---
license: cc-by-nc-sa-4.0
widget:
- text: ACCTGA<mask>TTCTGAGTC
tags:
- DNA
- biology
- genomics
- segmentation
---
# segment-nt-30kb

Segment-NT-30kb is a segmentation model leveraging the [Nucleotide Transformer](https://huggingface.co/InstaDeepAI/nucleotide-transformer-v2-500m-multi-species) (NT) DNA foundation model to predict the location of several types of genomics 
elements in a sequence at a single nucleotide resolution. It was trained on 14 different classes of human genomics elements in input sequences up to 30kb. These 
include gene (protein-coding genes, lncRNAs, 5’UTR, 3’UTR, exon, intron, splice acceptor and donor sites) and regulatory (polyA signal, tissue-invariant and 
tissue-specific promoters and enhancers, and CTCF-bound sites) elements.


**Developed by:** [InstaDeep](https://huggingface.co/InstaDeepAI)

### Model Sources

<!-- Provide the basic links for the model. -->

- **Repository:** [Nucleotide Transformer](https://github.com/instadeepai/nucleotide-transformer)
- **Paper:** [Segmenting the genome at single-nucleotide resolution with DNA foundation models]() TODO: Add link to preprint

### How to use

<!-- Need to adapt this section to our model. Need to figure out how to load the models from huggingface and do inference on them -->
Until its next release, the `transformers` library needs to be installed from source with the following command in order to use the models:
```bash
pip install --upgrade git+https://github.com/huggingface/transformers.git
```

A small snippet of code is given here in order to retrieve both logits and embeddings from a dummy DNA sequence.
```python
# Load model and tokenizer
from transformers import AutoTokenizer, AutoModel
import torch

tokenizer = AutoTokenizer.from_pretrained("InstaDeepAI/segment_nt_30kb", use_auth_token=hf_token, trust_remote_code=True)
model = AutoModel.from_pretrained("InstaDeepAI/segment_nt_30kb", use_auth_token=hf_token, trust_remote_code=True)


# Choose the length to which the input sequences are padded. By default, the 
# model max length is chosen, but feel free to decrease it as the time taken to 
# obtain the embeddings increases significantly with it.
max_length = tokenizer.model_max_length

# Create a dummy dna sequence and tokenize it
sequences = ["ATTCCGATTCCGATTCCG", "ATTTCTCTCTCTCTCTGAGATCGATCGATCGAT"]
tokens_ids = tokenizer.batch_encode_plus(sequences, return_tensors="pt", padding="max_length", max_length = max_length)["input_ids"]

# Compute the embeddings
attention_mask = torch_tokens != tokenizer.pad_token_id
outs = model(
    torch_tokens,
    attention_mask=attention_mask,
    output_hidden_states=True
)

logits = outs.logits.detach().numpy()
probabilities = torch.nn.functional.softmax(logits, dim=-1)
```


## Training data

The **segment-nt-30kb** model was trained on all human chromosomes except for chromosomes 20 and 21, kept as test set, and chromosome 22, used as a validation set.
During training, sequences are randomly sampled in the genome with associated annotations. However, we keep the sequences in the validation and test set fixed by 
using a sliding window of length 30,000 over the chromosomes 20 and 21. The validation set was used to monitor training and for early stopping.

## Training procedure

### Preprocessing

The DNA sequences are tokenized using the Nucleotide Transformer Tokenizer, which tokenizes sequences as 6-mers tokens as described in the [Tokenization](https://github.com/instadeepai/nucleotide-transformer#tokenization-abc) section of the associated repository. This tokenizer has a vocabulary size of 4105. The inputs of the model are then of the form:

```
<CLS> <ACGTGT> <ACGTGC> <ACGGAC> <GACTAG> <TCAGCA>
```

### Training

The model was trained on a DGXH100 node with 8 GPUs on a total of 23B tokens for 3 days. The model was trained on 3kb, 10kb, 20kb and finally 30kb sequences, at each time with an effective batch size of 256 sequences. 


### Architecture

The model is composed of the [nucleotide-transformer-v2-50m-multi-species](https://huggingface.co/InstaDeepAI/nucleotide-transformer-v2-500m-multi-species) encoder, from which we removed 
the language model head and replaced it by a 1-dimensional U-Net segmentation head [4] made of 2 downsampling convolutional blocks and 2 upsampling convolutional blocks. Each of these 
blocks is made of 2 convolutional layers with 1, 024 and 2, 048 kernels respectively. This additional segmentation head accounts for 53 million parameters, bringing the total number of parameters
to 562M.

### BibTeX entry and citation info

#TODO: Add bibtex citation here
```bibtex

```