpre ters
+sh ire
+sh ito
+Ġcereb ell
+Ġkit av
+Ġarth ro
+Ġ10 1
+Ġrt x
+Ġcircum cision
+Ġpen n
+Ġhere after
+Ġleuk em
+Ġhaem olysis
+Ġcytotox in
+Ġmis information
+Ġhp x
+oprotein emia
+ta a
+Ġros enberg
+Ġpurpose fully
+Ġanaes thesiology
+Ġtri oxide
+Ġnh r
+Ġnan ost
+Ġid n
+Ġfore brain
+Ġbuc cally
+Ġom it
+Ġtt d
+oz ol
+Ġslow s
+Ġtext ural
+gl a
+Ġacad emia
+Ġvul va
+Ġmultic omp
+Ġsv o
+Ġoverl ays
+Ġtong ji
+Ġpn f
+Ġsen ile
+Ġmind stream
+Ġstabil ised
+Ġhost ed
+Ġpw tt
+Ġpy rid
+Ġpy rexia
+Ġlm as
+Ġcn ns
+Ġcn isd
+Ġcin b
+25 2
+Ġtap a
+Ġresc uers
+Ġded uction
+Ġpara oxon
+Ġpk m
+Ġpk quest
+Ġmeaningful ness
+Ġhybrid isation
+Ġsimpl ifying
+Ġvd o
+olip in
+Ġcra i
+Ġcurv ilinear
+Ġgdm t
+Ġiliac a
+Ġstere o
+Ġwarm er
+Ġfinger prints
+Ġsort s
+Ġws ret
+iro cin
+Ġintrac av
+Ġfg m
+Ġfg r
+Ġfg ds
+Ġarrang ing
+Ġrutin oside
+Ġreplic ative
+Ġturb ulent
+Ġstream s
+Ġoffs prings
+Ġtx yf
+Ġgol gi
+Ġsuperimposition s
+Ġgj ht
+Ġburst s
+Ġseb um
+Ġrms d
+Ġwatch ed
+Ġcass ettes
+real d
+Ġpanc olitis
+Ġoblig ate
+Ġmicrom eter
+Ġlubric ating
+Ġtrypan os
+Ġbir ds
+Ġrvf wls
+Ġtas c
+Ġimpuls ive
+Ġton us
+Ġdav idson
+Ġstriat al
+Ġbutt ons
+Ġleiomy omas
+Ġshadow s
+Ġsubsid ized
+Ġeol c
+Ġhisti ocytic
+Ġsie ge
+Ġbdm ard
+Ġsapi ens
+Ġclim acteric
+Ġdol phin
+Ġhed gehog
+Ġquadr atus
+Ġimmobil isation
+Ġcoerc ive
+Ġvacuol ated
+Ġseawe ed
+Ġtut orial
+Ġpedig rees
+Ġhell p
+Ġdecap itation
+Ġanv ugib
+Ġtrin idad
+Ġinterpol ated
+plen omegaly
+Ġvaricoce le
+Ġlegit im
+Ġcommiss ure
+Ġacrom ion
+Ġprecaution ary
+Ġrik kun
+Ġradiotra cer
+Ġcommin uted
+Ġembal ming
+Ġjas per
+Ġopcab g
+Ġfles ch
+Ġabdomin opelvic
+Ġemir ates
+Ġlozen ges
+Ġhoneyb ush
+Ġwic p
+Ġheartbe at
+Ġprae via
+Ġsniff ing
+Ġidiosyncr atic
+Ġhispid ulin
+Ġpericarp ium
+Ġlymphoplasm acytic
+Ġsot etsu
+Ġloyal ty
+Ġlapt op
+Ġcryob alloon
+Ġeclip se
+Ġence lioides
+Ġmup irocin
+Ġcerule in
+Ġintrom ission
+Ġautocor relation
+Ġintracyt oplasmic
+Ġrosem ary
+Ġaminog uanidine
+Ġlans oprazole
+Ġallos ct
+Ġhyorh inis
+Ġhfup r
+Ġpapac arie
+bden um
+Ġreaff ir
+Ġadela ide
+Ġupps ala
+Ġagomel atine
+Ġmindstream s
+Ġrikkun shito
+Ġsotetsu flavone
+3 16
+d les
+h emat
+l b
+r ase
+w ere
+x iong
+Ġth yl
+on ally
+Ġs angu
+Ġc ites
+Ġp ach
+Ġp itting
+Ġf ang
+Ġf af
+Ġf je
+Ġf enton
+ic ially
+or ne
+Ġd ull
+Ġm uk
+Ġm reald
+Ġb ae
+as ian
+an il
+ar ine
+Ġre ch
+Ġre vel
+ul ant
+Ġn ts
+Ġn oca
+om ectomy
+Ġl fs
+os bu
+im ide
+Ġg z
+Ġg ear
+Ġg ics
+id oc
+Ġas mc
+Ġfor going
+Ġv ms
+ch ang
+Ġbe gg
+od ality
+od yst
+od ex
+ot ally
+Ġr it
+Ġis n
+Ġis ole
+am yl
+Ġres ective
+op ing
+Ġim iq
+ore lin
+Ġat b
+Ġat ro
+act ically
+Ġpre og
+Ġpre central
+Ġsh p
+Ġsh u
+Ġsh ells
+Ġle tt
+ay ama
+Ġare ald
+Ġco agulated
+iff erence
+eren ts
+ich e
+Ġaf amin
+ast igmine
+Ġap ople
+ug l
+Ġpres e
+Ġun k
+Ġun gal
+Ġsub ep
+Ġam ps
+Ġam kl
+Ġph orbol
+Ġy th
+Ġy cht
+ren ce
+Ġact b
+Ġar ra
+Ġhy flex
+Ġcol ocal
+Ġpr un
+ym ilk
+agn ostic
+Ġover inflation
+ass ie
+ery l
+Ġtrans gluteal
+Ġnon re
+Ġnon norm
+ep sis
+Ġdep ut
+Ġperi radicular
+Ġj ft
+Ġj ane
+Ġsp q
+Ġend om
+Ġem sa
+Ġsim eth
+ke eper
+Ġso ymilk
+Ġsm g
+Ġsm x
+Ġperiod ical
+lic ation
+Ġrem itting
+Ġma i
+Ġappro x
+Ġadm ix
+Ġmon otherapies
+Ġcardi omegaly
+Ġmin iat
+Ġed ii
+Ġfl oors
+duct ory
+yl ates
+yl itis
+Ġpe eling
+Ġhyper aemia
+Ġpath omechan
+Ġimm uplex
+Ġcent ile
+Ġel s
+Ġic on
+Ġintra pro
+Ġear n
+Ġep r
+Ġless on
+Ġless ened
+Ġgre g
+Ġmy rist
+Ġimmun olip
+Ġmal arial
+Ġhem operfusion
+Ġsyn apses
+Ġcyt opathic
+Ġimpact ions
+Ġca uter
+Ġil c
+Ġpoly ether
+Ġpsych ole
+Ġpsych ometrics
+Ġprom yel
+omet ries
+co le
+ffici encies
+Ġtem ozol
 cin ated
-cin ate
-Ġsqu eezing
-Ġsqu alane
-Ġtra ebert
-Ġtra etment
-Ġtra fford
-Ġtra versing
-Ġcalcul i
-Ġcalcul ators
-Ġpolymer ised
-Ġpolymer izes
-Ġpolymer isation
-Ġ8 000
-Ġ8 10
-Ġ8 89
-Ġ8 56
-Ġ8 60
-Ġlear ner
-Ġlear nt
-Ġsitu ational
-Ġoptim e
-Ġoptim ise
-Ġwa al
-Ġwa it
-Ġwa ited
-Ġwa als
-Ġwa hl
-Ġwa hn
-Ġwa had
-Ġbor uta
-Ġbor oujeni
-imin odi
-Ġattrib uting
-Ġphot ometer
-Ġphot omedic
-Ġphot ocop
-ext ct
-Ġrelevant ly
-Ġms m
-Ġms r
-Ġms ws
-Ġbre f
-Ġbre ach
-Ġbre eding
-Ġbre au
-Ġbre vis
-Ġbre vund
-Ġbre asor
-Ġsubs ide
-Ġsubs umes
-Ġsubgroup ed
-Ġinstruc tive
-me asure
-me yer
-me asures
-me aning
-Ġrecor der
-ru ity
-ru vate
-ocy anins
-ocy ante
-Ġaccord ed
-Ġens embled
-Ġens embl
-Ġtop ological
-Ġtop ographically
-Ġrecur ring
-Ġnational e
-Ġnational s
-Ġobes ogenic
-Ġtub ert
-Ġsil ences
-Ġsil enced
-Ġsil oxane
-Ġsil oranes
-Ġsil anization
-Ġmus savir
-Ġmus illi
-otyp ical
-Ġsn ap
-Ġsn ail
-Ġsn ored
-Ġsn odent
-Ġsn eezing
-Ġsn orting
-Ġsn odds
-Ġsn ellen
-Ġcd nas
-Ġcd kn
-Ġcd fc
-Ġcd mem
-Ġcd rc
-Ġcoll ation
-Ġcoll age
-Ġcoll ateral
-Ġcoll ins
-Ġcoll prot
+Ġright ing
+Ġlog s
+Ġhand ih
+Ġinstr ide
+Ġve ines
+Ġoste ocyte
+Ġoste omalacia
+Ġlabor ious
+Ġsw ell
+Ġmuc oc
+bo a
+Ġdec olonization
+Ġu ce
+Ġflu o
 Ġcoll agens
-Ġappropri ates
-Ġclean up
-Ġclean ers
-com as
-com parative
-com parisons
-Ġtit ration
-Ġtit ratable
-rop ores
-rop athy
-Ġster cher
-Ġster noc
-Ġtoothp icks
-eric a
-Ġcir au
-Ġcir cinate
-Ġrecru its
-Ġpen ding
-Ġpen light
-Ġpen alty
-Ġpen nington
-Ġbar on
-Ġbar ts
-Ġbar cel
-Ġbar ata
-Ġbar code
-Ġbar rel
-Ġbar bed
-not ably
-aps ular
-Ġprotein uric
-Ġcarious ly
-Ġill ino
-Ġmaintain ers
-Ġ201 70
-rix oma
-Ġeas iness
-Ġprep uberal
-uter ized
-Ġvisual isation
-Ġemploy ability
-Ġfunctional s
-Ġfunctional ize
-Ġfunctional ization
-Ġlingual ized
-Ġlingual ization
-Ġincub ating
-Ġreporting s
-Ġavoid s
-Ġcod ers
-Ġcod ings
-Ġten uous
-Ġten acity
-Ġten nis
-Ġexpected ly
-Ġprol apse
-Ġmagn um
-Ġmagn ified
-Ġmagn ets
-Ġmagn ifying
-Ġmagn eto
-Ġpneum onic
-Ġpneum ophil
-Ġpneum ocys
-Ġreal ization
-Ġreal izes
-Ġorgan ise
-Ġorgan ising
-Ġorgan izes
-Ġorgan ole
-Ġdirection ally
-Ġhydro lytically
-Ġhydro dynamic
-Ġalg ahe
-ax ceph
-pre p
-Ġmineral ize
-Ġmineral izing
-Ġic p
-Ġic r
-Ġic at
-Ġic eland
-Ġobjec tivity
-Ġbro ers
-Ġbro ach
-Ġbro der
-Ġbro ward
-Ġbro ok
-Ġbro oks
-Ġbro ws
-Ġbro wser
-Ġbro chures
-Ġnas opalatine
-Ġnas iolabial
-Ġread able
-Ġread iness
-Ġgenetic ist
-Ġzir cad
-Ġheter ologous
-Ġheter ogenetic
-Ġheter omeric
-ibr ated
-Ġultr acle
-Ġbur t
-Ġbur dened
-Ġsee ks
-Ġparti tion
-Ġtrials non
-Ġtrials quasi
-uro us
-uro xim
-Ġtend on
-Ġdam on
-Ġdam ped
-Ġhs l
-Ġhs ueh
-Ġhs ieh
-Ġtemper ament
-Ġge ared
-Ġge force
-Ġenc ore
-Ġenc ased
-Ġenc oraf
-Ġenc roaches
-Ġmy ofacial
-Ġmy ogenesis
-Ġmy rt
-Ġmy ocutaneous
-Ġmy ths
-Ġmy asthenia
-Ġmy riad
-Ġbu i
-Ġbu y
-Ġbu zz
-plas ties
-grad ing
-Ġmr is
-Ġmr onj
-Ġmr presso
-Ġhor n
-Ġhor se
-Ġhor ns
-Ġhor ani
-Ġev ans
-Ġev ade
-Ġev oke
-Ġev acuated
-Ġev agination
-Ġirradi ates
-Ġirradi ances
-Ġmill i
-Ġmill ard
-Ġmill isecond
-Ġmill igrams
-Ġstain er
-acti vities
-Ġinterven ed
-Ġinterven ing
-Ġphosph ine
-Ġphosph oprotein
-Ġphosph osil
-Ġbenef iting
-Ġepithelial ize
-Ġepithelial ized
-Ġsem inal
-Ġsem mel
-Ġdefin able
-Ġgran ular
-Ġgran atum
-pati ents
-Ġrecip e
-Ġmalign ity
-Ġfp n
-Ġinstrument ing
-Ġexpansion s
-Ġprepared ness
-Ġlig ate
-Ġlig ations
-Ġhem ocue
-Ġtren ding
-Ġmac es
-Ġmac arth
-Ġmac book
-Ġmac romo
-Ġmac pherson
-Ġmac ropores
-Ġhouse field
-Ġregen erating
-roc occus
-roc audal
-Ġsci enza
-Ġsci kit
-Ġcov r
-Ġminisc ule
-Ġexplain er
-Ġpapill ated
-Ġdebr iding
-Ġmedic o
-Ġmedic inal
-Ġweek days
-Ġultras tructure
-Ġultras hort
-cs b
-Ġrank les
-Ġflap ping
-Ġq in
-Ġq ude
-Ġq trap
-Ġve ins
-Ġtf h
-Ġsb d
-kers son
-Ġquanti le
-Ġquanti les
-Ġquanti kine
-Ġmar c
-Ġmar sa
-Ġmar itrix
-Ġmar riage
-Ġmust afa
-Ġbin ong
-Ġbin ning
-Ġbin imet
-Ġbin ominal
-Ġhom ed
-Ġhom ing
-Ġhom eless
-Ġhom onymous
-Ġhom olateral
-Ġhom emade
-Ġculture ware
-Ġdys gran
-Ġdys functional
-Ġdys gnathia
-Ġdys phor
-Ġdys kines
-Ġdys lipidemia
-Ġdys trophic
-Ġdys thym
-Ġdys phagia
-Ġmouthwas he
-Ġpocket of
-Ġess ence
-Ġess ay
+Ġair tra
+Ġdev ascular
+Ġintro ductory
+Ġcm t
+Ġcv id
+Ġheter ot
+Ġdom inate
+Ġod di
+Ġphosph ates
+Ġak ss
+Ġreact iv
+Ġax otomy
+Ġhead ge
+den se
+Ġalcohol ics
+Ġiv ac
+Ġhal ogen
 Ġess ix
-Ġpass ers
-Ġpass arge
-Ġpass aging
-Ġpass aged
-Ġpass word
-Ġpass iflora
-Ġpass ivated
-Ġoff ended
-Ġoff line
-Ġoff ending
-Ġra i
-Ġra hhal
-Ġaccept ably
-Ġfluid ity
-Ġcheck erboard
-Ġcand y
-Ġcop ied
-Ġcop ayment
-Ġcop rococcus
-arm ed
-Ġcf x
-Ġcf us
-Ġpast es
-Ġher b
-Ġher itable
-Ġher pex
-Ġher lof
-Ġher itage
-Ġher petic
-urs ors
-urs ive
-Ġcho i
-Ġcho oses
-Ġcho lewa
-Ġcho lecyst
-Ġcorrect ness
-Ġpm d
-Ġpm ns
-Ġtur co
-Ġtur ner
-Ġtur cica
-Ġtur rion
-Ġtur naround
-Ġtur ssi
-Ġnan ning
-Ġnan ogl
-Ġnan ograms
-Ġnan omolar
-Ġnan ohy
-Ġnan oplates
-Ġalcohol s
-Ġalcohol ism
-Ġrespect fully
-Ġfield work
-Ġadap tor
-Ġweight ings
-Ġsection ally
-Ġpor k
-Ġpor opl
-Ġdown growth
-Ġdown load
-Ġdown side
-Ġdown tur
-Ġdown graded
-Ġdown town
-Ġassign s
-Ġ19 2
-Ġ19 5
-Ġ19 10
-Ġ19 74
-Ġ19 95
-Ġ19 53
-Ġ19 32
-Ġ19 45
-Ġ19 30
-Ġ19 05
-Ġur zel
-Ġur jc
-Ġur anyl
-Ġmetast astic
-Ġmetast asized
-Ġder ives
-Ġder otate
-tric ted
-tric ably
-Ġenrol lees
-Ġphen ochlor
-Ġphen olic
-Ġphen yto
-Ġphen ylmeth
-Ġphen otypical
-Ġmanufact ures
-Ġtransfer able
-Ġtransfer ase
-Ġbonding s
-Ġaltern ated
-Ġaltern ating
-Ġaltern ately
-Ġchlor in
-Ġchlor ine
-Ġchlor oamin
-Ġchlor amines
-opath ogenicity
-Ġeng er
-Ġeng ages
-Ġblock er
-Ġblock ade
-he a
-he alth
-he iro
-he althy
-tt tg
-tt ga
-tt aga
-tt atc
-tt ggt
-Ġhd ock
-Ġinternal ised
-Ġent ers
-Ġent rus
-Ġent omb
-Ġent erovirus
-Ġmil ano
-Ġmil erad
-Ġmil grom
+az ines
+Ġx e
+Ġthromb ocyte
+Ġmi ab
+Ġmes ilate
+Ġmicrob e
+sh ock
+Ġbal d
+Ġport ability
+Ġpneum atization
+Ġmg i
+Ġ19 3
+Ġlum bor
+Ġsd r
+Ġten ets
+Ġbio ter
+Ġden y
+Ġalign ments
+une us
+Ġhp p
+Ġphot odi
+Ġdon key
+Ġlas ap
+Ġgradu ating
+Ġrepro cessing
+53 1
+Ġss ii
+Ġreverse ly
+Ġhypothes ise
+Ġnc b
+Ġln h
+Ġba uer
+Ġput ra
+Ġsv f
+Ġoverl aid
+Ġpb op
+Ġpb mt
+Ġlys ozyme
+Ġpum ila
+19 8
+Ġbronch oscopic
+Ġapplic ants
+Ġhm ga
+Ġfas l
+Ġ13 0
+Ġembol ized
+Ġsi adh
+Ġrevascular ized
+Ġlet ting
+Ġappend icular
+15 9
+Ġelectroc onvulsive
+pex y
+Ġice cap
+Ġmf ca
+Ġmann ose
+Ġgs d
+Ġgs i
+Ġff x
+Ġdermat ophyt
+Ġantif ibrotic
+Ġsquam osa
+67 9
+Ġsimpl ification
+anth ine
+acet amide
+Ġexec ut
+Ġexec uting
+Ġextr usive
+Ġrm sea
+onom ically
+Ġknock ed
+Ġblank s
+Ġtravel s
+Ġdt nb
+sp ace
+Ġmaxim a
+Ġmaxim ized
+Ġpep per
+Ġstere olith
+Ġqrs d
+Ġhypo ventilation
+Ġhv c
+Ġqt of
+Ġql ps
+Ġplex ig
+Ġrub us
+Ġrub bing
+Ġabras ives
+Ġabc d
+Ġsct s
+Ġchop ped
+Ġtol butamide
+Ġmicrot itre
+Ġjudgment al
+Ġimmunological ly
+Ġcong aplex
+Ġradiol ig
+Ġpalm it
+vac amten
+Ġmaf g
+Ġopac a
+Ġdiscol our
+Ġchief ly
+Ġfibrom a
+Ġmath ematically
+Ġphenyl methyl
+Ġsts g
+Ġcommission ers
+Ġnl phl
+rl m
+Ġspher oid
+Ġphag ocyt
+Ġdichlor odi
+Ġevac uated
+Ġpaste ur
+Ġmetaph ase
+Ġsof osbu
+Ġdispens ers
+Ġeug lycemic
+Ġici q
+Ġtriter penoid
+Ġish ak
+Ġenteric a
+Ġfacet ed
+Ġrectang le
+Ġsupras ternal
+Ġsse ps
+Ġnap ping
+Ġlst v
+Ġnest in
+Ġdyst rophic
+Ġfdi i
+Ġik k
+regard ing
+Ġwog onoside
+Ġlund man
+Ġcounsel ors
+Ġwrink le
+Ġriv astigmine
+Ġtes la
+Ġnem aline
+Ġhun ter
+opharm acological
+Ġbah ir
+Ġthiaz ide
+Ġabb meds
+Ġdsc v
+Ġprofil ometer
+Ġmalle olus
+Ġsjz ds
+Ġnur bs
+Ġgoni oth
+Ġinterpol ation
+Ġngr ns
+Ġeucalypt ol
+activ ator
+Ġdecalc ification
+Ġhypomineral ized
+Ġunsurprising ly
+Ġstrang ulation
+Ġmng ie
+Ġlyn ch
+Ġbasophil s
+Ġimmunostim ulatory
+Ġchyl omic
+Ġshan xi
+Ġsper ms
+Ġtart rate
+Ġware house
+Ġpersuas ive
+Ġcroc etin
+Ġbuttock s
+Ġenvenom ation
+Ġlec ithin
+Ġflax seed
+Ġstun ning
+Ġhepatos plenomegaly
+5564 42
+Ġvanill ic
+Ġasynchron ous
+Ġexs angu
+Ġcoom assie
+Ġhemos iderin
+Ġtwent ieth
+Ġenterocol itis
+Ġintrar ater
+Ġtachyp nea
+Ġinsur ances
+Ġpainkill ers
+Ġpolyc arbonate
+gnath ia
+Ġmicrohemorrh ages
+chu ic
+ogast rostomy
+Ġzj w
+Ġphosphodies terase
+Ġpyroph osphate
+Ġandrost enedione
+Ġliquir itin
+Ġintragast rically
+Ġprotocate chuic
+Ġdioscore a
+Ġaponeu rosis
+Ġgingive ctomy
+Ġfuzz y
+Ġindem nity
+Ġisole ucine
+Ġsimeth icone
+Ġtemozol omide
+Ġhandih aler
+Ġairtra q
+Ġlumbor um
+Ġsofosbu vir
+b oth
+c ompar
+d rop
+l ability
+n ever
+o ft
+p aren
+r anol
+Ġ velop
+Ġt rom
+Ġt ars
+Ġa plasia
+Ġa epa
+on itoring
+Ġs ve
+en er
+Ġc ue
+Ġc ite
+Ġc chs
+Ġp est
+Ġp rad
+Ġf est
+ic u
+ic z
+Ġd z
+Ġd uc
+Ġd gla
+is ons
+Ġand roid
+Ġb tt
+as ias
+ro de
+ar f
+ar cin
+Ġre iter
+ul line
+Ġn urt
+ere r
+ur ational
+ur ica
+Ġl anth
+Ġl cea
+ly can
+os d
+os aminidase
+Ġg ates
+Ġg uba
+id ae
+ce led
+if a
+Ġfor b
+Ġcon ject
+el en
+Ġv max
+Ġpro seal
+od as
+Ġr pl
+ist ance
+Ġor l
+oc ia
+Ġde protein
+Ġinc oming
+Ġch hf
+Ġpre ceptor
+Ġsh ir
+ip pi
+se vere
+Ġac d
+Ġwe bp
+Ġcl of
+Ġme peridine
+Ġit ns
+Ġinf inity
+ph er
+Ġint ends
+Ġha jj
+Ġaf x
+Ġap g
+Ġk ub
+Ġtr it
+Ġtr pa
+Ġtr iaz
+Ġreg ret
+Ġun just
+Ġcons ens
+Ġcons anguineous
+ill i
+Ġy ok
+all ed
+Ġant isp
+Ġant ares
+erm is
+Ġar iz
+Ġdet ergent
+cl ed
+Ġcor r
+Ġro bert
+Ġcol oration
+Ġfin anced
+Ġser pine
+ix ime
+Ġra fs
+Ġtrans activation
+Ġnon obstructive
+Ġsurg es
+Ġperi renal
+Ġsp f
+Ġsp ap
+Ġstr iving
+Ġend ings
+Ġdef end
+Ġrem des
+Ġma vacamten
+Ġgl acial
+Ġident ically
+Ġimp s
+Ġimp urities
+ines cent
+Ġmin istries
+Ġi if
+Ġlim ma
+Ġfl otation
+Ġred cap
+Ġhyper oside
+Ġinflamm ations
+Ġins idious
+Ġdo ors
+af ungin
+Ġchild less
+ov igilance
+Ġpress urized
+Ġret raining
+Ġop iate
+Ġmo y
+Ġz op
+Ġmicro aer
+ec g
+Ġsyn cyt
+Ġer cc
+ha war
+Ġca ag
+Ġweek day
+cle ft
+gan kyrin
+Ġfam ous
+Ġprom ega
+Ġbm t
+omet abolism
+Ġlip osomes
+Ġaut od
+Ġsl um
+Ġbr isk
+Ġhuman itarian
+Ġve mur
+Ġmen u
+Ġmm dp
+Ġelev ator
+Ġsurvey ing
+Ġinsulin s
+Ġos car
+bo urs
+Ġu as
+Ġprogram m
+ool s
+Ġfunctional ized
+Ġmac rogl
+Ġnor valine
+Ġreact ants
+Ġiv ra
+Ġlv p
+Ġhc ad
+Ġmit oses
+Ġlink ages
+Ġdevi ating
+Ġvisual ise
+work s
+Ġmt d
+Ġmt wa
+Ġnucle oprotein
+Ġx iv
+Ġx ia
+Ġpc b
+Ġmar igold
+Ġann um
+man y
+Ġbro cc
+Ġhcc s
+imin ib
+Ġacqu ainted
+Ġaden o
+Ġvac ation
+sa w
+Ġfall ot
+Ġ10 5
+Ġenhance ments
+Ġpt if
+Ġste a
+rin x
+Ġresol ves
+Ġpen ins
+bl ue
+Ġdeep ened
+Ġsil enced
+urb ed
+Ġfatig ued
+Ġtransl ocations
+Ġwar ned
+ea h
+Ġradiograph ical
+Ġfr g
+Ġfr t
+Ġnm ibc
+Ġsul ci
+Ġcla w
+Ġburn ed
+Ġoptim isation
+yc omb
+Ġstimul ators
+Ġaer ogenes
+Ġsy rinx
+Ġclean ers
+Ġeryth ro
+Ġrehabil itative
+Ġexpans ive
+Ġaccompan ies
+Ġpf h
+Ġpf u
+Ġrevers ion
+Ġquart z
+Ġtib i
+Ġtib ias
+Ġtgf br
+11 195
+Ġinterf ascial
+Ġsurround s
+Ġmv s
+Ġpn c
+22 7
+Ġsar ah
+Ġsulf ide
+14 8
+Ġsac cular
+Ġter r
+Ġbis pecific
+Ġtha w
+Ġsev s
+Ġcn y
+Ġcn ki
+Ġdh aka
+Ġile o
+Ġincrement ally
+Ġsubt ropical
+Ġacceler ometers
+27 5
+27 987
+Ġpcos q
+Ġdehyd ro
+Ġdors olateral
+Ġaw b
+Ġfab rics
+Ġaz ide
+Ġaz ole
+Ġlad y
+Ġneutral ized
+Ġmarket scan
+Ġgs dmd
+Ġhex osaminidase
+Ġsah p
+Ġvd d
+kin etic
+Ġfing ert
+Ġpic co
+60 7
+Ġmesial ization
+Ġber ries
+Ġmanip ulating
+Ġnac a
+Ġbin der
+Ġfront ier
+Ġrp oc
+Ġsecret ary
+Ġeat en
+Ġdt fc
+Ġcef ixime
+Ġacknowled gement
+Ġsyring omyel
+Ġscatter plots
+Ġhypo active
+Ġcoagul ant
+Ġoverestim ating
+Ġbeam s
+Ġlaborator ial
+Ġgb tl
+Ġabc de
+oxygen ated
+Ġum ss
+Ġum rfs
+Ġinters ected
+Ġbact ec
+Ġtransit ory
+Ġbh ut
+Ġtj h
+Ġturb ine
+Ġfb nc
+Ġtrypsin ogen
+Ġnl p
+Ġmalt ose
+Ġpms f
+Ġaccommod ative
+Ġengine ered
+Ġaerosol ised
+Ġfus obacteria
+Ġwrong ly
+Ġpes hawar
+Ġfsh d
+Ġmobil izing
+Ġscintig raphic
+Ġgrand m
+Ġmyofib ril
+Ġmag azine
+Ġmathemat ics
+Ġvh ds
+Ġspin opelvic
+Ġpolymyx ins
+Ġdipl opia
+Ġjc j
+Ġeuc erin
+Ġmyx oid
+Ġsubthem e
+Ġfq pcr
+Ġdav is
+Ġhone ycomb
+Ġanticholin ergics
+Ġsq e
+Ġdyst ocia
+Ġexud ation
+Ġimplicit ly
+Ġncr na
+Ġelu ate
+Ġhamp ers
+Ġventricul ography
+hem ispheric
+Ġcarbox ymethyl
+Ġunconscious ness
+Ġglycyrrhiz a
+Ġgq ds
+Ġunderpin ned
+Ġuncon ditional
+Ġentrap ped
+Ġadvers ities
+Ġcbp m
+Ġpuer ariae
+Ġincap able
+Ġpgs k
+Ġgrav id
+Ġbout s
+Ġrefresh er
+Ġling ually
+Ġexempt ed
+Ġnormother mic
+Ġgk rs
+oplasm osis
+Ġfingerprint ing
+Ġsynovi ocytes
+Ġcorpor ate
+Ġfds c
+Ġdyad ic
+Ġalph as
+Ġsams ung
+Ġfrid ay
+Ġepilept iform
+Ġrhb np
+Ġsesquiter pene
+Ġimplaus ibility
+Ġther most
+Ġsatur day
+Ġparap le
+Ġmonoter penes
+Ġzoled ronate
+Ġelectroencephal ogram
+Ġprb cs
+Ġschneider ian
+Ġmyomet rial
+Ġterpin en
+Ġsalic ylate
+Ġsulfon amides
+Ġpolygon um
+Ġtuc ker
+Ġprejud ice
+Ġappreh ension
+Ġpessim istic
+Ġmetaneph rines
+Ġpetech iae
+Ġmosqu ito
+Ġextraord inary
+Ġpreadip ocytes
+Ġlanc et
+irradi ated
+Ġteles copic
+Ġive ps
+Ġescul enta
+Ġmillis ec
+Ġrecy cling
+Ġvacut ainer
+Ġintertw ined
+Ġneure x
+Ġundist urbed
+Ġjiro ve
+Ġhyperext ension
+Ġheadge ar
+Ġphotodi ode
+Ġdiscolour ation
+Ġgonioth alamin
+Ġremdes ivir
+Ġvemur afenib
+27987 45
+Ġsyringomyel ia
+4 11
+7 19
+7 26
+b us
+d ra
+h imb
+p osition
+p yr
+r ins
+u j
+v ovec
+x x
+Ġt are
+Ġt anshinone
+Ġc raz
+Ġc wf
+Ġp ity
+Ġw er
+Ġw ra
+Ġin ver
+or isk
+Ġd art
+Ġd ilt
+is i
+is iac
+Ġm np
+Ġm ovable
+Ġb ch
+Ġb ial
+as emn
+ar l
+Ġre att
+Ġe exp
+Ġn ors
+om ta
+om ethyl
+om annan
+Ġl me
+Ġl atif
+Ġg bp
+ig y
+Ġas un
+Ġas arone
+Ġwas ted
+Ġon asemn
+el os
+el opsin
+ab ol
+Ġv ater
+up ta
+Ġal dehydes
+ag gg
+Ġis is
+Ġis cc
+um or
+ir ling
+ir ius
+oc ort
+op ride
+est ones
+Ġus at
+Ġus phs
+Ġch and
+Ġper im
+ip e
+Ġac o
+ay asu
+Ġdis put
+Ġind oors
+Ġwe iss
+Ġcl c
+Ġcl abs
+art z
+Ġne e
+Ġne opterin
+Ġsc rt
+per itoneal
+Ġinf inite
+ph enol
+Ġap oc
+Ġab epar
+Ġinter hemispheric
+ose al
+ill ar
+Ġmed io
+pro ved
+Ġqu iz
+Ġy eah
+Ġro chester
+Ġpr inters
+Ġen alap
+ile t
+Ġperform ers
+Ġover representation
+Ġunder d
+Ġman ometric
+Ġbut orph
+Ġj ilin
+Ġsp w
+Ġmult ichannel
+ex is
+Ġfunction ed
+Ġpar rot
+amm onium
+Ġfl atter
+yl ine
+Ġhyper fib
+Ġel ite
+Ġgra ve
+Ġdo uchi
+af ine
+Ġic ps
+Ġconsist encies
+Ġop u
+Ġmy oma
+Ġmy opic
+Ġimmun ogenic
+Ġimmun ochemotherapy
+que i
+Ġmechan istically
+Ġfib ulin
+Ġfib rogenic
+Ġvent ing
+oscop ically
+Ġsol o
+Ġsol ute
+Ġgluc opyranoside
+Ġml va
+Ġflow jo
+Ġq m
+Ġq bc
+Ġsal a
+ins u
+rop ic
+iat s
+Ġke fir
+Ġoste oking
+Ġpros st
+Ġdec on
+Ġdec ile
+Ġdec ides
+Ġu rolithiasis
+Ġu iats
+Ġwa i
+Ġventric ulo
+Ġcm ri
+Ġod our
+ucle a
+Ġver nier
+Ġoxid ore
+Ġbu oh
+Ġneuro peptides
+Ġpd tc
+Ġselection s
+Ġhal t
+Ġms ct
+Ġeng ines
+Ġdiss ipation
+Ġinteg er
+Ġsqu at
+Ġx iphoid
+uk umab
+Ġlateral is
+Ġhepatic a
+Ġpal om
+Ġmes orectum
+Ġtc bt
+Ġhom b
+Ġbro ke
+anes ulf
+Ġsaliv arius
+Ġadhes i
+Ġinteract ional
+rolog ical
+oplas ma
+Ġampl ifier
+Ġpi erc
+Ġprescrib er
+Ġpass engers
+20 7
+Ġamerican a
+Ġht c
+Ġdescript or
+Ġminim ised
+Ġrh omb
+rad ical
+Ġgc w
+amp ullary
+Ġasc iminib
+Ġproject ing
+Ġfil agg
+Ġfr utic
+Ġros acea
+Ġenter ovirus
+imm une
+Ġmethyl gly
+Ġhypox aemia
+Ġreh mann
+Ġfix tures
+Ġid c
+fact ual
+Ġindirect ness
+16 7
+Ġea w
+Ġom as
+Ġom alizumab
+Ġfer ula
+Ġtt mc
+Ġpolicy holders
 Ġmil estones
-Ġmil ieu
-Ġgerm a
-Ġgerm icides
-Ġinte gu
-Ġinte ger
-Ġinte grading
-Ġdiet ing
-Ġundergo es
-Ġprolif erations
-Ġprolif erating
-Ġstre ate
-Ġstre aked
-Ġstre aks
-ili ans
-Ġsugar less
-Ġcyto lysis
-Ġcyto plasms
-Ġcyto hubba
-Ġcyto lethal
-Ġmis cell
-Ġmis fits
-Ġmis wak
-Ġmis reporting
-Ġmis cegen
-Ġmis placed
-Ġmis registr
-Ġlin fen
-Ġlater otr
-Ġnucle ase
-Ġnucle oli
-Ġbrux er
-Ġbrux ane
-Ġcirc uits
-Ġintegr ative
-Ġintegr ins
-Ġsa e
-Ġsa o
-Ġsa atch
-Ġsa quin
-Ġsa ifi
-Ġhence for
-abol ize
-Ġdiss ect
-Ġdiss ecting
-Ġdiss ociation
-Ġcad mium
-Ġretr ain
-Ġretr acting
-Ġcompreh end
-Ġcompreh ending
-Ġinteraction ist
-Ġiv a
-Ġiv y
-Ġaff lic
-Ġaff ording
-Ġaff inities
-Ġbirth ing
-Ġbirth year
-Ġna ip
-Ġna oh
-Ġna ples
-Ġna ito
-Ġna eij
-Ġna idu
-Ġna vicular
-Ġcarb onic
-Ġcarb olic
-Ġcyt ology
-Ġcyt ometer
-Ġcyt opathic
-Ġcyt osc
-Ġcyt osol
-Ġcyt oskeletal
-Ġcyt omegal
-Ġcyt ocompatibility
-Ġ" ,
-Ġ" .
-Ġ" ?
-Ġeuro pa
-Ġeuro cleft
-Ġeuro fins
-Ġeuro clone
-Ġplay er
-Ġplay ful
-Ġnex p
-ishing ly
-Ġcam phor
-Ġcam illeri
-Ġflex ing
-Ġflex ure
-Ġflex ibly
-Ġflex comp
-Ġnod ular
-Ġram seier
-Ġmake up
-for ces
-for having
-Ġcomputer ised
-Ġart ocar
-Ġpf es
-Ġpf au
-Ġpf apa
-Ġpf kfb
-Ġpf wb
-Ġpf alz
-Ġvr am
-Ġvr anckx
-Ġke en
-Ġke uls
-Ġke ystone
-Ġke bang
-Ġke elung
-Ġdemineral izes
-Ġminim a
-Ġminim ising
-Ġminim ises
-Ġot odental
-Ġpil ocar
-Ġinternational e
-fs r
-Ġfore ver
-Ġfore fr
-Ġspecif ical
-Ġreciproc ity
-Ġreciproc ates
-Ġisol a
-Ġmetabol ized
-Ġmetabol ised
-ittle ment
-Ġmachine able
-ped ed
-Ġhighl ands
-Ġmode er
-gg ini
-gg tc
-gg cttg
-Ġpp b
-Ġpp ts
-Ġrest less
-Ġrest rospective
-Ġpriv ately
-Ġsubjective ly
-Ġdetailed ly
-Ġcre ams
-Ġcre pitus
-Ġds m
-Ġds lr
-icular is
-Ġray leigh
-Ġalloc ates
-Ġobserv ably
-Ġemd ogain
+Ġpil s
+Ġtp v
+Ġnc ap
+Ġane choic
+Ġendoc rown
+Ġpf d
+Ġpolymer izing
+Ġcounter factual
+Ġdecis ional
+Ġlc d
+Ġlc ig
+Ġsir ukumab
+Ġah med
+Ġmor cell
+17 2
+Ġren illa
+Ġmh su
+Ġanth elm
+Ġot rs
+Ġtet ral
+Ġcompens ating
+Ġts as
+Ġpad dle
+Ġket osis
+Ġpw l
+Ġnorth western
+Ġrheumat ologic
+Ġpenet rates
+Ġsta pling
+Ġdn fb
+Ġhipp o
+Ġgal i
+Ġtransm iss
+Ġice b
+Ġmann ers
+Ġsupra p
+Ġinvolve ments
+Ġlin agliptin
+Ġbund led
+Ġgynec ologist
+Ġdd a
+Ġdd is
+Ġdd ds
+thal amic
+onym ous
+Ġbiv ariable
+Ġbios ynthetic
+Ġbenz oyl
+Ġamelior ative
+Ġcus pid
+Ġantiplate lets
+Ġlith otomy
+Ġthrombocyt openic
+iaz em
+Ġodont oblast
+Ġfaecal ibacterium
+Ġsan ction
+lin ik
+Ġretro cl
+ah n
+car nitine
+Ġgb on
+Ġnam ibia
+Ġproce eds
+Ġdock ed
+enta enoic
+Ġsweet eners
+Ġinters ections
+Ġmicrot iss
+Ġcul min
+Ġdisposition al
+Ġunm ask
+Ġsure ly
+Ġpolit icians
+vac cinated
+Ġelbow s
+Ġexcis ional
+Ġstri ke
+Ġtag ging
+Ġdiph osphate
+Ġcub e
+Ġcub oidal
+Ġmenis cectomy
+Ġez rin
+Ġmismatch ed
+Ġnonc oding
+Ġdy ed
+Ġcitiz en
+Ġasymmet ries
+Ġunaware ness
+Ġbulb ospong
+Ġelab oration
+peri osteal
+Ġfluc loxacillin
+Ġstigm ata
+Ġhypom agnes
+keep ers
+Ġantich olinesterase
+Ġteen age
+Ġpheochromocyt omas
+Ġamend ment
+Ġmultil ayer
+Ġprefect ures
+Ġincomp etent
+Ġdischarg ing
+Ġdecont amin
+Ġyg mm
+Ġdoll ar
+Ġwm da
+Ġsubsid ies
+oflav in
+Ġau quei
+Ġstory telling
+Ġctn nb
+Ġcultiv ate
+imet rically
+Ġabort ed
+Ġgord on
+Ġtrunc ating
+Ġausc ult
+Ġsegreg ated
+omax illofacial
+Ġpect ineus
+Ġspous al
+Ġillumin ate
+Ġlor azepam
+osap entaenoic
+Ġcrash es
+Ġgeor ge
+Ġendop at
+Ġpipet ting
+Ġadvertis ement
+oresist ant
+Ġmans oura
+012 6
+Ġpericardi ectomy
+Ġpericardi ocentesis
+Ġunbl inded
+quam ous
+Ġimperfect a
+plen ism
+Ġohp ps
+Ġsesquiter penes
+Ġvaricoce lectomy
+Ġlegit imate
+Ġdismiss ed
+Ġdak o
+robenz ene
+Ġhydroxyt rypt
+Ġlacer ations
+rus or
+Ġaro used
+Ġgogg le
+Ġperit ubular
+Ġhypophosph atemia
+Ġingen ol
+Ġatherothromb otic
+Ġorom ia
+Ġaccr ual
+Ġrbfpd ps
+Ġrecap it
+Ġlister ia
+Ġhypoman ic
+Ġisa ac
+Ġdiseng agement
+Ġscutell aria
+Ġpedagog ical
+Ġsuppur ative
+Ġferr ara
+Ġcrot on
+Ġautoradi ography
+Ġplect in
+Ġacrochord on
+Ġziz iph
+Ġcpot ts
+Ġfluoropyrim idine
+Ġwsf et
+Ġhpb mcs
+Ġsubint imal
+Ġadmix ture
+Ġmyrist ate
+Ġuce is
+Ġbrocc oli
+Ġneurex an
+Ġdilt iazem
+Ġeexp o
+Ġonasemn ogene
+Ġabepar vovec
+Ġbutorph anol
+Ġfilagg rin
+Ġmethylgly oxal
+Ġanthelm int
+Ġbulbospong iosus
+4 69
+5 70
+b umin
+c ock
+c ysteine
+e v
+e ach
+f riend
+h asa
+i que
+j unct
+l ie
+o am
+y one
+z ol
+Ġt ung
+Ġt ils
+in ic
+Ġa ada
+Ġth omas
+Ġthe at
+en al
+en il
+en one
+Ġo so
+Ġo ms
+Ġo ta
+Ġo gc
+Ġc iel
+Ġp enc
+Ġw op
+Ġw agn
+Ġw iring
+al afil
+Ġin oper
+Ġin ns
+it idis
+Ġf ot
+Ġf icin
+ic m
+Ġd cis
+Ġd aps
+Ġd ada
+Ġm ous
+Ġm ges
+Ġand rag
+as ilar
+Ġre ver
+Ġh och
+Ġh xl
+ul op
+Ġn fa
+Ġst k
+Ġst m
+Ġst ann
+Ġl ft
+Ġl ova
+Ġl ucas
+os y
+Ġg ant
+Ġg uss
+if ib
+ud ied
+Ġon cop
+ch olic
+Ġpro qol
+Ġpro cera
+ot est
+Ġr arp
+Ġr cope
+Ġal imentary
+Ġal amar
+Ġwh odas
+ag ram
+am an
+Ġres yone
+Ġch oking
+ad one
+Ġpre n
+st art
+Ġsu ca
+rom atic
+Ġac ls
+Ġco found
+Ġnot icing
+ther ap
+Ġme ps
+Ġit a
+Ġsc aps
+Ġdi ex
+Ġinf ram
+ph ric
+Ġint ere
+Ġha pm
+ast in
+Ġab r
+Ġk os
+Ġall opathic
+ong est
+Ġinter rai
+Ġsub reg
+ans on
+ap id
+enc aps
+Ġbl x
+Ġbl ender
+Ġbl aming
+form ation
+Ġdet rusor
+Ġhy pe
+Ġpr r
+Ġpo hl
+Ġen light
+Ġen emas
+Ġover he
+Ġmeth emoglobin
+Ġdep ot
+Ġboth ered
+Ġj dm
+Ġsp x
+Ġdem rna
+Ġpost stroke
+Ġso br
+Ġtra ch
+Ġma ober
+Ġdid o
+Ġatt ent
+Ġred irection
+Ġol iv
+af loxacin
+uss ive
+ry thm
+Ġprot oty
+Ġpract ised
+Ġop ri
+Ġz ik
+Ġz hao
+Ġhem is
+Ġer d
+Ġer asm
+Ġcd nas
+Ġir ration
+Ġca ox
+Ġradi opharmaceutical
+Ġinst illed
+Ġsk ins
+br n
+br uck
+Ġsing ly
+Ġorgan elle
+arm ing
+Ġq j
+Ġprop ranol
+Ġsal icylic
+Ġsal meter
+Ġcy c
+Ġopt ode
+Ġhand ful
+Ġchem oresistance
+Ġmm h
+Ġvit re
+ocyt ometer
+Ġobserv ance
+Ġsw s
+Ġos x
+Ġconsum ptions
+bo o
+Ġdec imal
+Ġdam s
+Ġpromot ional
+Ġadjust s
+Ġartic ulate
+Ġtn fs
+Ġtraum atized
+Ġreal izing
+Ġax in
+Ġultras lim
+Ġneuro filament
+Ġmit ogenic
+Ġms k
+Ġdiss onance
+Ġkey hole
+Ġelder berry
+Ġhr cm
+Ġthromb ocytes
+Ġpc u
+Ġpc as
+Ġmes otherapy
+Ġalb iz
+Ġpharmac ovigilance
+Ġmicrob le
+Ġbro dal
+Ġcav r
+Ġip p
+Ġprec ice
+Ġadapt able
+orrh oe
+Ġaccum ulations
+Ġaccum ulative
+Ġdra fted
+Ġcolor less
+Ġpv u
+Ġrh i
+gt tc
+Ġben gal
+Ġpac ifiers
+Ġhard iness
+Ġtit led
+Ġlas ct
+Ġtransf oraminal
+Ġeg r
+Ġenter ocyte
+Ġdp cp
+Ġna uclea
+part icip
+Ġadop ts
+16 40
+Ġmedi us
+Ġrelie ves
+Ġmil estone
+Ġns r
+Ġmb ps
+Ġjud icious
+Ġmotor ized
 Ġmarginal ized
-Ġmarginal ization
-Ġenti tle
-Ġenti tled
-Ġsar vas
-Ġsar aj
-Ġsar scov
-Ġsar comas
-Ġfar s
-Ġfar ms
-Ġfar thest
-Ġ10 5
-Ġ10 18
-Ġ10 55
-Ġtrend ed
-Ġodont ostomat
-Ġodont ontocl
-Ġeurope ans
-oph or
+Ġpum ice
+19 90
+Ġpg pc
+Ġot i
+Ġevol ves
+Ġamp elopsin
+Ġdegrad es
+Ġbox ed
+Ġuter i
+Ġleaf y
+Ġreper fused
+Ġter bin
+Ġtsh oma
+Ġterminal is
+Ġpy y
+Ġappend ages
+27 4
+Ġextracellular ly
+Ġreflux ed
+Ġtf esi
+Ġtransm ucosal
+Ġbov is
+Ġcurcumin oids
+Ġrect o
+Ġpara esthesia
+Ġhex okinase
+Ġald osteronism
+30 5
+Ġhous ew
+Ġrb t
+Ġgt i
+Ġbios cience
+Ġtuberc ul
+Ġhaemat omas
+rof luor
+Ġram ifications
+rim oxazole
+Ġpic ros
+Ġbig uan
+Ġgn rha
+Ġoverload ing
+Ġcardiop rotection
+Ġbab a
+Ġbad ly
+Ġrp oa
+Ġsecret agogues
+Ġmening o
+Ġluc l
+Ġhsp b
+Ġslic er
+Ġcontrad icted
+Ġpin nata
+Ġdisinf ecting
+Ġhomogeneous ly
+rid den
+Ġecho ed
+Ġparamed ical
+Ġsarc omeric
+atiz ing
+Ġdimer ization
+Ġlaw ton
+Ġhabit ually
+Ġloos ened
+Ġgy ri
+Ġfs gs
+Ġharb in
+Ġmono hydrate
+Ġlag b
+Ġpapill oma
+Ġpapill omavirus
+Ġsj w
+Ġstrand ing
+Ġdend rites
+Ġemail ed
+Ġpj c
+Ġgather ings
+Ġester ified
+Ġtermin ator
+Ġunus ually
+Ġwitness es
+Ġinqu iries
+Ġtran qu
+Ġeps i
+Ġeps ilon
+Ġsrs f
+Ġcolonoscop ists
+Ġpq e
+Ġdq a
+Ġegf p
+Ġdiscer ned
+180 6
+Ġoxy but
+Ġbudget ary
+Ġvre t
+Ġhypop arathyroidism
+Ġophthalm ologist
+Ġsciatic a
+Ġintramuscular ly
+32 67
+Ġkcn n
+Ġprohib itive
+Ġpir nas
+Ġpend ulum
+Ġcalor imetry
+Ġmultil ocular
+Ġhsc aps
+Ġconvert ase
+Ġgang ren
+Ġpars ley
+Ġawakening s
+Ġberg en
+Ġchr cc
+Ġtad alafil
+Ġard abil
+Ġvictim ization
+Ġposter omedial
+Ġcot rimoxazole
+Ġhw ms
+Ġexcit ement
+Ġabrupt ly
+Ġexplo itation
+Ġmz y
+Ġavi ation
+Ġexcurs ions
+Ġtack ling
+Ġhpdl scs
+Ġeyeb rows
+Ġhaplo insu
+Ġqn r
+Ġnonresp onse
+Ġangio embolization
+Ġthyrot ropin
+Ġots c
+Ġglucuron idation
+Ġprioritis ation
+Ġbam boo
+eas ible
+Ġinterchange ably
+Ġtonsil lectomy
+Ġops cc
+Ġprofil er
+Ġleishman ia
+Ġleishman iasis
+Ġbarc ode
+Ġtrapez oidal
+Ġsinglet ons
+Ġnanos ilver
+Ġmicropart icle
+Ġmidf acial
+Ġferment ing
+Ġmisunder stand
+Ġmicronucle i
+Ġpiez oelectric
+Ġscant y
+Ġhdp cs
+Ġmillig rams
+Ġconvales cence
+Ġnormo albuminuria
+irit igenin
+Ġwelc omed
+Ġchamp ions
+Ġvirgin ia
+Ġnour ished
+Ġannounce ment
+Ġhotsp ots
+Ġneurofib rom
+Ġhydrod ynamic
+Ġpharmaco ec
+Ġsnow ball
+Ġzoled ronic
+Ġpant oprazole
+Ġdisaggreg ated
+Ġthermoform ing
+Ġoligodend rogli
+Ġhemoclip s
+Ġitg b
+Ġclum ping
+Ġeof az
+Ġscrip ts
+Ġcardam onin
+Ġboswell ia
+Ġnonse lective
+Ġvalv uloplasty
+Ġapne ic
+Ġsne ezing
+Ġcinnamom um
+Ġgrat itude
+Ġhamstr ing
+698 3267
+Ġinterincis al
+Ġinso far
+Ġsaik osaponin
+Ġvct e
+Ġnocicept ors
+Ġfumig atus
+Ġmississ ippi
+rinogen emia
+Ġdisartic ulation
+Ġecos ystem
+Ġagglom eration
+Ġgarc ia
+Ġgenex pert
+Ġthyl ak
+Ġnonnorm ally
+Ġvelop h
+Ġlanth anum
+Ġnors pine
+Ġenalap ril
+Ġtetral ogy
+Ġinns bruck
+Ġandrag ogy
+Ġhxl pe
+Ġdiex f
+Ġhapm ap
+Ġpropranol ol
+Ġsalmeter ol
+Ġbrodal umab
+Ġterbin afine
+Ġoxybut ynin
+3 50
+4 98
+8 53
+9 71
+b led
+c os
+e ic
+g om
+m ix
+m oidal
+n oline
+p ma
+t ls
+t reatment
+u ang
+v um
+v ari
+v ulus
+w id
+y rin
+Ġt cem
+Ġt max
+in ements
+Ġo js
+Ġc gn
+Ġc ee
+Ġp bp
+Ġw le
+Ġw ool
+Ġw brt
+it amin
+ic on
+ic tal
+ic ism
+ic ides
+Ġm age
+Ġm ases
+Ġm ads
+Ġm chc
+Ġb og
+Ġb ha
+Ġre boa
+Ġh gs
+le g
+Ġe ple
+ul ans
+Ġn ile
+Ġn idus
+Ġst ub
+om ix
+om ental
+om inal
+Ġl er
+Ġl irr
+im o
+im ps
+Ġg ru
+Ġg bc
+Ġg ye
+Ġg ulf
+ig argin
+ol ac
+un ken
+il or
+il lectomy
+Ġv ote
+Ġv zv
+Ġpro angiogenic
+od ulin
+ant ral
+Ġr st
+Ġr ales
+Ġal cl
+Ġal fentanil
+Ġwh ol
+ag gc
+ag mus
+Ġcom id
+Ġis ocratic
+am arin
+ir ide
+oc idal
+Ġinc urring
+Ġch ot
+ure ter
+ib ell
+Ġper id
+Ġper kin
+Ġle up
+Ġac anth
+Ġtw itching
+Ġare olar
+Ġbet ulin
+ard t
+we alth
+Ġinf ratentorial
+ph ys
+Ġap v
+Ġk om
+Ġk od
+Ġk ob
+ug lu
+Ġpres ident
+Ġun aff
+Ġun used
+Ġun vaccinated
+ans ion
+Ġmod ulen
+ap optosis
+Ġno va
+Ġbl end
+Ġcol orectum
+Ġpr al
+Ġpr ft
+cr imin
+Ġup load
+Ġser oma
+Ġmeth adone
+Ġunder representation
+ang a
+Ġspec ifies
+Ġtrans aortic
+cent esis
+Ġbi otrans
+Ġperi orisk
+Ġpost con
+Ġso aking
+lic d
+lic ular
+Ġtra gus
+Ġdr m
+ox anthin
+Ġdisc oid
+Ġref inements
+Ġpar ish
+Ġi el
+Ġi ep
+ok aw
+Ġcalc ulators
+Ġpe bd
+Ġinform s
+Ġhyper perfusion
+Ġprim ates
+Ġstand alone
+Ġel ana
+Ġtiss uglu
+Ġmedic o
+Ġes ld
+Ġhyp eren
+Ġhyp oderm
+Ġrep ressing
+Ġprot op
+Ġlead ed
+Ġcommon wealth
+Ġconduct s
+chn er
+Ġox o
+Ġmal asse
+ec rosis
+Ġsyn ot
+Ġvent rally
+Ġcyt or
+Ġcyt omorph
+Ġabs orptive
+Ġir rt
+Ġpoly ester
+Ġvalid ates
+Ġpsych ic
+Ġq licd
+Ġmat urational
+Ġur i
+Ġelect rop
+Ġsl pi
+Ġprop ionic
+Ġbr d
+Ġbr l
+Ġbr ussels
+Ġextra d
+Ġpan ax
+Ġchem os
+Ġorder ly
+Ġult rap
+Ġasp i
+Ġhb g
+Ġu w
+Ġplasma pheresis
+Ġcoll isions
+Ġcs vd
+Ġconcer ted
+Ġdev ise
+Ġcrit ics
+Ġtn c
+rob i
+Ġlv ls
+Ġhal ted
+Ġdil ators
+Ġenc rypt
+Ġdig luc
+ck er
+Ġcb i
+Ġtnf is
+Ġul bt
+Ġmi ra
+Ġpc pi
+Ġcycl ohex
+Ġaction able
+Ġnorm ocapnia
+Ġcatheter isation
+Ġthres holding
+Ġven ovenous
+Ġpneum on
+sa e
+Ġplant ain
+Ġfall er
+Ġnas obiliary
+Ġshock ed
+Ġpi hi
+Ġpt d
+Ġexplain able
+Ġadvant aged
+Ġnutrition ists
+Ġethn ographic
+Ġleuk oreduction
+Ġhab itu
+Ġtit rate
+Ġbed ridden
+Ġcomposition al
+Ġfr ight
+Ġaa i
+Ġcat t
+Ġequal ed
+Ġbreath lessness
+Ġneur orrhaphy
+Ġamin ophylline
+Ġdisp osed
+Ġss p
+Ġds q
+Ġds ct
+Ġdos imetry
+Ġgall ocatechin
+Ġgran atum
+Ġflav okaw
+Ġsr us
+Ġns ns
+Ġns vt
+Ġtherm ogenesis
+rig o
+Ġtib et
+Ġtgf b
+Ġah t
+Ġvul v
+Ġpn mm
+Ġlys ing
+Ġland is
+Ġneph rostomy
+Ġdecomp osed
+Ġtyp ology
+Ġresusc itate
+14 338
+arb ox
+Ġsac char
+cp f
+Ġ00 4
+Ġantagon ized
+Ġprote oglycan
+Ġbon n
+Ġvulner abilities
+Ġcn ic
+Ġcn ip
+Ġcouns ell
+Ġng m
+Ġmother hood
+25 8
+15 2
+Ġdors o
+Ġstra p
+Ġded uce
+Ġweb in
+Ġaz oles
+Ġtransverse ly
+flow er
+Ġshr imps
+Ġwc bt
+18 9
+bd nf
+Ġeq a
+Ġcx r
+Ġtl gs
+Ġdermat omal
+Ġsole us
+Ġfu wai
+Ġdd wr
+23 2
+Ġrm se
+alb avancin
+Ġimmers ive
+36 2
+Ġsun ny
+Ġdissem inating
+ora ph
+Ġdt m
+Ġbottom ed
+Ġly on
+Ġtetra acetic
+Ġingest ing
+Ġfundamental s
+Ġspot ty
+Ġplaus ibly
+Ġhv ps
+cephal y
+Ġfabric ate
+Ġsarc om
+Ġhind paw
+Ġnin j
+Ġeh ec
+Ġthi amine
+Ġcry oglobulin
+Ġum ic
+73 3
+Ġmesi olingual
+Ġmultifact or
+43 15
+Ġbh cpf
+Ġperfor in
+Ġperfor ator
+Ġhub ei
+ocyan in
+Ġlymphaden itis
+Ġbark s
+Ġcommission ing
+Ġnl h
+Ġmalt reatment
+Ġsab f
+Ġvene ered
+Ġunexpl ored
+Ġnews let
+Ġphantom s
+Ġtuber cular
+Ġmul ago
+Ġlun ate
+Ġhi ros
+Ġtz ds
+Ġccc ds
+Ġhypom ethylation
+Ġuh cc
+Ġdestro ying
+Ġautonom ously
+Ġinterven ed
+Ġgx st
+Ġeuc lide
+Ġgil bert
+Ġprohib ition
+Ġretard ed
+Ġimpuls es
+Ġmicrof ract
+Ġsubf amily
+Ġquin idine
+Ġmicrostruct ural
+Ġfz m
+Ġbull ied
+Ġahr r
+Ġbioeth ical
+Ġforget fulness
+Ġtript orelin
+Ġenerg etic
+Ġptl bw
+jug ular
+Ġguan osine
+Ġpeculiar ities
+Ġmiscon ception
+Ġnyst agmus
+Ġforum s
+Ġautumn ale
+Ġafe brile
+Ġneurodevelop ment
+Ġdyn ap
+Ġrosmarin us
+Ġfoet uses
+las mic
+Ġdecap itated
+Ġanis otropy
+Ġsulfonyl ureas
+Ġathle te
+Ġannounce ments
+Ġgogg les
+Ġmoistur izing
+Ġsafeguard ing
+Ġhypof unction
+Ġherm ene
+enzym es
+Ġgerani ol
+Ġaeg le
+Ġmarm elos
+Ġhypervir ulent
+Ġresurf acing
+Ġyar row
+Ġnanom ater
+Ġkins hasa
+epi and
+Ġileocolon oscopy
+Ġchym ase
+Ġbik ram
+Ġsint ered
+Ġsubfert ility
+Ġthaps igargin
+Ġrath l
+Ġdipept idyl
+imension ality
+Ġbeet root
+Ġshou wu
+Ġinterlock ing
+Ġgenec ards
+Ġnai robi
+Ġbioim ped
+Ġcarcino embryonic
+Ġcapec itabine
+Ġmulticomp onent
+Ġatro gin
+Ġapople xy
+Ġdermatophyt osis
+Ġautod ock
+Ġciel ab
+Ġsobr inus
+Ġzik v
+Ġerasm us
+Ġpicros irius
+Ġeple renone
+Ġencrypt ed
+Ġflavokaw ain
+Ġpnmm vd
+Ġeuclide an
+4 18
+4 73
+9 00
+9 18
+a ire
+a peut
+b ian
+f rom
+f ill
+h et
+i en
+i ens
+n cs
+p ite
+v nc
+z f
+Ġt pr
+at ellar
+Ġo cr
+Ġo wed
+er ty
+Ġp orter
+it ril
+Ġf ost
+ic ability
+or os
+or ized
+or oside
+Ġd albavancin
+is cus
+Ġb um
+Ġb red
+Ġre organ
+Ġre bu
+Ġre amer
+Ġh ud
+le lic
+Ġe oc
+us ate
+Ġn ipp
+Ġn pls
+Ġn inted
+Ġst ark
+ur ines
+Ġl th
+Ġl ms
+Ġl br
+Ġl anz
+et ting
+ly l
+os ced
+os quamous
+im olar
+im azole
+Ġg ore
+Ġg ose
+Ġg ren
+Ġg ks
+Ġg bi
+Ġon ko
+el an
+Ġv ot
+Ġv fs
+Ġv ta
+ant ation
+ot ential
+Ġr tha
+ag gl
+ag aa
+Ġis ointense
+um az
+am oto
+am ibi
+Ġres ampling
+est an
+qu ick
+Ġat opy
+Ġse bdnf
+Ġind ifference
+Ġnot or
+pe p
+ph enyl
+Ġha ip
+Ġaf c
+Ġaf w
+Ġap yr
+Ġap sae
+Ġab vs
+Ġk tw
+Ġcan celed
+ance ment
+Ġpl ung
+Ġpl wd
+Ġinter cal
+Ġinter class
+Ġinter body
+Ġrec ol
+Ġrec ursive
+Ġun reg
+Ġun labeled
+Ġcons angu
+Ġsub thalamic
+Ġam os
+Ġacc ra
+Ġy chd
+Ġbl o
+Ġbl urring
+erm an
+Ġcol gate
+Ġcontrol ler
+Ġpo und
+Ġpo uring
+ile y
+Ġund eni
+Ġser ositis
+Ġte pt
+Ġte ps
+Ġunder inflation
+Ġra il
+Ġra gs
+Ġdiagn odent
+ang in
+Ġtrans venous
+Ġnon pharm
+ros terone
+cent age
+int ang
+Ġinfl ict
+Ġem esis
+Ġpost d
+Ġpost ext
+Ġmult it
+Ġtotal s
+Ġmin uta
+Ġpar ane
+Ġpar aker
+Ġi ua
+Ġfl umaz
+Ġatt est
+Ġet ac
+Ġgra vit
+Ġfollowing s
+ov is
+ov ision
+Ġes icm
+Ġic aa
+Ġret rans
+Ġadj o
+Ġop rm
+Ġoper on
 oph aryn
-oph obic
-oph obia
-oph leb
-Ġreconstr uct
-Ġreconstr ucting
-Ġcolle gians
-Ġguide book
-Ġleuk emia
-Ġleuk oar
-Ġoperator ies
-opl anin
-Ġoffic er
-Ġoffic ially
-Ġmg cl
-Ġpromo tive
-Ġacqu ires
-Ġacqu aint
-Ġacqu ainted
-Ġ12 3
-Ġ12 7
-Ġ12 00
-Ġ12 80
-Ġ12 62
-Ġgrade pro
-Ġviol in
-Ġviol ated
-Ġviol ating
-Ġincorpor ations
-the iss
-Ġindepend ents
-Ġillustr a
-Ġillustr ator
-Ġchlorhexidine in
-Ġfal ter
-Ġabr ade
-Ġarr hy
-Ġsubstanti ates
-Ġsubstanti vity
-Ġcoefficient in
-Ġcost a
-Ġcost ly
-Ġmd t
-Ġann ouncing
-Ġann ihilator
-Ġann oyance
-Ġmc af
-Ġmc erebr
-Ġmc clish
-Ġmc bride
-otoxic ities
-Ġchi u
-16 3
-16 5
-Ġga a
-Ġga ik
-Ġshe han
-Ġprin ce
-Ġsuperim posable
-ble eds
-alle bne
-atin ics
-Ġgain za
-Ġsept ation
-back a
-Ġcn y
-orph ic
-Ġbal samin
-Ġlact am
-Ġwil ks
-Ġwil mes
-Ġconver ts
-Ġconver ter
-Ġconver ge
-Ġconver ging
-Ġconver ters
-Ġparalle led
-Ġparalle ls
-Ġattend s
-Ġattend ant
-Ġattend ers
-Ġanswers for
-Ġasymm etries
-Ġmanifest ing
-Ġglobal ization
-aries lesion
-Ġlymph otox
-Ġlymph oblastic
-Ġlymph openia
-Ġlymph oplasm
-Ġlymph ovascular
-Ġprop els
-Ġprop ensities
-Ġprop anol
-Ġprop ulsion
-Ġprop ylene
-Ġprop enen
-Ġprop ionibacterium
-Ġdeb t
-Ġqual trics
-Ġameric as
-Ġtransm its
-Ġtransm uted
-Ġtransm issibility
-bal ancing
-bal jevic
-Ġsd a
-Ġsd g
-Ġsaf est
-Ġsaf ran
-Ġinj ure
-Ġinj uring
-Ġmig rants
-Ġscrew ing
-Ġscrew dri
-Ġcm b
-Ġcm v
-Ġrev o
-Ġste er
-Ġste ered
-Ġste enberg
-Ġste iner
-Ġste ffens
-Ġste adier
-Ġstem ness
-Ġstem med
-Ġcogn izant
-Ġbeg ets
-Ġmicrole vel
-Ġsummar izing
-Ġsummar ising
-Ġrepro cessing
-Ġtogether ness
-Ġsubm itting
-Ġsubm enu
-Ġsubm alnutrition
-Ġsubm illimet
-Ġemp athic
-Ġemp athy
-Ġemp athetic
-Ġemp yema
-Ġemp athized
-Ġmortal ities
-Ġcapt ures
-Ġepidem ics
-Ġgut ter
-Ġgut enberg
-Ġgut taper
-10 3
-Ġcall ao
-Ġcall osum
-Ġlat ches
-Ġacute ly
-Ġtherapeutic ally
-Ġinjur ious
-tes man
-Ġcc ts
-Ġcc agggt
-Ġrestric tive
-Ġweak ly
-Ġweak est
-Ġbasic ranial
-Ġcentrifug ated
-Ġcentrifug ating
-Ġcv c
-Ġhere tofore
-Ġcarcin osis
-Ġcarcin ogens
-Ġcarcin omatous
-Ġarab ian
-Ġreproduc es
-Ġreproduc tion
-Ġcore ceptor
-Ġstomat ologists
-Ġstomat otoxicities
-Ġoverl ay
-Ġoverl aid
-Ġoverl aying
+Ġnew t
+Ġca ai
+Ġpa z
+Ġcle ave
+Ġdys rhythm
+Ġml l
+Ġml fs
+Ġadd icted
+Ġtak ayasu
+Ġbeha ved
+Ġq ca
+Ġstruct uring
+Ġhand ball
+Ġda o
+Ġmass ively
+Ġbias p
+omic in
+Ġsw an
+Ġdec iles
+Ġhb lc
+ns ylv
+Ġver n
+Ġbar rett
+Ġtraum atology
+Ġhome care
+Ġback up
+Ġreal ise
+Ġenvironment ally
+Ġhs mr
+Ġder anged
+Ġneuro active
+Ġpd li
+Ġiv h
+Ġta ich
+Ġbil omas
+Ġrad ar
+Ġrev ising
+Ġlesion ed
+az d
+Ġplot ter
+Ġcop ious
+Ġgu anine
+uk i
+uk es
+Ġthromb ocy
+pa ired
+Ġpal ates
+Ġalb um
+Ġalb ania
+oh um
+Ġlay ing
+Ġce ac
+Ġemot ive
+Ġport os
+Ġlat rines
+Ġana emic
+Ġmc ma
+Ġip ls
+Ġmg a
+Ġfluor ine
+Ġfav ours
+Ġprec uneus
+Ġforce ful
+roc ardia
+Ġped ro
+Ġconstruct ivist
+Ġmel it
+Ġ19 50
+Ġpt bi
+hyd ryl
+Ġpen nsylv
+Ġht w
+Ġbio aut
+Ġcarb onic
+Ġmis jud
+Ġtit res
+Ġfil ed
+Ġck i
+Ġchlor op
+Ġpediatric ian
+Ġcro cin
+Ġss me
+Ġss be
+Ġpept idog
+Ġlt f
+Ġelectro ca
+Ġurban ized
+Ġns m
+Ġstop watch
+Ġln d
+Ġbcl p
+Ġlc m
+Ġgraph ene
+Ġcorrespond ent
+Ġmor ally
+17 6
+Ġmelan ocyte
+oret ically
+Ġmineral isation
+Ġsuppress ors
+Ġpg r
+Ġfoot wear
+Ġlob ene
+Ġsulf onic
+Ġsulf hydryl
+Ġprogress ors
+arb azine
+Ġtet anus
+iform is
+Ġpad ma
+Ġembry onal
+Ġcord yce
+15 5
+Ġdors ally
+Ġinoc ulate
+Ġinoc ulating
+Ġundert reatment
+Ġerad icating
+Ġae le
+Ġtransm ittance
+Ġded ifferentiation
+Ġdegen erated
+Ġeq tls
+Ġcatal og
+Ġcatal yst
+Ġdermat ome
+Ġgranul omatosis
+Ġrb ps
+Ġham is
+Ġfu j
+Ġnig ra
+Ġcrypt oxanthin
+rof iban
+Ġgeriatric ians
+Ġsubc apsular
+Ġconfident ly
+Ġcus a
+Ġhct z
+Ġcollabor ated
+Ġpear ls
+Ġsarcop lasmic
+Ġsun itinib
+Ġhypers plenism
+Ġasd amarin
+hi kawa
+Ġconv olution
+Ġcircumf erentially
+Ġspectrom etric
+Ġcef alexin
+Ġration ality
+Ġcognition s
+Ġbrux ist
+Ġvast ly
+Ġanter ograde
+Ġmitig ates
+Ġretin oblastoma
+Ġoverestim ates
+Ġoverd oses
+Ġwealth y
+Ġthyro xin
+Ġirrit ating
+Ġsct o
+Ġpoison ed
+Ġclav ic
+Ġcoexist ent
+Ġdext rocardia
+Ġfrag ilis
+Ġreform ulated
+Ġpj nk
+Ġdiscol ored
+Ġglycer in
+Ġsulph onyl
+Ġrose a
+Ġabl ations
+Ġze us
+Ġmth a
+Ġfus iform
+Ġguarantee ing
+Ġresum ing
+Ġ199 2
+Ġoval bumin
+Ġspeak s
+Ġpunct uring
+Ġmicrog raph
+Ġgrand e
+Ġgrand io
+Ġboost ed
+Ġvh vs
+luor o
+jejun al
+Ġeph rina
+Ġscratch ed
+Ġfibros ure
+Ġpreschool ers
+Ġmicrom et
+Ġgloss ary
+yan ide
+Ġhydroly zing
+but y
+Ġcz a
+Ġcalm odulin
+Ġprevail ed
+Ġreferen ts
+Ġhyperm ethylated
+Ġlis argine
+Ġinvari ant
+Ġmek elle
+Ġperiv entricular
+Ġwst p
+Ġncr nas
+Ġautoreg ulatory
+Ġ150 1
+Ġquen ched
+Ġvasoconstrict ive
+Ġpsychoeduc ational
+orient ed
+Ġparv ifolia
+Ġslip a
+Ġsie ve
+Ġembra cing
+Ġupg raded
+Ġsest amibi
+Ġdun n
+Ġlux ation
+Ġunid irectional
+Ġrefresh ed
+Ġrepress or
+Ġtrapez ius
+Ġunderdi agnosis
+Ġtroph oblast
+Ġhbr as
+Ġnur ser
+Ġepoch s
+Ġnir is
+Ġshrs p
+Ġunbl inding
+Ġisat idis
+Ġenqu iry
+Ġsonograph er
+Ġsomn ifera
+Ġerupt ions
+Ġther more
+Ġhexa phylla
+Ġlymphang itis
+Ġgaug es
+Ġearning s
+Ġureapl asma
+Ġdib il
+Ġinterl obular
+Ġlicens ing
+Ġayurved a
+Ġgies sen
+Ġphy co
+ophthal m
+Ġuntrans lated
+Ġandre ws
+Ġvall ate
+achy us
+Ġerythroderm a
+Ġnephro protective
+reli osis
+178 78
+Ġlq ts
+Ġmacrost achyus
+Ġnaps i
+Ġaccre ta
+Ġspat ula
+Ġcochin chin
+Ġcystaden ocarcinoma
+Ġyct d
+Ġhul c
+Ġarthro centesis
+Ġdichlorodi hydrof
+Ġantisp asm
+Ġdehydro epiand
+Ġparaple gia
+Ġsala am
+Ġoxidore ductase
+Ġtheat res
+Ġmaober ry
+Ġqj mm
+Ġultrap ure
+Ġninted anib
+Ġapyr ase
+Ġflumaz enil
+Ġpennsylv ania
+3 26
+7 50
+7 44
+c roft
+d osteronism
+j ab
+m ate
+m esis
+s ignificant
+t ations
+u oka
+z ig
+Ġt de
+Ġt rophic
+Ġt ik
+in atory
+in arily
+Ġa osp
+Ġa ke
+Ġs elling
+Ġo estradiol
+er iatric
+Ġc iz
+Ġc bs
+Ġp ays
+Ġp np
+Ġw z
+Ġw ch
+Ġin ermis
+Ġof loxacin
+Ġf nt
+Ġf anta
+Ġf ringe
+or o
+Ġd are
+Ġd np
+Ġm ile
+Ġm itis
+Ġm oph
+Ġm be
+ent eration
+Ġre ductive
+Ġre ju
+ct gc
+Ġh ag
+Ġh ph
+Ġh oly
+Ġh iseq
+us c
+Ġn ace
+Ġn br
+Ġn ru
+Ġn ns
+Ġst umps
+om oly
+et en
+Ġg is
+Ġg om
+Ġg ec
+Ġg ck
+Ġg ambia
+ol ink
+Ġas r
+ud es
+un ci
+Ġon ward
+ect ic
+Ġex enteration
+Ġr or
+Ġr itual
+iv ism
+ist ent
+Ġres ides
+Ġor ph
+Ġor chi
+op oul
+Ġus g
+Ġch ores
+qu eness
+Ġat od
+Ġat ony
+Ġat rophied
+Ġcomp ilation
+og a
+ad utide
+Ġpre lact
+Ġsh ips
+Ġsh oot
+ip a
+Ġcont usions
+Ġcl ab
+ard ic
+ard rop
+Ġsc all
+Ġsc out
+Ġsc ram
+Ġfo veolar
+Ġk bs
+Ġall otted
+Ġev an
+Ġob c
+Ġrel ay
+Ġrec r
+Ġam gen
+Ġam ls
+Ġam ilor
+Ġno on
+Ġpos ited
+Ġgen ial
+Ġant ivir
+Ġbl m
+Ġtest icle
+Ġro ber
+Ġcr lm
+cr t
+Ġext ir
+Ġup to
+Ġdes at
+Ġund ue
+Ġman ik
+ass ing
+ject ive
+Ġra inf
+Ġactiv a
+vent ions
+ail ed
+Ġtrans ped
+Ġtrans jugular
+cent ration
+Ġbi ophysical
+Ġj acks
+Ġend ole
+Ġdist racted
+Ġdist ractor
+Ġem issions
+eth re
+lic is
+Ġdevelop er
+Ġgl ance
+Ġmult ires
+Ġmult iform
+Ġli ly
+anc a
+Ġi om
+amm ary
+yn ch
+Ġprim ordial
+Ġet na
+other apeut
+Ġol er
+ov ic
+Ġav uls
+Ġes kd
+Ġprot ozoa
+Ġep clin
+Ġcommon alities
+Ġmy omectomy
+Ġimmun oprecip
+Ġz rp
+Ġz pi
+Ġmal tes
+Ġhem atin
+Ġmicro elect
+Ġcyt o
+Ġcyt ologic
+Ġrat kr
+Ġhum il
+Ġcle aves
+Ġfac c
+Ġbm g
+Ġrest rain
+Ġml p
+Ġlip ocal
+Ġur anyl
+Ġcommun is
+Ġbr k
+Ġbr ill
+Ġsal cam
+Ġopt ing
+Ġinstr on
+Ġposition er
+Ġvit r
+Ġoste orad
+Ġble bbing
+Ġcirc ulated
+Ġsw ings
+Ġmuc ins
+Ġhb cab
+Ġwa als
+Ġcm p
+reg on
+Ġupper most
+emi ology
+Ġphosph omoly
+Ġretros pect
+Ġcommit ting
+resp ectively
+Ġsa ethre
+Ġthick est
+Ġimplement ations
+Ġreal istically
+Ġdown st
+Ġspecial ities
+Ġaccept s
+Ġiv sd
+Ġhc q
+Ġhc fc
+Ġpp o
+Ġhydro flu
+Ġeas l
+Ġangi omy
+Ġkid screen
+Ġnucle ated
+Ġx ie
+Ġgu i
+Ġgu atem
+Ġthromb oxane
+Ġbiom edicine
+Ġdiv is
+Ġmes orectal
+Ġalb anian
+Ġann uloplasty
+ereb ellar
+Ġacqu aint
+Ġaden otons
+Ġaden osquamous
+Ġcox ib
+gi ans
+roc aine
+inf ect
+Ġtm b
+Ġconsult ative
+Ġge ometries
+Ġsd at
+Ġten ax
+Ġminim us
+Ġpm ta
+Ġfd k
+Ġdigital ization
+Ġrh od
+Ġcyst c
+Ġoccup ies
+Ġphot oc
+yg otic
+Ġfr utes
+Ġpol licis
+Ġcat gut
+10 8
+ye o
+Ġna hs
+Ġfar ther
+Ġnan of
+Ġds ns
+Ġfix ated
+Ġci om
+Ġimmunohist ological
+Ġom fss
+Ġtt ty
+Ġgovern orates
+Ġvag otomy
+Ġpf as
+Ġfal con
+Ġsir nas
+22 29
+22 92
+Ġpilot ing
+Ġgut t
+irc ulation
+isc ences
+Ġsac cha
+Ġwr ight
+des pite
+enz a
+Ġter penoid
+Ġ13 3
+Ġsud s
+Ġva es
+Ġnp acer
+Ġeb mt
+Ġrecall ing
+Ġplasm acyt
+Ġmds cs
+Ġcartil aginous
+Ġaz o
+Ġamel ogenesis
+Ġdimin utive
+Ġscrew ed
+Ġantif ib
+Ġantihypert ensives
+Ġdw p
+Ġlh x
+45 88
+Ġef p
+28 8
+Ġextr athyroidal
+Ġacetyl cysteine
+Ġscal ers
+Ġcrani opharyn
+Ġpall iation
+Ġbad l
+Ġsun flower
+57 6
+Ġconv ulsion
+Ġlb de
+Ġglycos yl
+Ġeh ra
+Ġdebr ided
+Ġfibroblast ic
+Ġthi ocyanate
+Ġrub bed
+Ġbit ters
+oli us
+Ġmim icked
+Ġcoc r
+Ġws r
+Ġharb ors
+Ġcontamin ating
+Ġtab ular
+Ġcul otte
+63 2
+Ġmib s
+Ġtunnel s
+ovir al
+Ġgar cin
+Ġtrypsin ization
+Ġcommission ed
+Ġcream s
+Ġsubtract ive
+Ġsati vum
+Ġapt g
+Ġapt amers
+Ġtrem ors
+Ġpark er
+Ġhop es
+opoly mer
+Ġosseoin tegrated
+Ġvl bw
+Ġthiop urines
+Ġmag azines
+Ġlyophil ization
+Ġdispatch es
+Ġcaf s
+Ġlit ig
+Ġwatch ful
+Ġcompetitive ly
+Ġash amed
+endor ff
+Ġcere vis
+Ġterat ogenic
+Ġcae bv
+Ġquin ic
+Ġcem ri
+orh odamine
+Ġevd ri
+Ġrhabdomy osarcoma
+Ġcatalyz e
+Ġmushroom s
+Ġcot adutide
+Ġcele br
+Ġlign an
+Ġlump ectomy
+Ġlx rs
+Ġkir by
+Ġhyperther mic
+Ġcopt idis
+Ġrug ae
+Ġept b
+Ġbasket ball
+Ġtot ality
+Ġcorpor a
+Ġechinocand ins
+Ġimmunopos itivity
+Ġfid uc
+Ġmisf it
+Ġparat y
+Ġozon ized
+Ġprivile ged
+Ġpione er
+Ġrfvi ia
+Ġdeoxyrib onucleic
+Ġrain y
+Ġmultivit amin
+oren ce
+Ġhamart oma
+Ġredirect ed
+Ġorchid ectomy
+Ġplast ibell
+argin ine
+Ġfarnes yl
+Ġpectoral is
+Ġcapilla roscopy
+Ġcerebro lysin
+Ġym rs
+enf eld
+Ġoversh adow
+Ġhydroper oxides
+Ġteleph onic
+Ġlfc n
+akt iv
+Ġcrus ade
+Ġtransloc ates
+Ġhemiple gia
+Ġforn ix
+Ġverruc ous
+Ġcels ius
+Ġencro achment
+iaph ragmatic
+Ġhawth orne
+Ġdemyelin ating
+Ġdevascular ization
+paren ts
+Ġariz ona
+Ġrafs anjan
+ilet to
+Ġpalom ino
+Ġhydroxytrypt amine
+Ġdaps one
+Ġstann ous
+Ġchot zen
+Ġmalasse zia
+Ġonko aktiv
+Ġgravit ational
+Ġportos ystemic
+Ġdehydroepiand rosterone
+Ġaosp ine
+Ġreju ven
+Ġprelact eal
+Ġamilor ide
+Ġmanik ins
+Ġmaltes e
+Ġlipocal in
+Ġosteorad ion
+Ġhydroflu oric
+Ġguatem ala
+Ġfrutes cens
+2 80
+7 17
+9 50
+a j
+b es
+c z
+g ulation
+j amin
+k w
+o ise
+p res
+p rep
+r orrh
+r iform
+t ability
+t omy
+y ositis
+z adeh
+in hibition
+Ġa res
+Ġa vers
+Ġth ada
+on oids
+Ġs art
+Ġs io
+Ġs qol
+Ġs aves
+Ġs izable
+Ġo mental
+Ġo regon
+er um
+Ġc ne
+Ġp eter
+al ae
+Ġan oxic
+Ġan astro
+or f
+Ġd ct
+Ġd nas
+Ġd gc
+Ġm j
+Ġb illed
+as udil
+an oic
+ing er
+Ġh omic
+Ġh oa
+le u
+Ġe gta
+Ġto k
+Ġto co
+Ġn ib
+Ġn avy
+Ġl az
+im ony
+Ġg fs
+id ial
+ati les
+Ġas an
+un it
+un ya
+il oxane
+ra h
+ow er
+Ġv end
+ch oric
+ter y
+ot ency
+Ġr ars
+Ġr studio
+Ġal iph
+ag ga
+am ptic
+Ġde an
+est ock
+Ġch ained
+Ġch cs
+Ġch ai
+Ġcomp omer
+Ġse cl
+og onia
+Ġad duct
+Ġpre cis
+Ġsh ields
+Ġare ata
+Ġco factors
+pl j
+Ġit opride
+Ġne xp
+Ġanal g
+Ġsc v
+Ġha k
+Ġap amin
+Ġap rot
+Ġap ico
+Ġab ic
+Ġk iv
+Ġk ell
+Ġk oss
+Ġk ja
+Ġk uala
+Ġob a
+Ġpl v
+Ġeffect ed
+Ġun rip
+ill ion
+ill ous
+Ġthere in
+Ġph aryn
+Ġy d
+Ġy onse
+Ġy yeo
+all erg
+Ġen am
+Ġext ant
+Ġdes icc
+Ġund ec
+Ġte k
+Ġassess able
+cc i
+Ġman ova
+ang el
+Ġtrans nasal
+Ġbi ann
+Ġperi oral
+Ġj f
+Ġsp ice
+Ġstr iated
+Ġdem ol
+Ġsm f
+Ġsm elling
+Ġadm ira
+Ġcal r
+Ġcal ming
+Ġcal cein
+Ġbas olateral
+Ġsym pathy
+Ġi els
+Ġed hf
+av ia
+Ġfl orence
+Ġred esign
+Ġif m
+Ġmic romechanical
+ian one
+Ġextract able
+Ġliv estock
+af ety
+Ġinvest ing
+ont ia
+ont ium
+Ġps as
+Ġhyp oproteinemia
+Ġic ar
+Ġic bp
+Ġloc f
+erg ents
+Ġpract icable
+Ġset tling
+Ġz oon
+Ġvol vulus
+Ġvol atiles
+Ġprof iled
+Ġmal i
+Ġmal ta
+oph ysis
+Ġacid ified
+Ġcd ad
+Ġca ii
+Ġsk y
+Ġtak o
+Ġec ds
+co hort
+Ġorgan ising
+Ġq set
+Ġsl ips
+Ġbr un
+Ġbr uce
+Ġbr ittle
+Ġmen a
+Ġcolon ize
+Ġcirc nf
+Ġdm pp
+Ġconc ussion
+Ġcompound ing
+Ġaccess ories
+Ġskin fold
+Ġunderstand s
+Ġheter o
+Ġcp rd
+rob asilar
+Ġapproxim ates
+Ġak s
+Ġhs pm
+Ġder otation
+Ġbra vo
+Ġpolym yositis
+Ġaccept or
+Ġiv im
+Ġmit ophagy
+Ġpp a
+Ġhal ved
+Ġig b
+Ġtop ographical
+Ġspect rofluor
+ule oside
+az i
+Ġcop a
+Ġx o
+Ġobject ion
+Ġgu ill
+Ġgu ava
+Ġul k
+Ġmi y
+Ġthyroid al
+Ġcho i
+Ġfit more
+Ġnorm ocal
+Ġultrasound s
+lo u
+Ġmc at
+Ġip q
+Ġchrom ophore
+Ġtb ad
+Ġ19 87
+Ġmix er
+Ġsubstant ia
+Ġpass word
+Ġpet ro
+Ġoh b
+Ġcarb ons
+Ġsten oscore
+Ġbed ding
+Ġlas i
+Ġ12 6
+Ġmp cr
+Ġnm osd
+Ġneur oradi
+Ġdirection ality
+Ġcumulative ly
+Ġrob ins
+Ġreh ear
+Ġdisp ute
+Ġtransform s
+Ġtransform ative
+Ġhemorrh oidal
+Ġfer n
+Ġtt v
+eryth rin
+Ġdu wls
+Ġlt t
+Ġparal ytic
+Ġvag in
+Ġmb is
+Ġmb ar
+Ġft ms
+Ġinsp ector
+Ġinsp ecting
+Ġuni queness
+Ġstop p
+Ġrol led
+ril ateral
+Ġtail s
+Ġpn ft
+Ġsac roc
+Ġhost ile
+Ġhm bc
+Ġpod ocalyx
+Ġregen eten
+Ġts gh
+Ġts ubo
+Ġverteb robasilar
+Ġquad rilateral
+Ġpy d
+Ġbul ang
+Ġremark s
+Ġjaw bones
+Ġnp dr
+Ġdh fr
+27 1
+Ġband wid
+Ġtf pb
+Ġinhal ers
+Ġsubstit utive
+Ġae he
+Ġmicroc occus
+Ġaz ino
+Ġtrip art
+Ġpara protein
+Ġcough s
+30 1
+Ġexch anger
+Ġexch anging
+Ġfc plj
+Ġlept ospira
+Ġnig ella
+Ġbic on
+rof ol
+Ġtransp osed
+Ġmotiv ators
+Ġpic f
+Ġdorsal is
+Ġnos va
+Ġih cs
+Ġregurg itant
+Ġmultip ly
+Ġblank ing
+Ġhcm ec
+Ġsirt uin
+Ġlr c
+cha ft
+Ġureter oscopy
+Ġconnect ors
+Ġinterc ondylar
+Ġuro flow
+Ġuro therap
+Ġpaw p
+Ġsan ics
+Ġfasc icle
+Ġti rofiban
+Ġrom an
+Ġbiomechan ically
+Ġtann ic
+Ġicc dm
+Ġrip asudil
+Ġascorb ate
+Ġsilic osis
+Ġwet tability
+Ġimmunore gulatory
+Ġqi ime
+Ġthyro mental
+stand ard
+Ġdiagnost ically
+Ġinfra renal
+Ġcannab in
+Ġphyl ogen
+Ġhyperch olesterol
+Ġreject ing
+Ġrecon cil
+Ġpiece meal
+Ġemotion ality
+Ġesc uleoside
+Ġdial og
+Ġfibro ather
+Ġmisdi agn
+Ġalex ander
+Ġtam il
+Ġlved vi
+Ġcancell ations
+Ġurolog ists
+Ġdeh iscences
+Ġfis cher
+Ġgynaec ologic
+Ġprecon ceptions
+Ġhyperal dosteronism
+Ġobl ong
+Ġadvis or
+ili aries
+Ġhern iated
+Ġsant orin
+Ġarc uate
+Ġtx nip
+Ġspermat ogonia
+Ġdensit ometer
+Ġadp j
+Ġlent ulo
+Ġpick s
+Ġlaws onia
+Ġspin ning
+Ġaux iliaries
+Ġpcl s
+Ġdod oma
+Ġophthalm ologists
+pie ces
+Ġperpet uate
+mann in
+Ġapc n
+Ġmultil ocus
+Ġprefect ural
+gh ini
+Ġnaturo pathy
+Ġnoradrenal in
+Ġedit ors
+Ġog ib
+Ġtoile ting
+Ġpax gene
+Ġnegot iations
+Ġobliter ated
+meth acrylate
+Ġmesio angular
+Ġhosp ira
+Ġexagger ate
+Ġamygd alin
+Ġexplo it
+ishman ial
+Ġdemir na
+Ġgeneralis able
+benz oic
+Ġpom ace
+Ġdess ie
+Ġhur dle
+Ġsaff e
+Ġnanoem ul
+Ġinvag inated
+Ġbuff y
+Ġyemen i
+Ġeic osapentaenoic
+Ġmalle olar
+sulf onyl
+Ġtut ors
+ococc osis
+Ġtrin it
+Ġalkyl ating
+Ġreevalu ation
+Ġreevalu ated
+Ġasiatic oside
+Ġviv ax
+Ġlov o
+Ġbrin z
+Ġtay lor
+yce al
+Ġcym enol
+Ġwort mannin
+Ġinterrelations hips
+Ġmog ct
+Ġunve iled
+Ġnanog el
+Ġpaus es
+Ġdiz ygotic
+Ġstrychn ifolia
+andard ized
+Ġanz hen
+Ġsubord inate
+Ġindis crimin
+Ġsang on
+Ġpreoccup ation
+Ġantile ishmanial
+Ġlegion ella
+Ġosteocon ductive
+Ġthoraco abdominal
+Ġhandoff s
+Ġlvs v
+Ġsomal i
+Ġcrib riform
+Ġjian cheng
+Ġnoncompl iance
+Ġtinct ure
+Ġhypertriglycerid aemia
+Ġmyelosupp ression
+Ġcuve tte
+Ġaast re
+Ġperiimplant itis
+Ġcathelic idin
+Ġyth df
+Ġclabs i
+Ġwagn er
+Ġinoper able
+Ġoncop lastic
+particip ants
+Ġmisunderstand ings
+Ġpostcon ditioning
+Ġhyperen h
+Ġconsangu inity
+Ġthrombocy themia
+Ġmelit ensis
+Ġchlorop rocaine
+Ġelectroca ut
+Ġclavic ulae
+Ġphyco erythrin
+Ġorchi ectomy
+Ġjacks crew
+Ġcraniopharyn gi
+Ġcerevis iae
+Ġosteoradion ecrosis
+Ġanastro zole
+Ġdgc v
+Ġaliph atic
+Ġunrip e
+Ġyonse i
+Ġqset e
+Ġcircnf ib
+Ġpodocalyx in
+2 12
+a q
+g p
+g otinib
+m and
+n x
+r ion
+z ii
+Ġt ul
+Ġt ch
+Ġt als
+Ġa al
+Ġa uric
+Ġa hei
+re ating
+at isation
+at tc
+Ġs so
+Ġs ask
+Ġthe ore
+Ġo wi
+er se
+Ġp ere
+it ration
+Ġf ff
+or olac
+Ġd ag
+Ġd row
+Ġd js
+Ġm ph
+Ġm pla
+Ġb ug
+as ion
+as ser
+as cus
+Ġre occ
+ct ic
+Ġh wf
+Ġe am
+Ġto en
+us on
+ul cer
+ur ization
+Ġg te
+ig ence
+Ġon lays
+ut able
+Ġv gs
+Ġr iton
+Ġwh oles
+oc ative
+oc olic
+Ġde phosphorylation
+iz ole
+Ġim bra
+Ġad ef
+Ġpre cut
+Ġper imetry
+Ġsu ita
+ip es
+ip zig
+Ġle ipzig
+Ġass emble
+Ġac ron
+Ġac acetin
+ay ered
+Ġdis g
+Ġdis gt
+pl asm
+vel and
+ther apeutic
+ard ially
+we aver
+ph arma
+ary ll
+Ġsize able
+Ġfo e
+ich roma
+Ġk dm
+Ġtr il
+Ġreg ressing
+Ġrec ompensated
+Ġun man
+Ġam aryll
+pro pan
+ath a
+Ġout lying
+Ġexp ended
+Ġy jt
+Ġy azd
+ren s
+Ġar rythm
+Ġcol aus
+Ġpr rt
+ub itril
+Ġcr ater
+Ġext ub
+Ġup p
+vent ral
+ep in
+Ġperi ampullary
+Ġmethod ologic
+Ġchar ity
+Ġpop ulous
+ograph ics
+Ġma ur
+Ġma hal
+ms cs
+Ġbas elines
+ish i
+Ġcar away
+Ġatt un
+Ġphys ics
+Ġhyper nat
+Ġif s
+Ġins ects
+Ġmort ar
+ov o
+Ġic ans
+Ġintra renal
+Ġmy openia
+Ġline weaver
+Ġoper able
+Ġmal app
+Ġpa iring
+Ġradi od
+Ġcur ability
+Ġcle veland
+Ġpsych oses
+Ġprom is
+Ġmus a
+Ġlip omas
+Ġaut ov
+Ġsl ab
+Ġcy pro
+Ġplace bos
+orph one
+onal d
+Ġmen ghini
+Ġmm cs
+Ġda egu
+Ġher o
+Ġmr ps
+omic roscopy
+ored oxin
+Ġunt argeted
+ax omicin
+Ġos ter
+Ġwater tight
+Ġhb ig
+Ġsequ alae
+Ġconc urrence
+Ġvir id
+Ġib at
+Ġib adan
+Ġcm m
+Ġmot ive
+Ġvas o
+Ġod b
+Ġsa ag
+Ġdetect ors
+Ġback ed
+Ġcentral ization
+Ġak lm
+Ġnet tle
+Ġutil izers
+Ġlv dp
+Ġdil ations
+Ġta xi
+Ġtop ology
+Ġms ds
+Ġrepl ications
+Ġrepl antation
+Ġproduction s
+bp c
+Ġenc ir
+Ġsusp end
+Ġcop ings
+Ġcb v
+Ġx ue
+Ġx pro
+Ġgu y
+Ġpal is
+Ġmes o
+Ġpharmac ogn
+Ġlact ated
+Ġtc z
+Ġmicrob icidal
+Ġmicrob ubbles
+Ġdl r
+Ġpast oral
+Ġnorm p
+por ter
+Ġcas i
+Ġcav it
+sh ap
+Ġaden omatoid
+Ġov ulatory
+Ġpneum o
+Ġadhes ively
+Ġarch ival
+Ġ10 4
+Ġ19 89
+Ġincis ive
+Ġresol utions
+Ġcolor ants
+Ġspl atter
+Ġwhite i
+Ġht r
+Ġcompli ers
+Ġstre ets
+Ġdigital ized
+Ġben jamin
+Ġcerv ic
+Ġphot olysis
+Ġdon ations
+Ġfil gotinib
+Ġopi ates
+Ġinstitutional ised
+Ġnumer ator
+Ġunc ont
+Ġchlor amine
+Ġneur orad
+Ġdp brn
+Ġprost acy
+Ġtransform ational
+Ġsem cd
+Ġsubsc apular
+Ġfore arms
+Ġdc g
+Ġglyc an
+Ġthink s
+Ġgall oyl
+21 12
+Ġharm less
+Ġdop ed
+gl uc
+gg ia
+Ġgh ost
+Ġdeb re
+Ġdeb ut
+Ġuk t
+Ġstiff er
+Ġcortic ospinal
+Ġah pm
+Ġvel lus
+Ġvide ot
+Ġcontin ental
+Ġren ji
+Ġlys osome
+Ġmyel omon
+Ġopp ose
+Ġsb m
+Ġchew er
+Ġtempor o
+Ġsac ubitril
+uls ive
+Ġheat maps
+Ġunf ores
+Ġts m
+Ġts gs
+Ġnr p
+Ġverteb roplasty
+Ġket orolac
+Ġpseud onym
+Ġparas pinal
+Ġunst andardized
+Ġperic ellular
+Ġelectroph oretically
+27 9
+15 95
+Ġhumid ification
+Ġtransm itter
+otrop in
+att r
+Ġtrust s
+Ġtl jn
+Ġiod inated
+Ġcatal onia
+Ġmyc osis
+Ġcongenital ly
+Ġpas w
+Ġfc d
+Ġdd pcr
+Ġlot us
+iabet ics
+Ġtransp apillary
+Ġgli adin
+Ġram i
+Ġaver t
+24 3
+Ġcha pl
+oqu inones
+Ġscal ene
+Ġcra ib
+Ġscler a
+Ġmultip olar
+Ġultra centrif
+Ġneigh bours
+Ġsuppl iers
+Ġcip rofol
+Ġanter oseptal
+Ġmu enke
+Ġcred it
+Ġretro version
+Ġfasc icles
+Ġobt use
+Ġdf us
+Ġdf ra
+Ġlam ps
+Ġduplic ations
+Ġarchitect ures
+Ġdie go
+omorph ism
+Ġthi oredoxin
+Ġabc iximab
+Ġirrit ants
+Ġmim etic
+ipt yline
+Ġcbf as
+Ġtouch es
+Ġkm w
+Ġunm od
+Ġterrit orial
+Ġreplic ating
+48 6
+Ġhus k
+Ġmultin odular
+Ġdiscol or
+Ġmicrod iss
+Ġsecure ly
+Ġirrevers ibly
+Ġdihyd rop
+Ġvibration al
+Ġze ep
+Ġprur itic
+Ġantitum our
+Ġstream ing
+Ġcyan otic
+Ġimmunobl ots
+Ġpaste urized
+Ġmicrog ram
+Ġgrand parents
+Ġlich ens
+Ġni acin
+Ġmesiod ens
+Ġbanglades hi
+Ġmps ms
+Ġnn u
+Ġantis epsis
+Ġdispatch ed
+peri odont
+Ġfrust rating
+Ġkim ura
+Ġjoh ann
+Ġstigm atized
+Ġstrugg les
+Ġaq e
+fol io
+Ġdura plasty
+Ġgalact omannan
+Ġmicrom orph
+Ġiu fd
+Ġhps d
+Ġacclim ation
+Ġprohib it
+Ġsoy bean
+Ġpteryg opalatine
+Ġstretch es
+Ġlecture rs
+Ġmyx edema
+Ġovers ampling
+Ġjum ps
+Ġcorn us
+Ġcorn ell
+Ġancest ral
+Ġhypochlor ous
+77 4
+Ġnegot iate
+Ġoesophag itis
+analyz ed
+Ġdenom inators
+Ġomn ichroma
+Ġcil ia
+Ġflag ged
+Ġcw p
+Ġglutamyl transferase
+Ġchrist ians
+Ġlia oning
+Ġgate way
+Ġforecast ing
+bec ause
+Ġconfron ting
+Ġtransg astric
+Ġmonte ggia
+Ġgan b
+Ġgan oderma
+Ġtwist ed
+Ġelectrochem ical
+Ġpuer arin
+Ġdict ate
+Ġdict ates
+uren ce
+Ġautograft s
+Ġdeparaffin ization
+Ġinterchange ability
+Ġpalmar is
+Ġcave ats
+Ġacycl ic
+Ġchromatograph ed
+Ġept ifib
+Ġmond ia
+Ġmyof unctional
+Ġhca ec
+Ġethylenedi amine
+Ġanov ulation
+Ġmyo epithelial
+Ġfid axomicin
+Ġsale can
+Ġmicrocyst ic
+Ġrevolution ized
+chec ked
+Ġphotob ook
+Ġkarol a
+Ġmistaken ly
+Ġcytore duction
+Ġactu ator
+Ġsax ony
+qual ified
+similar ly
+Ġradiotra cers
+Ġyc j
+Ġtauro dont
+Ġbion ator
+Ġturbid imetric
+Ġintercus pation
+Ġmicrophot ographs
+ophot ogrammetry
+Ġplurip otent
+Ġreent ry
+Ġgust atory
+Ġplethysm ography
+Ġhydrocarb ons
+Ġeog e
+Ġdiath esis
+Ġspiro ch
+Ġhydrom orphone
+Ġthermocoup le
+Ġintert rigo
+Ġinfod emic
+Ġradiolab eled
+Ġpreco ated
+Ġosmolar ity
+Ġstaped ius
+Ġscrap ings
+Ġneonatic ide
+commun ication
+Ġchori o
+Ġreestab lish
+Ġhicc ups
+Ġdiarrhoe al
+Ġaminosalic ylates
+Ġcrist ae
+Ġdecann ulation
+Ġkitav ans
+Ġimmunolip osomes
+Ġbioter ror
+Ġstereolith ography
+Ġjirove cii
+Ġasun ercept
+Ġadhesi olysis
+Ġmorcell ation
+Ġsuprap ubic
+Ġauscult atory
+Ġanthelmint ic
+Ġnfa i
+Ġirration al
+Ġalbiz ia
+Ġfost ered
+Ġpeptidog lycan
+otherapeut ics
+Ġoler acea
+Ġdivis um
+infect ious
+Ġvend ors
+Ġaprot inin
+Ġelectrocaut ery
+Ġriton avir
+Ġimbra ve
+Ġacron ym
+Ġeptifib atide
+3 000
+d is
+f ile
+f ox
+g ood
+m ult
+o ethanol
+r ight
+t ions
+u el
+v r
+x g
+z ers
+Ġt ether
+Ġt ica
+on ly
+Ġs op
+Ġo ars
+Ġo ipa
+Ġc ud
+Ġp ial
+Ġp ine
+Ġp yc
+ed uct
+Ġw rs
+Ġan yt
+Ġf ict
+ic ut
+Ġm de
+Ġm sec
+Ġand ersen
+Ġb ail
+Ġb ored
+Ġb nt
+Ġb cm
+an ch
+an ale
+an ne
+an terior
+an xi
+ar us
+Ġre ple
+Ġe cr
+Ġe brt
+om ain
+Ġl aus
+os ol
+im ep
+Ġg rie
+id ade
+Ġcon us
+un orubicin
+Ġon n
+ut o
+ut ated
+Ġex osomal
+ot eness
+Ġr nc
+Ġr lt
+em ann
+Ġal oud
+ag cg
+Ġis th
+um e
+am is
+Ġres ecting
+oc il
+op ontine
+ys ed
+Ġde iod
+est rogenic
+Ġch atg
+Ġse eg
+Ġse pha
+Ġper iles
+Ġsu vs
+ign al
+Ġac ao
+ac ct
+Ġdis ent
+Ġco ined
+Ġcl es
+Ġhe ur
+end o
+end oscopic
+Ġne ap
+Ġsc st
+Ġinf rat
+uc il
+Ġaf ss
+Ġanalys ts
+Ġk ess
+Ġk oun
+Ġmet ad
+Ġpl p
+Ġreg aining
+Ġun h
+Ġsub cohort
+Ġam ic
+Ġam ines
+Ġacc p
+Ġph p
+ath isia
+Ġqu ota
+Ġmod d
+Ġno ises
+Ġy ac
+Ġdur an
+Ġdet ergents
+Ġtheir s
+Ġro sa
+Ġcol o
+Ġcol ostomy
+Ġcr imes
+Ġinv ades
+Ġte er
+Ġsup r
+ond rosis
+Ġtrans oesophageal
+Ġbi ometry
+��bi orad
+Ġbi olum
+Ġinfl ate
+Ġj up
+Ġj ensen
+Ġsp ic
+Ġstr ange
+Ġstr iae
+Ġem it
+Ġem dc
+Ġdem g
+Ġdem oral
+Ġdem ocratic
+Ġpop ping
+Ġrem it
+Ġrem inding
+Ġrem oteness
+urren cy
+Ġmon ocyt
+ob ot
+ob ile
+Ġcar s
+Ġwork day
+Ġhyper ion
+Ġif sa
+ores is
+Ġet w
+Ġform ate
+ian in
+Ġanti radical
+Ġstandard ise
+ov it
+Ġps vt
+Ġic ers
+ung unya
+Ġmy oblast
+Ġmy bpc
+Ġvol t
+Ġmal ak
+Ġmal union
+par able
+Ġinst agram
+Ġcur tis
+iple x
+ade us
+Ġct q
+Ġct cs
+Ġbm r
+Ġrest aur
+Ġadd wr
+Ġq a
+Ġq st
+Ġunivers idade
+Ġur ged
+Ġelect ively
+Ġsl ant
+Ġbr im
+Ġach p
+Ġhand outs
+Ġmm d
+Ġda hl
+Ġpublic ity
+Ġcer ad
+Ġcer asm
+Ġmid points
+Ġlength ened
+Ġdec ongest
+Ġdec arbox
+Ġhb b
+Ġhb d
+Ġrelev ancy
+Ġunderst udied
+Ġcs b
+Ġcs cc
+Ġhyd rophil
+ner i
+Ġdom est
+Ġstep ped
+Ġak athisia
+Ġreact ome
+ather ogenic
+Ġhs ws
+abil is
+Ġiv d
+Ġiv rt
+Ġoc imum
+Ġpp r
+Ġperiodont ics
+Ġrepl ies
+Ġla at
+Ġx cell
+Ġsn ds
+Ġthromb ophilia
+Ġpc n
+Ġlik eness
+Ġhom inis
+Ġrs b
+Ġrs pv
+Ġnut race
+Ġacet aldehyde
+Ġaltern ately
+Ġga ult
+Ġacqu ity
+Ġaden ylate
+Ġport folio
+Ġmc av
+Ġpneum atosis
+Ġprec ap
+Ġprec apillary
+Ġarch ae
+Ġmust ard
+Ġnaf am
 Ġdepend able
-Ġdepend ability
-Ġdepend ences
-Ġdepend encies
-Ġpersonal ities
-Ġpersonal ised
-Ġequal ization
-erv ised
-Ġalb ino
-Ġalb uquer
-Ġalb adri
-tm anea
-Ġtext ural
-ino lytic
-Ġdu oden
-Ġdu arte
-Ġtom ogram
-Ġtom ographies
-Ġtom ographs
-Ġtom orrow
-Ġhabit at
-Ġhabit ational
-Ġhabit ually
-Ġabras ions
-Ġhour glass
-Ġrat ers
-Ġrat aj
-Ġdepos iting
-ystal lisation
-Ġampl i
-Ġampl ifying
-Ġampl itudes
-Ġ05 5
-Ġremineral ized
-Ġremineral izable
-Ġcircum ferentially
-Ġcircum ferential
-Ġcircum vents
-Ġcircum vented
-Ġcircum pubertal
-Ġtherm ally
-Ġtherm ometer
-Ġtherm odynamics
-Ġtherm osetting
-Ġbes chwer
-Ġretain ment
-Ġprotr ude
-Ġprotr acting
-Ġprotr actor
-Ġdegrad es
-Ġkit ami
-Ġtnf p
-Ġtnf aip
-Ġmic o
-Ġvas eline
-Ġvas odil
-Ġvas ospas
-Ġvas oreactivity
-Ġrd b
-Ġrd p
-Ġrob bery
-Ġrob ledo
-Ġcounter balanced
-Ġcounter produc
-Ġcounter mom
-Ġcounter vail
-Ġcounter measures
-Ġcounter balancing
-Ġdirec ting
-Ġdirec tives
-bo tic
-bo ured
-bo emb
-Ġthin ness
-Ġthin ned
-lys iloxane
-irect club
-Ġsecre tary
-Ġsecre tory
-Ġactual ized
-itation diss
-Ġincom ing
-Ġheat ers
-Ġ16 0
-Ġ16 8
-Ġ16 9
-Ġ16 38
-Ġfloss ed
-Ġcontinu ation
-Ġcontinu ity
-va art
-va uthan
-Ġana esthes
-Ġker atitis
-Ġker ato
-Ġker nels
-Ġcondyl oma
-uan ide
-Ġincid ental
-Ġposts econd
-Ġbio trans
-Ġbio abs
-Ġbio elec
-Ġbio assays
-Ġbio quant
-Ġbio archae
-Ġbio activities
-Ġbiops ychosocial
-Ġulcer osa
-Ġconcerning ly
-pal uk
-Ġou ellet
-Ġcreat ors
-Ġstaff ing
-Ġnh c
-Ġnh ok
-Ġwire frames
-Ġconcept ually
-Ġ200 2
-Ġ200 00400
-Ġwestern ized
-Ġwestern ised
-Ġhost ing
-Ġnav igating
-Ġplastic ity
-Ġplastic ize
-Ġplastic ally
-Ġplastic ized
-Ġplastic izers
-Ġtor ques
-Ġden ys
-Ġden atures
-Ġden uded
-Ġden atured
-Ġbs a
-Ġbs m
-Ġexclud er
-Ġdeform ed
-Ġdeform aties
-Ġdisp ute
-Ġdisp elling
-Ġcs r
-Ġcs bss
-Ġgraph y
-Ġgraph ing
-Ġgraph itic
-Ġperf etti
-Ġperf luoron
-Ġscoring s
-Ġosteocl asis
-Ġemphas ise
-Ġemphas ised
-Ġide ation
-Ġbis ected
-Ġnar umi
-Ġgre mbow
-Ġord ination
-Ġord inate
-Ġexc ited
-Ġexc ise
-Ġexc isions
-Ġexc ursion
-Ġexc ursive
-Ġactinomycetemcomit an
-Ġtap es
-Ġtap ers
-Ġtap ering
-Ġtap puni
-Ġtap iova
-Ġtheore tic
-Ġox ogl
-Ġox ford
-Ġox imetry
-Ġox irane
-Ġox ysterols
-Ġdil ator
-Ġdil ute
-Ġdil uting
-Ġdil igent
-Ġdil uent
-let ter
-Ġemo tion
-Ġamino ethyld
-Ġamino acid
-Ġkap p
-15 6
-15 9
-15 842
-ca att
-ca aa
-ca atcc
-ca aat
-Ġfun gemia
-Ġwash ability
-Ġwash bas
-odem us
-Ġrad ix
-Ġrad ically
-Ġrad nz
-Ġcrystal ized
-Ġcrystal eye
-Ġfeature d
-Ġelectron ics
-Ġstrept oz
-Ġstrept avid
-Ġincomple teness
-Ġpis as
-Ġatten uate
-Ġenl isted
-Ġenl ightened
-Ġenl ightening
-Ġenl arging
-Ġdestr ucted
-Ġdestr ucting
-Ġjoint point
-Ġsociodem ographics
-de fin
-rup licate
-Ġuc m
-Ġuc hime
-Ġah n
-Ġah plus
-Ġpac ific
-Ġpac emakers
-Ġanomal ous
-Ġstart led
-Ġgc df
-Ġras ines
-Ġras hes
-Ġras pator
-Ġsound ness
-Ġdeclar ing
-Ġdeclar ations
-Ġstreptococ cal
-lect rophoretic
-Ġcarbon ization
-Ġcarbon izations
-Ġintrac artilaginous
-Ġintrac ardiac
-Ġremod eled
-Ġabsorb ent
-Ġmacro scopy
-Ġmacro gl
-Ġmacro porosity
-Ġmacro scale
-Ġaffili ations
-Ġsed ative
-Ġsed extct
-Ġlink ages
-Ġaction able
-Ġkin ins
-Ġfeas ibly
-Ġirrig ations
-Ġgeriatric s
-Ġinst antly
-Ġbott led
-Ġbott len
-ecal is
-Ġdemand ed
-Ġformula e
-Ġpredom inates
-Ġpredom inately
-Ġbinary zated
-Ġsent ence
-Ġmad a
-Ġmad unic
-Ġharm onic
-Ġacce ledent
-Ġadhere ns
-Ġkn it
-Ġkn ight
-Ġkn ocking
-Ġkn oop
-Ġkn ife
-Ġdivers ities
-Ġdivers ified
-Ġdivers ification
-Ġmetal s
-ole y
-pr ise
-pr asom
-pr imary
-Ġthor ax
-Ġthor nton
-Ġpack ing
-Ġinh ale
-Ġdg as
-Ġdg pro
-Ġdg kj
-Ġdich otomy
-Ġdich lorodih
-Ġblack s
-Ġosse o
-Ġskin ner
-Ġretrie vable
-Ġom it
-Ġom ari
-Ġom ission
-Ġom fs
-Ġom fr
-Ġom nist
-Ġom pds
-Ġrein formed
-Ġrein vented
-Ġrare fied
-Ġedge file
-Ġfiber optic
-Ġsusp ensory
-Ġxerost omic
-Ġsulf o
-Ġsulf ated
-Ġsulf onic
-Ġsulf adiaz
-Ġnarrow s
-Ġinadequ acy
-Ġinadequ ately
-Ġinadequ acies
-Ġmun ster
-Ġconc ession
-Ġconc rete
-Ġconc iseness
-Ġconc isely
-Ġvene ered
-Ġspect acle
-Ġcurv um
-Ġcurv iline
-Ġrobust ly
-Ġdichotom izing
-fa ecalis
-kk o
-lin i
-Ġtactile ly
-Ġpu han
-Ġpu zzle
-Ġfa ult
-Ġfa ith
-Ġmel le
-Ġmel ink
-Ġmel amine
-Ġmel phalan
-Ġmel kersson
-ister ium
-Ġhong al
-Ġld a
-Ġforward s
-Ġforward ed
-Ġforward ly
-umb ed
-Ġupr ighted
-Ġemb odied
-Ġemb arked
-Ġsmooth ing
-Ġbroad ening
-Ġbroad cast
-Ġmacroph agic
-Ġbreath er
-Ġbreath ed
-Ġbreath ers
-Ġswe ats
-Ġcustom s
-Ġcustom ers
-Ġcustom ization
-Ġcustom arily
-ank ara
-Ġben ha
-Ġben net
-Ġvestib ules
-Ġvestib ulum
-Ġcortical is
-Ġcolour ing
-Ġ14 3
+20 3
+Ġht b
+Ġrh ynch
+Ġasc end
+Ġtransl ocate
+Ġexpect ancies
+Ġ12 2
+Ġ12 8
+Ġsensitive ly
+Ġcat agen
+Ġcomput ations
+Ġchlor amb
+Ġcc bs
+imm er
+Ġautom ation
+Ġna a
+Ġcro tal
+Ġcompl ains
+Ġcruc ially
+Ġprost ates
+53 6
+Ġmill enn
+Ġsem il
+Ġid us
+Ġid af
+Ġhemorrh oidectomy
+Ġpack et
+16 9
+Ġcran ium
+Ġcran ially
+Ġflav or
+Ġhcv d
+Ġpf na
+11 4
+Ġfourth s
+Ġdeb ond
+Ġuk wp
+Ġln r
 Ġ14 5
-Ġ14 8
-Ġ14 65
-Ġelastom ers
+Ġhl m
+Ġvel um
+17 3
+Ġfm bs
+22 334
+Ġmyel inated
+Ġcit ri
+Ġai is
+Ġsulf orhodamine
+Ġrich ard
+Ġnom inated
+Ġconstit utions
+Ġvo is
+Ġts k
+Ġtor oids
+Ġsev r
+Ġrheumat ological
+Ġcouns elled
+Ġhair y
+Ġeb g
+Ġls il
+Ġfish bone
+Ġconjug ates
+Ġses am
+Ġscr c
+Ġrib otype
+Ġmann an
+Ġmas se
+Ġmas ps
+Ġpara ventricular
+Ġsupra maximal
+Ġperia ortic
+Ġkeratin ization
+Ġvd cc
+Ġpip es
+Ġbios afety
+Ġpsa qol
+Ġtun ic
+Ġdoub ly
+Ġolig omer
+Ġnac csh
+Ġpear l
+Ġmultip ar
+char acter
+Ġcytos ine
+Ġnb is
+Ġinvent ed
+Ġswallow ed
+Ġautoant igens
+Ġsel s
+Ġimmuno expression
+Ġattain able
+Ġlb mi
+Ġbrux ing
+Ġstere otype
+Ġacknowled ges
+Ġtrim et
+Ġmultim odality
+Ġreimburs ements
+Ġprotr usions
+Ġjejun o
+Ġpent rax
+Ġsuperimp osing
+Ġdeco y
+Ġwealth ier
+Ġthi ols
+88 8
+Ġtd cs
+Ġgab on
+Ġsic m
+Ġescal ate
+isk an
+Ġgw g
+Ġtig er
+Ġbc va
+Ġassemb ling
+Ġciv c
+Ġiad ls
+Ġrock wood
+Ġze b
+Ġsymmet rically
+Ġgonad otrophin
+Ġendodont ists
+Ġdefec ate
+Ġdefec ations
+Ġspind les
+Ġapo ai
+Ġpropag ate
+Ġhered ity
+ctt cc
+Ġvv v
+Ġccc dna
+Ġcongru ency
+Ġoverlo ok
+embr anous
+Ġconvinc ingly
+Ġdestro ys
+Ġlubric ant
+Ġgloss itis
+Ġwel ch
+Ġconceiv ably
+Ġcere al
+ectom ised
+Ġhon or
+Ġovers ized
+Ġtroub led
+Ġtfs d
+Ġlst p
+Ġincomp atibility
+86 1
+Ġgonadotrop ins
+Ġcolline ar
+Ġfemor o
+Ġnab h
+Ġcataract s
+Ġantihy per
+Ġchiropract ors
+Ġik zf
+Ġextern us
+Ġreprod ucing
+Ġmich ael
+Ġoutweigh ed
+Ġcultiv ating
+Ġmalposition ing
+osyl transferase
+Ġcasual ty
+Ġgond ii
+Ġsurpass ing
+Ġschistos oma
+Ġotolaryng ologist
+Ġnw o
+Ġejac ulatory
+Ġwg he
+Ġbreastf eed
+Ġanecd otally
+Ġpenal ty
+334 3
+Ġmonos odium
+Ġalph abet
+Ġxr cc
+Ġsubspecial ties
+Ġcranioc erebral
+Ġprivile ge
+Ġpsr cc
+Ġgcl c
+Ġdir ty
+Ġmycel ia
+Ġexhaust ively
+Ġarachnoid itis
+Ġmtbs g
+Ġfinn gen
+Ġmyomet rium
+Ġthermoform ed
+Ġposttrans plant
+Ġsemic on
+Ġsynch ondrosis
+Ġheterod imer
+Ġcrisp us
+Ġlympho edema
+Ġbiostat ist
+Ġpamph let
+Ġfars i
+Ġhts cs
+Ġchik ungunya
+Ġchangeover s
+Ġbureauc r
+Ġreca pt
+Ġmotorcy cle
+Ġbuddh ist
+Ġcph d
+Ġunatt ached
+Ġurod ynamic
+Ġdesquam ation
+Ġpersever ance
+Ġunass isted
+Ġpathob iology
+Ġchebul agic
+Ġgale ga
+Ġremin ds
+Ġsalping o
+Ġisoprost ane
+Ġcoel onin
+hipp ocamp
+Ġsnaps hot
+Ġeicosan oids
+Ġintracav itary
+Ġphenylmethyl sulfonyl
+Ġconsens ual
+Ġmicroaer ophilic
+719 3343
+Ġdisput es
+Ġmicroble eds
+14338 4
+4315 42
+Ġhbras iletto
+unci ation
+Ġavers ive
+Ġnanoemul gel
+Ġprostacy clin
+Ġunfores een
+periodont itis
+Ġanyt ime
+Ġchatg pt
+Ġperiles ional
+Ġkoun is
+Ġrestaur ants
+Ġnutrace utical
+Ġchloramb ucil
+22334 08
+" ;
+, ,
+0 90
+2 21
+8 27
+9 17
+a ults
+b et
+b uc
+e q
+f ic
+f ring
+g as
+g all
+g ma
+h ang
+h dm
+h ima
+k ar
+l ice
+m ep
+n cr
+o vian
+p u
+t ronic
+in de
+in emia
+Ġa ero
+Ġa ae
+Ġa oa
+re th
+Ġth s
+Ġo pson
+Ġc urs
+Ġc gt
+Ġp ragm
+Ġw ml
+Ġf js
+Ġf jd
+or fer
+Ġd res
+Ġd ressed
+Ġd vhd
+Ġd ukes
+Ġm nd
+Ġb ire
+Ġb ont
+Ġb ffe
+an mar
+ro ud
+ar ate
+Ġre te
+Ġh id
+Ġh ne
+Ġh itting
+Ġe bi
+Ġto ce
+ul al
+Ġn ist
+Ġn ds
+Ġn ema
+Ġst g
+om ata
+Ġl cr
+ith otomy
+os ae
+os ulfate
+ig l
+ig ley
+ig inous
+Ġcon ometric
+il ic
+Ġon coprotein
+ab in
+Ġv ma
+Ġv cp
+Ġv mc
+Ġv umc
+Ġbe ans
+od is
+ot uzumab
+ot ifen
+Ġr ims
+em ium
+ag tc
+op ac
+op raz
+Ġat ans
+ad d
+Ġper illa
+Ġle ven
+ay ment
+Ġdis fig
+Ġdis perse
+Ġco erule
+Ġind enter
+ell aceae
+Ġtre l
+ia ceae
+pt ical
+Ġsignific ative
+uc onazole
+and ed
+Ġap ds
+Ġab cc
+Ġab duct
+Ġab using
+Ġk ans
+Ġk ak
+Ġev asion
+Ġcan gre
+Ġob gy
+Ġtr ick
+Ġeffect ing
+Ġinter tro
+Ġmed s
+Ġam g
+Ġam u
+Ġam adeus
+Ġph o
+rol ateral
+ap olis
+Ġar vc
+cl ic
+Ġcor k
+ub iqu
+Ġcr ista
+Ġcr aters
+Ġext ro
+Ġext ram
+Ġag onal
+ple x
+ew an
+ice le
+Ġman k
+Ġman gan
+Ġra z
+Ġra ft
+Ġtrans ill
+Ġbi i
+Ġbi ost
+Ġbi ogl
+Ġbi oroot
+Ġcomm uting
+Ġj j
+Ġj ac
+Ġj ena
+Ġsp un
+Ġsp iel
+Ġstr ontium
+Ġchar ging
+Ġdef ensin
+Ġso a
+Ġso ul
+eth ox
+Ġtra ins
+Ġprov okes
+Ġma a
+Ġadm e
+Ġblood borne
+Ġmon oph
+Ġdisc on
+Ġref ram
+Ġref uted
+Ġref raction
+Ġcar l
+Ġi ist
+Ġi ec
+Ġi ief
+Ġed los
+Ġlim e
+av astatin
+Ġfl aring
+yl line
+oid in
+Ġhyper dense
+Ġet b
+Ġet o
+Ġmic rons
+Ġel ix
+Ġgra cil
+Ġclass mates
+Ġol l
+Ġol m
+af lav
+ov ine
+Ġav pd
+ont ract
+Ġep g
+Ġpract icability
+Ġneg ate
+Ġpressure d
+Ġcase ating
+Ġmy anmar
+Ġz g
+Ġz am
+Ġz ie
+Ġz bi
+Ġz eng
+Ġoper atory
+Ġfib roc
+Ġer aa
+Ġca is
+Ġmark ovian
+Ġcur ated
+Ġcur amin
+Ġct ac
+br he
+Ġec w
+Ġresist ed
+Ġq in
+Ġq oc
+Ġq ah
+Ġequ ator
+Ġ20 8
+Ġpan n
+Ġchem i
+Ġchem idoc
+Ġher itable
+ca at
+ca emia
+opath ogenic
+Ġsumm ative
+Ġdec iph
+Ġhf nef
+Ġunderst aff
+Ġcoll ared
+me yer
+Ġcs sh
+Ġorth osis
+Ġnational s
+Ġsa ecg
+Ġhome opaths
+Ġcod ominant
+Ġhs es
+Ġerr m
+Ġmetabol ize
+Ġhc up
+Ġoc ul
+Ġfluid ity
+Ġpower lessness
+Ġrecru itable
+Ġdevi ates
+Ġhydro therapy
+Ġdispl acing
+Ġangi odysplasia
+az hong
+Ġhr ms
+Ġmt ms
+Ġtox oplasma
+Ġx j
+Ġx ois
+Ġann ona
+Ġcycl oth
+plant ed
+Ġrs wg
+Ġdl l
+Ġven ular
+Ġregular ization
+Ġchrom en
+Ġmiddle brook
+Ġtg me
+Ġ10 8
+Ġnf g
+Ġ19 83
+Ġrot atory
+Ġpt tm
+Ġste in
+20 5
+Ġuc ss
+Ġpv z
+Ġcand idal
+phal angeal
+Ġfd t
+Ġneurolog ically
+Ġrh cc
+ced ure
+Ġhaem ochromatosis
+gt gc
+Ġsha per
+Ġbed room
+yg ium
+Ġalg ae
+Ġnm ds
+Ġck mb
+Ġdp rs
+Ġcro ps
+Ġamb ition
+Ġintr ons
+Ġasym pt
+Ġnan chang
+Ġtransform er
+Ġherbal ist
+Ġacs f
+Ġhemorrh oid
+Ġhu azhong
+16 01
+met ric
+Ġsy rup
+Ġom ics
+Ġclean room
+Ġaustral asian
+Ġflav one
+Ġsocioec onomically
+Ġfed ac
+38 8
+Ġstop cock
+Ġbasal oid
+11 1
+Ġ14 01
+Ġah s
+Ġmor ibund
+atch ewan
 Ġdifferential s
-Ġcdt abc
-Ġcat s
-Ġcat ered
-Ġcat ogor
-Ġcat arina
-Ġcat abolize
-Ġpaste urization
-Ġeg k
-Ġconv oluted
-Ġrt f
-Ġrt x
-Ġcontain ment
-Ġperiodont ologically
-Ġperiodont opathogen
-Ġpron amel
-Ġinterm odal
-press ant
-Ġhypochlor ous
-Ġprovision ally
-Ġauthor itarian
-Ġeasy q
-Ġfaecal i
-Ġfaecal ibacterium
-89 5
-Ġog den
-Ġog awa
-Ġwar n
-Ġwar ren
-Ġwar ms
-Ġwar ned
-Ġwar ns
-Ġwar ped
-Ġwar angkul
-Ġwhit ley
-Ġarth roscopy
-Ġarth ritic
-Ġarth rocent
-Ġelect rostimulation
-Ġdistinct ly
-Ġdistinct ness
-Ġthorough ness
-13 5
-13 7
-13 9
-13 12
-13 99
-sin us
-sin ce
-Ġcast es
-Ġcast ing
-Ġec x
-Ġec ops
-Ġec ologies
-Ġec chym
-Ġec kert
-Ġorient ated
-Ġprev ails
-Ġprev ocheck
-Ġlet ting
-Ġphenomen ology
-Ġacceler ator
-hth alene
-Ġion t
-Ġion ized
-Ġion ization
-Ġion ian
-Ġion ically
-Ġion izes
-Ġion omers
-Ġcath eters
-Ġfast x
-Ġfast ening
-Ġfast qc
-Ġfast prep
-Ġdw arfism
-Ġhif u
-Ġstabil ies
-Ġstabil ise
-Ġstabil ising
-Ġcongen iti
-Ġresour ced
-Ġattain able
-Ġdisag greg
-Ġclar ifications
-Ġups ide
-Ġmoti f
-Ġcurric ular
-Ġactiv ion
-Ġsmear ing
-Ġdegen erated
-Ġphoto irr
-Ġphoto electric
-Ġcolonies was
-be in
-be zo
-be havioral
-net b
+Ġfm ps
+Ġpn bs
+Ġmh cc
+22 82
+Ġneph ron
+ophag ia
+Ġovere ruption
+Ġple omorphism
 Ġoffer ings
-Ġnc cls
-Ġnow here
-Ġnow zari
-Ġgover ning
-Ġgover ns
-Ġrin n
-Ġsouth ard
-Ġsouth west
-Ġ11 7
-Ġ11 8
-Ġapplic ant
-Ġarchitect ural
-Ġlabel er
-Ġmouthwashes can
-Ġtetr ameth
-Ġtetr aacetic
-Ġather othrom
-Ġfif ties
-Ġhar z
-Ġhar bor
-Ġhar sh
-Ġhar assed
-Ġhar sher
-Ġhar akiri
-Ġhar boured
-Ġhol an
-Ġhol low
-Ġhol berg
-Ġhol otox
-Ġhol opros
-Ġhol chberg
-Ġgas zyn
-Ġgas lini
-Ġperm uting
-Ġcompress es
-Ġdiff uses
-Ġdiff raction
-Ġcover ings
-Ġconservative ly
-Ġquad ri
-Ġquad hel
-Ġquad ruplicate
-Ġuns olid
-Ġuns tick
-Ġuns afe
-Ġswallow ed
-Ġcorrespond ent
-Ġgranul omatosa
-12 1
-12 5
-12 36
-Ġcit rull
-Ġground ed
-Ġintergroup s
-crib e
-Ġprofil er
-Ġprofil ed
-Ġprofil ing
-Ġequip ping
-Ġequip oise
-Ġramec group
-Ġgreen ish
-Ġgreen ery
-Ġgreen gene
-Ġgovern ates
-Ġslow s
-Ġslow ed
-Ġow ning
-Ġhr ct
-Ġlist e
-Ġlist ened
-Ġcarri ere
-Ġmeaning less
-Ġhydroxy prop
-Ġouts ourced
-Ġsubtyp ing
-Ġpseud arth
-Ġpseud ocyst
-70 8
-bor g
-bor ate
-Ġsen iors
-Ġput ties
-Ġpay or
-Ġpay ers
-Ġfm pos
-Ġfm pm
-Ġstop pers
-Ġgi essen
-Ġgi emsa
-Ġextension s
-Ġextension al
-Ġclus talw
-Ġsubstr atum
-Ġcoron oid
-Ġ13 44
-Ġdraw s
-Ġdraw ings
-Ġnanop rec
-Ġsweet ener
-Ġeryth roid
-Ġeryth rocytes
-Ġeryth rosine
-Ġeryth ritol
-Ġter a
-Ġter rain
-Ġantic ariogenic
-Ġantic onvuls
-Ġmir on
-Ġmir na
-Ġmir nas
-Ġstom fak
-omer ated
-omer isation
-Ġvar icella
-Ġscar less
-Ġ18 0
-Ġ18 3
-Ġ18 5
-Ġ18 73
-Ġoccup ies
-Ġgradu ations
-Ġcathep sins
-Ġnanopartic ulate
-med a
-Ġsi ategories
-Ġing ress
-Ġing ots
-Ġing britt
-Ġnig ro
-Ġcomfort ably
-Ġmeh ta
-Ġmeh ra
-Ġscr ambled
-Ġround ing
-Ġnoti fy
-Ġmoun tain
-Ġimmers ive
-Ġparent age
-Ġvolunte ering
-Ġenlarge ments
-50 9
-ydr ified
-ydr amine
-Ġple ase
-Ġple ural
-Ġple asing
-Ġple asure
-Ġple thora
-Ġple asurable
-Ġangi ography
-Ġangi opo
-Ġfair ness
-Ġdim ax
-Ġdim itra
-acill in
-Ġrna imax
-Ġresol utive
-Ġacryl ate
-Ġacryl ics
-Ġacryl onitrile
-Ġadip ic
-Ġadip ocytes
-Ġadip oai
-Ġcla he
-Ġcla vicle
-Ġleg islative
-Ġunknow ingly
-Ġoutput voltage
-Ġmethan obacterium
-Ġmethan osarcin
-Ġmethan osphaera
-eptid ase
-Ġsolid ification
-Ġsolid ify
-Ġsolid ifying
-Ġsolid works
-Ġsolid solution
-Ġsuperv ising
-Ġsnp p
-Ġbottom s
-Ġoct enidine
-Ġoct acalc
-ange ments
-Ġbit ter
-Ġrm b
-Ġrm mas
-Ġrm sea
-Ġuniform ed
-Ġcortic otropic
-Ġstra umann
-Ġnons urg
-Ġnons tick
-Ġnons porulating
-Ġnons pecialist
-Ġpopular izing
-Ġolk in
-Ġdoctor al
-Ġfulfill s
-Ġfulfill ment
-23 19
-23 06
-gate kee
-tg aag
-Ġoxy dans
-Ġpull out
-Ġns d
-Ġns g
-Ġns p
-Ġns w
-ogl ossal
-Ġcool er
-Ġkh en
-Ġkh osra
-Ġkh iavi
-Ġoverc ame
-Ġoverc orre
-Ġdecont aminating
-Ġsimpl ifications
-Ġsimpl ifier
-Ġsimpl ifying
-Ġspr int
-Ġspr ays
-Ġspr ang
-Ġspr ague
-Ġspr inkle
-Ġformat s
-Ġopin on
-Ġgluc onid
-Ġgluc osyl
-Ġexpress ive
-Ġexpress ivity
-Ġhydrox ychlor
-Ġrepair ability
-Ġvarnish es
-Ġpush es
-Ġpush ing
-Ġinput ting
-Ġinput voltage
-Ġanth ocyanins
-Ġanter iors
-Ġanter olateral
-Ġfund s
-Ġmt f
-Ġmt wo
-Ġbad ly
-Ġrh oa
-Ġrh initis
-Ġrh izobium
-Ġchit ra
-opro fen
-Ġuncertain ties
-Ġelucid ation
-Ġpaediatric ians
-Ġarticular is
-Ġdiscrimin ated
-Ġdiscrimin ability
-Ġstraight ening
-Ġoxygen ated
-Ġoxygen ating
-mp uan
-Ġdiv isions
-acc ording
-acc agct
-Ġlibr arian
-imm igrants
-Ġgn omad
-Ġgn atium
-Ġital ic
-Ġpreschool s
-Ġpreschool er
-ught ered
-Ġmoist ness
-Ġliqu or
-Ġapproximal s
-Ġhydrogen ogen
-Ġhydrogen otrophic
-Ġempow erstats
-Ġrpd gf
-Ġhnscc s
-edic o
-Ġpit ts
-Ġpit fall
-Ġfed erated
-Ġfed erica
-Ġfine ly
-Ġmit f
-Ġmit ogen
-Ġmit oses
-Ġmit teilun
-Ġbul ge
-Ġbul ang
-Ġbul gar
-Ġreverse ly
-Ġstere oscopic
-Ġstere otyped
-Ġrig or
-Ġchrom a
-Ġchrom oblast
-Ġcompet ing
-Ġcompet ences
-Ġcompet encies
-Ġdisinf ective
-Ġabstr acted
-Ġ15 00
-Ġ15 189
-Ġautom atization
-Ġautom atized
-Ġtele visions
-Ġmultic rystalline
-Ġclaim ing
-Ġdc m
-Ġdc fh
-Ġdp c
-Ġdp as
-Ġdp bs
-Ġdp scs
-Ġmother board
-Ġscap hoid
-Ġtrain er
-Ġtrain able
-Ġunp acking
-Ġ30 4
-Ġ30 7
-Ġ30 216
-Ġmetagen omes
-obacter iace
-Ġpalat ogenesis
-Ġpalat ogingival
-Ġpalat oglossal
-Ġencod es
-Ġscience ll
-Ġpet erson
-Ġpet ersson
-Ġpet ermann
-Ġpet role
-Ġbic ortical
-Ġbic ycle
-Ġbic inch
-Ġlc d
-Ġlc u
-Ġrms prop
-Ġanalog ies
-Ġanalog ously
-Ġneural gic
-Ġunf inished
-Ġunf unded
-Ġunf oreseen
-Ġkind lin
-Ġdetr act
-Ġdetr itus
-Ġ00 25
-Ġzyg omaxillary
-Ġinspec ting
-Ġinspec tions
-Ġgloss y
-Ġgloss odyn
-Ġtransluc ence
-Ġmelan ocyte
-Ġmelan ocytic
-Ġmelan oblastic
-Ġanthrop ological
-Ġanthrop ology
-Ġprogramm atically
-58 0
-58 4
-58 63
-58 461
-eth ical
-Ġure ase
-Ġtp n
-Ġtas ked
-Ġpict ured
-Ġdf g
-Ġband pass
-Ġband eira
-Ġhu a
-Ġhu we
-Ġhu ifeng
-Ġhu umonen
-Ġdeposition s
-Ġscen ery
-Ġforest omach
-Ġobt use
-Ġemg s
-Ġsched uler
-Ġsched uling
-Ġdistress ing
-Ġdistress ful
-Ġohs ugi
-Ġdigitiz e
-Ġdigitiz er
-Ġdigitiz ing
-Ġstimul ant
-Ġstimul atory
-Ġstret cher
-Ġanteroposterior ly
-74 40
-74 85
-bi at
-enes ulf
-Ġpel leted
-Ġpeptid ase
-Ġpeptid yl
-Ġbb c
-Ġlp xtg
-Ġconce iving
-Ġconclud es
-Ġperfor ate
-Ġperfor ator
-Ġsep ts
-Ġsep tic
-chym e
-Ġneutr on
-Ġfold ers
-Ġarg yria
-Ġreflex es
-Ġnutrition s
-Ġnutrition ist
-Ġnutrition ists
-Ġthermocycl ed
-Ġattrition ed
-Ġembed s
-zo lyl
-Ġpog o
-Ġdon achie
-Ġren ewing
-Ġren net
-Ġren ders
-Ġren unciation
-Ġren min
-Ġgp ds
-Ġvast ly
-Ġrich er
-Ġrich est
-Ġrich ard
-Ġchip ped
-Ġprepar atory
-Ġneuro ectodermal
-Ġneuro cogn
-Ġneuro ticism
-Ġneuro cristopathy
-Ġsole m
-Ġsole us
-Ġformal dehyde
-Ġremark s
-Ġremark ablly
-Ġlips itz
-Ġimmunosup pressants
-Ġimmunosup presive
-Ġimmunosup pressant
-Ġneutral ized
-Ġneutral izing
-Ġneutral izes
-18 0
-18 4
-18 00872
-18 15842
-Ġrom ano
-Ġrom pen
-Ġrom antic
-Ġrom anians
-Ġpy ati
-Ġpy ogenic
-Ġpy kno
-Ġpy robest
-Ġpy ruvate
-Ġball s
-Ġball al
-Ġball ard
-Ġball ista
-Ġexer tion
-Ġexclus ivity
-Ġflav ins
-Ġflav oured
-Ġflav onoid
-Ġchron ically
-Ġchron ometer
-Ġbreak fast
-Ġcircumst antial
-Ġincident ally
-Ġtoughness es
-Ġzygomatic ofrontal
-ai osis
-Ġxi i
-Ġxi ap
-Ġtan ks
-Ġtan ba
-Ġtan ja
-Ġtan uma
-Ġtan erella
-Ġalex a
-Ġinner vation
-Ġinner vated
-Ġinner vating
-Ġfing ern
-Ġdark ly
-Ġdark ens
-Ġdark ening
-Ġment en
-Ġment or
-Ġment um
-Ġment oplates
-Ġbon fig
-Ġhc is
-Ġnd in
-Ġnight ly
-Ġnight time
-Ġald hu
-Ġald osterone
-Ġcompression s
-Ġdistor t
-Ġaden itis
-Ġaden oids
-Ġaden omas
-Ġaden otons
-Ġcoup le
-Ġcoup les
-Ġcoup ons
-Ġregister ation
-Ġunc ured
-Ġunc onscious
-Ġunc orrec
-Ġunc ulturable
-Ġunc ultivable
-Ġunc ountable
-Ġyemen is
-Ġkrus kall
-Ġweb cam
-Ġsupr arenal
-Ġspot light
-Ġextrac ranial
-Ġextrac apsular
-Ġendothel ium
-Ġfrag ility
-Ġethanol s
-Ġethanol ic
-Ġaligned viral
-Ġaggreg ating
-04 1
-95 5863
-Ġcu esta
-Ġcel iac
-Ġine fficacy
-Ġfat ality
-Ġmb t
-Ġdeal er
-Ġtruth ful
-Ġarm itage
-Ġdecom pose
-Ġdecom posing
-Ġ23 7
-Ġpossess ing
-Ġosteop ontin
-Ġhypo albumin
-Ġhypo echoic
-Ġ50 3
-Ġ50 7
-Ġbucc opalatal
-Ġbucc olingually
+Ġlib erty
+Ġnom ad
+Ġdich otomy
+Ġaud ible
+Ġbis oprolol
+Ġts ab
+Ġket ones
+Ġembry ogenesis
+Ġesophag o
+Ġpseud ovirus
+Ġpy raz
+Ġpy rim
+Ġord ination
+Ġcin it
+Ġnp o
+Ġdiscrimin ator
+Ġhair line
+Ġfp i
+Ġplasm odial
+Ġgal angin
+Ġrf pn
+Ġconjug ative
+Ġpolyp ectomies
+Ġoscc s
+Ġagon istic
+Ġgs es
+bd ate
+Ġultrason ically
+Ġcatal ogue
+Ġdermat ophyte
+Ġld v
+Ġcure tte
 Ġmesh ed
-Ġallevi ating
-Ġallevi ates
-Ġclarify ing
-des cribed
-des cribe
-rax in
-Ġpc b
-Ġpv c
-Ġpv d
-Ġdut p
-Ġbm w
-Ġbm is
-Ġregul ators
-Ġwealth y
-Ġmicrog raph
-Ġendo tracheal
-Ġfebr ile
-Ġphysi ochemical
-Ġphysi otherap
-Ġphysi ognomy
-Ġmesio angular
-Ġmesio vestib
-Ġdispers e
-Ġcrystall ites
-Ġcrystall oids
-Ġcompartment alization
-Ġanticip ating
-38 2
-38 6
-mon th
-pir al
-Ġtun neling
-Ġwet ness
-Ġfix ated
-Ġfix ogum
-Ġmess y
+Ġsubs urface
+Ġje ff
+Ġinnov ators
+Ġras p
+Ġpaed iatrics
+Ġgeriatric ian
+Ġabd el
+Ġbt bd
+Ġmotiv ates
+28 6
+70 41
+Ġnav a
+Ġih cc
+Ġber ry
+Ġcool ant
+Ġmultip les
+Ġblank ets
+Ġrc as
+Ġrc md
+Ġlock er
+40 7
+da o
+Ġlith iasis
+Ġgot ten
+Ġpuls eless
+Ġfre t
+Ġmacro vesicular
+Ġiso enzyme
+Ġwarm th
+Ġimt ms
+Ġtv t
+Ġrom anian
+Ġhind rance
+Ġhind foot
+Ġsuc ra
+Ġcontradict ions
+Ġbor reliosis
+Ġtann erella
+Ġlam bre
+Ġrip ening
+Ġgb f
+alc one
+Ġdeco ct
+omorph ometric
+Ġremed ial
+Ġpit avastatin
+Ġkc nd
+Ġsweet ness
+Ġfs q
+98 3
+Ġreass ure
+Ġdetrim ent
+Ġcontamin ant
+Ġgels emium
+Ġctx m
+Ġgw w
+Ġfos b
+Ġtj r
+Ġturb ulence
+Ġreble eds
+Ġvon opraz
+Ġprev ia
+Ġcub a
+Ġprur iens
+Ġunderl ies
+Ġnonc omp
+Ġsati ation
+87 7
+Ġcontempor aneous
+Ġshrink ing
+Ġhypercholester olemic
+Ġcyan ide
+Ġccr cc
+Ġzyg oma
+Ġpsycho anale
+Ġtrace able
+Ġcts b
+Ġcts k
+Ġsof lex
+Ġsubcl ones
+Ġpatent ed
+Ġmag enta
+obut yl
+Ġclam ps
+Ġantis erum
+Ġclip ped
+Ġdq y
+Ġhypov itamin
+Ġvin ci
+Ġsz abo
+Ġunaccept ably
+Ġechin atin
+Ġmant a
+Ġaceton ide
+Ġ79 00
+Ġferric yanide
+Ġgx d
+Ġpostp oning
+Ġubiquit ously
+Ġrvf v
+Ġcere c
+Ġtas ked
+Ġspong ing
+Ġdiscern able
+Ġcet yl
+Ġlifes aving
+Ġmcg rath
+Ġimproper ly
+Ġnest e
+Ġhyperd ynamic
+gly c
+Ġcarbonyl s
+Ġlibr arian
+Ġoint ments
+Ġerc ps
+Ġnanofib rous
+Ġpyro ptosis
+Ġvic ryl
+Ġpalat oplasty
+Ġunip rot
+Ġdepress ants
+Ġivig gm
+Ġaar hus
+Ġnephrolog ists
+Ġmyotub e
+Ġincap ac
+Ġadventit ial
+Ġdma hdm
+Ġtremend ously
+Ġstry ker
+Ġepiph yseal
+Ġendop rosthesis
+Ġdol icho
+Ġrespir ators
+Ġsuperm ark
+Ġmacros omic
+ogloss al
+Ġskip ped
+Ġmisf olded
+Ġdistract ing
+Ġsider oblasts
+Ġbart lett
+xf ad
+Ġgcl m
+Ġsequest ration
+Ġlacer ated
+Ġrota rod
+Ġrumin ococcaceae
+Ġaminosal icylic
+Ġsubtest s
+Ġcommin ution
+Ġdowng raded
+Ġblister ing
+Ġhav ics
+Ġdact ylitis
+Ġmould s
+Ġske ptical
+Ġdiz ocil
+Ġstrychn ine
+Ġlef se
+Ġjama ica
+Ġexcer pt
+Ġcheil itis
+Ġproanthocyan idins
+Ġmonoton ous
+Ġkeratocyst ic
+Ġcoix ol
+Ġposth oc
+Ġspati ally
+Ġsino atrial
+Ġbutyryl cholinesterase
+Ġparaph aryngeal
+haus er
+Ġverbas cum
+ispers ity
+Ġtant al
+Ġpharb itin
+2287 161
+Ġeub acterium
+Ġlord osis
+Ġytt rium
+Ġjane iro
+Ġnurt uring
+Ġwebp age
+Ġmillisec onds
+Ġpenc il
+Ġinfram ammary
+orrhoe ae
+Ġoligodendrogli omas
+Ġbioimped ance
+osced asticity
+Ġendole ak
+Ġmultires istant
+Ġbandwid th
+Ġsantorin icele
+Ġsask atchewan
+Ġadef ovir
+Ġautov acc
+Ġpharmacogn osy
+Ġbioterror ism
+Ġlaus anne
+Ġsepha rose
+Ġcerasm art
+Ġnafam ostat
+Ġrhynch ophylline
+inde ed
+Ġbire fring
+Ġcangre lor
+Ġmangan ese
+Ġgracil is
+Ġvonopraz an
+Ġhypovitamin osis
+Ġdizocil pine
+1 12
+4 28
+4 66
+9 67
+c ount
+d ue
+e eding
+e bp
+h ill
+h ui
+j pr
+l gren
+n u
+n ley
+p yl
+t p
+t rp
+w at
+Ġ ual
+Ġ ery
+Ġt is
+Ġt th
+Ġt lip
+in osus
+Ġth all
+Ġth iel
+at ten
+Ġs ys
+Ġs ons
+Ġo th
+Ġo chen
+Ġc ake
+Ġp urse
+Ġw ings
+Ġw gs
+Ġw fc
+al o
+Ġan hepatic
+Ġf ici
+ic ae
+ion es
+Ġd ch
+Ġd factor
+Ġm ck
+Ġm iles
+Ġm kn
+Ġm chs
+Ġb cis
+Ġb ica
+as ked
+as cal
+as core
+Ġre off
+Ġh ch
+Ġh ov
+Ġh ann
+Ġe id
+Ġe um
+Ġe ject
+Ġe oms
+Ġto i
+Ġto ken
+Ġn ell
+Ġn anol
+Ġst x
+Ġst eth
+Ġst ings
+Ġst eric
+ur c
+Ġl ul
+Ġl ak
+os urgery
+im idazole
+Ġg sc
+Ġg endered
+th yl
+th ink
+Ġas q
+Ġas md
+ow itz
+Ġv ies
+Ġv inyl
+ect a
+ter a
+Ġex ophytic
+Ġr ist
+Ġr uc
+Ġr ump
+Ġr urality
+em e
+Ġis omer
+Ġis bar
+Ġis hikawa
+am y
+ort ed
+Ġcomp osing
+ad t
+st ant
+rom yces
+Ġle aching
+Ġac orus
+ac ol
+Ġco val
+Ġnot ifications
+pl enic
+Ġbet adine
+Ġhe aviness
+Ġit al
+Ġsc k
+Ġinf raction
+Ġbetween ness
+Ġint i
+Ġha ecs
+ens itis
+Ġap bs
+Ġab e
+Ġab is
+Ġk ai
+Ġk umar
+Ġk linik
+Ġtr ka
+Ġrel a
+Ġmet analysis
+Ġreg roup
+Ġreg rett
+ding er
+Ġcell t
+Ġcell quest
+Ġinter o
+Ġinter ictal
+Ġinter phalangeal
+Ġincre d
+Ġsub periosteal
+Ġmed tronic
+Ġph all
+Ġqu igley
+Ġout ermost
+Ġy ers
+ear r
+Ġsam i
+Ġbl ush
+Ġdet ections
+te c
+Ġpr m
+ub ba
+Ġen e
+Ġen acted
+agn a
+Ġte ardrop
+Ġman go
+Ġ1 12
+Ġ1 11
+Ġra u
+Ġbut ylated
+osp ora
+Ġtrans ients
+Ġnon ob
+Ġperi articular
+Ġperi acetabular
+Ġj oln
+Ġsp it
+Ġsp ider
+Ġdist urbs
+Ġsim d
+Ġdem ean
+Ġpost operation
+eth oxy
+Ġsm l
+cept ible
+Ġgl imep
+Ġmon omic
+Ġmon ogenic
+ob ase
+Ġdisc ursive
+Ġwork group
+Ġpar ain
+Ġpar ks
+yn ec
+Ġmain z
+Ġhyper inflamed
+Ġhyper urica
+Ġform ulary
+Ġpredict ably
+Ġel ane
+Ġins ulated
+Ġins isted
+other mal
+Ġol mes
+Ġhyp ometabolism
+ting ham
+Ġless ening
+Ġgre gar
+Ġcomb o
+00 5
+Ġarter io
+Ġmajor ly
+Ġadminist rating
+Ġvent rolateral
+Ġir ccs
+Ġca as
+Ġii ic
+Ġang oroside
+Ġlab ile
+Ġhum our
+Ġec chym
+li k
+Ġorgan os
+Ġq q
+Ġequ id
+Ġequ ia
+Ġlip olytic
+Ġpul m
+Ġprop onents
+Ġbr itt
+Ġcategor ise
+Ġgene pharma
+rop ath
+Ġquant um
+Ġda unorubicin
+Ġher oes
+Ġsucc inate
+Ġpattern ing
+Ġos west
+Ġpur ported
+Ġasp d
+Ġdec olor
+Ġcam pb
+Ġhf i
+Ġaccess es
+Ġdam ascus
+Ġgo etting
+Ġcross ings
+Ġcm ets
+Ġcv o
+ank s
+Ġmak o
+Ġsa hs
+Ġreal ignment
+Ġcod er
+Ġbur gd
+Ġdevi ant
+Ġrepl aces
+az ide
+he ads
+Ġexpected ly
 Ġla uren
-Ġla velle
-Ġla ughing
-Ġnic odemus
-Ġshallow er
-Ġ25 7
-Ġ25 56
-Ġmetall ographic
-ultim ately
-Ġappra ising
-Ġappra ises
-Ġmagnetic ally
-Ġbuild s
-Ġbuild up
-Ġincorrect ness
-Ġepidemi ologist
-Ġmeaningful ness
-accur acy
-flex ions
-Ġae gean
-Ġthreat en
-Ġthreat ens
-enh aus
-enh ydramine
+Ġprep ares
+Ġtnf rs
+Ġlateral ized
+Ġmes op
+less ly
+Ġdistal izing
+Ġbro thers
+Ġeuro asp
 Ġcas h
-Ġcas till
-Ġcas eload
-Ġpanc reatoduodenectomy
-Ġwc ancerscore
-Ġwant ing
-Ġant elman
-Ġfus arium
-Ġded uce
-Ġded uction
-Ġtoler ates
-Ġperme ate
-Ġiso forms
-Ġindustr ielle
-Ġros ter
-Ġros ters
-Ġros entritt
-Ġinters pers
-Ġinters ecting
-Ġinters ections
-Ġinters pace
-Ġyo on
-Ġyo uden
-Ġ27 7
-Ġ29 0
-Ġ29 8
-Ġspring ing
-Ġmandib ulectomy
-Ġiot f
-Ġblast ospore
-Ġblast omyces
-Ġprosth odontists
-Ġmarket ed
-Ġbrown s
-Ġhemat o
-Ġhemat oma
-Ġhemat ogenous
-Ġhemat ologist
-Ġcontextual ization
-Ġoxid ant
-Ġoxid izing
-Ġoxid izes
-Ġsedent exct
-Ġspectrophot ometrically
-Ġoverex posed
-Ġpharmac ist
-Ġpharmac otherapy
-Ġpharmac otherapeutic
-Ġpharmac oeconomics
-Ġbulk y
-Ġbulk iness
-20 5
-20 15
-20 1312
-20 2306
-Ġts d
-Ġts ad
-align ed
-Ġpear ls
-Ġannot ator
-lytic us
-eterm inator
-Ġconve ys
-Ġvl p
-Ġcoil s
-Ġparaf ilm
-Ġparaf unction
-Ġka arn
-Ġka iser
-Ġmesen chyme
-Ġrealistic ally
-Ġmicrom eters
-Ġglyc ated
-Ġglyc olic
-Ġinn ocent
-Ġbil irub
-Ġho oking
-Ġho oley
-Ġstay ing
-Ġlub art
-Ġlav igne
-ospor ium
-Ġalkal izing
-Ġalkal inized
-Ġalkal inization
-Ġrub in
-Ġrub bers
-Ġdele gated
-Ġperioperative ly
-iph enyl
-Ġtrap ped
-Ġtrap ezi
-Ġ28 83
-Ġedm onton
-Ġverbal ized
-Ġverbal izing
-Ġsymm etrically
-Ġretro gnathia
-Ġretro gnathism
-Ġretro virals
-Ġretro fitt
-Ġretro peritone
-Ġsynerg ize
-Ġthermo plasm
-Ġharves ts
-Ġmoment um
-Ġmoment ously
-Ġjournal ism
-ken ya
-ran oside
-wa ite
-Ġtg aa
-Ġtg caaa
-Ġpolar isation
-Ġwarm ed
-Ġwarm ing
-Ġfren al
-Ġfren ula
-Ġfren cken
-Ġdn ase
-att ggt
-att ccaag
-Ġrep uls
-Ġrep olished
-Ġrep ulsion
-Ġrep olishing
-Ġrep ellent
-Ġhet reogen
-Ġhet ereogeneity
-Ġproxim ate
-Ġneu rosensory
-Ġquick er
-Ġquick est
-Ġquick mark
-Ġbios pin
-Ġbios pectrum
-Ġbios ource
-Ġbios ynthes
-Ġdiast olic
-Ġliver pool
-Ġcomplement ing
-Ġsmart peg
-Ġfeed forward
-Ġsynthes izes
-Ġadvoc ating
-Ġadvoc acy
-Ġ199 4
-Ġ199 8
-Ġ199 9
-Ġhdp c
-Ġarray er
-Ġarray le
-Ġamalgam s
-Ġamalgam ated
-sa an
-Ġaer obes
-Ġaer ogenes
-ata ac
-Ġbay rak
-Ġbay onet
-Ġnf atc
-Ġnf kb
-Ġri otte
-Ġgross man
-stand ard
-Ġinfr abony
-Ġinfr adental
-Ġinfr atemporal
-Ġroll ers
-Ġsubd ue
-Ġsubd ural
-Ġsubd ued
-Ġunco oper
-Ġmethyl ation
-Ġmethyl meth
-Ġmethyl cellulose
-Ġmethyl iminodi
-Ġmoi ety
-Ġmanage ments
-Ġmind ful
-Ġmind fulness
-Ġmalays ians
-Ġcouns ellors
-Ġdiscuss es
-Ġretrom andibular
-Ġstir rer
-Ġicc mst
-Ġnanos ized
-Ġenter prise
-Ġenter obacteriace
-Ġelectro porated
-Ġelectro convuls
-Ġelectro blotted
-Ġ; .
-Ġign ores
-Ġign oring
-Ġsand ifier
-Ġsand wich
-Ġsand papers
-Ġpic n
-Ġfish bein
-Ġmart in
-Ġmart ande
-Ġling ling
-Ġnb ar
-Ġnin eteen
-Ġreson ant
-Ġreson ates
-Ġpresum ption
-Ġsubcl oned
-Ġsubcl oning
-Ġintell igently
-Ġyes avage
-phosph ate
-Ġmaxim a
-Ġmaxim ization
-Ġmaxim izing
-Ġmaxim izes
-Ġmaxim ilians
-Ġjc m
-Ġtransp ire
-Ġtransp ired
-Ġtransp eptidase
-Ġerk oform
-Ġantigen icity
-Ġ60 5
-Ġnorwe gians
-Ġreplic a
-Ġreplic ability
-Ġenroll ments
-Ġcolleag ue
-Ġetiological ly
-Ġexcision al
-Ġcereb ellum
-Ġpixel wise
-Ġmimic ry
-Ġrheum atism
-Ġpancreatic oduodenectomy
-her d
-ij a
-Ġice box
-Ġtin y
-Ġtin idazole
-Ġtin ius
-Ġtin nius
-Ġtin nitus
-Ġtang entially
-Ġtang su
-Ġsic ca
-Ġsic ilian
-Ġpg k
-Ġfs rs
-Ġdest oring
-Ġbid irectionally
-Ġbath s
-Ġbath ed
-Ġbath ing
-Ġstaphyl ococcal
-Ġlib ya
-Ġlib erati
-Ġlll s
-Ġonc ogenic
-Ġonc ologic
-Ġonc oprotein
-Ġonc ologist
-Ġonc oproteins
-Ġonc opathogenicity
-Ġvent ana
-Ġvent ricular
-Ġvent anilla
-Ġvent riculomegal
-Ġvent rocaudal
-Ġvac ation
-Ġvac pre
-Ġvac post
-Ġexten uating
-Ġimper vious
-Ġtrib al
-Ġtrib st
-Ġtrib ometer
-Ġunex perienced
-Ġunex tracted
-Ġamb itious
-Ġdiscern ment
-Ġdiscern ible
-Ġdiver ge
-Ġdiver ting
-Ġelis as
-Ġswab bing
-Ġhyperd ontia
-Ġheterogeneous ly
-Ġporphy rym
-Ġquarter ly
-Ġsharp ening
-Ġsharp ened
-Ġrehabilit ations
-32 8
-79 0
-79 4
-Ġtu ition
-Ġtu fts
-Ġtu keys
-Ġtag ging
-Ġsph ingosine
-Ġsph incter
-Ġpec toris
-Ġfu el
-Ġfer rit
-Ġruss el
-Ġexec uting
-truct ures
-Ġche onan
-Ġmeg aspha
-Ġmeg avolt
-Ġshear n
-Ġpositi vo
-Ġhair s
-Ġsubl imit
-Ġinterrup ts
-Ġovers ight
-Ġ26 7
-Ġmicros ilver
-Ġmicros phere
-Ġmicros atell
-Ġ31 9
-Ġadju van
-Ġfitting s
-Ġdissol ves
-Ġgastro prot
-Ġgastro enterology
-Ġsun y
-Ġsun ny
-Ġsial oliths
-Ġsial ocele
-Ġsial ostrip
-Ġcatal ysis
-Ġcatal yses
-Ġcatal yz
-Ġpun itive
-Ġpun ica
-Ġpum ping
-Ġpum icing
-Ġpum iced
-Ġpum paluk
-arc zyk
-Ġretic ence
-Ġhap map
-Ġhind i
-Ġnit ro
+Ġcatheter ized
+Ġpneum ophila
+Ġip g
+ori us
+Ġmarg arine
+Ġmake up
+Ġprec edent
+Ġtg so
 Ġnit inol
-Ġnit rate
-Ġnit rous
-Ġnose bleeds
-Ġgh osh
-Ġgh ensi
-ames e
-Ġvic tor
-Ġvic enza
+Ġnit rer
+Ġ19 64
+eli k
+Ġrt as
+Ġuc l
+Ġarm m
+Ġsd tw
+Ġdigital is
+Ġrh is
+oly mph
+Ġexamine es
+Ġflex ibly
+Ġrestor able
+Ġenter ostomy
+Ġdp g
+Ġnh w
+Ġnan ob
+Ġss as
+Ġdemograph ically
+16 6
+Ġci u
+Ġom issions
+Ġcf d
+Ġtext ual
+Ġtherm ist
+Ġgh ent
+Ġcounter balance
+Ġlc os
+ocar pa
+Ġcomplement ing
+uff s
+Ġincomple teness
+Ġvide ocon
+Ġmv c
+Ġfm k
+Ġgest ations
+22 5
+Ġ16 2
+Ġeasy do
+Ġleak ages
+Ġbrazil ians
+Ġot ulin
+isc ore
+Ġsuture less
+Ġrd a
+Ġter pine
+Ġfa h
+Ġfa isal
+Ġket otifen
+Ġembry ological
+Ġpw i
+Ġnarrow ly
+Ġlm t
+Ġspir its
+Ġuv ula
+Ġcarcin ogenicity
+Ġdh k
+Ġnic us
+Ġ11 8
+Ġcg h
+Ġls cc
+Ġbs n
+Ġbs r
+Ġfish ing
+Ġtap ed
+ji k
+Ġrib onucleic
+Ġrib oflavin
+Ġosteo articular
+Ġect opia
+Ġsensit itre
+Ġtl x
+Ġtl ics
+Ġlin acl
+ocon junct
+Ġfc ms
+Ġsimpl ifies
+Ġham adan
+Ġangiotensin ogen
+Ġsah lgren
+Ġintens ifying
+Ġbiv p
+Ġbios heet
+Ġsubc ulture
+Ġtel ithromycin
+arp ine
+Ġvt ac
+Ġmanip ulators
+Ġolig odontia
+Ġimmers ing
+anal yses
+ik i
+Ġrp i
+40 9
+Ġju aze
+Ġunre acted
+Ġslic ing
+Ġconnect icut
+Ġhes itation
+Ġsynchron ously
+Ġappra ising
+omat is
+Ġmultim edia
+Ġcred ence
+Ġhope ful
+Ġimmunost ain
+Ġdf d
+Ġascertain ing
+Ġthym e
+rist in
+Ġath erectomy
+Ġimmunore act
+Ġrhin ovirus
+oxygen ases
+Ġmn u
+Ġxen opus
+Ġpra es
+Ġws acs
+Ġws jpr
+Ġosm otherapy
+Ġepig ast
+Ġrecover ies
+Ġcul m
+Ġannot ators
+Ġfos ters
+Ġbh is
+Ġrefus als
+Ġdial ect
+Ġsg k
+48 2
+Ġhac or
+Ġnl cr
+Ġaccommod ated
+Ġabl ate
+Ġcholest eat
+Ġradioluc encies
+Ġchel ate
+Ġurolog ist
+Ġcyl d
+Ġhcs cs
+Ġgj brhe
+Ġoi earr
+Ġepc am
+Ġoverlo oking
+align ed
+Ġtamp ere
+Ġhomozyg osity
+66 1
+Ġperpet rator
+Ġadvert ised
+Ġboy den
+Ġbz n
+Ġhypercal cemic
+Ġtowns end
+Ġgang li
+Ġmold ova
+Ġscap ulae
+Ġintrad ural
+Ġbifid obacteria
+Ġuneven ly
+Ġcem r
+Ġastragal i
+Ġdyst onia
+Ġunevent fully
+Ġnecro inflammatory
+Ġexud ative
+Ġadam s
+Ġoligo hydramnios
+Ġchat b
+Ġdetox ifying
+Ġellip se
+osit ories
+Ġconvuls ive
+Ġdissimilar ities
+Ġenum erated
+Ġorbit ofrontal
+Ġmz l
 Ġvic arious
-Ġalumin ates
-Ġalumin ium
-Ġprocl aim
-Ġapne as
-Ġcoop er
-Ġcoop erating
-Ġrelax ed
-Ġunm istak
-Ġuncom pleted
-Ġuncom parable
-Ġunfort unate
-Ġhistomorph ology
-Ġguarant ees
-Ġfibrin ous
-Ġhdl were
-Ġconceptual ize
-Ġconceptual ized
-Ġconceptual ization
-Ġinhab itable
-Ġarterial ized
-Ġconcur red
-Ġconcur rence
-Ġbench mar
-Ġbench top
-Ġunsatis fying
-Ġrheumat ologic
-Ġhierarch al
-14 3
-14 9
-14 57
-56 2
-56 3
-56 4
-56 8
-56 00
-Ġvel ar
-Ġvel ocities
-Ġti wari
-Ġsaw ed
-Ġsaw ing
-Ġculti vating
-Ġcensus es
-Ġpunct ual
-Ġfoss ae
-Ġfanc d
-Ġbed time
-Ġlys er
-Ġlys osomes
-Ġlys ozyme
-Ġgf c
-Ġgf x
-Ġasep sis
-Ġva ud
-Ġva ults
-uch ers
-Ġincon sequential
-Ġacycl ic
-ipt yline
-Ġcoinc ided
-Ġcantile vers
-Ġneo plasia
-Ġneo formations
-Ġsubc ortical
-Ġsubc ollective
-Ġsubc onscious
-rolog ie
-Ġceras mat
-Ġfamiliar izing
-Ġ62 2
-Ġ62 5
-Ġ62 7
-Ġhyperl ipemia
-Ġ79 1
-Ġdocument ations
-Ġadaptive ly
-Ġreinforce ments
-Ġacknowled gment
-Ġvacu olar
-Ġvacu olisation
-19 1
-19 7
-19 86
-Ġtail or
-Ġtail oured
-Ġpter igoid
-Ġmp d
-Ġbac itr
-Ġbig dy
-Ġbig uanide
-Ġexfoli ates
-Ġimag ers
-Ġimag ery
-Ġimag ines
-Ġfov s
-Ġplaus ability
-Ġplaus ibility
-Ġtrache otomy
-Ġsuperelastic ity
-Ġiod oform
-Ġiod ophor
-Ġcros stabs
-Ġ37 3
-Ġ37 8
-Ġtermin us
-Ġtermin ating
-Ġtermin ator
-Ġ94 9
-Ġoptimistic ally
-Ġderiv ation
-Ġderiv ates
-Ġmcf adden
-cript ome
-Ġexcav ated
-Ġexcav ating
-Ġmotiv ations
-Ġhazard ous
-Ġrepublic a
-Ġcholesterol s
-22 00
-22 285
-sh ell
+Ġcultiv ars
+Ġrhamn osus
+oduoden ostomy
+Ġbrist le
+quest ion
+Ġdisin teg
+Ġdisin hibition
+Ġrts a
+Ġcnc ds
+Ġepist emic
+Ġcic u
+Ġphal anges
+Ġprogest ins
+Ġunfamiliar ity
+Ġstab bing
+Ġpulmon ologist
+Ġdisregard ing
+Ġbah rain
+Ġclim ates
+Ġunid imensionality
+Ġepiph ysis
+Ġneuropath ies
+Ġhamper ing
+Ġhonest y
+Ġbfr cs
+Ġmountain ous
+Ġendeav ors
+Ġjurisd iction
+Ġentero endocrine
+Ġpenicill ium
+Ġcuc um
+absorb able
+Ġpreinc ubation
+Ġchamp ion
+Ġtranspos on
+Ġipt p
+Ġbrow ser
+Ġbroch ures
+Ġtryptic ase
+Ġtess ellation
+Ġshah roud
+Ġepo etin
+Ġdislod ged
+Ġtariff s
+Ġinterdep endence
+Ġsund ay
+Ġkun ming
+Ġoj q
+Ġplacent as
+Ġhpl p
+135 67
+Ġheterod im
+Ġgej ang
+Ġpseudotum our
+Ġalloh ct
+Ġalloh sct
+othiaz ide
+Ġreco il
+Ġunanim ously
+Ġglycopept ides
+Ġhexad ecanoic
+Ġyol k
+Ġsalut ogenic
+Ġsuccumb ed
+Ġprecont racted
+Ġstreak s
+Ġosteoarth ritic
+Ġhantavirus es
+Ġgans ui
+Ġrepurp osing
+Ġmorb ifera
+Ġkapp ab
+Ġnort e
+Ġsmurf less
+Ġaurant ium
+464 80
+Ġimpet us
+Ġcentrom ere
+Ġpsychotherap ists
+Ġlou is
+Ġgriff ith
+Ġimmunoturbid imetric
+Ġmicrocalc ifications
+Ġmegac olon
+Ġcolleg ial
+Ġpunctual ity
+Ġdisass emb
+Ġneurosph eres
+Ġmanne quin
+Ġlett uce
+Ġdeput y
+Ġintrapro cedural
+Ġgreg ory
+Ġradiolig and
+Ġpalmit oyl
+Ġexsangu ination
+Ġpest le
+Ġfingert ip
+726 13567
+Ġhypomagnes emia
+Ġsubreg ions
+Ġmethemoglobin emia
+Ġoliv ieri
+Ġtranqu il
+Ġhaploinsu fficiency
+Ġunaff ord
+Ġbiotrans formation
+Ġhiros hima
+Ġplung er
+ohum eral
+Ġdichlorodihydrof luorescein
+Ġrober ts
+Ġnib p
+Ġtripart ite
+Ġurotherap ist
+Ġmahal an
+Ġmalapp osition
+Ġpneumo cephalus
+Ġmyelomon ocytic
+Ġdihydrop yr
+Ġtaurodont ism
+Ġtether ing
+Ġinfrat emporal
+Ġcoerule us
+Ġcinit apride
+Ġautovacc ine
+Ġochen gi
+Ġvies cope
+Ġapbs ct
+Ġglimep iride
+Ġmonomic robial
+Ġhyperurica emia
+Ġoswest ry
+Ġcampb ell
+Ġgoetting en
+Ġburgd orfer
+Ġeuroasp ire
+Ġnitrer gic
+Ġlinacl otide
+Ġsahlgren ska
+Ġjuaze iro
+b mi
+d x
+f m
+h ilar
+i ya
+i oxetine
+m ets
+n ew
+o ved
+p ipe
+q s
+u ities
+v v
+w c
+w rit
+Ġt cl
+Ġt ld
+Ġa unt
+on is
+on ated
+on ps
+Ġs bo
+Ġs ru
+Ġthe il
+Ġo rog
+Ġc ers
+Ġc gg
+Ġp id
+Ġp uc
+Ġp isf
+Ġw en
+Ġw li
+Ġw rt
+Ġw oke
+al act
+it oba
+Ġf ax
+Ġd ion
+Ġd di
+Ġd pr
+Ġd alian
+Ġand rog
+Ġb ere
+Ġb ft
+Ġb bc
+Ġb attle
+ct cg
+Ġh iring
+Ġh gl
+Ġto y
+us oidal
+Ġn ect
+Ġn ilt
+Ġn bl
+Ġn ws
+Ġn pp
+Ġst v
+Ġst anol
+om bo
+ere re
+ur ial
+ur st
+Ġl gl
+os ves
+os hi
+im ine
+ig a
+Ġfor te
+un omide
+ut rombopag
+ab ras
+Ġv k
+Ġpro k
+ter stit
+od ec
+Ġwh ipl
+ist at
+Ġis ar
+Ġis av
+am cs
+op et
+est a
+Ġch ir
+ure ns
+ib les
+ib dq
+ess a
+ad ip
+ff ing
+Ġac rt
+Ġac itretin
+ers ed
+ac gg
+Ġdis resp
+Ġco urs
+Ġco activator
+Ġind o
+ell osis
+Ġnot ching
+Ġnot tingham
+Ġit pa
+Ġsc oo
+Ġsc orp
+Ġdi ab
+Ġfo k
+Ġaf rlm
+ens ano
+Ġsur plus
+Ġab x
+Ġk ra
+Ġk mt
+Ġall en
+Ġtr n
+ong k
+Ġreg ressive
+Ġun ions
+Ġun ifying
+Ġun born
+Ġsub national
+Ġmed dra
+Ġph ilt
+Ġqu inone
+Ġmod ulations
+Ġris ed
+Ġno h
+Ġy pd
+Ġar ven
+Ġhy omental
+te chn
+Ġcor poral
+Ġcol ost
+Ġhas i
+cr uit
+ile al
+Ġover work
+Ġover activation
+cc n
+Ġman ages
+Ġman itoba
+Ġ1 17
+Ġra bl
+Ġnon agen
+Ġnon medical
+Ġnon cleft
+Ġj acc
+Ġchar nley
+Ġem an
+Ġsim i
+Ġty rol
+Ġnumber ing
+ri ans
+Ġgl om
+Ġmult ig
+Ġcal yx
+Ġbas in
+Ġbas fi
+ob ronch
+Ġref ixation
+Ġref eeding
+Ġcar ved
+Ġpar li
+Ġpar anoid
+Ġi yg
+Ġed dy
+Ġlim p
+yn onymous
+Ġvalu ing
+Ġhyper cellular
+Ġhyper prol
+Ġif vp
+Ġ0 000
+Ġocc ured
+Ġel agolix
+Ġgra ves
+Ġindividual ize
+Ġdo a
+our ce
+Ġhyp ofib
+Ġhyp opharyngeal
+Ġhyp oglossal
+Ġep age
+Ġep iced
+Ġret reat
+ene ca
+Ġcase ous
+Ġmy pt
+Ġmy olysis
+Ġz ic
+Ġz imb
+Ġz bt
+Ġsens itis
+Ġhem in
+Ġhem ith
+Ġdel ncr
+ec ally
+ma z
+Ġcyt oh
+gen es
+Ġvi ab
+Ġmem antine
+Ġil vnc
+Ġpoly amide
+Ġpoly clin
+of osves
+Ġcur amed
+Ġcov ip
+Ġvalid ations
+Ġcle o
+Ġsk et
+Ġpsych otropics
+Ġct i
+Ġbm f
+Ġml f
+uro pe
+Ġmany ara
+Ġsaf ranin
+Ġdent icola
+Ġent rain
+Ġpat el
+Ġsl oven
+Ġright ward
+Ġsuper iors
+Ġsuper position
+Ġmm n
+Ġher d
+Ġke bel
+Ġoste opathy
+ca i
+Ġdiet etic
+aren chymal
+Ġconsum es
+Ġconsum ables
+Ġhf r
+Ġhf nt
+Ġplate a
+Ġcs bp
+Ġcs dmards
+Ġsubst andard
+Ġvir ilization
+Ġread just
+Ġcomplex ion
+ina emia
+Ġunderw ater
+Ġtn r
+Ġmand ates
+Ġcogn iz
+Ġmak erere
+Ġback ache
+Ġreal ist
+Ġreact ivated
+Ġax etil
+Ġerr atic
+Ġpd ph
+Ġoc uli
+Ġhr is
+Ġbo oked
+Ġsn d
+Ġprod igy
+Ġmar ath
+Ġtc ra
+Ġce ase
+Ġnorm ed
+Ġobtain s
+sh owed
+Ġmissing ness
+Ġmc ibdq
+Ġfluor ophore
+Ġfluor ophores
+Ġmolecular ly
+inf ections
+Ġtb c
+Ġincis ura
+Ġbow l
+orrh eic
+Ġrna i
+kn ife
+Ġaff erents
+ars ity
+Ġspl iced
+Ġpv tt
+Ġcompet ed
+Ġturn er
+Ġpm di
+gt ts
+Ġhp o
+Ġlas h
+Ġalg eria
+Ġaa ph
+Ġvar c
+Ġinterpret ative
+Ġprincip als
+Ġenter ography
+Ġmethyl cellulose
+Ġfar ms
+Ġarr ives
+Ġcruc iata
+Ġcalib ur
+Ġid sa
+Ġbroad ening
+Ġtt cm
+Ġmil iary
+Ġprophyl actically
+Ġrehabil itations
+Ġdrain ages
+Ġns iv
+Ġtherm ally
+Ġpf ds
+Ġhypog ammaglobulinemia
+Ġtgf a
+Ġgh an
+Ġarg os
+Ġonc ogenesis
+Ġlc n
+Ġah c
+Ġmv cs
+Ġmv aes
+tt g
+Ġpeep i
+Ġdeterior ations
+Ġneph el
+Ġevol ut
+Ġple ased
+Ġsb i
+Ġsb xf
+Ġtet rof
+Ġhm dc
+Ġvo iced
+Ġfa w
+Ġcode book
+Ġts i
+Ġpw pd
+Ġker atosis
+Ġsig lecs
+Ġremark ed
+Ġthrombo elast
+chym e
+Ġrr v
+Ġamyl in
+Ġile itis
+cy geal
+Ġbott led
+27 80
+Ġpig lets
+Ġrf cs
+Ġdors if
+Ġundert reated
+Ġaw i
+Ġnons ynonymous
+Ġtrip led
+Ġconscious ly
+Ġmas on
+Ġglomer ata
+18 6
+Ġexplor ations
+oin ferior
+oin terstit
+acc g
+Ġepiderm oid
+Ġmesh work
+30 8
+Ġquar ant
+Ġfc v
+Ġsubs amples
+Ġinterm uscular
+Ġlh on
+Ġpresum ption
+Ġgsh s
+Ġexec g
+pect omies
+Ġson ographically
+Ġcus o
+Ġcus pal
+Ġsut ural
+Ġmicros ize
+Ġtun ed
+Ġpall idus
+Ġherb a
+Ġmoment um
+Ġsecret es
+Ġgum my
+Ġdead ly
 Ġtight ened
-Ġaa o
-onduc tivity
-erup ted
-Ġpip eline
-Ġpip ettes
-Ġwal a
-Ġwal ter
-Ġwal king
-Ġwal pole
-Ġdic el
-Ġdro ve
-Ġdens er
-Ġbd dma
-Ġegg s
-Ġstv s
-Ġstro kes
-Ġnerv osa
-Ġgon zale
-Ġgot tsaun
-Ġgot tingen
-Ġgot tesman
-Ġvill i
-Ġvill arim
-Ġrib bing
-Ġreserv ations
-Ġscop ing
-Ġfores ight
-Ġfores een
-Ġhaem oglobin
-Ġhaem odialysis
-Ġhaem atinics
-Ġrod ent
-Ġrod ents
-Ġtrack ed
-Ġkol wij
-Ġkol omgro
-Ġarbit ration
-Ġphy ton
-Ġdiscontin uous
-Ġdiscontin uity
-Ġspear mint
-Ġknowing ly
-Ġdrink able
-Ġschematic s
-Ġschematic ally
-Ġfacem asks
-Ġslim line
-Ġ56 2
-Ġreplace ments
-Ġfavor ite
-Ġdownreg ulate
-Ġentr ained
-Ġacquire ment
-Ġopportunistic ally
-Ġinher it
-Ġelectroph erogram
-Ġplei osis
-Ġscatter plot
-Ġunexpected ness
-Ġknockdown on
-Ġpteryg opalatine
-26 6
-Ġaw ad
-Ġaw arding
-Ġaw aking
-Ġaw akened
-Ġaver sion
-Ġaver ting
-Ġthyroid itis
-Ġsan nino
-Ġsan chez
-Ġov oid
-Ġwom ac
-Ġdum mies
-level d
-Ġgent ler
-Ġgent amicin
-Ġorb icularis
-Ġperic oronal
-Ġpertain s
-Ġpertain ed
-Ġdev ise
-Ġdev ote
-Ġdev astating
-Ġindian a
-Ġrelig ated
-Ġrelig iosity
-Ġku rol
-Ġku hle
-Ġkill er
-Ġenrich ing
-Ġbran ched
-Ġmang os
-Ġmang old
-Ġmang alore
-Ġnonc ulture
-Ġnonc ariogenic
-Ġju iz
-Ġcommit ments
-Ġtransg lut
-Ġsmirn ova
-Ġinstal ling
-Ġdoub ted
-Ġ52 1
-Ġ57 7
-Ġhumid or
-Ġhumid ness
-Ġhumid ifies
-Ġswiss meda
-Ġpsychi atry
+Ġblast ed
+Ġconv iction
+Ġgad ofosves
+Ġbrux ers
+Ġgon orrhoeae
+Ġstere ological
+Ġvast a
+Ġnail fold
+Ġuro kinase
+Ġdecid ual
+Ġti ered
+Ġchloroform ic
+Ġbup le
+Ġenvelop ed
+Ġcry ostat
+Ġsalv aged
+88 9
+Ġvib rio
+Ġign ition
+Ġsedent ariness
+Ġinfra orbital
+Ġxen ogenic
+Ġinters ect
+Ġdichotomous ly
+Ġbav aria
+Ġintrac uff
+Ġstar ling
+Ġcoexist ed
+Ġperine phric
+Ġdisposition s
+Ġrecon c
+Ġsj ov
+Ġvort ioxetine
+Ġreplic able
+Ġreform atted
+Ġirr itative
+Ġfb ic
+Ġok m
+Ġdihyd roc
+mal ine
+Ġmismatch es
+87 4
+Ġlus utrombopag
+Ġcrack ing
+Ġphilosoph ies
+Ġstream line
+Ġfarm er
+Ġzyg osity
+Ġque ues
+Ġevac uate
+Ġcock croft
+Ġinqu iring
+Ġhemisph eric
+Ġmag i
+Ġtran se
+Ġthalass emic
+Ġsad dle
+Ġferro zine
+Ġmbl s
+Ġzn onps
+Ġstigm atizing
+Ġanion ic
+Ġsphygmoman ometers
+Ġais i
+Ġrectang les
+Ġhps m
+Ġphr ased
+Ġgranular ity
+Ġarous als
+Ġcooper ating
+Ġcps s
+Ġjum per
+mg ren
+Ġclostrid ial
+Ġtimefram es
+aga ag
+Ġquin ones
+Ġfiref ly
+Ġnond is
+Ġoverwhelming ly
+Ġscot ia
+Ġvapor izer
+Ġsubsid y
+Ġpaternal istic
+Ġantit ussive
+Ġist ent
+Ġreticul ocytes
+Ġglycyrrhiz ae
+Ġenrolle e
+Ġcultiv able
+Ġdac ron
+Ġcounsel or
+Ġhyperp olarization
+Ġlew y
+Ġanhyd ride
+Ġnephrolog ist
+Ġerm a
+Ġmural is
+Ġretr usive
+Ġimmunophen otypic
+Ġcommens urate
+Ġcartrid ges
+Ġgpr d
+Ġshen xiong
+Ġnutr iscore
+Ġuap n
+Ġvrs a
+Ġmans oni
+Ġlumin ometer
+Ġsacro iliac
+Ġpolyd ispersity
+Ġpii ip
+Ġwilli am
+Ġnonsmok er
+Ġstomat ognathic
+Ġexped ite
+Ġglaz ing
+Ġnaphth oquinones
+1799 971
+Ġcied e
+Ġpione ering
+Ġbaro re
+Ġfad d
+Ġunim proved
+Ġpericor onal
+Ġbrow ning
+Ġhydrod ist
+Ġleukotri enes
+Ġreplen ished
+Ġxenob iotic
+Ġfemin inity
+Ġtoddl er
+Ġprest ige
+Ġembal med
+Ġinterrelations hip
+Ġgav aged
+pos itive
+Ġsund ays
+Ġureapl asmas
+Ġdisacchar idase
+Ġuniversit as
+Ġholm ium
+Ġretract ors
+Ġmicroin jection
+Ġtubul ointerstit
+Ġreappe arance
+Ġhert z
+Ġmercapt oethanol
+Ġpedest rian
+Ġcrosslink ing
+Ġurog raphy
+Ġincarcer ated
+Ġscho enfeld
+Ġpari et
+icul opathy
+Ġcatat onia
+ulph ate
+Ġbuch e
+Ġvsa a
+Ġemolli ents
+Ġhypermet abolic
+Ġabsc issa
+Ġschm id
+Ġradioisot ope
+Ġcren ulata
+Ġpaeonia e
+Ġantituberc ulosis
+Ġstil b
+odyst rophy
+Ġendom ys
+Ġpenins ula
+Ġgrandm other
+Ġlatif olia
+Ġhousew ives
+Ġwhol ly
+Ġsarcom ere
+918 592
+Ġrecol lection
+Ġunreg ulated
+Ġadjo ining
+17878 362
+Ġcochinchin ensis
+Ġbrill iant
+Ġlitig ations
+Ġzoon otic
+Ġuroflow metry
+Ġvirid ans
+Ġdisent angle
+Ġpentrax in
+Ġtrel agliptin
+Ġintertro chanteric
+Ġspiel berger
+Ġelix hauser
+Ġxj ek
+pyl ori
+Ġcoval ently
+Ġolmes artan
+Ġequid istant
+Ġtnfrs f
+Ġterpine ol
+oconjunct ivitis
+Ġmahalan obis
+Ġwhipl ash
+Ġscoo ters
+Ġarven se
+Ġparli ament
+Ġiyg j
+Ġepiced ium
+Ġzbt b
+Ġcytoh ubba
+Ġkebel es
+Ġtetrof osmin
+Ġgadofosves et
+6 50
+6 18
+6 37
+b ling
+c urrent
+c ode
+d uced
+f ire
+h b
+j m
+k el
+l ut
+l ades
+r f
+t imes
+t aster
+u itive
+v ts
+v az
+y at
+Ġa os
+Ġa am
+Ġa opp
+re itol
+on ometric
+on ovine
+at is
+at ins
+Ġs xi
+Ġs aint
+Ġc ations
+Ġc amm
+Ġc ili
+Ġw rm
+Ġan akin
+Ġf ant
+Ġf bd
+ic f
+or ionic
+Ġd ancing
+Ġm ors
+Ġb ard
+Ġb gn
+Ġb acc
+Ġb vas
+Ġb ronj
+as emia
+Ġh ira
+ve cs
+ul ia
+ul bar
+Ġn ocardi
+Ġn idal
+Ġst amp
+om imetic
+Ġl rs
+Ġl itt
+Ġl jt
+et oh
+os arcomas
+Ġg pe
+Ġg ong
+Ġg rh
+Ġg ta
+Ġg upta
+id ipine
+ol licular
+if olius
+il u
+ra ines
+ra gment
+Ġon ch
+ut i
+Ġv ard
+Ġv ild
+Ġv rd
+Ġv mn
+od ef
+od omain
+Ġex erg
+Ġex eter
+Ġr ri
+Ġr ha
+Ġr imon
+Ġr anson
+ity per
+Ġal nd
+Ġwh ew
+ag ogue
+am ia
+am ined
+am ura
+ate x
+Ġde identified
+Ġch is
+Ġch ad
+Ġch uan
+Ġse ifa
+Ġper isin
+ign ed
+Ġle fl
+Ġle acs
+Ġac j
+Ġac ut
+ac ental
+Ġtw ee
+und um
+Ġwe ave
+pl at
+Ġbet hes
+Ġne ub
+Ġne omta
+Ġsc m
+Ġdi as
+Ġdi and
+Ġfo a
+Ġaf cs
+Ġaf xl
+and ez
+Ġshow er
+Ġk as
+Ġtr ips
+Ġmet res
+Ġpl oidy
+Ġlevel ed
+Ġpres cale
+Ġun obstruct
+Ġsub normal
+Ġthere for
+Ġph gs
+Ġph mb
+Ġclin oid
+Ġqu bit
+ap ical
+Ġno un
+Ġy ard
+Ġy ish
+Ġact a
+Ġact igraphy
+Ġant acid
+Ġant acids
+Ġtest icles
+Ġcol ombo
+Ġext ents
+Ġfin er
+ew s
+ew icz
+Ġser ca
+Ġser ogroups
+Ġover flow
+Ġmeth imazole
+Ġra hf
+Ġtrans oral
+Ġnon acc
+Ġperi arterial
+Ġperi hilar
+Ġj d
+Ġj ung
+Ġj gi
+Ġsp oon
+Ġend anger
+Ġdem ethylation
+eth nic
+Ġstatist icians
+Ġpred li
+Ġgl aze
+Ġcal amus
+ob i
+ob in
+Ġli hc
+Ġsug ared
+ust es
+Ġpar kin
+Ġed ged
+Ġfl anders
+Ġatt raction
+Ġred istribut
+Ġhyper function
+Ġpath o
+Ġif ns
+Ġprim us
+Ġ0 12
+Ġpain ted
+Ġcent en
+Ġcent iles
+Ġhist orm
+Ġhist ocompatibility
+Ġocc urence
+Ġel ute
+Ġins ular
+ds pathic
+Ġ3 50
+ov isc
+Ġav ib
+ie h
+Ġrep orters
+Ġintra ex
+Ġpoint es
+Ġmy omas
+Ġmy otomy
+Ġwill is
+Ġmal rot
+Ġmicro encaps
+Ġthem atically
+Ġimpact ful
+Ġca ir
+Ġpa ul
+Ġil s
+Ġhum eri
+Ġct etoh
+Ġprom ises
+Ġadd o
+Ġtak ara
+Ġorgan izers
+Ġequ imolar
+Ġlip us
+Ġlip otoxicity
+Ġsl ipp
+Ġprotocol ized
+Ġda e
+dl ns
+Ġassay ing
+Ġfract uring
+Ġmr im
+Ġmid st
+Ġmid life
+Ġproportion ately
+Ġpur kin
+Ġsumm ated
+Ġcam rel
+Ġtub ers
+Ġorth oses
+Ġcm f
+rob e
+Ġcod ox
+Ġhs u
+ss c
+Ġpd as
+Ġpp rom
+Ġdiss ip
+Ġfast idious
+ula z
+Ġemb ark
+Ġsn on
+Ġobject ions
+uk ast
+Ġantioxid ation
+Ġlik ing
+Ġbro ok
+Ġbal tic
+Ġrapid ity
+Ġmig raines
+Ġlat t
+Ġmc b
+Ġmc ce
+Ġmc ode
+Ġwash er
+Ġcirrh otics
+Ġspe eding
+Ġadmitted ly
+Ġ10 2
+Ġ19 5
+Ġpersonal ities
+Ġampl ifies
+12 6
+rin olytic
+Ġpass ion
+Ġaccum bal
+Ġarm itage
+Ġsci ensano
+Ġsd oh
+Ġht lv
+Ġten g
+Ġsil hou
+Ġrh tm
+Ġcyst ine
+Ġcyst adenoma
+gt cc
+oly l
+Ġroc en
+Ġsha w
+Ġpol r
+Ġmp x
+Ġnm j
+Ġck p
+Ġvital s
+Ġmutation taster
+Ġcollect ives
+rog raphy
+Ġna vi
+Ġna ples
+rich osis
+Ġduct ular
+Ġds d
+Ġid ar
+Ġsf rp
+Ġbuc lades
 Ġpurch ases
-Ġpurch asing
-Ġ82 1
-Ġveget ating
-Ġmulticent ric
-Ġantagon ism
-Ġwithdraw ing
-Ġwithdraw als
-Ġelectrophores ed
-environment al
-45 2
-45 9
-tons illoliths
-Ġaud its
+Ġhu i
+Ġfer re
+Ġpret rans
+21 1
+Ġconver ging
+Ġast m
+Ġast ro
+Ġast emi
+oz oal
+Ġwal ks
+Ġbd g
+Ġns vts
+gl omer
+Ġmb cs
+Ġrol ler
+Ġrevers ibly
+Ġlc u
+Ġdiver ge
+Ġviol ate
+Ġfm r
+Ġasth enia
+Ġmh n
+Ġmh fs
+22 9
+Ġ16 0
+Ġduoden itis
+Ġcit robacter
+Ġsemi ar
+Ġsac s
+Ġcephal ometry
+Ġbronch oscopes
+fl ur
+Ġwr ms
+Ġcold ness
 Ġaud ited
-Ġaud ibly
-Ġaud axceph
-Ġthal amus
-Ġsure call
-Ġpir ds
-Ġpfe iffer
-Ġwel tzi
-Ġmh z
-Ġbus an
-Ġbow l
-Ġbow s
-Ġbow ing
-Ġhan ley
-Ġhold e
-Ġhold ers
-Ġhoney comb
-Ġef netb
-Ġln ln
-Ġny on
-Ġny vad
-Ġascertain ing
-Ġcontig s
-Ġalve olopl
-Ġring git
-Ġproof ing
-Ġproof reading
-Ġcomment aries
-Ġchond rocyte
-Ġshir akata
-Ġrecomb ination
-Ġintens ifying
-Ġintens ifies
-Ġki emle
-Ġkil o
-Ġkil ogram
-Ġkil ovolt
-Ġphone tic
-Ġphyl otyped
-agg tg
-agg cat
-Ġembr aced
-Ġembr acing
-Ġembr asures
-Ġembr ittlement
-Ġperiodic ity
-Ġsmell s
-Ġarchae ological
-Ġprofound ly
-Ġestrogen ic
-Ġtaq tm
-Ġtaq ii
-Ġ95 1
-Ġpowerful ly
-Ġsubsid y
-Ġsubsid izing
-ocyt ose
-ocyt opathies
-Ġexceeding ly
-Ġultrason ography
-Ġengine ers
-Ġengine ered
-Ġafford ed
-Ġsubmuc ositis
-aryng ologic
-Ġirrele vance
-Ġguarantee ing
-Ġtil es
-inter media
-Ġcoc a
-Ġcoc oyl
-Ġcoc onut
-Ġpist ons
-Ġinex plicable
-Ġinex tricably
-Ġank ara
-Ġfung iform
-Ġbatch elor
-Ġrer un
-Ġreass ured
-Ġreass uring
-oll ate
-Ġont ogeny
-Ġfoot point
-Ġfoot board
-Ġprescrib es
-Ġobst etrix
-Ġquin quennial
-Ġarc uate
-Ġagric ultural
-Ġdiscre et
-Ġsput tering
-Ġfried y
-Ġbasel ined
-Ġpulpect omies
-Ġverte idigung
-Ġimmunore gulatory
-Ġ76 92
-Ġcyclospor in
-Ġ86 8
-Ġplateau ed
-Ġdissip ate
-Ġdissip ater
-Ġdissip ating
-Ġdissip ates
-Ġcarboxyl ation
-Ġpropag ating
-Ġmigr ate
-Ġsuspic ions
-Ġecological ly
-Ġjustify ing
-Ġneurolemm omas
-Ġineffec tiveness
-Ġobliter ated
-Ġobliter ate
-Ġobliter ations
-Ġaggrav ates
-25 1
-25 4
+Ġvo a
+Ġantagon izing
+Ġantagon izes
+Ġts uk
+Ġ13 1
+Ġ25 9
+Ġbul bar
+Ġlm cos
+Ġrr so
+Ġunst ead
+Ġcn i
+Ġcn vs
+Ġforest ry
+Ġsta pled
+Ġnp d
+ira vir
+Ġcoup lets
+Ġtal on
+Ġtal us
+Ġdb il
+Ġsociodem ographics
+15 8
+Ġcomfort ing
+Ġfri ability
+Ġmicroc ytic
+Ġded uct
+Ġempt ied
+Ġconven ed
+Ġaz m
+rox ide
+Ġpercutaneous ly
+Ġshr unken
+Ġhex oside
+Ġmyc ological
+Ġdesc ended
+bor g
+Ġdw m
+Ġsynthes es
+Ġabd ulaz
+Ġpolar izing
+Ġmidw est
+ih uang
+60 2
+Ġson opet
+Ġdoub les
+Ġarray c
+Ġmultip otent
+Ġjak arta
+ifer ol
+Ġkr use
+Ġdt r
+Ġdt na
+Ġdt pa
+29 8
+Ġepic utaneous
+Ġepic lus
+Ġprecip it
+Ġchond rogenesis
+Ġcef p
+Ġmacro adenoma
+Ġpor ion
+Ġtax ane
+Ġvacu o
+Ġstere ophotogrammetry
+Ġwest phal
+Ġhv m
+Ġcoagul opathic
+Ġlaw rence
+Ġthym oma
+olis thesis
+Ġkd ce
+Ġrub ra
+Ġglucos yl
+Ġfi ji
+con clusion
+Ġmail s
+Ġtrich oscopy
+Ġdeline ations
+Ġmesen chyme
+Ġkm f
+ochrom ic
+Ġao es
+Ġperfor ators
+Ġves ic
+Ġpun jab
+Ġintrath ecally
+Ġglycer ophosph
+ommod ative
+Ġgar nered
+Ġmicrod ontia
+Ġputative ly
+Ġibm x
+Ġphenyl propan
+Ġtreg pma
+Ġlg as
+Ġcardio emb
+Ġaj uga
+Ġberber is
+Ġmetron ome
+omed ullary
+Ġnitr ide
+Ġspermat ids
+Ġvenom s
+thet ical
+Ġisch i
+Ġsomat oform
+Ġspondyl olisthesis
+Ġimmunoblot ted
+Ġgyr b
+Ġtumorigen icity
+Ġantis era
+Ġanaesthet ised
+Ġmont gom
+Ġsuff ice
+Ġdistort ing
+Ġspiral is
+Ġlubric ated
+Ġmcc b
+Ġhyperkal aemia
+Ġcvr f
+Ġmicrof ilar
+Ġtriph enyl
+Ġprecondition ed
+Ġresorb ing
+Ġdemineral isation
+Ġdere cruit
+Ġtoile ts
+Ġwrap per
+Ġhq t
+Ġard isia
+Ġshadow ing
+Ġwm ta
+Ġsubsid iary
+Ġbibli ographies
+Ġcil iated
+Ġchiropract or
+Ġtelev is
+Ġcdt b
+Ġrhamn opyranoside
+Ġforget ting
+Ġparv ovirus
+Ġprocr ustes
+Ġfores ts
+Ġlump ur
+Ġhast atus
+Ġfla pless
+Ġhst ni
+Ġchord ee
+Ġbent all
+Ġdcf da
+Ġdihydroxy vitamin
+Ġglomerul osclerosis
+glut aryl
+Ġkyph otic
+Ġwol f
+Ġnormog lycemia
+Ġcheb ula
+Ġpreserv atives
+Ġmispl aced
+Ġtour ists
+Ġtour maline
+Ġjs nm
+Ġholid ay
+Ġbacterioph age
+gre en
+Ġhypokines is
+Ġmycel ial
+Ġhbm fs
+Ġloud ness
+Ġsbr s
+Ġileocol onic
+Ġrumin ococcus
+Ġresect ability
+Ġmonoter pene
+Ġhemip elve
+Ġchyl ous
+Ġwip ing
+Ġcontempl ated
+Ġjuxt ap
+Ġjag ged
+Ġunambiguous ly
+Ġamazon ensis
+Ġhydrocarb on
+Ġinvers ed
+Ġstyl us
+Ġicn arc
+Ġipm ns
+Ġlug ano
+Ġfel dspathic
+olu ene
+Ġcohab iting
+Ġarist ot
+Ġcentro ids
+Ġifv n
+Ġoligos accharides
+Ġpostanes thetic
+Ġreinser tion
+Ġshsst c
+Ġhelmin th
+Ġhing ed
+Ġmonobl oc
+Ġelis as
+Ġctca e
+Ġprese lected
+Ġpromyel ocytic
+Ġswell ings
+Ġunjust ified
+Ġculmin ating
+Ġtrach omatis
+Ġvitre ous
+Ġelectrop oration
+Ġhermene utic
+Ġlanz hou
+aggl utinin
+Ġparane oplastic
+Ġmultiform e
+Ġsaccha romyces
+Ġfiduc ial
+Ġrejuven ation
+Ġkiv u
+Ġpharyn geus
+Ġhypercholesterol aemia
+Ġindiscrimin ate
+Ġhypernat remia
+Ġsemicon ductor
+Ġdres den
+Ġasympt otic
+Ġruc am
+Ġjoln h
+Ġisav uconazole
+Ġjacc ard
+Ġviab ahn
+Ġentrain ment
+Ġsloven ian
+Ġplatea ued
+Ġmarath on
+Ġnsiv cd
+Ġanakin ra
+Ġnocardi osis
+Ġvild agliptin
+Ġwhew ellite
+Ġperisin usoidal
+Ġlefl unomide
+Ġbethes da
+Ġneub auer
+Ġdiand ric
+Ġunobstruct ed
+Ġyish en
+Ġnonacc ommodative
+Ġslipp age
+Ġpurkin je
+Ġcamrel izumab
+Ġbuclades ine
+Ġepiclus ianone
+Ġmontgom ery
+0 66
+1 10
+3 10
+4 36
+b ies
+b eta
+d ep
+g one
+g cs
+l an
+l um
+p k
+p ool
+r ys
+s ix
+t ered
+u ish
+v an
+z es
+Ġt xt
+Ġt ones
+Ġa pec
+Ġa ural
+Ġa pert
+on uria
+at ag
+at ism
+at ised
+Ġs ere
+Ġs emia
+Ġo qlq
+Ġo gtts
+er ules
+Ġp ram
+Ġp ids
+Ġp stat
+Ġw os
+Ġw ss
+Ġin born
+Ġan ea
+Ġan uria
+it ory
+Ġf se
+Ġf ission
+ic ardial
+Ġd ws
+Ġm te
+Ġb acs
+as vir
+an ax
+ar ters
+ing le
+Ġre val
+ct ca
+Ġh gc
+Ġe wing
+Ġto ps
+Ġn ong
+Ġn du
+Ġst amped
+ur ates
+Ġl ra
+Ġl yg
+Ġl acc
+os f
+im i
+Ġg us
+ol t
+ol ae
+ol actone
+Ġas bo
+ud ate
+un ce
+ra ch
+ab ant
+ab we
+res hold
+Ġv wd
+Ġv oting
+od a
+Ġex terior
+Ġex onic
+Ġr ved
+Ġr br
+Ġr ij
+Ġr xr
+Ġr antes
+em ental
+em onic
+Ġis d
+um oral
+ir cular
+oc cip
+Ġde pt
+Ġde uter
+Ġch q
+Ġch ulal
+ore active
+Ġcomp ose
+ult ured
+Ġpre b
+Ġper n
+Ġper chlor
+Ġper col
+able ment
+Ġgro oving
+Ġsh er
+Ġsh aving
+Ġsh unted
+ip ril
+ac lax
+Ġtw a
+Ġare g
+Ġco ales
+Ġwe ber
+Ġcont est
+Ġcont ention
+Ġcl aust
+Ġhe w
+Ġhe ater
+Ġne vus
+Ġha f
+ition al
+Ġful vest
+Ġk irs
+Ġob nd
+Ġob ey
+Ġtr iat
+Ġinter hospital
+Ġun ify
+Ġam astigotes
+Ġacc used
+Ġclin var
+Ġno b
+Ġno ble
+Ġfol iate
+Ġfol fox
+Ġtim osaponin
+Ġexp och
+Ġy b
+Ġbl ues
+Ġar n
+te br
+te enth
+Ġcor ps
+Ġpr k
+Ġpr dm
+Ġpo inter
+cr ystalline
+Ġdes moid
+Ġag lyc
+Ġover activity
+Ġra pt
+ang inal
+Ġobser ves
+int uitive
+Ġdep ressions
+Ġj on
+Ġj ed
+Ġj av
+Ġsp et
+Ġdem ise
+Ġdem ees
+Ġval acycl
+Ġpost in
+Ġpost central
+Ġpost ischemic
+Ġsm b
+Ġtra cp
+Ġpop s
+Ġma han
+inal ly
+Ġdr ier
+Ġgl ad
+Ġgl iding
+Ġprog av
+ox antrone
+ob ox
+ob iological
+Ġident ifications
+Ġref illing
+Ġref ills
+Ġmin as
+Ġmin ded
+Ġi arc
+Ġi kb
+Ġlim k
+av p
+Ġfl us
+Ġhyper oxic
+Ġhyper paramet
+Ġcent ella
+Ġhist oplasmosis
+Ġel iz
+Ġgra ils
+ps um
+Ġol faction
+Ġav v
+Ġprot otyping
+Ġpress o
+Ġep endym
+Ġimmun op
+Ġimmun ochemistry
+Ġz s
+Ġz an
+Ġvol ar
+Ġprof itability
+Ġhem othorax
+Ġdel ve
+Ġsyn opsis
+Ġfib rovascular
+ma jor
+Ġfra ught
+Ġcd ca
+ha w
+Ġdesign ers
+Ġir rs
+orb ide
+Ġca es
+Ġca hp
+Ġcir i
+Ġang uish
+Ġil o
+Ġcur ious
+Ġsk f
+Ġdys biotic
+Ġadv ia
+Ġhel mets
+Ġserv qual
+li o
+li hood
+Ġq h
+Ġmat ric
+Ġequ ated
+Ġlip osome
+Ġlip osarcoma
+Ġur mia
+Ġbr is
+Ġbr inp
+Ġvers atility
+ins ki
+Ġcy pr
+Ġhand les
+Ġdeg asser
+dl ing
+Ġbre gs
+Ġmr cr
+Ġauth ored
+Ġos d
+Ġos p
+Ġclear s
+Ġwater pipe
+Ġmuc ilage
+Ġu ip
+Ġu ai
+Ġfigure d
+Ġconc ana
+Ġfew est
+Ġcoll ins
+oy e
+roscop ies
+Ġcs es
+Ġcs ha
+Ġdev ote
+Ġcross bites
+Ġcm ps
+Ġcv h
+Ġcv hs
+Ġ9 00
+Ġvas ogenic
+Ġdom inates
+Ġcp ae
+Ġhome obox
+zym es
+Ġspecial isation
+Ġiv cci
+Ġmit oxantrone
+Ġbur ied
+Ġbil oma
+Ġbil ayer
+Ġprepar atory
+struct ure
+Ġrad ically
+Ġspect abilis
+Ġeas d
+Ġvisual izations
+he at
+Ġsept ate
+Ġvisit or
+Ġgastro pexy
+Ġmt bd
+Ġnucle osome
+Ġx s
+Ġsn omed
+Ġsn orers
+Ġhepatic ojejunostomy
+Ġmd asi
+oh l
+Ġcycl ed
+Ġindepend ency
+Ġaltern ations
+Ġport land
+Ġintestinal is
+Ġtend in
+ogl ut
+Ġseps ityper
+Ġfluor ometric
+Ġbiological s
+Ġpercept ible
+sw ell
+inf o
+Ġtb w
+Ġlum ina
+Ġsed iments
+Ġcircum maxillary
+Ġjap onic
+20 2
+Ġuc sf
+Ġpet rous
+Ġoh io
+Ġdescript ives
+land ular
+Ġfd d
+Ġrh v
+Ġwave let
+gt gt
+Ġsten osed
+oly s
+Ġmulti ethnic
+Ġtransf ect
+Ġtransf ecting
+Ġunc iv
+Ġtri ads
+Ġcc as
+Ġger anyl
+Ġger ais
+Ġna q
+Ġna is
+Ġamb ulate
+Ġsul odex
+Ġgp crs
+Ġfram eless
+Ġseptic aemia
+Ġdisp uted
+Ġnan a
+Ġherbal s
+Ġid p
+Ġid t
+Ġsf n
+ead s
+Ġanatom ies
+Ġbroad cast
+Ġdc v
+Ġpaper work
+Ġom im
+Ġpret reat
+Ġtt nt
+Ġtrache obronch
+Ġchart ed
+Ġconver ter
+Ġcore q
+Ġast raz
+ingu inal
+iop alatal
+Ġnc ct
+Ġnc ov
+Ġcf nas
+Ġlapa roscopically
+Ġtranscription ally
+Ġmb ec
+Ġpf ps
+Ġpf izer
+Ġpelv iva
+38 803
+Ġtib c
+Ġcounter meas
+Ġrv p
+Ġ14 1
+Ġhl ms
+Ġcortic o
+uff ed
+Ġah ri
+17 5
+Ġmh l
+Ġlys e
+Ġmelan ogenic
+22 39
+Ġ16 8
+Ġsar a
+Ġpg w
+irc ulatory
+Ġovere ating
+Ġdiscomfort s
+Ġlib erated
+Ġunf easible
+Ġhm aclax
+Ġphyt ocomp
+Ġphyt osomal
+Ġia e
+Ġirradi ations
+Ġpw a
+Ġpy reth
+Ġbound s
+Ġbul bs
+Ġlive lihood
+Ġparas agittal
+Ġsap on
+Ġreproduc ibly
+Ġcn cs
+Ġperic rypt
+Ġlp c
+Ġnervous ness
+Ġdn cr
 25 7
-200 8
-30 3
-30 6
-73 1236
-92 4
-gt ctg
-gt ctc
-gt acgga
-pens ating
-zi oglu
-Ġtre ble
-Ġtre acher
-Ġtre lle
-Ġtab s
-Ġtab ular
-Ġtel esc
-Ġaz ide
-Ġson ographic
-Ġson ically
-Ġson ographically
-Ġsas souni
-Ġcot angent
-Ġpiv oxil
-Ġfh p
-ann in
-ann es
-Ġeye let
-Ġeye wear
-Ġstock s
-Ġstock aligned
-Ġlam as
-Ġlam ella
-Ġlad en
-Ġlad der
-Ġnom ograms
-Ġven ue
-Ġven ipuncture
-Ġves ion
-Ġves icles
-Ġves terinen
-romy ces
-Ġlex ical
-Ġlex icon
-Ġhapl oins
-Ġtris phosphate
-Ġneph ritis
-Ġneph rology
-Ġneph elometry
-Ġneph ropathy
-Ġneph rologie
-Ġunw ished
-Ġweigh s
-Ġinvest ing
-Ġoverf it
-Ġbiot ech
-Ġbiot ene
-Ġbiot inyl
+Ġgal ant
+34 4
+Ġtf di
+Ġgir dle
+Ġaw r
+Ġses cc
+Ġnk cc
+Ġgs m
+Ġbol ster
+Ġeq tl
+Ġapex es
+Ġine fficiencies
+Ġdermat oses
+Ġcari ology
+Ġinfant icide
+30 4
+Ġpu a
+anth a
+Ġlot tery
+Ġef b
+Ġpolar ities
+Ġbt k
+Ġpic p
+Ġcha os
+Ġih i
+Ġnac ional
+Ġcustom ization
+Ġforeign ers
+Ġcoron aries
+Ġtrun ks
+Ġimped iment
+Ġrp f
+Ġrc di
+Ġrc bf
+Ġfn mep
+Ġche ops
+Ġnb m
+Ġdox epin
+Ġly ase
+Ġfre eman
+Ġmacro prolactinomas
+Ġtax es
+Ġtac i
+Ġallerg enic
+Ġmu a
+Ġmu fa
+Ġhall ux
+wash ing
+Ġsarc omatoid
+Ġnad kd
+Ġrip arin
+Ġinfer ring
+Ġphil ip
+Ġxyl ose
+Ġeh rs
+Ġrhin o
+Ġrhin orrhea
+Ġaspart ic
+Ġcry os
+Ġelectroly tic
+Ġskew ing
+Ġgy psum
+Ġvib rating
+Ġirrit ated
+Ġtin etti
+Ġrecover s
+pop exy
+Ġretrieval s
+78 2
+Ġtu f
+Ġunm utated
+Ġannot ator
+Ġwait list
+Ġtransth yre
+Ġtj s
+Ġhub s
+Ġsj l
+Ġwat son
+Ġsplint ed
+Ġfibro proliferation
+Ġsg as
+Ġbank ing
+artan in
 Ġsupposed ly
-Ġmicrot ome
-Ġmicrot omography
-Ġmicrot opography
-Ġtransduc ing
-Ġ35 98
-Ġthroat s
-Ġsla ughtered
-Ġpolys pecific
-Ġpolys accharides
-Ġpolys accharide
-Ġuz unoglu
-Ġinterns hip
-Ġteen age
-Ġprosper ous
-Ġundersc oring
-Ġmorphometric s
-Ġsteril izable
-Ġcamp bell
-Ġcamp oresi
-Ġdeficient primary
-Ġaccompl ishment
-Ġneurolog ist
-ocarcin oma
-67 2
-ga acgtgtc
-gl cn
-ptic ism
-with in
-Ġtc f
-Ġtro ugh
-Ġtro pe
-Ġtro ubles
-Ġtess ini
-Ġtess elation
-Ġthrom boemb
-Ġsick le
-Ġsick ness
-Ġost ecotomy
-Ġost ensible
+Ġmiscar ried
+Ġfibrom uscular
+Ġbag asse
+Ġtransc ortical
+Ġnasoph aryngitis
+renal ine
+Ġabl ating
+Ġze yl
+Ġbaical ensis
+Ġengine er
+izol am
+Ġaerosol ized
+Ġfus ing
+Ġinoculum s
+Ġvene zu
+Ġhop ing
+Ġgelatin olytic
+Ġgam ification
+Ġwhe els
+71 38803
+Ġkt f
+Ġcounteract s
+Ġlaws one
+Ġburd ock
+atric k
+Ġhistomorph ometrical
+Ġapolipoprotein s
+Ġcritic ised
+Ġplantar is
+Ġtz d
+Ġscl fp
+fol low
+Ġuh c
+Ġgalact oside
+Ġolive ira
+abl ock
+isin in
+Ġfle e
+Ġacclim ated
+Ġpostp on
+Ġtil ianin
+Ġrecre ation
+fil er
+Ġtrol ley
+Ġmultil ine
+Ġfq s
+Ġdiverg ences
+Ġhyperm uc
+Ġpars imony
+Ġmicrosph erules
+Ġhypoech ogenicity
+Ġsq ti
+Ġtrade off
+Ġparag raphs
+hal er
+Ġnegot iating
+Ġmme an
+Ġsubclass ification
+Ġcrev ice
+Ġparac lin
+Ġintrap arenchymal
+Ġreticul ata
+Ġdraft ing
+Ġepileptic us
+Ġhyperandrogen emia
+Ġuncon ventional
+Ġexfol iative
+oduoden al
+Ġjack et
+Ġlew inn
+Ġcasual ties
+Ġunsup ported
+Ġnem oros
+Ġsphing omy
+Ġsphing omyel
+Ġmicrotub ules
+Ġlor r
+Ġpom pe
+Ġmum e
+Ġlever aged
+Ġrab ies
+Ġnoc ardia
+Ġmetac ogn
+Ġqing dao
+Ġgrant ing
+Ġphosphoryl ate
+Ġphthal ates
+Ġpseudocyst s
+Ġciocalte au
+Ġknot ting
+Ġbarc odes
+Ġmountain s
+osper mic
+Ġbrady arrhythm
+Ġnanos cale
+Ġlumin ol
+Ġtrib es
+Ġintersp ersed
+Ġhydrochlor othiazide
+Ġcaroten oid
+Ġblow n
+Ġmicrocyst in
+Ġrevis ited
+odox ime
+Ġminds et
+Ġdir gs
+Ġneurole ptics
+Ġmacroc ytic
+Ġunim portant
+Ġdeter rent
+Ġchic ory
+Ġnid ulans
+Ġuyg h
+Ġpostpro cedural
+Ġfsw s
+Ġupt itration
+Ġske ptic
+Ġgym n
+Ġtemp ered
+Ġatherothromb osis
+Ġtheor ized
+Ġmch df
+Ġamid st
+Ġgarg ling
+ylv anicum
+Ġgerani in
+Ġreex amination
+Ġlicens ure
+Ġbifurc ations
+oti amide
+Ġlah ore
+Ġdimeth acrylate
+Ġexcer pts
+ben ch
+Ġdeploy ing
+Ġurog ynec
+Ġstereoty ped
+Ġpmvs d
+Ġsach ets
+Ġelectroanat omical
+Ġsolic ited
+Ġpens ylvanicum
+Ġdien ogest
+Ġrutaec arpine
+Ġunsus p
+Ġphell odend
+osup erior
+Ġbres low
+Ġperil ipin
+Ġmicrone ed
+Ġcerebell opontine
+Ġcites pace
+Ġheterot opia
+Ġforb idden
+Ġmacrogl obulin
+Ġmicrotiss ues
+Ġhoch berg
+Ġneurofibrom atosis
+Ġnsns aid
+Ġnewt ons
+Ġtaich ung
+Ġceac am
+buty rate
+Ġnurser y
+Ġantispasm odic
+Ġhematin ic
+Ġvitr ification
+Ġsart orius
+Ġbicon cave
+Ġhyperenh ancement
+Ġtheore m
+Ġwholes ale
+Ġultracentrif ugation
+Ġunmod ified
+Ġvolt ages
+Ġdebond ed
+Ġjejuno ileal
+Ġcycloth ymic
+Ġtantal um
+Ġhov on
+Ġthermist or
+Ġcholesteat oma
+Ġorog astric
+urens is
+ongk orn
+Ġzimb abwe
+urope in
+Ġtubulointerstit ial
+Ġrimon abant
+Ġavib actam
+Ġintraex aminer
+flur amine
+Ġcefp odoxime
+Ġderecruit ment
+Ġsemia ut
+Ġchulal ongkorn
+Ġfulvest rant
+Ġexpoch i
+Ġdemees ter
+Ġvalacycl ovir
+Ġgrails ine
+Ġsulodex ide
+Ġastraz eneca
+Ġpericrypt al
+Ġtransthyre tin
+Ġlewinn ek
+Ġnemoros one
+6 22
+7 38
+8 113
+a enoic
+d ul
+d he
+e velop
+e oside
+f v
+f x
+f illed
+f erencing
+g os
+g lu
+j as
+j ury
+l f
+m ir
+m atic
+n in
+n st
+n ame
+o op
+q hf
+s burg
+t ong
+w all
+w aves
+w ald
+x is
+y ak
+z omib
+Ġ ior
+Ġt li
+re vir
+Ġth urs
+Ġth omm
+on ine
+at ga
+Ġs ost
+Ġs ari
+Ġs cept
+Ġs yz
+Ġs ysm
+Ġo ily
+Ġo ues
+er ae
+Ġc ici
+Ġp ork
+Ġw ishing
+Ġin se
+Ġin line
+es ophag
+Ġf oss
+Ġf uch
+is y
+Ġm ns
+Ġb bi
+Ġb imat
+as il
+Ġre use
+Ġre oriented
+ct on
+Ġh ue
+Ġh ox
+Ġh ka
+le it
+Ġe yt
+Ġn art
+Ġn ido
+Ġl al
+Ġl ance
+Ġl gi
+Ġl omb
+ly tics
+Ġg ill
+Ġg anz
+Ġg artanin
+id or
+th en
+th est
+ol ow
+Ġas ge
+ud ca
+ra f
+Ġon ych
+el ukast
+ab eth
+Ġv or
+Ġbe ir
+Ġbe cton
+Ġpro ud
+Ġpro protein
+ant ly
+Ġr ies
+Ġwh vp
+am ping
+Ġde uts
+est icular
+qu arters
+Ġse w
+ad ent
+ad iaz
+Ġper oral
+Ġper nam
+rom eter
+Ġsh o
+Ġsh y
+Ġsh out
+ip role
+Ġle one
+Ġle fort
+Ġle can
+ine ae
+Ġac pp
+Ġac otiamide
+ay ashi
+ac o
+ac aa
+Ġtw irling
+pl ine
+Ġbet ablock
+Ġhe ck
+ia xial
+we ek
+Ġinf rastructural
+uc ible
+and ra
+ens burg
+Ġap en
+Ġk ath
+Ġk ato
+Ġk ano
+Ġmet ry
+Ġpl af
+Ġreg ensburg
+Ġlevel ling
+Ġinter cor
+Ġinter genic
+Ġinter osseous
+Ġun he
+Ġun hel
+Ġsub part
+ach io
+Ġam k
+Ġam itr
+pro filer
+oth reitol
+Ġqu ails
+ap pro
+Ġy aw
+Ġant oni
+Ġbl l
+ak is
+Ġar yl
+Ġcor pectomies
+Ġro st
+Ġro swell
+Ġpo ur
+Ġcr b
+Ġcr gs
+out i
+Ġen bc
+Ġfin ometer
+Ġover m
+Ġte ae
+Ġmeth b
+Ġfound ational
+str ong
+Ġbut anolic
+Ġnon un
+ep ith
+Ġinfl atable
+Ġj ava
+Ġsp arc
+Ġstr uv
+Ġval le
+eth anolic
+Ġty ing
+Ġtra z
+Ġpop ul
+Ġmult iskan
+ox ine
+yt ical
+ob iota
+ob iprole
+Ġcar fil
+Ġcardi ologic
+Ġkn ight
+Ġi ops
+yn ophagia
+Ġfl ail
+Ġred ef
+Ġhyper phosph
+Ġif it
+Ġet izolam
+cop y
+cop al
+Ġform ers
+Ġoral is
+Ġterm inations
+Ġins el
+Ġdo ug
+Ġ3 000
+amet er
+Ġps or
+Ġps ols
+di agnostic
+Ġprot ober
+Ġprot ozo
+Ġintra individual
+over all
+Ġconsist ence
+ts a
+ving ia
+Ġop gs
+Ġcomb inatory
+Ġmo hs
+Ġimmun otherapies
+Ġz mc
+Ġmechan o
+omy cosis
+Ġmal mgren
+Ġhem operitoneum
+Ġhem idia
+Ġsyn biotic
+Ġacid ogenic
+Ġcd o
+ha ft
+Ġir id
+Ġir vingia
+Ġheart man
+orb able
+Ġang ulus
+Ġcur l
+Ġcur ricular
+Ġinj ure
+Ġvolum etry
+Ġvolum inous
+Ġbm as
+Ġrest a
+Ġrest raining
+Ġflow ed
+Ġbacter iology
+Ġur l
+Ġsl ender
+Ġvarious ly
+Ġcategor ial
+Ġcategor ically
+Ġtem ps
+Ġsch im
+Ġhand washing
+Ġchem omechanical
+Ġhuman ity
+Ġve gas
+Ġut ah
+Ġapp v
+Ġlymph ocytosis
+Ġmr w
+arch al
+Ġsw b
+Ġos em
+Ġos ats
+go le
+Ġclear fil
+Ġpros ocial
+Ġcam el
+Ġhf yd
+ann ins
+eral d
+Ġinject ate
+Ġstrain er
+Ġod ynophagia
+Ġphosph orous
+Ġmand arin
+Ġrelevant ly
+Ġcp cm
+Ġver ifies
+Ġpancre atography
+Ġhs f
+Ġhead quarters
+Ġpd ai
+Ġpp des
+Ġpower point
+Ġig p
+Ġms is
+Ġms pa
+Ġeng or
+Ġrad iculopathy
+Ġenc ased
+Ġeas pa
+az idine
+az olid
+az ulu
+Ġech ography
+Ġech oic
+Ġcb u
+Ġcb se
+Ġnucle os
+Ġx bai
+Ġsn vs
+Ġdoc osa
+Ġgr ate
+Ġposterior i
+Ġhalf way
+Ġhepatic ogastrostomy
+Ġmar c
+Ġmd kt
+oh s
+Ġcycl ind
+Ġrs g
+Ġdl cc
+Ġalle ged
+Ġcox s
+Ġfluor oscopically
+ae i
+roc ortisone
+Ġped al
+Ġnf e
+Ġnit robenz
+Ġprem ier
+Ġmel oxicam
+Ġremoval s
+Ġlum py
+Ġlum inescent
+Ġpt osis
+Ġpt cco
+eli i
+Ġtm as
+Ġtm od
+Ġuc ms
+Ġpet ers
+Ġht p
+Ġten elig
+land ers
+Ġethn o
+Ġrh es
+Ġleuk aemic
+Ġsinus oid
+Ġgc b
+Ġgc ms
+Ġhp fh
+Ġphot od
+Ġabsorb s
+Ġexternal ization
+Ġtransf ections
+Ġinstitutional isation
+Ġtri aging
+Ġpredom inates
+Ġautom obile
+Ġnh amcs
+Ġhypox anthine
+Ġss ppd
+Ġds n
+Ġds me
+Ġds vs
+Ġid cs
+Ġfore lim
+Ġhemoglobin uria
+Ġcsf pp
+Ġnc x
+Ġcf se
+Ġmb a
+Ġjud kins
+Ġgh t
+Ġrv mdd
+Ġinadequ acies
+Ġah vaz
+Ġnt prob
+17 05
+Ġsv d
+Ġsv ri
+Ġpn g
+Ġ16 40
+Ġeasy haler
+19 11
+Ġfilt rated
+Ġfilt rates
+Ġsb ns
+Ġtempor ality
+Ġrd f
+Ġtet roxide
+Ġbronch o
+Ġ00 6
+Ġhm v
+Ġvo uch
+Ġbis phenol
+Ġrough ening
+Ġcode ine
+Ġts l
+Ġanalog ously
+Ġpw ds
+Ġicp n
+Ġcouns eled
+Ġnp vs
+Ġeb f
+Ġeb ola
+Ġfist ulous
+Ġlp n
+Ġbs p
+Ġacceler ometry
+Ġtap ers
+Ġband ed
+Ġneuros cience
+34 8
+for th
+Ġank k
+Ġank ara
+Ġmom h
+Ġstra umann
+Ġcartil ages
+64 0
+Ġelectrocardi ograph
+Ġamel x
+Ġharv ard
+Ġsuperf icially
+Ġhomogen izing
+Ġtl a
+Ġiod o
+Ġug i
+Ġmyc ology
+Ġpu zz
+Ġrb mscs
+Ġbund ang
+Ġerup ting
+imb ic
+Ġgt fb
+Ġlev y
+Ġje on
+Ġlh f
+Ġbios core
+Ġbic ycl
+Ġneurom onitoring
+Ġram ipril
+Ġgn i
+Ġcongest ed
+Ġtof ms
+Ġbrach ii
+Ġtoothp icks
+Ġbath ed
+Ġnac p
+Ġbin et
+Ġtrun cal
+Ġsoc g
+Ġsun burn
+Ġrc b
+Ġju j
+Ġlr r
+ij in
+Ġmeal time
+Ġgm m
+Ġgm r
+Ġfre undii
+acchar ide
+Ġfruit ful
+Ġlb md
+Ġvacu olar
+Ġconceptual ised
+Ġallerg oid
+Ġmultim ode
+Ġdeple te
+Ġiso enzymes
+Ġsuspic ions
+Ġdan lou
+Ġrom exis
+Ġbuild up
+Ġceft obiprole
+Ġanaer obe
+Ġemphasis ing
+Ġnorwe gians
+Ġwet ness
+Ġkd r
+Ġbrom o
+Ġcry otherapy
+Ġcry ogenic
+Ġkc ne
+Ġirrit ations
+Ġinfra occlusion
+Ġchb t
+Ġsic p
+Ġpra ying
+Ġole uropein
+Ġosm ium
+Ġhyperch romatic
+Ġcampaign ing
+Ġtab ulations
+Ġtris odium
+Ġunm asked
+Ġmoist ened
+43 2
+mm hg
+Ġhyal inization
+Ġpolit ics
+Ġturb inates
+Ġatl antic
+Ġaberrant ly
+Ġbc ce
+Ġfascia e
+Ġcholangi ogram
+Ġdiscretion ary
+Ġmaneuver ability
+Ġmol ding
+Ġlf ca
+Ġcircuit ry
+iber n
+Ġcyan obacteria
+Ġadvis ors
+Ġtempl ated
+Ġmetrop olis
+Ġtym p
+Ġfibros arcoma
+Ġran itidine
+Ġanore x
+Ġcomment ary
+Ġovari ectomised
+Ġhypom ethylated
+Ġnss is
+Ġmont elukast
+Ġpus an
+Ġtrypan ocidal
+Ġtherapeut ical
+Ġzygomatic o
+Ġzygomatic omaxillary
+Ġmyx omas
+Ġfq sec
+Ġpremed icated
+Ġaqu a
+Ġttm pb
+Ġcyclospor in
+Ġog m
+Ġpseudoaneurys ms
+Ġnarc iss
+Ġoesophag ectomy
+Ġvapor ization
+Ġaddict ions
+oco agulation
+Ġglab ella
+Ġcarboxy hemoglobin
+Ġmall ory
+Ġcric othyro
+Ġurs odeoxycholic
+Ġpopl ar
+Ġbotanical s
+Ġmpa w
+Ġquen ch
+Ġdisconn ect
+Ġmediastin itis
+Ġlingu istically
+Ġgras ping
+Ġwms ds
+Ġfores een
+Ġhaplo view
+Ġail ment
+Ġanhyd rase
+Ġitch y
+Ġcapit ata
+Ġgep ia
+Ġjp qhf
+Ġqn wl
+Ġmasc ot
+Ġstap es
+Ġsphing olipid
+Ġhypocal oric
+Ġhms s
+Ġkw azulu
+Ġambig uities
+Ġlever aging
+jug ated
+Ġted ugl
+Ġextrac apsular
+Ġintratum or
+Ġdess erts
+Ġstack ing
+Ġhaemod ynamically
+Ġconvol uted
+Ġrefresh ing
+Ġneuropath ological
+Ġcave at
+enn ial
+Ġhonest ly
+Ġrepress es
+Ġcollaps ing
+Ġmids haft
+Ġendeav or
+Ġperu vian
+Ġhob bies
+Ġconstrict ions
+Ġdeleg ation
+Ġhet e
+Ġhet m
+Ġphosphatidyl choline
+Ġimmunocyt ochemical
+Ġmicrocyst ins
+absorb ance
+1799 983
+Ġincongru ence
+vest igated
+Ġreinter ventions
+epid ermal
+Ġmycel ium
+Ġsatur days
+Ġneurofib rillary
+Ġapf el
+Ġmonkey pox
+Ġreplen ishment
+Ġtribut ary
+Ġhamart omas
+Ġpremium s
+Ġintuition s
+Ġthun b
+Ġoce an
+Ġvaler ian
+Ġnex us
+Ġglycosamin oglycans
+eto oth
+Ġblu etooth
+Ġplurip otency
+Ġagglomer ate
+Ġcricothyroid otomy
+Ġserr atus
+Ġisos orbide
+acycl ic
+Ġnitros ative
+Ġstereoty pical
+Ġincarcer ation
+Ġloup e
+Ġloup es
+Ġelectroanat omic
+Ġdisser tation
+Ġvertebr ates
+Ġpykn otic
+Ġcoccy x
+Ġaler ting
+Ġantitry psin
+721 917
+Ġthom pson
+Ġmethan ogens
+Ġdithi othreitol
+Ġwomb olu
+Ġreconsid ered
+Ġdecentral ized
+Ġenvis aged
+Ġinfund ibular
+Ġlique faction
+Ġerb ium
+Ġbottlene cks
+Ġrmm vecs
+Ġrivers ide
+Ġnanost ruct
+Ġlegitim acy
+Ġclof arabine
+Ġbhut an
+Ġgravid arum
+Ġbial lelic
+Ġfrutic osus
+Ġsanction s
+Ġziziph i
+Ġoverhe ating
+Ġplantain oside
+Ġcryoglobulin emia
+Ġnanomater ials
+opoul os
+Ġantivir als
+Ġrainf all
+Ġgarcin ia
+Ġhomic ide
+Ġkell gren
+Ġdemol ition
+Ġkess ler
+Ġmonocyt ogenes
+Ġhydrophil icity
+Ġoligomer ization
+Ġtrimet azidine
+buc o
+Ġleven e
+Ġzg w
+Ġsteth oscope
+46480 68
+Ġburgdorfer i
+Ġnect ar
+Ġonch ocer
+Ġcair ns
+Ġsilhou ette
+Ġvoa af
+Ġabdulaz iz
+Ġhemipelve ctomy
+Ġpern icious
+Ġmrcr m
+Ġpostpon ement
+Ġhypermuc ovisc
+Ġsphingomy elin
+Ġthomm en
+Ġsysm ex
+Ġbimat oprost
+Ġpernam buco
+Ġplaf ond
+Ġunhel p
+Ġstruv ite
+Ġcarfil zomib
+Ġprotober ber
+Ġprotozo an
+Ġhemidia ph
+Ġtenelig liptin
+Ġntprob np
+Ġtedugl utide
+4 63
+c ord
+e o
+e phrine
+f ected
+f bp
+f raction
+i ologists
+m olar
+p iration
+s pec
+u f
+u w
+v ital
+z k
+Ġa ich
+Ġa ics
+Ġa vian
+on emia
+at en
+at ical
+Ġs if
+Ġs rm
+en stein
+Ġo ra
+Ġo els
+Ġc io
+Ġc icl
+Ġc urrency
+Ġp na
+ed np
+Ġw ps
+Ġw ives
+al p
+Ġof i
+Ġf y
+Ġf ve
+Ġf om
+Ġf kb
+ic line
+Ġd read
+Ġm iz
+Ġb oc
+Ġb st
+Ġb rent
+as omes
+an is
+ar at
+Ġre analyzed
+Ġre checked
+Ġh ve
+Ġh uc
+Ġh attr
+Ġh ibern
+Ġe ve
+Ġe if
+Ġe ased
+Ġe uron
+Ġto h
+ul ite
+ul ls
+Ġn un
+Ġn ie
+Ġn eds
+Ġst agg
+Ġst icking
+ur u
+Ġl ability
+Ġl di
+os acral
+im ia
+Ġg lic
+Ġg be
+Ġg np
+Ġg exp
+ig fbp
+id ated
+th at
+ol imbic
+Ġcon str
+Ġcon icity
+il ion
+ra cy
+el ia
+Ġv il
+Ġv aren
+Ġv ander
+od yl
+Ġex ot
+Ġex its
+ant ia
+ot ive
+ot rip
+Ġr pes
+Ġr ubin
+iv ally
+iv ium
+Ġal u
+Ġal itretin
+Ġal ivium
+ist ical
+Ġres ent
+ir t
+ir al
+Ġor se
+oc ervical
+oc omplex
+iz olid
+Ġch ili
+ib l
+ib acter
+ib ond
+ib ilia
+qu an
+qu et
+Ġat ls
+ess ential
+Ġcomp ile
+Ġcomp elled
+Ġse o
+Ġse am
+og ain
+og ging
+Ġper se
+st ones
+Ġsu z
+Ġac urate
+Ġac uris
+ac ency
+Ġdis like
+iff a
+pl aque
+Ġbet le
+end inous
+Ġme hran
+Ġme but
+pt ation
+we is
+per centage
+Ġinf use
+Ġint ending
+Ġha wley
+ens or
+Ġap m
+Ġk ad
+Ġk eral
+Ġall ostatic
+Ġcan ak
+Ġob ed
+Ġtr h
+Ġtr iss
+Ġpl ri
+Ġinter assay
+Ġrec ounted
+Ġun inform
+Ġsub axial
+Ġsub urbs
+Ġam e
+ans en
+Ġph arma
+Ġclin oidectomy
+Ġqu een
+Ġexp elled
+Ġy rs
+Ġgen ioplasty
+Ġant wer
+Ġsam t
+Ġar k
+Ġcol ds
+Ġcol odef
+Ġpr iest
+Ġen ugu
+Ġext ral
+Ġup st
+yst ic
+ix i
+Ġover r
+cc g
+osp in
+Ġnon infectious
+Ġj fh
+Ġend onuclease
+Ġem u
+Ġem its
+Ġsim on
+ke e
+Ġpost re
+Ġpost ulates
+val in
+Ġsm n
+Ġsm ads
+Ġrem eas
+Ġfur nit
+Ġfurther ly
+Ġadm ixed
+Ġconf id
+Ġconf use
+Ġcar pi
+anc ers
+Ġi uta
+Ġfl os
+Ġfl ared
+duct ivity
+Ġif osf
+Ġet sa
+Ġet be
+ark inson
+Ġmic afungin
+Ġinflamm asomes
+Ġhist ones
+Ġpot encies
+Ġel v
+ound ed
+ral ima
+Ġrep r
+Ġic rs
+ven ger
+Ġdental ly
+Ġep ir
+ts s
+Ġcomb ustion
+Ġz ap
+00 45
+Ġmechan ic
+Ġhem ocytometer
+Ġmicro adenoma
+ec ass
+par ation
+Ġfib rillary
+Ġfib rillar
+yz p
+Ġrandom ize
+oph or
+Ġ5 000
+Ġir v
+ne ur
+Ġradi ance
+Ġradi ometer
+Ġmem os
+Ġlab ially
+Ġcle venger
+Ġsk ulls
+Ġrecommend able
+Ġscre wing
+Ġsit us
+Ġresist ing
+Ġq rd
+Ġequ ates
+Ġlip iod
+Ġelect rically
+Ġ20 5
+Ġsl id
+Ġbr ash
+Ġbr ats
+Ġoff ender
+Ġsch a
+Ġlo hs
+Ġmoder na
+Ġpan eth
+Ġchem otherapeutics
+Ġost omy
+Ġcolon ised
+Ġincub ations
+ocyt oma
+Ġmid lands
+Ġsat b
+Ġsw opp
+Ġanxi ogenic
+Ġdec onv
+Ġcoll ars
+Ġtool box
+Ġcs ph
+Ġgo u
+Ġcm cs
+Ġcm pd
+Ġnecess ities
+Ġvas orum
+Ġnational ities
+ner vation
+Ġlipid omic
+Ġback sc
+Ġnor ovirus
+Ġwall ich
+dm ard
+Ġcad res
+ather apeutic
+Ġnet a
+Ġfood st
+Ġlv df
+Ġmit es
+Ġhal ting
+Ġpower less
+Ġta qi
+Ġrad ially
+Ġhepat op
+Ġess dai
+Ġiss hl
+Ġech opac
+Ġthromb opoietin
+Ġmar ia
+Ġcho oses
+ging ivally
+Ġpharmac ope
+Ġpharmac otherapies
+Ġce asing
+Ġhom ing
+Ġrs dc
+Ġacet osa
+Ġga i
+Ġga ucher
+Ġacqu ires
+Ġlat via
+Ġtend ineae
+Ġlater o
+Ġpneum ocon
+Ġchrom agar
+Ġspe e
+gi as
+Ġglobal ization
+Ġtg k
+Ġtg ds
+Ġ10 9
+Ġnf b
+Ġprem ixed
+Ġ19 86
+Ġide als
+20 4
+20 8
+Ġcolor ado
+Ġuc s
+Ġuc sc
+Ġspl its
+Ġoh at
+Ġethn om
+Ġethn obot
+Ġpm ad
+Ġsil an
+Ġsil oxane
+Ġden ying
+Ġlayer ing
+be le
+Ġleuk emias
+Ġcentr ip
+Ġmis per
+Ġhab itus
+Ġwar saw
+Ġscoring s
+Ġmethyl ator
+Ġmethyl glutaryl
+Ġmitochond rion
+Ġna oci
+Ġna ja
+Ġepidemi ologists
+Ġaspir ating
+Ġcro we
+Ġamb ivalent
+Ġgp cr
+Ġsem ip
+Ġbroad band
+Ġequip ments
+Ġaug sburg
+Ġom ls
+50 1
+Ġconver ged
+nat ural
+Ġrehabil itated
+Ġlapa rot
+Ġns cc
+Ġpf os
+Ġenrich ing
+Ġcounter intuitive
+Ġarg y
+ata emia
+Ġdiver ting
+Ġformal ized
+Ġsph b
+Ġscen es
+ophys iological
+Ġmv ms
+Ġsv hd
+Ġretrie vable
+Ġtong mai
+Ġmelan osis
+Ġsen n
+Ġ16 7
+19 2
+Ġpg d
+Ġwant ai
+Ġot d
+Ġresusc itative
+Ġfever s
+14 9
+Ġtempor oparietal
+13 4
+Ġconflic ted
+Ġbronch oprotection
+Ġcab v
+Ġphyt om
+Ġ17 3
+Ġcart o
+Ġantigen emia
+Ġpad l
+Ġpw pt
+bi ochem
+27 3
+Ġtf d
+Ġhumid ifier
+Ġstrept okinase
+Ġresc uing
+Ġhg h
+Ġhg p
+Ġdominant ly
+Ġtransm its
+Ġscreen er
+Ġect odermal
+Ġshr ub
+Ġshr unk
+Ġradial is
+Ġpk d
+Ġpk ub
+Ġdisap pro
+67 0
+Ġfibers cope
+Ġsimpl istic
+Ġgt v
+Ġdd avp
+Ġnig dul
+Ġexcre tory
+Ġcaution ed
+28 9
+Ġpic ralima
+Ġedge wise
+70 1
+Ġcrani omaxillofacial
+Ġbin ocular
+Ġsoc ad
+Ġfn ac
+Ġmening es
+Ġbb n
+ara j
+Ġheparin ization
+Ġlith otrip
+Ġblast n
+Ġtetra c
+Ġfluctu ates
+Ġiliac us
+Ġlb np
+Ġgon orrhoea
+Ġinterc urrent
+Ġantid iabetics
+Ġmultim ark
+Ġhierarch ically
+Ġub i
+Ġub os
+Ġeu flex
+Ġvig or
+Ġspectra max
+Ġmicrobi ologists
 Ġcred ited
-Ġrevers es
-Ġek uni
-Ġek strand
-Ġek bom
-Ġchen g
-Ġatp ases
-Ġseman tics
-Ġshock wave
-Ġshah idi
-Ġscler osed
-Ġscler oses
-Ġleuc ocytes
-Ġparas ites
-Ġparas anguinis
-Ġparas itic
-Ġparad igms
-Ġparad oxically
-peri operative
-char acteristics
-Ġinterp apill
-Ġinterp apillary
-Ġinterp ersonal
-Ġune asy
-Ġamph iphil
-Ġks el
-Ġoutper forming
-Ġstrip ped
-Ġedar add
-Ġiat rosed
-Ġimped es
-Ġimped iment
-Ġmonoc entric
-Ġmonocl inic
-Ġemail ing
-Ġintragroup s
-Ġze iss
-Ġze ggini
-Ġerad icate
-Ġerad icator
-Ġmultil ateral
-Ġmultil ocular
-Ġmultil ocus
-Ġiris i
-Ġantise psis
-Ġantise ptics
+Ġretin oids
+hex aenoic
+Ġdf i
+Ġnad c
+Ġswitch es
+Ġgb ms
+Ġaph rod
+Ġoperational ization
+Ġwet ting
+Ġimmunomod ulating
+Ġ34 35
+Ġfi ks
+Ġum c
+73 1
+Ġpoison ings
+Ġcoc ulture
+Ġfs as
+Ġtrich in
+Ġbact ere
+Ġbact ibilia
+Ġhyperth ymic
+Ġrosc ovit
+moid es
+cm h
+Ġconvers ational
+Ġlag ged
+Ġamh aric
+Ġdg u
+phosph ate
+Ġimper me
+Ġwat ts
+Ġreplic on
+Ġpun ched
+Ġspar cc
+Ġfirm ness
+Ġbank s
+Ġkle in
+Ġsab dar
+Ġrock ing
+Ġrock et
+Ġdash board
+Ġchel ators
+Ġken ned
+Ġ199 1
+Ġemd ogain
+Ġtent ing
+Ġdbs np
+Ġpter ocar
+Ġverb en
+Ġcts d
+Ġsequel a
+Ġherpes vir
+Ġfulfill s
+Ġlit ers
+Ġscl ls
+Ġnormot ensives
+Ġrl n
+Ġophthalm ologic
+Ġhypere xc
+Ġpus illa
+Ġdesm oplastic
+Ġbotan ist
+Ġers gs
+Ġwel coming
+Ġvirolog y
+Ġmmr c
+Ġtropical is
+Ġcameroon ian
+Ġpga a
+Ġaqu ap
+Ġaqu atic
+Ġmicrostruct ures
+Ġmre c
+Ġobtur ating
+osit ide
+Ġfes em
+Ġcounterst aining
+Ġlogarithm ically
+Ġcarbox ylase
+Ġlarv icidal
+Ġsemiquantitative ly
+Ġnont umor
+Ġpyro gall
+Ġlod z
+Ġlod ged
+Ġworkst ations
+Ġforecast ed
+Ġvg pr
+Ġdysm orphic
+Ġhast en
+Ġotolaryng ologists
+Ġchim era
+Ġcoincident ally
+Ġguan ylate
+Ġnud ge
+Ġsid ak
+Ġpulmon ology
+Ġbuf omix
 Ġsuit ably
-Ġuv p
-Ġimmunocom pet
-Ġaddic tions
-Ġ61 7
-Ġhypert onic
-Ġhypert elor
-Ġactu ated
-Ġeconom ies
-Ġvegf r
-Ġssb ss
-Ġosteoconduc tivity
-Ġorthopantom ograms
-Ġorthopantom ographs
-Ġcoronavirus es
-Ġchromat ograph
-Ġchromat ographic
-Ġchromat ogram
-Ġchromat ograms
-Ġadenocarcin omas
-Ġuncommon ly
-Ġaceton itrile
-Ġeosinophil s
-Ġoblig ed
-Ġvapor izers
-Ġaerosol ized
-Ġsubdiv isions
-Ġdestro y
-Ġimperf ect
-Ġimperf ection
-Ġtracheost oma
-Ġadrenal ine
-Ġpakistan i
-oul os
-tw ice
-Ġthaw ing
-Ġsat ellate
-Ġcg cct
-Ġcow herd
-Ġinoc ulation
-Ġinoc ulate
-Ġinoc ulum
-Ġanton io
-Ġmiti gating
-thal mitis
-Ġbh alaj
-Ġbh atti
-Ġbms cs
-Ġreform ations
-Ġhb d
-Ġhered ia
-ulo ou
-Ġlu o
-Ġlu hs
-Ġlum ens
-Ġlum ps
-Ġlum eng
-Ġlaws one
-Ġgt fb
-Ġgt caatt
-Ġvig ilant
-Ġvibr ations
-Ġvibr atory
-Ġresor ted
-Ġdispro ved
-Ġallerg ies
-Ġallerg ological
-Ġtriang ulation
-Ġtriang les
-Ġaccident ally
-Ġkar ia
-Ġkar aca
-Ġweare r
-Ġdecalc ifications
-Ġsimul ates
-Ġbrist led
-Ġmanip ulations
-Ġspons oring
-Ġjo ves
-Ġhyal ine
-Ġhyal inised
-Ġlimb us
-Ġconflu ency
-Ġconflu ences
-Ġ32 74
-Ġ03 6
-Ġzo onotic
-Ġmultif arious
-Ġmultif ocus
-Ġmucoperi ostal
-Ġiraq i
-Ġglut amic
-Ġprofess ed
-Ġpulver ize
-Ġslic ed
-Ġ58 4
-Ġcontraind icating
-Ġautogenous ly
-Ġprecip itated
-Ġprecip itates
-Ġprecip itous
-Ġprecip itationdiss
-Ġelev ations
-ochrom es
-Ġmuscul ature
-Ġmuscul ocutaneous
-Ġmyc n
-Ġmyc obacteria
-Ġmisd iagn
-Ġnaive ty
-Ġcytological ly
-Ġforens ics
-Ġvasopress or
-Ġdwell ers
-Ġegypti ans
-Ġrhamn osus
-Ġmobil ised
-Ġmobil isation
-Ġmobil igy
-Ġscholars hip
-Ġanxio lytics
-Ġankyl os
-Ġankyl osed
-Ġthromb ocytes
-Ġthromb ocyte
-Ġthromb ophleb
-05 2
-05 4
-05 5
-40 9
-cat gc
-cat ctg
-da ily
-evalu ation
-ias m
-onucle otide
-Ġsis cho
-Ġoval e
-Ġcens or
-Ġcens orship
-Ġinqu ire
-Ġfasc in
-Ġfasc icles
-Ġfasc iitis
-Ġdor ay
-Ġdor ri
-Ġdan ion
-Ġdan ks
-Ġmich eelis
-Ġmich igan
-attr actant
-Ġbg m
-Ġbub bling
-Ġstad tmanea
-Ġlob bezo
-Ġnr p
-Ġnr ti
-ela ar
-Ġbear s
-Ġbear ings
-adow ed
-Ġprepro sthetic
-Ġmah arani
-Ġmah idol
-Ġmah moud
-Ġscrap e
-Ġscrap er
-Ġindis putable
-Ġpark ar
-Ġhaemat oma
-Ġhaemat ocrit
-Ġtrich omoniasis
-Ġtripl ed
-Ġinterim plant
-Ġinterfer on
-Ġunin formed
-Ġunin formative
-Ġintro version
-Ġintro flexions
-Ġyag uo
-Ġamp ule
-Ġdesquam ation
-Ġphr ased
-Ġcry ostat
-Ġdiscover ing
-Ġjun ta
-Ġdemarc ating
-Ġtranscript omics
-Ġpostp oned
-Ġpostp onement
-Ġconfer red
-Ġ33 6
-Ġolig o
-Ġolig omerisation
-Ġolig onucleotide
-Ġappreci ate
-Ġappreci ative
-Ġappreci ably
-Ġmouths for
-Ġglomer ulus
-Ġverb atim
-Ġepig lot
-Ġsuff ice
-Ġprompt ly
-Ġ45 1
-Ġfibroc artilaginous
-Ġbook lets
-Ġ78 8
-Ġchemo attractant
-Ġ92 1
-Ġ98 2
-Ġultravi olent
-Ġhomogen ised
-Ġhomogen izing
-Ġhomogen isation
-Ġdysreg ulating
-Ġcytoplasm atic
-Ġmediast initis
-Ġotolaryng ological
-Ġotolaryng ologist
-Ġleuka emic
-Ġdenom inators
-Ġintermitt ently
-Ġelectromy ograms
-Ġframes hift
-Ġconjug ate
-Ġconjug ates
-Ġstereolith ographic
-Ġstereolith ographically
-Ġcontradic ted
-Ġacknowledge ment
-Ġsynchron ized
-Ġlecture r
-Ġlecture rs
-Ġinactiv ates
-Ġdisappear ing
-Ġdistinctive ly
-Ġdispropor tions
-Ġdispropor tional
-Ġaccommod ated
-Ġaccommod ations
-24 1
-24 2
-24 3
-85 5
-aj o
-aj t
-sk og
-sk tra
-Ġtac tility
-Ġtear ing
-Ġsad ness
-Ġcis platin
-Ġpon tifical
-Ġanim ate
-Ġfv r
-Ġderm is
-Ġderm oid
-Ġderm aut
-Ġmer ge
-Ġmer ignac
-Ġbill s
-Ġreevalu ate
-Ġhur dles
-Ġnond estr
-Ġgamm aglobulin
-Ġconform ing
-Ġconform ance
-Ġconform ational
-Ġexoc ad
-Ġresh ape
-oco agulation
-Ġsev enties
-Ġcoag ulant
-Ġcoag ulopathy
-Ġcontem plate
-Ġcontem plated
-Ġplain ly
-Ġplug in
-Ġplug gers
-Ġtrim gal
-Ġconsolid ate
-Ġprist ina
-Ġunid irectionally
-Ġken yan
-Ġken ya
-Ġken ny
-Ġmoh amed
-Ġmoh amad
-aga aac
-aga atgg
-aga aagag
-aga aggcat
-Ġsupra erupted
-Ġspend s
-Ġmicrovascular ity
-Ġgrand mother
-Ġgrand paren
-Ġgray ish
-Ġunderp ins
-Ġseropos itive
-Ġ06 6
-Ġendotox emia
-Ġflo at
-Ġflo ors
-Ġflo qs
-Ġnews paper
-Ġnews letter
-Ġpolyv itex
-Ġscreens hot
-Ġimmunode pression
-Ġimmunoglob ulins
-Ġsegreg ated
-Ġ47 2
-Ġantibiof im
-Ġbiomechan ically
-Ġdelim itation
-Ġpsycho active
-Ġtravel ing
-Ġtravel led
-Ġ89 00
-Ġbenefici ary
-Ġannex ed
-Ġdestructive ly
-Ġharmon ize
-Ġharmon ization
-Ġamelior ates
-Ġbenz yl
-Ġbenz odiaz
-Ġbenz othiaz
-Ġcosmetic ally
-Ġharv est
-Ġharv ard
-Ġtaxon omies
-Ġdimeth acrylates
-Ġargu ments
-Ġinnov ations
-Ġneurom otor
-Ġinfras tructures
-Ġlingu opalatal
-Ġlingu ovel
-Ġelabor ative
-Ġelabor ates
-Ġskeleton ised
-65 1
-99 8
-99 9
-pop ulation
-Ġtar iffs
-Ġtar biat
-Ġatraumatic ally
-Ġsig le
-Ġsig ma
-Ġstit ch
-eng aged
-Ġcup s
-Ġciv ilization
-Ġciv ilian
-Ġciv atte
-Ġcub es
-Ġpend ant
-Ġpier ce
-Ġplex us
-Ġantr um
-Ġanesthes izing
-Ġanesthes iologist
-Ġfi ocru
-Ġfi orell
-Ġdial ister
-Ġdial yser
-Ġdeline ating
-Ġbam h
-Ġbund les
-Ġbund ling
-Ġbund esmin
-Ġham idi
-Ġham burg
-Ġham ilton
-Ġham adan
-Ġhcl o
-Ġll amas
-Ġalarm ingly
-Ġrl c
-Ġresembl ance
-Ġdisreg ards
-Ġadvent urous
-iaz epam
-Ġposter otr
-Ġposter olateral
-stud y
-stud ies
-stud ied
-arious sur
-Ġprescrip tive
+Ġguard ing
+Ġbicuspid s
+Ġflud rocortisone
+Ġclen ch
+Ġeap d
+Ġtat to
+Ġautocl ave
+Ġerl otinib
+Ġhomolog ue
+absorb ed
+Ġpist achio
+Ġartem isinin
+1799 889
+Ġeyelash es
+Ġnostril s
+Ġfootball ers
+Ġsider oblastic
+Ġunpro ven
+Ġadipocyt okine
+Ġitra q
+Ġjam es
+Ġtetrahyd ro
+Ġcumin i
+dst e
+Ġroast ing
+Ġhemip aresis
+Ġgaug ed
+Ġhyperchlore mic
+Ġplast y
+Ġrecons ider
+Ġdowng rading
+Ġhypof rt
+Ġterpin ene
+Ġmuller ian
+Ġmicrophot ograph
+Ġpft c
+Ġunderexp ansion
+aras itic
+hydrof olate
+Ġannoy ing
+Ġorthopantom ogram
+Ġplwh iv
+Ġserr atia
+Ġbras ili
+Ġpamph lets
+Ġprein duction
+Ġunderut ilization
+Ġcheil ion
+Ġjm jd
+Ġretinac ulum
+Ġmoly bdenum
+Ġcredential s
+Ġsucr ase
+Ġshel ter
+Ġhemophag ocytic
+Ġhemophag ocytosis
+Ġbarbit urate
+Ġcotrans porter
+interest ingly
+Ġhyperamm onia
+Ġneckl ace
+Ġcoadminist ration
+Ġhoff man
+Ġglucopyran osyl
+Ġfpd ip
+Ġsponsors hip
+Ġparab asal
+Ġforesee able
+Ġhod ges
+Ġjw ft
+Ġstor iform
+thi ocholine
+Ġdiffus ivity
+Ġlnh cy
+Ġrubus oside
+never theless
+Ġdeprotein ized
+Ġcraz e
+Ġinver tebr
+ocort in
+Ġgordon ii
+Ġcofound ers
+Ġgangren ous
+Ġveloph aryngeal
+Ġgye ong
+Ġacanth osis
+Ġparaker atosis
+Ġror r
+Ġorph an
+Ġextir pation
+Ġavuls ed
+Ġangiomy olip
+Ġcoxib s
+Ġnormocal cemic
+Ġdisg ust
+Ġoster ix
+Ġbenjamin i
+Ġchapl ains
+Ġdiscolor ations
+Ġjohann es
+Ġmetad ata
+Ġsupr atherapeutic
+Ġmillenn ium
+Ġbiostatist ician
+Ġmonoph asic
+Ġhann over
+Ġcellt iter
+Ġphall oidin
+Ġnonob ese
+ropath ies
+Ġchatb ot
+Ġrised ronate
+Ġcamm ednp
+Ġgrh u
+Ġvard enafil
+Ġidar ubicin
+Ġpretrans plant
+Ġkruse i
+occip ital
+Ġmtbd r
+Ġunciv il
+Ġparaclin ical
+Ġskeptic ism
+dhe as
+Ġamitr iptyline
+Ġtraz odone
+Ġdocosa hexaenoic
+Ġcoxs ack
+Ġeuron et
+Ġstagg ered
+Ġvaren icline
+Ġalitretin oin
+Ġmebut ate
+Ġkeral a
+Ġcolodef ense
+Ġfurnit ure
+Ġeuflex xa
+Ġroscovit ine
+Ġsabdar iffa
+Ġkenned y
+Ġhyperexc itability
+Ġpyrogall ol
+0 95
+2 65
+2 90
+2 120
+3 11
+5 13
+7 65
+a icin
+b md
+b ismus
+d op
+d rug
+f ew
+h ire
+k ward
+k off
+k la
+l op
+l ia
+l ining
+l oss
+l eness
+r ass
+r ush
+t ar
+v at
+z p
+Ġt if
+Ġt abs
+in ian
+in avia
+Ġa ep
+Ġth row
+at otic
+Ġs aus
+Ġo ve
+Ġo ma
+er ical
+Ġc un
+Ġc co
+Ġp ing
+Ġp te
+ed y
+al angeal
+Ġin chi
+it ution
+Ġf cl
+Ġf ade
+Ġf cal
+Ġf hs
+Ġf nf
+Ġf hai
+Ġd ing
+Ġd rench
+is iran
+Ġm atic
+Ġm yn
+Ġm oss
+Ġm umb
+Ġm cher
+Ġb ma
+as ement
+an ical
+ro chanteric
+ar ca
+Ġre ps
+Ġh ologic
+Ġh uk
+Ġh ense
+Ġh iaa
+le b
+Ġn pe
+Ġst h
+Ġl ics
+Ġl apses
+et ate
+et amines
+os er
+os cience
+Ġg th
+Ġg sa
+ce us
+Ġas u
+Ġas as
+Ġas st
+Ġas av
+Ġas lec
+Ġwas p
+Ġfor odes
+ra it
+Ġv ant
+Ġbe a
+Ġbe ers
+Ġbe acopp
+Ġex ited
+Ġex iting
+Ġex osome
+ot rich
+ot ibial
+Ġr gd
+em m
+Ġal ara
+ag i
+ist ence
+Ġis k
+am pled
+ir izine
+Ġor is
+Ġor yz
+op o
+Ġch ica
+Ġim rd
+Ġat os
+Ġat op
+Ġcomp omers
+Ġse wn
+Ġse hc
+ial is
+og s
+og ical
+Ġad as
+ad icular
+st ood
+rom etric
+Ġass d
+Ġac u
+ac ca
+und eu
+Ġdis gen
+Ġdis odium
+Ġind els
+ase f
+ell ulin
+Ġdiff uses
+Ġcl ark
+ther petic
+ost yl
+ia cea
+Ġne br
+Ġsc ct
+Ġsc ul
+Ġinf using
+Ġint ang
+Ġha as
+and i
+ast atic
+Ġk ant
+Ġk ich
+Ġk ick
+Ġk line
+ug olix
+Ġob i
+Ġtr as
+Ġtr gs
+Ġtr iploid
+Ġrel ugolix
+Ġmet el
+Ġpl ge
+Ġinter tra
+Ġdat ura
+Ġsub pleural
+pro te
+Ġph igfbp
+rol ine
+Ġrisk ing
+Ġpos therpetic
+Ġexp atri
+Ġexp fear
+Ġstat s
+Ġbl g
+Ġbl ur
+Ġar ia
+Ġar ld
+cl m
+cr ypt
+Ġup hold
+Ġdes per
+Ġag b
+Ġpresent ers
+Ġover diagnosis
+Ġte p
+lect omies
+Ġunder nourished
+Ġspec ulum
+Ġnon cul
+ros pin
+int o
+Ġbi oh
+Ġsp cs
+Ġsp vs
+Ġdef atted
+Ġso h
+Ġso och
+Ġso othing
+Ġsm og
+Ġsm ts
+Ġcharacter izations
+Ġaddition s
+ior ad
+Ġrelated ly
+Ġdr s
+yt oma
+ob ont
+Ġref raining
+oper oxide
+Ġcar los
+Ġwork bench
+Ġcardi oplegic
+Ġkn it
+Ġmin ne
+Ġi ke
+Ġi ocs
+Ġed ss
+Ġcalc inosis
+Ġpe it
+Ġpe eled
+Ġhyper per
+Ġhyper lip
+Ġimm ulite
+Ġprim aries
+Ġ0 15
+Ġ0 24
+ian o
+Ġextract ives
+Ġdo f
+other mic
+Ġany how
+Ġav ich
+Ġav idity
+Ġmedic a
+Ġps ws
+Ġic y
+Ġic ed
+Ġic rp
+Ġprot os
+Ġprot uber
+Ġintra rectal
+Ġret usa
+Ġimmun osen
+Ġlif a
+Ġz w
+Ġz ar
+Ġz orb
+00 46
+Ġmicro prolactinomas
+oph orum
+oph alangeal
+Ġeduc ations
+Ġdesign ations
+Ġir t
+Ġmax q
+Ġpa ek
+Ġradi omorphometric
+Ġdistribut ional
+Ġinst ig
+Ġmem or
+Ġrecord ers
+Ġpsych opharmacological
+Ġct fc
+roph obia
+Ġbm ac
+Ġhel ena
+fer red
+Ġq mat
+Ġmat th
+Ġpat isiran
+Ġur undeu
+Ġsl ough
+Ġprogn ost
+Ġhand pieces
+Ġhand writ
+Ġsoci ological
+Ġmr rh
+ind ex
+ca id
+ca prol
+Ġsurvey or
+Ġos st
+Ġdm h
+Ġcam ara
+Ġwa a
+Ġhyd ral
+Ġread out
+ina z
+Ġvas ovagal
+Ġdom in
+Ġod cl
+Ġphosph oin
+Ġmand ating
+Ġcogn istat
+Ġapproxim ating
+Ġsa as
+Ġdepart ures
+Ġcontent ment
+Ġreact ant
+Ġnet rin
+Ġbu ying
+Ġmetabol isms
+Ġaccept ors
+Ġhc clm
+Ġpp ia
+Ġdil atory
+Ġig l
+Ġeng ages
+Ġangi ographies
+Ġmagn um
+Ġla ure
+Ġla ips
+Ġx yle
+Ġsn i
+Ġsn akes
+Ġlight weight
+Ġattribut ions
+Ġalb ug
+oh ama
+Ġlact ones
+Ġstratif ications
+Ġann ul
+aps aicin
+Ġinduction s
+Ġdl s
+Ġpast es
+sh ift
+Ġlat ae
+Ġconn exin
+Ġconn otation
+reh abilitation
+Ġfluor ometer
+Ġmicroscop es
+Ġchrom atic
+Ġcontext ually
+Ġled ge
+Ġped f
+Ġped ometer
+Ġped icles
+oscler otic
+Ġnit ida
+Ġnit robl
+Ġmel ted
+Ġpi o
+oun cing
+hyd rox
+Ġkin caid
+rin one
+rin olysis
+Ġrt me
+Ġdepend encies
+pr im
+Ġwid r
+20 20
+Ġge ared
+bl ood
+Ġcandid osis
+Ġwave lets
+Ġinh aling
+Ġsten otroph
+Ġhp c
+Ġhp mc
+Ġphot ochemical
+Ġsha anxi
+Ġlas cd
+Ġfil ip
+yg os
+Ġaa as
+Ġcat ching
+Ġmp ox
+Ġflex neri
+Ġperf usate
+Ġdp o
+Ġrob otics
+Ġderm oscopy
+Ġderm oscopic
+Ġss fp
+Ġfore gut
+Ġdc x
+Ġom ni
+Ġpret oria
+Ġgran ulated
+Ġfund al
+Ġlt vv
+Ġcf h
+Ġpf mt
+Ġft i
+38 9
+Ġhd r
+Ġgh r
+omple te
+osin or
+Ġah ka
+Ġcond yl
+17 576
+Ġsmooth ness
+Ġsv s
+Ġabst inent
+ethyl ating
+Ġmh pg
+Ġmelan cholic
+19 279
+Ġactin omycin
+Ġduoden o
+Ġcit ron
+Ġfeed er
+Ġintracellular ly
+Ġwaist line
+Ġpref illed
+Ġvirt ues
+Ġhol o
+Ġthin ned
+Ġhm b
+des ign
+Ġphyt ol
+Ġphyt otherapeutic
+Ġfa o
+Ġthreat ens
+Ġfas a
+Ġdivers ities
+Ġ13 4
+Ġantigen otoxic
+Ġnr cts
+Ġsud d
+Ġpseud ost
+Ġlm hs
+Ġlm vs
+Ġbon us
+Ġdia pers
+Ġfeedback s
+Ġsta ples
+Ġdh ope
+Ġtal ar
+Ġpron eness
+Ġdetermin ate
+25 4
+Ġacl idinium
+umb ered
+Ġsteroid ogenesis
+Ġband age
+Ġstra bismus
+Ġcommercial ized
+Ġrib onucle
+Ġaz f
 Ġtrip od
-Ġtryp an
-Ġtrimm er
-Ġconsor tia
-Ġinterl acing
-Ġintercus pal
-Ġunres trained
-Ġunres olved
-Ġunres tricted
-Ġunequ ally
-Ġunidenti fiable
-Ġintu ition
-Ġkerm anshah
-Ġenfor cement
-Ġenjoy ment
-Ġenjoy able
-Ġunderm ine
-Ġunderm ined
-Ġunderm ines
-Ġradiop acity
-Ġje ffco
-Ġje annin
-Ġmicroc olon
-Ġmicrop ores
-Ġmicroet ching
-Ġtransposition s
-Ġgrid lines
-Ġblur ring
-Ġintras inus
-Ġintras ubjec
-Ġmultipl icity
-Ġmultipl icatively
-Ġremed y
-Ġsett ling
-Ġsett lement
-Ġcleans able
-Ġmuco cele
-Ġmucoc utaneous
-Ġbacteroid es
-Ġguang zhou
-Ġguang dong
-Ġverruc iform
-Ġcapac itates
-Ġrefine ments
-Ġwilli am
-Ġimmuno inflammatory
-Ġimmuno assays
-Ġresistor here
-Ġseventh ly
-Ġprioritiz ing
-Ġdelib erate
-Ġdelib erating
-Ġxanth one
-Ġxanth oma
-Ġcondens er
-Ġ93 4
-Ġ93 5
-Ġ93 9
-Ġ99 6
-Ġevap orate
-Ġqalp etgee
-Ġhomo lytically
-Ġpassage way
-Ġporous ites
-Ġsulph ate
-Ġsulph onic
-Ġmcm aster
-Ġdebilit ation
-Ġdebilit ated
-Ġcognition s
-Ġperfluor inated
-Ġperfluor ohex
-Ġperfluor odec
-Ġperfluor oundecanoic
-Ġgrey ish
-Ġintermed ium
-Ġtriad ent
-Ġfashion ed
-Ġfashion ing
-Ġobtur ator
-Ġmicromorph ological
-Ġtrapez oids
-Ġdestabil izes
-Ġpeculi ar
-Ġprefect ures
-Ġprefect ural
-Ġtowns hips
-Ġhookah s
-Ġarithmetic ally
-represent ative
-Ġdeprote inisation
-54 1
-76 4
-76 8
-78 8
-78 290
-fin ite
-some times
-Ġum c
-Ġum emori
-Ġum berto
-Ġum pteen
-Ġtet rology
-Ġtib ias
-Ġtib ialis
-ret inol
-Ġthous ands
-Ġsax lin
-Ġsax ton
-Ġcasc ades
-Ġcatch es
-Ġpent aery
-Ġpent obarb
-Ġpent raxin
-Ġpod ocytes
-Ġpod ocyte
-Ġpod osomes
-Ġpod oplanin
-Ġpod ocytopathies
-Ġwish es
-Ġdict ates
-Ġmur mans
-Ġmors els
-Ġmens uration
-Ġmerc ury
-Ġmuh amed
-Ġmuh ammed
-atc acg
-atr ization
-Ġbud gets
-Ġbib upillary
-Ġbag ging
-Ġbag hd
-Ġrecl inging
-Ġhus m
-Ġhop craft
-Ġech ocard
-Ġlac zko
-Ġlun ar
-Ġlun ate
-Ġlind he
-Ġlind auer
-Ġnur bs
-Ġnad u
-Ġgm fcs
-Ġgam bet
-Ġasc ites
-Ġasc omytes
-Ġvo ice
-Ġvo iced
-Ġvo uchers
-Ġexem pt
-quin one
-Ġpreb end
-Ġpret est
-Ġpret ended
-Ġpret tau
-Ġcompact ness
-Ġdisl ocation
-Ġdisl ocating
-Ġdisartic ulating
-Ġseas onality
-Ġshadow ing
-opy ranoside
-Ġleak y
-Ġsurfact ant
-Ġpars imony
-Ġpars ifal
-Ġinfar ct
-Ġabdul jab
-Ġinterr ater
-Ġunh indered
-Ġunh armed
-Ġunt oward
-Ġunt apped
-Ġdeter red
-Ġupload ing
-Ġcontroll ability
-Ġars enic
-Ġdecis ively
-Ġbronch oscopic
-Ġbronch odil
-Ġnoncont aminated
-Ġdiscour aged
-Ġsupre macy
-Ġradio active
-Ġradio immun
-Ġjoh ansen
-Ġjoh ansson
-Ġjoh annes
-Ġtranscrip ts
-Ġdie lectrophoretic
-Ġdiure tic
-Ġgrip ing
-Ġintramuscular ly
-Ġdrastic ally
-Ġtechnological ly
-obut yric
-Ġpeer less
-Ġethmoid ectomy
-Ġpercep tible
-Ġpercep tibility
-Ġabsor ber
-Ġabsor pti
-Ġhanded ness
-Ġfluoroph ore
-Ġpolyether ketone
-Ġsympos ia
-Ġohc ps
-psych ological
-Ġequator ial
-Ġ43 4
-Ġhyperther mic
-Ġarticul ators
-Ġarticul ography
-Ġxt index
-Ġsemic ircle
-Ġqia gen
-Ġqia amp
-Ġdowns ized
-Ġcrani osyn
-Ġcrani opharyn
+Ġect opy
+Ġmas imo
+okin in
+18 1
+yr rol
+Ġpict orial
+Ġlin z
+ocon centration
+30 7
+Ġsubs ites
+Ġdiaph oresis
+Ġlh as
+45 2
+Ġtransp alatal
+Ġabd ul
+Ġbt v
+Ġsubc omp
+Ġtel angi
+Ġtel opeptide
+Ġbrach iorad
+Ġih m
+Ġhh t
+Ġarrival s
+Ġups urge
+Ġpall or
+Ġbf pscs
+anal ys
+Ġcustom s
+Ġcustom ary
+Ġbin ominal
+Ġfamiliar ized
+Ġtric ellulin
+Ġlock out
+Ġdead line
+encephal ic
+Ġgm p
+Ġhsp cs
+57 7
+Ġgad ph
+Ġsel dinger
+ofib rosarcoma
+Ġmacro adenomas
+Ġlamin ate
+Ġnrs s
+anz a
+Ġuro tsa
+Ġappreci ating
+Ġpdl sc
+Ġretro ele
+Ġfasc icular
+Ġeuth ymic
+Ġhypn ot
+Ġcard shock
+44 7
+Ġsuc ked
+Ġhabit at
+Ġretin oid
+Ġlute us
+Ġpent af
+Ġphenoty pical
+Ġoverd osing
+Ġgb v
+ospor in
+Ġsalv ador
+Ġthal am
+Ġtd co
+Ġum a
+Ġxen ogeneic
+Ġphyl otypes
+Ġpra xis
+Ġich thy
+Ġtab oo
+Ġmist reatment
+Ġfh pp
+Ġcorne as
+Ġantip arkinson
+Ġsj d
+Ġhyal in
+Ġgg plot
+Ġvort ices
+Ġves ical
+Ġsolub ilization
+Ġswab bed
+Ġild s
+Ġez r
+ecan oate
+Ġpix antrone
+Ġprur itis
+Ġcaut ery
+Ġlf i
+Ġcholest anol
+Ġserological ly
+Ġlu o
 Ġmisclass ifications
-Ġtonsil lectomy
-Ġalbumin emia
-Ġmicr orough
-Ġmicr oneedle
-Ġattentive ly
-Ġextrem um
-Ġecosystem s
-Ġhrp z
+Ġjudg emental
+Ġcompuls ions
+Ġfrank el
+Ġsant i
+Ġhcs c
+Ġmobil ised
+Ġenjoy ing
+Ġgrand children
+Ġrenew ing
+Ġaad r
+Ġkt as
+Ġinsuff l
+Ġinsuff lated
+Ġspin osae
+Ġelab or
+Ġcitr ulline
+Ġimmunodef icient
+Ġhistomorph ology
+Ġsphygm ocor
+Ġcomment aries
+Ġhypom ethylating
+Ġdish arm
+Ġoxy hemoglobin
+Ġhypere mesis
+Ġperpet uation
+Ġalk anes
+Ġxl h
+Ġtransd ifferentiation
+Ġcondom less
+Ġcine ole
+Ġpteryg omaxillary
+Ġendo angel
+Ġdul cis
+Ġlecture r
+Ġtowns hips
+Ġbos nia
+Ġmyx ofibrosarcoma
+Ġprevail s
+Ġinelig ibility
+Ġmicrov illi
+Ġcet irizine
+Ġyl l
+Ġquin ine
+Ġsteep ness
+Ġdios cin
+ret ention
+Ġdor r
+Ġquiet ly
+Ġcatalyz ing
+Ġfemor otibial
+Ġspreads heets
+Ġcompact ed
+Ġdiscour aging
+Ġtcp o
+Ġoverse e
+Ġflag s
+Ġait l
+Ġparkinson ian
+Ġcid ma
+cn ac
+Ġoutweigh s
+Ġmetagen omics
+Ġuncon jugated
+Ġgras ped
+Ġunderm ining
+Ġpalat inal
+Ġchor oid
+Ġmang ost
+Ġtwitch es
+Ġcq fr
+Ġerm c
+Ġdamp ened
+Ġkre men
+Ġperimen opause
+Ġembra ced
+Ġted izolid
+Ġsympath o
+Ġdess ert
+Ġrestart ing
+Ġmetastas ized
+Ġdisappoint ment
+Ġdj k
+Ġmdct v
+Ġsyl het
+Ġqr f
+Ġovercrow ded
+Ġmalod our
+Ġmega pros
+Ġcorrid ors
+Ġimmobil ised
+Ġnemat ode
+Ġdysk ines
+Ġdx m
+Ġscand inavia
+Ġpenal ized
+Ġlumin ance
+Ġsubtilis in
+Ġsyndesm osis
+Ġtps a
+Ġdub lin
+Ġpericardi otomy
+Ġkds q
+Ġmonos omy
+Ġstagn ant
+Ġantihist amine
+Ġcram ping
+Ġpiez osurgery
+Ġwaf ers
+Ġhell enic
+Ġcollim ation
+Ġille g
+Ġtriacylglycer ols
+Ġrevis it
+Ġdesensit izing
+Ġhypomineral ised
+Ġguil an
+Ġsphen oidal
+Ġdichlorofluores cin
+Ġanis otropic
+Ġoctad ecanoic
+Ġdak ar
+Ġoutperform s
+Ġorg asm
+Ġhx hy
+Ġfemin ine
+Ġisovolum etric
+Ġlw fs
+Ġanthracy clines
+Ġspill age
+Ġsemic ircular
+enzym atic
+Ġsuprac ondylar
+Ġstad ium
+Ġjuxt a
+Ġaccr ue
+Ġtaxonom ist
+Ġflaw ed
+Ġbiostat istics
+Ġpedest rians
+Ġbiores orbable
+ynd romic
+Ġchaper one
+Ġglycopept ide
+Ġosteoin ductive
+Ġoctadec enoic
+Ġorex igenic
+Ġdelib eration
+Ġpuerper ium
+Ġhyg roma
+Ġditer penes
+Ġserp ina
+Ġbarbit urates
+Ġentreprene urs
+Ġanton io
+prom azine
+Ġwak o
+Ġhir ta
+Ġreshap ing
+Ġlfa e
+Ġthiazolidined ione
+Ġdick inson
+Ġobvi ate
+Ġreop ening
+Ġdefl ating
+Ġcarn osus
+Ġparaoxon ase
+Ġminiat urized
+Ġprad esh
+Ġyok ohama
+Ġsquat ting
+Ġtung sten
+Ġenlight en
+Ġbiguan ide
+Ġkod ak
+Ġdigluc onate
+Ġhabitu ation
+Ġdorso ventral
+Ġwebin ar
+intang tong
+Ġsulphonyl urea
+Ġthermore gulation
+Ġimmunoprecip itated
+Ġparaty phi
+Ġrehear sal
+Ġauric ul
+Ġamaryll ifolius
+Ġradiod ensity
+Ġmicrodiss ection
+Ġgrie v
+2282 679
+Ġpyraz inamide
+Ġbirefring ence
+urc umin
+Ġregrett ably
+Ġparain flu
+Ġdecolor ization
+Ġdfd ba
+Ġdisresp ect
+Ġcolost rum
+Ġhemith orax
+Ġbuple uri
+Ġclostridial es
+Ġastro virus
+Ġmahan intangtong
+Ġcypr us
+Ġgalant amine
+Ġlecan ora
+Ġdoug las
+Ġvouch ers
+Ġunhelp ful
+Ġantwer p
+Ġifosf amide
+Ġepir ubicin
+Ġlipiod ol
+Ġwallich ii
+Ġpharmacope ia
+Ġpneumocon iosis
+Ġaphrod isiac
+Ġmrec ist
+Ġcoxsack ie
+Ġmcher ry
+Ġhense leit
+Ġasav ld
+Ġforodes ine
+Ġsehc at
+Ġdisgen et
+Ġintertra becular
+Ġnoncul prit
+Ġsooch ow
+Ġminne apolis
+Ġimmunosen es
+Ġzorb ax
+Ġurundeu va
+Ġxyle m
+Ġnitrobl ue
+Ġstenotroph omonas
+19279 14
+2 20
+7 34
+f icence
+g yn
+g ins
+g ray
+h z
+h as
+h art
+j al
+k is
+l li
+l ope
+m is
+m vi
+o ct
+p resent
+q hc
+t em
+t rics
+u ros
+v one
+y ocardial
+Ġ umin
+Ġa ub
+Ġa af
+Ġa of
+Ġa ua
+re i
+Ġth v
+on c
+on en
+on osetron
+at z
+at ct
+at ra
+Ġs ust
+Ġs ages
+Ġs xt
+en omen
+Ġo as
+Ġo ly
+Ġo ph
+Ġo tal
+er ian
+Ġc ces
+Ġp ics
+Ġp ond
+Ġp amp
+Ġw um
+Ġw mt
+Ġw iley
+al em
+Ġan os
+it ide
+it ama
+es cent
+Ġof a
+Ġf hd
+or iation
+Ġd ow
+is ky
+Ġm est
+Ġm ine
+Ġb th
+Ġb ce
+Ġb ord
+ent ing
+as an
+an other
+ar re
+ar ctation
+ing ale
+Ġh ug
+Ġh va
+Ġh wa
+Ġe ee
+Ġto a
+ul g
+ul li
+Ġn pt
+Ġn ld
+Ġn uch
+Ġn he
+Ġst u
+Ġst av
+Ġst ss
+Ġst lt
+ur ve
+Ġl ce
+Ġl ied
+Ġl isa
+Ġl oren
+et ing
+et amol
+im onas
+Ġg in
+Ġg arb
+ig ent
+ig um
+ol ing
+ol ver
+ol vent
+ud din
+il ly
+il ol
+ut ia
+ut ics
+ut rition
+Ġv vi
+Ġv va
+Ġv pi
+up on
+od ora
+ant inib
+Ġr il
+Ġr unt
+Ġr ih
+Ġal v
+Ġal as
+Ġal luded
+Ġal cy
+Ġal aska
+ag ct
+Ġis omers
+Ġis obutyl
+um ination
+am ps
+am idine
+oc etin
+op lication
+ys ion
+iz o
+Ġch k
+Ġim plements
+Ġat n
+Ġcomp ost
+ad ate
+Ġper ire
+ip i
+ff ic
+Ġass embl
+se e
+Ġac rh
+ac gt
+ac odyl
+Ġtw elf
+Ġtw igs
+Ġco iled
+Ġcl tp
+pe b
+ia filtration
+ia ceus
+Ġne et
+Ġsc ac
+Ġsc pt
+per idol
+Ġdi oc
+Ġinf lex
+Ġinf rap
+uc ol
+uc cin
+Ġha us
+Ġha ven
+Ġha wa
+Ġap dp
+Ġk exin
+ug ula
+Ġpl ier
+Ġpl ump
+Ġreg ulative
+Ġinter oper
+Ġpres upp
+Ġun sh
+Ġun educ
+Ġun qualified
+Ġsub p
+pro st
+ap ont
+Ġhad lock
+Ġy p
+Ġy ates
+Ġy fs
+Ġar ugula
+Ġtest imon
+cl ival
+Ġpr iced
+Ġcontrol lability
+Ġhas him
+Ġpo ag
+Ġen flow
+Ġen flurane
+Ġup ms
+Ġhow ell
+Ġund one
+Ġser bian
+ever s
+Ġtrans cervical
+ros al
+Ġbi ograph
+tain able
+Ġj ul
+Ġstr idor
+Ġend owed
+Ġdem o
+Ġso aps
+Ġso ave
+Ġsm ac
+Ġsm ds
+na i
+Ġtra met
+unt ia
+Ġrem itters
+Ġprov ocative
+Ġma es
+Ġfur c
+ri atum
+Ġgl cnac
+Ġcal opl
+Ġcal yces
+ox ins
+Ġconf uc
+Ġconf ines
+Ġpar king
+Ġed ulis
+Ġsix fold
+Ġatt ested
+arg on
+Ġphys eal
+Ġpe q
+Ġhyper ostosis
+Ġimport ing
+Ġif ps
+Ġocc ident
+Ġel dh
+Ġanti anginal
+Ġposs es
+Ġany body
+ov an
+uss ed
+Ġav ance
+Ġes v
+Ġes be
+Ġps ad
+di abet
+ung ual
+Ġcommon place
+Ġgeneral ise
+Ġmy od
+Ġmy rt
+Ġimmun olab
+00 2
+Ġoper cul
+Ġox ides
+Ġuniv erse
+Ġhem oconcentration
+Ġmicro de
+Ġmicro adenomas
+Ġvent ed
+Ġcyt ostatic
+Ġcd a
+Ġcd ks
+Ġradi ated
+Ġrat t
+Ġpoly genic
+Ġpoly chrom
+Ġpoly choric
+of in
+Ġcur ving
+Ġcur iously
+Ġhum i
+Ġpsych ostim
+Ġpsych ophysical
+Ġbm ps
+Ġml ia
+Ġec onometric
+Ġorgan ise
+Ġflow metry
+Ġpul ls
+Ġsl ants
+Ġprol apsed
+Ġach r
+Ġsch e
+Ġlo q
+Ġextra ocular
+Ġsuper cutaneous
+Ġpan m
+Ġapp rent
+Ġdiet icians
+Ġgrowth s
+Ġble pha
+Ġdm se
+Ġdm ps
+Ġdec anted
+Ġcam i
+ann er
+ann abin
+Ġventil ations
+Ġorig ination
+Ġcm gcd
+Ġunderstand ability
+ank a
+Ġcp iii
+Ġsa arland
+xt g
+Ġak a
+Ġcad ence
+Ġultras hort
+Ġneuro critical
+Ġpd oc
+Ġiv erm
+Ġonset s
+Ġta jik
+Ġoxygen ator
+Ġrad ish
+iph ene
+cal ed
+Ġdecl aring
+Ġsept ation
+Ġplan imetry
+Ġcop ed
+Ġla und
+Ġmt l
+Ġprep uce
+Ġsn ri
+Ġgr v
+Ġgr atif
+Ġul ms
+Ġul moides
+Ġpc us
+och lor
+Ġpal onosetron
+Ġinternal izing
+Ġinterpre molar
+Ġqual trics
+wh o
+wh ite
+Ġacet o
+Ġdl rs
+Ġaden oviral
+Ġconn or
+Ġheight en
+Ġip aa
+Ġmg s
+Ġchrom oph
+Ġantic aries
+Ġcompreh ending
+Ġselect s
+Ġarth roscopically
+Ġtb as
+Ġfacilit ad
+Ġlum ber
+Ġsubstant iates
+Ġpap ular
+Ġele g
+Ġgel atine
+Ġdra pe
+Ġmanif old
+Ġcolor imetrically
+Ġuc a
+Ġcrp c
+Ġspl at
+phal in
+Ġsd q
+Ġhence forth
+Ġbrief ings
+Ġethn ography
+Ġpm hs
+Ġlig ust
+Ġrh apont
+Ġden erv
+Ġtoler ating
+Ġcyst ostomy
+Ġmis c
+Ġgc ot
+Ġgc bt
+Ġpel t
+Ġphot ons
+Ġfil um
+Ġfr ids
+Ġpurpose ly
+Ġmp fs
+Ġequal ing
+cript ional
+Ġnumer acy
+Ġdp d
+Ġdirection ally
+Ġhar vey
+Ġlang endorff
+Ġreh ab
+Ġauthor isation
+Ġcalib rating
+Ġss g
+Ġsem it
+Ġbroad ened
+16 5
+Ġoptim izes
+Ġgall ium
+Ġmedi olateral
+Ġhypothes izing
+Ġflav ored
+Ġdu odec
+Ġmil rinone
+Ġtp i
+Ġhor ne
+iop ogon
+Ġslow est
+Ġmb w
+Ġabsorbance of
+Ġpf ass
+Ġscient ist
+Ġcounter balanced
+Ġ14 4
+Ġcortic otroph
+Ġcortic otropin
+Ġgraph ed
+Ġcolum ba
+17 9
+oe lect
+Ġ15 2
+Ġmelan ocarpa
+22 3
+Ġ16 9
+Ġmyel ophil
+bre w
+Ġpum ped
+19 75
+Ġdecomp ose
+ophag a
+ocl avicular
+Ġple asing
+Ġrd p
+Ġtet anic
+Ġsac rospin
+Ġbronch opulmonary
+Ġincons picuous
+Ġunf illed
+Ġthin ness
+Ġhm as
+Ġ17 0
+Ġadrenal in
+Ġschiz ont
+Ġbis acodyl
+Ġrough er
+Ġ13 9
+Ġepidemiological ly
+Ġpseud arthrosis
+Ġbul ly
+pan osomal
+Ġsig gi
+Ġtor qu
+Ġaugment ations
+Ġgd c
+Ġord inance
+otom ized
+Ġcg d
+Ġdn v
+25 22
+Ġacl t
+Ġ24 0
+Ġrf b
+Ġcurc um
+Ġmds c
+Ġaw kward
+Ġnons us
+Ġnons yndromic
+64 4
+Ġrib ose
+Ġmf ns
+Ġaz ad
+Ġshr nas
+Ġmas do
+Ġapart ment
+Ġpk b
+30 9
+Ġhous em
+Ġfc u
+stit utional
+Ġham a
+Ġgt fc
+Ġpie b
+Ġbla utia
+Ġwt d
+Ġpip ec
+Ġbenz o
+Ġneurom a
+Ġneurom od
+Ġsubc ont
+Ġsick est
+Ġbf b
+anal ytical
+Ġfront otemporal
+Ġrod rig
+40 8
+Ġpiv cs
+Ġmaxill o
+Ġmaxim ization
+Ġmaxim izes
+Ġration ally
+Ġconsolid ating
+wa h
+Ġuna ided
+Ġstere otax
+Ġodont ology
+Ġodont oblastic
+Ġwalk way
+Ġcip m
+Ġeu v
+Ġrid ing
+Ġovert riage
+Ġdro ve
+Ġdro peridol
+Ġmu himb
+Ġretro gnathia
+Ġhall and
+Ġti ers
+Ġsharp ness
+Ġlon za
+Ġimmob ile
+Ġmad ecass
+angi ogenesis
+Ġrub rum
+Ġunw ar
+Ġsalv iae
+sec ution
+Ġecz ematous
+Ġdysph oric
+Ġvan ished
+Ġhaemorrh oids
+Ġretic ulo
+Ġcontamin ate
+Ġcontamin ations
+Ġbind ers
+Ġrenin oma
+Ġ37 5
+Ġdial yzed
+Ġsg ot
+Ġdip yr
+Ġpj is
+Ġhypertriglycer ida
+Ġbc bm
+Ġtransc ultural
+Ġnl fs
+Ġmicron vol
+Ġdiscord ances
+Ġsily b
+Ġdiamond s
+Ġpes pl
+Ġhern ial
+Ġffr x
+Ġharmon ised
+Ġwhe y
+Ġbill s
+Ġsomat ropin
+Ġturk u
+200 1
+Ġ000 4
+Ġactinomy cosis
+Ġdispens ation
+Ġgbs a
+Ġsect oral
+Ġphoto aging
+Ġrai u
+Ġios b
+Ġamph etamine
+Ġnice ly
+Ġconcordant ly
+Ġcorner stones
+Ġjoh rei
+Ġccc s
+Ġdiscer ning
+Ġspasm odic
+Ġnormot ension
+Ġcos y
+Ġoblig ated
+Ġaffir ming
+Ġbear ings
+Ġgloss opharyngeal
+Ġperpet uating
+mann ii
+Ġboy friend
+Ġisop renaline
+Ġfert il
+Ġvb hc
+Ġcz t
+Ġcalm ness
+Ġmalp resent
+Ġexecution er
+Ġallodyn ic
+Ġcavern osum
+Ġmold ed
+Ġaqu ablation
+Ġaqu educt
+ret inal
+Ġantibi ograms
+Ġastragal oside
+Ġsrcc s
+Ġlns ii
+Ġparag raph
+Ġamy otrophic
+Ġpyruv ic
+Ġmre mvi
+Ġinvolunt arily
+Ġspt md
+Ġflag ellar
+Ġhemi arch
+Ġmultis lice
+Ġhpe ep
+Ġgigant ea
+Ġorbit opathy
+Ġprepro cessed
+Ġshar ma
+Ġinternship s
+Ġnq rn
+Ġuncon firmed
+Ġmalfunction ing
+Ġawa ited
+Ġstip ulates
+yel inated
+enedi amine
+Ġsphing olipids
+Ġprioritis e
+Ġemphys ematous
+Ġbenefici ary
+Ġhur dles
+Ġguan idine
+Ġdisappoint ed
+Ġebs co
+Ġunrespons iveness
+Ġfss s
+Ġisc u
+Ġimperf ections
+Ġepiph enomen
+Ġhed onic
+Ġmega esophag
+Ġgamb ir
+Ġnatal izumab
+Ġsubend othelial
+104 2522
+Ġyq cp
+Ġconstrict or
+Ġccv ds
+Ġsjz d
+Ġxst i
+Ġaudi ences
+Ġfps s
+hap py
+Ġantimut agen
+Ġenfor cing
+Ġcrosst ab
+Ġpedun cle
+Ġfrid ays
+Ġrevert ant
+Ġrevert ants
+Ġexplos ive
+Ġunderpinning s
+Ġerp cs
+Ġtomato es
+ivers ity
+Ġship ped
+Ġconser ve
+Ġhydroxyt oluene
+Ġdinit rate
+Ġpharmaco epid
+Ġlov astatin
+Ġlymphang ion
+Ġdce as
+Ġorch itis
+Ġoxc arb
+Ġrud imentary
+Ġplw ms
+Ġunve il
+Ġimpr ison
+Ġsulfon amide
+Ġsuprac restal
+Ġinterdep endent
+Ġsolubil ize
+Ġpersuas ion
+Ġcapilla roscopic
+Ġpessim ism
+Ġreent rant
+Ġgur igum
+Ġkur dish
+Ġayurved ic
+Ġrbfpd p
+Ġmedull oblastomas
+Ġjer sey
+Ġcardam om
+Ġboswell ic
+Ġeuph orb
+Ġendang ered
+Ġendang ering
+Ġchaper ones
+Ġthermocoup les
+Ġescap ed
+Ġcomed onal
+Ġunanim ous
+Ġaie c
+Ġmik urensis
+Ġmongol ian
+Ġdisser tations
+Ġvertebr ate
+Ġmetam izole
+Ġenact ing
+Ġpykn osis
+Ġcree p
+Ġmov as
+Ġaler ted
+Ġpolymethyl methacrylate
+Ġuropath ogenic
+Ġantitry panosomal
+Ġtroch lear
+Ġtroch lea
+Ġcholester olemia
+Ġtard ive
+Ġweap on
+Ġbeautif ul
+Ġcay man
+Ġhemoly sin
+Ġlaugh ing
+Ġhib iscus
+Ġfork head
+Ġclom iphene
+Ġhomem ade
+Ġsangu inis
+Ġpsychole ptics
+Ġmucoc iliary
+Ġtrom etamol
+Ġtibi ofibular
+arl ixi
+Ġtransmiss ible
+zol amide
+Ġkos ovo
+Ġtubercul oma
+Ġcyclohex imide
+Ġfright ened
+Ġpostext ubation
+Ġbioaut ography
+744 877
+Ġtransped icular
+Ġplasmacyt oid
+Ġpetro clival
+Ġmbar ara
+Ġinspector ate
+Ġbiolum inescence
+Ġcitri odora
+hippocamp al
+Ġbiost ir
+Ġolm sted
+Ġjeff erson
+Ġnanol ip
+Ġrist ocetin
+Ġdihydropyr idine
+Ġbft c
+abras ion
+Ġcarved ilol
+Ġhypofib rinogenemia
+Ġdorsif lexion
+Ġhyperfunction ing
+Ġmicroencaps ulation
+Ġmicrofilar iae
+Ġreval idation
+Ġtriat riatum
+Ġclears ight
+Ġconcana valin
+oglut arate
+Ġphytocomp ounds
+Ġzeyl anicum
+Ġmicroneed ling
+Ġhemidiaph ragm
+Ġcio a
+Ġsuz uki
+Ġtrichin ella
+Ġverben acea
+Ġintang ible
+Ġbioh pp
+Ġike uchi
+Ġmaxq da
+Ġigl arlixi
+Ġpentaf ecta
+Ġwum ei
+Ġnuch al
+Ġperire ctal
+Ġtwelf th
+Ġhawa ii
+Ġuneduc ated
+Ġcalopl aca
+Ġtajik istan
+Ġsacrospin ous
+Ġmuhimb ili
+Ġhypertriglycerida emic
+Ġmicronvol ts
+Ġmegaesophag us
+Ġgurigum u
+3 22
+9 60
+? ".
+a pex
+b op
+b rom
+b ane
+b bs
+d iff
+d li
+f is
+g old
+g rams
+h umoral
+i y
+i atic
+j ac
+m el
+o hyoid
+p ur
+p et
+r ib
+s ters
+s ample
+t z
+t ze
+u ations
+v ad
+v ysion
+x grip
+Ġt ast
+Ġt ue
+Ġt ures
+in cre
+Ġth bs
+Ġs ics
+Ġs ves
+Ġs li
+Ġo ad
+Ġo ptom
+er oid
+Ġc act
+Ġc chd
+Ġp orph
+Ġp aves
+Ġw us
+Ġw rench
+al on
+al cul
+Ġan as
+Ġan eth
+or g
+or ium
+or onal
+or row
+Ġm iv
+Ġm ens
+Ġm ft
+Ġm ish
+Ġm br
+Ġm arian
+Ġb ry
+Ġb ins
+ent imes
+an ide
+ar h
+ar n
+ar ization
+ing enol
+Ġre read
+Ġh ly
+Ġh ove
+Ġh ls
+le olar
+Ġe pro
+Ġe ob
+Ġe verest
+ul ene
+Ġn ass
+Ġn les
+om ized
+Ġl ur
+Ġl ite
+Ġl ays
+Ġl ls
+Ġl fr
+Ġl ssc
+et e
+im ulation
+im lim
+im oto
+Ġg or
+Ġg ian
+id ov
+ati va
+ol ig
+ol der
+Ġas cent
+Ġas phy
+Ġcon izations
+ra bility
+ut z
+ut idine
+ut cm
+ab ond
+res earch
+Ġv og
+Ġv aps
+Ġv pm
+Ġbe aker
+Ġpro quest
+ter na
+ter itinib
+Ġex opoly
+Ġex terna
+Ġr ra
+Ġr ds
+Ġr icin
+Ġr yan
+Ġal os
+Ġis od
+Ġis cript
+Ġis otypes
+um i
+um ed
+am ot
+Ġor it
+oc ont
+Ġby ung
+Ġad cc
+Ġper l
+Ġper vious
+st m
+st atin
+rom y
+Ġsh ell
+Ġle m
+Ġass aults
+Ġac mg
+Ġare al
+Ġdis pase
+Ġco ex
+ress in
+Ġind irubin
+ell ia
+pl aced
+eren s
+Ġne osyn
+ard ipine
+Ġsc g
+Ġdi is
+Ġdi ammonium
+Ġint em
+Ġaf rm
+ens ities
+Ġap jm
+vi i
+Ġk j
+Ġev il
+Ġcan th
+Ġcan thus
+Ġtr cs
+Ġrel dli
+Ġpl k
+Ġpl um
+Ġpl ural
+Ġpl ague
+Ġinter st
+Ġrec k
+Ġrec ont
+Ġrec ourse
+Ġun et
+Ġun acc
+Ġun irradiated
+Ġun natural
+Ġthan k
+Ġincre ta
+Ġmed ped
+ach ys
+Ġassoci ative
+Ġph ob
+Ġph bs
+Ġclin pro
+Ġqu il
+ap ur
+Ġexp ia
+Ġy osh
+Ġact ig
+all a
+Ġfact o
+cl one
+Ġro set
+Ġhas s
+Ġpo z
+Ġcr na
+cr um
+Ġag ranul
+Ġag oraph
+ser um
+Ġmeth en
+Ġunder used
+Ġman aus
+Ġsup ere
+cre a
+Ġtrans rectal
+ep atectomy
+Ġbi ox
+Ġj und
+Ġj xg
+Ġsp icy
+Ġaccor ds
+Ġem per
+Ġpost ing
+eth e
+Ġsm iles
+Ġtra ps
+Ġdr oned
+Ġgl an
+Ġcal biochem
+Ġbas ics
+ob es
+ob ar
+ex or
+Ġkn n
+Ġkn oop
+Ġdecre ments
+Ġmin ch
+Ġi ic
+Ġi ut
+Ġi ous
+Ġi ub
+amm y
+Ġred eem
+Ġpe hc
+Ġhyper re
+Ġpath vysion
+Ġsever ance
+Ġ0 16
+Ġcomple tes
+Ġsecond hand
+Ġdiabet ogenic
+Ġits d
+Ġel om
+Ġel ob
+Ġel mer
+Ġgra ham
+Ġ3 243
+Ġol ga
+ov id
+Ġav at
+Ġrep op
+Ġday care
+Ġep oxide
+Ġep imed
+Ġdrug bank
+Ġneg ated
+Ġgre edy
+Ġop untia
+Ġmy ths
+Ġz c
+00 6
+Ġsevere r
+Ġfactor ies
+Ġox onate
+Ġvol itional
+Ġprof use
+Ġmal d
+Ġmal se
+Ġmal onyl
+Ġhem ico
+Ġsyn aps
+Ġsyn copal
+yz eh
+Ġfra ud
+gen in
+Ġdesign ate
+Ġradi ochemotherapy
+Ġinst inct
+Ġpoly arthritis
+Ġpoly peptides
+Ġpoly caprol
+of exor
+Ġcur tain
+Ġcur ry
+Ġpsych opathy
+Ġct cc
+sequ ently
+ty pical
+gro wn
+Ġadv os
+Ġadv ises
+Ġec ura
+uro us
+Ġmater ia
+ention ally
+Ġ4 50
+Ġflow cyt
+Ġur ges
+Ġprop yl
+Ġach ing
+Ġimplant ological
+Ġvers ed
+Ġcy ber
+oles e
+Ġve t
+Ġmen orrh
+Ġmm fd
+Ġstrateg ically
+Ġbre vity
+ocyt ophaga
+Ġcre p
+osph ere
+Ġcontrast ingly
+ax illary
+Ġlength en
+Ġpur ify
+bo ured
+Ġcut is
+Ġu o
+Ġu ge
+Ġu hs
+Ġu fo
+Ġmir cs
+Ġcs rs
+Ġamount ing
+ina e
+Ġcm rd
+Ġconst rains
+Ġsatisf ies
+Ġfinal ize
+Ġcp vi
+Ġcp ms
+Ġcp af
+Ġretros ternal
+Ġbar ley
+Ġbar nes
+Ġback s
+Ġcontent ious
+Ġreal d
+Ġnet osis
+Ġhs pa
+Ġbu o
+Ġbra y
+Ġmedium s
+Ġmetabol ome
+Ġdil ating
+Ġig s
+Ġhydro g
+Ġgly cop
+Ġhepat opathy
+Ġcath eps
+Ġhip sc
+lex ed
+Ġsusp ecting
+Ġhr f
+Ġbo oth
+ush u
+Ġla wn
+Ġessential s
+Ġmt f
+Ġmt cc
+Ġtox igenic
+Ġsn v
+Ġobject ify
+Ġglob ules
+Ġgr inded
+Ġdiv ert
+rot rans
+Ġmar riages
+Ġlact ates
+Ġtc g
+Ġinternal ize
+Ġoperation ally
+Ġport als
+Ġport rait
+Ġcorrect s
+Ġven ue
+lo ic
+Ġmc ne
+Ġip ad
+Ġfluor ogenic
+Ġfluor ochrome
+Ġperipheral s
+Ġmob a
+Ġadapt s
+Ġtb e
+Ġtb ut
+Ġhemod iafiltration
+che on
+Ġpap p
+Ġtm ql
+lip o
+Ġsd ann
+Ġht k
+land ia
+Ġpm p
+Ġpm me
+Ġpm ht
+Ġleuk o
+Ġinh ale
+gt ca
+Ġhp mm
+Ġwar n
+Ġwar burg
+Ġfr p
+Ġfr pc
+Ġros en
+Ġmp q
+Ġchlor promazine
+Ġbreath ers
+Ġeg v
+Ġenter op
+Ġenter opathogens
+Ġenter itidis
+Ġnh ws
+Ġdiscre et
+Ġmethyl phen
+Ġrob inson
+Ġhar boured
+Ġtom orrow
+Ġfrail er
+Ġbase plate
+Ġcalib rators
+Ġss rs
+Ġds f
+Ġfix ations
+16 4
+16 8
+16 67
+Ġgas oline
+Ġsy k
+Ġtt ge
+Ġgran isetron
+Ġchol erae
+Ġlt me
+Ġhor ns
+Ġbmd ms
+Ġoct n
+Ġsubm issions
+Ġns bbs
+Ġthought ful
+Ġendoc annabin
+Ġpf l
+Ġft m
+Ġliqu iritigenin
+Ġadren als
+Ġba o
+Ġ14 9
+cul ine
+Ġremod eled
+Ġblue phase
+Ġmor us
+Ġmach i
+Ġviol a
+Ġabst ained
+Ġsolid ified
+Ġgest ures
+Ġmh hs
+Ġ16 5
+Ġpum a
+Ġleak ing
+Ġace h
+Ġscar red
+Ġple k
+Ġple ocytosis
+Ġpotent ized
+Ġamp o
+Ġoa a
+Ġbronch ogenic
+fl um
+Ġhol mes
+Ġhol istically
+plast icity
+Ġray yan
+raz ine
+80 7
+Ġcompens ations
+Ġ13 7
+Ġnr cd
+Ġsi yp
+Ġpw r
+Ġquad rip
+Ġpy q
+Ġpy ocyanin
+Ġsig moidal
+Ġnic ardipine
+Ġelectroph er
+Ġtal ent
+25 00
+Ġbs fs
+Ġtap ing
+ameth onium
+Ġrf o
+Ġcac na
+Ġhg bl
+Ġnk f
+Ġepidural s
+Ġmas ala
+Ġmas culine
+Ġsensit izes
+Ġsensit izer
+Ġhippocamp i
+Ġiod ization
+Ġald olase
+Ġpu zzle
+Ġrb fd
+Ġhybrid apc
+Ġfc n
+anth rene
+Ġdeposition s
+Ġdw v
+Ġmultif lora
+Ġje an
+Ġdd p
+Ġras i
+Ġexcre te
+Ġcholang io
+Ġinap pl
+Ġencod er
+Ġsubc on
+Ġmaster mix
+28 3
+Ġcha otic
+Ġnos ac
+Ġhydroxy benzoic
+Ġsut imlim
+Ġcert olizumab
+Ġjn ps
+Ġscal ar
+Ġappropri ated
+Ġbf i
+Ġpao o
+Ġperin uclear
+Ġmultip ara
+Ġvc ps
+ik en
+ik ine
+Ġrp ds
+Ġneurot rophin
+Ġkr bh
+Ġmaxill ae
+Ġlaryng ectomy
+29 2
+Ġrac ially
+Ġfre der
+Ġcytoplasm atic
+albumin uric
+Ġpanor ama
+Ġnd r
+Ġbud d
+Ġacknowled gment
+Ġodont ogenesis
+pin ning
+Ġub c
+Ġub m
+Ġhypo esthesia
+Ġovert ly
+Ġeyes ight
+Ġarteri ole
+Ġfasc ic
+Ġprotr ude
+Ġconve ys
+Ġrom o
+68 1
+68 8
+Ġpent oxif
+Ġpent acyclic
+ophosph at
+Ġinfer oseptal
+Ġoperational ize
+35 874
+Ġfiss ured
+Ġthi oglyc
+Ġrhin oc
+Ġcannula e
+Ġcosm esis
+Ġws v
+Ġole fin
+Ġfen o
+Ġ48 6
+Ġkrus k
+Ġsand ers
+oca val
+ochrom atic
+Ġbca as
+Ġtj p
 Ġdimethyl arginine
-Ġdivor ce
-Ġpetech ial
-Ġdiscolor ant
-Ġdiscolor ants
-Ġstretch able
-Ġadenoid ectomy
-Ġantec ubital
-Ġproceeding s
-Ġnitr ite
-ydro flu
-Ġjuven iles
-Ġdisappointing ly
-Ġembry ological
-Ġembry onic
-Ġembry ologically
+Ġud p
+Ġud s
+Ġfrag rance
+Ġreplic ability
+Ġzh en
+Ġpalm atine
+Ġedition s
+ford shire
+Ġsulph oxide
+Ġbc nu
+Ġmicrod is
+Ġester ification
+Ġtau h
+Ġnatri uresis
+Ġtermin ologies
+Ġnonc ommun
+Ġprogen y
+Ġimag inary
+Ġindustrial ised
+Ġaur ora
+Ġpcc i
+Ġunint entionally
+Ġplug ger
+Ġisot opes
+Ġsant os
+Ġndm m
+Ġgam ified
+Ġtuber ous
+Ġmetaph ases
+Ġmicrog ap
+Ġhit ch
+Ġboost s
+pg han
+Ġsemin omas
+Ġcres ts
+Ġparasit ized
+Ġsrs q
+Ġsrs sept
+Ġeug enia
+Ġintercept ive
+Ġpropag ating
+Ġdispatch ers
+Ġamph etamines
+Ġlit re
+Ġ54 9
+ctt gg
+Ġfrust rations
+Ġjc v
 Ġcritic ize
-Ġcritic ized
-Ġpolysomn ography
-Ġcampus es
-Ġuneven ness
-Ġrefriger ant
-Ġhyalur onan
-Ġunavail ing
-Ġperturb ing
-Ġperturb ation
-Ġperturb ations
-Ġautis tic
-Ġcetyl trimethyl
-encephal ography
-Ġoblique ly
-03 5
-03 9
-09 1
-09 3
-44 1
-44 2
-ave a
-bel ow
-cant e
-po lysiloxane
-tct gga
-tgg acctg
-tgg gtacgga
-Ġub th
-Ġtack led
-Ġtack ling
-Ġaur antiaca
-Ġsid estep
-Ġsant ec
-Ġsant omauro
-Ġsend s
-Ġsene gal
-Ġole ophobic
-Ġpin heiro
-Ġped uzz
-Ġped odontics
-Ġpus teria
-Ġpere ira
-Ġpere mpuan
-Ġpma ip
-Ġanh idrosis
-Ġanh ydrified
-Ġdere rmined
-Ġdere plication
-Ġdip ped
-Ġdip ole
-Ġdip eptide
-Ġdip osit
-Ġmyl ar
-Ġmyl opoulou
-Ġber ge
-Ġber nal
-Ġber ry
-Ġber vian
-Ġbang alore
-Ġbang kok
-Ġbang lades
-Ġbang sar
-Ġbern ier
-Ġreferen cing
-Ġreex amine
-Ġreaff irming
-Ġtod dler
-Ġhit achi
-Ġeigen vect
-Ġeigen value
-Ġstuff ed
-ulf onyl
-aca aggc
-Ġlis inop
-Ġlud er
-Ġlati tud
-Ġni enk
-Ġnatal i
-Ġgg plot
-Ġgg cccagct
-Ġgy hd
-Ġgall i
-Ġasper ity
-Ġasper ities
-Ġcong olense
-Ġperin atally
-Ġisl am
-occ um
-Ġincap acitating
-Ġcompe titors
-Ġasser ted
-Ġassimil ated
-Ġassimil ates
-Ġclient eles
-Ġscant y
-Ġscant ly
-Ġcour ant
-Ġcann ula
-Ġcann abin
-Ġparamed ical
-Ġhaw ally
-Ġhaw kins
-Ġprese lected
-Ġobsc ure
-Ġobsc uration
-Ġrecon nected
-Ġrecon naissance
-Ġcarunc ula
-Ġabst inent
-Ġunl ocking
-Ġunl awfully
-Ġkim wip
-Ġkoch er
-Ġphag ocytose
-ctc cttcc
-Ġmould s
-Ġmould ed
-Ġnoncon forming
-Ġnoncon tributory
-Ġspin osum
-Ġspin ocerebell
-Ġbuttress es
-Ġcommens urate
-Ġtransc restal
-Ġtransc utaneous
-Ġtransc ultural
-Ġtransc ulturally
-Ġsale h
-Ġ09 1
-Ġinflux es
-Ġocclus o
-Ġpalp ate
-Ġpalp able
-Ġpalp ating
-Ġpalp atory
-Ġestr ada
-Ġflip ped
-Ġosteoph yte
-Ġprofici ent
-Ġveron a
-Ġ53 7
-Ġ53 9
-Ġhards hips
-Ġpolyp oid
-Ġpolyp eptides
-Ġsymb ionts
-Ġodonto lyticus
-Ġmultiplex ing
-Ġauthentic ity
-Ġ68 72
-Ġgelatin ous
-Ġpreca ution
-Ġclearing house
-Ġbooking s
-Ġhyperg ammaglobulinemia
-Ġmutagen esis
-Ġmutagen icity
-Ġskew s
-Ġpurs ued
-Ġpurs uit
-Ġtrajec tory
-Ġtransloc ate
-Ġtransloc ating
-Ġreplen ishing
-Ġencaps ulation
-Ġcopious ly
-Ġnanof illed
-Ġnanof ibers
-Ġurg ently
-Ġmiscon ceptions
-Ġpfh xs
-Ġcardi ometabolic
-Ġrevis it
-Ġrevis its
-Ġrevolution ize
-Ġvasoconstr iction
-Ġaggl omerated
-Ġdilacer ations
-Ġattract ant
-Ġattract ants
-Ġthorac oscopic
-Ġthorac oab
-Ġconcaten ating
-Ġconvinc ed
-Ġwarrant ing
-Ġelectroc auter
-Ġtransfusion s
-Ġquarant ined
-Ġquarant ines
-Ġanticoag ulants
-Ġnonsyn onymous
-Ġnonsignificant ly
-Ġexhaus tion
-Ġrefract ometer
-Ġsuprac utaneous
-Ġunreli ability
-Ġosteoprogen itors
-Ġventil atory
-Ġglycos ylphosph
-Ġneurop athic
-Ġneurop athy
-Ġnanostruct ured
-Ġcoincident ally
-Ġsubcult uring
-Ġlicens ure
-Ġpericard ial
-Ġreluctant ly
-Ġbusiness es
-Ġeiken ella
-Ġeiken alla
-Ġhonest y
-Ġhyperchrom atic
-Ġhyperchrom asia
-Ġinterpol ate
-Ġinterpol ations
-Ġzeal ous
-Ġmicha ud
-Ġmicha el
-Ġdermat an
-Ġdermat ology
-Ġadvertise ment
-Ġunderpin ned
-iquit ination
-Ġellip tic
-Ġellip tical
-Ġmenstr uation
-Ġbibli ographies
-Ġecho es
-Ġnurser y
-Ġexempl ified
-Ġveloph aryngo
-Ġsacrific ing
-Ġdublin iens
-Ġconglomer ates
-Ġimmob ilon
-Ġconspicuous ly
-Ġoverwhel m
-Ġoverwhel med
-Ġtubercul ous
-31 7
-aut oimmune
-kr ishnan
-oac ids
-sing le
-Ġty csb
-Ġtam il
-Ġtps dig
-Ġtps util
-Ġath ens
-Ġath lete
-Ġath letic
-Ġaus roc
-Ġaus terity
-Ġaus tenite
-Ġavid in
-Ġthi oglyc
-Ġthi ogalact
-Ġthi ocyante
-onin ic
-Ġsab a
-Ġsak ki
-Ġoint ments
-Ġophthal mic
-err correct
-Ġcac o
-Ġws ls
-Ġwrap per
-Ġwart y
-Ġwatch ful
-Ġwinb urn
-Ġinad aptability
-Ġinward ly
-Ġanamn estic
-Ġdq ms
-Ġdiph enyl
-Ġdiph osphonate
-Ġdiph enhydramine
-Ġmels on
-Ġbip upilar
-Ġbell ini
-Ġbell igerence
-Ġblow n
+Ġstir rer
+Ġunequ ally
+Ġyang tze
+Ġmont ene
+fol k
+Ġuh r
+Ġ89 4
+Ġgnrh r
+Ġmicrom eters
+Ġechin ococcosis
+Ġlie b
+oce les
+Ġacclim atize
+Ġwel ding
+Ġgil teritinib
+Ġprohib iting
+app reci
+Ġbend a
+Ġcapn ocytophaga
+Ġay as
+Ġmyofibrob lastic
+Ġclostrid ia
+ocarcin ogenesis
+Ġtriph asic
+Ġbrainst orm
+Ġton ometer
+urv ival
+Ġquin oa
+Ġoriental e
+Ġinex t
+Ġtyph oid
+Ġyg tss
+Ġyin zh
+Ġscra pe
+Ġcil ofexor
+Ġcrush ing
+Ġmillil itres
+bing en
+lym ph
+Ġaas ld
+Ġmultis ystemic
+calc iferol
+Ġcw r
+Ġrum ors
+Ġcorros ive
+Ġtff s
+Ġperturb ed
+Ġdac pr
+Ġgate keepers
+Ġbiof unctional
+Ġunif lora
+Ġjack knife
+Ġdps i
+Ġwis ca
+Ġerm b
+Ġnonresp onder
+Ġaffirm ation
+Ġflor ibund
+Ġban ana
+Ġbdm ccn
+Ġdecel erating
+Ġupg rading
+Ġsympath ovagal
+Ġhur ry
+Ġmetastas ectomy
+Ġeis en
+Ġdeoxy uridine
+Ġqing zh
+Ġvmp fc
+azep ate
+Ġnw co
+Ġdun can
+Ġpmv r
+Ġstry de
+Ġneuropath ology
+Ġprofil ometry
+Ġsubspec ies
+Ġbq s
+Ġcte ph
+Ġdmp n
+Ġinnerv ating
+Ġbri er
+Ġsong kla
+Ġcler ical
+Ġeap cs
+Ġreconn ected
+Ġoro antral
+Ġdeleg ated
+osc int
+osc rotal
+Ġqia quick
+Ġtour ism
+Ġcollim ators
 Ġblow ing
-Ġbisc upid
-Ġbah asa
-Ġbacill us
-Ġrebound ed
-Ġreorient ed
-Ġhung ate
-Ġhung ary
-Ġeb d
-Ġeub acterial
-Ġeuk aryotic
-Ġeager ness
-Ġstew art
-Ġlund skog
-Ġlag ocka
-Ġlux ated
-Ġlux ate
-Ġlux aprint
-Ġnice ly
-Ġgcc gctcc
-Ġgcc atcat
-Ġgcc atcacg
-Ġgust ave
-Ġgeront ological
-Ġgeront ology
-Ġgeront ologists
-Ġconges ted
-Ġons ite
-Ġons ets
-Ġverm ette
-Ġverm aire
-Ġverm illion
-Ġvacc ination
-Ġvinyl polysiloxane
-Ġrestr aining
-Ġisoprop yl
-Ġchim eric
-Ġchap ter
-Ġdepress or
-Ġmei osis
-Ġacr p
-Ġacr ies
-Ġacr onyms
-Ġcomputation ally
-Ġshin y
-Ġhex agonal
-Ġhex ahedral
-Ġcloth es
-Ġmaz umdar
-Ġcohes iveness
-Ġhaus en
-Ġallo immun
-Ġobe idi
-Ġaccred itation
-Ġnour ished
-Ġsami ee
-Ġabus er
+Ġcommod ity
+Ġpean uts
+Ġuncoup led
+Ġhen ri
+Ġyam ag
+Ġtachyc ardic
+Ġtess mannii
+Ġpyr iform
+Ġacrom ial
 Ġunil ocular
-Ġunpro cessed
-Ġintoler ant
-Ġyosh pe
-Ġyosh imura
-Ġyosh ihiro
-Ġamaz on
-Ġamaz ing
-Ġamaz onia
+Ġconspicuous ly
+Ġjat rorrh
+Ġintras pinal
+Ġslur ries
+Ġcraving s
+Ġcompanions hip
+Ġtympan i
+Ġsper mic
+Ġete c
+Ġhypophosph ataemia
+Ġoft entimes
+Ġspill over
+Ġhyperv olemia
+Ġupt akes
+Ġrew arming
+Ġintercus pal
+Ġuniversit ario
+Ġherpetic um
+Ġindefinite ly
+Ġwob imp
+Ġlaf h
+Ġlaf utidine
+Ġbifurc ated
+Ġcoag ulative
+operic ardium
+Ġsubord inates
+Ġtnfa ip
+Ġarcs ine
+Ġcamphor ata
+Ġfuk uoka
+Ġhypervir ulence
+Ġdiath erm
+Ġsyt o
+Ġproanthocyan idin
+Ġtorn ado
+Ġreco arctation
+Ġorex in
+Ġanim ation
+Ġmam ld
+Ġzheng zhou
+Ġfimbr ia
+Ġholog ram
+Ġneckl aces
+Ġbullet in
+opol itical
+Ġinfest ation
+Ġdemethyl ase
+Ġmultiph ase
+Ġtutorial s
+Ġarra yl
+Ġfest oons
+Ġconject ure
+Ġslum s
+Ġterr ible
+Ġmyofibril s
+Ġdart os
+Ġhyperfib rinolysis
+Ġretrocl ined
+Ġunmask ing
+Ġmicrofract ure
+Ġnipp onica
+Ġnonpharm acological
+Ġvern onia
+176 1667
+Ġcordyce ps
+Ġwz yzp
+Ġhcq is
+Ġadenotons illectomy
+bes ides
+Ġapico ectomy
+Ġabic iximab
+Ġguill ain
+Ġreconcil iation
+mand u
+Ġdahl berg
+Ġdecarbox ylase
+Ġbureaucr atic
+Ġkans as
+Ġocul omotor
+Ġrasp berry
+Ġdecoct ed
+Ġcetyl pyr
+Ġsupermark ets
+Ġeum ds
+Ġyers inia
+Ġecchym osis
+Ġunafford able
+Ġphilt rum
+Ġhydrodist illation
+Ġwrm ds
+Ġbacc etti
+Ġchad ox
+Ġwrms ds
+Ġcardioemb olic
+066 69
+Ġkirs chner
+Ġeliz abeth
+Ġbris bane
+Ġtendin opathy
+Ġcountermeas ures
+Ġphellodend ri
+Ġsyz ygium
+Ġinse parable
+Ġkath mandu
+Ġhyperphosph atemia
+Ġpsor ale
+Ġgrate ful
+Ġjuj ube
+Ġcicl osporin
+Ġcentrip etal
+Ġtetrac aine
+Ġbactere mic
+Ġmtbdr plus
+Ġmyn xgrip
+Ġhuk ou
+Ġosst ell
+Ġalbug inea
+Ġcitron ell
+Ġaof as
+Ġotal gia
+Ġgarb age
+Ġalcy one
+Ġhashim oto
+Ġpolychrom atic
+Ġapprent ices
+Ġiverm ectin
+Ġfacilitad ores
+Ġhousem ates
+Ġpipec uronium
+Ġtue bingen
+Ġtures ky
+Ġhove yzeh
+Ġcoex ists
+Ġneosyn ephrine
+Ġagranul ocytosis
+Ġdroned arone
+Ġhemico lectomy
+Ġpolycaprol actone
+Ġmenorrh agia
+Ġtmql b
+Ġrbfd ps
+Ġsutimlim ab
+35874 116
+Ġnoncommun icable
+Ġyinzh ihuang
+Ġqingzh uan
+Ġjatrorrh izine
+0 65
+2 68
+5 10
+6 63
+7 23
+7 903
+b ilt
+c ad
+c ia
+c oral
+c arb
+c oside
+f luoro
+j ia
+m f
+m ans
+m vo
+o ads
+q e
+s elf
+s uch
+u ates
+v ue
+w ag
+Ġt axis
+Ġt astes
+Ġt dlns
+Ġt udca
+in ene
+Ġa ica
+at ally
+Ġs gs
+en meyer
+Ġo rai
+Ġc ff
+Ġc pl
+Ġc olog
+Ġc osinor
+Ġp omer
+Ġp aryl
+Ġp plat
+Ġin icc
+Ġan oi
+Ġan iline
+or atory
+or oss
+or ini
+Ġd ough
+Ġd ns
+Ġm agg
+Ġm plus
+Ġb ays
+Ġb he
+Ġb ats
+Ġb ocs
+an abe
+an thera
+Ġre id
+Ġre intro
+Ġh ha
+Ġe od
+Ġe gn
+Ġe bb
+ve ct
+ul pal
+ul nar
+Ġn la
+Ġst up
+Ġl ope
+Ġl fts
+os ulphate
+im an
+Ġg ase
+Ġg na
+Ġg cls
+ig arh
+id onin
+th orax
+ce les
+ol o
+ol imod
+ol popexy
+if erin
+Ġas cle
+Ġfor d
+ra den
+ra ble
+ra gole
+ab g
+Ġv bd
+ch un
+Ġbe f
+Ġbe an
+Ġpro oxid
+Ġpro max
+Ġpro peptide
+Ġex oscopic
+Ġex ocytosis
+ant ar
+Ġr z
+Ġr ide
+Ġr mc
+Ġr ico
+Ġr alf
+am oya
+Ġor idonin
+oc aps
+op rop
+Ġde j
+Ġde ca
+ort is
+Ġch h
+Ġch un
+Ġim b
+ure t
+ure nic
+ib ourt
+qu ality
+ore act
+Ġse k
+og eriatric
+ad ione
+Ġpre o
+Ġper ich
+Ġper cp
+Ġsu its
+Ġsu ites
+Ġgro oved
+rom ed
+Ġsh cc
+Ġsh uff
+Ġsh ipping
+ip ramine
+Ġle vet
+und al
+Ġdis array
+Ġco um
+Ġco oked
+port s
+port in
+Ġsign post
+ell ae
+Ġnot ify
+pl akia
+pl acental
+Ġcl ade
+vel ess
+per ience
+Ġinf ects
+Ġfo ki
+Ġap ol
+Ġful crum
+Ġsur name
+Ġab h
+Ġk ud
+Ġk end
+Ġk av
+Ġk ash
+ors ion
+Ġall iacea
+Ġev odia
+Ġtr g
+Ġcell ul
+Ġinter relation
+Ġrec ode
+Ġun g
+Ġun inflamed
+Ġpart nered
+Ġsub way
+ill er
+Ġam ci
+Ġam da
+pro of
+Ġph b
+Ġclin check
+Ġmod us
+ap olar
+Ġlow ry
+Ġy as
+Ġy ue
+Ġy rc
+Ġact eoside
+erm e
+Ġar den
+Ġdet ention
+Ġtest ified
+cl onine
+Ġcor ail
+Ġro flum
+Ġhas san
+Ġcr ps
+ital ization
+cr c
+Ġen ke
+Ġext inguish
+Ġfin ns
+Ġup jo
+Ġinv ention
+Ġover bur
+Ġmeth acryl
+Ġunder f
+Ġman ga
+ass es
+ject ed
+Ġ1 19
+Ġ1 14
+Ġra h
+Ġimage quant
+Ġnon con
+Ġdep ilation
+Ġperi otest
+Ġhospital ists
+Ġsp id
+Ġsp io
+Ġ2 10
+Ġem em
+Ġem ono
+Ġdef a
+ardi olipin
+Ġyear book
+Ġpred icated
+Ġcal cemia
+Ġmon onucle
+Ġtotal ed
+Ġgener ators
+Ġthera cal
+Ġcardi of
+Ġsym pos
+anc o
+ust ular
+Ġest ragole
+Ġi uca
+Ġsymptom atically
+Ġcalc ulous
+Ġhyper leuk
+Ġhyper activation
+Ġhyper phosphorylation
+Ġpath file
+Ġif u
+Ġprim ipar
+Ġ0 18
+Ġins ulation
+olic idal
+Ġol a
+ov as
+ov ue
+ov sky
+ov illous
+Ġps ir
+Ġps af
+ie ved
+Ġprot otypes
+Ġprot ractor
+Ġintra vasation
+Ġloc ates
+Ġcondition er
+ts h
+Ġcommon ality
+Ġcase i
+Ġcomb inator
+Ġmo ore
+Ġmo vie
+Ġmy ogenin
+Ġimmun izations
+Ġsens ed
+Ġtechn ologists
+Ġox ia
+Ġmal let
+rain age
+Ġmicro por
+ec ke
+ec rolimus
+Ġer astin
+Ġcyt of
+Ġcyt oprotection
+Ġprevent ability
+Ġlab as
+Ġdys met
+Ġdys esthesia
+Ġpsych ophysiological
+Ġfac scan
+Ġbm n
+Ġgluc okinase
+Ġml v
+Ġhel pline
+Ġinjur ing
+Ġbel ts
+Ġbel ching
+co agulation
+co umarin
+Ġmus e
+Ġequ i
+Ġlip v
+Ġbene v
+Ġpul ley
+Ġliter ally
+Ġcommun alities
+Ġprop ulsion
+Ġicu ap
+Ġsal but
+Ġvers ican
+Ġanes thesiological
+Ġoff ense
+Ġopt ogenetic
+Ġhand ing
+Ġshort fall
+Ġchem ore
+Ġchem oprophylaxis
+Ġquant ikine
+Ġmen adione
+Ġvit exin
+Ġlymph ohist
+Ġlymph ocytopenia
+Ġ7 50
+Ġcirc ulate
+Ġunt o
+Ġos un
+opath ologist
+hy pop
+set s
+Ġdam ping
+Ġtub b
+Ġphen oxy
+me g
+me ability
+Ġcs ci
+iot roph
+Ġorth ometric
+Ġever ted
+Ġcrit ique
+ina es
+Ġfunctional ities
+Ġmac s
+Ġunderstand ably
+Ġheter osexual
+Ġartic ulator
+Ġver ona
+Ġbar on
+Ġnor folk
+ole akage
+Ġevery where
+Ġdown side
+Ġneuro inflammatory
+Ġneuro humoral
+Ġneuro plasticity
+Ġspecial ize
+Ġfood borne
+Ġmetabol izers
+Ġmorph o
+Ġpower lab
+Ġta ut
+Ġfast q
+Ġlesion ing
+Ġvisual izes
+Ġbo il
+Ġplan ed
+ush ima
+pid ermal
+Ġmt fa
+Ġprep ontine
+Ġx m
+Ġsn ris
+Ġgu ibourt
+Ġthromb osed
+Ġthromb ogenic
+Ġgr r
+Ġgr im
+Ġdiv ing
+Ġdiv ine
+bal ancing
+atif ied
+oh em
+Ġlik es
+Ġce i
+Ġcycl ers
+Ġeuro stat
+Ġdl a
+Ġnorm ativ
+Ġobtain ment
+Ġbp b
+Ġhemat o
+Ġven us
+agen et
+Ġplant ed
+Ġantic ardiolipin
+Ġsegment ing
+Ġjust ifications
+Ġpercept ron
+Ġnas a
+Ġled d
+Ġmaintain ers
+Ġ10 7
+Ġmix es
+Ġbow ing
+Ġpap pe
+Ġpap ulop
+Ġrt d
+Ġrna iso
+Ġcall iper
+Ġbowel s
+20 21
+Ġdra ped
+urg ically
+Ġpet iver
+Ġoh cp
+Ġethn ical
+Ġpm h
+Ġlig ations
+Ġrh mvo
+Ġnone x
+Ġhard est
+Ġfr co
+10 733
+Ġalgorith mic
+Ġure terol
+Ġcc bt
+Ġenter ococcal
+Ġenter otoxin
+Ġnh b
+Ġnh be
+Ġna res
+Ġrob ots
+Ġcentrifug ated
+Ġnan oform
+Ġnan oleakage
+Ġtele psych
+Ġss f
+Ġid l
+Ġadop ters
+Ġpermanent e
+yc urcumin
+Ġequip otent
+Ġea ec
+Ġtt i
+Ġflav us
+21 7
+Ġfund oplication
+Ġlt fu
+Ġcf vr
+Ġbd ns
+Ġpf ar
+Ġpf dd
+Ġft cp
+Ġsbp m
+Ġjud icial
+Ġuns olved
+Ġka en
+Ġgreen house
+Ġmor isky
+17 1
+Ġaml cg
+Ġhoriz ons
+Ġ15 5
+Ġpb t
+Ġbreak out
+Ġpilot s
+Ġcaps id
+Ġmyel ogenous
+Ġmyel olip
+Ġmineral ised
+Ġneon iti
+Ġduoden oscopes
+Ġneph rect
+Ġanth rac
+Ġtyp ified
+Ġresusc itations
+Ġdest inations
+Ġevident ial
+Ġgingiv ae
+Ġinsight ful
+Ġeye ball
+Ġuter otonic
+Ġhost ing
+Ġcompens ates
+Ġts cca
+Ġts dmards
+Ġnr qlq
+Ġmultid irectional
 Ġket ac
-Ġket oconazole
-Ġket oprofen
-Ġkel es
-Ġkel oid
-Ġkel antan
-Ġkir zioglu
-Ġwein stein
-Ġenqu iring
-Ġoutweigh s
-Ġoutweigh ed
-Ġsucc umbed
-Ġark ansas
-Ġmaxd ball
-Ġpharyng oscopy
-Ġoverhang s
-Ġoverhang ing
-Ġdecent ralised
-Ġcrypt ochromes
-Ġundec ane
-Ġdiscord ant
-Ġspar sity
-Ġmicropartic le
-Ġmalposition ed
-Ġconfine ment
-Ġconfront ation
-Ġconfront ational
-Ġserb ia
-Ġmonochrom ator
-Ġzh ong
-Ġzh ifei
-Ġzh ermack
-Ġzip per
-Ġdraf ting
-Ġexplo iting
-Ġsmr r
-Ġschiff ner
-Ġreceptive ly
-Ġpotenti ality
-Ġguess ing
-Ġpuls atile
-Ġslp m
-Ġslur ries
-Ġhypot onicity
-Ġleaders hip
-avail able
-Ġredirec ted
-Ġcontrac eptive
-Ġcontract ually
-Ġpartners hip
-score thickness
-Ġrefus als
-Ġpolyg raph
-Ġpolycr ystal
-Ġlabi olingual
-Ġlabi opalatal
-Ġlabi olingually
-Ġretreat ing
-Ġretreat ments
-Ġretreat ability
-Ġimmunocyt ochemical
-Ġswell ings
-Ġsynth ograft
-individual s
-Ġprecurs ors
-Ġworkload s
-Ġbiomolec ular
-Ġbiomolec ules
-Ġbiomolec ule
-Ġdelt as
-Ġpursu ant
-Ġlipopolys accharide
-Ġphotopolymer ized
-Ġcollaps ing
-Ġpenins ular
-Ġburn out
-Ġqi u
-Ġveter an
-Ġportr ayed
-Ġcomprehens ibility
-gga agg
-Ġetiopath ology
-Ġ124 3
-Ġgaug ing
-Ġlymphad enoid
-Ġincompet ence
-Ġpolicym aking
-Ġsyrup s
-Ġreinser tion
-Ġmelt down
-Ġbenj afield
-Ġpermut ations
-Ġquadr at
-Ġsubstruct ure
-Ġterat ogens
-Ġinga as
-Ġscrut iny
-Ġscrip ted
-Ġlegion ella
-Ġlegion ellosis
-Ġglucocortic oid
-Ġanthro plus
-Ġunpolymer ized
-Ġmotorcy cles
-Ġneuropsych ological
-Ġtann ins
-Ġdecompens ation
-Ġdecompens ated
-Ġdecompens ate
-Ġtunis ia
-Ġlaun ch
-Ġdeduc tible
-Ġintersti tium
-Ġmicromo tion
-Ġmicromo tions
-Ġmicromo vements
-Ġcertific ates
-Ġartefact ual
-Ġartefact ural
-Ġhaemost asis
-Ġperpet ually
-Ġbifurc ations
-Ġcoversl ips
-Ġparasit ophobia
-Ġunavoid ably
-Ġglomerul opathies
-Ġpathophysi ologic
-Ġsapi ens
-Ġtryptic ase
-Ġunrestor ability
-Ġevapor ated
-Ġdislod ged
-Ġphilosoph ies
-Ġubiquit ination
-Ġsidew ay
-Ġreexamin ed
-Ġreexamin ing
-Ġreexamin ations
-Ġgyna ecology
-Ġperinatal y
-Ġcardiomy ocyte
-Ġelectrocardi ography
-Ġtrophozo ite
-Ġpemph igus
-Ġnocic eptor
-Ġgingivect omies
-Ġsubcomposition s
-Ġsubcomposition al
-Ġjurisd iction
-170 5
-170 7485
-36 2
-420 1707485
-66 6
-bec ause
-bet a
-bled ygo
-cap ene
-cact tct
-cact aggtg
-dif ference
-dif ferent
-del iler
-div ant
-dem and
-dem onstrated
-diss atisfied
-gac agtt
-gac acagg
-juan a
-oz ide
-sur vival
-sum c
-second ly
-tur key
-uf ier
-uf statter
-Ġia j
-Ġtall ied
-Ġtian amp
-Ġtian jin
-Ġtale bi
-Ġtale ghani
-Ġaro use
-Ġaro used
-Ġsaccha rolytic
-Ġsaccha romyces
-Ġots u
-Ġots uki
-Ġcic lospor
-Ġcic atrization
-Ġcres ts
-Ġcres cent
-Ġctr l
-Ġcex p
-Ġcex tran
-Ġpb sts
-Ġpomer ania
-Ġpomer anian
-Ġpascal s
-Ġwood s
-Ġwood side
-Ġwinding s
-Ġingest ing
-esc ulin
-Ġaner obic
-Ġaner opack
-Ġanos im
-Ġanos mia
-Ġantim yco
-Ġantim etabol
-Ġanecd otal
-Ġanecd otally
-Ġfis cal
-Ġfos ters
-Ġfos fomycin
-Ġfab i
-Ġfab k
-Ġfled gling
-Ġdess ication
-Ġdess ert
-Ġdaw son
-Ġdaw ley
-Ġdiction ary
-Ġdiction aries
-Ġdalex tra
-Ġmn emonic
-Ġmers in
-Ġmary land
-Ġmile tic
-Ġmerg er
-Ġmerg ing
-atcc ggtc
-atgg acct
-Ġbum ping
-Ġbum pers
-Ġbile esculin
-Ġrever berates
-Ġrearr anging
-Ġrearr angements
-Ġreestabl ishing
-Ġreestabl ishment
-Ġtow ed
-Ġtow els
-Ġhed strom
-Ġhed ghe
-Ġhes itation
-Ġhes itant
-Ġhir ai
-Ġhir aki
-Ġhose y
-Ġhose in
-Ġegf r
-Ġstub born
-Ġsteep est
-Ġlent ulo
-Ġlent ulos
-Ġlia oning
-Ġlia ison
-Ġnol an
-Ġnol temeier
-Ġnap dh
-Ġnap hthalene
-Ġnem o
-Ġnem covsky
-Ġnik on
-Ġnik olic
-Ġgar net
-Ġgar vin
+Ġpw m
+Ġtrop isetron
+Ġlm k
+Ġcarcin osarcoma
+Ġcn uh
+Ġmanage ability
+Ġdiscrimin ates
+Ġ11 5
+ira cet
+Ġile oca
+Ġpron unciation
+Ġplasm in
+Ġfish ers
+Ġfish ery
+Ġtry p
+27 6
+34 0
+34 1
+15 1
+gc g
+Ġmilk y
+acco unted
+Ġcup ula
+Ġbypass es
+Ġaz am
+Ġdegen erate
+Ġgs v
+Ġbol ton
+Ġsensit izations
+18 18
+90 2
+Ġcatal yses
+Ġdermat o
+Ġpk p
+Ġld fa
+Ġcari ogenicity
+Ġendometri omas
+Ġpu romycin
+Ġgf obt
+Ġfu els
+olytic us
+Ġlept um
+Ġendogenous ly
+otra cker
+45 4
+Ġsynerg etic
+Ġfing olimod
+Ġtel en
+Ġpic cs
+Ġgn ets
+Ġchole calciferol
+24 7
+Ġrm st
+pect ral
+60 3
+Ġolig omers
+Ġautomatic ity
+36 8
+Ġlid o
+Ġlid cor
+Ġhepar an
+Ġrp fc
+37 3
+Ġsecret ome
+40 2
+Ġcholecyst okinin
+Ġdt f
+Ġhypers pectral
+inter ventional
+da h
+Ġlaryng opharyngeal
+Ġconstruction s
+Ġexhaus ting
+Ġmamm a
+Ġmur at
+Ġmacro d
+Ġmacro design
+Ġpep pers
+Ġfung emia
+Ġlb a
+Ġkh on
+Ġgon z
+Ġconceptual ize
+Ġment ality
+Ġhydroxyl ated
+Ġconfig ured
+Ġhall s
+Ġprotr usive
+Ġips cs
+Ġlute um
+Ġmalform ed
+35 1
+Ġremed ication
+Ġelectroly zed
+ocice ption
+Ġign ores
+Ġequilib rate
+Ġdysph oria
+Ġpra ise
+Ġich s
+Ġcaud a
+chin ps
+Ġfs u
+Ġfs ncs
+Ġretest ing
+Ġvr fs
+Ġlag cs
+Ġcong olese
+Ġrefus es
+Ġtic lop
 Ġgem ma
-Ġgem inatus
-Ġgill ison
-Ġglu ed
-Ġglu ing
-Ġgob let
-Ġgob bledygo
-Ġggg ccaact
-Ġggg tttg
-Ġgca agtctag
-Ġgca agaaagag
-Ġgtg tctgga
-Ġgtg tgggtacgga
-Ġcongr uous
-Ġcongr uent
-Ġorm ocer
-Ġorm ocers
-Ġvog ue
-Ġvog ues
-Ġvist as
-Ġvist adent
-Ġvanc omycin
-Ġvanc ouver
-Ġalk yl
-Ġalk oxy
-Ġaler ts
-Ġaler ted
-Ġalber o
-Ġalber ti
-Ġperth ometer
-Ġperth omether
-Ġperit ubular
-Ġperit onitis
-Ġpervious ness
-Ġperitone al
-Ġperitone um
-Ġresum es
-Ġresum ption
-trap ping
-Ġisthm us
-Ġisthm uses
-utom ated
-Ġchol inerg
-Ġchol angi
-Ġincong ruous
-Ġincong ruity
-Ġata xias
-Ġdistr act
-Ġdistr actions
-Ġdisoc cluded
-Ġdisoc clude
-Ġdisorgan ized
-Ġdisorgan ization
-Ġdisintegr ation
-Ġdisintegr ated
-Ġshen yang
-Ġship ped
-Ġshield ed
-Ġclon ally
-Ġclon idine
-Ġclad ogram
-Ġclad osporium
-Ġclaus ii
-Ġclaus trophobia
-Ġapic ectomy
-Ġapic ocoronal
-Ġlean er
-Ġsurin ame
-Ġsurin amese
-Ġcance led
-Ġcance ling
-Ġparag raph
-Ġparag raphs
-Ġroe koseal
-Ġroe leveld
-Ġroth ia
-Ġross i
-Ġross ini
-Ġtrin itrobenz
-Ġtrin idadian
-Ġtrig one
-Ġtrig eminal
-Ġconsens ual
-Ġconsens ually
-Ġconsangu inity
-Ġconsangu ineous
-clin ically
-clin icians
-Ġreck oned
-Ġrecons titution
-Ġrecons idered
-Ġreloc ated
-Ġreloc ates
-Ġprab hu
-Ġprab hak
-Ġcarre ra
-Ġcarre ras
-Ġquint essential
-Ġquint essenz
-Ġunim portant
-Ġunim peded
-Ġunper formed
-Ġunper ceived
-Ġuncon ventional
-Ġuncon fident
-Ġunanim ous
-Ġunanim ously
-Ġamm ari
-Ġamm onia
-Ġamin omethane
-Ġamin obutyric
-Ġkre vers
-Ġkre uter
-Ġkal ra
-Ġkal etra
-Ġkoh ar
-Ġkoil ocytes
-Ġkoil ocytosis
-Ġenerg ies
-Ġenerg ised
+Ġmerg er
+48 9
+Ġatl anto
+Ġhomogenous ly
+Ġalarm ingly
+Ġlatin os
+Ġadr b
+Ġxi ii
+Ġmex icans
+Ġlved a
+Ġbiote chn
+Ġendocrin opathy
+Ġendocrin opathies
+Ġincent iv
+Ġnodular ity
+Ġfus idic
+Ġimag o
+Ġdcs i
+Ġdy clonine
+Ġendodont ist
+Ġhop eless
+map per
+Ġprolifer ations
+Ġroad map
+Ġbook lets
+Ġsant orini
+Ġtx b
+Ġnitro so
+Ġgam ing
+Ġglyco hemoglobin
+Ġclon azepam
+Ġwed ged
+Ġisch ium
+Ġmultiplex ed
+Ġmyofib ers
+Ġreward ed
+Ġtran sep
+Ġgj a
+Ġpcl d
+Ġferro portin
+Ġwatch man
+Ġcomment ing
+Ġscl eral
+Ġcos olvent
+Ġetiological ly
+Ġpvt bf
+adi en
+alco hol
+Ġrehospital ized
+Ġbir d
+Ġexempl ify
+Ġdeox yc
+Ġphr asing
+Ġmip i
+Ġmip sc
+Ġell man
+Ġquadrup let
+Ġchile ans
+Ġblastocyst is
+Ġmultil ayered
+Ġintussus ceptions
+Ġrnase q
+Ġees l
+Ġdeflection s
+Ġtroub ling
+ensit ization
+Ġttm v
+ret ched
+Ġdemineral izing
+Ġdor zolamide
+49 7
+Ġcys tein
+Ġog ata
+Ġnebul ization
+obenz yl
+Ġsubsid ised
+Ġpolyt etra
+Ġsupers cripts
+Ġait ds
+Ġelu ents
+otub ular
+Ġahr q
+Ġexcit otoxicity
+Ġdefibrill ators
+Ġnont raumatic
+Ġtack led
+Ġade pt
+Ġdac arbazine
+Ġric over
+Ġcampus es
+Ġhyperp olar
+Ġchor oidal
+Ġjiang xi
+Ġiac uc
+Ġhyperc ontract
+Ġwon kw
+Ġefs a
+Ġmisle ad
+Ġneighbourhood s
+Ġkyph oplasty
+Ġsque ez
+Ġprocl ined
+Ġnonsm oking
+Ġdj w
+Ġew ha
+Ġthiaz olyl
+Ġdun nett
+Ġphosphoryl ating
+Ġtroc ars
+Ġimmobil on
+Ġmond ays
+Ġperceiv es
+Ġendeav our
+Ġanov ulatory
+Ġneurob iology
+Ġminip ig
+Ġpess aries
+Ġtrib al
+Ġral p
+Ġlmp ge
+Ġsme ared
+Ġerl enmeyer
+Ġsrl f
+Ġaerob actin
+Ġelectros pinning
+Ġdepolar ized
+Ġprosthodont ist
+Ġadap ters
+Ġsettle ment
+Ġfumar ic
+Ġunpro cessed
+phosphory lated
+Ġcatastroph e
+Ġsnake bite
+Ġsnake bites
+ept in
+Ġdrt b
+Ġthermoco agulation
+Ġcob lation
+Ġpim ecrolimus
+Ġstear ate
+hyp ophysis
+Ġhyperv ariable
+Ġmicrospor idial
+Ġoligodend rocytes
+Ġposttrans criptional
+Ġchrys in
+Ġimpr int
+Ġingen uity
+Ġintrat idal
 Ġenvision ed
-Ġfoli ated
-Ġfoli ate
-phys ical
-phys iological
-Ġard uous
-Ġard akani
-Ġbioc ides
-Ġbioc onductivity
-ctcc gaacgtgtc
-cttg ttatc
-Ġcolab oratory
-Ġcriti que
-Ġcriti ques
-Ġstrugg le
-Ġstrugg les
-Ġimplicit ly
-Ġsimon is
-Ġ295 23
-Ġ295 22
-Ġnonh omogenous
-Ġnonh ospital
-Ġnonparticip ation
-Ġnonparticip ating
-Ġorthox scan
-Ġradiod ensity
-Ġradiod ensities
-Ġedit orial
-Ġedit mask
-Ġmicrod ontia
-Ġmicrod ilution
-Ġmicrophot ograph
-Ġmicrocomp uted
-Ġmicrocomp uterized
-Ġmalalign ment
-Ġmalalign ments
-Ġtranssexual s
-Ġdij kstr
-Ġdij sktra
-Ġdipl oma
-Ġdipl omatic
-Ġimpar ts
-Ġimpar ting
-Ġimpuls es
-Ġimpuls ivity
-Ġprimes can
-Ġprimes cript
-Ġmetaph yseal
-Ġmetaph yses
-Ġmetacarpal s
-Ġmonos odium
-Ġmonos ymptomatic
-Ġblend s
-Ġoliver ia
-Ġerik sson
-Ġerik ssen
-Ġendang ered
-Ġendang ering
-Ġendeav or
-Ġendeav ors
-Ġendorse ment
-Ġcaval lo
-Ġcaval cante
-Ġcef uroxim
-Ġcef capene
-Ġpredig est
-Ġpredig ested
-Ġflux es
-Ġfluores ce
-Ġfluores ced
-Ġsmith ii
-Ġimmortal ized
-Ġimmortal ization
-Ġschul z
-Ġschul theiss
-Ġocclud e
-Ġocclud ing
-Ġsamplesw opmd
-Ġantiplate let
-Ġantiplate lets
-yls ilane
-yls ulfonyl
-Ġflag s
-Ġflag ellated
-Ġflood ed
-Ġflood ing
-Ġvirolog ic
-Ġvirolog ical
-Ġpointless ly
-Ġmatsu yama
-Ġepic utaneous
-Ġepic occum
+operic ytoma
+del g
+Ġhypoman ia
+Ġtubul ovillous
+Ġpreoccup ied
+Ġapne as
+Ġbasil icum
+Ġorm co
+hed ral
+Ġaop ps
+Ġsccm ec
+onit rot
+Ġmetam orph
+Ġcyn icism
+Ġying long
+Ġgnath ion
+Ġentreprene urial
+Ġperib ronchial
+Ġweap ons
+second ary
+Ġbeautif il
+Ġmoll is
+Ġtow el
+Ġinfest ations
+Ġendos on
 Ġepistem ological
-Ġepistem ology
-Ġswift ly
-Ġexpon ential
-Ġexpon entially
-Ġmeso americ
-Ġfibr illation
-Ġfibr inolytic
-Ġworkst ation
-Ġworkst ations
-Ġchrist ou
-Ġchrist ensen
-Ġvirgin ia
-Ġheadl ights
-Ġheadl amp
-Ġclinicopath iological
-Ġclinicopath ologic
-Ġmutan best
-comb ined
-Ġpension er
-Ġpension ers
-Ġhydrocarb on
-Ġhydrocarb ons
-Ġultrap ure
-Ġultrap ulse
-Ġdamp ening
-Ġdamp ened
-Ġmyel oid
-Ġmyel oma
-Ġsemia utomatic
-Ġsemia utomated
-Ġqray pen
-Ġqray cam
-Ġvet ted
-Ġvet ting
-Ġhomolog ue
-Ġhomolog ues
-Ġdysm orphism
-Ġdysm orphic
-Ġcopolymer ize
-Ġcopolymer ization
-Ġturb ine
-Ġturb inate
-Ġstream lined
-Ġramp ant
-Ġkeys plint
-Ġpilomat rical
-Ġpilomat rixoma
-Ġnonex traction
-Ġnonex perimental
-Ġthermost at
-Ġthermost atic
-Ġhisti ocytes
-Ġhisti ocytic
-Ġrevol ve
-Ġrevol utions
-Ġcallip er
-Ġcallip ers
-Ġaggrecan ases
-Ġdiscomfor ts
-Ġdiscomfor ting
-Ġrash id
-Ġvideotap ed
-Ġvideotap es
-Ġsulfon ated
-Ġsulfon amides
-Ġpuzz led
-Ġpuzz ling
-Ġbenzo ic
-Ġbenzo ate
-Ġharness ing
-Ġunsup ported
-Ġunsup ervised
-120 58461
-Ġpseudonym ized
-Ġpseudonym ised
-Ġsafegu ard
-Ġsafegu arding
-Ġerythropo ietin
-Ġerythropo iesis
-Ġadipok ine
-Ġadipok ines
-Ġlegitim ate
-Ġlegitim ise
-Ġnonsmo kers
-Ġnonsmo ker
-Ġnsa oh
-Ġnsa ids
-Ġbulim ic
-Ġbulim ia
-Ġteleph onic
-Ġteleph onically
-Ġunfold ed
-Ġunfamiliar ity
-Ġargin ase
-Ġdetriment ally
-Ġneurosc ience
-Ġneurosc ienti
-Ġendocrin ological
-Ġendocrin ology
-Ġrhein land
-Ġhypozin cemic
-Ġhypozin cemia
-otidyl inositol
-Ġdedupl ication
-Ġdedupl icated
-Ġarrayc force
-Ġarrayc fsr
-Ġarrayl the
-Ġarrayl wcan
-Ġelectrostatic ally
+Ġnel son
+Ġtrypanos oma
+Ġmuk oross
+Ġpathomechan ism
+Ġreactiv ations
+Ġplexig lass
+Ġchylomic rons
+Ġreiter ated
+Ġmoy amoya
+Ġprogramm able
+Ġmnp ces
+Ġpierc ing
+Ġendocrown s
+Ġtcem eps
+Ġstub s
+Ġleup eptin
+Ġdynap enia
+Ġbum per
+Ġundeni able
+Ġtik ur
+Ġscram bled
+Ġdesat ur
+Ġmicroelect rode
+Ġdownst aging
+Ġazo ospermia
+Ġantifib rinolytic
+Ġcopa iba
+Ġsacroc olpopexy
+Ġcraniopharyngi oma
+Ġdrow ning
+Ġtoen ails
+Ġahpm ct
+Ġvideot aped
+Ġbail out
+Ġdeiod inase
+Ġmalak oplakia
+Ġcsb ds
+Ġcrotal ine
+Ġsemil un
+Ġtunic amycin
+Ġrecapt ure
+Ġcurs or
+Ġextro version
+Ġjac ob
+Ġrefram ing
+Ġpyrim idine
+Ġdemean our
+Ġbritt leness
+Ġscorp ion
+Ġreconc ile
+Ġdihydroc apsaicin
+Ġcili opathies
+Ġchis el
+Ġphenylpropan oids
+Ġgus b
+Ġaglyc one
+Ġjaponic us
+Ġpretreat ments
+Ġtracheobronch itis
+738 409
+Ġthurs day
+Ġbetablock ers
+Ġvander bilt
+Ġcanak inumab
+Ġextral uminal
+Ġjfh mc
+Ġqrd rs
+Ġethnobot anical
+Ġsaus age
+Ġove jas
+Ġatos iban
+prote obacteria
+Ġhyperper meability
+Ġphosphoin ositide
+prim ary
+Ġalv are
+Ġconfuc ian
+Ġpanm ayo
+Ġlaund ry
+Ġchromoph obe
+Ġrhapont icum
+Ġduodec apolar
+Ġoxcarb azepine
+Ġphob ias
+Ġagoraph obia
+Ġmethen amine
+Ġsynaps in
+Ġcatheps ins
+Ġrhinoc erus
+Ġbqs rp
+Ġcitronell ol
+7903 146
+fluoro ethylene
+Ġparyl ene
+Ġanoi kis
+Ġegn cc
+Ġlope z
+Ġgase ous
+Ġlevet iracet
+Ġroflum ilast
+Ġcombinator ial
+Ġsalbut amol
+Ġguibourt ia
+Ġpapulop ustular
+Ġtelepsych iatry
+Ġileoca ecal
+Ġlidcor apid
+Ġticlop idine
+Ġtransep ithelial
+Ġwonkw ang
+Ġmukoross i
+Ġlevetiracet am
+0 20
+0 16
+0 35
+2 30
+5 22
+5 65
+6 60
+7 15
+7 78
+7 63
+9 46
+? ,
+b ury
+c ross
+e ight
+e ven
+f ara
+g un
+h ere
+h orn
+i ator
+i ometer
+l est
+l azide
+n umbered
+o hy
+p redict
+r ison
+s r
+t ect
+t ot
+w o
+w omen
+y ear
+y ros
+y ou
+z ox
+Ġt ix
+Ġt ta
+Ġt ata
+Ġt ira
+Ġt ighter
+in il
+Ġa ee
+re a
+at ising
+at oxin
+Ġs ain
+Ġthe s
+Ġthe aflav
+Ġo ch
+Ġc ures
+Ġc yste
+Ġc pscs
+Ġc ua
+Ġp itt
+Ġw ies
+al gesic
+Ġan l
+Ġan it
+Ġf ras
+Ġf ii
+Ġf sp
+Ġf aded
+Ġd uly
+Ġd ione
+Ġd neasy
+is amide
+Ġm ivac
+Ġb ics
+Ġb anned
+Ġb ots
+Ġb aking
+Ġb ends
+Ġb ordered
+Ġb rows
+ent gen
+ing ing
+Ġre z
+Ġh vem
+Ġh iding
+Ġh lecs
+Ġe ig
+Ġe asing
+Ġto c
+us nit
+Ġn ish
+Ġn oses
+Ġn ls
+Ġst ard
+Ġst mn
+Ġst agger
+Ġst itching
+om ous
+Ġl z
+Ġl te
+Ġl ofl
+Ġl uria
+et as
+et one
+Ġg iv
+Ġg ay
+Ġg ome
+Ġg oss
+ig id
+ig ious
+id ines
+if ractor
+Ġas ms
+ut ial
+ab brevi
+Ġv ted
+Ġv lc
+Ġbe zo
+Ġex g
+Ġex ophthalm
+ant e
+ot ron
+ot omes
+ot idine
+iv ariate
+em erg
+Ġal isol
+Ġal sf
+Ġwh pr
+ag lio
+Ġis othermal
+um etone
+am pl
+am ics
+ir m
+Ġor t
+op ed
+est rus
+Ġinc f
+iz a
+iz ard
+Ġch ary
+ore x
+Ġat retic
+Ġse clusion
+ial ys
+ad er
+Ġpre ms
+Ġpre planned
+st rom
+Ġsh ark
+ain ting
+ip y
+ip loic
+Ġle eds
+are g
+ay an
+und ing
+Ġdis interest
+Ġco axial
+Ġco expression
+Ġcont ig
+Ġdiff using
+Ġcl itor
+Ġme con
+Ġme pscs
+Ġinf ero
+Ġint aglio
+Ġfo bf
+Ġaf ap
+ens on
+Ġk tr
+Ġk shap
+Ġall oster
+Ġev a
+Ġinter neur
+Ġun l
+Ġun ful
+Ġun opp
+Ġun character
+Ġun accounted
+Ġpart ake
+Ġsub therapeutic
+Ġsub gingivally
+Ġmed etomidine
+Ġmed roxy
+Ġam ad
+pro gesterone
+ory lation
+Ġqu an
+Ġqu eu
+ap revir
+so le
+Ġout numbered
+Ġno ael
+Ġrisk score
+all is
+Ġfact ual
+Ġar ima
+Ġhy br
+Ġcor rod
+Ġro p
+Ġro entgen
+Ġmeas ur
+Ġpr isons
+Ġhas h
+Ġpo h
+Ġen o
+Ġen ucleated
+iss imum
+yst olic
+Ġser atex
+Ġte ac
+cc ag
+Ġunder p
+Ġunder ling
+Ġ1 16
+Ġuse i
+Ġra it
+Ġra ch
+Ġfound ing
+str ument
+vent able
+cre ta
+Ġspec ie
+Ġtrans con
+Ġnon b
+Ġnon ionic
+Ġbi ocon
+Ġj k
+Ġj se
+Ġj ea
+Ġj amb
+Ġj erus
+Ġj affe
+Ġsp ends
+Ġsp arsity
+Ġstr uck
+Ġchar isma
+Ġem ig
+Ġem etics
+Ġdem tect
+Ġtra v
+Ġrem inis
+Ġma ic
+Ġfur azolid
+ms s
+Ġdr i
+Ġdr fs
+Ġdr sp
+Ġadm its
+Ġgl ia
+Ġgl mm
+Ġcal ves
+Ġmon ast
+yt osis
+Ġli ang
+Ġcardi oc
+Ġkn osp
+Ġkn ob
+Ġed t
+Ġed ir
+Ġed hs
+yn e
+yl oric
+Ġred efined
+Ġpe cking
+Ġif is
+Ġ0 64
+ian ensis
+Ġel so
+Ġgra ined
+Ġins eln
+Ġprob ucol
+our ing
+Ġes os
+Ġes kin
+Ġes thetically
+Ġps q
+Ġic as
+Ġic ca
+Ġic gc
+ism atic
+Ġprotein aceous
+Ġret ts
+Ġmy b
+Ġz amb
+Ġcomparis ion
+Ġsin k
+Ġsin otubular
+Ġfactor ing
+Ġvol ley
+Ġeff er
+Ġeff acement
+Ġhem ih
+rain ian
+ec ess
+etic a
+Ġfib rate
+Ġfib tem
+Ġ5 50
+ych olate
+Ġir respectively
+ne ung
+Ġca rest
+Ġrat ch
+Ġcost us
+Ġfam otidine
+Ġml df
+Ġadv ices
+Ġcap b
+fer on
+Ġtak ah
+tic ola
+Ġsit afloxacin
+Ġorgan ole
+Ġmus ical
+Ġpat ri
+Ġpat ters
+Ġelect romechanical
+Ġsal am
+Ġopt i
+Ġopt ically
+Ġlo in
+Ġlog ged
+Ġinstr uctive
+bs is
+Ġsuper ant
+iat al
+Ġquant itect
+Ġmen elik
+oral es
+Ġincl us
+Ġincl ine
+ca ac
+Ġmid ventricular
+Ġmid flexion
+ci uria
+Ġmyoc lon
+Ġsw n
+ax anthin
+Ġdm ts
+Ġmuc orales
+Ġdec ree
+hy a
+Ġu iap
+Ġu zb
+Ġu adt
+Ġflu ka
+Ġdev d
+Ġdev alu
+ool ing
+Ġib g
+Ġib ds
+Ġmac au
+Ġvas osp
+Ġfinal s
+Ġcogn ate
+Ġver net
+Ġtemper ate
+Ġpancre ases
+Ġsupp orters
+Ġcentral ised
+Ġreal time
+Ġpd k
+Ġpd q
+Ġiv pg
+Ġmit t
+Ġlink er
+Ġpp z
+Ġms bi
+Ġdiss ipated
+Ġhepat ologist
+Ġess ay
+Ġfast start
+Ġangi opathy
+Ġsept ations
+Ġplan imet
+ones e
+Ġprep utial
+Ġx q
+Ġx ing
+Ġx av
+Ġx rs
+Ġsn gal
+Ġsn arf
+Ġgu ianensis
+Ġbiom ineralization
+Ġlight w
+Ġul mo
+Ġpc m
+Ġpc x
+Ġprognostic ator
+Ġann v
+Ġster coral
+Ġce ylon
+Ġce iba
+aps ing
+Ġinstitut o
+Ġdl ms
+Ġnorm obaric
+crib able
+Ġcapac itance
+Ġbp o
+Ġbal m
+opl antar
+Ġlater oposterior
+Ġsummar ising
+Ġantic arcin
+Ġmob ilis
+Ġtg ct
+Ġtb ab
+Ġ19 2
+Ġ19 6
+Ġ19 73
+Ġ19 85
+Ġpolic lin
+Ġpap anic
+Ġrna oc
+pr iv
+Ġcolor imetry
+Ġoh ps
+Ġht pr
+Ġclus tal
+Ġorigin ality
+Ġcyst o
+Ġphot ometer
+Ġ12 1
+Ġ12 7
+Ġexternal izing
+ochond rial
+Ġvar a
+Ġanaes thesiological
+Ġtri ath
+ull in
+Ġpredom inating
+Ġcc yr
+Ġger bil
+Ġneur agen
+rm o
+Ġaspir ator
+Ġcro ati
+Ġcompl iments
+Ġteach es
+Ġburn t
+Ġfix ators
+Ġpept one
+Ġbuc y
+Ġoptim izations
+yc arpa
+Ġequip ping
+Ġmeaning less
+Ġom phal
+Ġpret reating
+50 6
+Ġpil ocytic
+Ġtp ff
+Ġtp af
+iop ortal
+Ġelectro coagulation
+Ġsubm itting
+Ġpf apa
+Ġinsp iring
+Ġhd ps
+Ġhd ivc
+Ġrol and
+11 9
+Ġuk rainian
+Ġsupernat ural
+Ġsham s
+Ġba pt
+Ġba ha
+Ġba uru
+Ġinterf ragment
+Ġlc vp
+Ġhl x
+Ġgraph ite
+Ġah os
+Ġah ec
+Ġflavon ifractor
+Ġmor se
+Ġmach ining
+Ġmv t
+Ġmanufact ures
+Ġviol ating
+Ġnight ly
+Ġnight shift
+Ġsolid ify
+Ġmarginal ised
+Ġ15 7
+Ġpb anka
+Ġmh no
+Ġvolunte ering
+Ġneon at
+Ġneon atology
+Ġcit rated
+Ġdecomp ress
+Ġsulf onate
+isc overed
+Ġsb tr
+Ġdeclar ations
+Ġrd pv
+Ġoverexp ress
+Ġplat o
+Ġhm ds
+Ġray pex
+Ġsomet ime
+Ġfa es
+Ġfa ults
+Ġ13 5
+Ġket oprofen
+Ġpy retic
+Ġbul imia
+Ġcn f
+Ġcn ag
+Ġcn na
+Ġsta ph
+Ġnp ds
+Ġeb us
+Ġfp gc
+Ġfp km
+Ġlp me
+25 9
+Ġacceler omy
+Ġhipp ocratic
+Ġsteroid ogenic
+Ġband ages
+Ġdors i
+Ġethyl benz
+Ġcandida emia
+Ġorthop nea
+Ġinput ted
+Ġamel oblastomas
+Ġphysi opathology
+Ġagon ism
+utin ins
+Ġrect ocele
+Ġuric ase
+bd otoxin
+Ġff ar
+Ġiod onitrot
+Ġld r
+ineral ized
+30 2
+Ġpu jo
+67 8
+Ġmultif lor
+Ġll v
+Ġcag ib
+Ġras b
+Ġbios pec
+23 9
+Ġhaemat ologic
+Ġsynthes ise
+Ġbenz alk
+Ġrecess es
+Ġgli osis
+Ġmotiv ator
+Ġgn m
+24 1
+Ġmer ch
+Ġacetyl s
+60 1
+Ġson ovue
+arp al
+54 4
+Ġsport ing
+Ġbad en
+Ġstraight ened
+Ġeat th
+Ġmening ococcal
+Ġarrow head
+Ġche ers
+inter vention
+Ġpiv oting
+Ġnb a
+encephal itis
+Ġmeal times
+Ġgm t
+Ġgm as
+Ġarb a
+Ġradio ulnar
+Ġdiscl osures
+Ġconform ations
+Ġconform ability
+Ġssc v
+Ġpep statin
+Ġabut ting
+Ġreimb urse
+Ġtax oquinone
+Ġkh ome
+Ġcentered ness
+Ġconceptual isation
+Ġelic itation
+Ġantid ys
+Ġhypo allerg
+Ġovert ube
+els en
+Ġdan iel
+Ġgamm opathies
+Ġsuction ed
+Ġrom agna
+Ġcct s
+Ġcct ga
+pc dna
+Ġkill s
+Ġips rt
+Ġdf o
+Ġincont inent
+Ġmad a
+Ġmad agas
+Ġfitting s
+Ġcoinc ubation
+Ġplex iform
+Ġbrom age
+Ġrhin oconjunctivitis
+han i
+Ġkc se
+Ġthyro hyoid
+Ġosteoblast ogenesis
+Ġpra der
+Ġpra ised
+Ġpra usnit
+Ġmail box
+Ġws i
+Ġtrich omonas
+Ġtriang ulated
+Ġtol lip
+ipt w
+Ġuncommon ly
+Ġworks heet
+Ġrecon firmed
+Ġtang les
+Ġinduc ibility
+Ġpsm u
+Ġcong reg
+Ġao j
+Ġfh r
+Ġantip rot
+Ġantip arasitic
+Ġplexus es
+Ġracial ized
+Ġmultipl ate
+Ġwat anabe
+Ġves ico
+Ġbc ip
+Ġicg r
+Ġxi i
+Ġdihyd rogen
+Ġaccommod ating
+ecan oyl
+Ġantitum oral
+Ġmicroenvironment al
+Ġmth s
+Ġjug l
+Ġfus arium
+Ġimag eless
+ola ou
+Ġasymmet rically
+py ruv
+Ġevac uations
+amn iotic
+Ġgol estan
+Ġbulb ous
+Ġbiod iversity
+Ġhung ry
+Ġhemisph erical
+Ġreciproc ally
+Ġlee at
+Ġorbital e
+Ġantis yn
+Ġlit term
+Ġoi irr
+Ġcritic isms
+Ġegf rs
+Ġbac illary
+Ġspasm olytic
+Ġpanc a
+Ġrw pt
+ctg ac
+Ġdms a
+Ġvoid ed
+Ġintral obular
+Ġrehospital isation
+Ġhypere ch
+Ġhypere osin
+Ġperpet uated
+Ġash wag
+Ġhydroly ze
+Ġschw artz
+Ġrox ithromycin
+Ġangel icae
+Ġobsc uring
+Ġsre bf
+Ġamen ities
+Ġfrax inus
+Ġgang neung
+Ġpare tic
+Ġton ometric
+Ġnes b
+Ġhanded ness
+Ġcholedoch us
+Ġcholedoch oduodenostomy
+Ġesm o
+Ġwst c
+Ġhalluc ination
+Ġpolyt omous
+Ġroll out
+Ġdus p
+Ġnab umetone
+Ġvideolaryng oscopes
+Ġlves vi
+Ġsial oprotein
+Ġcot reatment
+Ġmycopl asmas
+Ġcma i
+Ġantit b
+Ġreticul ocytosis
+respons iveness
+Ġexplo iting
+Ġchick ens
+Ġmultist ep
+Ġcultiv ar
+Ġxg b
+Ġrhamn ose
+Ġparv iflora
+Ġadenomy omatosis
+Ġinactiv ates
+bec k
+Ġfores ight
+Ġintric acies
+omast igotes
+Ġqn ra
+Ġstip ulate
+Ġveno arterial
+Ġriv p
+Ġokay ama
+Ġstereomic roscopic
+Ġcach ectic
+Ġans ys
+Ġhbc ag
+Ġoy o
+Ġbte x
+Ġaccent uate
+Ġdeacet yl
+Ġcave olin
+Ġsmm se
+Ġstorm s
+Ġcompress es
+Ġjin an
+Ġamaz ing
+Ġtroph oblastic
+Ġminip rep
+Ġjeopard izing
+Ġpotato es
+architect ural
+Ġdeleg ate
+Ġsubdiv isions
+Ġmcd onald
+Ġkyn urenic
+Ġzon isamide
+Ġrand ox
+Ġuncor related
+Ġincongru ent
+Ġhay es
+high er
+attt g
+ophores is
+Ġmacroc irculation
+Ġhydrolys ate
+Ġassert ive
+Ġshield ed
+Ġcasel oads
+Ġnccn ipi
+Ġstrang ers
+Ġbioc ides
 Ġelectroencephal ography
-Ġelectroencephal ograms
-Ġsubclass ifications
-Ġsubtractive ly
-Ġmegakary ocytes
-Ġmegakary ocyte
-Ġovershadow ing
-Ġmicronutr ient
-Ġmicronutr ients
-Ġforesee ing
-Ġforesee able
-Ġchondro ectodermal
-Ġchondro itin
-aggc ac
-Ġreassign ed
-Ġreassign ing
-Ġadreno ceptor
-Ġselen ium
-Ġselen omonas
-Ġnephrotoxic ity
-Ġ343 7
-Ġslaughter house
-Ġmistaken ly
-classifications total
-Ġzeit geber
-Ġzeit ouni
-Ġreformat ting
-Ġlump ur
-Ġglutam ate
-Ġglutam ax
-Ġwitness ed
-Ġinterconnec tion
-Ġinterconnec tions
-Ġhepat ology
-Ġhepat ospl
-Ġmohamm ad
-Ġmohamm adi
-Ġplexig lass
-Ġplexig las
-Ġrecharge able
-Ġhotsp ot
-Ġhotsp ots
+Ġadreno ceptors
+Ġdnt ps
+Ġdisaggreg ation
+Ġdislod gment
+Ġhin di
+Ġsla ughter
+Ġsgt f
+Ġscrub bing
+Ġmicrospor um
+Ġrew iring
+Ġfault y
+Ġgarg le
+Ġblu ish
+1800 469
+Ġmq eo
+Ġgown s
+Ġplacent ation
+Ġpinpoint ed
+Ġreex amined
+Ġlozen ge
+Ġjh h
+5564 68
+Ġcnl n
+Ġinvers ions
+Ġhert fordshire
+Ġsheng jing
+Ġhyl an
+Ġgrad ia
 Ġpostero anterior
-Ġtrypsin ized
-Ġjeop ardized
-Ġjeop ardize
-Ġjejun um
-Ġjejun ectomy
-atcgt ggaagg
-Ġphilip pines
-Ġjohn ston
-aagag catctg
-tctag cacttct
-Ġreconf irm
-Ġreconf irmed
-Ġunlock ed
-Ġspongi ose
-Ġspongi osa
-further more
-Ġsabur ral
-Ġsabur reum
-Ġmonochromatic ity
-Ġcontracep tion
-Ġcontracep tives
-Ġdislodge ment
-Ġpupil s
-Ġdephosphory lation
-Ġdephosphory lated
-Ġpreoccup ation
-Ġpreoccup ied
+Ġmint o
+Ġunderut ilized
+Ġbiot ek
+Ġmonoton ically
+Ġescap ing
+Ġtos ilate
+Ġcher ry
+Ġfistul izing
+Ġflood ed
+Ġpuerper al
+Ġroth ia
+Ġosteoarth ropathy
+Ġgans u
+Ġism ail
+Ġhtt vs
+Ġcatat onic
+ogest rel
+Ġglen oids
+Ġrecalib ration
+Ġpostanes thesia
+Ġtravers ing
+Ġrutaec arpa
+Ġrick etts
+Ġreshap ed
+Ġundercut s
+Ġdelim ited
+Ġstepone plus
+Ġthiazolidined iones
+Ġged vi
+anil amide
+Ġcauter ization
+cole ces
+Ġplexig las
+Ġchylomic ron
+Ġsyncyt ial
+Ġchand igarh
+Ġqm zk
+Ġrehmann ia
+Ġidc mss
+Ġprototy pical
+Ġradiopharmaceutical s
+Ġtnfs f
+Ġrecto anal
+Ġthylak oids
+Ġhgs oc
+Ġcounsell ors
+Ġnewslet ter
+Ġlth rd
+Ġdysrhythm ia
+Ġgck r
+Ġundec ided
+Ġspectrofluor ometer
+Ġspiroch etes
+Ġhid raden
+Ġextram ural
+Ġmank ato
+Ġtransill umination
+ethox ycurcumin
+Ġzam fara
+Ġfibroc art
+Ġdolicho cephalic
+Ġreoff ending
+Ġnell cor
+Ġmesop orous
+Ġepigast rium
+Ġdion ex
+Ġdelncr nas
+Ġquarant ined
+Ġtranse pidermal
+Ġendomys ial
+Ġexerg aming
+Ġtwee zers
+Ġcenten arians
+Ġdissip ate
+Ġlatt ice
+Ġnavi o
+211 105
+Ġclaust rophobia
+Ġjed dah
+Ġunsusp ected
+evelop ed
+Ġoverm ethylated
+Ġschim peri
+Ġglic lazide
+Ġobed ience
+Ġremeas ured
+Ġsenn oside
+Ġimperme able
+Ġoryz anol
+Ġnebr aska
+Ġicy cler
+Ġprotos coleces
+Ġprotuber ance
+Ġhydral azine
+yrrol ate
+Ġsanti ago
+Ġdisharm ony
+Ġdyskines ias
+Ġoly mp
+Ġanos mia
+Ġdenerv ated
+Ġtorqu ing
+Ġsubcont inent
+Ġmadecass oside
+Ġreticulo endothelial
+Ġeuphorb ia
+Ġelob ixibat
+Ġepimed ium
+Ġenterop ooling
+Ġmethylphen idate
+Ġpentoxif ylline
+Ġkrusk all
+Ġmicrodis cectomy
+Ġmontene gro
+appreci ated
+Ġfloribund a
+Ġcetylpyr idinium
+Ġcardiof undal
+Ġhyperleuk ocytosis
+Ġlymphohist i
+Ġpetiver ia
+Ġpolytetra fluoroethylene
+zox azone
+Ġmivac urium
+Ġlofl azepate
+Ġalsf rs
+Ġchary bdotoxin
+Ġunopp osed
+Ġmedroxy progesterone
+Ġqueu ing
+Ġcorrod ens
+Ġjerus alem
+Ġreminis cent
+Ġfurazolid one
+Ġvolley ball
+Ġiodonitrot etrazolium
+Ġbenzalk onium
+Ġhypoallerg enic
+Ġmadagas car
+Ġprausnit zii
+Ġhidraden itis
+3 12
+3 56
+3 95
+4 12
+4 99
+7 90
+a imed
+c u
+c ome
+d ime
+e valu
+f ly
+f ract
+g raph
+g uanidine
+h w
+h ots
+j ee
+l iter
+l ational
+l ov
+l izumab
+m ins
+n ally
+o ia
+p oss
+p ings
+s ch
+s we
+t im
+t ically
+u fin
+w heat
+z ir
+z ens
+Ġt iles
+in ium
+Ġa ea
+re pt
+re omycin
+re cip
+Ġth w
+on ella
+at ty
+at gtt
+at urus
+Ġs ine
+Ġs ans
+Ġs ops
+Ġs iph
+Ġs ends
+Ġs iptw
+en etetra
+en roll
+Ġo re
+Ġo it
+Ġo ae
+er ce
+Ġc aste
+Ġp ym
+Ġp ake
+Ġp gf
+ed e
+ed ler
+Ġw am
+Ġw ad
+Ġw ds
+al us
+Ġan fis
+Ġan eroid
+it ra
+Ġof atumumab
+Ġf ilar
+Ġf bp
+or ch
+Ġd ts
+Ġd cca
+is ers
+Ġb ron
+Ġb ione
+Ġb hs
+Ġb oric
+ent is
+ro pe
+Ġre all
+Ġh are
+Ġh elf
+Ġh roc
+Ġh anks
+le ge
+Ġto tt
+us io
+us ai
+ul enol
+Ġn ed
+Ġn sh
+om ac
+ur itic
+Ġl oth
+Ġl ice
+Ġl ogn
+et ane
+Ġg amet
+ig mented
+th in
+th anol
+ati o
+ol ed
+ol uc
+Ġas mcs
+Ġas acol
+un i
+il us
+il ical
+il ane
+ut icum
+Ġv ass
+Ġv ts
+Ġv me
+Ġv ina
+Ġv mm
+Ġpro atherogenic
+ter feron
+od er
+od ext
+Ġex oc
+Ġex cise
+ant an
+ant ib
+Ġr wd
+ist ered
+Ġres ervation
+Ġor onasal
+oc am
+Ġinc r
+Ġinc iting
+Ġus ems
+Ġch ase
+ib lock
+ore a
+og ins
+ad v
+Ġpre he
+Ġsh d
+Ġsh ant
+Ġsh nc
+ip ette
+Ġle ptom
+se gmental
+Ġac er
+und i
+Ġco infections
+Ġnot ogins
+Ġwe ars
+orm onal
+Ġhe il
+Ġtre itz
+Ġinf irm
+ph ire
+Ġha pa
+Ġfo ul
+ich oic
+Ġaf ro
+and ronate
+Ġap ai
+Ġk one
+Ġk ron
+Ġk ung
+Ġk aff
+Ġk mp
+Ġev oking
+Ġtr id
+Ġtr illion
+Ġpl ication
+Ġpl vd
+Ġeffect ivity
+Ġinter link
+Ġrec id
+Ġun add
+Ġun iaxial
+Ġun happy
+ill ae
+Ġam oe
+Ġam ni
+Ġph es
+Ġph ar
+Ġph lor
+oth ers
+ap es
+Ġout ings
+Ġno uch
+Ġno xa
+Ġpos its
+Ġy hs
+Ġy ester
+Ġy fv
+ear ly
+Ġgen ip
+Ġbl i
+ak ic
+Ġar il
+te us
+Ġcor oz
+Ġcor ks
+Ġcor ruption
+Ġcol t
+Ġpr u
+Ġpr icking
+Ġpr iors
+Ġpo ems
+Ġcr r
+Ġfin c
+Ġup l
+ym an
+Ġdes ogestrel
+ile ged
+iss imus
+Ġag outi
+Ġover head
+Ġunder priv
+Ġ1 38
+Ġra ir
+Ġra ca
+Ġra kas
+ang or
+cer amides
+ros om
+ep iploic
+Ġbi week
+Ġdep res
+Ġhospital ist
+Ġmethod ical
+Ġj em
+Ġj bt
+Ġj argon
+Ġsp rains
+Ġ2 20
+Ġ2 25
+Ġstr ings
+Ġend ol
+Ġend ured
+Ġdist olingual
+Ġem br
+Ġem ilia
+Ġval veless
+Ġdef lect
+ardi asis
+Ġsm es
+Ġsm as
+Ġtra ged
+Ġrem i
+Ġma har
+Ġfur an
+Ġpred ecess
+Ġgl ued
+Ġcal yceal
+ox ym
+Ġmon ash
+ob alamin
+Ġdisc o
+Ġimp ati
+Ġimp over
+Ġimp urity
+ines is
+oper t
+Ġcardi olipin
+Ġpar afil
+Ġpar icalc
+Ġi it
+Ġfl ores
+Ġfl utes
+Ġphys io
+Ġinform ally
+Ġhyper icin
+Ġhyper flexion
+Ġimm aturus
+Ġ0 22
+Ġhist ometric
+Ġhist ochemistry
+Ġanti aging
+Ġ3 65
+af low
+Ġav h
+Ġes pghan
+ie c
+Ġep n
+Ġep on
+Ġadj acency
+Ġop rl
+Ġcomb ing
+Ġimmun on
+Ġz np
+Ġz ota
+Ġliver pool
+Ġhem im
+Ġhem ost
+ec onomic
+Ġfib rates
+ha hi
+ne gative
+Ġmax mt
+Ġgast roscopic
+Ġgast ropathy
+Ġinst able
+Ġil vd
+Ġpoly pl
+Ġlab ia
+Ġlab iopalatal
+Ġsol vation
+Ġsk v
+Ġprom ised
+Ġprom mp
+ator in
+Ġgluc oam
+Ġml si
+Ġchange able
+Ġcap reomycin
+rh ole
+Ġmus eum
+Ġsaf inamide
+Ġlip oper
+Ġlip ophil
+Ġlip odystrophy
+Ġur ia
+Ġelect rotrans
+Ġ20 50
+Ġsl f
+Ġsl abs
+Ġcategor izations
+ocol on
+Ġsal ting
+Ġoff ensive
+Ġopt ics
+Ġlog in
+Ġlog istically
+Ġextra pancreatic
+enced irect
+Ġsuper omedial
+Ġsuper critical
+Ġchem ogenetic
+Ġquant ifications
+Ġda x
+Ġut ter
+Ġke b
+Ġke bele
+Ġparticular ity
+Ġ7 65
+osph ing
+Ġapopt osome
+Ġdec or
+Ġcam pes
+Ġcam pin
+Ġplate aus
+Ġu ias
+gf p
+oy ang
+Ġphen ogroups
+Ġcs ns
+Ġorth os
+Ġorth ograde
+Ġvir ions
+Ġib andronate
+Ġ8 19
+Ġdatab ank
+Ġmale ficence
+Ġvas oplegia
+Ġod c
+Ġcp m
+Ġpcr v
+Ġapproxim ations
+Ġtraum atization
+Ġpharm mapper
+Ġback flow
+Ġoxid ised
+Ġwall onia
+dm ann
+Ġax ially
+rit ious
+clus ter
+Ġbra h
+Ġneuro g
+Ġneuro epithelial
+Ġiv pd
+Ġnod m
+Ġlv rr
+Ġmit ch
+Ġmit otracker
+Ġfluid o
+Ġbur rhole
+Ġhal le
+Ġms qol
+Ġeng ulf
+Ġrad on
+Ġeas iness
+Ġangi ogenetic
+Ġworld view
+Ġhip aa
+he hr
+Ġbo o
+Ġmagn us
+Ġgastro protection
+Ġgastro epiploic
+Ġcop olymer
+Ġmt kr
+Ġx fs
+Ġsn fl
+rot ect
+Ġens ite
+Ġens ues
+Ġpal s
+Ġlact is
+Ġitem ized
+Ġmicrob eads
+Ġaccord ed
+Ġtrig one
+Ġnut ritious
+Ġaltern ated
+Ġcav itary
+Ġmc ia
+Ġmc df
+Ġadhes iveness
+Ġmg j
+Ġchrom ophores
+Ġplant ago
+Ġgerm ans
+Ġtg m
+lu ence
+Ġnf p
+Ġpi ro
+Ġrot ates
+Ġchi u
+Ġlum b
+Ġlum ps
+Ġradical ity
+Ġaff ording
+Ġpet it
+Ġpet ersen
+Ġsci encedirect
+bl ia
+Ġoh cps
+Ġoh kawa
+Ġsd d
+Ġbio available
+Ġfet o
+gin terferon
+Ġrh l
+Ġrh apc
+Ġcarb amide
+rad es
+Ġestablish ments
+Ġpac ic
+amp us
+Ġgi ardiasis
+Ġphot ost
+Ġdement ias
+Ġtit ach
+Ġflex y
+Ġnm c
+Ġnm h
+Ġcc gs
+Ġcc vd
+Ġnh o
+Ġnh eks
+Ġmethyl enetetra
+Ġgap a
+rant ed
+Ġaspir ational
+Ġcro hn
+Ġamb ivalence
+Ġdiscont ent
+53 4
+53 7
+53 38
+Ġderm atosis
+Ġosteop enic
+Ġss q
+Ġmill iq
+Ġsem ir
+Ġacs l
+Ġsf bt
+Ġlap pa
+Ġactual ization
+Ġdc ia
+Ġoptim ys
+Ġea i
+Ġom er
+Ġclean ings
+50 8
+Ġflav ours
+Ġfund ers
+Ġhydrox ycin
+Ġnc f
+Ġnc ip
+Ġhoc l
+Ġhoc key
+Ġphenomen ography
+Ġns g
+Ġmb di
+Ġstop per
+Ġpolymer isation
+Ġsubty ping
+ips cs
+11 37
+emb olism
+Ġchannel ed
+Ġion t
+Ġfal ff
+Ġba rometric
+Ġlc p
+Ġlc ms
+ran ial
+Ġaort opulmonary
+Ġblue print
+Ġintermed ius
+Ġvide ocap
+17 07
+Ġdentin ogenesis
+Ġsv ts
+Ġviol in
+Ġnight ingale
+Ġpb q
+Ġparallel ism
+Ġduoden oscopy
+Ġdecomp ressed
+Ġot ological
+Ġsulf ated
+isc on
+Ġinn ocent
+Ġgingiv oplasty
+Ġfresh men
+13 17
+Ġsac ra
+Ġunf olding
+Ġdich orionic
+Ġphyt ate
+Ġphyt ochemistry
+Ġter p
+Ġrough ened
+80 6
+Ġpy oderma
+Ġ25 4
+Ġlm u
+Ġems ct
+Ġaugment ative
+Ġalkal inization
+Ġtob it
+Ġtal cum
+Ġdn m
+Ġdn n
+Ġpron ounce
+65 26
+Ġls i
+Ġbs nas
+Ġacceler ator
+umb ilical
+uric ase
+Ġchromos om
+Ġperme ated
+Ġstra ined
+Ġded icate
+Ġded uctively
+Ġelast omer
+Ġbypass ed
+Ġmann heim
+Ġrect ovaginal
+Ġvasopress inase
+Ġultrason ograph
+Ġveget ations
+Ġhex amers
+Ġpk r
+Ġlin en
+Ġgranul omata
+Ġpu ft
+Ġsubs ynd
+Ġevid encing
+esare ans
+Ġevolution arily
+Ġattack ed
+Ġattack ing
+iac ae
+Ġmaster ing
+Ġpic ol
+Ġmuscul ocutaneous
+Ġ23 3
+Ġhot el
+70 5
+Ġdisappe aring
+Ġih hp
+Ġber h
+Ġbus es
+Ġbus hehr
+iment ation
+Ġintub ator
+luores cence
+Ġstraight ening
+Ġpopular ly
+Ġtyros ol
+Ġtravel ers
+Ġrp rs
+Ġdas i
+Ġdas ha
+Ġeat l
+Ġarrow heads
+Ġche er
+Ġlr rc
+Ġlegal ization
+Ġluc k
+Ġgm vs
+Ġblast ing
+Ġpuls ations
+Ġpuls ating
+Ġmur ray
+Ġmur phy
+Ġsel angor
+Ġmetall opeptidase
+Ġpor ia
+Ġconsolid ative
+Ġlb h
+Ġtax ol
+Ġpalp atory
+Ġstere oscopic
+56 3
+Ġbif ida
+Ġdeple tes
+Ġfavor ite
+Ġcollateral ization
+Ġglycos idic
+Ġirre place
+Ġhypn otherapeutic
+Ġrom a
+Ġempow ers
+Ġlam b
+Ġlam blia
+Ġproxim ate
+Ġgb ps
+Ġiop romide
+ba um
+Ġjun iors
+Ġcry ov
+Ġont ological
+Ġdysph onia
+Ġtin idazole
+Ġcoc s
+Ġcoc rmo
+Ġtrich oscopic
+98 2
+agl obin
+Ġlactob acill
+otor ula
+Ġtang uticum
+Ġtu ition
+Ġtu fts
+Ġconvers ions
+Ġunm yelinated
+Ġdsm b
+Ġerg onovine
+Ġrely x
+Ġadul ter
+Ġptc nis
+Ġcontem plate
+Ġtj lb
+Ġintram yocardial
+Ġtic arc
+Ġwit ten
+Ġgem ox
+ket one
+Ġlac z
+olester olemic
+Ġreform ation
+Ġsg pt
+Ġdend rop
+75 232
+Ġarom a
+Ġky ushu
+Ġdiph en
+Ġinher it
+Ġmalt itol
+pre gn
+Ġmol li
+Ġimag ining
+Ġlus aka
 Ġaboriginal s
-Ġtimeatrisk forhaving
-Ġnumberofnewc aries
-Ġnumberofnewc arioussur
-Ġintraperitone al
-Ġintraperitone ally
-Ġstigmatis ing
-Ġstigmatis ation
-Ġneurotransm itter
-Ġneurotransm itters
-Ġperfluorooct ane
-Ġperfluorooct anoic
-212 78290
-214 0
-375 6
-49 3
-auc ine
-bro ok
-cv mi
-cz ak
-constr uct
-canti lever
-commun ity
-det ails
-dia gram
-direct ors
-direc ted
-fel t
-fir st
-fem ale
-fasc in
-frequ ently
-gtt cttgttatc
-gingival is
-gae y
-gctg ttga
-gtgtc gctgttga
-hor izontal
-high er
-hum an
-hinol aryngologic
-irop oulos
-kas emkit
-ket ones
-krus kal
-khah et
-met astatic
-mut ans
-micro soft
-mdsc oreopmd
-macg regor
-numer ous
-oqu ine
-pocl adium
-rad ar
-sal ivary
-sec retion
-sup ply
-show ed
-successful ly
-tetr azolium
-tata a
-whe ther
-xerost omia
-yro xine
-yttr ium
-zaws ka
-zarray n
-Ġull ah
-Ġumb ilical
-Ġtec co
-Ġtid ymodels
-Ġtuc ker
-Ġtir ana
-Ġtaus che
-Ġtesti fied
-Ġtpt p
-Ġtamm ami
-Ġtick ling
-Ġtedi ous
-Ġtires ome
-Ġtabol li
-Ġait chison
-Ġaqu a
-Ġavi ation
-Ġaok i
-Ġawa ited
-Ġaatt ctccgaacgtgtc
-Ġaky ol
-Ġaleg re
-Ġaacgtgtc agtgg
-Ġajith krishnan
-Ġthia zolyl
-Ġthong prasom
-Ġthric e
-Ġthym idine
-Ġthie le
-Ġthurs day
-Ġthiaz ide
-Ġthwar ted
-Ġthammas at
-Ġtheat re
-Ġtheor ised
-Ġthesi as
-Ġsom atization
-Ġsip py
-Ġsill ness
-Ġsple en
-Ġspro uting
-Ġsures mile
-Ġske pticism
-Ġsarg eran
-Ġsade k
-Ġsanc tis
-Ġsier ra
-Ġsider idou
-Ġsaph o
-Ġsagl am
-Ġsomn omedics
-Ġsgar amella
-Ġsongk la
-Ġoen ning
-Ġoed ema
-Ġoud erra
-Ġoce ania
-Ġoment um
-Ġoch oa
-Ġoug radar
-Ġotor hinolaryngologic
-Ġoks ayan
-Ġokr ug
-enkr att
-alarm ing
-alypt ol
-Ġced ex
-Ġcul pable
-Ġcim baljevic
-Ġcib ei
-Ġcull in
-Ġcenti meters
-Ġcay etano
-Ġcyp rus
-Ġcct ttaga
-Ġcak ur
-Ġcust odians
-Ġcili ated
-Ġcze izel
-Ġceng iz
-Ġcabin et
-educ ation
-Ġpim ozide
-Ġpich ler
-Ġpms f
-Ġpbr n
-Ġpunc tiform
-Ġpust ules
-Ġpav oni
-Ġpiment a
-Ġpantom ography
-Ġwan ed
-Ġwol ford
-Ġware house
-Ġwop mdscoreopmd
-Ġwins auer
-Ġwets elaar
-Ġwisc onsin
-Ġwaters hed
-Ġwperson nel
-Ġwenjuan xing
-Ġwernec k
-Ġinat tention
-Ġingr ained
-Ġinns bruck
-Ġinbre eding
-Ġinopress ors
-Ġinanim ate
-Ġantis ense
-Ġanym ore
-Ġanaphyl atox
-Ġaneg undi
-Ġfom ites
-Ġfay oum
-Ġfire fighting
-Ġfond azione
-Ġfles ch
-Ġfiro uz
-Ġfumar ic
-Ġfuchs ine
-Ġdib iase
-Ġdong yang
-Ġdile mma
-Ġdines h
-Ġdelf tia
-Ġdaren deliler
-Ġdammas chke
-Ġming le
-Ġmup pa
-Ġmot allebne
-Ġmum mified
-Ġmari juana
-Ġmong olian
-Ġmesti zo
-Ġmack erel
-Ġmort gage
-Ġmisc roscope
-Ġmuk htar
-Ġmission s
-Ġmams l
-Ġmogh addam
-atle astonec
-attem pts
-atacc gtctc
-thro ughout
-Ġandreas en
-Ġbion ics
-Ġbull ae
-Ġbach elor
-Ġbans al
-Ġbcc p
-Ġbish ara
-Ġbough t
-Ġbgi i
-Ġbros h
-Ġbomb ail
-Ġbudd hism
-Ġbogg ess
-Ġbkm r
-rotest osterone
-Ġreup take
-Ġreut roin
-Ġrefere ed
-Ġreop ened
-Ġrevel ation
-Ġreits ma
-Ġrethough t
-Ġrepre paration
-Ġreorgan ization
-Ġrebal ance
-Ġrehard ening
-Ġreintroduc ed
-Ġreanaly zed
-Ġrezif low
-Ġtoul ouse
-Ġtoly pocladium
-Ġtour ism
-Ġtoile t
-Ġtoss ed
-Ġtosc ano
-Ġtola rova
-Ġhud dinge
-Ġhts cs
-Ġhun an
-Ġhers elf
-Ġhill s
-Ġhass elkv
-Ġhack le
-Ġhob bies
-Ġhomet owns
-Ġhomic ide
-Ġhoch berg
-Ġhoh mann
-Ġhigg ins
-Ġhilt unen
-Ġhatt ab
-Ġhamp ered
-Ġhams ters
-leidom astoid
-Ġeun uchs
-Ġeuc alyptol
-Ġeys enck
-Ġeber hardt
-Ġejec ted
-Ġeust achian
-Ġeik anella
-Ġeiff el
-Ġeuv olemia
-Ġstur divant
-Ġstab holz
-Ġstum p
-Ġstrom al
-Ġstee per
-Ġstatis tily
-Ġstaw arczyk
-Ġstyl us
-Ġstoch astic
-Ġstagg ering
-erether ketone
-acaca acaaggc
-Ġlil acs
-Ġluc ky
-Ġliz ards
-Ġlore nz
-Ġlop inavir
-Ġlug o
-Ġliti gation
-Ġlinc omycin
-Ġlumb ar
-Ġlau vauthan
-Ġlumin ance
-Ġlaryng oscopy
-Ġluck ily
-Ġlenn on
-Ġlapa roscopic
-Ġlaryngo tracheal
-Ġllewelly n
-Ġnid dm
-Ġnip ples
-Ġnag elker
-Ġnirm ala
-Ġnaz ari
-Ġnemat ode
-Ġnemen yi
-Ġnalc aci
-Ġnlr p
-Ġgur zawska
-Ġgand olf
-Ġgase ous
-Ġgyp sum
-Ġgak uen
-Ġgha fari
-Ġgilm ore
-Ġgarc ia
-Ġgarth waite
-Ġggt ggcttg
-Ġgizan i
-Ġgalp ore
-Ġgogg les
-Ġgemt c
-Ġgilling ham
-Ġgarn ered
-Ġginig ivalis
-Ġwithst ood
-Ġwithhol ding
-Ġwasfilt ered
-Ġforamin al
-Ġforget fulness
-Ġforgot ten
-Ġasex ual
-Ġasah i
-Ġascrib ing
-Ġaston ishingly
-Ġasphy xia
-Ġasaccha rolytic
-Ġconqu ering
-Ġconval escent
-Ġconner t
-Ġonych o
-tstotal person
-Ġorino quia
-Ġorchi ectomy
-Ġortop edico
-Ġortob ajt
-Ġvse arch
-Ġvied oc
-Ġvolog da
-Ġvak if
-Ġvie ira
-Ġvinc kier
-Ġvoy age
-Ġvime o
-Ġvulgar is
-Ġalia ga
-Ġalph afold
-Ġalha ija
-Ġaldr ich
-Ġalask an
-Ġaliment ation
-Ġalsh ammery
-Ġaldehy des
-Ġalmoh amad
-Ġalhar bi
-Ġalcar az
-Ġalhuda ithi
-Ġalqer ban
-Ġalzhe imer
-Ġperple xing
-Ġperfer red
-Ġperuan a
-Ġrain forest
-Ġrist ow
-Ġrond ells
+Ġselen omonas
+lass es
+Ġprecon ceived
+Ġhcl o
+Ġcontextual ized
+Ġhyperal gesic
+Ġelectrophys iologic
+Ġantim it
+Ġngal so
+Ġnitr aria
+79 75232
+Ġclon ality
+thet ase
+Ġfort ification
+Ġfort night
+Ġpds a
+Ġvl f
+Ġlun a
+Ġlent i
+Ġtran st
+Ġpick led
+Ġparasit ological
+Ġaster ia
+Ġlaws uits
+Ġtourniqu ets
+Ġcollar less
+Ġpcl if
+Ġcapill aris
+Ġdq c
+Ġoscill atory
+Ġcec ss
+Ġyang zhou
+Ġnag el
+Ġtact ics
+Ġxl jd
+Ġschw ar
+Ġwel ded
+Ġcleans ers
+Ġdeox ycholate
+Ġrvf w
+obacterial es
+agc ag
+Ġqs at
+Ġcere mon
+Ġindent ified
+Ġhusband ry
+Ġsln b
+ano ate
+Ġhook ah
+Ġdios genin
+Ġpbl s
+Ġinex perience
+Ġquot ation
+Ġsubclass ified
+meth anol
+Ġtss k
+Ġcour tes
+oflav one
+Ġfaith fully
+Ġhw ang
+opyran osyl
+Ġeigen vect
+Ġnms s
+Ġcarbox ylated
+Ġmpa a
+Ġglycyrrhiz ic
+Ġrearr anged
+Ġorbit rap
+Ġforecast s
+Ġparv imonas
+Ġxf g
+Ġvm mcs
+Ġqn rb
+Ġhyperc ortis
+Ġwrink led
+benz idine
+Ġnem ls
+Ġsphing osine
+Ġmicrotub es
+Ġinterconn ection
+Ġchord oma
+Ġsympath olytic
+cons id
+Ġqing hai
+Ġale gre
+Ġfasci otomy
+Ġdtc ap
+Ġphosphoryl ase
+Ġleishman ial
+Ġlentivir uses
+iol ingual
+secre tory
+Ġjin zhou
+Ġcory noline
+Ġjeopard ized
+Ġwl q
+Ġscp is
+Ġsjz t
+Ġnur ture
+Ġautotrans planted
+Ġsubcult ures
+Ġaudi ovis
+Ġsight ed
+Ġow ning
+Ġimf ed
+Ġtetram ethoxy
+Ġlmp be
+Ġclick s
+Ġexped ient
+Ġexcav ated
+Ġmegakary ocyte
+Ġincongru ity
+Ġprivile ges
+Ġspro ut
+Ġnaso jejunal
+Ġcompartmental ization
+Ġdinit rophenyl
+Ġnitrop ohl
+Ġtbo aes
+Ġinaccess ibility
+Ġmicrop ores
+Ġmicrop ipette
+Ġsurfact ants
+Ġresor ufin
+Ġpalest inian
+Ġshin y
+Ġpier re
+Ġpostpro cedure
+rotest osterone
+Ġmicrospor idia
+Ġdcc v
+Ġgav iscon
+Ġamis ul
+Ġfop nl
+Ġccg q
+Ġthrust ing
+Ġpaus ed
+Ġmq h
+Ġmidnight blue
+Ġunderexp anded
+Ġstun ned
+Ġannoy ed
+Ġdimeth oxy
+Ġtetramethyl benzidine
+Ġarcs olver
+Ġohc as
+Ġcinnamom i
+Ġvcm x
+Ġasparag ine
+Ġbuck wheat
+Ġhein rich
+Ġitl n
+Ġhyg roscopic
+Ġrepurp osed
+Ġglen ohumeral
+Ġmuco epid
+Ġrecalib rated
+376 6526
+Ġdithi obis
+Ġcholester yl
+Ġhok usai
+Ġnoncont act
+Ġpust ular
+Ġecur ac
+Ġtetrad ec
+Ġparafunction s
+Ġclom ipramine
+Ġsubep icardial
+Ġcolocal ized
+Ġmoy ers
+Ġerythro plakia
+Ġpity riasis
+Ġrhomb oid
+Ġmous se
+Ġgru en
+Ġnotor iously
+Ġretrans plantation
+Ġiom ri
+Ġacquaint ance
+Ġrhod otorula
+2229 116
+Ġovershadow ed
+Ġneuroradi ologist
+Ġvagin itis
+Ġsubscapular is
+Ġreple te
+Ġxcell igence
+Ġrichard son
+Ġebi oscience
+Ġtrick y
+Ġpann us
+Ġpsychoanale ptics
+ascal s
+Ġincred ibly
+Ġpulm onic
+Ġvideocon ferencing
+Ġgangli oside
+Ġstilb enes
+Ġjd hy
+Ġmalrot ation
+Ġtriphenyl tetrazolium
+Ġaristot le
+Ġndu fs
+Ġvenezu ela
+Ġflee ce
+Ġmultiline age
+Ġmetacogn itive
+Ġuygh ur
+Ġries ke
 Ġrhes us
-Ġrne asy
-Ġritt ler
-Ġrdr p
-Ġrstud io
-Ġronald o
-Ġruos po
-Ġricuc ci
-Ġwhine y
-Ġwhipl ash
-Ġexoph ytic
-Ġexsangu ination
-Ġproqu est
-Ġproform ae
-Ġprohib itively
-Ġprodig y
-Ġresver atrol
-Ġresuture d
-Ġresaz urin
-Ġresurg ence
-Ġrestruct uring
-Ġbeech er
-Ġbehe ira
-Ġbeaut y
-Ġbezm ialem
-trad itionally
-Ġimpor ving
-Ġimip ramine
-Ġimpress ively
-Ġimidaz oles
-Ġisof ield
-Ġishib ashi
-Ġisomal t
-Ġisopro stanes
-Ġisaac son
-Ġisrct n
-addition ally
-irsag ar
-Ġchib a
-Ġchocol ates
-Ġcherv in
-Ġchees e
-Ġchaper ones
-Ġchalo os
-Ġchaud hary
-Ġchlord emethyld
-Ġdeub iquitination
-Ġdeox ynucle
-Ġdeuter ium
-Ġdeuts chland
-Ġdeidenti fied
-Ġdeacet ylase
-Ġdeescal ating
-Ġincogn ito
-Ġincarn ate
-Ġmeib omian
-Ġbystand er
-Ġatact ctatcgt
-Ġatrop ine
-Ġatatct attggt
-Ġatelocol lagen
-Ġprecr ystallisation
-Ġprecal ibrated
-Ġpreco ated
-Ġprefr ontal
-Ġpremax illa
-Ġpreodont oblast
-Ġprehist oric
-Ġacron ym
-Ġacumin atum
-Ġacetal dehyde
-Ġacrid inium
-Ġacaact ttggt
-ivile ged
-Ġdisper tion
-Ġdisple asing
-Ġdisten ding
-Ġdisappro ve
-Ġdisfig uration
-Ġdistill ation
-Ġdisfav or
-Ġseymo ur
-Ġseulgg ie
-Ġsevefl urane
-Ġshand ong
-Ġshee hab
-Ġshell hardt
-Ġsherm an
-Ġshack les
-Ġshark ia
-Ġshrin king
-Ġshimm ering
-Ġshiro ta
-Ġshuff led
-Ġshivash ankara
-Ġdifft est
-Ġadamant inomatous
-Ġhebe i
-Ġheyd ecke
-Ġhearten ed
-Ġheista ro
-Ġheidel berg
-Ġassembl ing
-Ġassosci ates
-Ġclop per
-Ġclip ped
-Ġclox acillin
-Ġclav ulanic
-Ġtwee zer
-Ġtwinc ubator
-Ġtwosample mr
-Ġmagg ots
-Ġmaze ii
-oprec ipitation
-Ġscip y
-Ġscour ge
+Ġprotoberber ine
 Ġscha edler
-Ġscanc o
-Ġsculpt able
-Ġperiopath ogens
-Ġperiopro be
-Ġaposens or
-Ġitch y
-Ġcoerc ive
-Ġcoinf ected
-Ġcoales cent
-Ġcoocc urring
-Ġcobbl estone
-Ġcoorlin ates
-Ġcoomass ie
-Ġindeterm inate
-Ġinduv ial
-Ġindraw ati
-Ġleva i
-Ġleita o
-Ġlevoth yroxine
-Ġleopold o
-Ġnotting ham
-Ġcanall ed
-Ġparath yroid
-Ġparama gnetic
-Ġparacr ine
-statistic al
-Ġforesh adowed
-perform ance
-Ġhaens zel
-Ġhaavi kko
-Ġhahn enkratt
-Ġhaffaj ee
-Ġcontag ious
-Ġpresyn aptic
-Ġpreserv atives
-Ġplurip otency
-Ġalldl ms
-Ġwhichbu ild
-Ġrousp o
-Ġtrag us
-Ġtrick y
-Ġtrih ydroxy
-Ġtriaz olam
-Ġtrieth ylene
-Ġconsola ro
-Ġregist ro
-Ġreglaz ing
-Ġobso lete
-Ġobweges er
-Ġaccru ed
-Ġnovic es
-Ġnohs a
-Ġrecateg orized
-Ġrecont ouring
-Ġrecumb ent
-Ġrecycl ing
-Ġnexy gen
-Ġnebn ext
-Ġnepom uceno
-Ġneuroradi ology
-Ġabik o
-Ġabaq us
-Ġabdel aziz
-Ġabudall atif
-facestotals urface
-Ġsubple ural
-Ġsubord inate
-Ġsubging inval
-Ġsubfl avea
-Ġsubfamil ies
-Ġsubthem es
-Ġsubarach noid
-Ġinterph ase
-Ġinterne urons
-Ġintercal ated
-Ġintergen erational
-Ġintergo up
-Ġintertw ined
-Ġinterchange ably
-Ġinterfur cal
-Ġinteroper ability
-Ġinterverte bral
-Ġinterappoint ment
-Ġquater nary
-Ġqueas iness
-Ġquiryn en
-Ġunstr atified
-Ġunint ended
-Ġunord ered
-Ġunman ly
-Ġunresp onsive
-Ġunmark ed
-Ġunme asured
-Ġunaff ordable
-Ġunra vel
-Ġunstead y
-Ġuntime ly
-Ġunobser ved
-Ġunstruct ured
-Ġuntrans formed
-Ġunhel pful
-Ġuninterpre table
-Ġunbu ffered
-Ġunestabl ished
-Ġunantic ipated
-Ġunvac cinated
-Ġunattain able
-Ġunleash ed
-Ġintuss usceptive
-Ġyass aei
-Ġyamam ura
-Ġyttr ia
-Ġamarant e
-Ġamitr iptyline
-Ġkual a
-Ġkob ayashi
-Ġkaw amura
-Ġkne ecaps
-Ġkih on
-Ġkont tinen
-Ġkaz az
-Ġkivo vics
-Ġkuro da
-Ġkavy a
-Ġksh irsagar
-Ġkla assen
-Ġkungs backa
-Ġkratch man
-Ġkrennma ir
-plect in
-Ġvalenc ia
-Ġvaldiv ia
-Ġencr ypted
-Ġenucle ation
-Ġenumer ated
-Ġenigm atic
-Ġenthus iasm
-Ġgenew iz
-Ġgenamic s
-olarct obacterium
-Ġcoryn ebacterium
-Ġcorros ive
-Ġcoroll ary
-Ġcorrid ors
-Ġdesmo plastic
-Ġdesicc ator
-Ġdescend ants
-Ġsobr inus
-Ġarric o
-Ġarbe itsgeme
-Ġarrosion s
-Ġmedrx iv
-Ġphasc olarctobacterium
-Ġphleb oliths
-Ġoverpres cribed
-Ġovercon fidence
-Ġovergro wn
-Ġovercom pensating
-Ġbiolum inescence
-Ġbiostatistic s
-ctta attg
-ctgc ctccttcc
-Ġmoons hine
-Ġmoebi us
-Ġmozan y
-Ġmoirangth em
-Ġcolde a
-Ġdecellular ized
-Ġdeceptive ly
-Ġcrush ed
-Ġcrick ets
-Ġcraf ted
-Ġcrimin ality
-Ġagtgg gtgtcgctgttga
-Ġcalzol ari
-Ġstratov an
-cccat ctc
-ccacagtt tc
-Ġ113 1
-Ġprocalc itonin
-Ġsimps on
-Ġbrust ad
-Ġbrav o
-Ġbramant e
-Ġbratth all
-Ġundeb ated
-Ġundetect able
-Ġundifferenti ated
-Ġmaneu ver
-Ġmanhatt an
-Ġmanzal awi
-Ġ213 8
-Ġnoncr itical
-Ġnonfer mentable
-Ġnonred undant
-Ġnonresp onse
-Ġnoncom plicated
-Ġnonvascular ized
-Ġnonnorm ally
-Ġnoninf ectious
-Ġnonmed ical
-Ġnoncycl oplegic
-Ġnonnen macher
-Ġnonpain ful
-Ġnonrand omized
-Ġnonalcohol ic
-Ġsupress es
-Ġorthophosph oric
-Ġradiopro tection
-Ġradiosensitiz er
-Ġdefrag mentation
-Ġspok en
-Ġspatul as
-Ġjak oba
-Ġjane iro
-Ġjitt ered
-Ġjoy ce
-Ġjung le
-Ġjok ovic
-Ġjcp ds
-Ġjacks on
-Ġjeremia h
-Ġjenk is
-Ġedef inition
-Ġfurunc u
-Ġfurhaus er
-Ġmicrodr ill
-Ġmicroca vities
-Ġmicrocy tic
-Ġmicrohy brid
-Ġmicroarr ays
-Ġmicroabs cesses
-Ġmicrophthal mia
-Ġmicroaer ophilic
-Ġmicroabras ion
-Ġdemethyl ase
-Ġdemaros i
-Ġminibr ush
-Ġminisce w
-Ġiked a
-Ġiwas aki
-Ġikb kg
-Ġmaltit ol
-Ġmalocl usion
-Ġmaladj ustment
-Ġmalho tra
-Ġmalnour ished
-Ġformaz an
-Ġoutcompet e
-Ġopio ids
-Ġdiarr hea
+Ġbacksc atter
+Ġlaparot omies
+Ġargy ria
+Ġmumb ai
+Ġfilip ino
+Ġbrachiorad ialis
+analys er
+Ġichthy osis
+Ġimmunosenes cence
+ffic acy
+Ġassembl ies
+Ġtramet inib
+Ġopercul um
+Ġstereotax ic
+Ġ0004 104
+Ġantimutagen icity
+Ġasphy xi
+Ġricin oleic
+Ġglycop yrrolate
+Ġinext ric
+oscint igraphy
+Ġcolog ne
+Ġascle pi
+Ġapol lo
+Ġoverbur den
+10733 113
+Ġureterol ithotomy
+Ġpwm ci
+Ġtryp omastigotes
+Ġsqueez ed
+Ġunful filled
+Ġmonast ir
+Ġzamb ian
+Ġhemih epatectomy
+Ġmyoclon us
+Ġvasosp astic
+Ġpapanic olaou
+Ġtriath lon
+Ġomphal ocele
+Ġrasb uricase
+pyruv ate
+Ġantisyn thetase
+Ġpake ke
+odext rin
+Ġleptom ening
+Ġunadd ressed
+Ġnouch ali
+Ġcoroz al
+Ġcorks crew
+Ġbiweek ly
+Ġparafil m
+Ġparicalc itol
+Ġzota rolimus
+Ġglucoam ylase
+Ġmethylenetetra hydrofolate
+Ġvideocap illa
+Ġsubsynd romal
+Ġxljd od
+3 17
+3 18
+3 67
+3 35
+3 607
+5 12
+5 20
+5 64
+5 90
+7 10
+8 15
+8 60
+b ens
+b red
+b odies
+b amine
+c ified
+c omplete
+d irect
+f ix
+f ather
+f lux
+f eld
+f inally
+g ics
+g lo
+g mon
+i oides
+j iao
+k op
+m mp
+m ela
+p am
+p arent
+r ially
+s iloxane
+t ropin
+v ens
+w au
+x aminer
+Ġt iz
+in as
+in os
+in oma
+in fusion
+Ġa if
+Ġa up
+Ġth k
+on on
+at ac
+Ġs arg
+Ġs ier
+Ġs ias
+Ġs otal
+en ar
+en ix
+Ġo all
+Ġo ha
+er ial
+er ous
+Ġc ulin
+Ġc inc
+Ġc icc
+Ġp ly
+Ġp ule
+Ġp uk
+ed ation
+Ġw ig
+Ġw aviness
+al pha
+it ides
+Ġf ry
+Ġf rit
+Ġf osin
+Ġf ainting
+ic or
+ic is
+ic os
+ic ol
+or otation
+Ġd ph
+Ġd ob
+Ġd ok
+Ġd ivalent
+is is
+is ide
+Ġm we
+Ġm ok
+Ġand alus
+Ġb ans
+Ġb our
+Ġb gs
+Ġb va
+as iness
+Ġre ptans
+Ġh ack
+Ġh atg
+Ġe hs
+ve c
+Ġn az
+ur yl
+Ġl bl
+Ġl gin
+Ġl akes
+Ġl gd
+Ġl iap
+et z
+im ag
+im ental
+im ene
+Ġg pl
+Ġg itt
+ig uan
+id am
+id able
+id erm
+id omide
+if ting
+Ġwas tage
+Ġwas tes
+ud s
+ud ation
+un ter
+el te
+el man
+el olactone
+ut anous
+ab ain
+Ġv iper
+ch imerism
+Ġpro form
+Ġpro str
+Ġex anth
+Ġex othermic
+ant ong
+Ġr ust
+Ġr uth
+Ġr sc
+Ġr np
+Ġr nt
+Ġr alc
+iv an
+iv ery
+em al
+Ġal um
+Ġal cap
+Ġcom ers
+am ab
+am aged
+ir rh
+op i
+ys ystole
+Ġde activ
+Ġde ubiqu
+Ġus b
+Ġch rome
+Ġim g
+ure lla
+ib w
+Ġat cs
+Ġat dc
+Ġse cc
+og alact
+Ġad onis
+ult ations
+Ġpre vertebral
+Ġper ig
+Ġper th
+Ġper techn
+Ġper creta
+st s
+st ead
+st rained
+Ġsu ck
+Ġsu ave
+Ġgro uting
+Ġsh b
+Ġsh red
+Ġsh ake
+Ġsh ots
+ign ant
+ain i
+ip as
+Ġle ach
+se xual
+Ġac umen
+ac oside
+Ġtw eed
+und ed
+Ġdis imp
+Ġdis enroll
+pl l
+pl ase
+Ġcl fm
+Ġhe brew
+Ġtre prost
+ost omic
+end oscope
+Ġme ar
+pt or
+Ġit cs
+Ġne omycin
+ph os
+Ġap cp
+Ġap orphine
+vi er
+Ġk k
+Ġk ow
+Ġk rd
+Ġk ba
+Ġk atg
+Ġall oplastic
+Ġev b
+Ġev ade
+Ġob e
+Ġob sole
+Ġtr ist
+Ġpl od
+Ġpl rt
+Ġinter na
+Ġrec up
+Ġpres yn
+Ġun ex
+Ġun question
+Ġcons ol
+Ġsub net
+Ġsub occipital
+ill ard
+Ġam per
+pro ductive
+Ġph h
+Ġph aryng
+ory noline
+ath ulenol
+rol ling
+Ġqu ips
+Ġmod fit
+ap an
+ap ping
+Ġno bel
+Ġno isy
+Ġfol der
+Ġfol iar
+Ġtim olol
+Ġpos ology
+Ġy ong
+Ġgen em
+Ġstat elessness
+Ġant il
+Ġant imus
+Ġbl ending
+Ġbl astic
+Ġmay er
+erm ann
+ak o
+ak ami
+Ġar isc
+Ġhy clone
+Ġvari x
+ub ble
+Ġfin ami
+ym ph
+Ġdes ol
+Ġund is
+Ġag np
+Ġag angl
+Ġag scs
+Ġperform er
+Ġser ration
+Ġte if
+Ġmeth acetin
+Ġsup ram
+Ġ1 13
+Ġra rest
+Ġra ja
+Ġfound er
+cre tion
+osp ond
+Ġtrans act
+Ġnon infected
+Ġnon infection
+Ġnon valvular
+Ġnon irradiated
+Ġbi ol
+Ġbi otypes
+Ġj ogging
+Ġsp y
+Ġsp athulenol
+Ġ2 14
+Ġend olymph
+Ġchar antia
+Ġem ma
+Ġem erald
+Ġdef ences
+Ġsystem atized
+Ġsm cc
+Ġsm pd
+Ġperiod icity
+Ġma as
+Ġma ves
+Ġfurther ing
+Ġdr ls
+Ġgl ur
+ite c
+Ġi eps
+yn ic
+Ġfl am
+Ġfl ocked
+ogen ital
+Ġatt c
+Ġsec undum
+Ġhyper inflammatory
+Ġprim a
+Ġmic ell
+Ġlong hua
+Ġhist ologies
+Ġel sa
+Ġdo zens
+Ġnurs ed
+Ġchang hai
+Ġ3 15
+Ġcriter ium
+Ġol c
+ov ich
+Ġav d
+Ġes w
+Ġnormal ise
+Ġintra b
+Ġintra corporeal
+Ġintra pancreatic
+Ġprovid encia
+Ġdemonstr ations
+Ġprotein tech
+Ġpress urization
+Ġep im
+Ġsampl ings
+Ġret t
+Ġret rob
+Ġret reated
+Ġpers piration
+ts son
+ene c
+Ġgeneral isation
+Ġimmun om
+Ġimmun of
+Ġimmun otherapeutic
+Ġz d
+Ġz uc
+Ġz hi
+Ġz fh
+Ġz ona
+Ġz idov
+Ġsens u
+Ġeth inyl
+Ġox azol
+Ġmechan oreceptors
+omy osin
+Ġuniv ari
+Ġmal mo
+Ġhem ides
+Ġhem oglob
+Ġmicro embolization
+Ġmicro implant
+Ġmicro vesicular
+Ġmicro abrasion
+Ġmicro architectural
+Ġmicro chimerism
+thes ias
+ma res
+Ġvent romed
+Ġcyt ocent
+Ġabs is
+Ġacid ogenicity
+Ġcd bp
+med icated
+Ġanalyz able
+Ġdesign er
+ne oplastic
+Ġinst ill
+Ġang ulin
+Ġpoly eth
+Ġpoly ols
+Ġlab orers
+Ġsol anum
+Ġfam e
+Ġdys genesis
+Ġdys kinetic
+Ġct f
+Ġct rc
+Ġct ibl
+Ġintervention ist
+Ġrest itution
+Ġml s
+Ġml ac
+Ġcap d
+br um
+li i
+Ġorgan oids
+Ġdirect s
+Ġdent ius
+Ġq ace
+Ġq ilu
+Ġmat su
+Ġequ ating
+Ġunivers ita
+Ġmetab arc
+Ġpat ched
+Ġur ti
+Ġisol iqu
+Ġaut oreactive
+Ġelect rophilic
+Ġelect robl
+Ġsl ugg
+Ġprol ene
+Ġbr ass
+Ġbr no
+Ġbr ighter
+Ġopt um
+Ġlog c
+Ġsuper structure
+rop ia
+Ġquant studio
+Ġmeta prop
+Ġmm rm
+Ġda ibd
+Ġcolon ial
+Ġoste opaths
+Ġoste otomes
+Ġlocal izes
+Ġsubgroup ing
+Ġinsulin emic
+ored a
+Ġsw pd
+Ġos r
+Ġpur ging
+Ġmuc or
+Ġcut ter
+Ġhb t
+Ġsequ ester
+Ġu ia
+Ġu cep
+Ġu uti
+Ġcoll ating
+Ġdam on
+Ġyoung sters
+Ġmir s
+Ġmir walk
+dom inant
+Ġventil ate
+Ġhyd rop
+Ġhypoth enar
+ool a
+Ġcm j
+Ġcm os
+Ġstro bil
+Ġheter ochrom
+Ġdom ination
+Ġfraction ed
+Ġver d
+Ġver h
+Ġver p
+Ġback drop
+Ġoxid ize
+ole y
+clus al
+Ġhs r
+Ġhs il
+Ġhs ieh
+Ġhead less
+Ġhead space
+Ġbu k
+Ġneuro prot
+Ġneuro apoptosis
+Ġpd hs
+Ġhc se
+Ġmit os
+Ġhal os
+Ġconvent ions
+Ġeng ender
+Ġhepat ologists
+Ġhepat ocarcinogenesis
+Ġess ays
+Ġrout ing
+Ġconfirm ative
+cal ing
+az aki
+Ġhr d
+Ġbo u
+ck et
+Ġcb g
+Ġprep aid
+Ġx cm
+Ġx chd
+Ġsn k
+Ġsn ell
+Ġobject ified
+Ġgu o
+Ġgu ards
+Ġgr d
+Ġgr f
+Ġgr ind
+Ġbiom imetic
+Ġens ue
+Ġpc de
+Ġpc bs
+Ġprod rug
+Ġshe er
+Ġtc vo
+Ġce eg
+Ġcycl op
+Ġhom im
+Ġhom od
+Ġhom oscedasticity
+ereb ro
+Ġrs d
+Ġhemat ologist
+Ġport ends
+Ġtransplant ing
+Ġov c
+Ġov ata
+Ġeurope p
+Ġmc u
+Ġip os
+Ġip anda
+Ġinteract ivity
+Ġchrom opert
+Ġsepsis pam
+Ġnas i
+inf arction
+Ġnf r
+Ġnit roph
+ipl oidy
+Ġ19 77
+Ġrot atable
+Ġpt mcs
+Ġpt nm
+Ġste ph
+Ġste aming
+pr ide
+Ġide ations
+Ġge opolitical
+Ġaff ixed
+Ġaff luence
+Ġuc f
+Ġpet rol
+Ġcand ies
+Ġcand esartan
+Ġdim eric
+Ġrh ine
+Ġrh tsh
+Ġorigin ators
+Ġcerv ico
+Ġown er
+Ġhp n
+Ġphot oin
+Ġtransl aryngeal
+ga ard
+Ġexpect or
+Ġcum ulus
+Ġtit rating
+Ġlas a
+Ġexperiment er
+Ġabsorb ances
+Ġpol ite
+Ġcomput es
+Ġmatr iderm
+Ġchlor zoxazone
+Ġenter oscopes
+Ġskeletal ly
+Ġamb itious
+Ġintr uded
+Ġbes ylate
+Ġnan ote
+Ġtele metric
+Ġcement oblasts
+Ġsem isol
+Ġbuc king
+Ġdc bs
+Ġci k
+met ically
+Ġlar a
+Ġpret o
+21 3
+Ġmil lett
+Ġmil wau
+ott i
+Ġeryth roph
+Ġeryth raline
+Ġtp ds
+Ġtp mt
+Ġexpans ions
+Ġhoc m
+Ġtherm ometry
+Ġpf x
+Ġpf cs
+gg ag
+enter ostomy
+Ġrv sp
+Ġonc abg
+Ġremod el
+Ġcortic otrophin
+Ġaort ocaval
+Ġgram mar
+Ġspread ability
+Ġah b
+Ġnt d
+Ġnt rk
+Ġequival ency
+Ġarrhythm ogenesis
+Ġmor row
+Ġtoxic ant
+Ġtoxic ants
+Ġnight mares
+Ġantibacterial s
+Ġpb d
+Ġmh ms
+Ġmh amis
+22 8
+Ġsar pe
+Ġhypot richosis
+Ġpg ad
+Ġ30 7
+Ġmedial is
+Ġot otoxicity
+Ġcover t
+Ġsemi ology
+bar a
+Ġinn oc
+Ġsb a
+Ġprogress or
+Ġprogress ions
+Ġtet x
+Ġcab b
+Ġthin prep
+Ġenl isted
+Ġter rain
+Ġfas n
+80 4
+Ġts at
+Ġnr w
+Ġembol isms
+Ġpy uria
+Ġpy rene
+Ġpy onephrosis
+Ġtrop ics
+Ġlm m
+Ġlm w
+Ġlm vd
+Ġker ato
+Ġsap phire
+Ġord inated
+Ġrhythm icity
+Ġnic m
+Ġeb a
+Ġanthrop ological
+Ġanthrop ometrical
+65 2
+65 60
+Ġls as
+Ġdb mp
+27 2
+Ġrf ms
+gc ag
+Ġae cc
+chol ate
+Ġmicroc omp
+Ġmf erg
+Ġaz in
+Ġtrip etala
+Ġect s
+Ġamel ogenin
+Ġphysi ochemical
+Ġbol in
+Ġsensit izers
+18 2
+Ġkap im
+Ġkap osi
+Ġeq s
+Ġhex ag
+Ġhex cers
+Ġpk q
+Ġld ha
+Ġcure t
+Ġlin teus
+Ġfro st
+Ġgranul ocytic
+Ġfc od
+Ġfu ther
+Ġlev in
+Ġbios heets
+Ġfatal ism
+Ġbip ap
+Ġey eg
+Ġcrypt ic
+Ġcrypt itis
+Ġniv ats
+Ġgli oblastomas
+Ġbt as
+Ġram ped
+Ġextr ude
+Ġgn bsi
+Ġmer id
+Ġrm ta
+Ġtach ysystole
+Ġmicros urface
+Ġdestruction s
+Ġring ed
+Ġpaediatric ian
+Ġsector ial
+Ġknock ing
+ode ple
+ni k
+Ġmultip arity
+Ġpopular ized
+Ġpoll uted
+Ġlith iatic
+Ġdic affe
+Ġgm dr
+Ġepic enter
+Ġanesthet ize
+Ġpuls otypes
+Ġgent iana
+Ġmacro cephal
+Ġfriends hips
+Ġscc ot
+Ġkh al
+Ġtac it
+Ġgon iotomy
+uan osine
+Ġhierarch ies
+Ġiso zymes
+Ġscatter grams
+Ġhv od
+enteric a
+cap illary
+Ġarteri opathy
+Ġpdl cs
+Ġretro virus
+Ġcrystall inity
+Ġprotr usio
+wash ed
+Ġafford s
+Ġhabit ats
+Ġunp olymer
+Ġpent amidine
+Ġdf c
+Ġgb wt
+Ġath ymic
+Ġtibia e
+Ġimmunore action
+Ġaspart ame
+Ġlean ing
+Ġmn emonic
+Ġirrit ate
+Ġdot a
+Ġsaw bone
+Ġdss c
+Ġtin ospora
+Ġvan uat
+Ġretrograde ly
+Ġintrac erebro
+Ġstar ter
+ocyst s
+pop ulation
+78 194
+Ġtu ohy
+Ġmoist ening
+43 53
+Ġfash ioned
+Ġlag er
+Ġgw ass
+Ġlav ages
+Ġxer ostomic
+Ġfire arm
+Ġesc ulin
+Ġpolit ically
+Ġbelg rade
+Ġsput tered
+Ġves air
+Ġtunnel ed
+Ġtunnel ated
+Ġars en
+Ġscholar ly
+Ġpalm er
+Ġtelemed ical
+Ġinstruct ing
+ez a
+Ġpurs u
+Ġfibrom atosis
+Ġreserv ations
+Ġhac ms
+Ġdece mentation
+Ġcub es
 Ġdihyd rotestosterone
-Ġdihydr ate
-Ġgramm atical
-Ġgrav is
-Ġgrind ed
-Ġgroning en
-Ġdeparaffin ization
-Ġsalame h
-Ġsalesp ersons
-Ġsalimetric s
-Ġunderpr ivileged
-Ġunderrepresent ed
-Ġimpinge ment
-Ġimpregn ated
-Ġpostpart um
-Ġpostcur ricular
-Ġcrouz on
-Ġconfron ting
-Ġpainkill ers
-Ġseraf im
-Ġmetacy c
-Ġmetatrans criptome
-Ġmetapoly zyme
-Ġmonoph ase
-Ġmonochlor inated
-Ġmonobe veled
-Ġblau tia
-Ġembl oyed
-Ġemble matic
-Ġemmel mann
-Ġfreuden mann
-Ġfreiburg er
-Ġintratum oral
-Ġintraind ividual
-Ġ0000 1
-Ġzechn er
-Ġzha o
-Ġzanc ajo
-Ġzaf iropoulos
-Ġzame er
-Ġzole til
-Ġzale plon
-Ġzij nge
-Ġzik avirus
-Ġzenot ec
-Ġzucch elli
-Ġerlen meyer
-Ġeriogl aucine
-Ġerzur um
-Ġerreyg ers
-Ġendoph thalmitis
-Ġendorph ins
-Ġendomicro scopy
-Ġendosc opes
-Ġcauter ization
-Ġinflatun s
-Ġcefr adine
-Ġeltaw il
-Ġmultiplan ar
-Ġmultimorb idity
-Ġremdes ivir
-Ġfranc a
-Ġfrances hi
-Ġfrustr ated
-Ġlongbott om
-Ġpredecess or
-Ġanycub ic
-Ġbasophil s
-Ġmucopolys accharides
-Ġmucogingiv itis
-Ġsmiled irectclub
-Ġinstig ates
-Ġappreh ension
-Ġschra ufstatter
-Ġschwar zer
-Ġschnut enhaus
-Ġschwend icke
-Ġschimid lin
-Ġdouch ing
-Ġcybers ickness
-Ġprotuber ance
-Ġmouthfe el
-Ġmouthpi ece
-Ġpathosystem s
-Ġantidi abetic
-Ġantipsych otics
-Ġantiprolif erative
-Ġantithrom bin
-Ġceragl aze
-Ġuniversita ire
-Ġosmore gulation
-Ġavulsion s
-Ġmechanotrans duction
-Ġfacscal ibur
-Ġpalind romic
-Ġguimara es
-Ġesco ufier
-Ġescher ichia
-Ġnecros iss
-Ġosteointegr ation
-Ġosteodyst rophy
-Ġattga acacaacaaggc
-Ġintravent ricular
-Ġintrauter ine
-Ġdaeg u
-Ġdavidopo uloou
-Ġsloter vaart
-Ġhypophosphate mia
-Ġhypopne a
-Ġmatru h
-Ġmatthe us
-Ġ570 5
-Ġepiph aryngeal
-Ġepimer ase
-Ġepiflu orescence
-Ġredistrib uted
-Ġabsciss a
-Ġnormodiver gence
-Ġnewbor ns
-Ġmorgell ons
-Ġcompliment ary
-Ġcrosslin king
-Ġacidov orans
-Ġhoskins on
-Ġdiabru x
-Ġmidgest ation
-Ġmidorb ital
-Ġpolygen ic
-Ġpolyhex inide
-Ġpolyeth eretherketone
-Ġpolyprop ylene
-Ġpolytom ous
-Ġpolybut adiene
-Ġpolydimethyl siloxane
-Ġpolytechn ic
-Ġpolyarylether ketones
-Ġpolypharm acy
-Ġachili as
-Ġpaepe gaey
-Ġpaolon i
-Ġparod ontium
-Ġpajn igara
-Ġpaolanton io
-Ġlifecy cle
-Ġpapyr acea
-Ġpapanic olau
-Ġufl c
-Ġautoch thone
-Ġautoph agy
-Ġautopolymer ized
-Ġautocorre lated
-Ġlightcycl er
-Ġreducedebr is
-Ġlaypers ons
-Ġimmunoph enotypic
-Ġimmunosen escence
-Ġaffectedsubjec tstotalperson
-Ġstippl ed
-Ġodhl ers
-Ġodynoph agia
-toomb ak
-Ġequilibr ated
-Ġequidist ant
-Ġmesang ial
-Ġmesoph aryngeal
-Ġ420 21278290
-Ġaxhaus en
-Ġtahm aseb
-Ġtaacatt agaaac
-Ġintereset ed
-Ġstrongyloid es
-Ġexperimentalgroup s
-Ġprecarious ness
-Ġboots trapping
-Ġbogeym an
-Ġpanouts opoulou
-Ġpancher z
-Ġpanphot ocoagulation
-Ġdeepithelial ization
-Ġstepano vic
-Ġhypercellular ity
-Ġhypermes h
-Ġhypercap nia
-Ġreasonabl eness
-Ġcyclophosph amide
-Ġelectir c
-Ġbiomineral ization
-Ġbiomechenich al
-Ġdelmop inol
-Ġpsychotic ism
-Ġpsychoneurolog ical
-Ġmuttuk adu
-Ġskyroc keted
-Ġxyle tol
-Ġxiang ya
-Ġlipofect amine
-Ġnorthe ast
-Ġnorrh em
-Ġbackprop agation
-Ġbackstep ping
-Ġpolastr i
-Ġ860 2
-Ġwahl strom
-Ġwahad ni
-Ġphotomedic ine
-Ġphotocop ies
-Ġbrevund imonas
-measure ments
-meaning ful
-Ġmussavir a
-Ġcollprot ect
-Ġsternoc leidomastoid
-Ġcirau qui
-Ġbarcel ona
-Ġillino is
-Ġ20170 1
-Ġtennis on
-Ġmagneto encephalography
-Ġpneumophil a
-Ġpneumocys tis
-Ġorganole ptic
-Ġalgahe fi
-Ġbrows able
-Ġultracle an
-Ġencoraf enib
-Ġmyrt le
-Ġbuzz ing
-Ġmillisecond s
-Ġphosphosil icate
-Ġsemmel weis
-Ġmacarth ur
-Ġmacromo lecules
-Ġqude imat
-Ġbinimet inib
-Ġdysgran ular
-Ġdysphor ia
-Ġdyskines ia
-Ġdysthym ia
-Ġherlof son
-Ġcholecyst ectomy
-Ġturrion i
-Ġnanogl asses
-Ġnanohy brid
-Ġporopl is
-Ġdowntur ns
-Ġphenochlor oform
-Ġphenyto in
-Ġphenylmeth ylsulfonyl
-Ġchloroamin oacids
-Ġentrus ted
-Ġintegu mental
-Ġmiscell aneous
-Ġmiscegen ation
-Ġmisregistr ations
-Ġlaterotr usion
-Ġsaatch i
-Ġsaquin avir
-Ġhencefor th
-Ġafflic ted
-Ġbirthyear s
-Ġnaeij e
-Ġcytosc ape
-Ġcytomegal ovirus
-Ġcamphor quinone
-Ġartocar pin
-Ġkebang saan
-Ġpilocar pine
-Ġforefr ont
-Ġsaraj evo
-Ġodontostomat ological
-Ġodontontocl asts
-Ġleukoar aiosis
-Ġacquaint ance
-Ġarrhy thmia
-Ġmcerebr um
-Ġgaik wad
-Ġbalsamin a
-Ġlymphotox ins
-Ġlymphoplasm acytic
-Ġpropenen itrile
-Ġsafran in
-Ġscrewdri ver
-Ġsteenberg he
-Ġsubmillimet re
-Ġguttaper cha
-Ġccagggt atggacct
-Ġalbuquer que
-Ġduoden um
-Ġrataj czak
-Ġbeschwer den
-Ġkitami ense
-Ġvasodil ation
-Ġvasospas ms
-Ġcounterproduc tive
-Ġcountermom ent
-Ġcountervail ing
-Ġanaesthes iologists
-Ġpostsecond ary
-Ġbiotrans formation
-Ġbioabs orbable
-Ġbioelec trical
-Ġbioarchae ological
-Ġ20000400 63
-Ġperfluoron onanoic
-Ġgrembow ski
-Ġtapiova ara
-Ġoxogl utarate
-Ġaminoethyld iphenyl
-caatcc cttaattg
-Ġwashbas in
-Ġradnz ic
-Ġstreptoz otocin
-Ġstreptavid in
-defin itions
-Ġgcdf p
-Ġraspator ium
-Ġmacrogl obulin
-Ġbottlen eck
-Ġdichlorodih ydroflu
-Ġomnist at
-Ġsulfadiaz ine
-Ġcurviline ar
-Ġbennet t
-Ġcatogor ized
-Ġwarangkul kasemkit
-Ġarthrocent esis
-Ġecchym osis
-Ġdisaggreg ated
-Ġphotoirr adiation
-Ġtetrameth ylsilane
-Ġatherothrom botic
-Ġholotox in
-Ġholopros encephaly
-Ġgaszyn ska
-Ġquadhel ix
-Ġunstick iness
-Ġcitrull inated
-Ġhydroxyprop yl
-Ġpseudarth rosis
-Ġnanoprec ursors
-Ġanticonvuls ant
-Ġangiopo ietin
-Ġmethanosarcin a
-Ġoctacalc ium
-Ġnonsurg ically
-gatekee per
-tgaag atccggtc
-Ġkhosra vi
-Ġovercorre ction
-Ġglucosyl transferase
-Ġhydroxychlor oquine
-accagct catgc
-Ġpitfall s
-Ġmitteilun gen
-Ġbulgar ia
-Ġchromoblast omycoses
-Ġpetrole um
-Ġbicinch oninic
-Ġglossodyn ia
-enesulf onic
-Ġrenmin bi
-Ġneurocogn itive
-Ġpykno tic
-Ġfingern ail
-Ġbonfig lio
-Ġaldhu wayhi
-Ġadenotons illar
-Ġunconscious ly
-Ġuncorrec ted
-Ġhypoalbumin emia
-Ġphysiotherap ists
-Ġmesiovestib ular
-Ġcastill o
-Ġinterspers ed
-201312 1815842
-202306 12058461
-Ġkaarn iranta
-Ġbilirub in
-Ġtrapezi us
-Ġretrofitt able
-Ġretroperitone um
-Ġthermoplasm ata
-Ġtgaa aagagcatctg
-Ġtgcaaa agaaggcat
-Ġrepuls ive
-Ġhetreogen ecity
-Ġbiosynthes ized
-Ġbayrak dar
-Ġnfkb ia
-Ġinfradental e
-Ġuncooper ativeness
-Ġmethylmeth acrylate
-Ġmethyliminodi acetic
-Ġiccmst m
-Ġenterobacteriace ae
-Ġelectroconvuls ive
-Ġnineteen th
-Ġtangsu ksan
-Ġventriculomegal y
-Ġporphyrym ona
-Ġferrit in
-Ġmegaspha era
-Ġmicrosphere s
-Ġmicrosatell ite
-Ġadjuvan tive
-Ġgastroprot ective
-Ġsunny brook
-Ġcatalyz es
-Ġproclaim ed
-Ġunmistak able
-Ġbenchmar king
-1457 7
-Ġbacitr acin
-Ġbigdy eterminator
-22285 70
-Ġgonzale z
-Ġgottsaun er
-Ġkolwij ck
-Ġkolomgro v
-Ġkuhle felt
-Ġtransglut aminase
-Ġweltzi en
-Ġalveolopl asty
-Ġtrelle borg
-Ġtelesc opic
-Ġhaploins ufficiency
-Ġbiotinyl ated
-Ġ3598 4
-glcn ac
-Ġtroubles ome
-Ġthromboemb olism
-Ġinterpapill ae
-Ġamphiphil ic
-Ġiatrosed ative
-Ġimmunocompet ent
-Ġhypertelor ism
-Ġcgcct accagctcatgc
-Ġbhalaj i
-Ġgtcaatt ctgcctccttcc
-Ġprecipitationdiss olution
-Ġmisdiagn ose
-Ġthrombophleb itis
-Ġlobbezo o
-Ġepiglot tis
-Ġnondestr uctive
-Ġtrimgal ore
-Ġmohamad khahet
-agaatgg gata
-Ġgrandparen ts
-Ġfloqs wabs
-Ġbenzodiaz epines
-Ġbenzothiaz ole
-Ġlinguovel ar
-Ġfiocru z
-Ġfiorell i
-Ġbundesmin isterium
-Ġhamidi ye
-Ġposterotr agion
-Ġjeffco at
-Ġmicrocolon ies
-Ġintrasubjec t
-Ġperfluorohex ane
-Ġperfluorodec anoic
-Ġpentaery thritol
-Ġpentobarb ital
-Ġmurmans k
-Ġbaghd ady
-Ġechocard iography
-Ġgambet ta
-Ġabduljab bar
-Ġbronchodil ators
-Ġradioimmun oprecipitation
-Ġabsorpti ometry
-Ġpolyetherketone ketone
-Ġcraniosyn ostosis
-Ġcraniopharyn gioma
-Ġmicrorough ness
-Ġcetyltrimethyl ammonium
-Ġsidestep s
-Ġoleophobic ity
-Ġpeduzz i
-Ġbanglades h
-Ġeigenvect ors
-Ġlisinop ril
-Ġlatitud es
-Ġnienk emper
-Ġggcccagct tctagcacttct
+Ġmenis ci
+Ġppe ak
+Ġnonc arious
+87 6
+Ġtanz er
+Ġchel ator
+Ġphag ocyte
+Ġcyan obacterial
+Ġved otin
+Ġisland ers
+Ġharmon ics
+Ġunsuccessful ly
+Ġwed elolactone
+Ġsubcl one
+Ġfort ified
+Ġreciproc ity
+Ġanne aled
+Ġni osh
+Ġankyl osed
+Ġhips cs
+Ġmeg ap
+Ġoccip ut
+Ġphle gmon
+atg cc
+Ġseb orrheic
+Ġdispatch er
+Ġhi ke
+arous al
+Ġpartition s
+Ġphotos ensitivity
+Ġsuff ocation
+Ġfried rich
+Ġophthalm opathy
+Ġechin acoside
+Ġaffir ms
+Ġeras er
+Ġbrand ed
+Ġsubth reshold
+Ġwom ans
+Ġprohib its
+Ġexempl arily
+Ġrecre ate
+Ġhypercal caemia
+Ġlvm w
+Ġcalor imetric
+Ġquadrup lex
+Ġcapn ographic
+Ġpaf s
+Ġunpleasant ness
+Ġirrelev ance
+Ġdisagree ing
+Ġgang etica
+Ġpare to
+Ġnepal i
+Ġshallow er
+Ġprecondition s
+Ġaggl utinin
+Ġigt fast
+Ġmct si
+Ġcds mp
+Ġmicrosph ere
+Ġradiop ac
+Ġtyph l
+Ġsq stm
+Ġbct s
+Ġruss ell
+Ġprosth etically
+Ġhcp cs
+Ġanb essa
+Ġbronchi olitis
+Ġmandib ulectomy
+Ġscot ch
+Ġprehypert ensive
+133 30
+Ġrefrig eration
+Ġellip tic
+Ġtrabec ulation
+Ġgard ner
+Ġaneuploid ies
+Ġsucce eding
+Ġrum ex
+Ġlmwh s
+Ġembarr assing
+Ġgpi ib
+Ġgastrin oma
+Ġcarbox amide
+Ġgigant eus
+Ġhisti ocytosis
+Ġavi um
+Ġhil us
+Ġbioeth ic
+Ġpha ii
+Ġuncon strained
+bu ilding
+Ġparv um
+Ġfores kin
+ophyll um
+Ġaap o
+Ġqn rs
+Ġqn rd
+Ġrass f
+Ġcloud s
+Ġillumin ating
+Ġglucuron idase
+do ct
+Ġgenuine ly
+Ġprioritis ing
+Ġted ious
+Ġcing ulin
+Ġsympath omimetic
+glut ination
+Ġpermiss ibility
+Ġphal angeal
+Ġentit le
+Ġhypogonad otropic
+Ġbss fp
+Ġmetastas izing
+Ġresort ed
+Ġresort ing
+Ġoverf illing
+Ġhirs uta
+Ġlux emb
+Ġtocopher ols
+Ġek iti
+Ġwol ff
+Ġwol fram
+Ġpag et
+Ġwaters hed
+Ġbq z
+Ġlars en
+Ġcollaps es
+Ġcheb ulae
+Ġppt p
+Ġinnerv ate
+Ġunpre ventable
+stat istical
+Ġpeace ful
+Ġfanc a
+Ġwl st
+Ġkor le
+Ġeap c
+Ġguess es
+Ġchur ches
+Ġpolysomn ographic
+Ġabrog ation
+Ġenqu ired
+Ġou abain
+Ġlymphangi ogenesis
+Ġreevalu ate
+Ġisoflav one
+Ġrevis its
+Ġnaphth ol
+oprote ases
+Ġsequest ered
+Ġhydrolys ed
+Ġassert iveness
+Ġimpart ing
+Ġtpt z
+Ġpetros elin
+Ġpyr idine
+Ġbioc idal
+Ġsteril ised
+Ġsteril izing
+Ġrpp c
+Ġmoz amb
+recent ly
+Ġorchid ometer
+Ġcym bop
+Ġdact ylon
+Ġblastom ere
+Ġpostpro cessing
+Ġwip ed
+Ġuss ing
+Ġpedis urv
+Ġrear foot
+Ġchon nam
+Ġamnes ic
+Ġsolubil ised
+Ġrld f
+Ġprejud ices
+Ġemuls ified
+107 6560
+Ġkum asi
+Ġkum mer
+lys ed
+129 16
+Ġagglomer ates
+yly l
+Ġfag an
+Ġpseudotum or
+Ġindis put
+Ġgies on
+Ġppf x
+Ġpetech ial
+Ġsheng hui
+Ġoversh oot
+Ġgrad ation
+Ġmosqu it
+Ġasparag inase
+Ġhomebound ness
+Ġechocardiograph er
+Ġechocardiograph ers
+Ġarabin ose
+Ġmoly bdate
+Ġpari eto
+Ġinfod emiology
+Ġbaf md
+Ġshel ters
+Ġverbas coside
+Ġning bo
+Ġiud s
+Ġdownt own
+115 888
+Ġcoadminist ered
+Ġhamm er
+Ġmack ay
+Ġsurm ised
+Ġsubser osal
+Ġsanit ization
+Ġproph et
+Ġcrust ing
+Ġpach ycarpa
+compar ison
+Ġsve gfr
+Ġgrave olens
+Ġdecon ditioning
+Ġintere xaminer
+Ġprototy ped
+Ġpharmacoec onomic
+Ġpharmacoec onomics
+Ġthylak oid
+Ġkob ayashi
+Ġextrad ural
+Ġpneumon ectomy
+Ġvulv ovaginal
+Ġblo om
+Ġmultit ask
+Ġritual s
+Ġrecr ystall
+Ġphotoc uring
+cz yn
+Ġnexp ia
+Ġbiann ual
 Ġcannabin oids
-Ġkimwip es
-Ġspinocerebell ar
-Ġthoracoab dominal
-Ġelectrocauter y
-Ġglycosylphosph otidylinositol
-Ġvelopharyngo plasties
-Ġdubliniens is
-Ġthioglyc ollate
-Ġthiogalact opyranoside
-Ġdiphenyl tetrazolium
-Ġgccgctcc gacacagg
-Ġgccatcat gttcttgttatc
-Ġgccatcacg ccacagtttc
-Ġalloimmun ization
-4201707485 4
-gacagtt caaat
-Ġciclospor in
-Ġantimyco tic
-Ġantimetabol ites
-Ġhedghe hog
-Ġlentulos piral
-Ġgobbledygo ok
-Ġgggccaact gacagttcaaat
-Ġgggtttg caatcccttaattg
-Ġgcaagtctag ataccgtctc
-Ġgtgtctgga agaatgggata
-Ġgtgtgggtacgga aggcac
-Ġcholinerg ic
-Ġcholangi ocarcinoma
-Ġtrinitrobenz enesulfonic
-Ġprabhak ar
-Ġnonhospital ized
-Ġdijkstr a
-Ġcefuroxim e
-Ġmesoameric an
-Ġneuroscienti fic
-Ġarraylwcan cer
-Ġhepatospl enic
-Ġtimeatriskforhaving atleastonec
-Ġnumberofnewcarioussur facestotalsurface
-Ġaattctccgaacgtgtc acgt
-Ġaacgtgtcagtgg tggacctg
-Ġcctttaga ac
-Ġanaphylatox ins
-Ġmotallebne jad
-Ġhasselkv ist
-Ġlauvauthan on
-Ġnagelker ke
-Ġggtggcttg cactaggtg
-Ġchlordemethyld iazepam
-Ġdeoxynucle otidyl
-Ġatactctatcgt cccatctc
-Ġatatctattggt attccaag
-Ġacaactttggt atcgtggaagg
-Ġarbeitsgeme inschaft
-Ġagtgggtgtcgctgttga agt
-Ġtaacattagaaac ctg
-Ġphenylmethylsulfonyl fluoride
-Ġccagggtatggacct gtctg
-Ġaminoethyldiphenyl borate
-Ġdichlorodihydroflu orescein
-Ġtgaaaagagcatctg tgaagatccggtc
-Ġtgcaaaagaaggcat gg
-Ġcgcctaccagctcatgc ataac
-Ġgtcaattctgcctccttcc acc
-Ġgccgctccgacacagg tataa
-Ġgccatcatgttcttgttatc g
-Ġgcaagtctagataccgtctc g
-Ġtimeatriskforhavingatleastonec arieslesion
+Ġpere ira
+Ġreocc urrence
+Ġgte x
+Ġcmm rd
+Ġfict ive
+Ġbored om
+Ġheur istics
+Ġarchae a
+090 1317
+Ġual can
+atten uation
+Ġgregar ine
+Ġstv ip
+Ġnonagen arians
+Ġbarore ceptor
+Ġschmid t
+Ġacut ens
+Ġferre ira
+Ġperchlor ic
+Ġbeir ut
+Ġdeuts che
+Ġsew age
+adiaz ine
+Ġifit m
+Ġresta urant
+Ġforelim b
+Ġcricothyro tomy
+Ġbrent uximab
+Ġdeconv olution
+Ġmultimark ers
+Ġaquap orin
+Ġtatto o
+Ġscul pt
+Ġprognost ically
+Ġlinz agolix
+Ġloren z
+peb ral
+diabet es
+Ġmyrt us
+Ġsplat ters
+Ġunwar ranted
+Ġdipyr idam
+Ġsilyb ins
+Ġepiphenomen on
+Ġanas arca
+Ġmiv od
+Ġhly a
+Ġsupere lastic
+Ġmagg ic
+Ġkend all
+Ġmacrod ilution
+Ġdesatur ase
+Ġmecon ium
+Ġalloster ic
+Ġinterneur ons
+Ġhybr ids
+Ġtranscon jug
+Ġtrav oprost
+Ġeffer ves
+Ġorganole ptic
+Ġplanimet rical
+Ġcroati an
+Ġinterfragment ary
+Ġantiprot ozoal
+556468 66
+Ġbione er
+Ġamni ocentesis
+Ġyester day
+Ġcolt osol
+Ġunderpriv ileged
+Ġdepres cribing
+Ġlipophil icity
+Ġcampes terol
+Ġcampin as
+Ġsemir igid
+Ġpicol ax
+Ġirreplace able
+Ġticarc illin
+Ġcourtes y
+Ġhypercortis olemia
+Ġaudiovis ual
+Ġamisul pride
+Ġasclepi us
+Ġsotal ol
+elte on
+Ġalcap a
+Ġpertechn etate
+Ġsuave olens
+Ġtreprost inil
+Ġobsole te
+Ġarisc at
+Ġzfh x
+Ġzidov udine
+Ġoxazol one
+Ġcytocent rif
+Ġmetabarc oding
+Ġslugg ish
+Ġchromopert ubation
+Ġnanote chnology
+Ġsemisol id
+Ġmilwau kee
+Ġvanuat u
+78194 12
+Ġcymbop ogon
+115888 50
+Ġdipyridam ole
+0 25
+0 48
+2 16
+2 206
+4 27
+4 277
+5 26
+6 29
+7 57
+8 75
+a ure
+a ug
+b alling
+d art
+d ex
+d ucing
+d ye
+d orf
+e enth
+f j
+f ied
+f oli
+h off
+h tt
+i ell
+i ences
+i ensis
+k ras
+k aya
+l en
+m ers
+o oh
+o urous
+p age
+p oor
+q t
+r int
+r ink
+r ances
+s up
+s urgical
+v ision
+x ing